Datasets:

tomekkorbak

/

pile-detoxify-test

like 0

[ "Don't you just love crunchy, salty snacks? ", "We sure do. ", "Potato or tortilla chips would be the perfect snack if it weren't for the fact they are low in vital micro-nutrients and high in fat.", "\n\nIf there is one thing we vegans are good at when it comes to food, it is finding great tasting alternatives to old standbys.", "\n\nSo, what is the chip alternative? ", "Kirsten's Raw Vegan Kale Chips.", "\n\nWe are really excited to tell you about Kirsten's new ebook, \"20 Amazing Raw Vegan Kale Chip Recipes!\"", "\n\nThese 20 AMAZING KALE CHIP RECIPES really are the best ever--We're serious. ", "Kirsten spent so much time creating, testing, more testing (aka eating and eating) various trial recipes until the whole family(the kiddos love them too!) ", "decided which recipes were the very very very best! ", "You, your family, your friends, your neighbors, co-workers, classmates--whomever, will absolutely and positively become a lover of these RAW VEGAN KALE CHIPS!", "\n\nThis e-Book is a great deal too! ", "You could maybe buy a bag of kale chips at your local health food store for the price of this e-book, but that's it--one little bag! ", "But for just $ 4.97(The regular price is $6.97 but we wanted to give you a discount for subscribing to our e-Zine.) ", "you have 20 of the BEST KALE CHIP RECIPES IN THE UNIVERSE, forever, in your home, ready for you to use ANYTIME YOU WANT." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006283323164097965, 0.0006160279735922813, 0.07906637340784073, 0.001298742019571364, 0.0007123954128473997, 0.007611637469381094, 0.000741486088372767, 0.0007177297957241535, 0.0012860475108027458, 0.0006647516274824739, 0.06939350068569183, 0.0009175149607472122, 0.0019748227205127478, 0.001143521978519857, 0.0007106070406734943 ]

[ "1. ", "Field of the Invention\nThe present invention relates to an indwelling catheter set for transfusion, which is applied in a case of dialysis treatment, fluid infusion, blood infusion and such, and more particularly, to an indwelling catheter set which effectively prevents blood leakage in every step of the transfusion, for example, inserting the indwelling catheter set to the body of the patient and connecting a blood infusion circuit to the syringe, and which assures safety after drawing out a needle from the body of the patient.", "\n2. ", "Discussion of the Related Art\nJapanese Patent Publication of examined application No. ", "H3-70502 discloses a related art of the indwelling catheter set. ", "The application discloses an indwelling catheter set provided with a hemostatic adapter detachably attached to a catheter. ", "The hemostatic adapter is provided with a plurality of packing seals disposed separately with each other, each of which has a cylinder-bottomed shape. ", "When the catheter is drawn out of a needle thereof, the plural packing seals prevent blood leakage." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0006234355387277901, 0.001185585861094296, 0.0006109689711593091, 0.0007098625064827502, 0.0007752258679829538, 0.0006266449927352369, 0.019057057797908783 ]

[ "The most dangerous time to be on Edmonton streets is on a Friday afternoon in December at around 5 p.m.\n\nThat's according to the city's 2016 Motor Vehicle Collisions Report, released on Thursday.", "\n\n(City of Edmonton) The detailed report contains some good news and lots of interesting numbers.", "\n\nCollisions on city streets hit at a 15-year low. ", "The numbers show there were 23,139 collisions last year, a decrease of about nine per cent from the 25,517 collisions the year before.", "\n\nInjury collisions were also down by 12.4 per cent from 3,033 in 2015 to 2,656 last year.", "\n\n\"This has been a long-term exercise over the last decade, so that trend is working very well,\" said Gerry Shimko, executive director of traffic safety. \"", "This was the first year since we've been keeping track where, on average, we did not have someone hospitalized every day of the year as a result of a motor-vehicle collision.\"", "\n\nThere were 22 traffic fatalities last year, down 10 from the year before.", "\n\n(City of Edmonton) Breaking down the 2016 numbers by month, the fewest collisions happened in April, while the most happened in December.", "\n\nFriday saw more collisions than any other day of the week. ", "Sunday saw the fewest.", "\n\nPeak week-day collision times matched morning and afternoon rush hours. ", "The most dangerous hour was between 5 p.m. and 6 p.m.\n\nShimko said those breakdowns could serve as a reminder for drivers, especially during the holiday season.", "\n\n\"This might be a good opportunity for them to use it as an educational opportunity and change when they're going out on Fridays in December.\"", "\n\nOther key findings from the annual report included:\n\nMore than half of all collisions happened at intersections (57.8 per cent);\n\nThe most common cause of collisions was following too closely (38.6 per cent);\n\nOther common causes include hitting a parked vehicle (13.0 per cent) and improper lane changes (10.8 per cent).", "\n\nA total of 297 pedestrians were injured in collisions last year, down from 317 the year before. ", "Ten pedestrians were killed in crashes, down from 12 in 2015.", "\n\nMotorcycle collisions were also down slightly, from 208 in 2015 to 191 last year.", "\n\nMale drivers were involved in almost two-thirds of at-fault collisions ( 62.2 per cent).", "\n\nThat final statistic came as no surprise to Shimko.", "\n\n\"That's just been the trend for all the years I've been here,\" he said. \"", "I think some of it is culture. ", "Males tend to be more risk-taking than females.\"", "\n\nAge was also a factor in collisions. ", "Statistics show drivers aged 15 to 24 were responsible for 21 per cent of all collisions.", "\n\nThere may be some intersections to try to avoid when you travel Edmonton streets.", "\n\nFor two years in a row, the top collision location has been the traffic circle at 107th Avenue and 142nd Street. ", "There were 134 collisions there last year, compared to 98 in 2015\n\n(City of Edmonton)" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006317719235084951, 0.0005267099477350712, 0.001064413576386869, 0.0005865325219929218, 0.000893420830834657, 0.0005953556974418461, 0.0005606129998341203, 0.0008607931667938828, 0.0005386226112022996, 0.0008002445101737976, 0.0036081501748412848, 0.0006377918180078268, 0.0008745922823436558, 0.000515157647896558, 0.0005694835563190281, 0.0006105617503635585, 0.0010138897923752666, 0.0005967615288682282, 0.0018760703969746828, 0.000753980886656791, 0.0006713360198773444, 0.0006873210659250617, 0.005993505474179983, 0.0007229975308291614, 0.0007878723554313183, 0.0006084347842261195, 0.0006336421356536448, 0.0005507250316441059 ]

[ "Q:\n\nAsking to write a sentence in a loop to count vowels, won't ask again even when the loop goes on\n\nTitle might be a bit confusing, I tried to be as specific as I could\nHi, total c++ beginner here, trying to make work a simple program that should tell me how many vowels a sentence contains. ", "Problem here is the loop is not asking me to write a sentence like it should when it continues after the first iteration.", "\nSo basically here's my code : \n#include <iostream>\nusing namespace std;\nint main(){\n int i, nb_vowels, cont=1;\n char sentence[100];\n\n while(cont!=0){\n cout << \"Enter a sentence : \";\n\n while ((sentence[i] = getchar()) !", "= '\\n') {\n i++;\n if(sentence[i]=='a' || sentence[i]=='e'|| sentence[i]=='i' || sentence[i]=='o' || sentence[i]=='u'){\n nb_vowels++;\n }\n }\n sentence[i] = '\\0';\n\n cout << \"Number of vowels : \" << nb_vowels <<endl;\n\n cout << \"1 to continue or 0 to stop : \";\n cin >> cont;\n } \n}\n\nHere's an example of how it goes when I execute it :\nEnter a sentence : hello i am learning c++\nNumber of vowels : 1 //that part is still not working btw, but i want to know how to fix the loop problem first\n1 to continue or 0 to stop : 1\nEnter a sentence : Number of vowels : 1 //i cant write anything here, it just pops like that\n1 to continue or 0 to stop :\n\nHere's how it should go : \nEnter a sentence : hello i am learning c++\nNumber of vowels : 6\n1 to continue or 0 to stop : 1\nEnter a sentence : wooo it works\nNumber of vowels : 1\n1 to continue or 0 to stop : 0\n\nI'm kind of lost right now as I know so little about C++ (only started a few days ago), any help would be greatly appreciated!", "\n\nA:\n\nFirst of all, i and nb_vowels are not initialized to anything, initialize properly like: int nb_vowels = 0, i = 0;\nSecondly, why don't you use cin.getline(sentence, 100); to input a sentence, why looping yourself to do this task?", "\nAnd if you use cin.getline, you'd have to add an cin.ignore(); after your input of cin >> cont;\nHere's the code you can use to perform this task:\nint cont = 1;\nint nb_vowels = 0;\nchar sentence[100];\nwhile (cont !", "= 0){\n cout << \"Enter a sentence: \";\n cin.getline(sentence, 100);\n int sentenceSize = strlen(sentence);\n for (int i = 0; i < sentenceSize; i++){\n if (sentence[i] == 'a' || sentence[i] == 'e'|| sentence[i] == 'i' || sentence[i] == 'o' || sentence[i] == 'u')\n nb_vowels++;\n }\n cout << \"No. ", "of Vowels: \" << nb_vowels << endl;\n cout << \"1 to continue or 0 to stop : \";\n cin >> cont;\n cin.ignore();\n}\n\nBetter yet, you should use std::string instead of char array. ", "Read about the string, it's pretty simple, if you'd have any problem regarding that, first search about that problem, and then come with some real problem.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007357614231295884, 0.0011011668248102069, 0.0014585652388632298, 0.0012270936276763678, 0.001094806706532836, 0.001522223697975278, 0.001342168776318431, 0.0010611588368192315, 0.0006809117621742189, 0.001995444530621171 ]

[ "// Copyright Nick Thompson, 2019\n// Use, modification and distribution are subject to the\n// Boost Software License, Version 1.0.", "\n// (See accompanying file LICENSE_1_0.txt\n// or copy at http://www.boost.org/LICENSE_1_0.txt)\n#ifndef BOOST_MATH_QUADRATURE_DETAIL_OOURA_FOURIER_INTEGRALS_DETAIL_HPP\n#define BOOST_MATH_QUADRATURE_DETAIL_OOURA_FOURIER_INTEGRALS_DETAIL_HPP\n#include <utility> // for std::pair.", "\n#include <mutex>\n#include <atomic>\n#include <vector>\n#include <iostream>\n#include <boost/math/special_functions/expm1.hpp>\n#include <boost/math/special_functions/sin_pi.hpp>\n#include <boost/math/special_functions/cos_pi.hpp>\n#include <boost/math/constants/constants.hpp>\n\nnamespace boost { namespace math { namespace quadrature { namespace detail {\n\n// Ooura and Mori, A robust double exponential formula for Fourier-type integrals,\n// eta is the argument to the exponential in equation 3.3:\ntemplate<class Real>\nstd::pair<Real, Real> ooura_eta(Real x, Real alpha) {\n using std::expm1;\n using std::exp;\n using std::abs;\n Real expx = exp(x);\n Real eta_prime = 2 + alpha/expx + expx/4;\n Real eta;\n // This is the fast branch:\n if (abs(x) > 0.125) {\n eta = 2*x - alpha*(1/expx - 1) + (expx - 1)/4;\n }\n else {// this is the slow branch using expm1 for small x:\n eta = 2*x - alpha*expm1(-x) + expm1(x)/4;\n }\n return {eta, eta_prime};\n}\n\n// Ooura and Mori, A robust double exponential formula for Fourier-type integrals,\n// equation 3.6:\ntemplate<class Real>\nReal calculate_ooura_alpha(Real h)\n{\n using boost::math::constants::pi;\n using std::log1p;\n using std::sqrt;\n Real x = sqrt(16 + 4*log1p(pi<Real>()/h)/h);\n return 1/x;\n}\n\ntemplate<class Real>\nstd::pair<Real, Real> ooura_sin_node_and_weight(long n, Real h, Real alpha)\n{\n using std::expm1;\n using std::exp;\n using std::abs;\n using boost::math::constants::pi;\n using std::isnan;\n\n if (n == 0) {\n // Equation 44 of https://arxiv.org/pdf/0911.4796.pdf\n // Fourier Transform of the Stretched Exponential Function: Analytic Error Bounds,\n // Double Exponential Transform, and Open-Source Implementation,\n // Joachim Wuttke, \n // The C library libkww provides functions to compute the Kohlrausch-Williams-Watts function, \n // the Laplace-Fourier transform of the stretched (or compressed) exponential function exp(-t^beta)\n // for exponent beta between 0.1 and 1.9 with sixteen decimal digits accuracy.", "\n\n Real eta_prime_0 = Real(2) + alpha + Real(1)/Real(4);\n Real node = pi<Real>()/(eta_prime_0*h);\n Real weight = pi<Real>()*boost::math::sin_pi(1/(eta_prime_0*h));\n Real eta_dbl_prime = -alpha + Real(1)/Real(4);\n Real phi_prime_0 = (1 - eta_dbl_prime/(eta_prime_0*eta_prime_0))/2;\n weight *= phi_prime_0;\n return {node, weight};\n }\n Real x = n*h;\n auto p = ooura_eta(x, alpha);\n auto eta = p.first;\n auto eta_prime = p.second;\n\n Real expm1_meta = expm1(-eta);\n Real exp_meta = exp(-eta);\n Real node = -n*pi<Real>()/expm1_meta;\n\n\n // I have verified that this is not a significant source of inaccuracy in the weight computation:\n Real phi_prime = -(expm1_meta + x*exp_meta*eta_prime)/(expm1_meta*expm1_meta);\n\n // The main source of inaccuracy is in computation of sin_pi.", "\n // But I've agonized over this, and I think it's as good as it can get:\n Real s = pi<Real>();\n Real arg;\n if(eta > 1) {\n arg = n/( 1/exp_meta - 1 );\n s *= boost::math::sin_pi(arg);\n if (n&1) {\n s *= -1;\n }\n }\n else if (eta < -1) {\n arg = n/(1-exp_meta);\n s *= boost::math::sin_pi(arg);\n }\n else {\n arg = -n*exp_meta/expm1_meta;\n s *= boost::math::sin_pi(arg);\n if (n&1) {\n s *= -1;\n }\n }\n\n Real weight = s*phi_prime;\n return {node, weight};\n}\n\n#ifdef BOOST_MATH_INSTRUMENT_OOURA\ntemplate<class Real>\nvoid print_ooura_estimate(size_t i, Real I0, Real I1, Real omega) {\n using std::abs;\n std::cout << std::defaultfloat\n << std::setprecision(std::numeric_limits<Real>::digits10)\n << std::fixed;\n std::cout << \"h = \" << Real(1)/Real(1<<i) << \", I_h = \" << I0/omega\n << \" = \" << std::hexfloat << I0/omega << \", absolute error estimate = \"\n << std::defaultfloat << std::scientific << abs(I0-I1) << std::endl;\n}\n#endif\n\n\ntemplate<class Real>\nstd::pair<Real, Real> ooura_cos_node_and_weight(long n, Real h, Real alpha)\n{\n using std::expm1;\n using std::exp;\n using std::abs;\n using boost::math::constants::pi;\n\n Real x = h*(n-Real(1)/Real(2));\n auto p = ooura_eta(x, alpha);\n auto eta = p.first;\n auto eta_prime = p.second;\n Real expm1_meta = expm1(-eta);\n Real exp_meta = exp(-eta);\n Real node = pi<Real>()*(Real(1)/Real(2)-n)/expm1_meta;\n\n Real phi_prime = -(expm1_meta + x*exp_meta*eta_prime)/(expm1_meta*expm1_meta);\n\n // Takuya Ooura and Masatake Mori,\n // Journal of Computational and Applied Mathematics, 112 (1999) 229-241.", "\n // A robust double exponential formula for Fourier-type integrals.", "\n // Equation 4.6\n Real s = pi<Real>();\n Real arg;\n if (eta < -1) {\n arg = -(n-Real(1)/Real(2))/expm1_meta;\n s *= boost::math::cos_pi(arg);\n }\n else {\n arg = -(n-Real(1)/Real(2))*exp_meta/expm1_meta;\n s *= boost::math::sin_pi(arg);\n if (n&1) {\n s *= -1;\n }\n }\n\n Real weight = s*phi_prime;\n return {node, weight};\n}\n\n\ntemplate<class Real>\nclass ooura_fourier_sin_detail {\npublic:\n ooura_fourier_sin_detail(const Real relative_error_goal, size_t levels) {\n#ifdef BOOST_MATH_INSTRUMENT_OOURA\n std::cout << \"ooura_fourier_sin with relative error goal \" << relative_error_goal \n << \" & \" << levels << \" levels.\" ", "<< std::endl;\n#endif // BOOST_MATH_INSTRUMENT_OOURA\n if (relative_error_goal < std::numeric_limits<Real>::epsilon() * 2) {\n throw std::domain_error(\"The relative error goal cannot be smaller than the unit roundoff.\");", "\n }\n using std::abs;\n requested_levels_ = levels;\n starting_level_ = 0;\n rel_err_goal_ = relative_error_goal;\n big_nodes_.reserve(levels);\n bweights_.reserve(levels);\n little_nodes_.reserve(levels);\n lweights_.reserve(levels);\n\n for (size_t i = 0; i < levels; ++i) {\n if (std::is_same<Real, float>::value) {\n add_level<double>(i);\n }\n else if (std::is_same<Real, double>::value) {\n add_level<long double>(i);\n }\n else {\n add_level<Real>(i);\n }\n }\n }\n\n std::vector<std::vector<Real>> const & big_nodes() const {\n return big_nodes_;\n }\n\n std::vector<std::vector<Real>> const & weights_for_big_nodes() const {\n return bweights_;\n }\n\n std::vector<std::vector<Real>> const & little_nodes() const {\n return little_nodes_;\n }\n\n std::vector<std::vector<Real>> const & weights_for_little_nodes() const {\n return lweights_;\n }\n\n template<class F>\n std::pair<Real,Real> integrate(F const & f, Real omega) {\n using std::abs;\n using std::max;\n using boost::math::constants::pi;\n\n if (omega == 0) {\n return {Real(0), Real(0)};\n }\n if (omega < 0) {\n auto p = this->integrate(f, -omega);\n return {-p.first, p.second};\n }\n\n Real I1 = std::numeric_limits<Real>::quiet_NaN();\n Real relative_error_estimate = std::numeric_limits<Real>::quiet_NaN();\n // As we compute integrals, we learn about their structure.", "\n // Assuming we compute f(t)sin(wt) for many different omega, this gives some\n // a posteriori ability to choose a refinement level that is roughly appropriate.", "\n size_t i = starting_level_;\n do {\n Real I0 = estimate_integral(f, omega, i);\n#ifdef BOOST_MATH_INSTRUMENT_OOURA\n print_ooura_estimate(i, I0, I1, omega);\n#endif\n Real absolute_error_estimate = abs(I0-I1);\n Real scale = (max)(abs(I0), abs(I1));\n if (!", "isnan(I1) && absolute_error_estimate <= rel_err_goal_*scale) {\n starting_level_ = (max)(long(i) - 1, long(0));\n return {I0/omega, absolute_error_estimate/scale};\n }\n I1 = I0;\n } while(++i < big_nodes_.size());\n\n // We've used up all our precomputed levels.", "\n // Now we need to add more.", "\n // It might seems reasonable to just keep adding levels indefinitely, if that's what the user wants.", "\n // But in fact the nodes and weights just merge into each other and the error gets worse after a certain number.", "\n // This value for max_additional_levels was chosen by observation of a slowly converging oscillatory integral:\n // f(x) := cos(7cos(x))sin(x)/x\n size_t max_additional_levels = 4;\n while (big_nodes_.size() < requested_levels_ + max_additional_levels) {\n size_t ii = big_nodes_.size();\n if (std::is_same<Real, float>::value) {\n add_level<double>(ii);\n }\n else if (std::is_same<Real, double>::value) {\n add_level<long double>(ii);\n }\n else {\n add_level<Real>(ii);\n }\n Real I0 = estimate_integral(f, omega, ii);\n Real absolute_error_estimate = abs(I0-I1);\n Real scale = (max)(abs(I0), abs(I1));\n#ifdef BOOST_MATH_INSTRUMENT_OOURA\n print_ooura_estimate(ii, I0, I1, omega);\n#endif\n if (absolute_error_estimate <= rel_err_goal_*scale) {\n starting_level_ = (max)(long(ii) - 1, long(0));\n return {I0/omega, absolute_error_estimate/scale};\n }\n I1 = I0;\n ++ii;\n }\n\n starting_level_ = static_cast<long>(big_nodes_.size() - 2);\n return {I1/omega, relative_error_estimate};\n }\n\nprivate:\n\n template<class PreciseReal>\n void add_level(size_t i) {\n using std::abs;\n size_t current_num_levels = big_nodes_.size();\n Real unit_roundoff = std::numeric_limits<Real>::epsilon()/2;\n // h0 = 1. ", "Then all further levels have h_i = 1/2^i.", "\n // Since the nodes don't nest, we could conceivably divide h by (say) 1.5, or 3.", "\n // It's not clear how much benefit (or loss) would be obtained from this.", "\n PreciseReal h = PreciseReal(1)/PreciseReal(1<<i);\n\n std::vector<Real> bnode_row;\n std::vector<Real> bweight_row;\n\n // This is a pretty good estimate for how many elements will be placed in the vector:\n bnode_row.reserve((static_cast<size_t>(1)<<i)*sizeof(Real));\n bweight_row.reserve((static_cast<size_t>(1)<<i)*sizeof(Real));\n\n std::vector<Real> lnode_row;\n std::vector<Real> lweight_row;\n\n lnode_row.reserve((static_cast<size_t>(1)<<i)*sizeof(Real));\n lweight_row.reserve((static_cast<size_t>(1)<<i)*sizeof(Real));\n\n Real max_weight = 1;\n auto alpha = calculate_ooura_alpha(h);\n long n = 0;\n Real w;\n do {\n auto precise_nw = ooura_sin_node_and_weight(n, h, alpha);\n Real node = static_cast<Real>(precise_nw.first);\n Real weight = static_cast<Real>(precise_nw.second);\n w = weight;\n if (bnode_row.size() == bnode_row.capacity()) {\n bnode_row.reserve(2*bnode_row.size());\n bweight_row.reserve(2*bnode_row.size());\n }\n\n bnode_row.push_back(node);\n bweight_row.push_back(weight);\n if (abs(weight) > max_weight) {\n max_weight = abs(weight);\n }\n ++n;\n // f(t)->0 as t->infty, which is why the weights are computed up to the unit roundoff.", "\n } while(abs(w) > unit_roundoff*max_weight);\n\n // This class tends to consume a lot of memory; shrink the vectors back down to size:\n bnode_row.shrink_to_fit();\n bweight_row.shrink_to_fit();\n // Why we are splitting the nodes into regimes where t_n >> 1 and t_n << 1?", "\n // It will create the opportunity to sensibly truncate the quadrature sum to significant terms.", "\n n = -1;\n do {\n auto precise_nw = ooura_sin_node_and_weight(n, h, alpha);\n Real node = static_cast<Real>(precise_nw.first);\n if (node <= 0) {\n break;\n }\n Real weight = static_cast<Real>(precise_nw.second);\n w = weight;\n using std::isnan;\n if (isnan(node)) {\n // This occurs at n = -11 in quad precision:\n break;\n }\n if (lnode_row.size() > 0) {\n if (lnode_row[lnode_row.size()-1] == node) {\n // The nodes have fused into each other:\n break;\n }\n }\n if (lnode_row.size() == lnode_row.capacity()) {\n lnode_row.reserve(2*lnode_row.size());\n lweight_row.reserve(2*lnode_row.size());\n }\n lnode_row.push_back(node);\n lweight_row.push_back(weight);\n if (abs(weight) > max_weight) {\n max_weight = abs(weight);\n }\n --n;\n // f(t)->infty is possible as t->0, hence compute up to the min.", "\n } while(abs(w) > (std::numeric_limits<Real>::min)()*max_weight);\n\n lnode_row.shrink_to_fit();\n lweight_row.shrink_to_fit();\n\n // std::scoped_lock once C++17 is more common?", "\n std::lock_guard<std::mutex> lock(node_weight_mutex_);\n // Another thread might have already finished this calculation and appended it to the nodes/weights:\n if (current_num_levels == big_nodes_.size()) {\n big_nodes_.push_back(bnode_row);\n bweights_.push_back(bweight_row);\n\n little_nodes_.push_back(lnode_row);\n lweights_.push_back(lweight_row);\n }\n }\n\n template<class F>\n Real estimate_integral(F const & f, Real omega, size_t i) {\n // Because so few function evaluations are required to get high accuracy on the integrals in the tests,\n // Kahan summation doesn't really help.", "\n //auto cond = boost::math::tools::summation_condition_number<Real, true>(0);\n Real I0 = 0;\n auto const & b_nodes = big_nodes_[i];\n auto const & b_weights = bweights_[i];\n // Will benchmark if this is helpful:\n Real inv_omega = 1/omega;\n for(size_t j = 0 ; j < b_nodes.size(); ++j) {\n I0 += f(b_nodes[j]*inv_omega)*b_weights[j];\n }\n\n auto const & l_nodes = little_nodes_[i];\n auto const & l_weights = lweights_[i];\n // If f decays rapidly as |t|->infty, not all of these calls are necessary.", "\n for (size_t j = 0; j < l_nodes.size(); ++j) {\n I0 += f(l_nodes[j]*inv_omega)*l_weights[j];\n }\n return I0;\n }\n\n std::mutex node_weight_mutex_;\n // Nodes for n >= 0, giving t_n = pi*phi(nh)/h. ", "Generally t_n >> 1.", "\n std::vector<std::vector<Real>> big_nodes_;\n // The term bweights_ will indicate that these are weights corresponding\n // to the big nodes:\n std::vector<std::vector<Real>> bweights_;\n\n // Nodes for n < 0: Generally t_n << 1, and an invariant is that t_n > 0.", "\n std::vector<std::vector<Real>> little_nodes_;\n std::vector<std::vector<Real>> lweights_;\n Real rel_err_goal_;\n std::atomic<long> starting_level_;\n size_t requested_levels_;\n};\n\ntemplate<class Real>\nclass ooura_fourier_cos_detail {\npublic:\n ooura_fourier_cos_detail(const Real relative_error_goal, size_t levels) {\n#ifdef BOOST_MATH_INSTRUMENT_OOURA\n std::cout << \"ooura_fourier_cos with relative error goal \" << relative_error_goal\n << \" & \" << levels << \" levels.\" ", "<< std::endl;\n std::cout << \"epsilon for type = \" << std::numeric_limits<Real>::epsilon() << std::endl;\n#endif // BOOST_MATH_INSTRUMENT_OOURA\n if (relative_error_goal < std::numeric_limits<Real>::epsilon() * 2) {\n throw std::domain_error(\"The relative error goal cannot be smaller than the unit roundoff!\");", "\n }\n\n using std::abs;\n requested_levels_ = levels;\n starting_level_ = 0;\n rel_err_goal_ = relative_error_goal;\n big_nodes_.reserve(levels);\n bweights_.reserve(levels);\n little_nodes_.reserve(levels);\n lweights_.reserve(levels);\n\n for (size_t i = 0; i < levels; ++i) {\n if (std::is_same<Real, float>::value) {\n add_level<double>(i);\n }\n else if (std::is_same<Real, double>::value) {\n add_level<long double>(i);\n }\n else {\n add_level<Real>(i);\n }\n }\n\n }\n\n template<class F>\n std::pair<Real,Real> integrate(F const & f, Real omega) {\n using std::abs;\n using std::max;\n using boost::math::constants::pi;\n\n if (omega == 0) {\n throw std::domain_error(\"At omega = 0, the integral is not oscillatory. ", "The user must choose an appropriate method for this case.\\n\");\n }\n\n if (omega < 0) {\n return this->integrate(f, -omega);\n }\n\n Real I1 = std::numeric_limits<Real>::quiet_NaN();\n Real absolute_error_estimate = std::numeric_limits<Real>::quiet_NaN();\n Real scale = std::numeric_limits<Real>::quiet_NaN();\n size_t i = starting_level_;\n do {\n Real I0 = estimate_integral(f, omega, i);\n#ifdef BOOST_MATH_INSTRUMENT_OOURA\n print_ooura_estimate(i, I0, I1, omega);\n#endif\n absolute_error_estimate = abs(I0-I1);\n scale = (max)(abs(I0), abs(I1));\n if (!", "isnan(I1) && absolute_error_estimate <= rel_err_goal_*scale) {\n starting_level_ = (max)(long(i) - 1, long(0));\n return {I0/omega, absolute_error_estimate/scale};\n }\n I1 = I0;\n } while(++i < big_nodes_.size());\n\n size_t max_additional_levels = 4;\n while (big_nodes_.size() < requested_levels_ + max_additional_levels) {\n size_t ii = big_nodes_.size();\n if (std::is_same<Real, float>::value) {\n add_level<double>(ii);\n }\n else if (std::is_same<Real, double>::value) {\n add_level<long double>(ii);\n }\n else {\n add_level<Real>(ii);\n }\n Real I0 = estimate_integral(f, omega, ii);\n#ifdef BOOST_MATH_INSTRUMENT_OOURA\n print_ooura_estimate(ii, I0, I1, omega);\n#endif\n absolute_error_estimate = abs(I0-I1);\n scale = (max)(abs(I0), abs(I1));\n if (absolute_error_estimate <= rel_err_goal_*scale) {\n starting_level_ = (max)(long(ii) - 1, long(0));\n return {I0/omega, absolute_error_estimate/scale};\n }\n I1 = I0;\n ++ii;\n }\n\n starting_level_ = static_cast<long>(big_nodes_.size() - 2);\n return {I1/omega, absolute_error_estimate/scale};\n }\n\nprivate:\n\n template<class PreciseReal>\n void add_level(size_t i) {\n using std::abs;\n size_t current_num_levels = big_nodes_.size();\n Real unit_roundoff = std::numeric_limits<Real>::epsilon()/2;\n PreciseReal h = PreciseReal(1)/PreciseReal(1<<i);\n\n std::vector<Real> bnode_row;\n std::vector<Real> bweight_row;\n bnode_row.reserve((static_cast<size_t>(1)<<i)*sizeof(Real));\n bweight_row.reserve((static_cast<size_t>(1)<<i)*sizeof(Real));\n\n std::vector<Real> lnode_row;\n std::vector<Real> lweight_row;\n\n lnode_row.reserve((static_cast<size_t>(1)<<i)*sizeof(Real));\n lweight_row.reserve((static_cast<size_t>(1)<<i)*sizeof(Real));\n\n Real max_weight = 1;\n auto alpha = calculate_ooura_alpha(h);\n long n = 0;\n Real w;\n do {\n auto precise_nw = ooura_cos_node_and_weight(n, h, alpha);\n Real node = static_cast<Real>(precise_nw.first);\n Real weight = static_cast<Real>(precise_nw.second);\n w = weight;\n if (bnode_row.size() == bnode_row.capacity()) {\n bnode_row.reserve(2*bnode_row.size());\n bweight_row.reserve(2*bnode_row.size());\n }\n\n bnode_row.push_back(node);\n bweight_row.push_back(weight);\n if (abs(weight) > max_weight) {\n max_weight = abs(weight);\n }\n ++n;\n // f(t)->0 as t->infty, which is why the weights are computed up to the unit roundoff.", "\n } while(abs(w) > unit_roundoff*max_weight);\n\n bnode_row.shrink_to_fit();\n bweight_row.shrink_to_fit();\n n = -1;\n do {\n auto precise_nw = ooura_cos_node_and_weight(n, h, alpha);\n Real node = static_cast<Real>(precise_nw.first);\n // The function cannot be singular at zero,\n // so zero is not a unreasonable node,\n // unlike in the case of the Fourier Sine.", "\n // Hence only break if the node is negative.", "\n if (node < 0) {\n break;\n }\n Real weight = static_cast<Real>(precise_nw.second);\n w = weight;\n if (lnode_row.size() > 0) {\n if (lnode_row.back() == node) {\n // The nodes have fused into each other:\n break;\n }\n }\n if (lnode_row.size() == lnode_row.capacity()) {\n lnode_row.reserve(2*lnode_row.size());\n lweight_row.reserve(2*lnode_row.size());\n }\n\n lnode_row.push_back(node);\n lweight_row.push_back(weight);\n if (abs(weight) > max_weight) {\n max_weight = abs(weight);\n }\n --n;\n } while(abs(w) > (std::numeric_limits<Real>::min)()*max_weight);\n\n lnode_row.shrink_to_fit();\n lweight_row.shrink_to_fit();\n\n std::lock_guard<std::mutex> lock(node_weight_mutex_);\n // Another thread might have already finished this calculation and appended it to the nodes/weights:\n if (current_num_levels == big_nodes_.size()) {\n big_nodes_.push_back(bnode_row);\n bweights_.push_back(bweight_row);\n\n little_nodes_.push_back(lnode_row);\n lweights_.push_back(lweight_row);\n }\n }\n\n template<class F>\n Real estimate_integral(F const & f, Real omega, size_t i) {\n Real I0 = 0;\n auto const & b_nodes = big_nodes_[i];\n auto const & b_weights = bweights_[i];\n Real inv_omega = 1/omega;\n for(size_t j = 0 ; j < b_nodes.size(); ++j) {\n I0 += f(b_nodes[j]*inv_omega)*b_weights[j];\n }\n\n auto const & l_nodes = little_nodes_[i];\n auto const & l_weights = lweights_[i];\n for (size_t j = 0; j < l_nodes.size(); ++j) {\n I0 += f(l_nodes[j]*inv_omega)*l_weights[j];\n }\n return I0;\n }\n\n std::mutex node_weight_mutex_;\n std::vector<std::vector<Real>> big_nodes_;\n std::vector<std::vector<Real>> bweights_;\n\n std::vector<std::vector<Real>> little_nodes_;\n std::vector<std::vector<Real>> lweights_;\n Real rel_err_goal_;\n std::atomic<long> starting_level_;\n size_t requested_levels_;\n};\n\n\n}}}}\n#endif\n" ]

{ "pile_set_name": "Github" }

[ 0.0006572601851075888, 0.000635913573205471, 0.001512354239821434, 0.0023343940265476704, 0.004220753442496061, 0.000609301496297121, 0.0013477574102580547, 0.000903885462321341, 0.001909282524138689, 0.002479110611602664, 0.0011615299154073, 0.0007968294085003436, 0.0006644621607847512, 0.0005849654553458095, 0.0007461775676347315, 0.0014269466046243906, 0.0008927771705202758, 0.000628291571047157, 0.0007119501824490726, 0.0016024201177060604, 0.0009434695821255445, 0.0006541577749885619, 0.0027273602318018675, 0.0011210499797016382, 0.0008308739634230733, 0.0008541254210285842, 0.002088142093271017, 0.0013874400174245238, 0.0008209499646909535, 0.0008729599067009985, 0.001046429155394435, 0.0019078091718256474, 0.0008562199654988945, 0.001590437488630414, 0.0020399128552526236, 0.0009134706342592835, 0.0042947870679199696 ]

[ "er: l or i?", "\ni\nSuppose 5*u + 766 - 818 = -t, 2*t + 4*u - 62 = 0. ", "Suppose 15 = -7*y + 2*y, 0 = -4*a - 4*y + 60. ", "Is a less than t?", "\nFalse\nSuppose 0 = 2*o - 129 - 93. ", "Let f = -93195 - -93307. ", "Is o not equal to f?", "\nTrue\nSuppose 3*r - 14 = -4*r. ", "Let h(z) = -53*z - 32. ", "Let q be h(r). ", "Which is greater: q or -137?", "\n-137\nLet f be 26/3 - (-1)/3. ", "Suppose -w + 14 = f. Suppose -u + 14 = -5*r + 3*u, 0 = -4*r - 3*u - w. Is -2 at most as big as r?", "\nTrue\nLet o = 568 + -542. ", "Suppose -a = 5*l - o, -36*l = -38*l - 5*a + 15. ", "Are 70/13 and l equal?", "\nFalse\nSuppose 2*u = -6, u - 8632 = 39*k - 34*k. ", "Is k greater than or equal to -1727?", "\nTrue\nLet v = 138 + 302. ", "Suppose v = 19*s + 1998. ", "Is s less than -82?", "\nFalse\nLet d = 3893 - 58397/15. ", "Which is smaller: d or -0.89?", "\n-0.89\nLet b(r) = 8*r**2 + 26*r + 23. ", "Let x(h) = -2*h**2 + 1. ", "Let l(a) = b(a) + 3*x(a). ", "Let s be l(-11). ", "Which is greater: s or -13?", "\n-13\nSuppose -2 + 14 = -4*h, h + 6 = g. Suppose 2*p = 2*t - p - 7, 8 = t - g*p. ", "Are t and -8 unequal?", "\nTrue\nLet l(a) = a + 1. ", "Let j(w) = -w - 1. ", "Let b(i) = -i - 16. ", "Let r(z) = b(z) - 3*j(z). ", "Let k(f) = -3*l(f) + r(f). ", "Let m be k(7). ", "Which is bigger: -24 or m?", "\nm\nLet v be -2*(-442)/(-4) - 0. ", "Let z be 861/(-41) - 226 - -26. ", "Is v greater than or equal to z?", "\nTrue\nSuppose 4*a + 13*h + 7230 = 8*h, 5418 = -3*a - 3*h. ", "Which is greater: -1802 or a?", "\na\nLet a = -19973 - -19960. ", "Which is bigger: -1/82 or a?", "\n-1/82\nLet o(v) = -8 + v - 29 - 3 + v. Let l be o(19). ", "Let r be -8 + l + 6 + 2. ", "Is 0 less than or equal to r?", "\nFalse\nLet k(y) = -7*y + 75. ", "Let j be k(6). ", "Let f = j - 75. ", "Let m be ((-6)/(-7))/((-3)/147). ", "Is m <= f?", "\nTrue\nLet x = -52897/25170 - -4/2517. ", "Are x and -3 unequal?", "\nTrue\nLet c = 61 - 61.91. ", "Let j = -2157 - -2155.69. ", "Let k = c - j. Which is smaller: -2/37 or k?", "\n-2/37\nLet d = -247 - -244. ", "Let x be (-104)/(-6) - (7 - (-20)/d). ", "Suppose -3*b + 2*u + 50 = -1, -2*b + 41 = u. Is b !", "= x?", "\nTrue\nLet f = 323 - 342.3. ", "Let o = -19.5 - f. Which is smaller: 1/32 or o?", "\no\nLet d(o) = 32*o**2 - 3*o**3 + 4*o + 14 + 28*o + 24 + 18 + 4*o**3. ", "Let y be d(-31). ", "Are y and 26 non-equal?", "\nTrue\nSuppose 123*n - 4*n + 8798 = 1182. ", "Does 27 = n?", "\nFalse\nLet r = 6.307 - 6.227. ", "Let u = 5 - 4.96. ", "Which is smaller: r or u?", "\nu\nLet k = 42.6 + -39. ", "Let w = 0.47366 + -0.17366. ", "Which is smaller: w or k?", "\nw\nLet g = 7119705/26 - 274363. ", "Let n = 528 + g. Which is smaller: -2/5 or n?", "\n-2/5\nLet c = 238.5 - 240. ", "Let j = -5.8 - c. Which is greater: j or 1/5?", "\n1/5\nLet h = -110826/10681 + 12/971. ", "Let i = -241 + 594. ", "Suppose 0 = 6*m - 299 + i. Which is bigger: h or m?", "\nm\nLet c = 7 - 4. ", "Suppose c*u = -5*f + 1, f + 3*u = 2*f + 7. ", "Let g be (-10)/(-705) + 0/2. ", "Do f and g have the same value?", "\nFalse\nLet n = -67.14 + 0.14. ", "Let b = n - -153. ", "Let p = 88.3 - b. Which is smaller: -1 or p?", "\n-1\nLet h = 0.1049 - 5.0949. ", "Let m = h + -0.01. ", "Which is greater: 36 or m?", "\n36\nLet j be (-14572)/(-108)*24 - 14 - (-2)/(-9). ", "Do 3226 and j have different values?", "\nTrue\nLet x(o) be the second derivative of o**4/6 + 2*o**3 + 11*o**2/2 + 3*o - 13. ", "Let s be x(-5). ", "Which is bigger: -6/65 or s?", "\ns\nSuppose 19*c = -160 + 141. ", "Is 1/1351 >= c?", "\nTrue\nLet o be (-6)/(-33) + ((-128070)/25740)/(2/4). ", "Does o = -9?", "\nFalse\nLet r = 1.146 + -0.146. ", "Let z = 782 + -778.87. ", "Let j = -3 + z. Which is smaller: j or r?", "\nj\nLet x be (-20*15/(-150))/(6 - 0). ", "Does 4046 = x?", "\nFalse\nLet t = -4308 - -3010. ", "Is t less than -1298?", "\nFalse\nLet o = 1.28 - -10.72. ", "Let l = 12.1 - o. Which is greater: 0 or l?", "\nl\nSuppose 7*y + 7*y = -13*y + 7*y. ", "Which is smaller: y or 20/259?", "\ny\nLet b(m) = -27*m - 6. ", "Let k(j) = 1. ", "Let q(g) = -b(g) - k(g). ", "Let w be q(-1). ", "Let y be (11/w)/((-5)/(-2) - 2). ", "Does -1 = y?", "\nTrue\nSuppose -135 = 4*c + 3*v, 12 - 42 = c + 2*v. ", "Let d = c + 35. ", "Let g be 24/(-84)*(-7)/(-75). ", "Is d < g?", "\nTrue\nLet l = 3753 - 3751. ", "Is 214 < l?", "\nFalse\nLet w be 4015/126 - (-4)/(-8). ", "Let q = -272/9 + w. Let d = 261 - 260. ", "Does q = d?", "\nFalse\nLet r be 318/3339*(-2)/(-4). ", "Is -0.043 equal to r?", "\nFalse\nSuppose 41 - 36 = 5*o. ", "Let w be (-72)/(-10) - o - (-1)/(-5). ", "Let h be (2/w)/(((-5)/12)/(-5)). ", "Is h greater than 16/5?", "\nTrue\nLet w = 27.102 + -27. ", "Let t = w - -57.898. ", "Let b = -58.1 + t. Which is bigger: -6 or b?", "\nb\nSuppose 17*h = 19*h - 5*l + 56, 4*h - 5*l + 112 = 0. ", "Which is smaller: -32 or h?", "\n-32\nLet u = -370 - -369.5. ", "Let g be ((-64)/(-12) - (-5)/(-1))/1. ", "Is g less than u?", "\nFalse\nLet r = -12.4 + 11.4. ", "Let f = 1 + r. Is f smaller than -0.12?", "\nFalse\nLet l be 2 - (-95)/(4 - -1). ", "Let d be (l/12 + -1)/(45/300). ", "Which is bigger: d or 24/5?", "\nd\nLet h = 11967/7 - 25980371/15197. ", "Which is greater: h or 0?", "\n0\nLet n = -3.8 + 3.7. ", "Let r = -3.8 + 3.6. ", "Let p = r - n. Is -3 at most as big as p?", "\nTrue\nLet j be (4/4)/((-245)/90 + (-28)/(-126)). ", "Which is bigger: j or 5273?", "\n5273\nLet q = 0.978 + -0.9. ", "Let w = q + -0.238. ", "Let b = 1 + 0. ", "Which is smaller: b or w?", "\nw\nLet h = 203 - 112. ", "Let g = h - 95. ", "Let j = -500576/131109 - 2/11919. ", "Is g at least as big as j?", "\nFalse\nLet w = 18.3053 - 1.3053. ", "Is w greater than or equal to 310?", "\nFalse\nSuppose 28*m - 3910 = -718. ", "Does m = 225/2?", "\nFalse\nLet a be 12*(-5)/(-10) + 469/(-35) + 13. ", "Which is greater: -7 or a?", "\na\nLet o be 1634/12 + 1/(-6). ", "Suppose 40*k + 61*k - 10124 - 3612 = 0. ", "Is k greater than or equal to o?", "\nTrue\nLet n be ((-2448)/(-1514700))/(-2*3). ", "Is 1 > n?", "\nTrue\nLet z = -0.5167 + -1.2833. ", "Is z !", "= -36?", "\nTrue\nSuppose 43*y + 154 = 54*y. ", "Let d(h) = -h**2 + 13*h - 32. ", "Let m be d(y). ", "Which is smaller: m or -47?", "\n-47\nLet w = 984.9 - 984.018. ", "Is -0.1 < w?", "\nTrue\nSuppose -3*k - 25*z = -20*z + 23, 0 = -4*k + z. Let y = -8 + 46. ", "Which is greater: k or y?", "\ny\nLet c = 3 - 0. ", "Let l = -234 + 24. ", "Let g = l - -210.11. ", "Is g >= c?", "\nFalse\nLet x = 5314/5 - 36337137/34190. ", "Which is bigger: x or 1?", "\n1\nLet r be (-4)/(-5) + 2/10. ", "Let j(k) = k**3 + 9*k**2 + 8*k + 2. ", "Let q be j(-8). ", "Let g be 33/21 + (1 - q). ", "Is r less than g?", "\nFalse\nLet y(c) be the first derivative of -c**2/2 + 6*c - 38. ", "Let r be y(-8). ", "Suppose -7*t + r*t + 140 = 0. ", "Which is greater: t or -19?", "\n-19\nSuppose 4*p = 1 + 51. ", "Let t = p - 9. ", "Let l be (-33)/(-5) - (-12)/t. ", "Which is bigger: l or 10?", "\n10\nSuppose -5*f = 3*a + 20, 4*f - 1895 = -4*a - 1911. ", "Is a !", "= 38/35?", "\nTrue\nLet k = 98 - 70. ", "Suppose 10 = -4*u + 134. ", "Are k and u non-equal?", "\nTrue\nLet u = -252243 + 3031979/12. ", "Let i = u + -835/2. ", "Let j = 14/3 - i. Which is greater: -66 or j?", "\nj\nLet y = 131 + -3. ", "Let o = y - 134. ", "Is o <= 3?", "\nTrue\nSuppose -20*k + 59*k + 39 - 78 = 0. ", "Is k greater than or equal to 2/4993?", "\nTrue\nSuppose 36*m - 16 + 7 = 27. ", "Is -5/796 bigger than m?", "\nFalse\nLet q(w) = -23*w**2 - 24*w - 1. ", "Let b be q(1). ", "Is 17 <= b?", "\nFalse\nSuppose -10332 = -0*g - 21*g. ", "Suppose 490 = 2*b + g. Which is bigger: b or -5/44?", "\n-5/44\nSuppose 2*r = 4*c - 0*r + 92, c = 2*r - 17. ", "Let i = -28 - c. Let g(t) = -t - 4. ", "Let o be g(i). ", "Is o bigger than -1/97?", "\nFalse\nLet s be (1/(-12))/(12/18) - (-1836)/9056. ", "Which is bigger: s or 0?", "\ns\nSuppose 82*f - 86*f = 1300. ", "Let p be -1*(8 - f/(-30)). ", "Which is smaller: 2 or p?", "\n2\nLet k = 16.9 - 7.6. ", "Let f = 55.3 - k. Let v = -46.2 + f. Is 1.5 >= v?", "\nTrue\nLet a = 181 - 95. ", "Let f = a + -64. ", "Let r = f + -22.2. ", "Which is greater: -28/3 or r?", "\nr\nLet s be 4/(-4) + 0/(-1). ", "Suppose 2*m + 3*n - 609 = -586, 4*m - 3*n - 1 = 0. ", "Is s at least m?", "\nFalse\nLet r be (-2)/8 + 4648/32. ", "Let c = r - 241. ", "Which is smaller: -97 or c?", "\n-97\nLet z = 38559/7 + -4111. ", "Is z <= 1397?", "\nFalse\nLet g(z) = -61*z + 1418. ", "Let k be g(23). ", "Is k greater than -4/11?", "\nTrue\nSuppose -1343*n + 77 = -1266*n. ", "Which is smaller: n or 6/809?", "\n6/809\nLet r = -32794 + 61751100/1883. ", "Let n = r + -3428/318227. ", "Let y(c) = 60361*c - 120723. ", "Let h be y(2). ", "Is h !", "= n?", "\nTrue\nLet d be 4 - (1 + (-2)/1). ", "Suppose -d*o + 2*o + 345 = 0. ", "Let m = o - 114. ", "Which is bigger: -62 or m?", "\nm\nLet f be (-47)/(-57) + (-4)/6. ", "Let q(r) = -25*r - 126. ", "Let k be q(-5). ", "Which is smaller: f or k?", "\nk\nLet l be (-5)/(-20) + (-5265)/(-1836). ", "Does 3 = l?", "\nFalse\nLet d(m) = -2*m**2 + 27*m - 84. ", "Let p be d(14). ", "Let y be (-3)/7 - ((-840)/p + -11). ", "Which is bigger: y or -12?", "\ny\nLet z = -466.8 - -264.7. ", "Let v = z + 202. ", "Is v at most -152?", "\nFalse\nSuppose -4*c + 2*q = -7 - 97, -3*q - 31 = -c. ", "Let t be (-1)/(-3)*(6 - 0)*-1. ", "Let l be t/(-1) + (-4)/3. ", "Is l <= c?", "\nTrue\nLet x(m) = -m**3 - 6*m**2 - 6*m - 8. ", "Let f be x(-5). ", "Let r be (f/(-711))/(18/108). ", "Which is smaller: r or 0.5?", "\nr\nLet g be 1/(18007/(-9778)) - (-48)/88. ", "Are g and -2/5 non-equal?", "\nTrue\nLet m be (8 " ]

{ "pile_set_name": "DM Mathematics" }

[ 0.001011757762171328, 0.0033367802388966084, 0.009347730316221714, 0.020115328952670097, 0.0026834476739168167, 0.0015077658463269472, 0.007914461195468903, 0.0022620256058871746, 0.0034531180281192064, 0.001989243784919381, 0.0007990237791091204, 0.0014678024454042315, 0.12756261229515076, 0.0012954575940966606, 0.013424383476376534, 0.0009985617361962795, 0.8580613136291504, 0.0016520582139492035, 0.0009581238264217973, 0.0010967185953631997, 0.0010796886635944247, 0.0013207555748522282, 0.0007552098832093179, 0.057690586894750595, 0.00659156683832407, 0.0047684828750789165, 0.0008458710508421063, 0.0008451753528788686, 0.09408234804868698, 0.0009641819051466882, 0.0013657762901857495, 0.0019540025386959314, 0.0038399402983486652, 0.012783290818333626, 0.9123184680938721, 0.0021918099373579025, 0.000826357223559171, 0.0037066012155264616, 0.001035852823406458, 0.0024714109022170305, 0.009272624738514423, 0.0007248519686982036, 0.004674125462770462, 0.0008205546764656901, 0.014737916179001331, 0.0024699124041944742, 0.0021004073787480593, 0.02563551627099514, 0.0014457611832767725, 0.0017132643843069673, 0.0011454867199063301, 0.004933933727443218, 0.0009968692902475595, 0.0008600614382885396, 0.0009992378763854504, 0.0014243163168430328, 0.0014945833245292306, 0.001361600123345852, 0.000981953227892518, 0.2649436295032501, 0.001074926694855094, 0.0011072782799601555, 0.002426550257951021, 0.31720981001853943, 0.0010371286189183593, 0.0012872067745774984, 0.0014220522716641426, 0.0019350133370608091, 0.0013742160517722368, 0.0012115458957850933, 0.0008800601935945451, 0.15942779183387756, 0.0025185965932905674, 0.0007762016030028462, 0.0014454266056418419, 0.002203443320468068, 0.0017179169226437807, 0.0020394923631101847, 0.0011884327977895737, 0.0011465210700407624, 0.0010021897032856941, 0.0018478084821254015, 0.5431143045425415, 0.0016956795006990433, 0.0008754314039833844, 0.005500500090420246, 0.004386630840599537, 0.000991786946542561, 0.0010038740001618862, 0.0036456631496548653, 0.0007945339311845601, 0.0013776748673990369, 0.0007378102163784206, 0.018450330942869186, 0.0009729183511808515, 0.0008156520198099315, 0.0013715899549424648, 0.0009102299227379262, 0.0013641052646562457, 0.0017373055452480912, 0.0048118275590240955, 0.0013981523225083947, 0.0023082802072167397, 0.0018455864628776908, 0.001030151848681271, 0.002200955990701914, 0.0010040097404271364, 0.0028093981090933084, 0.0031698462553322315, 0.004412079695612192, 0.000737466849386692, 0.03296394646167755, 0.002693856367841363, 0.023115554824471474, 0.0012550264364108443, 0.0014456785283982754, 0.0011732247658073902, 0.0018260369542986155, 0.0015474874526262283, 0.001186039880849421, 0.005731197074055672, 0.0009298042859882116, 0.0009647984988987446, 0.001068387646228075, 0.001103055546991527, 0.0016266674501821399, 0.0009924003388732672, 0.0024297081399708986, 0.0063736215233802795, 0.004400522448122501, 0.001297050854191184, 0.0013037682510912418, 0.0012248194543644786, 0.0012535654241219163, 0.003792461007833481, 0.0074634794145822525, 0.0007381614996120334, 0.0013981275260448456, 0.0013198470696806908, 0.05398806184530258, 0.003490209113806486, 0.004286447074264288, 0.0011637044372037053, 0.0009156900923699141, 0.0008561330614611506, 0.0010112108429893851, 0.0012107902439311147, 0.00957589689642191, 0.0020467531867325306, 0.035794030874967575, 0.0010324395261704922, 0.00083512207493186, 0.0019984315149486065, 0.0021515695843845606, 0.002643393352627754, 0.0007336707785725594, 0.0013134917244315147, 0.002267938107252121, 0.0009805659065023065, 0.02745554782450199, 0.0019544181413948536, 0.0011170139769092202, 0.0014517715899273753, 0.0008735391311347485, 0.0035655363462865353, 0.0007986344280652702, 0.001107888761907816, 0.7223808169364929, 0.005933116655796766, 0.0015199286863207817, 0.0013508640695363283, 0.002174742752686143, 0.004276758059859276, 0.0009681912488304079, 0.0011846923734992743, 0.00598572101444006, 0.01002805121243, 0.0007399610476568341, 0.0013328983914107084, 0.0013646711595356464, 0.4148196280002594, 0.0011707430239766836, 0.003268769709393382, 0.0018892688676714897, 0.0019827226642519236, 0.001218379009515047, 0.0013591003371402621, 0.000906051485799253, 0.001638250076211989, 0.9699694514274597, 0.0010418870951980352, 0.0011638142168521881, 0.0037034822162240744, 0.006921206600964069, 0.0017982320860028267, 0.01766529493033886, 0.0008763265213929117, 0.0012325774878263474, 0.0018758961232379079, 0.0012985379435122013, 0.0009189003030769527, 0.04613369330763817, 0.011976943351328373, 0.000893910531885922, 0.0010336821433156729, 0.0013726444449275732, 0.00954626128077507, 0.0010953841265290976, 0.001404482638463378, 0.0014167384942993522, 0.0019712087232619524, 0.0052390871569514275, 0.0014271186664700508, 0.29483965039253235, 0.0019537180196493864, 0.0010735768591985106, 0.0022917042952030897, 0.005045217461884022, 0.0012610434787347913, 0.0011488774325698614, 0.005978091154247522, 0.0015251123113557696, 0.00972319021821022, 0.03359105437994003, 0.14039292931556702, 0.002885424066334963, 0.0009976117871701717, 0.0012057223357260227, 0.07562278211116791, 0.0021250571589916945, 0.0007007509120739996, 0.002075135475024581, 0.03478429093956947, 0.0010607021395117044, 0.004785973113030195, 0.0040513258427381516, 0.0008192569366656244, 0.0017919529927894473, 0.03132706135511398, 0.0011367459082975984, 0.001366861630231142, 0.0018779472447931767, 0.000701428740285337, 0.0010307413758710027, 0.0010729111963883042, 0.0037580374628305435, 0.0022548865526914597, 0.0012148936511948705, 0.00222594290971756, 0.0007485463283956051, 0.0010034292936325073, 0.0012768467422574759, 0.0016262037679553032, 0.0020830887369811535, 0.0029737246222794056, 0.0019011482363566756, 0.000979577424004674, 0.0035541567485779524, 0.00571746239438653, 0.0008108883048407733, 0.008685681968927383, 0.0022138203494250774, 0.0017362597864121199, 0.0011497527593746781, 0.0047070300206542015, 0.0011641096789389849, 0.007989509962499142, 0.001392894540913403, 0.0010815189452841878, 0.0008804321987554431, 0.0026730657555162907, 0.001605266472324729, 0.0008283415227197111, 0.002443190198391676, 0.002858487656340003, 0.0024743503890931606, 0.0012127305381000042, 0.00539063336327672, 0.0018433312652632594, 0.0009333871421404183, 0.0007874824805185199, 0.0021953845862299204, 0.0012146674562245607, 0.0017071610782295465 ]

[ "Piggly Wiggly shoppers in South Carolina now can pick up a state parks passport — at a 20% discount — with their groceries.", "\n\nPiggly Wiggly and the South Carolina Department of Parks, Recreation and Tourism formed a partnership to give customers another reason to shop at Piggly Wiggly while also getting more people to consider buying an annual park passport.", "\n\n“Piggly Wiggly has been ‘Local Since Forever,’ and the beautiful natural resources showcased and preserved in South Carolina’s State Parks have truly been around forever,” said David Schools, president and CEO of Piggly Wiggly Carolina Co. “The Pig family saw this partnership as a great opportunity to give our customers a significant admission discount to South Carolina State Parks.”", "\n\nThe discount, available in Piggly Wiggly stores in the Lowcountry and Midlands through Dec. 31, is 20%. ", "That means the top level passport will drop from $99 to less than $80. ", "That Park Passport Plus is good for all 47 state parks, and it covers admission for everyone in your family or in your vehicle. ", "It also includes a copy of “Beautiful Places,” a coffee table book on the parks, and other perks.", "\n\nCustomers will get a voucher at the store that can be redeemed for a passport at any state park at any time in 2013. ", "People who already have park passports can hold onto the vouchers and redeem them when their current passports expire.", "\n\nTwo other levels of passport are available at the discounted rate: The Statewide Passport, which covers all 47 parks, will be $60, and the Inland Park Passport, which includes only the 42 inland parks, is $40. ", "Those are normally $75 and $50.", "\n\nLeave a Reply\n\nJoin Our FREE RVBasics Email Discussion Group\n\nGet current information about the RVing lifestyle, and the RV industry from your fellow RVers. ", "You can also post your own questions. ", "We never share your email address with anyone. ", "Get more info about the RVbasics Discussion Group.", "\nEnter your email address below." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0017423805547878146, 0.0009936477290466428, 0.0014489118475466967, 0.0010977095225825906, 0.0010152884060516953, 0.0006003824528306723, 0.002584753790870309, 0.000578083738218993, 0.0006363824941217899, 0.0005940828705206513, 0.000806839088909328, 0.0009434596868231893, 0.0009625990642234683, 0.0008880981476977468, 0.0008161200676113367, 0.0006444184691645205 ]

[ "Autonomic healing of acrylic bone cement.", "\nSelf-healing in orthopedic bone cement is demonstrated with a novel thermoplastic solvent-bonding approach. ", "Low toxicity solvent-filled microcapsules, embedded in a commercial acrylic bone cement matrix, enable recovery of up to 80% of the virgin fracture toughness of the cement at room and body temperature conditions without external stimuli or human intervention." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008074378129094839, 0.0006826323224231601, 0.0006085032364353538 ]

[ "Total non sequitur, naive white liberal guilt variety: I’m watching Eyes on the Prize, and it just kills me to watch a bunch of smug white people – which, in general, is a group to which I belong – cheerfully defending their resistance to civil rights as if such resistance is absolutely natural and right. ", "The scary thing is that to them, it was. ", "They’re so cheery about it because they’re so secure in this belief that they can’t even take the contrary seriously. ", "It always scares me to think, if I had grown up in the south during the period of Jim Crow – would I have supported segregation? ", "I mean, if I’d been taught from childhood that it was “right” and “natural” that people of different races should live separately, how much would it have taken to convince me otherwise? ", "Because there were plenty of evil, evil people who supported segregation. ", "But I’m sure there were plenty of ordinary, reasonably good people who did, too, just because it was the way it had always been, and they probably thought that if that was the case, there must have been a reason for it.", "\n\nAnd you know, none of this happened very long ago.", "\n\nWhen I watch those interviews I almost want to reach into the television and shake those people into my world or what I assume is some semblance of rationality and understanding. ", "The challenge, of course, is to appreciate that white Southerners (“ordinary, reasonably good people”) were working through new and difficult experiences based on their own racial assumptions and a Jim Crow legal system that was taken for granted. ", "In short, what they considered reasonable or rational. ", "New Kid highlights what for me is the moral backdrop of my own interest in reading and researching the past, and that is the role of luck. ", "We need to be reminded that much of what goes into our “selves” or personalities involves a set of conditions that we have no control over, including when, where, and to whom we are born. ", "History provides an arena for thinking about moral case studies that are not so removed from what we consider possible behavior once the role of luck is acknowledged. [", "Psychology also provides examples, most notably Milgram’s famous experiments on obedience to authority.] ", "Would I have supported segregation if a few conditions had been changed? ", "The answer is more than likely YES. ", "And that is why it must be understood. ", "Thinking about history in this way brings me closer to people that for moral reasons I am tempted to push away psychologically. ", "To run the risk of sounding philosophically vague, and borrowing a phrase from one of my undergraduate professors, the realization is that I AM THAT PERSON." ]

{ "pile_set_name": "Pile-CC" }

[ 0.06253752112388611, 0.000843115383759141, 0.0012233753222972155, 0.0017105522565543652, 0.000683201418723911, 0.12261413782835007, 0.0005657109431922436, 0.0008538832771591842, 0.0006368093891069293, 0.0034907099325209856, 0.0006110935937613249, 0.000644257350359112, 0.000685429316945374, 0.0005945759476162493, 0.0006051922682672739, 0.0008084324654191732, 0.0007110893493518233, 0.0006057138671167195, 0.000687006046064198, 0.0006881905137561262 ]

[ "Top Google Chrome Browser Extensions for Web Developers\n\nThis blog receives a commission from affiliate partners through the affiliate links that we share with you in our posts. ", "Although we receive a commission for using and linking their products, all our opinions and suggestions are unbiased.", "\n\nGoogle Chrome offers access to a large repository of extensions and tools to make our lives easier on a daily basis. ", "Let’s see what extensions Chrome offers that make the lives of web developers easier:\n\nThe web developer extension for Google Chrome adds a little toolbar with different tools available. ", "It has a lot of handy tools developers can use in their day to day work. ", "This extension is also available for Firefox browsers.", "\n\nDevelopers working with RESTful APIs, reading raw JSON data on a browser can be quite tricky. ", "It’s much easier to read JSON in a tree-view format, rather than in its raw state. ", "The Chrome extension JSONview helps you view JSON documents in the browser.", "\n\nCollorZilla is a simple color picker tool that helps web developers and graphic designers with color related tasks both basic and advanced. ", "It includes Color Picker, Eye Dropper, Gradient Generator, and much more additional advanced color tools.", "\n\nCSSViewer is a simple CSS property viewer. ", "It offers a floating panel that reports on the identity of the section that the mouse hovers over, along with its font, text, color, background, box, positioning and effects attributes.", "\n\nChad Crouch\n\nChad is an experienced Systems Administrator with exposure to various technologies and enterprise ICT environments. ", "He has a huge passion for Technologies, specifically Linux, Open Source Software, Cloud Computing, DevOps, Software & Web Development, electronics, and IoT technologies.", "\nIf you enjoy our articles please support us and make a small contribution: Buy Us A Coffee" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005403805407695472, 0.0005078906542621553, 0.0005774113815277815, 0.0005925314617343247, 0.0005646150093525648, 0.0008816347108222544, 0.0006636356702074409, 0.0006214994355104864, 0.0005874883499927819, 0.0007922110962681472, 0.0007046883110888302, 0.0008653306285850704, 0.0005957269459031522, 0.0006076359422877431, 0.0006839731358923018, 0.0006736901123076677 ]

[ "Analysis: It’s a toss-up at the top but we’ll go with Michigan State, which churned ahead by bagging Purdue as others stumbled and, in our view, remains the most talented team in the land . . . ", "The big winner is Ohio State, which vaults seven spots by beating Purdue . . . ", "nobody plummeted big, but dropping five spots were Purdue, Kansas and Oklahoma." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0010502312798053026, 0.0008690099930390716, 0.0008043920970521867 ]

[ "FZS Marching Band Website is LIVE\n\nThe FZS Marching Band Website is LIVE. ", "It’s the reason I haven’t posted in a while. ", "I have been working on a couple of other sites for some people. ", "One of them being my son’s marching band website: fzsband.com. ", "It has been a long time coming. ", "We have a great bunch of parents (past and present) that have supported the marching band. ", "Our previous marching band website was setup by a previous band parent as a wiki. ", "In hopes to drive more parents to use the site we looked into creating a new website.", "\n\nAfter a few discussions and gavel throwings (just kidding) it was decided I would put together a new site. ", "I decided to use WordPress mainly because it fit the bill. ", "It is fairly easy to set up. ", "It is fairly easy to maintain. ", "And most importantly, if there is anything you don’t know how to do in WordPress there are thousands of resources available.", "\n\nFor the most part, I think the new site looks decent. ", "I’m not the most creative person in the world so I left that in the hands of the creators of the Weaver II theme. ", "Great theme and very customizable and it displays well on a mobile device. ", "I did take the time to create a plugin specifically for the band. ", "It is an addon to my roster plugin (BCD Roster). ", "It adds some specific band information to the roster member post. ", "I was intending it to be a way for the band’s Buzz Book to be available online, but I have been having trouble getting the printing to work right. ", "Cross browser compatibility is killing me. ", "On one browser I can get the pagination to work, but on another it looks horrid.", "\n\nThe BCD Roster plugin still comes in handy to maintain the band’s members. ", "Makes it real easy to have a page that simply lists the band members.", "\n\nNow that the site is live everyone can start giving some real feedback. ", "This is when the fun begins! ", "Since I’m not very creative it’s nice to get the feedback of the populace and hear what they need or want." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007361433235928416, 0.0007450261618942022, 0.0005363525706343353, 0.0006938169244676828, 0.0006315807695500553, 0.0005427299183793366, 0.000705388723872602, 0.0009414850501343608, 0.0008685021894052625, 0.0006343750865198672, 0.0005419635563157499, 0.0005496860831044614, 0.0006050221854820848, 0.000543660600669682, 0.0006764215067960322, 0.0005399814690463245, 0.0005937947425991297, 0.000889666669536382, 0.0005618222057819366, 0.0005755616584792733, 0.16968275606632233, 0.022529810667037964, 0.0005930156330578029, 0.0006029066862538457, 0.0005664009950123727, 0.0008719022152945399, 0.0006370758637785912 ]

[ "Q:\n\nButton positioning different on iOS then Windows and Android\n\nI have a span what has 2 elements, input and svg.", "\nI want the svg to be centered vertically in the input field.", "\nI have 3 devices where I'm testing the design of my PWA.", "\n\nWindows 10 - Google Chrome\nAndroid 6.0 - Google Chrome\niOS 12.+ - Safari\n\nOn both Windows and Android it's centered vertically, only not on the iOS device.", "\nDoes anyone have an idea what this would fix?", "\nReact Component:\n<StyledInputSpan>\n <StyledInput />\n <StyledClearButton />\n</StyledInputSpan>\n\nStyled Component:\nexport const StyledInput = styled.input`\n //Reset box-shadow\n -webkit-appearance: none;\n -moz-appearance: none;\n appearance: none;\n\n display: block;\n padding: 0.75em 2em 0.75em 0.75em; //Extra padding on the right for the clear button.", "\n font-size: 1em;\n\n //Hide the standard clear button.", "\n &[type=search]::-webkit-search-cancel-button {\n display: none;\n }\n`;\n\nexport const StyledClearButton = styled.button`\n position: absolute;\n top: calc(2.8em - env(safe-area-inset-top)); //env() is for the nodge on iOS.", "\n right: 0;\n`;\n\nconst StyledInputSpan = styled.span`\n display: flex;\n align-items: center;\n`;\n\nA:\n\nFind out that using env(safe-area-inset-top) is not what I was looking for.", "\n\nenv(safe-area-inset-top) works only for the top of your app on iOS.", "\n When you use env(safe-area-inset-top) it push down your app with the height of the nodge.", "\n\nI changed my css/styled component to:\nexport const StyledInput = styled.input`\n //Reset box-shadow\n -webkit-appearance: none;\n -moz-appearance: none;\n appearance: none;\n\n position: relative;\n display: block;\n padding: 0.75em 2em 0.75em 0.75em; //Extra padding on the right for the clear button.", "\n font-size: 1em;\n\n //Hide the standard clear button.", "\n &[type=search]::-webkit-search-cancel-button {\n display: none;\n }\n`;\n\nexport const StyledClearButton = styled.button`\n position: absolute;\n top: 27.5%;\n transform: translate(0, -50%);\n right: 0;\n`;\n\nconst StyledInputSpan = styled.span`\n position: relative;\n display: flex;\n align-items: center;\n`;\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.00063228391809389, 0.0005579917342402041, 0.0006243926472961903, 0.0006172794965095818, 0.0007319322321563959, 0.0008385558030568063, 0.0007027608808130026, 0.0007456107414327562, 0.0006969021051190794, 0.0006897765561006963, 0.00343527365475893, 0.000703074038028717, 0.0007027608808130026, 0.000742295291274786 ]

[ "(CNN) Seventeen black women made history Tuesday night in winning judicial seats in Harris County, Texas.", "\n\nThe 17 Democratic candidates were elected under a campaign they called \"Black Girl Magic Texas,\" hoping to be the largest number of black women elected judges in Harris County.", "\n\nHarris County, which includes Houston, is the largest county in the state.", "\n\nSome of the women celebrated their success on social media.", "\n\n\"This election is still sinking in,\" LaShawn Williams, judge-elect for one of the county civil courts at law, wrote on Facebook . \"", "I am speechless and overjoyed by all of your kind words and powerful actions to help us make a court system which ensures that everyone will be heard.\"", "\n\nRead More" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.004036859609186649, 0.029051825404167175, 0.0008404071559198201, 0.000739492301363498, 0.0006485685589723289, 0.000603934982791543, 0.0007913075969554484 ]

[ "Digitally controlled oscillators (DCOs) are commonly employed in a variety of applications, including communication and timing circuitry. ", "In particular, DCOs are commonly used in phase-locked loop (PLL) systems. ", "Functionally, a DCO may be viewed as a circuit that seeks to transform an input control voltage signal to an output voltage signal having a desired frequency.", "\nIn this case, the output signal of the PLL is normally compared against a reference signal, and a loop filter is used to tune the DCO in a manner dependent upon the comparison such that the output signal “matches” the reference signal. ", "Such PLLs are usually used to synthesize signals at a desired frequency or, for example, to recover a clock signal from a data stream. ", "PLLs can also be advantageously used in mobile radio for the purposes of signal modulation." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0007706437609158456, 0.0007344142650254071, 0.0007301432196982205, 0.0007207412272691727, 0.0007027196697890759, 0.0005768483388237655 ]

[ "A fledgling basketball academy is partnering with Notre Dame High School and the Ottawa Catholic School Board in the hopes of making the school a new hotbed for hoops in Eastern Ontario.", "\n\nThe Canada Topflight Academy pilot program aims to train 12 to 15 teenage boys to become elite basketball players while they attend classes at Notre Dame — including, potentially, international players who would be required to pay expensive tuition fees to the school board.", "\n\nThe academy's founder, local basketball promoter Tony House, is hoping to use a preparatory model similar to the Athlete Institute in Orangeville, Ont., ", "which has groomed two players, Jamal Murray and Thon Maker, who are both expected to be drafted in the 2016 NBA draft in June.", "\n\nMurray, a national team standout, played one year at the University of Kentucky before entering his name in the draft, while Maker is attempting to make the leap from high school directly to the NBA.", "\n\nTony House, the founder and director of Canada Topflight Academy, hopes to give parents of potential basketball stars an Ottawa option for training and development. (", "CBC)\n\n'Timing is right'\n\nPrior to the arrival of local basketball academies, top high school players in Canada would often go to the United States to play their final years of high school basketball in order to get noticed by U.S. college recruiters.", "\n\nOlivier Hanlan of Gatineau's Aylmer neighbourhood, for example, played two years in New Hampshire before he was recruited by Boston College. ", "Hanlan was drafted last year by the NBA's Utah Jazz and currently plays in a Lithuanian pro league.", "\n\nHouse said he hopes to field one full team that could play a competitive schedule, but said he was open to expanding if the first year proved successful.", "\n\n\"The timing is right. ", "A few years ago we lost five or six players to prep schools in Toronto and the U.S., so it's nice to give them an Ottawa option,\" he told CBC Radio's Ottawa Morning on Thursday.", "\n\n\"I think parents will be happy and thrilled that they would probably be sleeping in their own beds and having dinner at home, instead of being four and a half, six, seven hours away. ", "So we're pretty excited about it.\"", "\n\nOlivier Hanlan of Gatineau, Que., ", "played his final two years of high school basketball in New Hampshire before he was recruited by Boston College. (", "AP Photo/Seth Wenig)\n\nFinancial benefit 'not the reason'\n\nThe academy has some marquee names on its board of directors, including Dave Smart, the 12-time Canadian Interuniversity Sport champion head coach of the Carleton Ravens men's team, Leo Rautins, the former men's national team coach, and Milt Palacio, a former NBA player who played for both the Vancouver Grizzlies and Toronto Raptors.", "\n\nTuition at the school would not be cheap, however. ", "House said it would cost students about $10,000 a year to attend the academy. ", "The academy would also be funded through sponsorship and donations, he said.", "\n\nPeter Atkinson, superintendent of continuing and community education with the OCSB, told CBC News Thursday the academy would offer \"no real financial benefit\" to the board — although House is open to attracting foreign students to the program, students who would then have to pay international tuition fees on top of the academy's attendance fee.", "\n\nIf there is financial benefit, that's wonderful. ", "But that's not the purpose. ", "The purpose is student success. - ", "Peter Atkinson, OCSB\n\nThose international fees amount to an extra $13,000 a year, per student.", "\n\n\"That's not what's motivating us to do this. ", "What's motivating us to do this to provide opportunity for students,\" Atkinson said.", "\n\n\"Financial benefit is not the reason why we're partnering with Topflight Academy. ", "If there is financial benefit, that's wonderful. ", "But that's not the purpose. ", "The purpose is student success.\"", "\n\nThe OCSB says in a news release it is participating in the pilot in response to an increasing demand for sports-specific training in high schools.", "\n\n\"We support the CTA's goal to deliver an excellent program both in the classroom and on the basketball court,\" said director of education Denise Andre in a statement. \"", "It will not replace existing interscholastic programs, yet will complement the opportunities available to our students.\"" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000690826156642288, 0.0007649346953257918, 0.0005717677995562553, 0.000629015383310616, 0.0007225450244732201, 0.00053883291548118, 0.0005949218175373971, 0.0006713245529681444, 0.0006597868632525206, 0.0005711621488444507, 0.0006314914207905531, 0.0005615807021968067, 0.0007072044536471367, 0.0005569946370087564, 0.000859866093378514, 0.0008285515359602869, 0.0006068152724765241, 0.0006974352872930467, 0.0006856144755147398, 0.0005533128860406578, 0.0005403614486567676, 0.0005839340155944228, 0.0010840744944289327, 0.0006196676404215395, 0.0005735335289500654, 0.0009322743280790746, 0.0006238879286684096, 0.0005933187203481793, 0.0005839340155944228, 0.0010840744944289327, 0.0006076839636079967, 0.0005530711496248841, 0.0005527272587642074, 0.0005795531324110925 ]

[ "Luisa Ottolini\n\nLuisa Ottolini (born July 10, 1954, in Tortona, province of Alessandria, Italy) is an Italian physicist.", "\n\nBiography\nIn 1978, Luisa Ottolini graduated in Physics at the University of Pavia. ", "From 1982 to 1986, she was the Head of the Structuristic Section at the Istituto Sperimentale dei Metalli Leggeri (I.S.M.L.) in Novara. ", "In 1987, she activated the Strategic Project of the National Research Council of Italy (CNR) An Ion Microprobe for Advanced Researches in the Earth Sciences with the installation at the “Centro di Studio per la Cristallografia Strutturale” in Pavia of the first, and so far, the only one National Laboratory of Secondary Ion Mass Spectrometry (SIMS) in the Earth Sciences. ", "Since that time she has been the Head of the SIMS Lab. ", "Starting from 1989, she activated the National SIMS service for University and CNR Institutions affering the Earth Science Committee (05), following more than 90 research projects. ", "In 2002-2005 she coordinated a research Unit in Pavia, sponsored by the European Framework Project EUROMELT (European Community’s Human Potential Programme, contract HPRN-CT-2002-00211). ", "Since December 19, 2005, she has been the Head of CNR-Institute of Geosciences and Geo-resources (IGG)-Section of Pavia.", "\n\nShe co-authored more than 150 international ISI publications, of which 5 in Nature; more than 200 Abstracts at International and National Meetings, 35 monographs and inner reports.", "\n\nMain scientific interests\n\nHer research activities mainly concerned the use of SIMS for the quantitative measurement of low-concentration constituents, of light (Lithium, Beryllium and Boron) and volatile elements (Hydrogen, Fluorine, Chlorine, Carbon) in geological samples, with particular reference to the investigation of the physical/chemical processes underlying the production of secondary ions, aiming at overcoming the limitations of the technique (interferences and non-linear effects, “matrix effects”); the development, set up and optimization of SIMS procedures for trace elements, light and volatile elements, and ultra-trace elements in the frame of petrologic, geochemical and crystal-chemical studies, with particular reference to the investigation of melt inclusions, silicate minerals, artificial glasses, chemically-complex silicate and non-silicate matrixes, experimental charges.", "\n\nAwards and honors\n 2004 - Awards from CNR in the celebration of the 80th anniversary of the foundation of CNR, as one of the 12 CNR female researchers who contributed to the development of the scientific progress of Italy.", "\n 2004 - The name of Ferri-ottoliniite to a new amphibole end-member (IMA-CNMMN 2001-67A) to acknowledge the “fundamental contribution of L. Ottolini to the advancement of ion-probe analysis of minerals, with particular reference to light elements”.", "\n 2006 - Inclusion of L. Ottolini in Who’s Who in the World (23rd Edition by Marquis, Who’s Who, Philadelphia, PA, USA) and in Who's Who in Science and Engineering.", "\n Since 2013 - Partner of the University of Liege.", "\n\nReferences\n\nExternal links\n CNR - National Research Council of Italy\n CNR - Institute of Geosciences and Geo-resources (IGG)-Section of Pavia\n IGG CNR\n\nCategory:1954 births\nCategory:20th-century Italian scientists\nCategory:20th-century women scientists\nCategory:20th-century physicists\nCategory:21st-century Italian scientists\nCategory:21st-century women scientists\nCategory:21st-century physicists\nCategory:Living people\nCategory:Italian physicists\nCategory:Italian women physicists\nCategory:Mass spectrometrists\nCategory:People from Tortona\nCategory:People from the Province of Alessandria\nCategory:Rare earth scientists" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0007658883696421981, 0.0006235449691303074, 0.0008823011303320527, 0.0005690985708497465, 0.0006215201574377716, 0.0005443196278065443, 0.0005985846510156989, 0.0006502424366772175, 0.0006116748554632068, 0.0005496630328707397, 0.000552558689378202, 0.0005638349102810025, 0.0005891866167075932, 0.0005638155853375793, 0.0006536868750117719 ]

[ "\r\n\r\n\r\n\r\nEx Parte Borland \r\n\r\n\r\n\r\nIN THE COURT OF APPEALS, THIRD DISTRICT OF TEXAS,\n\nAT AUSTIN\n\n\n \n\n\n\nNO. ", "3-92-479-CR\n\n\n\nEX PARTE: JOHN W. BORLAND,\n\n\tAPPELLANT\n\n \n\n\nFROM THE COUNTY COURT AT LAW NO. ", "2 OF WILLIAMSON COUNTY\n\nNO. ", "35,580-2, HONORABLE ROBERT F. B. MORSE, JUDGE PRESIDING \n\n \n\n\n\tJohn W. Borland appeals from an order of the trial court denying relief on his\r\npretrial writ of habeas corpus. ", " Borland is charged by information with driving while intoxicated\r\nby alcohol, controlled substance, drug, or combination of two or more of these substances. ", " See\r\nTex. ", "Rev. Civ. ", "Stat. ", "Ann. ", "art. ", "6701l-1 (West Supp. ", "1993). ", " Borland alleges that the constitutional\r\nprinciple of double jeopardy (1) prohibits the State of Texas from trying him after his first trial ended\r\nin a mistrial due to a deadlocked or \"hung\" jury. ", " We will affirm the trial court's order. ", "\n\n\n BACKGROUND\n\tThe information against Borland in his first trial charged him with driving while\r\nintoxicated under the influence of alcohol alone. ", " On the date of trial, before jury selection,\r\nBorland's counsel informed the State's counsel that he intended to use the defense that Borland\r\nhad not been intoxicated through the consumption of alcohol and had used prescription drugs on\r\nthe day of his arrest. ", " The State did not attempt to amend the information or ask for a continuance. ", "\r\nBorland presented evidence at trial that supported his prescription-drug defense. (", "2) The State\r\nrequested and the trial court gave a jury charge, over Borland's objection, that contained the two\r\nparagraphs at issue in this appeal:\n\n\nYou are instructed that if a defendant indulges in the use of drugs to such an extent\r\nthat he thereby makes himself more susceptible to the influence of alcohol than he\r\notherwise would have been and by reason thereof becomes intoxicated by the\r\nrecent introduction of alcohol into his body, he would be in the same position as\r\nthough his intoxication was produced by the use of alcohol alone.", "\n\nNow, if you believe from the evidence beyond a reasonable doubt that . . . ", "John\r\nW. Borland, Jr., did then and there, while intoxicated by alcohol alone or by\r\nalcohol in combination with a drug or drugs, drive or operate a motor vehicle in\r\na public place within said county, as alleged in the information, you will find the\r\ndefendant guilty as charged . . . .", "\n\n\nThese instructions are substantially identical to language approved by the Court of Criminal\r\nAppeals in Heard v. State, 665 S.W.2d 488, 489 (Tex. ", "Crim. ", "App. ", "1984).", "\n\tThe jury deliberated for eight hours. ", " During this time, it sent several notes to the\r\ntrial court complaining that it was deadlocked. ", " The presiding juror testified in this proceeding that\r\nthe jury voted five-to-one in favor of acquittal during its deliberations. ", " The trial court considered\r\nissuing a \"dynamite charge\" (3) to encourage the jury to reach a decision if possible, but instead\r\ndeclared a mistrial, over Borland's objection.", "\n\tThe State then filed the information in this case alleging intoxication by the use of\r\nalcohol and drugs alone or in combination. ", " Borland challenges the trial court's denial of relief\r\nby three points of error. ", " His first two points allege the Heard instructions given the jury acted\r\nas an amendment of the information and that their submission constituted gross negligence and\r\nintentional prosecutorial misconduct, thereby barring his retrial under the prohibition against\r\ndouble jeopardy for the same offense found in the Fifth Amendment to the United States\r\nConstitution and Article I, Section 14 of the Texas Constitution. ", " His third point alleges his retrial\r\nis barred because this intentional misconduct deprived him of his right to due course of law\r\nguaranteed by the Fourteenth Amendment to the United States Constitution and Article I, Section\r\n19 of the Texas Constitution.", "\n\n\nDOUBLE JEOPARDY\n\n\tJeopardy attached in Borland's first trial when the jury was sworn and impanelled. ", "\r\nCrist v. Bretz, 437 U.S. 28 (1978). ", " Ordinarily, once jeopardy attaches, a defendant possesses a\r\nvalued right to have his guilt or innocence determined before the trier of fact. ", " United States v.\r\nScott, 437 U.S. 82 (1978); Torres v. State, 614 S.W.2d 436, 441 (Tex. ", "Crim. ", "App. ", "1981). ", " If a\r\nmistrial is declared without the defendant's request or consent, there must be a manifest necessity\r\nfor the mistrial, or it must serve the ends of public justice. ", " Illinois v. Somerville, 410 U.S. 458\r\n(1973); United States v. Perez, 22 U.S. (9 Wheat.) ", "579 (1824) (classic exposition of this rule by\r\nJustice Story); Chvojka v. State, 582 S.W.2d 828, 830 (Tex. ", "Crim. ", "App. ", "1979). ", " When the\r\nmistrial is declared at the defendant's request, however, retrial is barred only if prosecutorial or\r\njudicial overreaching provokes the defendant's request. ", " Prosecutorial overreaching will be found\r\nwhen the State, through gross negligence or intentional misconduct, causes aggravated\r\ncircumstances to develop that seriously prejudice a defendant, causing him to reasonably conclude\r\nthat a continuation of the tainted proceedings would result in a conviction. ", " Chvojka, 582 S.W.2d\r\nat 830-31 (relying on United States v. Dinitz, 424 U.S. 600 (1976)).", "\n\tThe State correctly points out that Borland's complaint on appeal raises the issue\r\nof prosecutorial overreaching, normally a consideration only when the defendant requests a\r\nmistrial, rather than where, as here, the trial court declares a mistrial sua sponte. ", " However,\r\nbecause the burden is on the State to show manifest necessity in such a case, if Borland can\r\ndemonstrate intentional misconduct by the prosecution, it may be difficult for the State to prove\r\nsuch necessity existed.", "\n\tBorland presents an unusual argument. ", " He claims the State's misconduct in the\r\nfirst trial was calculated to \"hang\" the jury because the State realized Borland's prescription-drug\r\ndefense would probably result in his acquittal. ", " In fact, the jury was unable to reach a verdict. ", "\r\nBorland attempts to bar his retrial following the trial court's dismissal of a \"hung\" jury in his first\r\ntrial, a formidable task:\n\n\n[T]he trial judge's belief that the jury is unable to reach a verdict [has] long been\r\nthe classic basis for a proper mistrial. ", " The argument that a jury's inability to agree\r\n. . . ", "requires acquittal, has been uniformly rejected in this country. ", " Instead,\r\nwithout exception, the courts have held that the trial judge may discharge a\r\ngenuinely deadlocked jury and require the defendant to submit to a second trial. ", "\r\nThis rule accords recognition in giving the prosecution one complete opportunity\r\nto convict those who have violated its laws.", "\n\nThe trial judge's decision to declare a mistrial when he considers the jury\r\ndeadlocked is therefore accorded great deference by a reviewing court.", "\n\n\nArizona v. Washington, 434 U.S. 497, 509-10 (1978). ", " Nevertheless, the Supreme Court\r\nrecognized certain instances where this deference is inappropriate: \"If the record reveals that the\r\ntrial judge has failed to exercise the `sound discretion' entrusted to him . . . [", "or] acts for reasons\r\ncompletely unrelated to the trial problem which purports to be the basis for the mistrial ruling,\r\nclose appellate scrutiny is appropriate.\" ", " Id. at 510 n.28. ", " One Texas court of appeals has stated\r\nthat bad faith prosecutorial or judicial overreaching could create a valid double jeopardy claim\r\neven in the case of a \"hung\" jury. ", " Knight v. State, 642 S.W.2d 180, 181 (Tex. ", "App.--Houston\r\n[14th Dist.] ", "1984, no pet.). ", " If, as Borland alleges, the State submitted a jury charge it knew to\r\nbe erroneous in order to create confusion among the jurors and force the trial court to declare a\r\nmistrial in order to salvage a case that otherwise appeared lost, we would be forced to determine\r\nwhether manifest necessity required a mistrial.", "\n\nTHE HEARD CHARGE\n\n\tIn Kessler v. State, 125 S.W.2d 308 (Tex. ", "Crim. ", "App. ", "1938), the defendant was\r\nconvicted of driving while intoxicated by alcohol. ", " On appeal, she claimed the court erred in\r\ndeclining to submit her proffered instruction that if the jury found her intoxicated from the\r\ncombined effect of alcohol and the drug amytal, she must be acquitted. ", " The Court of Criminal\r\nAppeals noted the charge correctly informed the jury that it was to acquit the defendant if it found\r\nher intoxicated from drug use alone, but then held,\n\n\n\"If she indulged in the use of amytal to such an extent that she thereby made\r\nherself more susceptible to the influence of intoxicating liquor than she otherwise\r\nwould have been and by reason thereof became intoxicated from the recent use of\r\nardent spirits, she would be in the same position as though her intoxication was\r\nproduced by the use of [alcohol] alone.", "\n\n\nId. at 309. ", " At the time, driving under the influence of drugs or the combined influence of alcohol\r\nand drugs was not a specific offense under Texas law. ", " The Kessler court merely held that \"a\r\nperson who gets himself in the condition whereby he may get intoxicated from a lesser quantity\r\nof [alcohol] than it would ordinarily take to produce intoxication, is nevertheless intoxicated from\r\nthe use of [alcohol].\" ", " Miller v. State, 341 S.W.2d 440, 442 (Tex. ", "Crim. ", "App. ", "1960).", "\n\tIn Heard, the trial court used the language in Kessler, which had rejected a\r\ndefensive instruction that combined drug and alcohol use required acquittal, and submitted a jury\r\ninstruction that such combined use required conviction. ", " The Court of Criminal Appeals held that\r\nthe charge was a correct statement of Texas law. ", " Heard, 665 S.W.2d at 489-90.", "\n\tBorland argues the State in effect amended the information when it submitted the\r\ntwo paragraphs from the Heard charge. ", " The Court of Criminal Appeals specifically rejected such\r\nan argument in Heard: \"Thus, the trial court's charge did not expand on the allegations of the\r\ninformation but merely applied the facts of this particular case to the law.\" ", " Id. at 490; see also\r\nBooher v. State, 668 S.W.2d 882, 884 (Tex. ", "App.--Houston [1st Dist.] ", "1984, pet. ", "ref'd)\r\n(\"synergistic charge\" of combined drug and alcohol use does not charge defendant with new\r\ncrime).", "\n\tBorland, however, contends the holding in Heard is no longer valid. ", " He correctly\r\nnotes that Heard involved conduct occurring in 1980 and that the driving while intoxicated statute\r\nwas substantially altered, effective January 1, 1984. ", " The statute now encompasses the use of\r\ndrugs as well as the combined use of alcohol and drugs. ", " See Tex. ", "Rev. Civ. ", "Stat. ", "Ann. ", "art.", "\r\n6701l-1 (West Supp. ", "1993). ", " Borland contends the changes to the statute nullified the holding in\r\nHeard and required the State to charge a defendant with the combined use of drugs and alcohol\r\nrather than relying upon the jury instructions upheld in Heard.", "\n\tBorland cites no authority stating that Heard's holding has been overruled by the\r\namended driving while intoxicated statute. (", "4) We do not decide the continuing validity of Heard\r\nin this opinion, but will assume that Heard is no longer good law under the amended statute.", "\n\n\nTHE STATE'S CONDUCT IN THE FIRST TRIAL\n\tThe State originally charged Borland with the use of alcohol alone because it was\r\nunaware he had used any other intoxicating substances. ", " Borland informed the State's counsel on\r\nthe day of trial, before jury selection, that he would be using a prescription-drug defense. ", " The\r\nState was faced with several options at this point. ", " First, as jeopardy had not yet attached, it could\r\ndismiss the information and file a new charging instrument alleging the use of alcohol, drugs, or\r\na combination thereof. ", " Second, it could ask for a continuance. ", " Both actions would have delayed\r\nthe start of trial and wasted state resources. ", " Third, it could amend the information to include the\r\nadditional allegations. ", " However, the Court of Criminal Appeals has held that if the defendant\r\nobjects, it is reversible error for the trial court to allow such an amendment on the day of trial\r\nbefore proceedings have begun. ", " State v. Murk, 815 S.W.2d 556, 558 (Tex. ", "Crim. ", "App. ", "1991);\r\nSodipo v. State, 815 S.W.2d 551, 556 (Tex. ", "Crim. ", "App. ", "1991). ", " Finally, it could rely upon the\r\ninstructions in Heard to respond to the prescription-drug defense if in fact Borland developed this\r\ndefense during trial.", "\n\tProsecutors in this State are entitled to rely on the opinions of the Court of\r\nCriminal Appeals. ", " If the 1984 amendment of article 6701l-1 overruled Heard, it did so only\r\nindirectly. ", " We do not believe that Heard's incompatibility with the amended driving-while-intoxicated statute is so obvious that, as a matter of law, further reliance on the opinion constitutes\r\nintentional misconduct or gross negligence. ", " Borland had failed to demonstrate that the prosecutor\r\nwas acting in bad faith by relying on Heard at the first trial, or that the prosecutor's request for\r\nthe Heard instruction was calculated to produce a hung jury. ", " Borland has also failed to establish\r\nthat the prosecutor should have known that a hung jury was likely if the Heard instruction was\r\ngiven. ", " We decline to hold that the prosecutor's actions at Borland's first trial amounted to\r\ndeliberate misconduct or gross negligence. (", "5) Therefore, the \"hung\" jury created a manifest\r\nnecessity that supports the trial court's declaration of a mistrial. ", " See Woodson v. State, 777\r\nS.W.2d 525 (Tex. ", "App.--Corpus Christi 1989, pet. ", "ref'd) (affirming trial court's declaration of\r\nmistrial due to \"hung\" jury after eight hours of deliberation). ", " The State has not placed Borland\r\nin double jeopardy by retrying him when such necessity existed in the first trial. ", " We overrule his\r\nfirst two points of error.", "\n\tBorland's third point argues that the State's intentional misconduct bars his retrial\r\nbecause it violated his right to due course of law. ", " As we have found the State's conduct was not\r\nintentionally designed to provoke a \"hung\" jury, we overrule this point.", "\n\tThe order of the trial court is affirmed.", "\n\n\n \n\t\t\t\t\tMarilyn Aboussie, Justice\n[Before Chief Justice Carroll, Justices Aboussie and Jones]\nAffirmed\nFiled: May 12, 1993\n[Do Not Publish]\r\n1. ", " A pretrial writ of habeas corpus is the correct procedure for raising and appealing a claim\r\nof double jeopardy based on a previous trial. ", " Ex parte Robinson, 641 S.W.2d 552, 555 (Tex.", "\r\nCrim. ", "App. ", "1982) (relying on Abney v. United States, 431 U.S. 651 (1977)); see also Ex parte\r\nLoffland, 670 S.W.2d 390, 392 (Tex. ", "App.--Fort Worth 1984, pet. ", "ref'd). ", " This Court has\r\njurisdiction to hear an appeal from denial of a writ of habeas corpus. ", " See Tex. ", "R. App. ", "P. 44.", "\r\n2. ", " The exact nature of this defense is difficult to ascertain, as the record on appeal does not\r\ncontain a complete statement of facts from the first trial. ", " However, in Borland's proposed\r\nfindings of fact that he submitted to the trial court in this habeas corpus proceeding, one finding\r\nstates that he admitted he consumed two beers prior to his arrest, but also testified he used\r\nprescription pain medicine due to oral surgery. ", " The State does not dispute this account of\r\nBorland's testimony.", "\r\n3. ", " See Allen v. United States, 164 U.S. 492 (1896).", "\r\n4. ", " State v. Carter, 810 S.W.2d 197, 200 (Tex. ", "Crim. ", "App. ", "1991) requires the State, on the\r\ndefendant's motion to quash, to allege in the charging instrument whether the defendant was\r\nintoxicated by loss of his physical and mental faculties or by having an alcohol concentration of\r\n0.10 or more in his blood, breath, or urine. ", " Garcia v. State, 747 S.W.2d 379, 381 (Tex. ", "Crim.", "\r\nApp. ", "1988) requires the State to specify what type of intoxicant the defendant allegedly used. ", "\r\nHere, the State met these requirements in the first trial by alleging Borland lost the use of his\r\nfaculties by the use of alcohol.", "\r\n5. ", " Borland argues that judicial overreaching also bars his retrial. ", " He claims the trial court\r\ncommitted gross negligence by submitting the Heard charge to the jury. ", " We reject this argument. ", "\r\nBorland does not assert this complaint by point of error. ", " Further, even if the holding in Heard\r\nis no longer viable law, no court has so held, and we do not reach this issue today.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007434859871864319, 0.0007439920445904136, 0.0007973652682267129, 0.0007908179541118443, 0.0013863260392099619, 0.0007498146733269095, 0.0008226755307987332, 0.0009744156268425286, 0.0015625481028109789, 0.001342528616078198, 0.0009069890365935862, 0.0007438244647346437, 0.0009795130463317037, 0.0006406005122698843, 0.0011131177889183164, 0.0007917310576885939, 0.0006488414946943521, 0.0006029405631124973, 0.0010220702970400453, 0.0008212387328967452, 0.0014055784558877349, 0.0007055060123093426, 0.0018367550801485777, 0.000847632298246026, 0.0007612597546540201, 0.0005839902441948652, 0.0006472268141806126, 0.0007377824513241649, 0.0007186421426013112, 0.0008138813427649438, 0.0008290119585581124, 0.0007299073622561991, 0.0009247427224181592, 0.0008204381447285414, 0.0008151457877829671, 0.0006472548120655119, 0.0008375718025490642, 0.0018367550801485777, 0.000847632298246026, 0.0007816465222276747, 0.0006833099178038538, 0.0007658128160983324, 0.0007355858106166124, 0.0018367550801485777, 0.000847632298246026, 0.0007885937811806798, 0.0006865812465548515, 0.0009523714543320239, 0.0007709827623330057, 0.0006342040142044425, 0.0007210214389488101, 0.0006409623310901225, 0.0011578877456486225, 0.0009884104365482926, 0.0028435897547751665, 0.000809526420198381, 0.000734395463950932, 0.0007443537469953299, 0.0008097767713479698, 0.0006509350496344268, 0.0007135198684409261, 0.0006134891300462186, 0.0006246822304092348, 0.001234012539498508, 0.0007403458002954721, 0.000894639000762254, 0.00070689752465114, 0.0006986047374084592, 0.0007189376628957689, 0.000711295404471457, 0.0018367550801485777, 0.000847632298246026, 0.007537208031862974, 0.0014723808271810412, 0.0009423285955563188, 0.0899970605969429, 0.0009359830874018371, 0.0010156643111258745, 0.0007801623432897031, 0.0018367550801485777, 0.000847632298246026, 0.0007815940189175308, 0.000796991924289614, 0.0007895408780314028, 0.000717814196832478, 0.0005885681021027267, 0.000628169160336256, 0.0008134616073220968, 0.0006960017490200698, 0.0007795049459673464, 0.0006632328731939197, 0.000672187190502882, 0.0006405633175745606, 0.0008486458100378513, 0.0007498146733269095, 0.0008226755307987332, 0.0009744156268425286, 0.0015625481028109789, 0.001342528616078198, 0.0009069890365935862, 0.0007438244647346437, 0.0007124622934497893, 0.001228933921083808, 0.000641638005618006, 0.000772998493630439, 0.0007107123965397477, 0.0006750790635123849, 0.0008197040297091007, 0.0005501609994098544, 0.0011800903594121337, 0.00060436682542786, 0.0006552543491125107, 0.0008783069206401706, 0.0018367550801485777, 0.000847632298246026, 0.0007752141100354493, 0.0018367550801485777, 0.000847632298246026, 0.00074430659878999, 0.0006201356300152838, 0.0006118270102888346, 0.0006804927252233028, 0.0010108809219673276, 0.0008114749216474593, 0.0006516904686577618, 0.0007529297727160156, 0.0008727621170692146, 0.0006764111458323896, 0.0006947929505258799, 0.0006861690781079233, 0.0009700439986772835, 0.0008556474349461496, 0.0008634243276901543, 0.0007283415179699659, 0.0006104183848947287, 0.0006690890295431018, 0.0014693750999867916, 0.0007369396043941379, 0.0018367550801485777, 0.000847632298246026, 0.000670490728225559, 0.0007428404642269015, 0.0007989582954905927, 0.0012293712934479117, 0.0007498146733269095, 0.0009975661523640156, 0.0007953785825520754, 0.001185585861094296, 0.0006415090174414217, 0.0007168633164837956, 0.0006785541190765798, 0.00117425003554672, 0.000681883015204221, 0.0012900278670713305, 0.0008082870044745505, 0.0018367550801485777, 0.000847632298246026, 0.006364378612488508, 0.000711115775629878, 0.0018367550801485777, 0.000847632298246026, 0.0009059564908966422, 0.0009949200320988894, 0.0013671480119228363, 0.0008295607403852046, 0.0010067160474136472, 0.0008570937206968665, 0.0007815980934537947, 0.0006258726352825761, 0.001995444530621171 ]

[ "CICAK NAMED SLC WOMEN'S TENNIS PLAYER OF THE WEEK\n\nJan 20, 2009\n\nTexas\nA&M-Corpus Christi freshman Mirna Cicak was named the Southland\nConference's women's tennis player of the week, the first awarded\nof the season.", "\n\nCicak earned\nthe honor by defeating Julie Chao of Rice, the #23 ranked player in\nthe\nSouthwest Divison of the Intercollegiate Tennis Association. ", "Playing in the first match of\nher collegiate career, Cicak faced off against the heralded Chao\nand beat her in straight sets, 7-5, 7-6.", "\n\n\"I really\nsalute Mirna for what showing so much poise and maturity in her\nfirst collegiate match.\"", "\nsaid Head Coach Steve Moore. \"", "We are all very proud of her and this\nhonor she received.\"", "\n\nThe victory\nover Chao marked the highest-ranked player ever beaten by an\nIslander in the history of the program.", "\n\nCicak and the\nrest of the Islanders' team will be back in action against Central\nArkansas on Feb. 1 in Dallas." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007865456864237785, 0.0006641620420850813, 0.001730004558339715, 0.0007400964386761189, 0.0006051559466868639, 0.0005327147664502263, 0.0007444953080266714, 0.0007133628241717815 ]

[ "New degrees, sports highlight future for area colleges\n\nNew degree programs at area colleges and universities and new buildings for students are just part of the plans on the horizon for higher education this year.", "\n\nDEBORAH CIRCELLIEDUCATION WRITER\n\nNew degree programs at area colleges and universities and new buildings for students are just part of the plans on the horizon for higher education this year. ", "Sports will also take center stage. ", "Football fans will get into the Hatter spirit as Stetson University brings football back next fall after a more than 50-year absence while Daytona State College starts women's volleyball and Embry-Riddle Aeronautical University begins construction on an athletic complex. ", "Embry-Riddle's largest building to date — a new College of Arts and Sciences building — is expected to be completed at the end of next year while Bethune-Cookman University offers weekend and night classes and moves to add two new small campus-type sites under consideration in Deltona and Ormond Beach. ", "Here's a more detailed look at what each of the schools expects for the coming year:\n\nEMBRY-RIDDLE CONSTRUCTION BOOM CONTINUES\n\nOn the heels of opening a new welcome center and administration building last fall, construction has already begun on a 140,000-square-foot College of Arts and Sciences building at Embry-Riddle, which will have the largest university-based telescope in Florida. ", "The $39 million building, which should be completed next December and open in January 2014, will be the largest on campus, but not for long as permitting and development begins the next year on a 220,000-square-foot new student center. ", "The center will be one-stop shopping to \"enhance the quality of student life,\" President John Johnson said, with everything from game rooms to possibly a movie theater. ", "Construction will also start on a new athletic complex that will include offices, locker rooms, concession stands, bleachers and a skybox near the women's softball field. ", "A new perimeter road now under construction is expected to be finished in 2013, Johnson said, and completely encircle the campus. ", "Construction will also start in 2013 on a 600-space parking garage south of the College of Arts and Sciences building since parking is \"very much in demand with all the growth happening,\" Johnson said. ", "Engineering will also get a second building for more research labs and offices with construction starting next year. ", "The university also plans to buy a wind tunnel next year, which officials said would be one of the largest in the country, to be used for research by the school and aerospace companies. ", "Embry-Riddle will also officially break ground on its Aerospace Research and Technology Park in February, while discussions are ongoing with aerospace companies, including in Canada, looking to go into the park. ", "New degree programs will also be starting next fall, including the university's third doctorate degree, which will be in aerospace engineering, Johnson said. ", "A fourth doctorate may start in 2014 in human factors, which looks at biological factors at various times, including during space exploration. ", "Also, Embry-Riddle will add next year a master's of science in unmanned aerial vehicles that will deal with the design aspect as opposed to the bachelor's added in 2011 in unmanned aircraft systems that trains the pilots who fly and control the drones. ", "The university will also have a new bachelor degree in commercial space operation next fall. ", "A new minor program will also start on the study of biology and life sciences. \"", "We have a very busy agenda. ", "It's a very exciting time,\" Johnson said.", "\n\nBETHUNE-COOKMAN TO ADD MORE LOCATIONS\n\nBethune-Cookman University may have a new permanent president next year as the board expects to make a decision soon on selecting a search firm. ", "Firms have been interviewed but no timeline has been made on when a new president will be hired. ", "Board chairman John Harrington said the process does not need to be \"hurried\" since the university has an \"outstanding\" interim president— Edison Jackson. ", "Jackson replaced Trudie Kibbe Reed, who retired in May after eight years. ", "The university has been moving forward, including looking at adding more small campus sites that would serve about 20 to 30 students. ", "Darryl Frazier, dean of the university's School of Professional Studies, said the university hopes to open a site in Deltona at the end of March or April to be ready for students in the summer and fall semesters in a building leased from the city. ", "Several locations are under consideration. ", "The university has had a similar site in Hastings for more than 20 years and is also looking at establishing sites in Ormond Beach, Sanford and Gainesville. ", "The small sites are more for non-traditional students. ", "The university had multiple extension sites in the past, but they were discontinued. ", "Because of the state of the economy, Frazier said more people are wanting to further their education and enjoy learning in small groups and on the weekends or evenings. ", "Bethune-Cookman also started evening courses last fall on the main campus and is adding weekend courses for the spring semester that starts in January. \"", "We're bringing in people who would not go to class during the day,\" Frazier said. \"", "In the long-run, it also increases enrollment.\" ", "The university offers a variety of programs and is looking to add more certifications and bachelor and master degrees, as well, next year. ", "The academic profile of students at the main campus is also changing as the university recruits students with higher grade point averages and test scores than in the past. ", "Jackson said the school wants to be sure it admits \"students who have a reasonable chance of succeeding\" and graduating. ", "About 37 percent of Bethune-Cookman students who began in the fall of 2005 graduated in six years, according to the National Center for Education Statistics. ", "Dwaun Warmack, vice president for enrollment management and student development, said recruitment efforts include expanding to new markets in the Midwest and northeast and recruiting not only African-Americans but Caucasians and Hispanics as well to \"diversify our population to ensure students have a holistic experience.\"", "\n\nSTETSON UNIVERSITY\n\nAre you ready for some football? ", "Stetson's \"Countdown to Kickoff\" on its website is tracking to the minutes and seconds until the first Aug. 31 home game. \"", "It's going to be a big day for us,\" said Stetson President Wendy Libby. \"", "It's already changed things substantially. ", "We brought in an additional 100 men this past year, which is much faster than our expectations.\" ", "The cumulative grade point average of the players, who are from 19 states, is more than 3.5, she said. \"", "They are scholars first and athletes second,\" Libby said. ", "The university overall has also grown in enrollment and has the reserves to continue upgrades to classrooms, improvements to residence halls and funding for faculty development and research. ", "Enrollment since Libby started in July 2009 has grown from about 2,000 to more than 2,500 this fall and is expected to be at 3,000 in 2016. ", "Those numbers reflect an increase in new students and retaining more students than in the past. ", "The university spent the past year revising its values statement, stressing such things as personal growth, global citizenship and social responsibility. ", "One example is the university's consideration of whether to become a smoke-free campus while another group looks at environmental sustainability initiatives. ", "Discussions continue, including developing the values into the curriculum. \"", "It's important that the values become a part of the fabric of who we are,\" Libby said. \"", "Our students are very conscious about issues around social justice and equality so we want to make sure our students and university responds in a way that changes the world and makes it a better place to be.\" ", "The university has also added new deans at three of its schools who will work with faculty on strategic plans. ", "To handle the projected increase in enrollment, in November the university announced its purchase of the University Inn in DeLand. ", "Stetson takes over the property next summer and will renovate it before opening with 120 beds in August. ", "Stetson continues operating its theater arts program in the Museum of Florida Art after the demolition of Stover Theatre last year. ", "The university added about $300,000 to $400,000 in upgrades to the theater part of the museum, such as lighting. ", "Stetson is also planning a comprehensive campaign that will include a number of building renovations and expansions campuswide. ", "None will break ground in 2013.", "\n\nDAYTONA STATE COLLEGE\n\nDaytona State College and its department heads continue to discuss adding more bachelor's degrees to meet students' needs while the Palm Coast campus gears up for construction to start on a new building. ", "One of the proposed bachelor programs continuing to be discussed is nursing. ", "The board of trustees in August approved conducting a feasibility study and a research company has been hired to look at the needs from local hospitals and students. ", "Daytona State President Carol Eaton expects the report \"will be ready for the board very early in 2013.\" ", "University of Central Florida officials have questioned whether demand exists for Daytona State to also offer the bachelor degree. ", "Daytona State is planning next fall to start a new associate of science degree in interactive media production, which will include studies such as photography, journalism, music production and computer design. ", "Women's volleyball, a new sport approved by the board earlier this year, will also begin in August. ", "If approved by the Legislature, the college will move forward with other state colleges to meet Gov. Rick Scott's challenge to create a $10,000 bachelor degree program aimed at making higher education more affordable. ", "Daytona State College proposes an accelerated \"Fast-Track Baccalaureate Program'' next fall that would offer high school students a three-year path for any of its bachelor's degrees at a savings of about $3,000 and less than half of what it would cost at a state university. ", "As far as capital projects, a new water chiller plant at the Daytona Beach campus will likely open this summer. ", "The plant will result in savings in electricity for the college. ", "The college will also seek funding from the Legislature in the spring, including $24 million for a multistory classroom/student center on the main Daytona Beach campus. ", "Another $532,678 is needed toward the new Flagler/Palm Coast Campus Classroom Building. ", "Construction will start in the summer after $7.6 million was approved earlier this year and the building will open in August 2014. ", "Planning will also continue on the new scene shop at The News-Journal Center. ", "As far as enrollment, Eaton expects enrollment will remain below the peak that it was several years ago as \"students will still be feeling the impact of a less robust economy.\" ", "The number of students taking college credit courses was down about 9 percent this fall, compared to fall of 2011." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005661823670379817, 0.0005613792454823852, 0.0006168042891658843, 0.001012186286970973, 0.0006231340812519193, 0.0005332825239747763, 0.0006809760234318674, 0.0005981423892080784, 0.0006900780717842281, 0.0006034616963006556, 0.0005990988574922085, 0.0005634409026242793, 0.0005906310398131609, 0.0005344225792214274, 0.000641245802398771, 0.0005307988612912595, 0.0005749187548644841, 0.0006615020101889968, 0.0005609756917692721, 0.0007725901086814702, 0.00058858742704615, 0.0005635120323859155, 0.0005524494335986674, 0.0005517445388250053, 0.0008870372548699379, 0.0005268503446131945, 0.0005883258418180048, 0.0005455576465465128, 0.0005560475401580334, 0.0006760589894838631, 0.0006004192982800305, 0.0005228706286288798, 0.000573242548853159, 0.0007506146794185042, 0.0005519957048818469, 0.0005376478075049818, 0.0005795523175038397, 0.0005317622562870383, 0.0006480328738689423, 0.0006135251023806632, 0.0010065999813377857, 0.0006109471432864666, 0.0006502520409412682, 0.0005949776968918741, 0.000540636305231601, 0.0006245521944947541, 0.0006234676693566144, 0.0005344185046851635, 0.0005733266589231789, 0.0006005123723298311, 0.0005282394122332335, 0.0005608489154838026, 0.000514659215696156, 0.0005958237452432513, 0.0005433777696453035, 0.0005629676743410528, 0.000575136044062674, 0.0010249466868117452, 0.0005974660743959248, 0.0006083895568735898, 0.0005890777101740241, 0.0006202497170306742, 0.0005962449940852821, 0.0005466121365316212, 0.0005274288705550134, 0.0005424718838185072, 0.0005740320775657892, 0.000665180035866797, 0.0006474420661106706, 0.0006261685048229992, 0.0006130233523435891, 0.0005719221080653369, 0.0005407076678238809, 0.0005643344484269619, 0.0006706722779199481, 0.0006011001532897353, 0.0005479115061461926, 0.0005515163647942245, 0.0006873017409816384 ]

[ "Eyal Hertzog\n\nEyal Hertzog, Bancor’s Chief Architect and Head of Product Development, is a serial entrepreneur. ", "The Bancor protocol enables built-in price discovery and a liquidity mechanism for tokens on smart contract blockchains. ", "These “smart tokens” hold one or more other tokens in reserve and enable any party to instantly purchase or liquidate the smart token in exchange for any of its reserve tokens, directly through the smart token’s contract, at a continuously calculated price, according to a formula which balances buy and sell volumes.", "\nPreviously he was co-founder of Metacafe, a place where artists create, consumers interact and technology enables communication. ", "Prior to co-founding Metacafe, Mr. Hertzog co-founded Contact Networks in 1998, one of the first interpersonal, professional online networks. ", "At Contact Networks, he was responsible for overall product strategy and overall technical architecture, and managed strategic relationships with Nokia, GemPlus, Comverse and other large partners. ", "He has also advised US and Israeli high-tech startups on strategy, product roadmaps and technology architecture, and worked with Israeli venture capital firm Millennium Capital Venture as an investment advisor." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0015086635248735547, 0.0006126640946604311, 0.0006793765351176262, 0.0006330147152766585, 0.0006559610483236611, 0.0005649388185702264, 0.0005466009606607258 ]

[ "Pumping music and hundreds of sweating individuals, the intensity and energy is at a max. ", "Team that with FIVE rooms of workouts, lectures and workshops, and you are guaranteed to go away with a bunch of new ideas and the motivation to strive for the best that you can be.", "\n\nThis is where you choose your weekend experience! ", "Choose wisely and come back and change your mind any time.... but session slots numbers are restricted so if you dont get your first choice, you may be able to go into the standby line for your session on the day.", "\n\nFatima Batook\n\nTalk to me about an opportunity to redistribute TIMA sport apparel for women at your facility www.timalovelife.com, want to a change of career and move to Saudi to train and inspire women then please do let me know!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005698057939298451, 0.0005945042939856648, 0.0008712389972060919, 0.0005949920741841197, 0.0008268738747574389 ]

[ "Meet the Man Who Makes Your Favorite Announcer Sound Smarter Sports fans have been led to believe that the broadcast booth is typically occupied by just two people—play-by-play announcer and former player analyst. ", "But there’s more happening inside the booth than we see." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006333481287583709, 0.0008730789413675666 ]

[ "娛\n" ]

{ "pile_set_name": "Github" }

[ 0.005230687092989683 ]

[ "Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.", "\nWe report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. ", "The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. ", "We also discuss the current literature on fusion procedures for isthmic spondylolisthesis." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007612992776557803, 0.0010529947467148304, 0.001971677877008915, 0.0005659468588419259 ]

[ "Efficacy of quantifying melanosome transfer with flow cytometry in a human melanocyte-HaCaT keratinocyte co-culture system in vitro.", "\nIn this study, we describe a simple, specific, reproducible and quantitative assay system to assess melanosome transfer. ", "We first established a co-culture model of normal human epidermal melanocytes and HaCaT keratinocytes. ", "The cells were co-cultured for 72 h in a serum-free keratinocyte growth media and double labelled with Fluorescein isothiocyanate (FITC)-conjugated antibody against the melanosome-specific protein gp100, and with Phycoerythrin (PE)-conjugated antibody against the keratinocyte-specific marker cytokeratin. ", "Then, the cells were examined using co-focal microscope and flow cytometry. ", "The increased melanosome transfer from melanocytes to HaCaT keratinocytes was observed in a time-dependent manner. ", "To verify the accessibility of this method, two known melanosome transfer inhibitors and two known melanosome transfer stimulators were applied. ", "Consistent with previous investigation, soybean trypsin inhibitor (STI), niacinamide inhibited melanosome transfer, alpha-melanocyte stimulating hormone (alpha-MSH) and keratinocyte growth factor (KGF) increased melanosome transfer, respectively, in a dose-dependent manner. ", "The model used in this study could thus represent a rapid and reliable tool to identify modulators of human melanosome transfer." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007078068447299302, 0.0006484551704488695, 0.001271912595257163, 0.0007489655981771648, 0.0005535571835935116, 0.0006351140327751637, 0.0006634715246036649, 0.0007553108735010028, 0.0006727409199811518 ]

[ "Q:\n\nCan I use ruby's .map but also pass in an argument?", "\n\nI have an array of integers, floats, and booleans. ", "I want to convert all the elements to floats.", "\nIf it were only integers and floats, I could do something like:\nmy_array.map(&:to_f)\n\nHowever, the booleans complicate this.", "\nI can write a function like this:\ndef my_object_to_float(var)\n if(var.is_a?(Integer))\n return var.to_f\n elsif(var.is_a?(Float))\n return var\n else\n return var ? ", "1.0 : 0.0\n end\nend\n\nBut is there any way to call this function from map like so:\nmy_array.map(&:my_object_to_float)\n\nA:\n\nYes.", "\n> my_array.map(&method(:my_object_to_float))\n\nAnd it can be cleaner, e.g.,\ndef object_to_float(var)\n if var.is_a?(Integer)\n var.to_f\n elsif var.is_a?(Float)\n var\n else\n var ? ", "1.0 : 0.0\n end\nend\n\n> a = [1, 2.0, true, false]\n> puts a.map(&method(:object_to_float))\n1.0\n2.0\n1.0\n0.0\n\nYou could also just check to see if the object responds to to_f and use whatever is already defined, and use truthiness for the remaining types that don't, e.g.,\ndef object_to_float(obj)\n obj.respond_to?(:to_f) ? ", "obj.to_f : obj ? ", "1.0 : 0.0\nend\n\nOf course, nested ternaries are bad.", "\n\nA:\n\nYour code could be a bit cleaner with a case statement and a lambda:\nobject_to_float = lambda { |x|\n case x\n when Float then x\n when Numeric then x.to_f\n when true then 1.0\n else 0.0\n end\n}\n\np [1, 2, true, false, nil, 3.0].map(&object_to_float)\n# [1.0, 2.0, 1.0, 0.0, 0.0, 3.0]\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0010687399189919233, 0.0006681825034320354, 0.0007770652882754803, 0.0006897624116390944, 0.0024115683045238256, 0.001085501629859209, 0.0010468384716659784, 0.0010236542439088225, 0.007313467096537352, 0.008523669093847275, 0.0010506575927138329 ]

[ "Q:\n\nHow to check is there any date between two dates in javascript?", "\n\nOk, so I have a date when feeding started:\n\n**vm.feedFreqDate = 2020-07-06**\n\nand date when something is created, it's vm.createdDate\n**vm.createdDate = 2020-07-01**\n\nIs there any function i can check if there is other vm.feedFreqDate between them?", "\nSorry for lack of code\n\nA:\n\nYou could just use the Date constructor to parse your data format into timestamp, so you could easily just compare numbers instead.", "\n\nconst startDate = \"2020-07-01\"\nconst endDate = \"2020-07-06\"\n\nfunction isBetween(start, end, date){\n const startTimestamp = new Date(start).getTime();\n const endTimestamp = new Date(end).getTime();\n const dateTimestamp = new Date(date).getTime();\n\n return startTimestamp < dateTimestamp && endTimestamp > dateTimestamp;\n}\n\nconsole.log(isBetween(startDate, endDate, \"2020-06-06\")) // before, expected false\nconsole.log(isBetween(startDate, endDate, \"2020-07-03\")) // between, expected true\nconsole.log(isBetween(startDate, endDate, \"2020-08-01\")) // after, expected false\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006655037868767977, 0.0006701062084175646, 0.0005874393973499537, 0.000875081226695329 ]

[ "Get breaking news alerts and special reports. ", "The news and stories that matter, delivered weekday mornings.", "\n\nA Texas mother who shot her two daughters­­ to death on her husband’s birthday last week had called “a family meeting” before the shootout, authorities said Monday.", "\n\nChristy Sheats, 42, was then killed by a police officer after she allegedly refused to drop a .38-caliber handgun.", "\n\nInvestigators with Fort Bend County Sheriff's Office said Christy Sheats, 42, shot and killed her daughters, Taylor Sheats, 22, and Madison Sheats, 17. ", "via Facebook\n\nIn a statement, the Fort Bend County Sheriff’s Office said that on Friday afternoon, Christy gathered her children — 22-year-old Taylor and 17-year-old Madison — and her husband, Jason, who had just turned 45, in the living room of their Katy, Texas, home, west of Houston.", "\n\n“During that meeting, Christy Sheats held up a gun and shot both girls,” the statement said.", "\n\nThe girls and their father fled, though Madison soon collapsed and died, according to the statement. ", "Jason raced to the end of a cul-de-sac, while Taylor ran into the street.", "\n\nMadison Sheats via Facebook\n\nLet our news meet your inbox. ", "The news and stories that matters, delivered weekday mornings. ", "This site is protected by recaptcha\n\nChristy then chased after Taylor, shooting her again, before returning home and reloading, the statement added.", "\n\n“Christy Sheats returned and shot Taylor once more,” it said.", "\n\nTaylor later died at a local hospital. ", "Jason was not injured, NBC affiliate KPRC reported.", "\n\nA responding deputy and police officer found the girls lying in the street and Sheats with a gun in her hand.", "\n\n“We heard the dad say, 'Don't do this. ", "They're our kids,'” a neighbor, Fazz Zainuddin, told KPRC.", "\n\nHe added that police were stationed behind trees and cars and told Sheats to put the gun down.", "\n\n\"Obviously she did not,” Zainuddin told KPRC.", "\n\nTaylor Sheats via Facebook\n\nPolice do not know what the motive for the shooting was. ", "Fort Bend County Sheriff's Office spokeswoman Caitilin Espinosa told NBC News that Jason Sheats is cooperating with the investigation.", "\n\nA LinkedIn page for Sheats lists her profession as a business manager at Clean Canvas Laser, a tattoo removal shop in Houston.", "\n\nJohn Hollis, owner of Clean Canvas Laser, a tattoo removal clinic in Houston, told NBC News Christy Sheats worked for him from January 2015 to May 2015 as a part-time receptionist. ", "He said she was having some troubles at home at the time.", "\n\n\"She was separated and she lived in an apartment, and her husband and daughters lived in the home that they all lived in where the incident happened,\" he said.", "\n\nHollis said he fired Sheats due to \"irregular attendance and things just not adding up. ", "She didn't steal from me or anything, she just seemed to get her facts mixed up.\"", "\n\nHe added that since then, he had repeatedly requested Sheats remove his company from her LinkedIn page as her current employer.", "\n\nThe sheriff’s office said it was called to the Sheats home 14 times, beginning in January 2012. ", "Some were for alarm issues. ", "Police said they have been forbidden from elaborating on the calls due to legal constraints issued by the county attorney.", "\n\nFort Bend County Sheriff Troy E. Nehls called the situation \"a terrible incident\" in a Facebook post a day after the shootings.", "\n\n\"As everyone is certainly aware, we had a terrible incident last night that involved the deaths of 3 people. ", "An unimaginable tragedy that it seems we see too often,\" Nehls wrote. \"", "Keep the family in your prayers.\"" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0009640565258450806, 0.0005951551720499992, 0.04725807160139084, 0.0029170881025493145, 0.020028769969940186, 0.0007712843944318593, 0.03558734059333801, 0.026407068595290184, 0.011605716310441494, 0.0006643605302087963, 0.0005969642661511898, 0.006233701948076487, 0.009979046881198883, 0.001349449623376131, 0.0006841201102361083, 0.008564190939068794, 0.019199810922145844, 0.04631390422582626, 0.019795402884483337, 0.0009386470774188638, 0.0008367677801288664, 0.0007465702365152538, 0.0005772086442448199, 0.0005934730288572609, 0.0006768045132048428, 0.000827991112601012, 0.000761568546295166, 0.0007067136466503143, 0.0006452632369473577, 0.0006006391486153007, 0.0006501218886114657, 0.0006338288076221943, 0.0008866717107594013, 0.00070077960845083, 0.0007782895700074732, 0.0030739607755094767 ]

[ "CHICAGO – The SuperDraft is becoming an afterthought for some MLS teams, but not FC Cincinnati.", "\n\n“We’ve only got 10 picks right now and we’d like to have 11,” head coach Alan Koch deadpanned to a group of journalists at a downtown Chicago hotel on Thursday evening. “", "No, I’m just kidding.”", "\n\nIn addition to holding the No. ", "1 overall pick, the 2019 expansion newcomers have stockpiled selections in Friday’s event, happily cutting against the grain of the draft’s evolution into a less crucial player acquisition mechanism for many of their counterparts. ", "Most notably, they completed an unprecedented transaction with the Philadelphia Union on Wednesday night to acquire all five of Philly’s 2019 SuperDraft picks in exchange for up to $200,000 in General Allocation Money.", "\n\n“As you’re going through the draft, much of this is chance and I think there’s always the opportunity that a player maybe didn’t have a good showing at the Combine and slips for some reason, maybe he’s an international player, maybe he’s a player we pick up and own his MLS rights for two years and maybe he develops in a different way and comes back,” FCC technical director Luke Sassano told MLSsoccer.com on Thursday.", "\n\n“So I think it just gives a unique and kind of unorthodox way of approaching the draft, probably something that for us, as an expansion team without Homegrown Players … is kind of a unique circumstance.”", "\n\nThe Orange and Blue have their inaugural MLS roster to fill out in the coming months, and lack the academy or USL side that others can lean on for that task.", "\n\n\"We are very determined to use this historic draft opportunity to get a jumpstart on building for the future.”", "\n\n\n\n- @JeffBerding on #FCCincy's trades for @MLS #SuperDraft picks.", "\n\n\n\n📰: https://t.co/p5HQ2WGJx7 pic.twitter.com/28ga2EKi1v — FC Cincinnati (@fccincinnati) January 10, 2019\n\nBut Koch, who played a key role in the development of Vancouver Whitecaps Homegrown phenom Alphonso Davies in his previous gig as coach of that club’s since-shuttered USL team, has a track record of spotting and grooming talent, and feels confident of doing the same with many of those in this year’s draft class. ", "Cincinnati built a substantial domestic scouting department last year and Koch believes as many as 16 SuperDraft contenders have the potential to become MLS regulars.", "\n\n“I would classify the majority of the players in this draft as projects, and I think that’s a huge positive. ", "We’re trying to find the players that we think have a high ceiling,” said Koch.", "\n\n“A lot of the players that get picked up in the draft really are coming on trial when they come in, but we’re excited to embrace them and bring them into the family and work with these guys as much as possible to set our club up for success.”", "\n\nCincy have not yet selected a USL affiliate club and may not do so at all this season. ", "With ample knowledge and contacts around the league that they just departed, the coaching staff believe they can arrange individual loan deals with prospects they draft who might not yet be ready for the daily grind of MLS.", "\n\n“We’re having a lot of conversations here. ", "We may have an affiliation or we may just use lots of different teams,” Koch told MLSsoccer.com. “", "In this business, from a development perspective everything is case by case. ", "Every individual develops differently in different ways in different environments.", "\n\n“I go back to my own experiences in Vancouver – we picked Tim Parker in the draft, we picked him with the 13th pick and he ended up being capped by the US national team. ", "So you can find diamonds in the rough in this draft. ", "it’s our goal to try to find one or two of those and set them up for success.”", "\n\nFCC are also prepared for draft-day wheeling and dealing. ", "Koch said there’s “definite interest” from other clubs in acquiring the No. ", "1 pick and Sassano predicted that “our phones are going to be ringing all night,” with both pronouncing themselves ready to listen to offers, even though they’re “very, very comfortable,” in Koch’s words, with their current situation." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.001269733184017241, 0.0005986742326058447, 0.0011525122681632638, 0.0009350377949886024, 0.0006275946507230401, 0.0007113736937753856, 0.0006143993232399225, 0.0006356763187795877, 0.0006621349602937698, 0.0018485571490600705, 0.0006252212915569544, 0.0008997039985843003, 0.0007084925309754908, 0.0005611537490040064, 0.0007899502525106072, 0.0005578577402047813, 0.0006304850103333592, 0.0005500721163116395, 0.0005768000264652073, 0.0005846869898959994, 0.0005745331291109324, 0.0005693462444469333, 0.0006456224946305156, 0.0007011773996055126, 0.0005898592062294483, 0.0005383159732446074, 0.0007261895225383341, 0.0006157133029773831 ]

[ "Invandrare drabbas av vänsterns ”fina” rasism\n\nDebattören: Måste vi med invandrarbakgrund vara särskilt lojala mot vänstern?", "\n\nPublicerad: 27 maj 2019\n\nDetta är en debattartikel. ", "Det är skribenten som står för åsikterna som förs fram i texten, inte Aftonbladet.", "\n\nHög kriminalitet är väldigt ofta kopplad till en totalt misslyckad integrationspolitik. ", "När jag presenterat åtgärder jag genuint tror på, har jag blivit bemött av vänsterns vrede och fina rasism. ", "Förminskande i form av att jag inte vet vad jag egentligen tycker, skriver Hussein Salim, representant för moderata studenter Uppsala. ", "Visa mer Foto: TT\n\nDEBATT. ", "Med valet i sikte har samtliga partier påbörjat sitt kampanjande. ", "I varje gatuhörn ser vi valaffischerna som ska tala till opinionen. ", "Den här gången med en undergångskänsla som nästan går att klå förra valet.", "\n\nAnnie Lööf ser bestämd ut med klar blick, hon ska än en gång ta kampen mot högerpopulism. ", "Jonas Sjöstedt är inte sämre, mitt under pågående debatt i SVT vädjar han till väljarna att inte ge makt åt rasisterna. ", "Löfven står med ena foten vid dörren. ", "Han kan inte riktigt bestämma sig. ", "Ska han skryta den här gången om hur många asylsökande som åkt tillbaka till sina hemländer under hans tid eller ska han försöka avskräcka väljare från att rösta på en gedigen opposition genom att använda epitet som \"rasist\" och \"högerextremist\".", "\n\nAtt vänstern skrämmer oliktänkande med dessa ordval är varken nytt eller unikt för Sverige. ", "Det har alltid varit en del av tonen från den politiska vänstern. ", "Det som däremot förvånar är hur vi av invandrarbakgrund år efter år fortsätter köpa detta narrativ av att vänstern är de goda och högern de onda. ", "Ett narrativ som enbart vill pressa oss till att ge våra röster i utbyte mot en meningslös identitetspolitik.", "\n\nVi har en pågående nationell kris i våra förorter som behöver omedelbar sakpolitik. ", "En kris i form av hög kriminalitet som väldigt ofta är kopplad till en totalt misslyckad integrationspolitik. ", "Då hjälper det inte att Löfven håller första majtal om hur M och KD ska akta sig från de högerextrema.", "\n\nDet som behövs för att lösa krisen är fler poliser, mer kameraövervakning, ett bidragstak så att människor väljer jobb framför bidrag, samt längre straff för de gängkriminella så att de inte längre ges möjligheten att värva nya unga till det kriminella livet. ", "Slutligen behövs det en stram migrationspolitisk för att man överhuvudtaget ska ha en chans att integrera de människor som har invandrat till Sverige. ", "Socioekonomisk bakgrund och ungdomskriminalitet hör ihop.", "\n\nNär jag presenterat åtgärder som dessa, vilket är åtgärder jag genuint tror på, har jag blivit bemött av vänsterns vrede och fina rasism. ", "Förminskande i form av att jag inte vet vad jag egentligen tycker, att jag blivit manipulerad av den onda högern och jag istället bör känna tacksamhet. ", "Vi av invandrarbakgrund ska alltså ha en särskild lojalitet till vänstern, annars är vi \"otacksamma\". ", "Hur ska jag kunna känna tacksamhet för ett system som klart inte fungerar?", "\n\nSverige har inte och har aldrig haft en fungerande integrationspolitik. ", "De vänsterliberala partierna har varit upptagna med att tävla i vem som kan vara mest antirasist och locka flest röster från Sveriges utsatta förorter. ", "Målet för integration är så pass lågt bland vänstern att man nu knappt ens bemödar sig med att kampanja på svenska i dessa områden, istället trycker man ut affischer på arabiska där man varnar för högern.", "\n\nHade vänstern dock varit så tolerant som man påstår sig att vara, hade man inte haft antagandet att alla med invandrarbakgrund tänker eller ska tänka lika. ", "Faktum är att det är en hel del som tänker olika från vänstern. ", "Dessa personer är inte ”manipulerade”, ”oförstådda” eller ”otacksamma” som vänstern vill referera till dem som. ", "De är fritänkande individer som vaknat upp från vänsterns narrativ. ", "De vill inte längre bli placerade i den lilla box där man måste tänka som vänstern – annars får man den ”fina” rasismen mot sig. ", "De har sett problemen och vill ha en politik nu som lägger fokus på att skapa förändring, den förändringen kan endast högern stå för.", "\n\n\n\nHussein Salim, representant för moderata studenter Uppsala\n\n\n\nHäng med i debatten och kommentera artikeln\n\n– gilla Aftonbladet Debatt på Facebook.", "\n\nPublisert: Publicerad: 27 maj 2019 kl. ", "04.00" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.05089912191033363, 0.0031672162003815174, 0.027576815336942673, 0.21081595122814178, 0.6089454889297485, 0.04213650897145271, 0.0012355090584605932, 0.14275449514389038, 0.09521312266588211, 0.10248235613107681, 0.1693931370973587, 0.15327401459217072, 0.014828786253929138, 0.11966059356927872, 0.23505958914756775, 0.05130143091082573, 0.062485311180353165, 0.10507087409496307, 0.17392286658287048, 0.15111182630062103, 0.21860572695732117, 0.24186715483665466, 0.2848545014858246, 0.2791610360145569, 0.25672343373298645, 0.5436365604400635, 0.5797707438468933, 0.027704589068889618, 0.09995651245117188, 0.05006619170308113, 0.10929734259843826, 0.3718445599079132, 0.16304418444633484, 0.41904932260513306, 0.06556624919176102, 0.07905878871679306, 0.47855064272880554, 0.4722042381763458, 0.015002990141510963, 0.001017419621348381, 0.0010923403315246105 ]

[ "/*\n * This program is free software; you can redistribute it and/or\n * modify it under the terms of the GNU General Public License\n * as published by the Free Software Foundation; either version 2\n * of the License, or (at your option) any later version.", "\n *\n * This program is distributed in the hope that it will be useful,\n * but WITHOUT ANY WARRANTY; without even the implied warranty of\n * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", " See the\n * GNU General Public License for more details.", "\n *\n * You should have received a copy of the GNU General Public License\n * along with this program; if not, write to the Free Software Foundation,\n * Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.", "\n *\n * The Original Code is Copyright (C) 2009 Blender Foundation, Joshua Leung\n * All rights reserved.", "\n */\n\n/** \\file\n * \\ingroup edanimation\n */\n\n/* System includes ----------------------------------------------------- */\n\n#include <float.h>\n#include <math.h>\n#include <stdlib.h>\n#include <string.h>\n\n#include \"MEM_guardedalloc.h\"\n\n#include \"BLI_dlrbTree.h\"\n#include \"BLI_listbase.h\"\n#include \"BLI_math.h\"\n#include \"BLI_rect.h\"\n#include \"BLI_utildefines.h\"\n\n#include \"DNA_anim_types.h\"\n#include \"DNA_brush_types.h\"\n#include \"DNA_cachefile_types.h\"\n#include \"DNA_gpencil_types.h\"\n#include \"DNA_mask_types.h\"\n#include \"DNA_object_types.h\"\n#include \"DNA_scene_types.h\"\n\n#include \"BKE_fcurve.h\"\n\n#include \"GPU_immediate.h\"\n#include \"GPU_state.h\"\n\n#include \"UI_resources.h\"\n#include \"UI_view2d.h\"\n\n#include \"ED_anim_api.h\"\n#include \"ED_keyframes_draw.h\"\n\n/* *************************** Keyframe Processing *************************** */\n\n/* ActKeyColumns (Keyframe Columns) ------------------------------------------ */\n\nBLI_INLINE bool is_cfra_eq(float a, float b)\n{\n return IS_EQT(a, b, BEZT_BINARYSEARCH_THRESH);\n}\n\nBLI_INLINE bool is_cfra_lt(float a, float b)\n{\n return (b - a) > BEZT_BINARYSEARCH_THRESH;\n}\n\n/* Comparator callback used for ActKeyColumns and cframe float-value pointer */\n/* NOTE: this is exported to other modules that use the ActKeyColumns for finding keyframes */\nshort compare_ak_cfraPtr(void *node, void *data)\n{\n ActKeyColumn *ak = (ActKeyColumn *)node;\n const float *cframe = data;\n float val = *cframe;\n\n if (is_cfra_eq(val, ak->cfra)) {\n return 0;\n }\n\n if (val < ak->cfra) {\n return -1;\n }\n return 1;\n}\n\n/* --------------- */\n\n/* Set of references to three logically adjacent keys. */", "\ntypedef struct BezTripleChain {\n /* Current keyframe. */", "\n BezTriple *cur;\n\n /* Logical neighbors. ", "May be NULL. */", "\n BezTriple *prev, *next;\n} BezTripleChain;\n\n/* Categorize the interpolation & handle type of the keyframe. */", "\nstatic eKeyframeHandleDrawOpts bezt_handle_type(BezTriple *bezt)\n{\n if (bezt->h1 == HD_AUTO_ANIM && bezt->h2 == HD_AUTO_ANIM) {\n return KEYFRAME_HANDLE_AUTO_CLAMP;\n }\n if (ELEM(bezt->h1, HD_AUTO_ANIM, HD_AUTO) && ELEM(bezt->h2, HD_AUTO_ANIM, HD_AUTO)) {\n return KEYFRAME_HANDLE_AUTO;\n }\n if (bezt->h1 == HD_VECT && bezt->h2 == HD_VECT) {\n return KEYFRAME_HANDLE_VECTOR;\n }\n if (ELEM(HD_FREE, bezt->h1, bezt->h2)) {\n return KEYFRAME_HANDLE_FREE;\n }\n return KEYFRAME_HANDLE_ALIGNED;\n}\n\n/* Determine if the keyframe is an extreme by comparing with neighbors.", "\n * Ends of fixed-value sections and of the whole curve are also marked.", "\n */\nstatic eKeyframeExtremeDrawOpts bezt_extreme_type(BezTripleChain *chain)\n{\n if (chain->prev == NULL && chain->next == NULL) {\n return KEYFRAME_EXTREME_NONE;\n }\n\n /* Keyframe values for the current one and neighbors. */", "\n float cur_y = chain->cur->vec[1][1];\n float prev_y = cur_y, next_y = cur_y;\n\n if (chain->prev && !", "IS_EQF(cur_y, chain->prev->vec[1][1])) {\n prev_y = chain->prev->vec[1][1];\n }\n if (chain->next && !", "IS_EQF(cur_y, chain->next->vec[1][1])) {\n next_y = chain->next->vec[1][1];\n }\n\n /* Static hold. */", "\n if (prev_y == cur_y && next_y == cur_y) {\n return KEYFRAME_EXTREME_FLAT;\n }\n\n /* Middle of an incline. */", "\n if ((prev_y < cur_y && next_y > cur_y) || (prev_y > cur_y && next_y < cur_y)) {\n return KEYFRAME_EXTREME_NONE;\n }\n\n /* Bezier handle values for the overshoot check. */", "\n bool l_bezier = chain->prev && chain->prev->ipo == BEZT_IPO_BEZ;\n bool r_bezier = chain->next && chain->cur->ipo == BEZT_IPO_BEZ;\n float handle_l = l_bezier ? ", "chain->cur->vec[0][1] : cur_y;\n float handle_r = r_bezier ? ", "chain->cur->vec[2][1] : cur_y;\n\n /* Detect extremes. ", "One of the neighbors is allowed to be equal to current. */", "\n if (prev_y < cur_y || next_y < cur_y) {\n bool is_overshoot = (handle_l > cur_y || handle_r > cur_y);\n\n return KEYFRAME_EXTREME_MAX | (is_overshoot ? ", "KEYFRAME_EXTREME_MIXED : 0);\n }\n\n if (prev_y > cur_y || next_y > cur_y) {\n bool is_overshoot = (handle_l < cur_y || handle_r < cur_y);\n\n return KEYFRAME_EXTREME_MIN | (is_overshoot ? ", "KEYFRAME_EXTREME_MIXED : 0);\n }\n\n return KEYFRAME_EXTREME_NONE;\n}\n\n/* Comparator callback used for ActKeyColumns and BezTripleChain */\nstatic short compare_ak_bezt(void *node, void *data)\n{\n BezTripleChain *chain = data;\n\n return compare_ak_cfraPtr(node, &chain->cur->vec[1][0]);\n}\n\n/* New node callback used for building ActKeyColumns from BezTripleChain */\nstatic DLRBT_Node *nalloc_ak_bezt(void *data)\n{\n ActKeyColumn *ak = MEM_callocN(sizeof(ActKeyColumn), \"ActKeyColumn\");\n BezTripleChain *chain = data;\n BezTriple *bezt = chain->cur;\n\n /* store settings based on state of BezTriple */\n ak->cfra = bezt->vec[1][0];\n ak->sel = BEZT_ISSEL_ANY(bezt) ? ", "SELECT : 0;\n ak->key_type = BEZKEYTYPE(bezt);\n ak->handle_type = bezt_handle_type(bezt);\n ak->extreme_type = bezt_extreme_type(chain);\n\n /* count keyframes in this column */\n ak->totkey = 1;\n\n return (DLRBT_Node *)ak;\n}\n\n/* Node updater callback used for building ActKeyColumns from BezTripleChain */\nstatic void nupdate_ak_bezt(void *node, void *data)\n{\n ActKeyColumn *ak = node;\n BezTripleChain *chain = data;\n BezTriple *bezt = chain->cur;\n\n /* set selection status and 'touched' status */\n if (BEZT_ISSEL_ANY(bezt)) {\n ak->sel = SELECT;\n }\n\n /* count keyframes in this column */\n ak->totkey++;\n\n /* For keyframe type, 'proper' keyframes have priority over breakdowns\n * (and other types for now). */", "\n if (BEZKEYTYPE(bezt) == BEZT_KEYTYPE_KEYFRAME) {\n ak->key_type = BEZT_KEYTYPE_KEYFRAME;\n }\n\n /* For interpolation type, select the highest value (enum is sorted). */", "\n ak->handle_type = MAX2(ak->handle_type, bezt_handle_type(bezt));\n\n /* For extremes, detect when combining different states. */", "\n char new_extreme = bezt_extreme_type(chain);\n\n if (new_extreme !", "= ak->extreme_type) {\n /* Replace the flat status without adding mixed. */", "\n if (ak->extreme_type == KEYFRAME_EXTREME_FLAT) {\n ak->extreme_type = new_extreme;\n }\n else if (new_extreme !", "= KEYFRAME_EXTREME_FLAT) {\n ak->extreme_type |= (new_extreme | KEYFRAME_EXTREME_MIXED);\n }\n }\n}\n\n/* ......... */\n\n/* Comparator callback used for ActKeyColumns and GPencil frame */\nstatic short compare_ak_gpframe(void *node, void *data)\n{\n bGPDframe *gpf = (bGPDframe *)data;\n\n float frame = gpf->framenum;\n return compare_ak_cfraPtr(node, &frame);\n}\n\n/* New node callback used for building ActKeyColumns from GPencil frames */\nstatic DLRBT_Node *nalloc_ak_gpframe(void *data)\n{\n ActKeyColumn *ak = MEM_callocN(sizeof(ActKeyColumn), \"ActKeyColumnGPF\");\n bGPDframe *gpf = (bGPDframe *)data;\n\n /* store settings based on state of BezTriple */\n ak->cfra = gpf->framenum;\n ak->sel = (gpf->flag & GP_FRAME_SELECT) ? ", "SELECT : 0;\n ak->key_type = gpf->key_type;\n\n /* count keyframes in this column */\n ak->totkey = 1;\n\n return (DLRBT_Node *)ak;\n}\n\n/* Node updater callback used for building ActKeyColumns from GPencil frames */\nstatic void nupdate_ak_gpframe(void *node, void *data)\n{\n ActKeyColumn *ak = (ActKeyColumn *)node;\n bGPDframe *gpf = (bGPDframe *)data;\n\n /* set selection status and 'touched' status */\n if (gpf->flag & GP_FRAME_SELECT) {\n ak->sel = SELECT;\n }\n\n /* count keyframes in this column */\n ak->totkey++;\n\n /* for keyframe type, 'proper' keyframes have priority over breakdowns\n * (and other types for now). */", "\n if (gpf->key_type == BEZT_KEYTYPE_KEYFRAME) {\n ak->key_type = BEZT_KEYTYPE_KEYFRAME;\n }\n}\n\n/* ......... */\n\n/* Comparator callback used for ActKeyColumns and GPencil frame */\nstatic short compare_ak_masklayshape(void *node, void *data)\n{\n MaskLayerShape *masklay_shape = (MaskLayerShape *)data;\n\n float frame = masklay_shape->frame;\n return compare_ak_cfraPtr(node, &frame);\n}\n\n/* New node callback used for building ActKeyColumns from GPencil frames */\nstatic DLRBT_Node *nalloc_ak_masklayshape(void *data)\n{\n ActKeyColumn *ak = MEM_callocN(sizeof(ActKeyColumn), \"ActKeyColumnGPF\");\n MaskLayerShape *masklay_shape = (MaskLayerShape *)data;\n\n /* store settings based on state of BezTriple */\n ak->cfra = masklay_shape->frame;\n ak->sel = (masklay_shape->flag & MASK_SHAPE_SELECT) ? ", "SELECT : 0;\n\n /* count keyframes in this column */\n ak->totkey = 1;\n\n return (DLRBT_Node *)ak;\n}\n\n/* Node updater callback used for building ActKeyColumns from GPencil frames */\nstatic void nupdate_ak_masklayshape(void *node, void *data)\n{\n ActKeyColumn *ak = (ActKeyColumn *)node;\n MaskLayerShape *masklay_shape = (MaskLayerShape *)data;\n\n /* set selection status and 'touched' status */\n if (masklay_shape->flag & MASK_SHAPE_SELECT) {\n ak->sel = SELECT;\n }\n\n /* count keyframes in this column */\n ak->totkey++;\n}\n\n/* --------------- */\n\n/* Add the given BezTriple to the given 'list' of Keyframes */\nstatic void add_bezt_to_keycolumns_list(DLRBT_Tree *keys, BezTripleChain *bezt)\n{\n if (ELEM(NULL, keys, bezt)) {\n return;\n }\n\n BLI_dlrbTree_add(keys, compare_ak_bezt, nalloc_ak_bezt, nupdate_ak_bezt, bezt);\n}\n\n/* Add the given GPencil Frame to the given 'list' of Keyframes */\nstatic void add_gpframe_to_keycolumns_list(DLRBT_Tree *keys, bGPDframe *gpf)\n{\n if (ELEM(NULL, keys, gpf)) {\n return;\n }\n\n BLI_dlrbTree_add(keys, compare_ak_gpframe, nalloc_ak_gpframe, nupdate_ak_gpframe, gpf);\n}\n\n/* Add the given MaskLayerShape Frame to the given 'list' of Keyframes */\nstatic void add_masklay_to_keycolumns_list(DLRBT_Tree *keys, MaskLayerShape *masklay_shape)\n{\n if (ELEM(NULL, keys, masklay_shape)) {\n return;\n }\n\n BLI_dlrbTree_add(keys,\n compare_ak_masklayshape,\n nalloc_ak_masklayshape,\n nupdate_ak_masklayshape,\n masklay_shape);\n}\n\n/* ActKeyBlocks (Long Keyframes) ------------------------------------------ */\n\nstatic const ActKeyBlockInfo dummy_keyblock = {0};\n\nstatic void compute_keyblock_data(ActKeyBlockInfo *info, BezTriple *prev, BezTriple *beztn)\n{\n memset(info, 0, sizeof(ActKeyBlockInfo));\n\n if (BEZKEYTYPE(beztn) == BEZT_KEYTYPE_MOVEHOLD) {\n /* Animator tagged a \"moving hold\"\n * - Previous key must also be tagged as a moving hold, otherwise\n * we're just dealing with the first of a pair, and we don't\n * want to be creating any phantom holds...\n */\n if (BEZKEYTYPE(prev) == BEZT_KEYTYPE_MOVEHOLD) {\n info->flag |= ACTKEYBLOCK_FLAG_MOVING_HOLD | ACTKEYBLOCK_FLAG_ANY_HOLD;\n }\n }\n\n /* Check for same values...\n * - Handles must have same central value as each other\n * - Handles which control that section of the curve must be constant\n */\n if (IS_EQF(beztn->vec[1][1], prev->vec[1][1])) {\n bool hold;\n\n /* Only check handles in case of actual bezier interpolation. */", "\n if (prev->ipo == BEZT_IPO_BEZ) {\n hold = IS_EQF(beztn->vec[1][1], beztn->vec[0][1]) &&\n IS_EQF(prev->vec[1][1], prev->vec[2][1]);\n }\n /* This interpolation type induces movement even between identical keys. */", "\n else {\n hold = !", "ELEM(prev->ipo, BEZT_IPO_ELASTIC);\n }\n\n if (hold) {\n info->flag |= ACTKEYBLOCK_FLAG_STATIC_HOLD | ACTKEYBLOCK_FLAG_ANY_HOLD;\n }\n }\n\n /* Remember non-bezier interpolation info. */", "\n if (prev->ipo !", "= BEZT_IPO_BEZ) {\n info->flag |= ACTKEYBLOCK_FLAG_NON_BEZIER;\n }\n\n info->sel = BEZT_ISSEL_ANY(prev) || BEZT_ISSEL_ANY(beztn);\n}\n\nstatic void add_keyblock_info(ActKeyColumn *col, const ActKeyBlockInfo *block)\n{\n /* New curve and block. */", "\n if (col->totcurve <= 1 && col->totblock == 0) {\n memcpy(&col->block, block, sizeof(ActKeyBlockInfo));\n }\n /* Existing curve. */", "\n else {\n col->block.conflict |= (col->block.flag ^ block->flag);\n col->block.flag |= block->flag;\n col->block.sel |= block->sel;\n }\n\n if (block->flag) {\n col->totblock++;\n }\n}\n\nstatic void add_bezt_to_keyblocks_list(DLRBT_Tree *keys, BezTriple *bezt, int bezt_len)\n{\n ActKeyColumn *col = keys->first;\n\n if (bezt && bezt_len >= 2) {\n ActKeyBlockInfo block;\n\n /* Find the first key column while inserting dummy blocks. */", "\n for (; col !", "= NULL && is_cfra_lt(col->cfra, bezt[0].vec[1][0]); col = col->next) {\n add_keyblock_info(col, &dummy_keyblock);\n }\n\n BLI_assert(col !", "= NULL);\n\n /* Insert real blocks. */", "\n for (int v = 1; col !", "= NULL && v < bezt_len; v++, bezt++) {\n /* Wrong order of bezier keys: resync position. */", "\n if (is_cfra_lt(bezt[1].vec[1][0], bezt[0].vec[1][0])) {\n /* Backtrack to find the right location. */", "\n if (is_cfra_lt(bezt[1].vec[1][0], col->cfra)) {\n ActKeyColumn *newcol = (ActKeyColumn *)BLI_dlrbTree_search_exact(\n keys, compare_ak_cfraPtr, &bezt[1].vec[1][0]);\n\n if (newcol !", "= NULL) {\n col = newcol;\n\n /* The previous keyblock is garbage too. */", "\n if (col->prev !", "= NULL) {\n add_keyblock_info(col->prev, &dummy_keyblock);\n }\n }\n else {\n BLI_assert(false);\n }\n }\n\n continue;\n }\n\n /* Normal sequence */\n BLI_assert(is_cfra_eq(col->cfra, bezt[0].vec[1][0]));\n\n compute_keyblock_data(&block, bezt, bezt + 1);\n\n for (; col !", "= NULL && is_cfra_lt(col->cfra, bezt[1].vec[1][0]); col = col->next) {\n add_keyblock_info(col, &block);\n }\n\n BLI_assert(col !", "= NULL);\n }\n }\n\n /* Insert dummy blocks at the end. */", "\n for (; col !", "= NULL; col = col->next) {\n add_keyblock_info(col, &dummy_keyblock);\n }\n}\n\n/* Walk through columns and propagate blocks and totcurve.", "\n *\n * This must be called even by animation sources that don't generate\n * keyblocks to keep the data structure consistent after adding columns.", "\n */\nstatic void update_keyblocks(DLRBT_Tree *keys, BezTriple *bezt, int bezt_len)\n{\n /* Recompute the prev/next linked list. */", "\n BLI_dlrbTree_linkedlist_sync(keys);\n\n /* Find the curve count */\n int max_curve = 0;\n\n LISTBASE_FOREACH (ActKeyColumn *, col, keys) {\n max_curve = MAX2(max_curve, col->totcurve);\n }\n\n /* Propagate blocks to inserted keys */\n ActKeyColumn *prev_ready = NULL;\n\n LISTBASE_FOREACH (ActKeyColumn *, col, keys) {\n /* Pre-existing column. */", "\n if (col->totcurve > 0) {\n prev_ready = col;\n }\n /* Newly inserted column, so copy block data from previous. */", "\n else if (prev_ready !", "= NULL) {\n col->totblock = prev_ready->totblock;\n memcpy(&col->block, &prev_ready->block, sizeof(ActKeyBlockInfo));\n }\n\n col->totcurve = max_curve + 1;\n }\n\n /* Add blocks on top */\n add_bezt_to_keyblocks_list(keys, bezt, bezt_len);\n}\n\n/* --------- */\n\nbool actkeyblock_is_valid(ActKeyColumn *ac)\n{\n return ac !", "= NULL && ac->next !", "= NULL && ac->totblock > 0;\n}\n\n/* Checks if ActKeyBlock should exist... */\nint actkeyblock_get_valid_hold(ActKeyColumn *ac)\n{\n /* check that block is valid */\n if (!", "actkeyblock_is_valid(ac)) {\n return 0;\n }\n\n const int hold_mask = (ACTKEYBLOCK_FLAG_ANY_HOLD | ACTKEYBLOCK_FLAG_STATIC_HOLD);\n return (ac->block.flag & ~ac->block.conflict) & hold_mask;\n}\n\n/* *************************** Keyframe Drawing *************************** */\n\nvoid draw_keyframe_shape(float x,\n float y,\n float size,\n bool sel,\n short key_type,\n short mode,\n float alpha,\n uint pos_id,\n uint size_id,\n uint color_id,\n uint outline_color_id,\n uint flags_id,\n short handle_type,\n short extreme_type)\n{\n bool draw_fill = ELEM(mode, KEYFRAME_SHAPE_INSIDE, KEYFRAME_SHAPE_BOTH);\n bool draw_outline = ELEM(mode, KEYFRAME_SHAPE_FRAME, KEYFRAME_SHAPE_BOTH);\n\n BLI_assert(draw_fill || draw_outline);\n\n /* tweak size of keyframe shape according to type of keyframe\n * - 'proper' keyframes have key_type = 0, so get drawn at full size\n */\n switch (key_type) {\n case BEZT_KEYTYPE_KEYFRAME: /* must be full size */\n break;\n\n case BEZT_KEYTYPE_BREAKDOWN: /* slightly smaller than normal keyframe */\n size *= 0.85f;\n break;\n\n case BEZT_KEYTYPE_MOVEHOLD: /* Slightly smaller than normal keyframes\n * (but by less than for breakdowns). */", "\n size *= 0.925f;\n break;\n\n case BEZT_KEYTYPE_EXTREME: /* slightly larger */\n size *= 1.2f;\n break;\n\n default:\n size -= 0.8f * key_type;\n }\n\n uchar fill_col[4];\n uchar outline_col[4];\n uint flags = 0;\n\n /* draw! */", "\n if (draw_fill) {\n /* get interior colors from theme (for selected and unselected only) */\n switch (key_type) {\n case BEZT_KEYTYPE_BREAKDOWN: /* bluish frames (default theme) */\n UI_GetThemeColor4ubv(sel ? ", "TH_KEYTYPE_BREAKDOWN_SELECT : TH_KEYTYPE_BREAKDOWN, fill_col);\n break;\n case BEZT_KEYTYPE_EXTREME: /* reddish frames (default theme) */\n UI_GetThemeColor4ubv(sel ? ", "TH_KEYTYPE_EXTREME_SELECT : TH_KEYTYPE_EXTREME, fill_col);\n break;\n case BEZT_KEYTYPE_JITTER: /* greenish frames (default theme) */\n UI_GetThemeColor4ubv(sel ? ", "TH_KEYTYPE_JITTER_SELECT : TH_KEYTYPE_JITTER, fill_col);\n break;\n case BEZT_KEYTYPE_MOVEHOLD: /* similar to traditional keyframes, but different... */\n UI_GetThemeColor4ubv(sel ? ", "TH_KEYTYPE_MOVEHOLD_SELECT : TH_KEYTYPE_MOVEHOLD, fill_col);\n break;\n case BEZT_KEYTYPE_KEYFRAME: /* traditional yellowish frames (default theme) */\n default:\n UI_GetThemeColor4ubv(sel ? ", "TH_KEYTYPE_KEYFRAME_SELECT : TH_KEYTYPE_KEYFRAME, fill_col);\n }\n\n /* NOTE: we don't use the straight alpha from the theme, or else effects such as\n * graying out protected/muted channels doesn't work correctly!", "\n */\n fill_col[3] *= alpha;\n\n if (!", "draw_outline) {\n /* force outline color to match */\n outline_col[0] = fill_col[0];\n outline_col[1] = fill_col[1];\n outline_col[2] = fill_col[2];\n outline_col[3] = fill_col[3];\n }\n }\n\n if (draw_outline) {\n /* exterior - black frame */\n UI_GetThemeColor4ubv(sel ? ", "TH_KEYBORDER_SELECT : TH_KEYBORDER, outline_col);\n outline_col[3] *= alpha;\n\n if (!", "draw_fill) {\n /* fill color needs to be (outline.rgb, 0) */\n fill_col[0] = outline_col[0];\n fill_col[1] = outline_col[1];\n fill_col[2] = outline_col[2];\n fill_col[3] = 0;\n }\n\n /* Handle type to outline shape. */", "\n switch (handle_type) {\n case KEYFRAME_HANDLE_AUTO_CLAMP:\n flags = 0x2;\n break; /* circle */\n case KEYFRAME_HANDLE_AUTO:\n flags = 0x12;\n break; /* circle with dot */\n case KEYFRAME_HANDLE_VECTOR:\n flags = 0xC;\n break; /* square */\n case KEYFRAME_HANDLE_ALIGNED:\n flags = 0x5;\n break; /* clipped diamond */\n\n case KEYFRAME_HANDLE_FREE:\n default:\n flags = 1; /* diamond */\n }\n\n /* Extreme type to arrow-like shading. */", "\n if (extreme_type & KEYFRAME_EXTREME_MAX) {\n flags |= 0x100;\n }\n if (extreme_type & KEYFRAME_EXTREME_MIN) {\n flags |= 0x200;\n }\n if (extreme_type & KEYFRAME_EXTREME_MIXED) {\n flags |= 0x400;\n }\n }\n\n immAttr1f(size_id, size);\n immAttr4ubv(color_id, fill_col);\n immAttr4ubv(outline_color_id, outline_col);\n immAttr1u(flags_id, flags);\n immVertex2f(pos_id, x, y);\n}\n\nstatic void draw_keylist(View2D *v2d,\n DLRBT_Tree *keys,\n float ypos,\n float yscale_fac,\n bool channelLocked,\n int saction_flag)\n{\n const float icon_sz = U.widget_unit * 0.5f * yscale_fac;\n const float half_icon_sz = 0.5f * icon_sz;\n const float smaller_sz = 0.35f * icon_sz;\n const float ipo_sz = 0.1f * icon_sz;\n\n GPU_blend(GPU_BLEND_ALPHA);\n\n /* locked channels are less strongly shown, as feedback for locked channels in DopeSheet */\n /* TODO: allow this opacity factor to be themed? */", "\n float alpha = channelLocked ? ", "0.25f : 1.0f;\n\n /* Show interpolation and handle type? */", "\n bool show_ipo = (saction_flag & SACTION_SHOW_INTERPOLATION) !", "= 0;\n\n /* draw keyblocks */\n if (keys) {\n float sel_color[4], unsel_color[4];\n float sel_mhcol[4], unsel_mhcol[4];\n float ipo_color[4], ipo_color_mix[4];\n\n /* cache colors first */\n UI_GetThemeColor4fv(TH_STRIP_SELECT, sel_color);\n UI_GetThemeColor4fv(TH_STRIP, unsel_color);\n UI_GetThemeColor4fv(TH_DOPESHEET_IPOLINE, ipo_color);\n\n sel_color[3] *= alpha;\n unsel_color[3] *= alpha;\n ipo_color[3] *= alpha;\n\n copy_v4_v4(sel_mhcol, sel_color);\n sel_mhcol[3] *= 0.8f;\n copy_v4_v4(unsel_mhcol, unsel_color);\n unsel_mhcol[3] *= 0.8f;\n copy_v4_v4(ipo_color_mix, ipo_color);\n ipo_color_mix[3] *= 0.5f;\n\n uint block_len = 0;\n LISTBASE_FOREACH (ActKeyColumn *, ab, keys) {\n if (actkeyblock_get_valid_hold(ab)) {\n block_len++;\n }\n if (show_ipo && actkeyblock_is_valid(ab) && (ab->block.flag & ACTKEYBLOCK_FLAG_NON_BEZIER)) {\n block_len++;\n }\n }\n\n if (block_len > 0) {\n GPUVertFormat *format = immVertexFormat();\n uint pos_id = GPU_vertformat_attr_add(format, \"pos\", GPU_COMP_F32, 2, GPU_FETCH_FLOAT);\n uint color_id = GPU_vertformat_attr_add(format, \"color\", GPU_COMP_F32, 4, GPU_FETCH_FLOAT);\n immBindBuiltinProgram(GPU_SHADER_2D_FLAT_COLOR);\n\n immBegin(GPU_PRIM_TRIS, 6 * block_len);\n LISTBASE_FOREACH (ActKeyColumn *, ab, keys) {\n int valid_hold = actkeyblock_get_valid_hold(ab);\n if (valid_hold !", "= 0) {\n if ((valid_hold & ACTKEYBLOCK_FLAG_STATIC_HOLD) == 0) {\n /* draw \"moving hold\" long-keyframe block - slightly smaller */\n immRectf_fast_with_color(pos_id,\n color_id,\n ab->cfra,\n ypos - smaller_sz,\n ab->next->cfra,\n ypos + smaller_sz,\n (ab->block.sel) ? ", "sel_mhcol : unsel_mhcol);\n }\n else {\n /* draw standard long-keyframe block */\n immRectf_fast_with_color(pos_id,\n color_id,\n ab->cfra,\n ypos - half_icon_sz,\n ab->next->cfra,\n ypos + half_icon_sz,\n (ab->block.sel) ? ", "sel_color : unsel_color);\n }\n }\n if (show_ipo && actkeyblock_is_valid(ab) &&\n (ab->block.flag & ACTKEYBLOCK_FLAG_NON_BEZIER)) {\n /* draw an interpolation line */\n immRectf_fast_with_color(\n pos_id,\n color_id,\n ab->cfra,\n ypos - ipo_sz,\n ab->next->cfra,\n ypos + ipo_sz,\n (ab->block.conflict & ACTKEYBLOCK_FLAG_NON_BEZIER) ? ", "ipo_color_mix : ipo_color);\n }\n }\n immEnd();\n immUnbindProgram();\n }\n }\n\n if (keys) {\n /* count keys */\n uint key_len = 0;\n LISTBASE_FOREACH (ActKeyColumn *, ak, keys) {\n /* Optimization: if keyframe doesn't appear within 5 units (screenspace)\n * in visible area, don't draw.", "\n * This might give some improvements,\n * since we current have to flip between view/region matrices.", "\n */\n if (IN_RANGE_INCL(ak->cfra, v2d->cur.xmin, v2d->cur.xmax)) {\n key_len++;\n }\n }\n\n if (key_len > 0) {\n /* draw keys */\n GPUVertFormat *format = immVertexFormat();\n uint pos_id = GPU_vertformat_attr_add(format, \"pos\", GPU_COMP_F32, 2, GPU_FETCH_FLOAT);\n uint size_id = GPU_vertformat_attr_add(format, \"size\", GPU_COMP_F32, 1, GPU_FETCH_FLOAT);\n uint color_id = GPU_vertformat_attr_add(\n format, \"color\", GPU_COMP_U8, 4, GPU_FETCH_INT_TO_FLOAT_UNIT);\n uint outline_color_id = GPU_vertformat_attr_add(\n format, \"outlineColor\", GPU_COMP_U8, 4, GPU_FETCH_INT_TO_FLOAT_UNIT);\n uint flags_id = GPU_vertformat_attr_add(format, \"flags\", GPU_COMP_U32, 1, GPU_FETCH_INT);\n\n GPU_program_point_size(true);\n immBindBuiltinProgram(GPU_SHADER_KEYFRAME_DIAMOND);\n immUniform1f(\"outline_scale\", 1.0f);\n immUniform2f(\n \"ViewportSize\", BLI_rcti_size_x(&v2d->mask) + 1, BLI_rcti_size_y(&v2d->mask) + 1);\n immBegin(GPU_PRIM_POINTS, key_len);\n\n short handle_type = KEYFRAME_HANDLE_NONE, extreme_type = KEYFRAME_EXTREME_NONE;\n\n LISTBASE_FOREACH (ActKeyColumn *, ak, keys) {\n if (IN_RANGE_INCL(ak->cfra, v2d->cur.xmin, v2d->cur.xmax)) {\n if (show_ipo) {\n handle_type = ak->handle_type;\n }\n if (saction_flag & SACTION_SHOW_EXTREMES) {\n extreme_type = ak->extreme_type;\n }\n\n draw_keyframe_shape(ak->cfra,\n ypos,\n icon_sz,\n (ak->sel & SELECT),\n ak->key_type,\n KEYFRAME_SHAPE_BOTH,\n alpha,\n pos_id,\n size_id,\n color_id,\n outline_color_id,\n flags_id,\n handle_type,\n extreme_type);\n }\n }\n\n immEnd();\n GPU_program_point_size(false);\n immUnbindProgram();\n }\n }\n\n GPU_blend(GPU_BLEND_NONE);\n}\n\n/* *************************** Channel Drawing Funcs *************************** */\n\nvoid draw_summary_channel(\n View2D *v2d, bAnimContext *ac, float ypos, float yscale_fac, int saction_flag)\n{\n DLRBT_Tree keys;\n\n saction_flag &= ~SACTION_SHOW_EXTREMES;\n\n BLI_dlrbTree_init(&keys);\n\n summary_to_keylist(ac, &keys, saction_flag);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, false, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\nvoid draw_scene_channel(\n View2D *v2d, bDopeSheet *ads, Scene *sce, float ypos, float yscale_fac, int saction_flag)\n{\n DLRBT_Tree keys;\n\n saction_flag &= ~SACTION_SHOW_EXTREMES;\n\n BLI_dlrbTree_init(&keys);\n\n scene_to_keylist(ads, sce, &keys, saction_flag);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, false, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\nvoid draw_object_channel(\n View2D *v2d, bDopeSheet *ads, Object *ob, float ypos, float yscale_fac, int saction_flag)\n{\n DLRBT_Tree keys;\n\n saction_flag &= ~SACTION_SHOW_EXTREMES;\n\n BLI_dlrbTree_init(&keys);\n\n ob_to_keylist(ads, ob, &keys, saction_flag);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, false, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\nvoid draw_fcurve_channel(\n View2D *v2d, AnimData *adt, FCurve *fcu, float ypos, float yscale_fac, int saction_flag)\n{\n DLRBT_Tree keys;\n\n bool locked = (fcu->flag & FCURVE_PROTECTED) ||\n ((fcu->grp) && (fcu->grp->flag & AGRP_PROTECTED)) ||\n ((adt && adt->action) && ID_IS_LINKED(adt->action));\n\n BLI_dlrbTree_init(&keys);\n\n fcurve_to_keylist(adt, fcu, &keys, saction_flag);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, locked, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\nvoid draw_agroup_channel(\n View2D *v2d, AnimData *adt, bActionGroup *agrp, float ypos, float yscale_fac, int saction_flag)\n{\n DLRBT_Tree keys;\n\n bool locked = (agrp->flag & AGRP_PROTECTED) ||\n ((adt && adt->action) && ID_IS_LINKED(adt->action));\n\n BLI_dlrbTree_init(&keys);\n\n agroup_to_keylist(adt, agrp, &keys, saction_flag);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, locked, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\nvoid draw_action_channel(\n View2D *v2d, AnimData *adt, bAction *act, float ypos, float yscale_fac, int saction_flag)\n{\n DLRBT_Tree keys;\n\n bool locked = (act && ID_IS_LINKED(act));\n\n saction_flag &= ~SACTION_SHOW_EXTREMES;\n\n BLI_dlrbTree_init(&keys);\n\n action_to_keylist(adt, act, &keys, saction_flag);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, locked, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\nvoid draw_gpencil_channel(\n View2D *v2d, bDopeSheet *ads, bGPdata *gpd, float ypos, float yscale_fac, int saction_flag)\n{\n DLRBT_Tree keys;\n\n saction_flag &= ~SACTION_SHOW_EXTREMES;\n\n BLI_dlrbTree_init(&keys);\n\n gpencil_to_keylist(ads, gpd, &keys, false);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, false, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\nvoid draw_gpl_channel(\n View2D *v2d, bDopeSheet *ads, bGPDlayer *gpl, float ypos, float yscale_fac, int saction_flag)\n{\n DLRBT_Tree keys;\n\n bool locked = (gpl->flag & GP_LAYER_LOCKED) !", "= 0;\n\n BLI_dlrbTree_init(&keys);\n\n gpl_to_keylist(ads, gpl, &keys);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, locked, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\nvoid draw_masklay_channel(View2D *v2d,\n bDopeSheet *ads,\n MaskLayer *masklay,\n float ypos,\n float yscale_fac,\n int saction_flag)\n{\n DLRBT_Tree keys;\n\n bool locked = (masklay->flag & MASK_LAYERFLAG_LOCKED) !", "= 0;\n\n BLI_dlrbTree_init(&keys);\n\n mask_to_keylist(ads, masklay, &keys);\n\n draw_keylist(v2d, &keys, ypos, yscale_fac, locked, saction_flag);\n\n BLI_dlrbTree_free(&keys);\n}\n\n/* *************************** Keyframe List Conversions *************************** */\n\nvoid summary_to_keylist(bAnimContext *ac, DLRBT_Tree *keys, int saction_flag)\n{\n if (ac) {\n ListBase anim_data = {NULL, NULL};\n bAnimListElem *ale;\n int filter;\n\n /* get F-Curves to take keyframes from */\n filter = ANIMFILTER_DATA_VISIBLE;\n ANIM_animdata_filter(ac, &anim_data, filter, ac->data, ac->datatype);\n\n /* loop through each F-Curve, grabbing the keyframes */\n for (ale = anim_data.first; ale; ale = ale->next) {\n /* Why not use all #eAnim_KeyType here?", "\n * All of the other key types are actually \"summaries\" themselves,\n * and will just end up duplicating stuff that comes up through\n * standard filtering of just F-Curves. ", "Given the way that these work,\n * there isn't really any benefit at all from including them. - ", "Aligorith */\n\n switch (ale->datatype) {\n case ALE_FCURVE:\n fcurve_to_keylist(ale->adt, ale->data, keys, saction_flag);\n break;\n case ALE_MASKLAY:\n mask_to_keylist(ac->ads, ale->data, keys);\n break;\n case ALE_GPFRAME:\n gpl_to_keylist(ac->ads, ale->data, keys);\n break;\n default:\n // printf(\"%s: datatype %d unhandled\\n\", __func__, ale->datatype);\n break;\n }\n }\n\n ANIM_animdata_freelist(&anim_data);\n }\n}\n\nvoid scene_to_keylist(bDopeSheet *ads, Scene *sce, DLRBT_Tree *keys, int saction_flag)\n{\n bAnimContext ac = {NULL};\n ListBase anim_data = {NULL, NULL};\n bAnimListElem *ale;\n int filter;\n\n bAnimListElem dummychan = {NULL};\n\n if (sce == NULL) {\n return;\n }\n\n /* create a dummy wrapper data to work with */\n dummychan.type = ANIMTYPE_SCENE;\n dummychan.data = sce;\n dummychan.id = &sce->id;\n dummychan.adt = sce->adt;\n\n ac.ads = ads;\n ac.data = &dummychan;\n ac.datatype = ANIMCONT_CHANNEL;\n\n /* get F-Curves to take keyframes from */\n filter = ANIMFILTER_DATA_VISIBLE; // curves only\n ANIM_animdata_filter(&ac, &anim_data, filter, ac.data, ac.datatype);\n\n /* loop through each F-Curve, grabbing the keyframes */\n for (ale = anim_data.first; ale; ale = ale->next) {\n fcurve_to_keylist(ale->adt, ale->data, keys, saction_flag);\n }\n\n ANIM_animdata_freelist(&anim_data);\n}\n\nvoid ob_to_keylist(bDopeSheet *ads, Object *ob, DLRBT_Tree *keys, int saction_flag)\n{\n bAnimContext ac = {NULL};\n ListBase anim_data = {NULL, NULL};\n bAnimListElem *ale;\n int filter;\n\n bAnimListElem dummychan = {NULL};\n Base dummybase = {NULL};\n\n if (ob == NULL) {\n return;\n }\n\n /* create a dummy wrapper data to work with */\n dummybase.object = ob;\n\n dummychan.type = ANIMTYPE_OBJECT;\n dummychan.data = &dummybase;\n dummychan.id = &ob->id;\n dummychan.adt = ob->adt;\n\n ac.ads = ads;\n ac.data = &dummychan;\n ac.datatype = ANIMCONT_CHANNEL;\n\n /* get F-Curves to take keyframes from */\n filter = ANIMFILTER_DATA_VISIBLE; // curves only\n ANIM_animdata_filter(&ac, &anim_data, filter, ac.data, ac.datatype);\n\n /* loop through each F-Curve, grabbing the keyframes */\n for (ale = anim_data.first; ale; ale = ale->next) {\n fcurve_to_keylist(ale->adt, ale->data, keys, saction_flag);\n }\n\n ANIM_animdata_freelist(&anim_data);\n}\n\nvoid cachefile_to_keylist(bDopeSheet *ads,\n CacheFile *cache_file,\n DLRBT_Tree *keys,\n int saction_flag)\n{\n if (cache_file == NULL) {\n return;\n }\n\n /* create a dummy wrapper data to work with */\n bAnimListElem dummychan = {NULL};\n dummychan.type = ANIMTYPE_DSCACHEFILE;\n dummychan.data = cache_file;\n dummychan.id = &cache_file->id;\n dummychan.adt = cache_file->adt;\n\n bAnimContext ac = {NULL};\n ac.ads = ads;\n ac.data = &dummychan;\n ac.datatype = ANIMCONT_CHANNEL;\n\n /* get F-Curves to take keyframes from */\n ListBase anim_data = {NULL, NULL};\n int filter = ANIMFILTER_DATA_VISIBLE; // curves only\n ANIM_animdata_filter(&ac, &anim_data, filter, ac.data, ac.datatype);\n\n /* loop through each F-Curve, grabbing the keyframes */\n LISTBASE_FOREACH (bAnimListElem *, ale, &anim_data) {\n fcurve_to_keylist(ale->adt, ale->data, keys, saction_flag);\n }\n\n ANIM_animdata_freelist(&anim_data);\n}\n\nvoid fcurve_to_keylist(AnimData *adt, FCurve *fcu, DLRBT_Tree *keys, int saction_flag)\n{\n if (fcu && fcu->totvert && fcu->bezt) {\n /* apply NLA-mapping (if applicable) */\n if (adt) {\n ANIM_nla_mapping_apply_fcurve(adt, fcu, 0, 0);\n }\n\n /* Check if the curve is cyclic. */", "\n bool is_cyclic = BKE_fcurve_is_cyclic(fcu) && (fcu->totvert >= 2);\n bool do_extremes = (saction_flag & SACTION_SHOW_EXTREMES) !", "= 0;\n\n /* loop through beztriples, making ActKeysColumns */\n BezTripleChain chain = {0};\n\n for (int v = 0; v < fcu->totvert; v++) {\n chain.cur = &fcu->bezt[v];\n\n /* Neighbor keys, accounting for being cyclic. */", "\n if (do_extremes) {\n chain.prev = (v > 0) ? &", "fcu->bezt[v - 1] : is_cyclic ? &", "fcu->bezt[fcu->totvert - 2] : NULL;\n chain.next = (v + 1 < fcu->totvert) ? &", "fcu->bezt[v + 1] : is_cyclic ? &", "fcu->bezt[1] : NULL;\n }\n\n add_bezt_to_keycolumns_list(keys, &chain);\n }\n\n /* Update keyblocks. */", "\n update_keyblocks(keys, fcu->bezt, fcu->totvert);\n\n /* unapply NLA-mapping if applicable */\n if (adt) {\n ANIM_nla_mapping_apply_fcurve(adt, fcu, 1, 0);\n }\n }\n}\n\nvoid agroup_to_keylist(AnimData *adt, bActionGroup *agrp, DLRBT_Tree *keys, int saction_flag)\n{\n FCurve *fcu;\n\n if (agrp) {\n /* loop through F-Curves */\n for (fcu = agrp->channels.first; fcu && fcu->grp == agrp; fcu = fcu->next) {\n fcurve_to_keylist(adt, fcu, keys, saction_flag);\n }\n }\n}\n\nvoid action_to_keylist(AnimData *adt, bAction *act, DLRBT_Tree *keys, int saction_flag)\n{\n FCurve *fcu;\n\n if (act) {\n /* loop through F-Curves */\n for (fcu = act->curves.first; fcu; fcu = fcu->next) {\n fcurve_to_keylist(adt, fcu, keys, saction_flag);\n }\n }\n}\n\nvoid gpencil_to_keylist(bDopeSheet *ads, bGPdata *gpd, DLRBT_Tree *keys, const bool active)\n{\n bGPDlayer *gpl;\n\n if (gpd && keys) {\n /* for now, just aggregate out all the frames, but only for visible layers */\n for (gpl = gpd->layers.last; gpl; gpl = gpl->prev) {\n if ((gpl->flag & GP_LAYER_HIDE) == 0) {\n if ((!", "active) || ((active) && (gpl->flag & GP_LAYER_SELECT))) {\n gpl_to_keylist(ads, gpl, keys);\n }\n }\n }\n }\n}\n\nvoid gpl_to_keylist(bDopeSheet *UNUSED(ads), bGPDlayer *gpl, DLRBT_Tree *keys)\n{\n bGPDframe *gpf;\n\n if (gpl && keys) {\n /* Although the frames should already be in an ordered list,\n * they are not suitable for displaying yet. */", "\n for (gpf = gpl->frames.first; gpf; gpf = gpf->next) {\n add_gpframe_to_keycolumns_list(keys, gpf);\n }\n\n update_keyblocks(keys, NULL, 0);\n }\n}\n\nvoid mask_to_keylist(bDopeSheet *UNUSED(ads), MaskLayer *masklay, DLRBT_Tree *keys)\n{\n MaskLayerShape *masklay_shape;\n\n if (masklay && keys) {\n for (masklay_shape = masklay->splines_shapes.first; masklay_shape;\n masklay_shape = masklay_shape->next) {\n add_masklay_to_keycolumns_list(keys, masklay_shape);\n }\n\n update_keyblocks(keys, NULL, 0);\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.000670275476295501, 0.0006370534538291395, 0.0005785230896435678, 0.0006064076442271471, 0.0005954567459411919, 0.004507868550717831, 0.0010133199393749237, 0.0014602246228605509, 0.0012296675704419613, 0.0007729823119007051, 0.0011055225040763617, 0.000623190775513649, 0.0011303125647827983, 0.005551259499043226, 0.0021269062999635935, 0.001118701882660389, 0.0022708335891366005, 0.0010672437492758036, 0.00732341967523098, 0.001199730671942234, 0.0009203788940794766, 0.0005825584521517158, 0.001962865237146616, 0.0012351643526926637, 0.0016204972052946687, 0.0017592433141544461, 0.0007320919539779425, 0.0006837062537670135, 0.001005770405754447, 0.0006843969458714128, 0.001145969028584659, 0.0011515399673953652, 0.001425633323378861, 0.0011453283950686455, 0.002240430796518922, 0.0014635385014116764, 0.004498815163969994, 0.0011820929357782006, 0.001629456295631826, 0.002225056756287813, 0.00155208061914891, 0.01022922433912754, 0.0007511895964853466, 0.009579723700881004, 0.010522153228521347, 0.0009301237878389657, 0.0015828936593607068, 0.0008864685078151524, 0.0012674520257860422, 0.2955892086029053, 0.0011741571361199021, 0.009391285479068756, 0.008155873976647854, 0.007357811089605093, 0.0007511895964853466, 0.023570897057652473, 0.0006654609460383654, 0.0010057330364361405, 0.0014306253287941217, 0.0008925194852054119, 0.0011336327297613025, 0.03233623132109642, 0.011718234978616238, 0.009061632677912712, 0.0016629479359835386, 0.0012174920411780477, 0.0006905845366418362, 0.0007331996457651258, 0.0007410254911519587, 0.0007345529738813639, 0.0006988358218222857, 0.0007965264958329499, 0.0010083959205076098, 0.0007120431982912123, 0.0008695372380316257, 0.0006640845094807446, 0.0011474807979539037, 0.00124275591224432, 0.0008280467591248453, 0.0007734409300610423, 0.0023457445204257965, 0.002565953880548477, 0.0008441993850283325, 0.002062436193227768, 0.002156819449737668, 0.0014871321618556976, 0.0005481844418682158, 0.0010340375592932105, 0.0014526172308251262, 0.013101249001920223, 0.0010726663749665022, 0.0005931335617788136, 0.006709136068820953, 0.001590750995092094, 0.0014430904993787408, 0.0007888840045779943, 0.0007998605724424124, 0.0047687953338027, 0.0008029534947127104, 0.0024340914096683264, 0.0033235300797969103, 0.000847764837089926, 0.0009427511249668896 ]

[ "fileFormatVersion: 2\nguid: d4d05e72b5afbcf489dc1e87a3fa38f2\nMonoImporter:\n serializedVersion: 2\n defaultReferences: []\n executionOrder: 0\n icon: {instanceID: 0}\n" ]

{ "pile_set_name": "Github" }

[ 0.002503520343452692 ]

[ "Q:\n\nMetro-style data input form application\n\nSimilar to this question asking about relatively light-weight data entry / editor application development, which would follow Metro design guidelines.", "\nThe question is do you know of any samples of a whole app I could look at to see how a (multi-page) forms application might look like? ", "I.e. textboxes, checkboxes, comboboxes in Windows 8 style...\n\nMaybe you know to pinpoint one here?", "\n\nA:\n\nThe best app I know that showcases some data input is the calendar. ", "Try creating a new appointment. ", "I imagine there are more apps that have input, but I just don't know of any off the top of my head.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005497547681443393, 0.0005955063970759511, 0.0006493750843219459, 0.0005485863657668233, 0.0019013218116015196, 0.000591195363085717, 0.001995444530621171 ]

[ "//\n// OllaDataBindContainer.m\n// OllaFramework\n//\n// Created by nonstriater on 14-7-2.", "\n// Copyright (c) 2014年 xiaoran. ", "All rights reserved.", "\n//\n\n#import \"OllaDataBindContainer.h\"\n\n@implementation OllaDataBindContainer\n\n- (void)applyDataBinding:(id)data{\n for (OllaDataBind *dataBind in _dataBindings) {\n [dataBind applyDataBinding:data];\n }\n\n}\n\n\n@end\n" ]

{ "pile_set_name": "Github" }

[ 0.0011156899854540825, 0.0006349664181470871, 0.0006133938441053033, 0.0008974202210083604 ]

[ "fyi.", "\n----- Forwarded by Lara Leibman/Enron Communications on 02/27/01 07:35 PM \n-----\n\n\tPR & Marketing\n\tSent by: EBS Announcements\n\t02/27/01 01:35 PM\n\t\t \n\t\t To: All EBS\n\t\t cc: \n\t\t Subject: ENRON BROADBAND SERVICES LAUNCHES ONLINE BANDWIDTH TRADING IN EUROPE\n\n\n\nAnita Cullen\nEnron Broadband Services \n+44 (0) 20 7783 2384\n\n\nENRON BROADBAND SERVICES LAUNCHES ONLINE BANDWIDTH TRADING IN EUROPE\n\nFOR IMMEDIATE RELEASE: Tuesday, February 27,2001\n\n\nLONDON \u0001) Enron Broadband Services, a wholly-owned subsidiary of Enron Corp. \n(NYSE: ENE), announced today the launch of online bandwidth trading in \nEurope. ", "Bandwidth transactions that used to take months to close can now be \nconcluded in minutes, creating wholesale market efficiencies.", "\nBandwidth trading is carried out via the EnronOnline trading platform. ", " \nLaunched in November 1999 to handle the trading of Enron\u0001,s natural gas, oil, \nelectricity and other commodities, EnronOnline is the world\u0001,s largest \nbusiness-to-business e-commerce website, currently handling over 3,850 \ntransactions with a notional value of over $2.6 billion, each day. ", " \nThe easy-to-use, customisable site enables registered customers to log on and \nbuy and sell bandwidth in just a few clicks. ", "STM-1 capacity is available, \nwith contract durations of between three and 12 months and forward delivery \nranging from two to 14 months. ", "Once a transaction is closed, settlement and \nprovisioning are handled offline. ", "\nTo provide the physical infrastructure to enable bandwidth trading, Enron has \ninstalled pooling points, or switching and interconnection facilities at \nselected locations throughout Europe, through which connections between \nbandwidth buyers and sellers can be established and monitored. ", "To further \nfacilitate the commoditisation of bandwidth, Enron has also developed \nstandard terms and conditions which provide firm start dates and service \nlevel agreements backed by liquidated damages. ", "\n\u0001&Enron\u0001,s online bandwidth trading service is not an exchange or bulletin \nboard. ", "Instead, it satisfies orders at a quoted price with Enron acting as \nthe principal,\u00018 said Marcello Romano, vice president, Bandwidth Trading, \nEnron Broadband Services, Europe.", "\n\u0001&The last three months have marked a turning point in the development of this \nmarket in Europe. ", "Participants are waking up to the value of firm service \nlevel agreements and the flexibility offered through bandwidth trading and \nrisk management solutions. ", "The best efforts service associated with this \nmarket is finally being challenged.\u00018\n###\nEditor\u0001,s Notes\nAbout Enron \nEnron Broadband Services is a leading provider of high quality, high \nbandwidth delivery and application services. ", " The company\u0001,s business model \ncombines the power of the Enron Intelligent Network, Enron\u0001,s Broadband \nOperating System, bandwidth trading and intermediation services, and \nhigh-bandwidth applications to fundamentally improve the experience and \nfunctionality of the Internet. ", " Enron\u0001,s Broadband Operating System allows \napplication developers to dynamically provision bandwidth for the quality of \nservice necessary to deliver broadband content. ", " Enron is also creating a \nmarket for bandwidth that will allow network providers to scale to meet the \ndemands required by increasingly complex applications. ", " Enron Broadband \nServices can be found on the Web at www.enron.net. ", "\nEnronOnline (www.EnronOnline.com) offers customers a free Internet-based \nsystem for conducting wholesale transactions with Enron as principal. ", " \nEnronOnline provides real-time prices for bandwidth, power, natural gas, \ncoal, weather products, petrochemicals, pulp and paper and other commodities \nin the Americas, Europe and Asia. ", " Since its launch in November 1999, \nEnronOnline has expanded to include approximately 1,120 products and has \ncompleted over 685,000 transactions with a total notional value exceeding \n$420 billion.", "\nEnron is one of the world\u0001,s leading electricity, natural gas and \ncommunications companies. ", " The company, with revenues of $101 billion in \n2000, markets electricity and natural gas, delivers physical commodities and \nfinancial and risk management services to customers around the world, and has \ndeveloped an intelligent network platform to facilitate online business. ", " \nFortune magazine has named Enron \u0001&America\u0001,s Most Innovative Company\u00018 for six \nconsecutive years. ", " Enron\u0001,s Internet address is www.enron.com. ", " The stock is \ntraded under the ticker symbol \u0001&ENE.\u00018" ]

{ "pile_set_name": "Enron Emails" }

[ 0.0015258030034601688, 0.0005986051983200014, 0.0006186338141560555, 0.0005996556137688458, 0.0005994710372760892, 0.0005675166030414402, 0.000551969395019114, 0.0006014457321725786, 0.0005644949851557612, 0.0006477488204836845, 0.0007084857788868248, 0.0005988736520521343, 0.0005562036531046033, 0.0005571892252191901, 0.0005766244139522314, 0.0006020020227879286, 0.0005602780147455633, 0.0006940060993656516, 0.0005660057067871094, 0.0006186783430166543, 0.0006037516868673265, 0.0006216919864527881, 0.0007133407052606344, 0.0005935992230661213, 0.0005729628610424697, 0.0006621601060032845, 0.0007695778040215373 ]

[ "By CCN.com: Hollywood hates conservatives. ", "That’s because it is so ridiculously liberal in its ideals and values – and hypocritical to boot – that anyone with a different political viewpoint is blacklisted. ", "Yes, it’s a real thing.", "\n\nHollywood has shut conservative artists out, even those who have made studios a lot of money.", "\n\nKelsey Grammer Is Hollywood Royalty\n\nYet one artist remains unaffected by Hollywood’s bias, and that’s Kelsey Grammer.", "\n\nKelsey Grammer, aka Dr. Frasier Crane, has been immune to being blacklisted in Hollywood. ", "Since concluding his run on NBC’s “Frasier” in 2004, Kelsey Grammer continues to both produce and act.", "\n\nTake a look at this cast! ", "Can’t wait for you all to see the @innocentonfox season premiere this FRIDAY at 9/8c on FOX. ", "pic.twitter.com/MJVRGGOloZ — Kelsey Grammer (@KelseyGrammer) February 11, 2019\n\nHis success continues despite comments such as those he made to liberal “journalist” Christiane Amanpour about his support for Donald Trump.", "\n\nAmanpour: “You are one of those rare Hollywood beasts who is conservative, and you voted for Donald Trump. ", "And I just wonder, what, whether you sort of took any hits in Hollywood for that? ", "Did you feel that you were sort of marginalized?” ", "Grammer: “I’m not aware of taking a hit for it but now, certainly passions run high, and certainly he has touched on an extraordinarily passionate response. ", "I don’t know if it’s as serious or horrible as everybody wants it to be.”", "\n\nGrammer also told the BBC in 2016:\n\n“I’m a conservative. ", "I have been for a long time. ", "I’m just not a big government guy. ", "In terms of policy, I don’t have a lot of problems with what [Trump] is doing.”", "\n\nWhy Is Kelsey Grammer Still Working?", "\n\nThere are three reasons.", "\n\nThe first reason is money. ", "Kelsey Grammer has been in Hollywood for 35 years and has been a value-add to every project he’s touched. ", "Frasier Crane was so popular in “Cheers” that NBC spun-off a show just for that character. ", "It ran for 11 years, making NBC tons of money.", "\n\nThe second reason is that his Hollywood relationships are very solid. ", "The other item in Hollywood that matters besides money is “who you know.” ", "More than three decades of rubbing elbows with the Hollywood elite have earned him a kind of immunity that, coupled with his success, makes him untouchable.", "\n\nThe third reason is that Kelsey Grammer is not boisterous about his politics. ", "Were he brash and shrill, he might not be cut the same slack. ", "As he told BBC:\n\n“I’m a reasoned, thoughtful guy so I’m not going to say stuff that doesn’t make some sense…I will continue to do it in a polite way.”", "\n\nRare Exceptions to the Rule\n\nThere are plenty of other open conservatives in Hollywood, yet few have the star power of Kelsey Grammer. ", "Clint Eastwood is a rare exception, as are Sylvester Stallone, Arnold Schwarzenegger, and Gary Sinise.", "\n\nThey certainly haven’t been snubbed by Hollywood. ", "A few others actors like Nick Searcy (“Justified”) and Adam Baldwin (“The Last Ship”) are far too talented, despite being outspoken, to be ignored.", "\n\n'Gosnell' Continues Its Victory Lap https://t.co/QSQ78AQkyQ — NewsBusters (@newsbusters) May 7, 2019\n\nYet acting great and outspoken conservative James Woods, who was recently banned by Twitter for no good reason, has struggled.", "\n\nThe great playwright and director David Mamet saw his big-screen career dry up when he came out of the conservative closet.", "\n\nFor now, Kelsey Grammer appears to have escaped liberal Hollywood’s wrath." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.39083147048950195, 0.037725675851106644, 0.0007049032719805837, 0.023823881521821022, 0.0010125103872269392, 0.0009012972586788237, 0.0008740016492083669, 0.0010236039524897933, 0.0007666082819923759, 0.0009403962758369744, 0.002614668570458889, 0.0006415185052901506, 0.0008516836678609252, 0.0005773029988631606, 0.001615016022697091, 0.0008366752881556749, 0.0006232579471543431, 0.0014039977686479688, 0.0007059025228954852, 0.0008983907173387706, 0.0007637414964847267, 0.0012671315344050527, 0.0006782615091651678, 0.0007856894517317414, 0.0008701655315235257, 0.0007110144942998886, 0.0010669479379430413, 0.0008334498852491379, 0.003433623816817999, 0.021062251180410385, 0.0005690199322998524, 0.0009597629541531205, 0.0007841004990041256, 0.0020503834821283817, 0.0008110895869322121, 0.0008360157953575253, 0.0025073825381696224, 0.06237872317433357 ]

[ "Fenghao\n\nFenghao () is the modern name of the twin city formed by the Western Zhou capitals of Feng and Hao on opposite banks of the Feng River near its confluence with the Wei River in Shaanxi, China.", "\n\nHistory\nAs Duke Wen (ruled c. 1099–1050 BCE) expanded the territory of Zhou east into Shanxi in preparation for an assault on his nominal Shang overlords, he constructed a new capital on the west bank of the Feng about downstream from Zhou's original capital on the Wei River below Mount Qi. ", "This city was called Feng, Fengxi, or Fengjing (, Fēngjīng).", "\n\nAfter his son Fa defeated the Shang at Muye and ascended the throne as King Wu (ruled c. 1046–1043 BCE), the capital was moved to a new establishment on the east bank called Hao or Haojing. ", "The two formed a twin capital, with Feng continuing to serve the rituals of the Zhou Ancestral Shrine and gardens and Hao containing the royal palace and government administration.", "\n\nBoth were abandoned in 771 BC during the Quanrong invasion that drove the Zhou out of the Wei River Valley and brought an end to its Western dynasty. ", "The capital of the Eastern Zhou was located at Chengzhou.", "\n\nRuins\nThe ruins of Fenghao lie in present-day southwest Xi'an in Shaanxi Province. ", "The site was declared an important national cultural heritage site by the State Council of the People's Republic of China in 1961.", "\n\nSee also\n Historical capitals of China\n\nReferences\n\nThis article is based on a translation of \"沣镐\" in the Chinese Wikipedia.", "\n\nCategory:Ancient Chinese capitals\nCategory:History of Xi'an\nCategory:11th-century BC establishments\nCategory:2nd-millennium BC establishments\nCategory:Populated places established in the 2nd millennium BC\nCategory:Major National Historical and Cultural Sites in Shaanxi" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006678319768980145, 0.0006265288102440536, 0.0006109398091211915, 0.0017050422029569745, 0.0005796434707008302, 0.0008226007339544594, 0.000619700993411243, 0.0007028392283245921, 0.0006042683962732553, 0.0005528463516384363, 0.0006257891072891653 ]

[ "Blue light emitting devices such as a light emitting diode (LED) and laser emitting blue light were developed and white light emitting devices using the blue light emitting devices have been put into practical use. ", "The white light emitting devices have excellent light emission efficiency and long product's life. ", "Because of these advantages, the white light emitting devices are expected to be used in a wide variety of fields including backlight of liquid crystal displays and lighting such as indoor lighting and automobile headlight. ", "On the other hand, the brightness and color reproducing and rendering properties of the white light emitting device have been desired to be further improved.", "\nAs white light emitting devices, the following three types are known. ", " 1. ", "A first type of white light emitting device has a blue light emitting device in combination with a fluorescent material emitting a complementary blue upon receipt of light emitted from the blue light emitting device. ", " 2. ", "A second type of white light emitting device has a blue light emitting device in combination with a red emitting fluorescent material and a green emitting fluorescent material, which emit fluorescence upon receipt of light emitted from the blue light emitting device. ", " 3. ", "A third type of white light emitting device has an ultraviolet light emitting device, a blue emitting fluorescent material, a green emitting fluorescent material and a red emitting fluorescent material, which emit fluorescence upon receipt of ultraviolet light emitted from the ultraviolet light emitting device.", "\nThe first type of white light emitting device is disclosed in Japanese Patent Laid-Open Nos. ", "10-093146, 10-065221, and 10-242513. ", "The white light emitting device of this type contains an LED formed of a blue light emitting nitride semiconductor and a fluorescent material (referred to as “YAG:Ce fluorescent material”), which emits a complementary blue upon receipt of blue light emitted from the LED and which is formed of a YAG based oxide represented by (Y, Gd)3(Al, Ga)5O12 and having Ce doped in its host lattice. ", "Particles of the fluorescent material are dispersed in an inclusion resin surrounding the LED. ", "Furthermore, Japanese Patent Laid-Open No. ", "11-46015 discloses a white light emitting device in which a layer containing a non-particulate fluorescent material represented by (Re1-xSmx)3(Al1-yGay)5O12:Ce is formed on an LED.", "\nThese white light emitting devices are used in backlight for a display and an LED display device, etc. ", "However, the emission intensity of red light emission area is not sufficient. ", "Consequently, when the white light emitting device is used in lighting, for example, the skin color looks bluish. ", "Since the natural color of an object cannot be faithfully reproduced as is the case may be, these white light emitting devices have a problem in color reproducing and rendering properties for use in display light for commercial goods.", "\nThe second type of white light emitting device is improved in color reproducing and rendering properties compared to the first type. ", "Japanese Patent Laid-Open No. ", "2005-235934 discloses a white light emitting device using a YAG:Ce fluorescent material, which serves as a fluorescent material emitting a complementary blue upon receipt of blue light from an LED, and a red emitting fluorescent material having a solid solution of Eu in a CaAlSiN3 crystalline phase. ", "Japanese Patent Laid-Open No. ", "2005-60714 discloses a white light emitting device using a YAG:Ce florescent material and a red emitting florescent material represented by Ca2-xSi5N8:Eux. ", "Japanese Patent Laid-Open No. ", "2004-327518 discloses a white light emitting device using an LED emitting blue light, a europium doped yttrium/aluminum/garnet based green emitting fluorescent material and a europium doped strontium thiogallate based red emitting fluorescent material.", "\nThe third type of white light emitting device is a three-wavelength type white light emitting device, which contains an LED emitting ultraviolet light in combination with a blue emitting fluorescent material, a green emitting fluorescent material and a red emitting fluorescent material, as is disclosed in National Publication of International Patent Application No. ", "WO98/39805. ", "In the white light emitting device of this type, a centroclinal transparent resin, which has an ultraviolet light emitting diode arranged therein and three types of fluorescent material powders mixed therein, is formed on a transparent substrate (front panel). ", "To the surface of the transparent resin, mirror processing is applied such that the surface works as a mirror.", "\nThese white light emitting devices employ a red emitting fluorescent material such as Y2O2S:Eu3+, which emits light when excited by light having a wavelength of 370 nm. ", "Therefore, red light emission cannot be sufficiently obtained in a white light emitting device having an LED emitting ultraviolet light, which has an emission peak between a wavelength of 390 nm and 400 nm. ", "In the circumstances, it has been desired to develop a red emitting fluorescent material emitting light when excited by light having a wavelength of near 390 nm. ", "Since the visual sensitivity of red light is low compared to blue/green light, it has been desired to develop a red emitting fluorescent material emitting a further brighter light.", "\n[Patent Document 1] Japanese Patent Laid-Open No. ", "10-093146\n[Patent Document 2] Japanese Patent Laid-Open No. ", "10-065221\n[Patent Document 3] Japanese Patent Laid-Open No. ", "10-242513\n[Patent Document 4] Japanese Patent Laid-Open No. ", "11-46015\n[Patent Document 5] National Publication of International Patent Application No. ", "WO02/011214\n[Patent Document 6] Japanese Patent Laid-Open No. ", "2005-235934\n[Patent Document 7] Japanese Patent Laid-Open No. ", "2005-60714\n[Patent Document 8] National Publication of International Patent Application No. ", "WO98/39805" ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006910358788445592, 0.0006109905079938471, 0.0005779339116998017, 0.000566360482480377, 0.000610619958024472, 0.0009391900966875255, 0.0006517339497804642, 0.001185585861094296, 0.0007591129979118705, 0.00117425003554672, 0.0006952695548534393, 0.0006604852387681603, 0.0008533168002031744, 0.0008635498234070837, 0.0005618285504169762, 0.0006941930041648448, 0.0006394272786565125, 0.0006208523991517723, 0.0006050602532923222, 0.0006318559171631932, 0.0007252672221511602, 0.0006472390959970653, 0.0007520513026975095, 0.0007619409007020295, 0.0007520513026975095, 0.0025128505658358335, 0.0007520513026975095, 0.0006696589407511055, 0.0006618885672651231, 0.0013691663043573499, 0.000665407394990325, 0.0006069656810723245, 0.0008027695002965629, 0.0006827855249866843, 0.0005528708570636809, 0.0005714363069273531, 0.0006197249749675393, 0.000679659831803292, 0.0006910708034411073, 0.0006885857437737286, 0.0006757060182280838, 0.0007008540560491383, 0.0006715267081744969, 0.0006739049567840993, 0.0023882598616182804 ]

[ "“I must not fear. ", "Fear is the mind-killer. ", "Fear is the little-death that brings total obliteration. ", "I will face my fear. ", "I will permit it to pass over me and through me. ", "And when it has gone past I will turn the inner eye to see its path. ", "Where the fear has gone there will be nothing. ", "Only I will remain.” ", "This is the litany Paul Atreides recites in the book “Dune” as he is being tested. ", "A powerful insight into the truth that fear really is “the little death.” ", "Fear usually stops us in our tracks. ", "And fear isn’t always a bad thing, but being able to discern when it is is absolutely necessary to escape the paralysis of fear!", "\n\nWe humans are susceptible to the power of fear and it’s ability to cause us to overreact or be paralyzed into inaction. ", "So, fear is an emotion we must control or it will control us.", "\n\nLook at our Lesson today in 2 Timothy 1:3-8:\n\nTimothy, my son, I thank God whom I serve with a clear conscience, as did my fathers, when I remember you constantly in my prayers. ", "As I remember your tears, I long night and day to see you, that I may be filled with joy. ", "I am reminded of your sincere faith, a faith that dwelt first in your grandmother Lois and your mother Eunice and now, I am sure, dwells in you. ", "Hence I remind you to rekindle the gift of God that is within you through the laying on of my hands; for God did not give us a spirit of timidity but a spirit of power and love and self-control. ", "Do not be ashamed then of testifying to our Lord, nor of me his prisoner, but share in suffering for the gospel in the power of God.", "\n\nSt. Paul writes his spiritual son St. Timothy (as an aside to all those folks who complain about we Orthodox calling our clergy “father,” I wonder what Timothy called Paul) and gives him some fatherly advice about his work in the parish where St. Paul has sent him. ", "He reminds Timothy first that he is serving God with a clear conscience. ", "What a powerful statement! ", "To be able to be so confident of one’s calling that Paul can say that his conscience is clear is amazing, especially given the life Paul had before Christ confronted him on the Damascus Road. ", "Paul’s clear conscience flows from his confidence in God’s love and mercy and his life of repentance!", "\n\nNext St. Paul reminds this young priest that he, too, has come through hardships in his own spiritual journey. ", "St. Paul tells Timothy that he “remembers” Timothy’s tears. ", "We do ourselves no favors when we hide from the reality of our lives. ", "When we try to pretend that bad things haven’t happened to us, we invite the sickness of delusion and fantasy to overtake us. ", "When that happens, we are easy prey for fear and despair! ", "Being honest about the good times and the bad times is all about being free from shame and living a life of repentance. ", "And then St. Paul tells Timothy that the faithfulness Timothy saw in his mother and grandmother is a guiding example for him as well. ", "We aren’t going to escape the crippling effects of fear and doubt by ourselves. ", "Using the wonderful and faithful example of those who came before us is absolutely essential if we, too, are going to be faithful. ", "It is in not forgetting or ignoring the faithful examples of those before us that teach us how to remain faithful ourselves!", "\n\nFinally, St. Timothy is ready for the natural result of serving God with a clear conscience, remembering to be honest about our lives, and embracing the good examples of faithfulness from those around us: God has not given us a spirit of fear (timidity) but of power, love, and self-control! ", "That’s the payoff of all that previous hard spiritual labor. ", "Our lives are flooded with the power to stay focused, love to keep our hearts pure, and self-control to exercise our proper dominion over our desires and passions! ", "That’s the birth-right of a faithful follower of Christ!", "\n\nToday, does power, love, and self-control describe your life? ", "If not, examine where your conscience may be clouded, your heart gripped by timidity and fear, and your forgetfulness of the faithful examples left for you in those who have come before you! ", "Doing this good and necessary spiritual inventory will grow your faith and make you Orthodox on Purpose!", "\n\nP.S. So looking forward to our FIRST Faith Encouraged Trip this week in North Royalton, OH at St. Paul’s Greek Orthodox Church! ", "This Winter retreat is all about “Taming The Passions: Timeless Wisdom in Being Orthodox on Purpose.” ", "The retreat is January 26 and 27 and you can find out more on the St. Paul’s website – www.stpaulgoc.org! ", "We’ll be doing a book signing and saying hello to all our Patrons in the area, so y’all come! ", "And share this with your family and friends in the Cleveland area!", "\n\nLike this: Like Loading..." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008145708125084639, 0.03554899990558624, 0.050684526562690735, 0.06403052806854248, 0.0013137138448655605, 0.0009391271159984171, 0.0028076795861124992, 0.0011936489026993513, 0.0006982626509852707, 0.002101115183904767, 0.0019010738469660282, 0.0011875586351379752, 0.005186845548450947, 0.0024991955142468214, 0.0005511873750947416, 0.000953978335019201, 0.007799366023391485, 0.0009856622200459242, 0.004080111626535654, 0.0007497264305129647, 0.0005953965592198074, 0.005891007371246815, 0.0006226814584806561, 0.0014375178143382072, 0.0006554220453836024, 0.0012274354230612516, 0.001779507496394217, 0.01232585497200489, 0.0021493849344551563, 0.049079135060310364, 0.000594736950006336, 0.0048299552872776985, 0.0005481922999024391, 0.0008966692839749157, 0.0006546027143485844, 0.0021500620059669018, 0.000852332275826484, 0.005078041926026344, 0.0009189759730361402, 0.00197836896404624, 0.0013892422430217266, 0.0006703074323013425, 0.0008411493618041277, 0.0007286788895726204, 0.001159493695013225, 0.0006069254595786333, 0.000974163063801825 ]

[ "Hydrolysis of thionopeptides by the aminopeptidase from Aeromonas proteolytica: insight into substrate binding.", "\nA series of L-leucine aniline analogues were synthesized that contained either a carbonyl or thiocarbonyl as a part of the amide bond. ", "Additionally, the para-position on the phenyl ring of several substrates was altered with various electron-withdrawing or donating groups. ", "The kinetic constants K(m) and k(cat) were determined for the hydrolysis of each of these compounds in the presence of the aminopeptidase from Aeromonas proteolytica (AAP) containing either Zn(II) or Cd(II). ", "The dizinc(II) form of AAP ([ZnZn(AAP)]) was able to cleave both carbonyl and thiocarbonyl containing peptide substrates with similar efficiency. ", "However, the dicadmium(II) form of AAP ([CdCd(AAP)]) was unable to cleave any of the carbonyl-containing compounds tested but was able to cleave the thionopeptide substrates. ", "This is consistent with the borderline hard/soft nature of Zn(II) vs Cd(II). ", "The trends observed in the K(m) values suggest that the oxygen atom of the amide bond directly interacts with the dinuclear active site of AAP. ", "Heterodimetallic forms of AAP that contained one atom of Zn(II) and one of Cd(II) (i.e., [CdZn(AAP)] and [ZnCd(AAP)]) were also prepared. ", "The K(m) values for the thionopeptides substrates are the smallest when Cd(II) is in the first metal binding site, suggesting that substrate binds to the first metal binding site. ", "1-Phenyl-2-thiourea (PTU) and urea (PU) were also examined to determine the differences between thionopeptide and peptide binding to AAP. ", "PTU and PU were found to be competitive inhibitors of AAP with inhibition constants of 0.24 and 4.6 mM, respectively. ", "The electronic absorption and EPR spectra of [CoCo(AAP)], [CoZn(AAP)], and [ZnCo(AAP)] were recorded in the absence and presence of both PU and PTU. ", "Spectral changes were observed for PTU binding to [CoCo(AAP)] and [CoZn(AAP)] but not for [ZnCo(AAP)], while no spectral changes were observed for any of the Co(II)-substituted forms of AAP upon the addition of PU. ", "These data indicate that carbonyl binding occurs only at the first metal binding site. ", "In light of the data presented herein, the substrate binding step in the proposed mechanism of AAP catalyzed peptide hydrolysis can be further refined." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006238852511160076, 0.0008834278560243547, 0.0006796190282329917, 0.0006167764076963067, 0.0008404839900322258, 0.0007529466529376805, 0.0006611723219975829, 0.0006750890170224011, 0.0007568492437712848, 0.0006424261373467743, 0.0007893072906881571, 0.0006941205356270075, 0.000669591361656785, 0.0006307178409770131, 0.0005875379429198802, 0.0005142167210578918 ]

[ "Influence of low dose irradiation on the quality of fresh buffalo meat stored at 0-3°C.", "\nThe effect of low dose irradiation on the microbiological, chemical and sensory qualities of fresh buffalo meat stored at 0-3°C was studied. ", "Meat slices packed in polyethylene bags subjected to 2·5 kGy dose had a shelf-life of 4 weeks with acceptable sensory score, low total volatile basic nitrogen values and remarkable improvement in microbiological quality. ", "Irradiated meat was completely free of Pseudomonas spp. ", "and Enterobacteriaceae throughout storage. ", "In contrast, the unirradiated control meat spoiled within 2 weeks." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007220662664622068, 0.0006377762765623629, 0.0007480614585801959, 0.06838216632604599, 0.0005971825448796153, 0.0012724724365398288 ]

[ "\"use strict\";\n\nObject.defineProperty(exports, \"__esModule\", {\n value: true\n});\nexports.default = isBlockScoped;\n\nvar _generated = require(\"./generated\");\n\nvar _isLet = _interopRequireDefault(require(\"./isLet\"));\n\nfunction _interopRequireDefault(obj) { return obj && obj.__esModule ? ", "obj : { default: obj }; }\n\nfunction isBlockScoped(node) {\n return (0, _generated.isFunctionDeclaration)(node) || (0, _generated.isClassDeclaration)(node) || (0, _isLet.default)(node);\n}" ]

{ "pile_set_name": "Github" }

[ 0.0008454085327684879, 0.001691129058599472 ]

[ "{\"type\":\"article\",\"show_header_text\":false,\"header\":\"ARTICLES ABOUT WILLIAM F. SCHULZ \",\"query\":\"((per = \\\"SCHULZ, WILLIAM F\\\") or (per=\\\"Schulz, William\\\" and org=\\\"Amnesty International\\\"))\",\"search_query\":\"((persons:\\\"SCHULZ, WILLIAM F\\\") OR (persons:\\\"Schulz, William\\\" AND organizations:\\\"Amnesty International\\\"))\",\"num_search_articles\":\"10\",\"show_summary\":true,\"show_byline\":true,\"show_pub_date\":true,\"hide_thumbnails\":false,\"show_kicker\":false,\"show_title\":false,\"show_related_topics\":true,\"show_rad_links\":true,\"show_subtopics\":true,\"exclude_topics\":\"SCHULZ, WILLIAM F\",\"more_on_header\":\"MORE ON WILLIAM F. SCHULZ AND:\",\"alternate_index_subidx\":\"\",\"show_thumbnails\":true}\n\nIn a report being released today, Amnesty International accuses Russia, China, Poland, Belarus and other countries of selling military weaponry to Sudan despite the fact that the weapons are being used to conduct human rights abuses against civilians...\n\nTo the Editor: In ''Justice, Nigeria's Way'' (Op-Ed, Oct. 4), Helon Habila says human rights groups didn't ''aid the cause of human rights'' by taking up the case of Amina Lawal, who was sentenced by an Islamic court to death by stoning.", "\n\nOctober 10, 2003, Friday\n\nTo the Editor: ''At Mass Grave in Iraq Marsh, an Open Secret Is Laid Bare'' (front page, May 14) states that Amnesty International reported that 17,000 Iraqis disappeared over the last 20 years. ", "This number reflects the Iraqi ''disappeared'' for...\n\nMarch 13, 2003, Thursday\n\nTo the Editor: Re ''U.S. Is Completing Plan to Promote a Democratic Iraq'' (front page, Jan. 6): In a September report, the Bush administration listed the decades of human rights violations by the Iraqi government, including arbitrary arrest and...\n\nGiven all the interest these days in the founding fathers, especially John Adams, it shouldn't be surprising that some writers are citing different Adamses as they wage one of the longest-running debates in American history. ", "What are the respective...\n\nTo the Editor: Re ''Needed: Freedom's Caucus,'' by William Safire (column, May 31): Amnesty International in no way ''celebrated'' the removal of the United States from the United Nations Human Rights Commission. ", "We have applauded the United...\n\nJune 5, 2001, Tuesday\n\nTo the Editor: President Andrés Pastrana of Colombia says he is cracking down on paramilitary groups (news article, Feb. 27), but during his presidency the human rights situation has deteriorated and paramilitary groups are now responsible for 80...\n\nMarch 4, 2001, Sunday\n\nTo the Editor: Re ''Saudi Heir Urges Reform, and Turn from U.S.'' (front page, Dec. 4): The Saudi government's recent ratification of several international human rights conventions is a good beginning, but the provisions of these treaties must..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.001194383017718792, 0.0007723118760623038, 0.0006045117625035346, 0.0005863111582584679, 0.0005928162136115134 ]

[ "Yesterday, I checked out a Radio Spirits CD collection of Green Hornet episodes from 1944 (no, the CD's weren't from 1944; they were brand new) and in reading the little booklet that came with it, I found out an interesting bit of trivia--Britt Reid, the Green Hornet, was the great nephew of the Lone Ranger!", "\n\nBoth shows originated at the Michigan Radio Network's flagship station, WXYZ and were created by a man named George W. Trendle. ", "He is quoted in the booklet as saying the Green Hornet was, in essence, a spinoff of the Lone Ranger.", "\n\n\"When I first conceived the character, the idea was to connect it up with The Lone Ranger,\" explained George W. Trendle. \"", "As we had a character in the Lone Ranger who was the Ranger's nephew, one Dan Reid, a young boy of 14 or 15 who occasionally traveled with the Ranger. ", "I had young Dan sent east to finishing school by the Lone Ranger where Dan eventually became a newspaperman and owner of a large metropolitan newspaper. ", "His son, who is Britt Reid of the Green Hornet was, in his youth, a playboy; and as his dad wanted to make a man out of him, he turned the newspaper over to Britt to see if the responsibility of that sort of job would bring about the desired result.\"", "\n\nThe booklet goes on to say that Britt Reid kept his secret identity as the Green Hornet from his father for more than a decade before finally revealing it in 1947, the show having started in early 1936. ", "In the episode where he reveals his identity, his father tells him about his great uncle, the Lone Ranger. ", "It seems masks run in the family.", "\n\nI'm kind of looking forward to the Green Hornet movie that's coming out after Christmas, although my usual reservations about such things stands firm in this case: It'll either be really good or it will really stink and there won't be much in the way of room for middle ground between the two. ", "Either way, I somehow I doubt there will be any mention of the Lone Ranger in the movie.", "\n\nAlso the late Fred foy (who passed away earlier this week)was the annoer for at least to of the three The Lone Ranger and the green hornet. ", "iHe may have also down Challenge of the Yukon. ", "However jay michael was the primary announcer for the hornet and Yukon.", "\n\nAlso Brace Beemer played Preston in the latter year of the show. ", "Interestingly enough the actual star of the Yukon show was the Dog King. ", "Trendle had thei idea when he made preston to make the dog the star of the show.", "\n\nGetting back to the hornet Al Hodge who ws the Hernet early in the series went on to star as Captain Video in the early days oftelevision.", "\n\nI actually saw a comic strip in some 1930's or 1940's Canadian paper the other day that had King as the star of the strip rather than \"Sgt Preston\" (although, not sure it was Preston - it WAS a Royal Mounted Popo.) ", "I believe the name of the strip was called, \"King.", "\"_________________http://otrbuffet.blogspot.com\n\nAlso Mr. Beemer did the voice of The Lone Ranger during part of its run on the radio I believe. ", "It's interesting how many characters some radio actors performed way back when.", "\n\nTHESHADOW wrote:\n\nAlso the late Fred foy (who passed away earlier this week)was the annoer for at least to of the three The Lone Ranger and the green hornet. ", "iHe may have also down Challenge of the Yukon. ", "However jay michael was the primary announcer for the hornet and Yukon.", "\n\nAlso Brace Beemer played Preston in the latter year of the show. ", "Interestingly enough the actual star of the Yukon show was the Dog King. ", "Trendle had thei idea when he made preston to make the dog the star of the show.", "\n\nGetting back to the hornet Al Hodge who ws the Hernet early in the series went on to star as Captain Video in the early days oftelevision." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006082127219997346, 0.0006618194747716188, 0.0005884537240490317, 0.0006048494833521545, 0.0006186558748595417, 0.0006663360982201993, 0.0008307975949719548, 0.0006424662424251437, 0.0006291302270255983, 0.0008634457481093705, 0.004679343197494745, 0.0005812013405375183, 0.0008014182094484568, 0.0007239010301418602, 0.0005987412296235561, 0.0006936679128557444, 0.0006680153892375529, 0.0009292003232985735, 0.000770054233726114, 0.0006469255313277245, 0.000831283803563565, 0.000695057213306427, 0.0005692580598406494, 0.0010341765591874719, 0.0007239010301418602, 0.0005987412296235561, 0.0006936679128557444, 0.0006680153892375529, 0.0009292003232985735, 0.000770054233726114 ]

[ "Q:\n\nHow does jurisdiction of international courts work?", "\n\nMy understanding is that states who are signatories to international court are bound to respond to a lawsuit brought against them by another member state. ", "Is that correct assessment?", "\nOr it’s case by case where a state can refuse to accept international Court intervention in a particular case?", "\nIn other words, are BOTH countries’ consent required in each case for international Court to proceed with that case?", "\n\nA:\n\nA case in the International Court of Justice can be brought by one state. ", "The defendant state does not need to be consulted when the case is brought.", "\nHowever, all state parties must agree and recognise the jurisdiction of the ICJ in a particular matter. ", "This can happen in three ways: \n\nboth parties agree to seek recourse to the Court,\na clause in a treaty states that disputes will be resolved in the Court\na state can agree to be bound only in respect of other states that also have agreed to be bound. ", "This is called an \"Optional clause declaration\".", "\n\nFor example.", "\n\nYabulistan and Tokmania both claim the Mago islands. ", " To avoid war they jointly agree to allow the ICJ to consider the legal case.", "\nSome years ago, Tokmania and Yabulistan signed a treaty which allowed Tokmanian citizens the right to pass through Yabulistan to the Tokmanian enclave of Kingsburgh. ", "In return, Tokmania allows Yabulistan tariff free access to its agricultural markets. ", "The treaty contains a clause which says that any dispute will be resolved by the ICJ. ", "Recently Yabulistan has been requiring Tokmanians to travel on foot. ", "Tokmania believes this is a breach of the treaty and takes Yabulistan to court. ", "\nYabulistan sees a benefit in binding itself to the ICJ. ", "It passes a law which says that it agrees to be bound by decisions of the ICJ in cases brought by other states that also have agreed to this bind. ", "If Tokmania also passes a similar law (called an \"optional law declaration\") then Tokmania can bring a case against Yabulistan without a special agreement.", "\n\nThe decisions of the court are binding to the extent that the various nations have agreed to this by joining the UN. ", "Article 94 of the charter provides for the power of the court to make binding decisions. ", "A nation that ignores a decision of the Court could be subject to UN sanctions up to a Security Council authorised military action against that nation.", "\nIn the particular case of India and Pakistan. ", " Pakistan has made an optional clause declaration (renewed in 2017), as has India (in 1974). ", "Thus both countries recognise the jurisdiction of the ICJ, with some reservations. ", "However one of the reservations is \"disputes with the government of any State which is or has been a Member of the Commonwealth of Nations\". ", " A list of the declarations is held by the ICJ\nSee https://www.icj-cij.org/en/frequently-asked-questions\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007210932672023773, 0.0006975290598347783, 0.0007194147328846157, 0.0007064692326821387, 0.0006449696375057101, 0.0006036184495314956, 0.0005779804196208715, 0.0005419186200015247, 0.0005528979818336666, 0.0006245015538297594, 0.0007242715801112354, 0.0008768084226176143, 0.0007376084686256945, 0.0005647086072713137, 0.0006717363139614463, 0.0005692081758752465, 0.0006183060468174517, 0.0006533026462420821, 0.0007526112603954971, 0.0006277648499235511, 0.0006766777951270342, 0.000571821816265583, 0.0006150684203021228, 0.0009299580124206841, 0.0005490151233971119, 0.0005373414023779333, 0.0005342588410712779, 0.0005469811731018126, 0.000555853359401226 ]

[ "Anti-SSA/Ro52 autoantibodies in scleroderma: results of an observational, cross-sectional study.", "\nTo date, the diagnostic utility of anti-SSA/Ro52 autoantibodies in scleroderma and the association of them with certain clinical manifestations, particularly inflammatory myositis, are still controversial. ", "This paper aims to assess the correlation between the presence of anti-SSA/Ro52 antibodies and the demographic, clinical and prognosis characteristics of patients with systemic sclerosis (SSc). ", "This is a retrospective, cross-sectional and observational study in patients with SSc. ", "Baseline demographic and clinical characteristics were recorded. ", "Presence of anti-SSA/Ro52, anti-SSA/Ro, anti-SSB/La, snRNP/Sm, anti-centromere, anti-Scl-70 and anti-PM-Scl were analysed by immunoblot, and antinuclear antibodies (ANA) by indirect immunofluorescence. ", "Statistical analysis was performed with PASW Statics 18 software. ", "A total of 132 consecutive patients with analysis of anti-SSA/Ro52 antibodies were selected from a Spanish cohort of 408 patients with SSc, 87.1% of them being women. ", "About half of patients had the limited form (51.5%), followed by diffused form (18.9%), sclerosis sine scleroderma (22.7%), and pre-scleroderma (6.8%). ", "Prevalence of anti-SSA/Ro52 was 35.6%. ", "No association between anti-SSA/Ro52 and clinical manifestations was found, while detection of anti-SSA/Ro52 was significantly associated with the presence of anti-Ro. ", "The results of our study show that anti-SSA/Ro52 antibodies are often found in SSc patients. ", "No clinical manifestations, including inflammatory myopathy, were related with anti-SSA/Ro antibodies." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006315741338767111, 0.0007182052358984947, 0.000700770178809762, 0.0005941686686128378, 0.0005447125295177102, 0.0007561052916571498, 0.0005831047892570496, 0.0007747514173388481, 0.0008143193554133177, 0.0008093983633443713, 0.0007446382660418749, 0.0006059628212824464, 0.0009233786258846521 ]

[ "Battle Order 204 by Christobel Mattingley\n\nDavid's boyhood desires of flying led him to England for months of teaching to be a bomber pilot in global battle II at age 19, yet his ultimate flight was once a nightmare. ", "Seconds after the bombs have been published, David used to be wounded in 5 locations and his fellow pilot puppy used to be hit. ", "Flying steel slashed his correct knee, thigh, and shoulder; the tendons and artery in his correct hand have been severed; and shrapnel ripped via his thick leather-based helmet, fracturing his cranium as his plane went right into a dive. ", "This riveting actual tale takes teens in the course of the occasions of a tender WWII pilot’s heroic trip and his braveness and patience within the face of terrifying conditions.", "\n\nCompelled from her downtown ny residence via the terrorist assault of September eleven, journalist Wendy Bounds was once brought to Guinan's doorstep -- a mythical Irish ingesting gap and state shop nestled alongside the banks of the Hudson River within the small city of Garrison, manhattan -- by way of a chum. ", "Captivated by way of the bar's charismatic yet ill proprietor and his captivating, motley customers, Bounds uprooted herself completely and moved to tiny Garrison, the picturesque river city all of them name domestic.", "\n\n“A significant contribution to the knowing of Hasidic knowledge and notion; it brings the reader towards Hasidism’s maximum teller of stories. ”", "―Elie Wiesel the quest for religious that means drives nice leaders in all religions.", "\n\nSorting delusion from fact during this striking story of braveness and heroism, Anne Schraff breathes new existence into the tale of the main recognized \"conductor\" at the Underground Railroad. \"", "I grew up like a ignored weed—ignorant of liberty, having no event of it. ", "Now i have been unfastened, i do know what a dreadful slavery is.", "\n\nIt was mid-January. ", "There was no shade or shelter for the young airmen, and the planes, made of wood and plywood, sat out in the sun all day, and were blisteringly hot when on the ground. ", "They were Oxfords, twin-engined monoplanes, more than twice the size of the single-engined biplane Tiger Moths. ", "The landscape, too, was very different. ", "After Tasmania’s spring and early summer verdure, rivers and purple mountains, the expanse of sunburnt brown paddocks shimmering in the heat, windswept and treeless, was a shock and the glare was much harder on the eyes.", "\n\nFatigue, punishment for small misdemeanours such as being late on parade, meant extra latrine cleaning or kitchen work. ", "One day, David and his companion were on guard duty when a carload of girls became bogged in the sandy track nearby. ", "In reward for their gallantry in digging out the car, the girls gave them each an enamel mug full of sherry! ", "The boys were lucky to escape punishment. ", "At dinner, everyone was also hungry for the mail which was distributed, eager for news from home. ", "The big moment when ‘the eagle shat’ came once a fortnight at pay parade, and each man received four pounds and four shillings – six shillings per day.", "\n\nDrill, marching and physical training before lunch provided a welcome break from concentrated study. ", "The recruits moaned about the weekly cross-country run, but gradually everyone grew fitter and tougher, losing puppy fat or flab. ", "indd 26 2/4/07 3:15:57 PM Name, Rank and Number Daily duties included kitchen work, cleaning latrines and guard duties. ", "Fatigue, punishment for small misdemeanours such as being late on parade, meant extra latrine cleaning or kitchen work. ", "One day, David and his companion were on guard duty when a carload of girls became bogged in the sandy track nearby." ]

{ "pile_set_name": "Pile-CC" }

[ 0.001280190539546311, 0.0012906361371278763, 0.05837392807006836, 0.0010932069271802902, 0.0008031271863728762, 0.0013032585848122835, 0.0007239504484459758, 0.000698121904861182, 0.001004568999633193, 0.16002914309501648, 0.008466260507702827, 0.0008340727654285729, 0.0010760357836261392, 0.0008150917710736394, 0.0006221347721293569, 0.0009461296140216291, 0.0015020387945696712, 0.003580547170713544, 0.0007219028775580227, 0.002156756818294525, 0.000576245307456702, 0.001205527107231319, 0.0005598133429884911, 0.148237943649292, 0.0009426222532056272, 0.0015020387945696712, 0.003580547170713544 ]

[ "The promises of cancer immunotherapy have not been translated into clinical successes because immune-suppressive mechanisms that act in cancer patients can block effective anti-tumor immunity. ", "Therefore, to eradicate cancers by immunotherapy, tumor-induced immunosuppression must be overcome. ", "We have recently demonstrated a novel tumor-intrinsic immunosuppressive mechanism whereby tumor-derived CD73 functions as an ecto-enzyme to produce extracellular adenosine which limits anti-tumor T cell immunity to promote tumor growth via adenosine receptor (AR) signaling. ", "We also found that CD73 expression in malignant cancers was closely associated with poor immune status of tumor infiltrating effector T cells. ", "Our exciting preliminary data using CD73 siRNA-treated tumor cells and CD73-/- mice indicated that ablation of both tumor and host CD73 synergistically inhibited tumor growth in a T cell-dependent manner. ", "A similar anti-tumor effect was observed by pharmacological blockade of CD73 using the selective inhibitor a,-methylene adenosine 5'-diphosphate (APCP). ", "Thus, we hypothesize that both tumor and host CD73 through their enzymatic activity prevent tumor destruction by incoming anti-tumor T cells. ", "We here plan to further clarify the mechanisms of tumor protection by which CD73 expression on either tumor cells or host cells impacts anti-tumor T cell responses. ", "Because endogenous anti-tumor immunity, even if restored, is often insufficient and transient, targeted CD73 cancer therapy may not be optimal unless combined with other forms of immunotherapy, such as adoptive T cell transfer or DC vaccines. ", "Several immunogenic tumors will be tested to assess the efficacy of endogenous and adoptively transferred anti-tumor CD8+ T cell immunity in combination with CD73 ablation. ", "Finally, to establish the translational relevance of targeted CD73 therapy, we will explore the preclinical potential of inhibiting CD73 using APCP or an anti-CD73 monoclonal antibody (mAb) combined with T cell therapy. ", "PUBLIC HEALTH RELEVANCE: By the completion of these studies, we will gain insight into the immunosuppressive mechanisms of CD73 in the cancer microenvironment and, more importantly, we will validate a novel and feasible strategy of cancer treatment. ", "This therapeutic approach may enhance chemotherapy and particularly T cell-based therapy by enhancing the adaptive immune response machinery, which may increase the function of tumor-infiltrating CD8+ T lymphocytes, and subsequently lead to improved survival in cancer patients." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.0008990843780338764, 0.0009663661476224661, 0.0007244914304465055, 0.0010156139032915235, 0.0006150467088446021, 0.0008744696970097721, 0.0008068890310823917, 0.0006372628849931061, 0.0007263279403559864, 0.0006319184903986752, 0.000626127643045038, 0.0005210246308706701, 0.0008810653234831989 ]

[ "Odontogenic keratocysts in a 5-year-old: initial manifestations of nevoid basal cell carcinoma syndrome.", "\nThe purpose of this paper is to report the occurrence of odontogenic keratocysts in a young child. ", "Odontogenic keratocysts are one of the principal features of nevoid basal cell carcinoma syndrome. ", "Their occurrence in this syndrome is usually during the second or third decades of life. ", "This report describes the occurrence of odontogenic keratocysts in a 5-year-old, which proved to be the initial presentation of nevoid basal cell carcinoma syndrome and highlights the need to consider this syndrome as a possible diagnosis in all cases of odontogenic keratocysts." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.011054485104978085, 0.001864773454144597, 0.02431359514594078, 0.0007902014185674489, 0.0014958661049604416 ]

[ "A cognitive-affective approach to understanding individual differences in stress propensity and resultant strain.", "\nThe cognitive-affective model of the stress response provides a framework for making inferences about individual differences in stress propensity and levels of resultant strain. ", "A new cognitive-affective conceptualization provides a means of analyzing mediating processes affecting psychological and physiological reactions to stressors. ", "The model also facilitates examination and understanding of a latent cognitive-affective stress propensity construct that moderates the relationships between stressors and strain. ", "Propositions are presented with the intention of stimulating further research." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006217506597749889, 0.0005813204916194081, 0.0006174865993671119, 0.0006062559550628066, 0.0005554844392463565 ]

[ "Volodymyr Shandra\n\nVolodymyr Mykolajovych Shandra () is Ukrainian politician and former Governor of Kiev Oblast.", "\n\nEducation \nSince 1981, he studied at the Faculty of Nuclear Power Plants and equipment for the Moscow Engineering Physics Institute (later — Obninsk Institute for Nuclear Power Engineering), specializing in thermal power engineer. ", "In 2006 he graduated from the National Academy of Management, where he received a master's degree in finance.", "\n\nPhD in Economics. ", "He defended his thesis on technological innovation economy in innovative practice.", "\n\nWork Experience \n1980 — started his career grinder for the production association \"Ternopil combine factory\".", "\n\n1987 — after graduation he worked at the Khmelnitskiy Nuclear Power Plant, where he rose from the reactor operator's compartment, a senior engineer with repair and maintenance of equipment of the reactor compartment to the chief engineer of the control reactor.", "\n\nFrom 1992 to 2002 works in private sector of economics.", "\n\nPolitics \nIn 2002, Vladimir Shandra elected deputy of Ukraine under Yushchenko Bloc \"Our Ukraine\" (No. ", "39). ", "He was Deputy Chairman of the Verkhovna Rada of Ukraine on Industrial Policy and Entrepreneurship.", "\n\nIn the presidential election of 2004 was led by Khmelnytsky Regional Headquarters coalition \"People Power\".", "\n\nFrom February 2005 to August 2006 served as Minister of Industrial policy of Ukraine.", "\n\nIn 2006–2007 — Advisor to the President of Ukraine. ", "He was Chairman of the NGO \"Institute for Social and Economic Development\".", "\n\nIn 2006–2008 — member of the supervisory board of the State Savings Bank of Ukraine and the State Export-Import Bank.", "\n\nIn the parliamentary elections of 2007, ran for Parliament Bloc \"Our Ukraine — People's Self-Defense\" (No. ", "75). ", "At the head of the electoral re-election headquarters in Khmelnytsky region.", "\n\n18 December 2007 – 11 March 2010 — Minister of Ukraine of Emergencies and Affairs of Population Protection from the Consequences of Chornobyl Catastrophe (appointed by the Supreme Council of Ukraine No. ", "10-VI of 18 December 2007 and dismissed by the Verkhovna Rada of Ukraine on 11 March 2010 number 1965-VI).", "\n\nHe was a member of the party \"People's Union \"Our Ukraine\".", "\n\nOn 2 March 2014 Acting President Oleksandr Turchynov appointed Shandra Governor of Kiev Oblast. ", "Shandra resigned from this post on 27 January 2016. ", "Seven days later he was appointed as advisor to President Petro Poroshenko.", "\n\nFamily \nWife Antonina Єvgenіvna (1960).", "\n\nHe has two sons — Andrew (1980) and Anton (1994).", "\n\nAwards and titles \nA civil servant rank 1 (October 2006). ", "He was awarded the Order of Merit III degree (September 2008).", "\n\nReferences\n\nExternal links \nBiography\n\nCategory:Government of Yulia Tymoshenko\n\nCategory:1963 births\nCategory:People from Zboriv\nCategory:Our Ukraine (political party) politicians\nCategory:Living people\nCategory:Industrial policy ministers of Ukraine\nCategory:Emergency ministers of Ukraine\nCategory:Recipients of the Order of Merit (Ukraine), 3rd class\nCategory:Governors of Kiev Oblast" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.001729993149638176, 0.0006200965726748109, 0.0006231082370504737, 0.0006656512268818915, 0.0005570025532506406, 0.0009004797320812941, 0.0006537656881846488, 0.0006165530649013817, 0.000631134316790849, 0.0009051609667949378, 0.0007655168883502483, 0.0006965422653593123, 0.000695985509082675, 0.0006812039064243436, 0.0006020103464834392, 0.000638058700133115, 0.0007266197353601456, 0.0008797381888143718, 0.0009131930419243872, 0.0006556498119607568, 0.0008057599188759923, 0.0012127576628699899, 0.0006412413204088807, 0.0007773223333060741, 0.000688091095071286, 0.0006863130256533623, 0.0007906559621915221, 0.0005684702773578465, 0.0006407293258234859, 0.0005388919380493462 ]

[ "# -*- coding: utf-8 -*-\r\nfrom django.shortcuts import render, Http404, HttpResponseRedirect\r\nfrom django.contrib import auth\r\nfrom django.contrib.auth.decorators import login_required\r\nfrom django.template import Context, RequestContext, loader\r\nfrom django.template.context_processors import csrf\r\nfrom django.http import HttpResponse\r\nfrom django.http import JsonResponse\r\nfrom django.db.models import Q\r\nfrom django.core.files.base import ContentFile\r\nfrom django.utils import timezone\r\nfrom collections import OrderedDict\r\nfrom django.views.decorators.csrf import csrf_exempt\r\nimport datetime\r\nimport pytz\r\nimport re\r\nimport json\r\n\r\n# import pymysql\r\nimport time\r\nfrom time import strftime, localtime\r\nfrom ffxivbot.models import *\r\nfrom ffxivbot.handlers.", "QQUtils import *\r\nfrom channels.layers import get_channel_layer\r\nfrom asgiref.sync import async_to_sync\r\nfrom hashlib import md5\r\nimport math\r\nimport requests\r\nimport base64\r\nimport random\r\nimport sys\r\nimport traceback\r\nimport codecs\r\nimport html\r\nimport hmac\r\nfrom bs4 import BeautifulSoup\r\nimport urllib\r\nfrom websocket import create_connection\r\n\r\n\r\ndef webapi(req):\r\n res_dict = {\"response\": \"error\", \"msg\": \"Request not handled\", \"rcode\": \"102\"}\r\n try:\r\n req_json = json.loads(req.body)\r\n req_data = req_json[\"data\"]\r\n request_type = req_json[\"request\"]\r\n if request_type == \"weather\":\r\n territory_name = req_data[\"territory\"]\r\n territory = None\r\n try:\r\n territory = Territory.objects.get(name=territory_name)\r\n except Territory.", "DoesNotExist:\r\n for temp in Territory.objects.all():\r\n for temp_name in json.loads(temp.nickname):\r\n if temp_name in territory_name or territory_name in temp_name:\r\n territory = temp\r\n break\r\n if territory:\r\n break\r\n if not territory:\r\n res_dict = {\r\n \"response\": \"error\",\r\n \"msg\": \"Territory {} not found\".format(territory_name),\r\n \"rcode\": \"1001\",\r\n }\r\n else:\r\n weather_name = (\r\n None if \"weather\" not in req_data.keys() else req_data[\"weather\"]\r\n )\r\n length = 10 if \"length\" not in req_data.keys() else req_data[\"length\"]\r\n length = min(length, 100)\r\n length = max(length, -100)\r\n TIMEFORMAT_MDHMS = \"%Y-%m-%d %H:%M:%S\"\r\n if weather_name:\r\n try:\r\n weathers = Weather.objects.filter(name=weather_name)\r\n times = getSpecificWeatherTimes(\r\n territory, weathers, length, TIMEFORMAT_MDHMS\r\n )\r\n res_dict = {\r\n \"response\": \"success\",\r\n \"msg\": \"\",\r\n \"rcode\": \"0\",\r\n \"data\": times,\r\n }\r\n except Weather.", "DoesNotExist:\r\n res_dict = {\r\n \"response\": \"error\",\r\n \"msg\": \"Weather {} not found\".format(weather_name),\r\n \"rcode\": \"1002\",\r\n }\r\n else:\r\n times = getFollowingWeathers(\r\n territory, length, TIMEFORMAT_MDHMS, unixSeconds=time.time()\r\n )\r\n res_dict = {\r\n \"response\": \"success\",\r\n \"msg\": \"\",\r\n \"rcode\": \"0\",\r\n \"data\": times,\r\n }\r\n\r\n elif request_type == \"dps\":\r\n boss_name = req_data[\"boss\"]\r\n boss_obj = None\r\n CN_source = False\r\n boss_list = Boss.objects.all()\r\n for boss in boss_list:\r\n try:\r\n boss_nicknames = json.loads(boss.nickname)[\"nickname\"]\r\n except KeyError:\r\n boss_nicknames = []\r\n boss_nicknames.append(boss.name)\r\n boss_nicknames.append(boss.cn_name)\r\n boss_nicknames.sort(key=len, reverse=True)\r\n for item in boss_nicknames:\r\n if boss_name.find(item) == 0:\r\n boss_obj = boss\r\n break\r\n if boss_obj:\r\n break\r\n if not boss_obj:\r\n res_dict = {\r\n \"response\": \"error\",\r\n \"msg\": \"Boss {} not found\",\r\n \"rcode\": \"1011\",\r\n }\r\n else:\r\n job_name = req_data[\"job\"]\r\n job_list = Job.objects.all()\r\n job_obj = None\r\n for job in job_list:\r\n try:\r\n job_nicknames = json.loads(job.nickname)[\"nickname\"]\r\n except KeyError:\r\n job_nicknames = []\r\n job_nicknames.append(job.name)\r\n job_nicknames.append(job.cn_name)\r\n job_nicknames.sort(key=len, reverse=True)\r\n for item in job_nicknames:\r\n if job_name.find(item) == 0:\r\n job_obj = job\r\n break\r\n if job_obj:\r\n break\r\n if not job_obj:\r\n res_dict = {\r\n \"response\": \"error\",\r\n \"msg\": \"Job {} not found\",\r\n \"rcode\": \"1012\",\r\n }\r\n else:\r\n CN = req_data[\"CN\"] if \"CN\" in req_data.keys() else False\r\n day = (\r\n req_data[\"day\"]\r\n if \"day\" in req_data.keys()\r\n else math.ceil(\r\n (int(time.time()) - boss_obj.cn_add_time) / (24 * 3600)\r\n )\r\n )\r\n atk_res = crawl_dps(\r\n boss=boss_obj, job=job_obj, day=day, CN_source=CN\r\n )\r\n if isinstance(atk_res, str):\r\n res_msg = atk_res.replace(\"Error:\", \"\", 1)\r\n res_dict = {\r\n \"response\": \"error\",\r\n \"msg\": \"DPS parsing error: {}\".format(res_msg),\r\n \"rcode\": \"1013\",\r\n }\r\n else:\r\n res_dict = {\r\n \"response\": \"success\",\r\n \"msg\": \"\",\r\n \"rcode\": \"0\",\r\n \"data\": {\r\n \"day\": day,\r\n \"source\": (\"CN\" if CN else \"Intl\"),\r\n \"dps\": atk_res,\r\n },\r\n }\r\n\r\n elif request_type == \"search\": # 102X\r\n name = req_data[\"name\"]\r\n search_res = search_item(\r\n name,\r\n \"https://ff14.huijiwiki.com\",\r\n \"https://cdn.huijiwiki.com/ff14/api.php\",\r\n url_quote=False,\r\n )\r\n res_dict = {\r\n \"response\": \"success\",\r\n \"msg\": \"\",\r\n \"rcode\": \"0\",\r\n \"data\": search_res,\r\n }\r\n elif request_type == \"raid\": # 103X\r\n wol_name = req_data[\"name\"]\r\n server_name = req_data[\"server\"]\r\n server = None\r\n servers = Server.objects.all()\r\n for s in servers:\r\n if server_name in str(s.name) or server_name in str(s.alter_names):\r\n server = s\r\n if not server:\r\n res_dict = {\r\n \"response\": \"error\",\r\n \"msg\": \"Server {} not found\".format(server_name),\r\n \"rcode\": \"1031\",\r\n }\r\n else:\r\n raid_data = {}\r\n data = {\r\n \"method\": \"queryhreodata\",\r\n \"name\": wol_name,\r\n \"areaId\": server.areaId,\r\n \"groupId\": server.groupId,\r\n }\r\n r = requests.post(\r\n url=\"http://act.ff.sdo.com/20180525HeroList/Server/HeroList171213.ashx\",\r\n data=data,\r\n )\r\n res = json.loads(r.text)\r\n raid_data.update({\"sigma\": res})\r\n r = requests.post(\r\n url=\"http://act.ff.sdo.com/20171213HeroList/Server/HeroList171213.ashx\",\r\n data=data,\r\n )\r\n res = json.loads(r.text)\r\n raid_data.update({\"delta\": res})\r\n res_dict = {\r\n \"response\": \"success\",\r\n \"msg\": \"\",\r\n \"rcode\": \"0\",\r\n \"data\": {\r\n \"name\": wol_name,\r\n \"server\": server_name,\r\n \"raid\": raid_data,\r\n },\r\n }\r\n\r\n except json.decoder.", "JSONDecodeError:\r\n res_dict = {\"response\": \"error\", \"msg\": \"JSON decode error\", \"rcode\": \"103\"}\r\n except KeyError:\r\n res_dict = {\"response\": \"error\", \"msg\": \"KeyError\", \"rcode\": \"104\"}\r\n except TypeError:\r\n res_dict = {\"response\": \"error\", \"msg\": \"Parameter type error\", \"rcode\": \"105\"}\r\n except Exception as e:\r\n res_dict = {\r\n \"response\": \"error\",\r\n \"msg\": \"Unhandled Exception: {}\".format(e),\r\n \"rcode\": \"-1\",\r\n }\r\n return res_dict\r\n\r\n\r\ndef github_webhook(req):\r\n req_json = json.loads(req.body)\r\n event_type = req.", "META.get(\"HTTP_X_GITHUB_EVENT\")\r\n msg = None\r\n if not event_type:\r\n pass\r\n # return HttpResponse(\"Can't get github event type.\", ", "status=500)\r\n elif event_type == \"ping\":\r\n msg = req_json.get(\"zen\", \"Hello from github\")\r\n elif event_type == \"push\":\r\n pusher = req_json.get(\"pusher\")\r\n repo = req_json.get(\"repository\")\r\n msg = \"New push to {}:\\n\".format(repo.get(\"full_name\"))\r\n msg += \"Pusher: {}\\n\".format(pusher.get(\"name\") or pusher.get(\"username\"))\r\n msg += \"Ref: {}\\n\".format(req_json.get(\"ref\"))\r\n msg += \"Commits:\\n\"\r\n for commit in req_json.get(\"commits\"):\r\n msg += \" {}: {}\\n\".format(commit[\"id\"][:7], commit[\"message\"])\r\n msg += \"Check at {}\".format(req_json.get(\"compare\") or req_json.get(\"compare_url\"))\r\n elif event_type == \"pull_request\":\r\n action = req_json.get(\"action\")\r\n number = req_json.get(\"number\")\r\n pr = req_json.get(\"pull_request\")\r\n repo = req_json.get(\"repository\")\r\n pusher = pr.get(\"user\").get(\"login\")\r\n if action == \"opened\":\r\n msg = \"{} opened a new pull request to {}:\\n\".format(\r\n pusher, repo.get(\"full_name\")\r\n )\r\n msg += \"#{}:{}\\n\".format(number, pr.get(\"title\"))\r\n else:\r\n msg += \"{} {} PR#{}:{}, state changed to {}.\\n\".format(\r\n pusher, action, number, pr.get(\"title\"), pr.get(\"state\")\r\n )\r\n msg += \"Check at {}\\n\".format(pr.get(\"html_url\"))\r\n elif event_type == \"star\":\r\n action = req_json.get(\"action\")\r\n sender = req_json.get(\"sender\")\r\n repo = req_json.get(\"repository\")\r\n if action == \"created\":\r\n msg = \"{} stared {}\".format(sender.get(\"login\"), repo.get(\"full_name\"))\r\n elif action == \"deleted\":\r\n msg = \"{} canceled star of {}\".format(\r\n sender.get(\"login\"), repo.get(\"full_name\")\r\n )\r\n elif event_type == \"issues\":\r\n action = req_json.get(\"action\")\r\n issue = req_json.get(\"issue\")\r\n number = issue.get(\"number\")\r\n repo = req_json.get(\"repository\")\r\n pusher = issue.get(\"user\").get(\"login\")\r\n if action == \"opened\":\r\n msg = \"{} opened a new issue to {}:\\n\".format(pusher, repo.get(\"full_name\"))\r\n msg += \"#{}:{}\\n\".format(number, issue.get(\"title\"))\r\n else:\r\n msg += \"{} {} issue#{}:{}, state changed to {}.\\n\".format(\r\n pusher, action, number, issue.get(\"title\"), issue.get(\"state\")\r\n )\r\n msg += \"Check at {}\\n\".format(issue.get(\"html_url\"))\r\n elif event_type == \"fork\":\r\n forkee = req_json.get(\"forkee\")\r\n repo = req_json.get(\"repository\")\r\n msg = \"{} forked {} to {}\".format(\r\n forkee.get(\"owner\").get(\"login\"),\r\n repo.get(\"full_name\"),\r\n forkee.get(\"full_name\"),\r\n )\r\n elif event_type == \"gollum\":\r\n pages = req_json.get(\"pages\")\r\n sender = req_json.get(\"sender\")\r\n repo = req_json.get(\"repository\")\r\n msg = \"{} updated wiki pages of {}:\\n\".format(\r\n sender.get(\"login\"), repo.get(\"full_name\")\r\n )\r\n for page in pages:\r\n msg += \"{}:{}\\n\".format(page.get(\"page_name\"), page.get(\"html_url\"))\r\n msg = msg.strip()\r\n else:\r\n msg = 'Github event \"{}\" is not implemented.", "'.format(event_type)\r\n return msg\r\n" ]

{ "pile_set_name": "Github" }

[ 0.001041608746163547, 0.0008789573330432177, 0.0008837200584821403, 0.001621256466023624, 0.0008654489065520465, 0.0007864419603720307, 0.0035578252281993628, 0.0007103186217136681 ]

[ "Q:\n\nhow to pipe an R LDA topic model into Topic Model Visualization Engine (TMVE)?", "\n\nWhat's a good framework for building a topic model and topic browser in Python? ", " \ndocuments --> topic model --> topic browser\n\nTopic Model Visualization Engine (TMVE) might pipe the results of Latent Dirichlet Allocation and arrange them into websites. ", " I have already learned to use topicmodel library in R, but I don't know how to pipe it into TMVE.", "\n\nMainly, I'm looking for solutions that use Python or R. I might just try to build my own (really crappy) topic browers from the R output.", "\nIt looks like this was a hot research topic a year or two ago. ", "The resources on David Blei's page seem to be going out of date. ", " \nTMVE seems to be on gitHub, it was last edited a year ago.", "\n\nA:\n\nYou might also consider the Topical Guide. ", " Here's an out-of-date web-page: https://facwiki.cs.byu.edu/nlp/index.php/Topical_Guide\nThe project is now hosted on GitHub.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006730291643179953, 0.0005888663581572473, 0.0006440694560296834, 0.0006054668920114636, 0.012286126613616943, 0.000575656013097614, 0.0006241343799047172, 0.0009198454208672047, 0.000525600160472095, 0.0008486304432153702, 0.001995444530621171 ]

[ "{\n \"version\":\"2.0\",\n \"metadata\":{\n \"apiVersion\":\"2015-02-02\",\n \"endpointPrefix\":\"elasticache\",\n \"protocol\":\"query\",\n \"serviceFullName\":\"Amazon ElastiCache\",\n \"signatureVersion\":\"v4\",\n \"uid\":\"elasticache-2015-02-02\",\n \"xmlNamespace\":\"http://elasticache.amazonaws.com/doc/2015-02-02/\"\n },\n \"operations\":{\n \"AddTagsToResource\":{\n \"name\":\"AddTagsToResource\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"AddTagsToResourceMessage\"},\n \"output\":{\n \"shape\":\"TagListMessage\",\n \"resultWrapper\":\"AddTagsToResourceResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"SnapshotNotFoundFault\"},\n {\"shape\":\"TagQuotaPerResourceExceeded\"},\n {\"shape\":\"InvalidARNFault\"}\n ]\n },\n \"AuthorizeCacheSecurityGroupIngress\":{\n \"name\":\"AuthorizeCacheSecurityGroupIngress\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"AuthorizeCacheSecurityGroupIngressMessage\"},\n \"output\":{\n \"shape\":\"AuthorizeCacheSecurityGroupIngressResult\",\n \"resultWrapper\":\"AuthorizeCacheSecurityGroupIngressResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheSecurityGroupNotFoundFault\"},\n {\"shape\":\"InvalidCacheSecurityGroupStateFault\"},\n {\"shape\":\"AuthorizationAlreadyExistsFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"CopySnapshot\":{\n \"name\":\"CopySnapshot\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"CopySnapshotMessage\"},\n \"output\":{\n \"shape\":\"CopySnapshotResult\",\n \"resultWrapper\":\"CopySnapshotResult\"\n },\n \"errors\":[\n {\"shape\":\"SnapshotAlreadyExistsFault\"},\n {\"shape\":\"SnapshotNotFoundFault\"},\n {\"shape\":\"SnapshotQuotaExceededFault\"},\n {\"shape\":\"InvalidSnapshotStateFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"CreateCacheCluster\":{\n \"name\":\"CreateCacheCluster\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"CreateCacheClusterMessage\"},\n \"output\":{\n \"shape\":\"CreateCacheClusterResult\",\n \"resultWrapper\":\"CreateCacheClusterResult\"\n },\n \"errors\":[\n {\"shape\":\"ReplicationGroupNotFoundFault\"},\n {\"shape\":\"InvalidReplicationGroupStateFault\"},\n {\"shape\":\"CacheClusterAlreadyExistsFault\"},\n {\"shape\":\"InsufficientCacheClusterCapacityFault\"},\n {\"shape\":\"CacheSecurityGroupNotFoundFault\"},\n {\"shape\":\"CacheSubnetGroupNotFoundFault\"},\n {\"shape\":\"ClusterQuotaForCustomerExceededFault\"},\n {\"shape\":\"NodeQuotaForClusterExceededFault\"},\n {\"shape\":\"NodeQuotaForCustomerExceededFault\"},\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidVPCNetworkStateFault\"},\n {\"shape\":\"TagQuotaPerResourceExceeded\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"CreateCacheParameterGroup\":{\n \"name\":\"CreateCacheParameterGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"CreateCacheParameterGroupMessage\"},\n \"output\":{\n \"shape\":\"CreateCacheParameterGroupResult\",\n \"resultWrapper\":\"CreateCacheParameterGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheParameterGroupQuotaExceededFault\"},\n {\"shape\":\"CacheParameterGroupAlreadyExistsFault\"},\n {\"shape\":\"InvalidCacheParameterGroupStateFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"CreateCacheSecurityGroup\":{\n \"name\":\"CreateCacheSecurityGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"CreateCacheSecurityGroupMessage\"},\n \"output\":{\n \"shape\":\"CreateCacheSecurityGroupResult\",\n \"resultWrapper\":\"CreateCacheSecurityGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheSecurityGroupAlreadyExistsFault\"},\n {\"shape\":\"CacheSecurityGroupQuotaExceededFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"CreateCacheSubnetGroup\":{\n \"name\":\"CreateCacheSubnetGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"CreateCacheSubnetGroupMessage\"},\n \"output\":{\n \"shape\":\"CreateCacheSubnetGroupResult\",\n \"resultWrapper\":\"CreateCacheSubnetGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheSubnetGroupAlreadyExistsFault\"},\n {\"shape\":\"CacheSubnetGroupQuotaExceededFault\"},\n {\"shape\":\"CacheSubnetQuotaExceededFault\"},\n {\"shape\":\"InvalidSubnet\"}\n ]\n },\n \"CreateReplicationGroup\":{\n \"name\":\"CreateReplicationGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"CreateReplicationGroupMessage\"},\n \"output\":{\n \"shape\":\"CreateReplicationGroupResult\",\n \"resultWrapper\":\"CreateReplicationGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"InvalidCacheClusterStateFault\"},\n {\"shape\":\"ReplicationGroupAlreadyExistsFault\"},\n {\"shape\":\"InsufficientCacheClusterCapacityFault\"},\n {\"shape\":\"CacheSecurityGroupNotFoundFault\"},\n {\"shape\":\"CacheSubnetGroupNotFoundFault\"},\n {\"shape\":\"ClusterQuotaForCustomerExceededFault\"},\n {\"shape\":\"NodeQuotaForClusterExceededFault\"},\n {\"shape\":\"NodeQuotaForCustomerExceededFault\"},\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidVPCNetworkStateFault\"},\n {\"shape\":\"TagQuotaPerResourceExceeded\"},\n {\"shape\":\"NodeGroupsPerReplicationGroupQuotaExceededFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"CreateSnapshot\":{\n \"name\":\"CreateSnapshot\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"CreateSnapshotMessage\"},\n \"output\":{\n \"shape\":\"CreateSnapshotResult\",\n \"resultWrapper\":\"CreateSnapshotResult\"\n },\n \"errors\":[\n {\"shape\":\"SnapshotAlreadyExistsFault\"},\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"ReplicationGroupNotFoundFault\"},\n {\"shape\":\"InvalidCacheClusterStateFault\"},\n {\"shape\":\"InvalidReplicationGroupStateFault\"},\n {\"shape\":\"SnapshotQuotaExceededFault\"},\n {\"shape\":\"SnapshotFeatureNotSupportedFault\"},\n {\"shape\":\"InvalidParameterCombinationException\"},\n {\"shape\":\"InvalidParameterValueException\"}\n ]\n },\n \"DeleteCacheCluster\":{\n \"name\":\"DeleteCacheCluster\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DeleteCacheClusterMessage\"},\n \"output\":{\n \"shape\":\"DeleteCacheClusterResult\",\n \"resultWrapper\":\"DeleteCacheClusterResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"InvalidCacheClusterStateFault\"},\n {\"shape\":\"SnapshotAlreadyExistsFault\"},\n {\"shape\":\"SnapshotFeatureNotSupportedFault\"},\n {\"shape\":\"SnapshotQuotaExceededFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DeleteCacheParameterGroup\":{\n \"name\":\"DeleteCacheParameterGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DeleteCacheParameterGroupMessage\"},\n \"errors\":[\n {\"shape\":\"InvalidCacheParameterGroupStateFault\"},\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DeleteCacheSecurityGroup\":{\n \"name\":\"DeleteCacheSecurityGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DeleteCacheSecurityGroupMessage\"},\n \"errors\":[\n {\"shape\":\"InvalidCacheSecurityGroupStateFault\"},\n {\"shape\":\"CacheSecurityGroupNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DeleteCacheSubnetGroup\":{\n \"name\":\"DeleteCacheSubnetGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DeleteCacheSubnetGroupMessage\"},\n \"errors\":[\n {\"shape\":\"CacheSubnetGroupInUse\"},\n {\"shape\":\"CacheSubnetGroupNotFoundFault\"}\n ]\n },\n \"DeleteReplicationGroup\":{\n \"name\":\"DeleteReplicationGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DeleteReplicationGroupMessage\"},\n \"output\":{\n \"shape\":\"DeleteReplicationGroupResult\",\n \"resultWrapper\":\"DeleteReplicationGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"ReplicationGroupNotFoundFault\"},\n {\"shape\":\"InvalidReplicationGroupStateFault\"},\n {\"shape\":\"SnapshotAlreadyExistsFault\"},\n {\"shape\":\"SnapshotFeatureNotSupportedFault\"},\n {\"shape\":\"SnapshotQuotaExceededFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DeleteSnapshot\":{\n \"name\":\"DeleteSnapshot\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DeleteSnapshotMessage\"},\n \"output\":{\n \"shape\":\"DeleteSnapshotResult\",\n \"resultWrapper\":\"DeleteSnapshotResult\"\n },\n \"errors\":[\n {\"shape\":\"SnapshotNotFoundFault\"},\n {\"shape\":\"InvalidSnapshotStateFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeCacheClusters\":{\n \"name\":\"DescribeCacheClusters\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeCacheClustersMessage\"},\n \"output\":{\n \"shape\":\"CacheClusterMessage\",\n \"resultWrapper\":\"DescribeCacheClustersResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeCacheEngineVersions\":{\n \"name\":\"DescribeCacheEngineVersions\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeCacheEngineVersionsMessage\"},\n \"output\":{\n \"shape\":\"CacheEngineVersionMessage\",\n \"resultWrapper\":\"DescribeCacheEngineVersionsResult\"\n }\n },\n \"DescribeCacheParameterGroups\":{\n \"name\":\"DescribeCacheParameterGroups\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeCacheParameterGroupsMessage\"},\n \"output\":{\n \"shape\":\"CacheParameterGroupsMessage\",\n \"resultWrapper\":\"DescribeCacheParameterGroupsResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeCacheParameters\":{\n \"name\":\"DescribeCacheParameters\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeCacheParametersMessage\"},\n \"output\":{\n \"shape\":\"CacheParameterGroupDetails\",\n \"resultWrapper\":\"DescribeCacheParametersResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeCacheSecurityGroups\":{\n \"name\":\"DescribeCacheSecurityGroups\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeCacheSecurityGroupsMessage\"},\n \"output\":{\n \"shape\":\"CacheSecurityGroupMessage\",\n \"resultWrapper\":\"DescribeCacheSecurityGroupsResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheSecurityGroupNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeCacheSubnetGroups\":{\n \"name\":\"DescribeCacheSubnetGroups\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeCacheSubnetGroupsMessage\"},\n \"output\":{\n \"shape\":\"CacheSubnetGroupMessage\",\n \"resultWrapper\":\"DescribeCacheSubnetGroupsResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheSubnetGroupNotFoundFault\"}\n ]\n },\n \"DescribeEngineDefaultParameters\":{\n \"name\":\"DescribeEngineDefaultParameters\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeEngineDefaultParametersMessage\"},\n \"output\":{\n \"shape\":\"DescribeEngineDefaultParametersResult\",\n \"resultWrapper\":\"DescribeEngineDefaultParametersResult\"\n },\n \"errors\":[\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeEvents\":{\n \"name\":\"DescribeEvents\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeEventsMessage\"},\n \"output\":{\n \"shape\":\"EventsMessage\",\n \"resultWrapper\":\"DescribeEventsResult\"\n },\n \"errors\":[\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeReplicationGroups\":{\n \"name\":\"DescribeReplicationGroups\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeReplicationGroupsMessage\"},\n \"output\":{\n \"shape\":\"ReplicationGroupMessage\",\n \"resultWrapper\":\"DescribeReplicationGroupsResult\"\n },\n \"errors\":[\n {\"shape\":\"ReplicationGroupNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeReservedCacheNodes\":{\n \"name\":\"DescribeReservedCacheNodes\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeReservedCacheNodesMessage\"},\n \"output\":{\n \"shape\":\"ReservedCacheNodeMessage\",\n \"resultWrapper\":\"DescribeReservedCacheNodesResult\"\n },\n \"errors\":[\n {\"shape\":\"ReservedCacheNodeNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeReservedCacheNodesOfferings\":{\n \"name\":\"DescribeReservedCacheNodesOfferings\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeReservedCacheNodesOfferingsMessage\"},\n \"output\":{\n \"shape\":\"ReservedCacheNodesOfferingMessage\",\n \"resultWrapper\":\"DescribeReservedCacheNodesOfferingsResult\"\n },\n \"errors\":[\n {\"shape\":\"ReservedCacheNodesOfferingNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"DescribeSnapshots\":{\n \"name\":\"DescribeSnapshots\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"DescribeSnapshotsMessage\"},\n \"output\":{\n \"shape\":\"DescribeSnapshotsListMessage\",\n \"resultWrapper\":\"DescribeSnapshotsResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"SnapshotNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"ListAllowedNodeTypeModifications\":{\n \"name\":\"ListAllowedNodeTypeModifications\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"ListAllowedNodeTypeModificationsMessage\"},\n \"output\":{\n \"shape\":\"AllowedNodeTypeModificationsMessage\",\n \"resultWrapper\":\"ListAllowedNodeTypeModificationsResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"ReplicationGroupNotFoundFault\"},\n {\"shape\":\"InvalidParameterCombinationException\"},\n {\"shape\":\"InvalidParameterValueException\"}\n ]\n },\n \"ListTagsForResource\":{\n \"name\":\"ListTagsForResource\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"ListTagsForResourceMessage\"},\n \"output\":{\n \"shape\":\"TagListMessage\",\n \"resultWrapper\":\"ListTagsForResourceResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"SnapshotNotFoundFault\"},\n {\"shape\":\"InvalidARNFault\"}\n ]\n },\n \"ModifyCacheCluster\":{\n \"name\":\"ModifyCacheCluster\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"ModifyCacheClusterMessage\"},\n \"output\":{\n \"shape\":\"ModifyCacheClusterResult\",\n \"resultWrapper\":\"ModifyCacheClusterResult\"\n },\n \"errors\":[\n {\"shape\":\"InvalidCacheClusterStateFault\"},\n {\"shape\":\"InvalidCacheSecurityGroupStateFault\"},\n {\"shape\":\"InsufficientCacheClusterCapacityFault\"},\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"NodeQuotaForClusterExceededFault\"},\n {\"shape\":\"NodeQuotaForCustomerExceededFault\"},\n {\"shape\":\"CacheSecurityGroupNotFoundFault\"},\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidVPCNetworkStateFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"ModifyCacheParameterGroup\":{\n \"name\":\"ModifyCacheParameterGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"ModifyCacheParameterGroupMessage\"},\n \"output\":{\n \"shape\":\"CacheParameterGroupNameMessage\",\n \"resultWrapper\":\"ModifyCacheParameterGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidCacheParameterGroupStateFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"ModifyCacheSubnetGroup\":{\n \"name\":\"ModifyCacheSubnetGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"ModifyCacheSubnetGroupMessage\"},\n \"output\":{\n \"shape\":\"ModifyCacheSubnetGroupResult\",\n \"resultWrapper\":\"ModifyCacheSubnetGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheSubnetGroupNotFoundFault\"},\n {\"shape\":\"CacheSubnetQuotaExceededFault\"},\n {\"shape\":\"SubnetInUse\"},\n {\"shape\":\"InvalidSubnet\"}\n ]\n },\n \"ModifyReplicationGroup\":{\n \"name\":\"ModifyReplicationGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"ModifyReplicationGroupMessage\"},\n \"output\":{\n \"shape\":\"ModifyReplicationGroupResult\",\n \"resultWrapper\":\"ModifyReplicationGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"ReplicationGroupNotFoundFault\"},\n {\"shape\":\"InvalidReplicationGroupStateFault\"},\n {\"shape\":\"InvalidCacheClusterStateFault\"},\n {\"shape\":\"InvalidCacheSecurityGroupStateFault\"},\n {\"shape\":\"InsufficientCacheClusterCapacityFault\"},\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"NodeQuotaForClusterExceededFault\"},\n {\"shape\":\"NodeQuotaForCustomerExceededFault\"},\n {\"shape\":\"CacheSecurityGroupNotFoundFault\"},\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidVPCNetworkStateFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"PurchaseReservedCacheNodesOffering\":{\n \"name\":\"PurchaseReservedCacheNodesOffering\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"PurchaseReservedCacheNodesOfferingMessage\"},\n \"output\":{\n \"shape\":\"PurchaseReservedCacheNodesOfferingResult\",\n \"resultWrapper\":\"PurchaseReservedCacheNodesOfferingResult\"\n },\n \"errors\":[\n {\"shape\":\"ReservedCacheNodesOfferingNotFoundFault\"},\n {\"shape\":\"ReservedCacheNodeAlreadyExistsFault\"},\n {\"shape\":\"ReservedCacheNodeQuotaExceededFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"RebootCacheCluster\":{\n \"name\":\"RebootCacheCluster\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"RebootCacheClusterMessage\"},\n \"output\":{\n \"shape\":\"RebootCacheClusterResult\",\n \"resultWrapper\":\"RebootCacheClusterResult\"\n },\n \"errors\":[\n {\"shape\":\"InvalidCacheClusterStateFault\"},\n {\"shape\":\"CacheClusterNotFoundFault\"}\n ]\n },\n \"RemoveTagsFromResource\":{\n \"name\":\"RemoveTagsFromResource\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"RemoveTagsFromResourceMessage\"},\n \"output\":{\n \"shape\":\"TagListMessage\",\n \"resultWrapper\":\"RemoveTagsFromResourceResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheClusterNotFoundFault\"},\n {\"shape\":\"SnapshotNotFoundFault\"},\n {\"shape\":\"InvalidARNFault\"},\n {\"shape\":\"TagNotFoundFault\"}\n ]\n },\n \"ResetCacheParameterGroup\":{\n \"name\":\"ResetCacheParameterGroup\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"ResetCacheParameterGroupMessage\"},\n \"output\":{\n \"shape\":\"CacheParameterGroupNameMessage\",\n \"resultWrapper\":\"ResetCacheParameterGroupResult\"\n },\n \"errors\":[\n {\"shape\":\"InvalidCacheParameterGroupStateFault\"},\n {\"shape\":\"CacheParameterGroupNotFoundFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"RevokeCacheSecurityGroupIngress\":{\n \"name\":\"RevokeCacheSecurityGroupIngress\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"RevokeCacheSecurityGroupIngressMessage\"},\n \"output\":{\n \"shape\":\"RevokeCacheSecurityGroupIngressResult\",\n \"resultWrapper\":\"RevokeCacheSecurityGroupIngressResult\"\n },\n \"errors\":[\n {\"shape\":\"CacheSecurityGroupNotFoundFault\"},\n {\"shape\":\"AuthorizationNotFoundFault\"},\n {\"shape\":\"InvalidCacheSecurityGroupStateFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n },\n \"TestFailover\":{\n \"name\":\"TestFailover\",\n \"http\":{\n \"method\":\"POST\",\n \"requestUri\":\"/\"\n },\n \"input\":{\"shape\":\"TestFailoverMessage\"},\n \"output\":{\n \"shape\":\"TestFailoverResult\",\n \"resultWrapper\":\"TestFailoverResult\"\n },\n \"errors\":[\n {\"shape\":\"APICallRateForCustomerExceededFault\"},\n {\"shape\":\"InvalidCacheClusterStateFault\"},\n {\"shape\":\"InvalidReplicationGroupStateFault\"},\n {\"shape\":\"NodeGroupNotFoundFault\"},\n {\"shape\":\"ReplicationGroupNotFoundFault\"},\n {\"shape\":\"TestFailoverNotAvailableFault\"},\n {\"shape\":\"InvalidParameterValueException\"},\n {\"shape\":\"InvalidParameterCombinationException\"}\n ]\n }\n },\n \"shapes\":{\n \"APICallRateForCustomerExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"APICallRateForCustomerExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"AZMode\":{\n \"type\":\"string\",\n \"enum\":[\n \"single-az\",\n \"cross-az\"\n ]\n },\n \"AddTagsToResourceMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"ResourceName\",\n \"Tags\"\n ],\n \"members\":{\n \"ResourceName\":{\"shape\":\"String\"},\n \"Tags\":{\"shape\":\"TagList\"}\n }\n },\n \"AllowedNodeTypeModificationsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"ScaleUpModifications\":{\"shape\":\"NodeTypeList\"}\n }\n },\n \"AuthorizationAlreadyExistsFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"AuthorizationAlreadyExists\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"AuthorizationNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"AuthorizationNotFound\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"AuthorizeCacheSecurityGroupIngressMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"CacheSecurityGroupName\",\n \"EC2SecurityGroupName\",\n \"EC2SecurityGroupOwnerId\"\n ],\n \"members\":{\n \"CacheSecurityGroupName\":{\"shape\":\"String\"},\n \"EC2SecurityGroupName\":{\"shape\":\"String\"},\n \"EC2SecurityGroupOwnerId\":{\"shape\":\"String\"}\n }\n },\n \"AuthorizeCacheSecurityGroupIngressResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSecurityGroup\":{\"shape\":\"CacheSecurityGroup\"}\n }\n },\n \"AutomaticFailoverStatus\":{\n \"type\":\"string\",\n \"enum\":[\n \"enabled\",\n \"disabled\",\n \"enabling\",\n \"disabling\"\n ]\n },\n \"AvailabilityZone\":{\n \"type\":\"structure\",\n \"members\":{\n \"Name\":{\"shape\":\"String\"}\n },\n \"wrapper\":true\n },\n \"AvailabilityZonesList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"String\",\n \"locationName\":\"AvailabilityZone\"\n }\n },\n \"AwsQueryErrorMessage\":{\"type\":\"string\"},\n \"Boolean\":{\"type\":\"boolean\"},\n \"BooleanOptional\":{\"type\":\"boolean\"},\n \"CacheCluster\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"ConfigurationEndpoint\":{\"shape\":\"Endpoint\"},\n \"ClientDownloadLandingPage\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"Engine\":{\"shape\":\"String\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"CacheClusterStatus\":{\"shape\":\"String\"},\n \"NumCacheNodes\":{\"shape\":\"IntegerOptional\"},\n \"PreferredAvailabilityZone\":{\"shape\":\"String\"},\n \"CacheClusterCreateTime\":{\"shape\":\"TStamp\"},\n \"PreferredMaintenanceWindow\":{\"shape\":\"String\"},\n \"PendingModifiedValues\":{\"shape\":\"PendingModifiedValues\"},\n \"NotificationConfiguration\":{\"shape\":\"NotificationConfiguration\"},\n \"CacheSecurityGroups\":{\"shape\":\"CacheSecurityGroupMembershipList\"},\n \"CacheParameterGroup\":{\"shape\":\"CacheParameterGroupStatus\"},\n \"CacheSubnetGroupName\":{\"shape\":\"String\"},\n \"CacheNodes\":{\"shape\":\"CacheNodeList\"},\n \"AutoMinorVersionUpgrade\":{\"shape\":\"Boolean\"},\n \"SecurityGroups\":{\"shape\":\"SecurityGroupMembershipList\"},\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"SnapshotRetentionLimit\":{\"shape\":\"IntegerOptional\"},\n \"SnapshotWindow\":{\"shape\":\"String\"}\n },\n \"wrapper\":true\n },\n \"CacheClusterAlreadyExistsFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheClusterAlreadyExists\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheClusterList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheCluster\",\n \"locationName\":\"CacheCluster\"\n }\n },\n \"CacheClusterMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"CacheClusters\":{\"shape\":\"CacheClusterList\"}\n }\n },\n \"CacheClusterNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheClusterNotFound\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheEngineVersion\":{\n \"type\":\"structure\",\n \"members\":{\n \"Engine\":{\"shape\":\"String\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"CacheParameterGroupFamily\":{\"shape\":\"String\"},\n \"CacheEngineDescription\":{\"shape\":\"String\"},\n \"CacheEngineVersionDescription\":{\"shape\":\"String\"}\n }\n },\n \"CacheEngineVersionList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheEngineVersion\",\n \"locationName\":\"CacheEngineVersion\"\n }\n },\n \"CacheEngineVersionMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"CacheEngineVersions\":{\"shape\":\"CacheEngineVersionList\"}\n }\n },\n \"CacheNode\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheNodeId\":{\"shape\":\"String\"},\n \"CacheNodeStatus\":{\"shape\":\"String\"},\n \"CacheNodeCreateTime\":{\"shape\":\"TStamp\"},\n \"Endpoint\":{\"shape\":\"Endpoint\"},\n \"ParameterGroupStatus\":{\"shape\":\"String\"},\n \"SourceCacheNodeId\":{\"shape\":\"String\"},\n \"CustomerAvailabilityZone\":{\"shape\":\"String\"}\n }\n },\n \"CacheNodeIdsList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"String\",\n \"locationName\":\"CacheNodeId\"\n }\n },\n \"CacheNodeList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheNode\",\n \"locationName\":\"CacheNode\"\n }\n },\n \"CacheNodeTypeSpecificParameter\":{\n \"type\":\"structure\",\n \"members\":{\n \"ParameterName\":{\"shape\":\"String\"},\n \"Description\":{\"shape\":\"String\"},\n \"Source\":{\"shape\":\"String\"},\n \"DataType\":{\"shape\":\"String\"},\n \"AllowedValues\":{\"shape\":\"String\"},\n \"IsModifiable\":{\"shape\":\"Boolean\"},\n \"MinimumEngineVersion\":{\"shape\":\"String\"},\n \"CacheNodeTypeSpecificValues\":{\"shape\":\"CacheNodeTypeSpecificValueList\"},\n \"ChangeType\":{\"shape\":\"ChangeType\"}\n }\n },\n \"CacheNodeTypeSpecificParametersList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheNodeTypeSpecificParameter\",\n \"locationName\":\"CacheNodeTypeSpecificParameter\"\n }\n },\n \"CacheNodeTypeSpecificValue\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"Value\":{\"shape\":\"String\"}\n }\n },\n \"CacheNodeTypeSpecificValueList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheNodeTypeSpecificValue\",\n \"locationName\":\"CacheNodeTypeSpecificValue\"\n }\n },\n \"CacheParameterGroup\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"CacheParameterGroupFamily\":{\"shape\":\"String\"},\n \"Description\":{\"shape\":\"String\"}\n },\n \"wrapper\":true\n },\n \"CacheParameterGroupAlreadyExistsFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheParameterGroupAlreadyExists\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheParameterGroupDetails\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"Parameters\":{\"shape\":\"ParametersList\"},\n \"CacheNodeTypeSpecificParameters\":{\"shape\":\"CacheNodeTypeSpecificParametersList\"}\n }\n },\n \"CacheParameterGroupList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheParameterGroup\",\n \"locationName\":\"CacheParameterGroup\"\n }\n },\n \"CacheParameterGroupNameMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"}\n }\n },\n \"CacheParameterGroupNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheParameterGroupNotFound\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheParameterGroupQuotaExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheParameterGroupQuotaExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheParameterGroupStatus\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"ParameterApplyStatus\":{\"shape\":\"String\"},\n \"CacheNodeIdsToReboot\":{\"shape\":\"CacheNodeIdsList\"}\n }\n },\n \"CacheParameterGroupsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"CacheParameterGroups\":{\"shape\":\"CacheParameterGroupList\"}\n }\n },\n \"CacheSecurityGroup\":{\n \"type\":\"structure\",\n \"members\":{\n \"OwnerId\":{\"shape\":\"String\"},\n \"CacheSecurityGroupName\":{\"shape\":\"String\"},\n \"Description\":{\"shape\":\"String\"},\n \"EC2SecurityGroups\":{\"shape\":\"EC2SecurityGroupList\"}\n },\n \"wrapper\":true\n },\n \"CacheSecurityGroupAlreadyExistsFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheSecurityGroupAlreadyExists\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheSecurityGroupMembership\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSecurityGroupName\":{\"shape\":\"String\"},\n \"Status\":{\"shape\":\"String\"}\n }\n },\n \"CacheSecurityGroupMembershipList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheSecurityGroupMembership\",\n \"locationName\":\"CacheSecurityGroup\"\n }\n },\n \"CacheSecurityGroupMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"CacheSecurityGroups\":{\"shape\":\"CacheSecurityGroups\"}\n }\n },\n \"CacheSecurityGroupNameList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"String\",\n \"locationName\":\"CacheSecurityGroupName\"\n }\n },\n \"CacheSecurityGroupNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheSecurityGroupNotFound\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheSecurityGroupQuotaExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"QuotaExceeded.", "CacheSecurityGroup\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheSecurityGroups\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheSecurityGroup\",\n \"locationName\":\"CacheSecurityGroup\"\n }\n },\n \"CacheSubnetGroup\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSubnetGroupName\":{\"shape\":\"String\"},\n \"CacheSubnetGroupDescription\":{\"shape\":\"String\"},\n \"VpcId\":{\"shape\":\"String\"},\n \"Subnets\":{\"shape\":\"SubnetList\"}\n },\n \"wrapper\":true\n },\n \"CacheSubnetGroupAlreadyExistsFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheSubnetGroupAlreadyExists\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheSubnetGroupInUse\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheSubnetGroupInUse\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheSubnetGroupMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"CacheSubnetGroups\":{\"shape\":\"CacheSubnetGroups\"}\n }\n },\n \"CacheSubnetGroupNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheSubnetGroupNotFoundFault\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheSubnetGroupQuotaExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheSubnetGroupQuotaExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CacheSubnetGroups\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"CacheSubnetGroup\",\n \"locationName\":\"CacheSubnetGroup\"\n }\n },\n \"CacheSubnetQuotaExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"CacheSubnetQuotaExceededFault\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"ChangeType\":{\n \"type\":\"string\",\n \"enum\":[\n \"immediate\",\n \"requires-reboot\"\n ]\n },\n \"ClusterIdList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"String\",\n \"locationName\":\"ClusterId\"\n }\n },\n \"ClusterQuotaForCustomerExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"ClusterQuotaForCustomerExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"CopySnapshotMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"SourceSnapshotName\",\n \"TargetSnapshotName\"\n ],\n \"members\":{\n \"SourceSnapshotName\":{\"shape\":\"String\"},\n \"TargetSnapshotName\":{\"shape\":\"String\"},\n \"TargetBucket\":{\"shape\":\"String\"}\n }\n },\n \"CopySnapshotResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"Snapshot\":{\"shape\":\"Snapshot\"}\n }\n },\n \"CreateCacheClusterMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheClusterId\"],\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"AZMode\":{\"shape\":\"AZMode\"},\n \"PreferredAvailabilityZone\":{\"shape\":\"String\"},\n \"PreferredAvailabilityZones\":{\"shape\":\"PreferredAvailabilityZoneList\"},\n \"NumCacheNodes\":{\"shape\":\"IntegerOptional\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"Engine\":{\"shape\":\"String\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"CacheSubnetGroupName\":{\"shape\":\"String\"},\n \"CacheSecurityGroupNames\":{\"shape\":\"CacheSecurityGroupNameList\"},\n \"SecurityGroupIds\":{\"shape\":\"SecurityGroupIdsList\"},\n \"Tags\":{\"shape\":\"TagList\"},\n \"SnapshotArns\":{\"shape\":\"SnapshotArnsList\"},\n \"SnapshotName\":{\"shape\":\"String\"},\n \"PreferredMaintenanceWindow\":{\"shape\":\"String\"},\n \"Port\":{\"shape\":\"IntegerOptional\"},\n \"NotificationTopicArn\":{\"shape\":\"String\"},\n \"AutoMinorVersionUpgrade\":{\"shape\":\"BooleanOptional\"},\n \"SnapshotRetentionLimit\":{\"shape\":\"IntegerOptional\"},\n \"SnapshotWindow\":{\"shape\":\"String\"},\n \"AuthToken\":{\"shape\":\"String\"}\n }\n },\n \"CreateCacheClusterResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheCluster\":{\"shape\":\"CacheCluster\"}\n }\n },\n \"CreateCacheParameterGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"CacheParameterGroupName\",\n \"CacheParameterGroupFamily\",\n \"Description\"\n ],\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"CacheParameterGroupFamily\":{\"shape\":\"String\"},\n \"Description\":{\"shape\":\"String\"}\n }\n },\n \"CreateCacheParameterGroupResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheParameterGroup\":{\"shape\":\"CacheParameterGroup\"}\n }\n },\n \"CreateCacheSecurityGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"CacheSecurityGroupName\",\n \"Description\"\n ],\n \"members\":{\n \"CacheSecurityGroupName\":{\"shape\":\"String\"},\n \"Description\":{\"shape\":\"String\"}\n }\n },\n \"CreateCacheSecurityGroupResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSecurityGroup\":{\"shape\":\"CacheSecurityGroup\"}\n }\n },\n \"CreateCacheSubnetGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"CacheSubnetGroupName\",\n \"CacheSubnetGroupDescription\",\n \"SubnetIds\"\n ],\n \"members\":{\n \"CacheSubnetGroupName\":{\"shape\":\"String\"},\n \"CacheSubnetGroupDescription\":{\"shape\":\"String\"},\n \"SubnetIds\":{\"shape\":\"SubnetIdentifierList\"}\n }\n },\n \"CreateCacheSubnetGroupResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSubnetGroup\":{\"shape\":\"CacheSubnetGroup\"}\n }\n },\n \"CreateReplicationGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"ReplicationGroupId\",\n \"ReplicationGroupDescription\"\n ],\n \"members\":{\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"ReplicationGroupDescription\":{\"shape\":\"String\"},\n \"PrimaryClusterId\":{\"shape\":\"String\"},\n \"AutomaticFailoverEnabled\":{\"shape\":\"BooleanOptional\"},\n \"NumCacheClusters\":{\"shape\":\"IntegerOptional\"},\n \"PreferredCacheClusterAZs\":{\"shape\":\"AvailabilityZonesList\"},\n \"NumNodeGroups\":{\"shape\":\"IntegerOptional\"},\n \"ReplicasPerNodeGroup\":{\"shape\":\"IntegerOptional\"},\n \"NodeGroupConfiguration\":{\"shape\":\"NodeGroupConfigurationList\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"Engine\":{\"shape\":\"String\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"CacheSubnetGroupName\":{\"shape\":\"String\"},\n \"CacheSecurityGroupNames\":{\"shape\":\"CacheSecurityGroupNameList\"},\n \"SecurityGroupIds\":{\"shape\":\"SecurityGroupIdsList\"},\n \"Tags\":{\"shape\":\"TagList\"},\n \"SnapshotArns\":{\"shape\":\"SnapshotArnsList\"},\n \"SnapshotName\":{\"shape\":\"String\"},\n \"PreferredMaintenanceWindow\":{\"shape\":\"String\"},\n \"Port\":{\"shape\":\"IntegerOptional\"},\n \"NotificationTopicArn\":{\"shape\":\"String\"},\n \"AutoMinorVersionUpgrade\":{\"shape\":\"BooleanOptional\"},\n \"SnapshotRetentionLimit\":{\"shape\":\"IntegerOptional\"},\n \"SnapshotWindow\":{\"shape\":\"String\"},\n \"AuthToken\":{\"shape\":\"String\"}\n }\n },\n \"CreateReplicationGroupResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReplicationGroup\":{\"shape\":\"ReplicationGroup\"}\n }\n },\n \"CreateSnapshotMessage\":{\n \"type\":\"structure\",\n \"required\":[\"SnapshotName\"],\n \"members\":{\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"SnapshotName\":{\"shape\":\"String\"}\n }\n },\n \"CreateSnapshotResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"Snapshot\":{\"shape\":\"Snapshot\"}\n }\n },\n \"DeleteCacheClusterMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheClusterId\"],\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"FinalSnapshotIdentifier\":{\"shape\":\"String\"}\n }\n },\n \"DeleteCacheClusterResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheCluster\":{\"shape\":\"CacheCluster\"}\n }\n },\n \"DeleteCacheParameterGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheParameterGroupName\"],\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"}\n }\n },\n \"DeleteCacheSecurityGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheSecurityGroupName\"],\n \"members\":{\n \"CacheSecurityGroupName\":{\"shape\":\"String\"}\n }\n },\n \"DeleteCacheSubnetGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheSubnetGroupName\"],\n \"members\":{\n \"CacheSubnetGroupName\":{\"shape\":\"String\"}\n }\n },\n \"DeleteReplicationGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\"ReplicationGroupId\"],\n \"members\":{\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"RetainPrimaryCluster\":{\"shape\":\"BooleanOptional\"},\n \"FinalSnapshotIdentifier\":{\"shape\":\"String\"}\n }\n },\n \"DeleteReplicationGroupResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReplicationGroup\":{\"shape\":\"ReplicationGroup\"}\n }\n },\n \"DeleteSnapshotMessage\":{\n \"type\":\"structure\",\n \"required\":[\"SnapshotName\"],\n \"members\":{\n \"SnapshotName\":{\"shape\":\"String\"}\n }\n },\n \"DeleteSnapshotResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"Snapshot\":{\"shape\":\"Snapshot\"}\n }\n },\n \"DescribeCacheClustersMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"},\n \"ShowCacheNodeInfo\":{\"shape\":\"BooleanOptional\"},\n \"ShowCacheClustersNotInReplicationGroups\":{\"shape\":\"BooleanOptional\"}\n }\n },\n \"DescribeCacheEngineVersionsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Engine\":{\"shape\":\"String\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"CacheParameterGroupFamily\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"},\n \"DefaultOnly\":{\"shape\":\"Boolean\"}\n }\n },\n \"DescribeCacheParameterGroupsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeCacheParametersMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheParameterGroupName\"],\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"Source\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeCacheSecurityGroupsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSecurityGroupName\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeCacheSubnetGroupsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSubnetGroupName\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeEngineDefaultParametersMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheParameterGroupFamily\"],\n \"members\":{\n \"CacheParameterGroupFamily\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeEngineDefaultParametersResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"EngineDefaults\":{\"shape\":\"EngineDefaults\"}\n }\n },\n \"DescribeEventsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"SourceIdentifier\":{\"shape\":\"String\"},\n \"SourceType\":{\"shape\":\"SourceType\"},\n \"StartTime\":{\"shape\":\"TStamp\"},\n \"EndTime\":{\"shape\":\"TStamp\"},\n \"Duration\":{\"shape\":\"IntegerOptional\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeReplicationGroupsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeReservedCacheNodesMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReservedCacheNodeId\":{\"shape\":\"String\"},\n \"ReservedCacheNodesOfferingId\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"Duration\":{\"shape\":\"String\"},\n \"ProductDescription\":{\"shape\":\"String\"},\n \"OfferingType\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeReservedCacheNodesOfferingsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReservedCacheNodesOfferingId\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"Duration\":{\"shape\":\"String\"},\n \"ProductDescription\":{\"shape\":\"String\"},\n \"OfferingType\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"Marker\":{\"shape\":\"String\"}\n }\n },\n \"DescribeSnapshotsListMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"Snapshots\":{\"shape\":\"SnapshotList\"}\n }\n },\n \"DescribeSnapshotsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"SnapshotName\":{\"shape\":\"String\"},\n \"SnapshotSource\":{\"shape\":\"String\"},\n \"Marker\":{\"shape\":\"String\"},\n \"MaxRecords\":{\"shape\":\"IntegerOptional\"},\n \"ShowNodeGroupConfig\":{\"shape\":\"BooleanOptional\"}\n }\n },\n \"Double\":{\"type\":\"double\"},\n \"EC2SecurityGroup\":{\n \"type\":\"structure\",\n \"members\":{\n \"Status\":{\"shape\":\"String\"},\n \"EC2SecurityGroupName\":{\"shape\":\"String\"},\n \"EC2SecurityGroupOwnerId\":{\"shape\":\"String\"}\n }\n },\n \"EC2SecurityGroupList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"EC2SecurityGroup\",\n \"locationName\":\"EC2SecurityGroup\"\n }\n },\n \"Endpoint\":{\n \"type\":\"structure\",\n \"members\":{\n \"Address\":{\"shape\":\"String\"},\n \"Port\":{\"shape\":\"Integer\"}\n }\n },\n \"EngineDefaults\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheParameterGroupFamily\":{\"shape\":\"String\"},\n \"Marker\":{\"shape\":\"String\"},\n \"Parameters\":{\"shape\":\"ParametersList\"},\n \"CacheNodeTypeSpecificParameters\":{\"shape\":\"CacheNodeTypeSpecificParametersList\"}\n },\n \"wrapper\":true\n },\n \"Event\":{\n \"type\":\"structure\",\n \"members\":{\n \"SourceIdentifier\":{\"shape\":\"String\"},\n \"SourceType\":{\"shape\":\"SourceType\"},\n \"Message\":{\"shape\":\"String\"},\n \"Date\":{\"shape\":\"TStamp\"}\n }\n },\n \"EventList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"Event\",\n \"locationName\":\"Event\"\n }\n },\n \"EventsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"Events\":{\"shape\":\"EventList\"}\n }\n },\n \"InsufficientCacheClusterCapacityFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InsufficientCacheClusterCapacity\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"Integer\":{\"type\":\"integer\"},\n \"IntegerOptional\":{\"type\":\"integer\"},\n \"InvalidARNFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InvalidARN\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidCacheClusterStateFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InvalidCacheClusterState\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidCacheParameterGroupStateFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InvalidCacheParameterGroupState\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidCacheSecurityGroupStateFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InvalidCacheSecurityGroupState\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidParameterCombinationException\":{\n \"type\":\"structure\",\n \"members\":{\n \"message\":{\"shape\":\"AwsQueryErrorMessage\"}\n },\n \"error\":{\n \"code\":\"InvalidParameterCombination\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidParameterValueException\":{\n \"type\":\"structure\",\n \"members\":{\n \"message\":{\"shape\":\"AwsQueryErrorMessage\"}\n },\n \"error\":{\n \"code\":\"InvalidParameterValue\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidReplicationGroupStateFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InvalidReplicationGroupState\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidSnapshotStateFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InvalidSnapshotState\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidSubnet\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InvalidSubnet\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"InvalidVPCNetworkStateFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"InvalidVPCNetworkStateFault\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"KeyList\":{\n \"type\":\"list\",\n \"member\":{\"shape\":\"String\"}\n },\n \"ListAllowedNodeTypeModificationsMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"ReplicationGroupId\":{\"shape\":\"String\"}\n }\n },\n \"ListTagsForResourceMessage\":{\n \"type\":\"structure\",\n \"required\":[\"ResourceName\"],\n \"members\":{\n \"ResourceName\":{\"shape\":\"String\"}\n }\n },\n \"ModifyCacheClusterMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheClusterId\"],\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"NumCacheNodes\":{\"shape\":\"IntegerOptional\"},\n \"CacheNodeIdsToRemove\":{\"shape\":\"CacheNodeIdsList\"},\n \"AZMode\":{\"shape\":\"AZMode\"},\n \"NewAvailabilityZones\":{\"shape\":\"PreferredAvailabilityZoneList\"},\n \"CacheSecurityGroupNames\":{\"shape\":\"CacheSecurityGroupNameList\"},\n \"SecurityGroupIds\":{\"shape\":\"SecurityGroupIdsList\"},\n \"PreferredMaintenanceWindow\":{\"shape\":\"String\"},\n \"NotificationTopicArn\":{\"shape\":\"String\"},\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"NotificationTopicStatus\":{\"shape\":\"String\"},\n \"ApplyImmediately\":{\"shape\":\"Boolean\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"AutoMinorVersionUpgrade\":{\"shape\":\"BooleanOptional\"},\n \"SnapshotRetentionLimit\":{\"shape\":\"IntegerOptional\"},\n \"SnapshotWindow\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"}\n }\n },\n \"ModifyCacheClusterResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheCluster\":{\"shape\":\"CacheCluster\"}\n }\n },\n \"ModifyCacheParameterGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"CacheParameterGroupName\",\n \"ParameterNameValues\"\n ],\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"ParameterNameValues\":{\"shape\":\"ParameterNameValueList\"}\n }\n },\n \"ModifyCacheSubnetGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheSubnetGroupName\"],\n \"members\":{\n \"CacheSubnetGroupName\":{\"shape\":\"String\"},\n \"CacheSubnetGroupDescription\":{\"shape\":\"String\"},\n \"SubnetIds\":{\"shape\":\"SubnetIdentifierList\"}\n }\n },\n \"ModifyCacheSubnetGroupResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSubnetGroup\":{\"shape\":\"CacheSubnetGroup\"}\n }\n },\n \"ModifyReplicationGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\"ReplicationGroupId\"],\n \"members\":{\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"ReplicationGroupDescription\":{\"shape\":\"String\"},\n \"PrimaryClusterId\":{\"shape\":\"String\"},\n \"SnapshottingClusterId\":{\"shape\":\"String\"},\n \"AutomaticFailoverEnabled\":{\"shape\":\"BooleanOptional\"},\n \"CacheSecurityGroupNames\":{\"shape\":\"CacheSecurityGroupNameList\"},\n \"SecurityGroupIds\":{\"shape\":\"SecurityGroupIdsList\"},\n \"PreferredMaintenanceWindow\":{\"shape\":\"String\"},\n \"NotificationTopicArn\":{\"shape\":\"String\"},\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"NotificationTopicStatus\":{\"shape\":\"String\"},\n \"ApplyImmediately\":{\"shape\":\"Boolean\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"AutoMinorVersionUpgrade\":{\"shape\":\"BooleanOptional\"},\n \"SnapshotRetentionLimit\":{\"shape\":\"IntegerOptional\"},\n \"SnapshotWindow\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"NodeGroupId\":{\"shape\":\"String\"}\n }\n },\n \"ModifyReplicationGroupResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReplicationGroup\":{\"shape\":\"ReplicationGroup\"}\n }\n },\n \"NodeGroup\":{\n \"type\":\"structure\",\n \"members\":{\n \"NodeGroupId\":{\"shape\":\"String\"},\n \"Status\":{\"shape\":\"String\"},\n \"PrimaryEndpoint\":{\"shape\":\"Endpoint\"},\n \"Slots\":{\"shape\":\"String\"},\n \"NodeGroupMembers\":{\"shape\":\"NodeGroupMemberList\"}\n }\n },\n \"NodeGroupConfiguration\":{\n \"type\":\"structure\",\n \"members\":{\n \"Slots\":{\"shape\":\"String\"},\n \"ReplicaCount\":{\"shape\":\"IntegerOptional\"},\n \"PrimaryAvailabilityZone\":{\"shape\":\"String\"},\n \"ReplicaAvailabilityZones\":{\"shape\":\"AvailabilityZonesList\"}\n }\n },\n \"NodeGroupConfigurationList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"NodeGroupConfiguration\",\n \"locationName\":\"NodeGroupConfiguration\"\n }\n },\n \"NodeGroupList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"NodeGroup\",\n \"locationName\":\"NodeGroup\"\n }\n },\n \"NodeGroupMember\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"CacheNodeId\":{\"shape\":\"String\"},\n \"ReadEndpoint\":{\"shape\":\"Endpoint\"},\n \"PreferredAvailabilityZone\":{\"shape\":\"String\"},\n \"CurrentRole\":{\"shape\":\"String\"}\n }\n },\n \"NodeGroupMemberList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"NodeGroupMember\",\n \"locationName\":\"NodeGroupMember\"\n }\n },\n \"NodeGroupNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"NodeGroupNotFoundFault\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"NodeGroupsPerReplicationGroupQuotaExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"NodeGroupsPerReplicationGroupQuotaExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"NodeQuotaForClusterExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"NodeQuotaForClusterExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"NodeQuotaForCustomerExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"NodeQuotaForCustomerExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"NodeSnapshot\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"NodeGroupId\":{\"shape\":\"String\"},\n \"CacheNodeId\":{\"shape\":\"String\"},\n \"NodeGroupConfiguration\":{\"shape\":\"NodeGroupConfiguration\"},\n \"CacheSize\":{\"shape\":\"String\"},\n \"CacheNodeCreateTime\":{\"shape\":\"TStamp\"},\n \"SnapshotCreateTime\":{\"shape\":\"TStamp\"}\n },\n \"wrapper\":true\n },\n \"NodeSnapshotList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"NodeSnapshot\",\n \"locationName\":\"NodeSnapshot\"\n }\n },\n \"NodeTypeList\":{\n \"type\":\"list\",\n \"member\":{\"shape\":\"String\"}\n },\n \"NotificationConfiguration\":{\n \"type\":\"structure\",\n \"members\":{\n \"TopicArn\":{\"shape\":\"String\"},\n \"TopicStatus\":{\"shape\":\"String\"}\n }\n },\n \"Parameter\":{\n \"type\":\"structure\",\n \"members\":{\n \"ParameterName\":{\"shape\":\"String\"},\n \"ParameterValue\":{\"shape\":\"String\"},\n \"Description\":{\"shape\":\"String\"},\n \"Source\":{\"shape\":\"String\"},\n \"DataType\":{\"shape\":\"String\"},\n \"AllowedValues\":{\"shape\":\"String\"},\n \"IsModifiable\":{\"shape\":\"Boolean\"},\n \"MinimumEngineVersion\":{\"shape\":\"String\"},\n \"ChangeType\":{\"shape\":\"ChangeType\"}\n }\n },\n \"ParameterNameValue\":{\n \"type\":\"structure\",\n \"members\":{\n \"ParameterName\":{\"shape\":\"String\"},\n \"ParameterValue\":{\"shape\":\"String\"}\n }\n },\n \"ParameterNameValueList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"ParameterNameValue\",\n \"locationName\":\"ParameterNameValue\"\n }\n },\n \"ParametersList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"Parameter\",\n \"locationName\":\"Parameter\"\n }\n },\n \"PendingAutomaticFailoverStatus\":{\n \"type\":\"string\",\n \"enum\":[\n \"enabled\",\n \"disabled\"\n ]\n },\n \"PendingModifiedValues\":{\n \"type\":\"structure\",\n \"members\":{\n \"NumCacheNodes\":{\"shape\":\"IntegerOptional\"},\n \"CacheNodeIdsToRemove\":{\"shape\":\"CacheNodeIdsList\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"}\n }\n },\n \"PreferredAvailabilityZoneList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"String\",\n \"locationName\":\"PreferredAvailabilityZone\"\n }\n },\n \"PurchaseReservedCacheNodesOfferingMessage\":{\n \"type\":\"structure\",\n \"required\":[\"ReservedCacheNodesOfferingId\"],\n \"members\":{\n \"ReservedCacheNodesOfferingId\":{\"shape\":\"String\"},\n \"ReservedCacheNodeId\":{\"shape\":\"String\"},\n \"CacheNodeCount\":{\"shape\":\"IntegerOptional\"}\n }\n },\n \"PurchaseReservedCacheNodesOfferingResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReservedCacheNode\":{\"shape\":\"ReservedCacheNode\"}\n }\n },\n \"RebootCacheClusterMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"CacheClusterId\",\n \"CacheNodeIdsToReboot\"\n ],\n \"members\":{\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"CacheNodeIdsToReboot\":{\"shape\":\"CacheNodeIdsList\"}\n }\n },\n \"RebootCacheClusterResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheCluster\":{\"shape\":\"CacheCluster\"}\n }\n },\n \"RecurringCharge\":{\n \"type\":\"structure\",\n \"members\":{\n \"RecurringChargeAmount\":{\"shape\":\"Double\"},\n \"RecurringChargeFrequency\":{\"shape\":\"String\"}\n },\n \"wrapper\":true\n },\n \"RecurringChargeList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"RecurringCharge\",\n \"locationName\":\"RecurringCharge\"\n }\n },\n \"RemoveTagsFromResourceMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"ResourceName\",\n \"TagKeys\"\n ],\n \"members\":{\n \"ResourceName\":{\"shape\":\"String\"},\n \"TagKeys\":{\"shape\":\"KeyList\"}\n }\n },\n \"ReplicationGroup\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"Description\":{\"shape\":\"String\"},\n \"Status\":{\"shape\":\"String\"},\n \"PendingModifiedValues\":{\"shape\":\"ReplicationGroupPendingModifiedValues\"},\n \"MemberClusters\":{\"shape\":\"ClusterIdList\"},\n \"NodeGroups\":{\"shape\":\"NodeGroupList\"},\n \"SnapshottingClusterId\":{\"shape\":\"String\"},\n \"AutomaticFailover\":{\"shape\":\"AutomaticFailoverStatus\"},\n \"ConfigurationEndpoint\":{\"shape\":\"Endpoint\"},\n \"SnapshotRetentionLimit\":{\"shape\":\"IntegerOptional\"},\n \"SnapshotWindow\":{\"shape\":\"String\"},\n \"ClusterEnabled\":{\"shape\":\"BooleanOptional\"},\n \"CacheNodeType\":{\"shape\":\"String\"}\n },\n \"wrapper\":true\n },\n \"ReplicationGroupAlreadyExistsFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"ReplicationGroupAlreadyExists\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"ReplicationGroupList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"ReplicationGroup\",\n \"locationName\":\"ReplicationGroup\"\n }\n },\n \"ReplicationGroupMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"ReplicationGroups\":{\"shape\":\"ReplicationGroupList\"}\n }\n },\n \"ReplicationGroupNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"ReplicationGroupNotFoundFault\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"ReplicationGroupPendingModifiedValues\":{\n \"type\":\"structure\",\n \"members\":{\n \"PrimaryClusterId\":{\"shape\":\"String\"},\n \"AutomaticFailoverStatus\":{\"shape\":\"PendingAutomaticFailoverStatus\"}\n }\n },\n \"ReservedCacheNode\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReservedCacheNodeId\":{\"shape\":\"String\"},\n \"ReservedCacheNodesOfferingId\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"StartTime\":{\"shape\":\"TStamp\"},\n \"Duration\":{\"shape\":\"Integer\"},\n \"FixedPrice\":{\"shape\":\"Double\"},\n \"UsagePrice\":{\"shape\":\"Double\"},\n \"CacheNodeCount\":{\"shape\":\"Integer\"},\n \"ProductDescription\":{\"shape\":\"String\"},\n \"OfferingType\":{\"shape\":\"String\"},\n \"State\":{\"shape\":\"String\"},\n \"RecurringCharges\":{\"shape\":\"RecurringChargeList\"}\n },\n \"wrapper\":true\n },\n \"ReservedCacheNodeAlreadyExistsFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"ReservedCacheNodeAlreadyExists\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"ReservedCacheNodeList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"ReservedCacheNode\",\n \"locationName\":\"ReservedCacheNode\"\n }\n },\n \"ReservedCacheNodeMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"ReservedCacheNodes\":{\"shape\":\"ReservedCacheNodeList\"}\n }\n },\n \"ReservedCacheNodeNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"ReservedCacheNodeNotFound\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"ReservedCacheNodeQuotaExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"ReservedCacheNodeQuotaExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"ReservedCacheNodesOffering\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReservedCacheNodesOfferingId\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"Duration\":{\"shape\":\"Integer\"},\n \"FixedPrice\":{\"shape\":\"Double\"},\n \"UsagePrice\":{\"shape\":\"Double\"},\n \"ProductDescription\":{\"shape\":\"String\"},\n \"OfferingType\":{\"shape\":\"String\"},\n \"RecurringCharges\":{\"shape\":\"RecurringChargeList\"}\n },\n \"wrapper\":true\n },\n \"ReservedCacheNodesOfferingList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"ReservedCacheNodesOffering\",\n \"locationName\":\"ReservedCacheNodesOffering\"\n }\n },\n \"ReservedCacheNodesOfferingMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"Marker\":{\"shape\":\"String\"},\n \"ReservedCacheNodesOfferings\":{\"shape\":\"ReservedCacheNodesOfferingList\"}\n }\n },\n \"ReservedCacheNodesOfferingNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"ReservedCacheNodesOfferingNotFound\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"ResetCacheParameterGroupMessage\":{\n \"type\":\"structure\",\n \"required\":[\"CacheParameterGroupName\"],\n \"members\":{\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"ResetAllParameters\":{\"shape\":\"Boolean\"},\n \"ParameterNameValues\":{\"shape\":\"ParameterNameValueList\"}\n }\n },\n \"RevokeCacheSecurityGroupIngressMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"CacheSecurityGroupName\",\n \"EC2SecurityGroupName\",\n \"EC2SecurityGroupOwnerId\"\n ],\n \"members\":{\n \"CacheSecurityGroupName\":{\"shape\":\"String\"},\n \"EC2SecurityGroupName\":{\"shape\":\"String\"},\n \"EC2SecurityGroupOwnerId\":{\"shape\":\"String\"}\n }\n },\n \"RevokeCacheSecurityGroupIngressResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"CacheSecurityGroup\":{\"shape\":\"CacheSecurityGroup\"}\n }\n },\n \"SecurityGroupIdsList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"String\",\n \"locationName\":\"SecurityGroupId\"\n }\n },\n \"SecurityGroupMembership\":{\n \"type\":\"structure\",\n \"members\":{\n \"SecurityGroupId\":{\"shape\":\"String\"},\n \"Status\":{\"shape\":\"String\"}\n }\n },\n \"SecurityGroupMembershipList\":{\n \"type\":\"list\",\n \"member\":{\"shape\":\"SecurityGroupMembership\"}\n },\n \"Snapshot\":{\n \"type\":\"structure\",\n \"members\":{\n \"SnapshotName\":{\"shape\":\"String\"},\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"ReplicationGroupDescription\":{\"shape\":\"String\"},\n \"CacheClusterId\":{\"shape\":\"String\"},\n \"SnapshotStatus\":{\"shape\":\"String\"},\n \"SnapshotSource\":{\"shape\":\"String\"},\n \"CacheNodeType\":{\"shape\":\"String\"},\n \"Engine\":{\"shape\":\"String\"},\n \"EngineVersion\":{\"shape\":\"String\"},\n \"NumCacheNodes\":{\"shape\":\"IntegerOptional\"},\n \"PreferredAvailabilityZone\":{\"shape\":\"String\"},\n \"CacheClusterCreateTime\":{\"shape\":\"TStamp\"},\n \"PreferredMaintenanceWindow\":{\"shape\":\"String\"},\n \"TopicArn\":{\"shape\":\"String\"},\n \"Port\":{\"shape\":\"IntegerOptional\"},\n \"CacheParameterGroupName\":{\"shape\":\"String\"},\n \"CacheSubnetGroupName\":{\"shape\":\"String\"},\n \"VpcId\":{\"shape\":\"String\"},\n \"AutoMinorVersionUpgrade\":{\"shape\":\"Boolean\"},\n \"SnapshotRetentionLimit\":{\"shape\":\"IntegerOptional\"},\n \"SnapshotWindow\":{\"shape\":\"String\"},\n \"NumNodeGroups\":{\"shape\":\"IntegerOptional\"},\n \"AutomaticFailover\":{\"shape\":\"AutomaticFailoverStatus\"},\n \"NodeSnapshots\":{\"shape\":\"NodeSnapshotList\"}\n },\n \"wrapper\":true\n },\n \"SnapshotAlreadyExistsFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"SnapshotAlreadyExistsFault\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"SnapshotArnsList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"String\",\n \"locationName\":\"SnapshotArn\"\n }\n },\n \"SnapshotFeatureNotSupportedFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"SnapshotFeatureNotSupportedFault\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"SnapshotList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"Snapshot\",\n \"locationName\":\"Snapshot\"\n }\n },\n \"SnapshotNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"SnapshotNotFoundFault\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"SnapshotQuotaExceededFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"SnapshotQuotaExceededFault\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"SourceType\":{\n \"type\":\"string\",\n \"enum\":[\n \"cache-cluster\",\n \"cache-parameter-group\",\n \"cache-security-group\",\n \"cache-subnet-group\",\n \"replication-group\"\n ]\n },\n \"String\":{\"type\":\"string\"},\n \"Subnet\":{\n \"type\":\"structure\",\n \"members\":{\n \"SubnetIdentifier\":{\"shape\":\"String\"},\n \"SubnetAvailabilityZone\":{\"shape\":\"AvailabilityZone\"}\n }\n },\n \"SubnetIdentifierList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"String\",\n \"locationName\":\"SubnetIdentifier\"\n }\n },\n \"SubnetInUse\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"SubnetInUse\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"SubnetList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"Subnet\",\n \"locationName\":\"Subnet\"\n }\n },\n \"TStamp\":{\"type\":\"timestamp\"},\n \"Tag\":{\n \"type\":\"structure\",\n \"members\":{\n \"Key\":{\"shape\":\"String\"},\n \"Value\":{\"shape\":\"String\"}\n }\n },\n \"TagList\":{\n \"type\":\"list\",\n \"member\":{\n \"shape\":\"Tag\",\n \"locationName\":\"Tag\"\n }\n },\n \"TagListMessage\":{\n \"type\":\"structure\",\n \"members\":{\n \"TagList\":{\"shape\":\"TagList\"}\n }\n },\n \"TagNotFoundFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"TagNotFound\",\n \"httpStatusCode\":404,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"TagQuotaPerResourceExceeded\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"TagQuotaPerResourceExceeded\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"TestFailoverMessage\":{\n \"type\":\"structure\",\n \"required\":[\n \"ReplicationGroupId\",\n \"NodeGroupId\"\n ],\n \"members\":{\n \"ReplicationGroupId\":{\"shape\":\"String\"},\n \"NodeGroupId\":{\"shape\":\"String\"}\n }\n },\n \"TestFailoverNotAvailableFault\":{\n \"type\":\"structure\",\n \"members\":{\n },\n \"error\":{\n \"code\":\"TestFailoverNotAvailableFault\",\n \"httpStatusCode\":400,\n \"senderFault\":true\n },\n \"exception\":true\n },\n \"TestFailoverResult\":{\n \"type\":\"structure\",\n \"members\":{\n \"ReplicationGroup\":{\"shape\":\"ReplicationGroup\"}\n }\n }\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0010527506237849593, 0.001168339978903532 ]

[ "Litecoin’s (LTC) Litepay was meant to be released on 26th February in an event that was dubbed as revolutionary and bridging the gap between cryptocurrency and regular day to day spending in a normal fiat economy. ", "A fiat economy is one that is backed by the respective central bank of the issuing country. ", "Examples of fiat currency are the United States Dollar, The Indian Rupee, European Union Euro and South African Rand. ", "Litepay was meant to bridge the gap between cryptocurrencies – using Litecoin as the base crypto in the platform – and the fiat currencies mentioned above and the many more available around the globe.", "\n\nThe anticipation of the release had propelled Litecoin (LTC) to levels of $233 on the scheduled day of release. ", "However, the team at Litepay and Litecoin (LTC) sent out an email notifying preregistered users of the platform, that release was going to be postponed indefinitely. ", "It was later revealed that the Litecoin team was having a hard time finding a payment card provider that was lenient towards cryptocurrencies. ", "Such card payment service providers include the famous VISA and MasterCard.", "\n\nSince the indefinite postponement of the Litepay launch, the value of Litecoin has dropped 33.4% from the peak value that February morning of $233 to a current trading value of $155 at the moment of writing this.", "\n\nIn the case of Litepay lacking a payment card provider who would back their platform, Mastercard has come out openly and declared, through a statement, that it will only support State Issued cryptocurrencies and none of the current crypto in the market that support anonymity by abiding by the Satoshi principle of decentralization.", "\n\nMastercards idea is for using central bank issued cryptocurrencies in the future. ", "This means that the only coin that can qualify to be used on their card services, is Venezuela’s and President Nicolas Maduro’s Petro. ", "The partnership between the Petro and Mastercard is highly unlikely due to current political tensions between Venezuela and the United States. ", "This is because Mastercard is a company that has been incorporated in the United States. ", "I am sure the US Government will have something to say about any attempts of a partnership between the two.", "\n\nPerhaps one way of Litepay to get around the stiff Mastercard requirement, is the endorsement of Litecoin (LTC) by a very liberal American State such as California or Washington (Seattle). ", "The United States constitution allows for States in the Union to make their own laws. ", "Perhaps it is time for California or Washington to embrace Litecoin as an alternative to the dollar. ", "I doubt this will cause the Federal government to send in the National Guard for there is no legislation for Cryptocurrencies in the current American Constitution. ", "This is a loophole that can be explore. ", "Or if you want to use computer programming terms, this is is a bug in the American Constitution. (", "Please note I am not a lawyer.)", "\n\nIt is also highly unlikely for Mastercard to partner with any current cryptocurrencies due to the fact that the card payment service provider, recently filed a patent for instantaneous payments using blockchain technology. ", "This does not necessarily mean that Mastercard wants to issue its own ICO. ", "This means that the back end settlement software they want to implement, will be on their blockchain.", "\n\nMastercard’s instantaneous payment settlement idea is not that much different to products already available through the Ripple Network. ", "Ripple has three such solutions: xCurrent, xRapid and xVia.", "\n\nIn conclusion, Litepay has two options moving forward. ", "The first, is to get the backing of a government somewhere in the world. ", "One option would be to explore options such as Vanuatu, Panama or even the Autonomous territory of China known as Macau. ", "Another option for Litepay is to completely forget Mastercard and go back to the drawing board and design a platform similar to that being offered by Crypterium. ", "A partnership between the two projects – Crypterium and Litepay – would be a perfect solution that would show Mastercard and Visa that they are not the ‘prettiest girls at the party’.", "\n\n[Photo source, youtube.com]\n\nFollow us on Telegram\n\n\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007160863024182618, 0.0006140987388789654, 0.000660227844491601, 0.0007551806629635394, 0.0006007627816870809, 0.0005715976003557444, 0.0007452352438122034, 0.0006138354074209929, 0.0005878449301235378, 0.0007924228557385504, 0.0007557162898592651, 0.000640743353869766, 0.0005850825109519064, 0.0006346054724417627, 0.0005416314816102386, 0.0006299435044638813, 0.000670941430144012, 0.0006575975567102432, 0.0007682841969653964, 0.0006509126396849751, 0.000768835365306586, 0.0006901430897414684, 0.0007190576288849115, 0.0007308083004318178, 0.0007903922814875841, 0.0006153534050099552, 0.0006982699851505458, 0.0005974495434202254, 0.0007028094260022044, 0.0005229678354226053, 0.0009356576483696699, 0.020566940307617188, 0.0006362800486385822 ]

[ "Famous Soviet-era clown Oleg Popov dies at 86 Published duration 3 November 2016\n\nimage copyright AFP image caption Oleg Popov found fame in Europe after a Kremlin-sponsored tour in the 1950s\n\nRussians are paying tribute to Oleg Popov, a Soviet-era clown who became a cultural icon.", "\n\nPopov died suddenly on Wednesday from a heart attack while on tour in Rostov-on-Don in south-west Russia, the local circus director said.", "\n\nHe rose to fame touring Europe in the 1950s with the state circus. ", "He also toured Asia and North America and starred in several films\n\nIn 1969 he was given the title of \"The People's Artist of the Soviet Union\".", "\n\nimage copyright Herbert Behrens image caption Oleg Popov performing in the Netherlands in 1961\n\nPopov graduated from Moscow Circus School in 1949 aged 19 and was subsequently signed up by the Great Moscow State Circus, a government-run circus organisation.", "\n\nHis big break came in 1954 when he stepped in for the head clown who had broken his arm while performing. ", "Popov took over as head clown two years later.", "\n\nThe celebrated performer was an early part of the Soviet Union's attempt to strengthen its international image under Nikita Khrushchev, when his circus embarked on a Kremlin-organised tour of Western Europe in 1956.", "\n\nIt was the first foreign performance by a Soviet circus group.", "\n\nimage copyright PATRICK GLANZ image caption Popov, performing here with the Russian State Circus in Worms, Germany, in 2009, made his home in Germany\n\nRussian Culture Minister Vladimir Medinsky offered his condolences in a statement, saying that Popov's performances \"brought joy and goodness to many generations of our compatriots\".", "\n\n\"He managed to create a unique image of an eccentric clown who radiated light just by making an appearance, and turned every performance into a festivity,\" he added.", "\n\nThe Moscow State Circus joined the tributes by offering to host a farewell celebration to the star, praising his \"generosity, multi-faceted talent and dedication\".", "\n\nHe is survived by wife Gabriela Lehmann, a German circus performer, and a daughter from his first marriage, Olga Popova, a violinist who also lives in Germany.", "\n\nFollowing any tribute in Moscow it is likely that Mr Popov will be buried in Germany, his home since the 1990s." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.001979032065719366, 0.0013356023700907826, 0.000725951511412859, 0.0006310205790214241, 0.0006320143584161997, 0.002030995674431324, 0.00295909121632576, 0.0006584411021322012, 0.0006965923821553588, 0.0006049869698472321, 0.0007946316036395729, 0.0005160204018466175, 0.000795362691860646, 0.0007792268297635019 ]

[ "by\n\n\n\nBullshit business is about the meaningless language conjured up in schools, in banks, in consultancy firms, in politics, in the media and, of course, in thousands of business schools releasing MBA-certificated managers who are then spreading the meaningless managerial buzz-word language of bullshit business around the world. ", "Bullshit business can indeed take over organizations crowding out their core purpose – profit-maximization. ", "When pro-business academics, management writers, CEOs, and upper-level managers invent bullshit language, they fabricate something that sustains Managerialism. ", "While ideologically supporting Managerialism and capitalism, bullshit business also just gets in the way of the proper functioning of a business, a corporation, and ultimately capitalism. ", "If business bullshit and its banal language were removed, corporations might even improve their real bottom line. ", "Yet despite being rather counterproductive, Managerialism clings on to bullshit business.", "\n\nThe historic origins of bullshit business and its pathological language lie in Kroning and AT&T’s management “guru” hired to change the AT&T corporation. ", "A management guru is someone named so by people who can’t spell “charlatan”. ", "Others call them “witch doctors”. ", "In the case of AT&T’s bullshit business, it was Russian mystic George Gurdjieff introducing an entire new set of bullshit language. ", "Managerialism’s language has indeed led to a lot more management meetings as everything takes twice as long.", "\n\nIt is true that Kroning may have been killed off while Kronese has lived on. ", "Nonetheless there are powerful forces behind bullshit business. ", "Like Managerialism, the bullshitter has a lack of connection or concern for the truth – as if truth had ever been relevant for corporations and corporate management. ", "True, bullshitters are not concerned that their grand pronouncements might be illogical, unintelligible or downright baffling. ", "All they care about is whether people will listen and whether they can persuade them that corporations are good, management is legitimate and capitalism is the best system on earth. ", "And this even though life expectancy in the USA – a truly capitalist country – has declined for the second consecutive year.", "\n\nMeanwhile bullshit business jargon is also used as a linguistic barbed wire fence, which stops unfortunate amateurs (that is us) from trespassing on territory already claimed by experts (managers and business school professors). “", "That’s bullshit” indeed puts up a barbed wire fence. ", "It not just blocks conversations, it also blocks critical thoughts about bullshit business protecting business, corporations, and capitalism as such. ", "Consequently, many of the managerial practices are not adopted because they work, but because they are fashionable and they ideologically legitimize corporations. ", "Ever since its invention, the bullshit merchant or management consultant can find a lucrative trade in any large organization. ", "Managerialism thrives on this while management consultants rake in large fees as workers are “downsized” – to use another managerial buzzword.", "\n\nAt the same time, business schools remain one of the key drivers behind the process of bullshit business. ", "The predecessor of bullshit business is David Graeber’s well known concept of “bullshit jobs”. ", "These are jobs in which people experience their work as utterly meaningless, contributing nothing to the world and they think they should not exist? ", "Not just in business schools but also in private industry, Managerialism has serious impacts when deans of business schools, university presidents – not yet called “CEOs” – and real CEOs flourish on bullshit business.", "\n\nAligned to bullshit business and Managerialism, all the managerial image enhancement has one economic impact: the CEOs’ pay went up. ", "Large CEO pay cheques and golden parachutes have a very serious economic impact – inequality rises on a global scale. ", "Even the otherwise extremely business friendly Fortune Magazine admitted recently that the pay gap between the average worker and CEOs stands at 271 in 2017, announcing “Top CEOs Make More in Two Days Than An Average Employee Does in One Year”.", "\n\nAn almost classical example of bullshit business is Nokia’s “Hello There” story of 2014. ", "It remains one of the perfect examples of what Managerialism euphemistically calls organizational life – a true bullshit business term often taken on in the blissful unawareness that most of human life takes place outside of organizations while organizations, or better workplaces are all but deprived of life. ", "The Orwellian bullshit business term “organizational life” is designed to camouflage the fact that for-profit corporations and companies hardly provide a livable space. ", "Beyond that, “organization” sound so much nicer than corporation. ", "The term corporation carries negative connotations to unwanted realities such as, for example, profits, the ruthless destruction of life on earth, etc. ", "Perhaps dilbert.com’s cynicism is the best one can hope for on “organizational life”. ", "Organizational life might boil down to what has been described in the BBC’s “the office”, The Living Dead – Switched off Zoned Out, The Shocking Truth about Office Life, Organizational Pathology: Life and Death of Organizations, and the by now classical study on the Moral Mazes – The World of Corporate Managers.", "\n\nA much less recognized example of bullshit business occurred in Helsinki where a costly merger of three educational institutions (a business school, a technical school, and a design school) was driven by the analogy of the “Nordic MIT”. ", "Finland’s top educational managers might have been Victims of Groupthinking. ", "They might have also been victims of Managerialism believing their own ideology. ", "Nordic MIT and similar hallucinations occur because of the prevalence of marketing and PR (public relations and propaganda) inside formerly research and teaching oriented institutions that once deserved the name “university”. ", "As macro-level neoliberalism and micro-level Managerialism took hold, universities became PR institutions ruled by public relations managers creating what has been called a PR-university’. ", "All too often, these are driven by top-managers with kitschy MBA certificates on their walls.", "\n\nWhile MBAs learn bullshit business jargon in business schools, those on the receiving end of the Managerialism double-speak merchant are coerced into what ultimately results in ‘silence is the best policy’. ", "Workers under the regime of Managerialism are forced to adhere to an old feudal policy: when the great lord passes by, the wise peasant bows deeply and farts silently. ", "In the corporate workplace, it becomes: when the great CEO or one of his top managers pass by, the wise worker bows deeply and farts silently. ", "In almost all business schools, in many management textbooks and crypto-academic articles on business, those at the receiving end of all this – the workers – are not just forgotten but all too often deliberately eliminated from public view.", "\n\nAs workers are disregarded or perhaps discarded, other themes are ideologically reframed. ", "Just as standard management textbooks prefer the Orwellian Newspeak term “organization”, profits (Oldspeak) have been replaced with “shareholder value” (Newspeak). ", "Whenever anti-democratic authoritarian management regimes need to vanish into rhetoric’s thin air, Managerialism’s henchmen prefer the word “bureaucracy”. ", "Exchanging management with bureaucracy whenever convenient might make Cicero’s disciples happy while protecting managerial domination. ", "However, management double-talk rarely enlightens one about the true state of workplace affairs often governed by a top-heavy bureaucratic apparatus. ", "Despite the widespread stories about the decline of bureaucracy, we have actually experienced an explosion of bureaucracy.", "\n\nOriginating from the French Jean Claude Marie Vincent de Gournay (1712-1759), bureau or office actually means a system of government in which most of the important decisions are taken by state officials rather than by elected representatives. ", "It does not mean an overblown managerial apparatus that runs today’s corporations operating in the profit mode. ", "It means public administration for a greater good, namely the state. ", "What bureaucracy also does not mean is a self-serving management elite narrowly focused on ROI – return of investment and the real bottom line. ", "Transferring bureaucracy into the world of business and management makes the ugly “C”-words (corporations and companies) disappear. ", "With it also disappears the company’s historical origin found in the con-pane, the bread sharing mercenaries – hired killers. ", "With the bullshit business language of organizations and bureaucracy, the harshness of the profit maxim vanishes as Managerialism borrows heavily from democratic institutions and state bureaucracies. ", "Much of this aids the appearance that lower level administrators are the problem – not those who govern them, i.e. top-management and CEOs. ", "Very often, the very opposite is the case.", "\n\nWhen stabilizing Managerialism as it is often done by business schools, the task is to infuse new MBAs with the latest managerial buzz- and “weasel worlds”. ", "Set apart from corporate reality, it is not at all surprising to find that many management ideas are cooked up far from the day-to-day realities of a workplace. ", "Generally, management ideas are designed without having much to do with day-to-day workplace realities. ", "Far from workplaces, bullshit business buzz-words have a rather different task. ", "Often, they are specifically not invented to be reflective of management and work. ", "Instead, they fulfill what ideology sets out to achieve:\n\n1) Camouflaging contradictions (e.g. workers and management have different interests on wages, working time and general working conditions); 2) cementing domination (e.g. the domination of management over workers); and finally, 3) the prevention of emancipation (e.g. by obscuring the true affairs of work through, for example, putting up a smokescreen called bullshit business).", "\n\nFar above the harshness of the neoliberal workplace, bosses continue to demand loyalty from their subordinates while those at the top get the lion’s share of rewards. ", "Down the line, a global bureaucracy has created a huge number of bullshit jobs, such as PR agents, corporate lawyers, and a supportive cohort of pro-business writers in the corporate press and business schools. ", "The central mission of many bullshit managers is to create a vast and apparently unbroken complex of rules and regulations which increasingly infiltrate all of our lives. ", "The bullshit job list also includes CEOs, top managers and business school professors. ", "Perhaps American writer and Pulitzer Prize winner Upton Sinclair hit the nail on the head when noting, it is difficult to get a man to understand something when his salary depends upon his not understanding it!", "\n\nCreating bullshit business and its adjacent language remains the job of upper managers and a vast ring of ideologues surrounding corporations, ranging from lobbying camouflaged as think-tanks to employer associations, to the so-called business press, PR agencies, business school academics, and neoliberal economists. ", "They provide the “right”(!) ", "atmosphere for business, corporations, capitalism, and managerial regimes. ", "In workplaces, office workers are managerially controlled, supervised, monitored, watched, assessed and measured by KPIs, the infamous key performance indicators. ", "It is not workers but managers who are responsible for complex sets of rules and regulations. ", "In the corporate world of business, however, these are no longer called rules and regulations – they are now called corporate policies, mission statements, and the like.", "\n\nSuch a top-down engineering of corporate bullshit policies, KPIs, mission statements, etc. ", "has rather negative consequences for workers. ", "Not only do you have to spend your time answering emails, sitting in meetings, and update your LinkedIn page as well as your next performance review, now you also need to spend time trying to optimize the way you process the bullshit that rains down on you from the top. ", "This puts a double burden onto workers in the form of bullshit time, e.g. wasted time satisfying the upper echelons of Managerialism, and real working time, e.g. doing your job. ", "Beyond that, many workers complain about the stratospheric increase of sitting in often rather useless meetings. ", "The sheer endless amount of Dilbert cartoons and internet-transmitted jokes about management meetings tells one as much.", "\n\nConcurrently, Managerialism’s bullshit business not just wastes an employee’s time sitting in management meetings but much of middle-management’s work is also artificially made busy through attending meetings, reviewing other people’s work, maintaining good relationships with co-workers and upper management through informal conversations, feed the administration machine through various form filling, and putting together proposals and propositions for new projects and funding. ", "Worse, some workers are annually forced into re-applying for their own positions. ", "In those cases, HRM’s internal labor market is driven to extremes by upper-managers hooked on the systemic and structural casualization of the workforce often camouflaged as being part of strategic management or restructuring or some other fashionable bullshit business. ", "Beyond that, much of this legitimizes upper management as they organize the entire recruitment and selection process from job analysis to position descriptions, advertising the position, creating short-lists, holding job interviews, etc.", "\n\nMore often than not, many of these activities are done to feed the upper-management apparatus by sustaining its existence as many of these activities, like form filling, even when online, aren’t really necessary for the administration of a company. ", "They are necessary for the acceptability of upper-management, the chain of command, the hierarchies and the controlling rules it has established. ", "In short, it feeds the behemoth of Managerialism. ", "Many at the top of the managerial pyramid who remain true believers of management fundamentalism see those at the bottom of Fayol’s infamous “chain of command” in the following way: you’re just a sheet of paper. ", "While this sheet of paper might appear to be bullshit business, in managerial reality, it reduces workers to a figure on Kaplan and Norton’s “balanced scorecard”.", "\n\nWhether employees are denigrated to human resources and assigned an individual profit indicting number on an (often not really) “balanced” scorecard or Xcel-file for the purpose of performance management, they are forced into line – a line invented and handed out by management. ", "Under neoliberalism’s deregulation of formerly protective work rules and the deliberately created demise of trade unions, this occurs increasingly in a “my way or the highway” approach. ", "In any case, you can be cynical about management bullshit all you want in private, but in public you need to pretend you are signing up. ", "Workplaces under the rule of Managerialism are never really the “public”. ", "Quite often, these are authoritarian workplaces without democracy.", "\n\nThese workplaces are reflective of a mixture of George Orwell’s “Animal Farm” and “Nineteen Eighty-Four”. ", "Managerialism mixes Orwellian style “some animals are more equal than others” with Big Brother style workplace surveillance. ", "Workers deliver scripted behavior and “Impression Management”. ", "On a much more sophisticated and perhaps even slightly philosophical note, what occurs inside managerial regimes might be reflective of Baudrillard’s “Simulacra”. ", "Many workers no longer really partake in management bullshit. ", "Instead, they merely simulate. ", "Working in today’s companies becomes mere simulation. ", "And this remains so irrespective of “Working With the Corporate Psychopath” or not.", "\n\nOf course, it is not only ordinary office workers who are drowning in shit, Managerialism or bullshit business has entered universities as well. ", "This is so ever since Managerialism came to universities as the German army came to Poland. ", "As a consequence, for example, plans for a new building for an international center for democracy and conflict resolution were cancelled in favor of a new building for the business school. ", "The much believed “we live in a democracy” ideology conveniently camouflages the democracy to business move. ", "An awareness that huge chunks of our lives are excluded from democracy: our educational systems, our schools, and of course our workplaces, is eliminated from our imagination. ", "Terms like workplace or industrial democracy have all but disappeared. ", "Google.", "Books gives the impression that industrial democracy died a slow death sometime during the 1970s. ", "It has effectively been eliminated from the public domain and even more so from academia. ", "Industrial democracy is no longer taught at universities.", "\n\nBullshit business also helps to assure that in the managerialized university, teaching and research have been replaced by the classical insignia of Managerialism with league tables, beauty contests, rankings and “impact factor fetishism” as the crown king of scholarly achievement. ", "What counts in universities as in business schools are the routinely undergone brand-building and brand-refreshing exercises each time there is a change of deans or a new cohort of management consultants is hired. ", "This is an activity spiced up with the eternally performed treadmill of business restructuring. ", "In any top-heavy university apparatus blown up by Managerialism, the number of administrators has increased rapidly while the number of academics has stayed relatively flat. ", "When the managerialist university is “Selling Students Short”, it does so with more managers and less academics. ", "Meanwhile, the real work no longer means doing research and teaching and other things a university is supposed to do. ", "Rather, the real work has become dealing with bullshit to make universities appear more business-like.", "\n\nVirtually the same happened, for example, in Britain’s National Health Service: there was an 87 per cent increase in the number of managers, whereas the number of clinical staff rose by about a third. ", "This may be bullshit business but all this has something to do with neoliberalism, Managerialism, Maggie Thatcher, Ronald Reagan and the Austrian aristocrat Herr von Hayek’s neoliberalism. ", "Under the managerial university, people like Albert Einstein and Alan Turing are all but useless as they do not “publish a lot” nor do they rake in external, i.e. corporate funding. ", "Certainly, in the case of Alan Turing, they might not even help in creating the right image of a university. ", "Today, what matters is the external presentation – the eternal beauty pageant ever since a few second-tier journalists of a middle-level outfit called “USA Today” invented university rankings during lunch -or so the story goes.", "\n\nEccentrics like Alan Turing may well be the people who once told the truth but in today’s university their reputation is on the line and so are their jobs. ", "Today, university management will “performance management you out of here” if you do not measure up. ", "The case of London’s Imperial College and Stefan Grimm has shown so pointedly. ", "In other words, reality reaches well beyond the fact that business bullshit took precedent over anything vaguely resembling the truth – it can kill people. ", "Bullshit business in the form of Managerialism has very serious consequences reaching far beyond mere lips-service.", "\n\nIt is certainly on the mark to note that relying on bullshit means organizations do not get to the root of the issue. ", "The very same can be said about business schools. ", "They too do not get to the root of the issue. ", "Their ideological task is to camouflage the negatives of business, corporations, and capitalism. ", "For them bullshit business is very much a mixed blessing. ", "Blessed is the managerial bullshitter. ", "In a reminiscence of avoiding what American philosopher John Rawls once called the “veil of ignorance”, one should never be ignorant to what lies behind bullshit business. ", "Some of this is shown in Schrijvers’ most exquisite ‘The Way of the Rat’. ", "Interestingly, one shouldn’t forget key bullshit business terms such as PR’s corporate social responsibility (CSR) and business ethics. ", "Bullshit business has been with us for some time now and the indications that it will leave soon are slim. ", "Bullshit business supports capitalism and Managerialism. ", "Someone once said that it is easier to imagine the end of the world than to imagine the end of capitalism. ", "In the case of bullshit business, this seems pretty much on the mark.", "\n\nAndre Spicer’s book Bullshit Business was published in 2018 by Routledge." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.8457755446434021, 0.9488038420677185, 0.4859088659286499, 0.6177021265029907, 0.816780149936676, 0.9205541014671326, 0.3857879936695099, 0.018427792936563492, 0.02114247903227806, 0.7998730540275574, 0.0006046223570592701, 0.00602152943611145, 0.9547924399375916, 0.61802738904953, 0.9014121294021606, 0.008493811823427677, 0.0006414522067643702, 0.7193928360939026, 0.9438655376434326, 0.8619429469108582, 0.0006204820820130408, 0.7535401582717896, 0.000805747346021235, 0.8335913419723511, 0.940834641456604, 0.00146171182859689, 0.5139941573143005, 0.7128685712814331, 0.0009528297814540565, 0.0006435748655349016, 0.6983416080474854, 0.29031726717948914, 0.7632834911346436, 0.0006546644144691527, 0.0007130957092158496, 0.0020795937161892653, 0.0007679226109758019, 0.23689281940460205, 0.0007460467168129981, 0.0013136194320395589, 0.0014183620223775506, 0.0010163374245166779, 0.0006486665224656463, 0.4603141248226166, 0.047559965401887894, 0.029033873230218887, 0.00064285151893273, 0.0006640867795795202, 0.0006192343425936997, 0.0012665119720622897, 0.0006266332929953933, 0.0005970311467535794, 0.0006598707986995578, 0.0006272615864872932, 0.0007308535277843475, 0.0006058951839804649, 0.0006754678324796259, 0.0015555626014247537, 0.0008352024597115815, 0.7061724066734314, 0.001966512529179454, 0.0007026370149105787, 0.0011325549567118287, 0.000616053119301796, 0.0006080564926378429, 0.9353837966918945, 0.000595333578530699, 0.06302959471940994, 0.0013533711899071932, 0.3532905876636505, 0.9171491265296936, 0.9323087930679321, 0.0017807650147005916, 0.6847653388977051, 0.0006946880021132529, 0.0005747040268033743, 0.0007443981012329459, 0.0007366039790213108, 0.000608273025136441, 0.8039060235023499, 0.000977983814664185, 0.8098457455635071, 0.594693124294281, 0.001410445082001388, 0.001369767589494586, 0.2690298855304718, 0.0036883538123220205, 0.19844146072864532, 0.0006262219394557178, 0.0005853574839420617, 0.0006218401831574738, 0.012617378495633602, 0.04273996874690056, 0.25503140687942505, 0.0006462322198785841, 0.0014499746030196548, 0.6763359904289246, 0.0008389013237319887, 0.0009198647458106279, 0.0008050327887758613, 0.0008162478916347027, 0.0007351054227910936, 0.000611690862569958, 0.9448874592781067, 0.0010786631610244513, 0.0009021999430842698, 0.10497432947158813, 0.8865584135055542, 0.0008874649647623301, 0.0005724956281483173, 0.0006557866581715643, 0.0006595058366656303, 0.0007331374217756093, 0.0009281968814320862, 0.0018585012294352055, 0.0006378465332090855, 0.0007744499016553164, 0.5402437448501587, 0.0005981443682685494, 0.0005918003153055906, 0.0007308657513931394, 0.001239958917722106, 0.0007020941120572388, 0.8369195461273193, 0.0006087364163249731, 0.8755031228065491, 0.0127260135486722, 0.0005635152338072658, 0.0006995438016019762, 0.000981526798568666, 0.002889163326472044, 0.0005894430796615779, 0.8658580183982849, 0.9564874172210693, 0.7222042679786682, 0.0006295332568697631, 0.0007839638274163008, 0.0006893211393617094, 0.9357110857963562, 0.9332731366157532, 0.7585785984992981, 0.018001915886998177, 0.5663836002349854, 0.9586045145988464, 0.9477000832557678, 0.000775531807448715, 0.852912187576294, 0.7028890252113342 ]

[ "Product Description\n\nHandheld Buddhist prayer wheel\n\nMade of copper, brass and carved wood handle\n\nFeatures six colored accent beads and small attached weight\n\nMeasures 7.75 inches long, 1.5 inches diameter\n\nWeighs about 2 ounces\n\nPractice your mantra with the help of these personal Buddhist prayer wheels. ", "Inspired by centuries of tradition, these rustic instruments are embossed with the meditative chant: “Om Mani Padme Hum.” ", "Each copper and brass wheel is decorated with six blue and red beads and is linked by chain to a small weight.", "\n\nBecause of the unique artistry behind each prayer wheel, no two are alike. ", "Variations in the copper and bronze finish, the wood handles and even the wheel weights and beads are natural imperfections that only further the individual identity of these modern-day artifacts.", "\n\nProduct Description\n\nHandheld Buddhist prayer wheel\n\nMade of copper, brass and carved wood handle\n\nFeatures six colored accent beads and small attached weight\n\nMeasures 7.75 inches long, 1.5 inches diameter\n\nWeighs about 2 ounces\n\nPractice your mantra with the help of these personal Buddhist prayer wheels. ", "Inspired by centuries of tradition, these rustic instruments are embossed with the meditative chant: “Om Mani Padme Hum.” ", "Each copper and brass wheel is decorated with six blue and red beads and is linked by chain to a small weight.", "\n\nBecause of the unique artistry behind each prayer wheel, no two are alike. ", "Variations in the copper and bronze finish, the wood handles and even the wheel weights and beads are natural imperfections that only further the individual identity of these modern-day artifacts." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006058409926481545, 0.0007596814539283514, 0.0006236798362806439, 0.000609596841968596, 0.0005806064000353217, 0.0006058409926481545, 0.0007596814539283514, 0.0006236798362806439, 0.000609596841968596, 0.0005806064000353217 ]

[ "Q:\n\nHow can I check to see if any values in an array show a value of true with an if statement?", "\n\nI have the following object:\nvar myObj = \n{\"qId\":\"726112\",\n \"text\":\"xx\",\n \"answers\":[{\"answerId\":null,\n \"answerUId\":1,\n \"text\":\"xx\",\n \"correct\":null,\n \"response\":false},\n {\"answerId\":null,\n \"answerUId\":2,\n \"text\":\"xx\",\n \"correct\":null,\n \"response\":false},\n {\"answerId\":null,\n \"answerUId\":4,\n \"text\":\"xx\",\n \"correct\":null,\n \"response\":false}]}\n\nCan someone tell me how I can use an if statement to check if any one of the response fields has a value of true?", "\n\nA:\n\nYou can use Array.prototype.some function, which returns true if atleast one of the elements return true, like this\nif (myObj.answers.some(function(answer) { return answer.response; })) {\n # Atleast one of them is true\n}\n\nWorking demo\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000680775847285986, 0.0010017567547038198, 0.0007121245726011693 ]

[ "Relative tumor burden predicts metastasis-free survival in pediatric osteosarcoma.", "\nTo analyze the significance of relative tumor burden in pediatric osteosarcoma. ", "We retrospectively reviewed 241 patients with localized pediatric osteosarcoma and measured tumor size on MR images at presentation. ", "Absolute tumor size parameters measured on MR images were converted to relative values by dividing body surface area. ", "Both absolute and relative size parameters were analyzed for their correlation with metastasis-free survival (MFS). ", "The 5-year MFS was 67.5 +/- 3.1%, with median follow-up of 72 months (range, 8-205 months). ", "In addition to poor histologic response (RR 3.24; 95% CI: 1.99-5.28; P < 0.001), large relative tumor plane (RTP; RR 3.28; 95% CI: 1.72-6.25; P < 0.001), large relative tumor area (RTA; RR 4.14; 95% CI: 1.53-11.22; P = 0.005), and large absolute tumor width (ATW; RR; 3.10; 95% CI: 1.23-7.79; P = 0.02) shortened the MFS. ", "When survival was analyzed by combining RTP and histologic response, patients with small RTP and a good response showed the best survival (5-year MFS of 90.2 +/- 3.6%), while those with large RTP and a poor response showed the worst survival (5-year MFS of 45.1 +/- 6.6%). ", "Relative two-dimensional tumor size parameters (RTP and RTA) rather than absolute values are useful prognostic factors in pediatric osteosarcoma patients." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0014069966273382306, 0.0007032481953501701, 0.0007900316268205643, 0.0005987021722830832, 0.0006101231556385756, 0.0005803211824968457, 0.0008860163507051766, 0.0006106270011514425, 0.0007471502176485956 ]

[ "Walking speed is a feasible measure for patients admitted to an acute care hospital, illustrating that patients walk slowly relative to community requirements but that their speed improves even over a short course of therapy, say authors of an article published online in Journal of Geriatric Physical Therapy.", "\n\nThis observational cross-sectional study included 46 hospital inpatients (mean age 75 years (SD = 7.8) who were referred to physical therapy and able to walk at least 20 feet. ", "Researchers obtained information regarding diagnosis, comorbidities, physical assistance, device use, body height, and weight for each participant. ", "Speed was determined during initial and final physical therapy visits while patients walked at their self-selected speed over a marked course in a hospital corridor.", "\n\nTherapists reported that measuring walking speed was clinically feasible, requiring inexpensive, available resources, 4 minutes' additional time, and simple calculations for documentation. ", "Initial walking speed was a mean of 0.33 m/s (SD = 0.21), whereas final speed was 0.37 m/s (SD = 0.20). ", "The Wilcoxon test showed the increase in walking speed (0.04 m/s) to be significant over a mean therapy period of 2.0 days (SD = 1.4) and total hospitalization period of 5.5 days (SD = 3.6). ", "The effect size and standardized response mean were 0.19 and 0.36, respectively. ", "Minimal detectable change was 0.18 m/s." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006555370055139065, 0.000621077255345881, 0.0005225584609434009, 0.0005682928604073822, 0.000553685356862843, 0.0006917682476341724, 0.0007040851633064449, 0.0006415316602215171, 0.000641543185338378 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a device for lifting a seat of a toilet. ", "More particularly, the present invention relates to a foot operated device for lifting a seat of a toilet.", "\n2. ", "Description of the Prior Art\nNumerous innovations for foot operated devices for lifting a seat of a toilet have been provided in the prior art that will be described. ", "Even though these innovations may be suitable for the specific individual purposes to which they address, however, they differ from the present invention.", "\nA FIRST EXAMPLE, U.S. Pat. ", "No. ", "4,649,576 to Lillie teaches a foot actuated toilet seat lifter in which a base member of substantially triangular cross-section is placed on the floor with the apex down. ", "Foot pressure on one surface of the base pivots the base about the apex, causing a shaft to press upward on a bracket attached to the toilet seat, thus lifting the seat. ", "A variety of base shapes are disclosed, together with a bellows for damping seat lowering, and optional means for securing the base to the floor or carpet. ", "All parts are removable to aid in cleaning, and may be installed or removed without tools. ", "The base member may optionally have a continuously curving lower surface, or may be formed of angled material to achieve the same effect as a triangular member. ", "The resulting devices have the advantage of employing very few parts when compared to some prior art lifters.", "\nA SECOND EXAMPLE, U.S. Pat. ", "No. ", "4,975,988 to Won teaches a device for lifting, lowering, and locking a toilet seat assembly in position without any hands-on interaction with the toilet seat assembly that includes a selection of devices having additional mechanical advantage when pivoting the seat assembly. ", "In one preferred embodiment of the invention, a cable-operated foot lever is used in combination with a crank portion on the hinge of the toilet seat. ", "In another preferred embodiment of the invention, a system of planetary gears is used in the lever and/or the hinge assembly.", "\nA THIRD EXAMPLE, U.S. Pat. ", "No. ", "5,444,877 to Kumarasurier teaches a foot operated double acting lever for rotating a lid hinged to a base from a first position to a second position such as lifting the seat of a toilet bowl without touching the seat with the hands wherein the lid (or seat) is locked in the second position when the pedal is not depressed thereby maintaining the seat in its second position and is unlocked by depressing the pedal a second time and allowing the lid to rotate back to its first position at a speed that is under control of the foot on the pedal. ", "The device includes a rotating housing coupled to one end of the lever (opposite the end with the pedal) that is coupled to a drive gear that turns a hinge gear mounted to rotate on the same axis as the lid. ", "In order that the lid be locked in the second position, a lock catch engages the drive gear and a fixed slot thereby locking the drive gear. ", "when the pedal is depressed, the lock catch is with drawn permitting the drive gear to rotate thereby allowing the lid to rotate on its hinge back to its first position.", "\nA FOURTH EXAMPLE, U.S. Pat. ", "No. ", "5,448,782 to RataJac teaches a foot actuated toilet seat lifting device having an adjustable width toilet seat attachment bracket, a telescoping lifting arm assembly, an actuator lever, a fluid pressure cylinder, and a base assembly. ", "The rear end of the fluid pressure cylinder is pivotally secured to the base assembly and the front end of its piston rod is pivotally secured to the actuator lever intermediate its front and rear ends. ", "The actuator lever is secured to a transversely extending axle mounted to the base assembly. ", "A foot pedal assembly is mounted on the front end of the actuator level. ", "When the foot pedal is depressed, the actuator level pivots around its axle and lifts the telescoping lifting arm assembly tube upwardly. ", "This causes the toilet seat attachment bracket secured to its upper end to lift the toilet seat through a predetermined upward angle. ", "The fluid pressure cylinder allows the toilet seat to be automatically slowly lowered to its horizontal position upon release of pressure on the foot pedal assembly.", "\nA FIFTH EXAMPLE, U.S. Pat. ", "No. ", "5,487,192 to Hodges teaches an apparatus for the raising and self-lowering of a toilet seat comprising a level, the lever being disposed in an essentially vertical plane having a central aperture extending therethrough for the receipt of a bolt and an associated nut for constituting a pivot point, the lever having an outboard end with a pedal secured thereto for being depressed by the foot of a user, the lever having an inboard end with an aperture therethrough for receipt of a bolt with an associated nut for transferring motion from the pedal to a toilet seat to be lifted upon the depression of the pedal; and a support assembly for attachment to a support bolt of a toilet seat and for supporting the lever at its pivot point, the support assembly including an L-shaped bracket with a horizontal leg formed with an aperture for being received by and secured to the support bolt of a toilet and with the L-shaped bracket having an upstanding leg with an aperture, the support assembly also having a horizontal bracket with a pair of apertures at each end, the aperture at one end being coupled to the apertures of the L-shaped bracket, the support assembly also including a vertical bracket having an upper end with two apertures adapted to be received in the outboard apertures of the horizontal bracket and with a lower end positionable in contact with the toilet for maintaining a proper orientation of the support assembly.", "\nA SIXTH EXAMPLE, U.S. Pat. ", "No. ", "5,488,743 to Alfonso teaches a mechanical apparatus used to lift and lower the lid and seat of a toilet by the way of a pedal mechanism. ", "The pedal mechanism is connected by levers to a cylindrical lifting device mounted on a shaft. ", "The lifting device is connected to the lid and seat by clasps which are screwed, bolted, riveted, or glued to the toilet lid and seat. ", "The apparatus is held in place by floor braces attached by threaded studs which are fixed to the floor by nuts or by being cemented in depending on the material to be fixed to. ", "An adjusting lever proceeding from the lifting device and connected to the pedal mechanism by a lever, can be adjusted 80 that the lid and seat stay up after taking the foot away from the pedal. ", "One or both pedals can be actioned at the same time with one foot. ", "The pedal stirrups are cup shaped. ", "Thus the lid and seat can be lifted by pressing down with the sole of the shoe. ", "To lower the seat and/or lid, the top of the shoe toe makes contact with the inside top of the pedal stirrup pressing upwards on the pedal thus lowering the seat and/or the lid. ", "The entire apparatus can be made of synthetic materials and/or noncorrosive metal with the exception of the mounting shaft and the floor braces. ", "For the mounting shaft and the floor braces noncorrosive metal is best due to the strain produced when fixing the apparatus in it place to keep it secured.", "\nA SEVENTH EXAMPLE, U.S. Pat. ", "No. ", "5,594,958 to Nguyen teaches a hands-off toilet seat lifting apparatus comprised of a mounting bracket adapted for removable securement around a base of an existing toilet. ", "The mounting bracket has a securement block secured to an outer surface thereof. ", "The device contains a first foot pedal having a rod extending outwardly therefrom. ", "The rod has an end portion pivotally coupled to an intermediate portion of an arm. ", "A stop mechanism is coupled around the pivotally coupled rod and arm. ", "The arm has a first end and a second end. ", "The first end is pivotally coupled to an outer surface of the securement block of the mounting bracket. ", "The second end of the arm has an adjustable shaft extending upwardly therefrom. ", "The adjustable shaft has an end portion secured to a toilet cover. ", "The first foot pedal has a spring secured to a bottom surface thereof. ", "The first end of the arm has a spring secured to a bottom surface thereof. ", "It is apparent that numerous innovations for foot operated devices for lifting a seat of a toilet have been provided in the prior art that are adapted to be used. ", "Furthermore, even though these innovations may be suitable for the specific individual purposes to which they address, however, they would not be suitable for the purposes of the present invention as heretofore described.", "\nACCORDINGLY, AN OBJECT of the present invention is to provide a foot operated device for lifting a seat of a toilet that avoids the disadvantages of the prior art.", "\nANOTHER OBJECT of the present invention is to provide a foot operated device for lifting a seat of a toilet that is simple and inexpensive to manufacture.", "\nSTILL ANOTHER OBJECT of the present invention is to provide a foot operated device for lifting a seat of a toilet that is simple to use.", "\nBRIEFLY STATED, STILL YET ANOTHER OBJECT of the present invention is to provide a foot operated device for lifting a toilet seat that includes a base, a foot pedal, a pair of arms, and a pedal lock. ", "The base includes a pair of fulcrums. ", "The foot pedal includes a pair of levers that are pivotally mounted to the pair of fulcrums, respectively, and a pedal that connects the pair of levers. ", "The pair of arms are pivotally mounted to the levers, respectively, extend upwardly therefrom, and engage the toilet seat so as to allow the toilet seat to be raised when the pedal is depressed by a foot by virtue of the pair of levers being pivoted upwardly causing the pair of arms to rise and raise the toilet seat along therewith. ", "The pedal lock is movably mounted to the base and maintains the toilet seat in its up position, and when released, allows the toilet seat to return to its down position.", "\nThe novel features which are considered characteristic of the present invention are set forth in the appended claims. ", "The invention itself, however, both as to its construction and its method of operation, together with additional objects and advantages thereof, will be best understood from the following description of the specific embodiments when read and understood in connection with the accompanying drawing." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0013600728707388043, 0.0011351542780175805, 0.001185585861094296, 0.000783901778049767, 0.0005919086397625506, 0.0007282512378878891, 0.0013785817427560687, 0.0013069037813693285, 0.0014205890474840999, 0.0005420669331215322, 0.0007277188124135137, 0.0005895444191992283, 0.0007980171358212829, 0.0007980726077221334, 0.0013785817427560687, 0.0009303268161602318, 0.0010565448319539428, 0.0006345855654217303, 0.0008459463715553284, 0.0013785817427560687, 0.0010844330536201596, 0.0008136681281030178, 0.001018199254758656, 0.0011821311200037599, 0.0008249320671893656, 0.0013785817427560687, 0.0009413159568794072, 0.0007822064799256623, 0.0006845789030194283, 0.0006892048404552042, 0.0010204759892076254, 0.0025724044535309076, 0.0019319159910082817, 0.0008321396890096366, 0.0013785817427560687, 0.0007806898793205619, 0.0008073608623817563, 0.0013785817427560687, 0.0010800543241202831, 0.0006902217282913625, 0.0012842555297538638, 0.0007721408037468791, 0.0006957925506867468, 0.0008498405804857612, 0.0013134179171174765, 0.0007972311577759683, 0.0015890880022197962, 0.0006406514439731836, 0.0006335923681035638, 0.0007785562775097787, 0.0013785817427560687, 0.001276840572245419, 0.0007500080391764641, 0.0008961073472164571, 0.0008220577146857977, 0.0006345635047182441, 0.0011344888480380177, 0.000775073014665395, 0.0010643749265000224, 0.0020211017690598965, 0.0007161815301515162, 0.0006979033350944519, 0.0008821245864965022, 0.0005673078703694046, 0.0012312827166169882, 0.0011796295875683427, 0.0014387544943019748, 0.0008382772793993354, 0.011878996156156063, 0.00095632259035483, 0.0023528377059847116, 0.0019985511898994446, 0.0005804147222079337, 0.0005258942837826908 ]

[ "Alright, this is my first challenge, and I've noticed in this Otaku World... people sure do like to make a lot of Vocaloid Wallpapers...! ", "But I rarely see the BOYS in the wallpaper! ", "And I'd like to change that!", "\n\nRules For the ~Vocaloid Boys~ Challenge\n\nMust be of either of the two Vocaloid boys (and as of recently I heard there is five, just Len and Kaito are more widely known\n\nYou may include one of the girls, but they have to be a background character. (", "Or something not as important as the boys)\n\nUnlimited Entries, go wild!", "\n\nGive credit where credit is due\n\nNo plagiarism! ", "That's a no-no!", "\n\nPlease keep it PG\n\nAnd no Yaoi for this one, I'll make something else for that ;)\n\nContest ends 8/9/10 <--- Hey... that's kind of cool! ", "xD\n\nAnd also, the more colourful and upbeat the wallpaper, the greater the chance to win. ", "But you're free to try and persuade me with any type of wallpaper. ", "Remember, unlimited entry!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0021713997703045607, 0.0012490175431594253, 0.0012812213972210884, 0.0007172818295657635, 0.005301276221871376, 0.002556955674663186, 0.004160179290920496, 0.0007145031122490764, 0.0006713476032018661, 0.0006633017910644412, 0.0007240390405058861 ]

[ "Detectives in the city are reaching out to the Somali community in\nhopes of tracking down a man wanted on Canada-wide warrants for second\ndegree murder.", "\n\nInvestigators say Hassan Isse Ismail, 30, is\nwanted in connection with the death of Aden Ahmed, 24. ", "Ahmed was found\ndead near 113th Avenue and 94th Street suffering from stab wounds.", "\n\nPolice hope that someone in the Somali community, or elsewhere in Edmonton, may know where Ismail is.", "\n\nScott Pattison, with EPS, says they are releasing posters in both English and Somali.", "\n\n\"They are going out to about 30 or 40 businesses throughout the East\nAfrican community, aswell as the broader community in Edmonton. ", "The\nposter was translated with help by leaders within the Somalia community,\nwhich highlights our strong relationship we have with them.\"", "\n\nAds By Google\n\nPattison says the Somalia community played a vital role in solving an\nearlier homicide and are hoping they can do the same with Ismail.", "\n\nHe's described as a black man, about six foot three inches tall and weighs around 200 pounds.", "\n\nIf you know anything about Ismail's whereabouts or have any other information on this case contact police or CrimeStoppers." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009533291449770331, 0.0006160067860037088, 0.010651415213942528, 0.000613153912127018, 0.00096892163855955, 0.000526079791598022, 0.0004932830343022943, 0.0005392734310589731, 0.09116098284721375, 0.0006374444928951561 ]

[ "Andrea Bocelli recently announced dates for short U.S. tour 2019. ", "Andrea Bocelli will kick-off this 8-city tour on Dec. 7th at MGM Grand Garden Arena – Las Vegas, NV.", "\n\nAndrea Bocelli will be performing in support to his 16th studio album ‘Si’ – including shows in cities like San Diego, Houston, Washington, New York, and Riga. ", "In addition to this U.S. tour Andrea will be performing across Europe, UK, and South Africa.", "\n\nAndrea Bocelli will wrap-up this short U.S. tour with final show at Madison Square Garden – New York, NY on Dec. 19th. ", "Tickets are available for sale at TicketHub" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005941516719758511, 0.0007507434347644448, 0.0007071272702887654, 0.0006791476625949144, 0.0007050544372759759, 0.0007825333741493523 ]

[ "Design, Architecture, Gardens, Southern California Living\n\n'Paranormal Activity,' the horror of supernatural decor\n\nOctober 12, 2009 | 4:02\npm\n\nIt wasn't the demon. ", "It was the decor. ", "With apologies to the cult building around the midnight shocker \"Paranormal Activity,\" the most terrifying thing about the film was its claustrophobic, stultifying suburban set. ", "The spooky goings-on unfold inside a San Diego tract house, circa 2006, filled with furniture that looked like a one-day run to Pier 1, Z Gallerie, Cost Plus World Market and L.A. budget favorite Anna's Linens (with a stop at Best Buy for the most honkingly huge TV and some video equipment).", "\n\nWorking on a $15,000 budget for the entire film, director Oren Peli accurately captured the look of an average home where a young and obnoxious day trader is shacking up with his fiancee, a college student who has been demonized by an evil spirit since age 8.", "\n\nAmong the frights: A puffy bachelor pad black leather sofa, a faux Tuscan chandelier, the monstrous faux salvaged-from-a-church headboard and silk orchid arrangement in the bedroom shown here, and a patchwork tapestry shower curtain in gold and burgundy that actually made me gasp in horror.", "\n\n\"It's the modern-day version of a Gothic castle,\" whispered my movie-going companion.", "\n\nToo true. ", "The home actually belongs to Peli, a former video game designer turned director who still lives in it -- I hope with some new furniture." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006640443461947143, 0.0009770650649443269, 0.002791163045912981, 0.0011594847310334444, 0.018626151606440544, 0.004827989265322685, 0.0007171789766289294, 0.001703217625617981, 0.0005921413539908826 ]

[ "Judy Weinstein\n\nJudy Weinstein is a businesswoman who has been active in dance music since the 1970s. ", "From 1971 onwards, she attended David Mancuso's parties at The Loft in New York City, and assisted Mancuso with the running of his record pool. ", "In January 1978 David closed the record pool for several weeks without notice or explanation, apparently suffering from stress. ", "On February 1, 1978, she started a new record pool, For the Record, with Mark Riley and Hank Williams, and recruited a large number of New York's top DJs.", "\n\nWeinstein also co-founded the Def Mix production company in 1987, which became the home for DJs including Frankie Knuckles, David Morales and Satoshi Tomiie. ", "Weinstein brought Def Mix to Ibiza with a long-standing residency at Pacha.", "\n\nWeinstein also served as a bridge between traditional record companies and the dance music scene by working as a consultant on remixing for PolyGram Records, A&M Records and MCA Records. ", "She also produced a remix of her own, of \"Borderlines\" by Jeffrey Osborne.", "\n\nReferences \n\nCategory:Living people\nCategory:House music\nCategory:American entertainment industry businesspeople\nCategory:Year of birth missing (living people)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0010619779350236058, 0.0006089885719120502, 0.0008750524139031768, 0.0006110056419856846, 0.0007130005396902561, 0.0006587599636986852, 0.0006665879627689719, 0.0006722679827362299, 0.0005863114492967725 ]

[ "Alex Jones breaks down the nationwide protests calling for state and local governments to lift stay-at-home orders and allow Americans to get back to work, but Democrat leaders are determined to drag on the economic standstill to use as leverage against President Trump and the upcoming election.", "\n\nAlso tune in at infowars.com/show\n\nThe Emergency Election Sale is now live! ", "Get 30% to 60% off our most popular products today!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008495426154695451, 0.0007754708058200777, 0.024111228063702583 ]

[ "In order to reduce pollution level in the capital, the Delhi government has asked the Centre to make a provision in the law to impose a hefty fines on vehicles more than 15 years old entering the city.", "\n\nConcerned over the increasing pollution levels, Union Environment Minister Prakash Javadekar on Monday called a meeting with environment ministers of Haryana, Uttar Pradesh and Rajasthan, Delhi.", "\n\nAccording to the city's government, there are thousands of old vehicles from other states, including light and heavy which cause pollution at a high level.", "\n\n\"We have suggested Union Environment Minister to make such a provision in the law to impose a hefty fine on over 15-year-old vehicles entering the capital to discourage them from running here,\" Delhi Environment Minister Asim Ahmed Khan told PTI.", "\n\nUnion Environment Ministry has convened a meeting with environment ministers of Delhi, Haryana, Rajasthan and Uttar Pradesh on Monday to discuss the issue again.", "\n\nKhan said that more than 15-year-old vehicles, be it from Haryana, Punjab, or Jammu & Kashmir, they should be challaned strictly when they enter the capital.", "\n\n\"There is an urgent need to reduce pollution levels in the national capital and keeping this in mind, we have to take some major decisions. ", "In the past, several files to curb pollution have been prepared, but nothing happed on ground,\" he said.", "\n\nDismayed at the increasing level of air pollution in Delhi, National Green Tribunal had on November 26 barred all vehicles - private cars, bikes, commercial vehicles, buses and trucks - over 15 years old from plying in the capital." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008984104497358203, 0.0005611702799797058, 0.0008466911385767162, 0.0007083382806740701, 0.0005253957933746278, 0.0006049133953638375, 0.0005846708081662655, 0.0007352381944656372, 0.0006886287592351437 ]

[ "It looks like he mentioned his cakeday in the title It's a bold strategy, Cotton. ", "Let's see if it pays off for 'em.", "\n\n99,182 shares" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000660228484775871, 0.004798572044819593, 0.0015695714391767979 ]

[ "Although there are more cell phones in the United States then people, the FBI statistics of people who are involved in emergency situations is staggering. ", "Every second in the United States someone is involved with a car accident. ", "A property crime occurs every 3.5 seconds in the United States. ", "Every 5 seconds someone is a victim of larceny, aggravated assault, every 42 seconds, a robbery every 1.5 minutes, a rape every 6 minutes and a murder every 36 minutes. ", "Hundreds of people go missing each day in America and thousands are abducted each month.", "\nThe elderly demographic, defined as persons older than 56 years old, is the one of the fastest growing group of mobile device users and has been reported up 18% in the last few years. ", "While there are existing alert systems that are optimized and marketed to the elderly, many of these alert systems use the outdated. ", "Some derive from a pendant that is wirelessly connected with a speaker system located somewhere inside a house. ", "Other systems involve the transmission of a predetermined message using cellular transmission. ", "However, many senior citizens remain active and do not need to be constrained within the confines of their home to feel secure or have access to a security or alter system. ", "It is an object of the present invention to provide these people an alert system that enhances their independence to allow them to enjoy life.", "\nIt is an object of the invention to provide a simple, inexpensive system that allows people in emergency situations to establish rapid contact with friends, relatives and first responders and to make them aware of emergency situations. ", "In the ever-evolving world of extreme sports, people may be found in unusual emergency situations in remote backcountry areas where contact with others may be limited or infrequent. ", "Moreover, in many instances, people that are active in backcountry recreational activities, such as riding motorcycles, bicycling, skiing, snowboarding and horseback riding, will often wear a helmet and gloves which can impede the ability to easily communicate using a conventional cell phone. ", "For example, in some emergency circumstances, such as after an injury, it may be difficult or impossible to manipulate a conventional cell phone transmitter and a helmet can further impede the use.", "\nIf a person becomes lost or is missing, the person's friends and relatives may not be able to easily find them and may be required to obtain a court order to allow for the release of cell phone records that may help locate the person.", "\nThe horrific mass shootings that have occurred in recent history also illustrate a need for improved communications technology. ", "In this regard, many police chiefs have instructed people to follow the following protocol who find themselves in these situations: 1) Remove oneself from the dangerous location and retreat to a secure and safe location; 2) Barricade oneself in a safe spot and turn off your cellphone or any device that will ring; 3) Attempt to make contact with third parties without compromising a secret location; and 4) Wait for help." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005583649617619812, 0.0009319250239059329, 0.0007929293205961585, 0.06898779422044754, 0.0007526944973506033, 0.0007616454968228936, 0.0006680854130536318, 0.0005905319703742862, 0.0006038544233888388, 0.0005513298092409968, 0.0008073304779827595, 0.000590228708460927, 0.0006679819198325276, 0.0007265345775522292, 0.0005886082071810961, 0.0006734385387971997, 0.0007378925220109522, 0.0007361987372860312 ]

[ "Q:\n\nMost pythonic way to search through text to find answers to questions\n\nFor example lets say I have this text. ", "\n\nLorem ipsum dolor sit amet, consectetur adipiscing elit. ", "Nulla\n condimentum aliquam felis a efficitur. ", "Nunc vulputate, risus quis\n mollis tristique, odio velit tempus urna, quis tincidunt nulla nunc\n sit amet justo. ", "Maecenas quis quam molestie, hendrerit augue et,\n\nWhat is your name and occupation? ", "\n\nI am Jerry and I'm unemployed\n\nHow big is your family? ", "\n\nThere's five of us\nEtiam ipsum lorem, ullamcorper nec massa id, vulputate gravida sem.", "\n Duis pulvinar lacinia mattis. ", "Aenean dictum quam sed tincidunt\n eleifend. ", "Suspendisse convallis in leo at accumsan. ", "In viverra odio\n non ex egestas, malesuada feugiat justo malesuada. ", "Curabitur vitae\n\nWhat would be the easiest way to search through the text, and find the answesr to the questions? ", "Could a regex that grabs all text between question marks and the next number work? ", "Cheers. ", "\nEDIT: Does this regex make sense in the slightest? ", "\\\\?([^]]+)\\\\[0-9]\n\nA:\n\nIf you know the question will always be like (or similar to) the current format as you've shown then using the following pattern could potentially work:\n^.+\\?$|(.*)", "\n\nThe pattern finds all the questions, then captures everything else into a group. ", "It might require a bit of tweaking to get it to capture exactly what you want, but this might be a good starting point.", "\nimport re\n\nregex = r\"^.+\\?$|(.*)\"", "\n\nresult = re.findall(regex, test_str, re.", "MULTILINE)\n\nif result:\n for match in result: \n print(match)\n\nExample:\nhttps://regex101.com/r/bweMiZ/2\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005983057781122625, 0.0836300402879715, 0.11617656797170639, 0.3671455383300781, 0.0019343042513355613, 0.011964874342083931, 0.031988468021154404, 0.042887669056653976, 0.041986722499132156, 0.0029367830138653517, 0.04003670811653137, 0.0013084642123430967, 0.0008433584007434547, 0.0005552615621127188, 0.0008081397973001003, 0.000794747844338417, 0.0006154108559712768, 0.0005438782973214984, 0.0010960130020976067, 0.0006969791720621288, 0.0006247260025702417 ]

[ "Wednesday, August 17, 2016\n\nKing's Survey: A Story Where Nothing Happens\n\nIn\nwhich we experience the rhythms of ordinary life in an ordinary time—the life\nand time, no matter where or when it is, that most of us inhabit.", "\n\nSo here I am getting ready to talk with you about the coming of\nthe American Revolution, and I find myself looking at Ethan.", "\n\n—Hey, Mr. K.\n\nGreetings, Ethan. ", "You’ll note that Ethan looks reasonably alert\ncompared to Chris—or what appears to be Chris, if that’s Chris’s mane on a desk\nat this ungodly hour of 8:30 a.m. Ah, Chris, nice of you to join us. ", "Ethan, I\nsee you’re wearing a vintage Rage Against the Machine t-shirt.", "\n\n—It was my dad’s.", "\n\nA fact which reinforces the point I was about to make. ", "Ethan is\nwearing his dad’s Rage Against the Machine t-shirt. ", "Which is to say that we\nhave here a kid who’s wearing an emblem of rebellion from an earlier\ngeneration. ", "The fact that he’s wearing his father’s couture amounts to an act of\nfilial piety.", "\n\n—What’s couture?", "\n\nClothing, Jonah.", "\n\n—And what’s filial piety?”", "\n\nHonoring your elders, Emily. ", "Do you do that?", "\n\n—Ummm … Sort of.", "\n\nSort of?", "\n\n—I mean, I try.", "\n\nFigures.", "\n\nHey!", "\n\nNow, now, dear Em. ", "My point is that the Founding Fathers would\nbe probably be scratching their heads to see Ethan wearing a Rage shirt—what\ncould possibly anger one about a mechanical device? —", "though perhaps Thomas\nJefferson would get it, given his ambivalence about role of machines in\nAmerican life and his enthusiasm for rebellion everywhere (except among his\nslaves). “", "The tree of liberty must be refreshed with the blood of tyrants,” he\nfamously said at the time of the French Revolution. ", "So I don’t think he’d mind\nsome Rage. ", "Though I suspect he’d be disappointed that Ethan couldn’t be more\noriginal.", "\n\n—Well, I have a Kendrick Lamar T-shirt too. ", "Would that work?", "\n\nI dunno. ", "Doubtful. ", "But that’s OK. ", "We can’t all be as\nbloodthirsty as Thomas Jefferson.", "\n\n—You’re\nkidding, right?", "\n\nWell, no, Yin. ", "But I am digressing. ", "Let me get back on\ntrack. ", "What I want you do now is imagine yourselves, dear students, not as\nhappy residents of the 21stcentury\nbut instead as a people who were born somewhere in one of the thirteen original\nBritish colonies in 1760. (", "Among other things, this birthdate will make you the\nage you are now when our friend Jefferson makes his famous Declaration.)", "\n\n—Just like the Magic School Bus.", "\n\nRight. ", "But while those time-travel books drop you right into the\nmiddle of a dramatic situation just before it happens, I’m hoping to land us into\na moment in which nothing particular is happening. ", "You might find yourself in\nany number of circumstances, but I don’t think there’s any really big event\nthat takes place in the colonies in 1760. ", "Technically, there’s a war on—there\nhave been wars between England and France going on almost continually for the\nlast 70 years—but the hugely important Battle of Quebec has just been fought.", "\nNow it’s all over but the shouting; the British defeated the French in that\nbattle, and then went on to take Montreal in this year of your imagined birth.", "\nBoth cities, I’ll point out, are in Canada. ", "And you’re not. ", "So we’re going to\nsay this action is far away. (", "Pretty mucheverythingis far away at this point; roads are\npoor when they exist at all. ", "Trips you now make in hours now were measured in\nweeks.) ", "Besides, you’re a baby. ", "Maybe you’ve got an uncle or something off\nfighting. ", "But right now you’re on the far rim of the European world, almost\nsurely living on a farm. ", "That farm might be isolated, or it might be in a village.", "\nThere’s a slim chance you’re living in a city. ", "But you are, literally and\nfiguratively, provincial, living on the edge of a global empire that sprawls\nacross North America, the Caribbean, Europe, and Asia.", "\n\nBy the time you’re born in this Year of Our Lord 1760, there\nhave been English settlers on the Atlantic seaboard for over 150 years, and\nforced African migrants for about as long. ", "So your family might well have been\nhere for many generations already. ", "They might be more recent arrivals, too,\nwhether from one of those places or perhaps part of a new wave of migration\nScotland. ", "Or from that region of Europe we know as Germany. ", "In any event, you\nget my point: what some have been calling “the New World” is kinda old already.", "\nA civilization that rests, as all civilizations do, on the exploitation and\ndisplacement of the weak, has been established. ", "But it’s fragile; how fragile\ndepends on the precise location—North has more critical mass than South; East\nis more secure than West—but the whole span of the rim is solidifying.", "\n\nThe rhythms of everyday life on this perimeter haven’t changed\nin 1760. ", "Indeed, in some important respects, they haven’t changed in thousands\nof years. ", "You’re up at first light; your workday ends at sunset. ", "Depending how\nrich your family is, you might have money to burn in the form of candles, but\nvirtually no one is reckless about that. ", "Your home, even if you’re rich, is\nlikely to be quite small—tiny by 21stcentury standards. ", "Men, women and\nchildren will huddle together in rooms and beds, as much for warmth as for a\nlack of space. ", "Work, no matter what it is, will involve significant amounts of\ndrudgery. ", "Most of it will be manual labor, and most of that will involve\nfarming: plowing, planting, weeding, harvesting. ", "Milking, shepherding, shearing.", "\nHousehold tasks like churning, baking, and washing. ", "Even cushy professions like\nthe law will involve lots of routine tasks like copying letters contracts, and\nother documents—there are no Xerox machines— though if you’re successful you’ll\nhave someone to do some of that stuff for you. ", "Then, as before and later, the\nkey indicator of wealth is the degree to which you have someone else to do your\nwork, from housecleaning to executing trades.", "\n\nWhat varies are the tiers, and kinds of tiers, between the\nbottom and the top. ", "In between the ranks of free and slaves is a stratum of\nindentured servants. ", "Essentially, their labor has been sold (maybe by their\nparents; maybe to pass the cost of their travel to America) for a fixed number\nof years, typically seven. ", "Indentured servants learn a trade from a master,\nafter which they are free to become journeymen, and, hopefully, masters\nthemselves. ", "Women perform work anddevelop skills\nthat ideally will allow them, after their indenture ends, to marry, start\nfamilies and become mistresses of households. ", "Social mobility is real but\nfinite for white people, and a handful of black ones, though this has declined\nas the line between slave and free hardened.", "\n\nNo matter who you are, the pace of life is slow. ", "Travel, as I\nalready mentioned, is time-consuming and often unpleasant if not dangerous.", "\nNews will routinely take months to cross the ocean—and traveling on water is\ngenerally faster than traveling on land. ", "Routine transactions like buying and\nselling will be constrained by the lack of banks, paper money and trust: most\ntrade will take the form of barter, and will involve people you know. ", "Though\nyou’re aware of a wider world, you live in a very small one.", "\n\n—Sounds boring.", "\n\nWell, you don’t know any alternative, so you’re not likely to be\nunhappy about it. ", "In any case, boredom is less of a problem than fear. ", "There’s\nany number of things to be afraid of, beginning with disease. ", "Indian raids are\nalways a possibility. ", "And the weather is a source of chronic anxiety. ", "There are\nthe destructive storms, of course. ", "But as often as not it’s seemingly routine\nweather patterns that pose a threat: Too much rain? ", "Too little? ", "Too hot? ", "Too\ncold? ", "Your family fortunes rest on conditions for which there is nothing in the\nway of reliable forecasts, and over which you have no control.", "\n\n—What do people do for fun?", "\n\nWell, any number of things. ", "But the important thing to keep in\nmind is that there’s not nearly as much time for fun as there is now. ", "Which,\nagain, is not something you’re likely to notice. ", "There are a few people—the\nplanters on the great estates—who like to think of themselves as men of\nleisure. ", "But they often have to work harder than they’re willing to admit to\nmaintain what they have, and their wives have often have responsibilities, too.", "\nThere are no expectations of very young children (rich or poor, slave or free),\nwho often mingle, but before long everyone must take theirplace,\na term that was understood literally as well as figuratively, whether that\nplace was in the fields or with one’s tutors.", "\n\nBut to answer your questions, there are any number of pastimes.", "\nSome involve horses for those who have them. ", "Card games. ", "Of course, there’s\nalways sex. ", "Then, as now —maybemorethen than now—it’s the default\nfree-time activity. ", "And that includes people your age, though with barriers to\nprevent actual intercourse. ", "For instance, there’s the practice of bundling,\nwhere boys and girls are allowed to sleep together if they remain wrapped in\nseparate blankets. ", "Such forms of socializing follow events like barn-raisings,\nwhere the people in a town would pitch in to help each other with big projects\nthey can’t manage on their own. ", "Parties often follow, where there’s lots of\nalcohol; beer and cider are staples, along with whiskey. ", "People at this time\ndrink like fish—an average of over seven gallons annually for every man woman\nand child, in part because alcohol, since it’s sterile, is safer than water,\nwhere countless microbes lurk.", "\n\n—But weren’t they Puritans? ", "All uptight and stuff?", "\n\nWell, Emily, someof them were Puritans. ", "Descendants of\nthe Puritans, anyway. ", "But the Puritans weren’t really prudes in that way when\nit came to drinking or certain kinds of sex. ", "That said, you had to be careful:\nthe expectation was that if a girl got pregnant, there were great pressures for\nthe boy to marry her. ", "By 1760, this was as much for economic as moral reasons\nin a given community: raising that kid isyourjob; don’t makeusbear the cost of feeding your brat. ", "On\nthe other hand, if you’re a slave, your child is a slave, too. ", "So slave owners\nhad a real financial incentive for people to have sex, which they encouraged.", "\nAnd in some cases forced. ", "Sex was a popular pastime, but it had its dangers\ntoo, whether as a matter of rape or a high mortality rate for pregnant women\nand newborns. ", "The colonial woman gave birth anaverageof seven times in her life. ", "She\ntypically spent most of her adulthood pregnant or nursing.", "\n\n—Oh my god.", "\n\nFunny you should mention him, Em. ", "Because that’s where we’re\ngoing tomorrow: to church.", "\n\nAbout King's Survey\n\nKing's Survey is an imaginary high school history class taught by Abraham King, a.k.a. \"", "Mr. K.\" Though the posts proceed in a loosely chronological fashion, you can drop in on the conversation any time. ", "For more background on this series, see my other site, Conversing History. ", "The opening chapter of \"Kings Survey\" is directly below.", "\n\n“The Greatest Catholic Poet of Our Time . . . ", "Is a Guy from the JerseyShore? ", "Yup,” in The Best Catholic Writing 2007, edited by Jim Manney (Chicago: Loyola Press, 2007)\n\n“I’s a Man Now: Gender and African-American Men,” in Divided Houses:Gender and the Civil War, edited by Nina Silber and Catherine Clinton (Oxford University Press, 1992).", "\n\nTHE COMPLETE MARIA CHRONICLES, 2009-2010\n\nMost writing in the vast discourse about American education is analytic and/or prescriptive: It tells. ", "Little of that writing is actually done by active classroom teachers. ", "The Maria Chronicles, like the Felix Chronicles that preceded them (see directly below), takes a different approach: They show. ", "These (very) short stories of moments in the life of the fictional Maria Bradstreet, who teaches U.S. history at Hudson High School, located somewhere in metropolitan New York, dramatize the issues, ironies, and realities of a life in schools. ", "I hope you find them entertaining. ", "And, just maybe, useful, whether you’re a teacher or not.–Jim Cullen" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000616236706264317, 0.0006172548164613545, 0.0006915935082361102, 0.0021870729979127645, 0.076633021235466, 0.003509123343974352, 0.0006721638492308557, 0.06743068993091583, 0.0007261140854097903, 0.03565407171845436, 0.000965278479270637, 0.0009279466466978192, 0.0026509659364819527, 0.0007188088493421674, 0.0011378591880202293, 0.0008154934039339423, 0.0008710779948160052, 0.0008254533167928457, 0.0006976416916586459, 0.0025768503546714783, 0.001535962801426649, 0.013102766126394272, 0.000773642968852073, 0.08061178028583527, 0.06728333234786987, 0.0006186694954521954, 0.01334820594638586, 0.0009344313875772059, 0.0009662957163527608, 0.0007462457870133221, 0.0007015513838268816, 0.05207402631640434, 0.0013700793497264385, 0.0060994611121714115, 0.0006789370672777295, 0.0006081127212382853, 0.0006100792088545859, 0.0009358568931929767, 0.005724908318370581, 0.0008918967214412987, 0.0007346708443947136, 0.0005694354767911136, 0.0008348412229679525, 0.014740880578756332, 0.0005961926653981209, 0.0802830383181572, 0.0006599101470783353, 0.013262481428682804, 0.0006017074338160455, 0.47165924310684204, 0.08300215005874634, 0.01833982579410076, 0.0006087080109864473, 0.0014636542182415724, 0.005880764685571194, 0.0010276674292981625, 0.001156397513113916, 0.000600082625169307, 0.0006252358434721828, 0.0012318188091740012, 0.0011576892575249076, 0.0006300650420598686, 0.0006270667654462159, 0.0005961466813459992, 0.0037578141782432795, 0.018988311290740967, 0.04041628912091255, 0.0012362818233668804, 0.001205770648084581, 0.0006379747646860778, 0.02465861663222313, 0.0007276764954440296, 0.007365260738879442, 0.0006868040072731674, 0.0006636894540861249, 0.1280340999364853, 0.0006143510108813643, 0.0019418251467868686, 0.038277722895145416, 0.05372397229075432, 0.013957127928733826, 0.0006444925093092024, 0.0006304315174929798, 0.0006055652629584074, 0.06059544160962105, 0.046907689422369, 0.0010180477984249592, 0.002160902600735426, 0.0015007777838036418, 0.0006027285126037896, 0.0006011491641402245, 0.0010549281723797321, 0.0009023147285915911, 0.007069068029522896, 0.01985318399965763, 0.006769087165594101, 0.0011658580042421818, 0.000787196506280452, 0.0006371633498929441, 0.0006283320253714919, 0.00110806489828974, 0.0007127196877263486, 0.0010945246322080493, 0.004990530665963888, 0.000742934294976294, 0.0006280389497987926, 0.0010531401494517922, 0.1304405778646469, 0.001357351546175778, 0.008246573619544506, 0.0013180162059143186, 0.0007506082765758038, 0.0008782540680840611, 0.0045822435058653355, 0.018244905397295952, 0.014112220145761967, 0.0836244449019432, 0.0048873391933739185, 0.3469637632369995, 0.0008760171476751566, 0.2247035801410675, 0.9247144460678101, 0.6656984090805054, 0.0007539043435826898, 0.1795385181903839, 0.006400035694241524, 0.0008654966950416565, 0.007195109501481056, 0.0007438354077748954, 0.003544709412381053, 0.0007111652521416545, 0.0005420087836682796, 0.0005459662061184645, 0.0005577357369475067, 0.003006024518981576, 0.001605849713087082, 0.0007498321938328445, 0.0005955080850981176, 0.0007435749284923077, 0.0005784238455817103, 0.000677456904668361, 0.0005887187435291708, 0.0013273939257487655 ]

[ "Descendentsof Johannes Hoogeveen\n\nby Dirk Hoogeveen and Jan Arie van Hengel on September 19th 2014\n\nI Johannes Hoogeveen was born in 1697 in Loosduinen , ZH , NL.", "\nJohannes died on 26-05-1775 in ’s Gravenhage , ZH , NL, aged 77 or 78.", "\n\nOccupation:\n\nTuinier\n\nAt the age of 25 or 26, Johannes married Elisabeth Brederoo, aged 25, on 09-05-1723 in ’s Gravenhage , ZH , NL. ", "Elisabeth is a daughter of Gerrit Brederoo and Willmijna Hoogkamer.", "\nShe was baptised on 12-11-1697 in ’s Gravenhage, ZH, NL. ", "Elisabeth died on 20-04-1763 in ’s Gravenhage , ZH , NL, aged 65.", "\n\n(1) At the age of 22, Elisabet married Willem Joosten Kiefter on 24-10-1779 in ’s Gravenhage , ZH , NL.", "\n\n(2) At the age of 43, Elisabet married George Reinhard Embder, aged 28 or 29, on 22-06-1800 in ’s Gravenhage , ZH , NL. ", "George was born in 1771 in Zwerden , Nordrhein Westphalen , DL.", "\nGeorge died on 03-04-1853 in ’s Gravenhage , ZH , NL, aged 81 or 82.", "\n\n(1) At the age of 22, Johanna married Bernhardt Heinrich KĀhne, aged 26, on 16-05-1930 in ’s Gravenhage , ZH , NL. ", "Bernhardt was born on 13-01-1904 in ’s Gravenhage , ZH , NL.", "\nBernhardt died on 19-09-1957 in Voorburg , ZH , NL, aged 53.", "\nHe was buried on 21-09-1957 in ’s Gravenhage , ZH , NL.", "\n\n(2) At the age of 52, Johanna married Jan Marinus Nijssen, aged 59, on 20-04-1960 in Voorburg , ZH , NL. ", "The marriage was dissolved on 24-07-1962 in Voorburg, ZH, NL. ", "Jan was born on 22-10-1900 in Goes , Zld , NL.", "\nJan died.", "\n\n(1) At the age of 27, Engeltje married Carel Philip Weber on 04-08-1799 in ’s Gravenhage , ZH , NL. ", "Carel died before 1804.", "\n\n(2) At the age of 32, Engeltje married Jan Henkes, aged 29 or 30, on 08-07-1804 in ’s Gravenhage , ZH , NL. ", "Jan was born in 1774 in ’s Gravenhage , ZH , NL, son of Johannes Henkes and Jesijna Zwaanenburg.", "\nJan died on 24-01-1846 in ’s Gravenhage , ZH , NL, aged 71 or 72.", "\n\nIII-h Johannes Hoogeveen, son of Ari Hoogeveen (see II-c) and Maria Klinkenberg.", "\nHe was baptised on 17-01-1762 in ’s Gravenhage, ZH, NL. ", "Johannes died before 1801, aged less than 39.", "\nAt the age of 31, Johannes married Ida Pieternella Hoornik on 23-01-1793 in Voorburg , ZH , NL. ", "Ida was born in Geertruidenberg , NB , NL.", "\n\nIII-i Beatrix Hoogeveen, daughter of Ari Hoogeveen (see II-c) and Maria Klinkenberg.", "\nShe was baptised on 05-06-1763 in ’s Gravenhage, ZH, NL. ", "Beatrix died on 26-12-1822 in ’s Gravenhage , ZH , NL, aged 59.", "\nAt the age of 29, Beatrix married Reinier van Kampen on 20-01-1793 in Voorburg , ZH , NL. ", "Reinier was born in ’s Gravenhage , ZH , NL.", "\nReinier died after 1822.", "\n\nIII-j Elisabeth Hoogeveen, daughter of Ari Hoogeveen (see II-c) and Maria Klinkenberg.", "\nShe was baptised on 02-06-1765 in ’s Gravenhage, ZH, NL. ", "Elisabeth died on 16-07-1840 in ’s Gravenhage , ZH , NL, aged 75.", "\nAt the age of 33, Elisabeth married Barend van Ettinger, aged 30 or 31, on 19-05-1799 in Voorburg , ZH , NL. ", "Barend was born in 1768 in Voorburg , ZH , NL.", "\nBarend died.", "\n\n(1) At the age of 32, Adrianus married Helena van der Ende on 11-02-1770 in Delft , ZH , NL. ", "Helena was born in Rijswijk , ZH , NL.", "\nHelena died before 1775.", "\n\n(2) At the age of 38, Adrianus married Jannetje Rensen, aged 30, on 03-12-1775 in Delft , ZH , NL, after their intention to marry had been registered on 18-11-1775 in Delft , ZH , NL. ", "Jannetje is a daughter of Reinier Anthonie Rensen and Grietje Ariens Mooijman.", "\nShe was baptised on 19-09-1745 in Nootdorp, ZH, NL. ", "Jannetje died in Delft , ZH , NL aged 40.", "\nShe was buried on 01-09-1786 in Delft , ZH , NL.", "\n\n(3) At the age of 51, Adrianus married Jannetje van Vliet, aged 35 or 36, on 15-02-1789 in Delft , ZH , NL, after their intention to marry had been registered on 31-01-1789 in Delft , ZH , NL. ", "Jannetje was born in 1753 in Zegwaart (Zoetermeer) , ZH , NL, daughter of Cornelia van Vliet.", "\nJannetje died on 12-10-1817 in Delft , ZH , NL, aged 63 or 64.", "\n\nIII-k Reinier Hoogeveen was born on 05-06-1777 in Delft , ZH , NL, son of Adrianus Hoogeveen (see II-d) and Jannetje Rensen.", "\nReinier died on 15-11-1853 in Delft , ZH , NL, aged 76.", "\nThe decease was registered.", "\n\nOccupation:\n\nwarmoesier\n\nAt the age of 22, Reinier married Alida Cornelisse van den Akker, aged 21, on 29-09-1799 in Delft , ZH , NL, after their intention to marry had been registered on 13-09-1799 in Delft , ZH , NL. ", "Alida was born on 03-03-1778 in Hof van Delft , ZH , NL, daughter of Cornelis van den Akker and Jannetje van den Akker.", "\nShe was baptised on 08-03-1778 in Delft, ZH, NL. ", "Alida died on 15-06-1848 in Delft , ZH , NL, aged 70.", "\n\nIV-f Johanna Hoogeveen was born on 18-11-1799 in Delft , ZH , NL, daughter of Reinier Hoogeveen (see III-k) and Alida Cornelisse van den Akker.", "\nShe was baptised on 24-11-1799 in Delft, ZH, NL. ", "Johanna died on 07-06-1884 in Rotterdam , ZH , NL, aged 84.", "\nAt the age of 20, Johanna married Leendert Landsman, aged about 25, on 13-09-1820 in Delft , ZH , NL. ", "Leendert was born around 1795 in Purmerend , NH , NL, son of Floris Landsman and Sijtje Schotels.", "\nLeendert died on 01-01-1870 in Delfshaven (Rotterdam) , ZH , NL, aged about 75.", "\n\nV-c Floris Adrianus Landsman was born on 18-08-1823 in Delfshaven (Rotterdam) , ZH , NL, son of Leendert Landsman and Johanna Hoogeveen (see IV-f).", "\nFloris died.", "\nAt the age of 30, Floris married Neeltje van Duijn, aged 24 or 25, on 24-12-1853 in Naaldwijk , ZH , NL. ", "Neeltje was born in 1828 in Naaldwijk , ZH , NL, daughter of Jacob van Duijn and Teuntje Koole.", "\nNeeltje died.", "\n\nV-d Reinier Kornelis Landsman was born on 04-04-1825 in Delfshaven (Rotterdam) , ZH , NL, son of Leendert Landsman and Johanna Hoogeveen (see IV-f).", "\nReinier died on 02-07-1881 in Giessendam , ZH , NL, aged 56.", "\nAt the age of 37, Reinier married Louisa Maria Frederika Pantekoek, aged 30 or 31, on 05-09-1862 in Heenvliet , ZH , NL. ", "Louisa was born in 1831, daughter of Johannes Marinus Jacob Pantekoek and Magdalena Pool.", "\nLouisa died on 02-04-1920 in Giessendam , ZH , NL, aged 88 or 89.", "\n\nV-e Johannes Hendrik Landman was born on 27-01-1832 in Delfshaven (Rotterdam) , ZH , NL, son of Leendert Landsman and Johanna Hoogeveen (see IV-f).", "\nJohannes died.", "\nAt the age of 31, Johannes married Antoinetta Kloesman on 27-12-1863.", "\n\nV-f Frederik Hendrik Landsman was born on 24-05-1841 in Delfshaven (Rotterdam) , ZH , NL, son of Leendert Landsman and Johanna Hoogeveen (see IV-f).", "\nFrederik died on 19-10-1926 in Utrecht , Ut , NL, aged 85.", "\nAt the age of 29, Frederik married Johanna Maartje van Gent, aged 24 or 25, on 26-10-1870 in Gouda , ZH , NL. ", "Johanna was born in 1845 in Gouda , ZH , NL, daughter of Engel van Gent and Geertje Tijsterman.", "\nJohanna died on 24-10-1911 in Utrecht , Ut , NL, aged 65 or 66.", "\n\n3 Johanna Landsman, born in 1877.", "\nJohanna died on 02-12-1959 in Amersfoort , Ut , NL, aged 81 or 82.", "\n\n4 Geertruida Landsman, born in 1882.", "\nGeertruida died on 22-04-1940 in Utrecht , Ut , NL, aged 57 or 58.", "\n\nVI-g Leendert Landsman was born in 1871 in Nieuwkoop , ZH , NL, son of Frederik Hendrik Landsman (see V-f) and Johanna Maartje van Gent.", "\nLeendert died on 23-12-1936 in Utrecht , Ut , NL, aged 64 or 65.", "\nAt the age of 35 or 36, Leendert married Clasina Bok, aged 29 or 30, on 28-02-1907 in Utrecht , Ut , NL. ", "Clasina was born in 1877 in Tiel , Gld , NL, daughter of Peter Bok and Petronella Winkelman.", "\nClasina died.", "\n\nVI-h Engel Landsman was born in 1875 in Nieuwkoop , ZH , NL, son of Frederik Hendrik Landsman (see V-f) and Johanna Maartje van Gent.", "\nEngel died on 06-02-1944 in Utrecht , Ut , NL, aged 68 or 69.", "\nAt the age of 21 or 22, Engel married Aaltje Treels, aged 26 or 27, on 20-05-1897 in Woerden , Ut , NL. ", "Aaltje was born in 1870 in Kamerik , Ut , NL, daughter of Arie Treels and Margje Romijn.", "\nAaltje died before 1944, aged less than 74.", "\n\nIV-g Cornelia Hoogeveen, daughter of Reinier Hoogeveen (see III-k) and Alida Cornelisse van den Akker.", "\nShe was baptised on 02-07-1801 in Delft, ZH, NL. ", "Cornelia died on 26-04-1862 in Delft , ZH , NL, aged 60.", "\nAt the age of 21, Cornelia married Anthony van Vuurde, aged about 28, on 14-05-1823 in Delft , ZH , NL. ", "Anthony was born around 1795 in Delft , ZH , NL, son of Johannis van Vuurde and Maria Eliesabed van der Burgh.", "\nAnthony died on 18-12-1862 in Delft , ZH , NL, aged about 67.", "\n\nOccupation:\n\ntuinder\n\nIV-h Adrianus Hoogeveen was born on 25-10-1803 in Delft , ZH , NL, son of Reinier Hoogeveen (see III-k) and Alida Cornelisse van den Akker.", "\nHe was baptised on 27-10-1803 in Delft, ZH, NL. ", "Adrianus died on 24-02-1886 in Rotterdam , ZH , NL, aged 82.", "\nAt the age of 23, Adrianus married Bregje Noordam, aged about 22, on 23-05-1827 in Delft , ZH , NL. ", "Bregje was born around 1805 in Naaldwijk , ZH , NL, daughter of Cornelis Noordam and Dirkje de Jong.", "\nBregje died.", "\n\nAt the age of 24, Alida married Willem den Hengst, aged 23, on 06-05-1857 in Delft , ZH , NL. ", "Willem was born on 10-11-1833 in Delft , ZH , NL, son of Willem den Hengst and Alida Anna de Vos.", "\nWillem died on 12-09-1868 in Delft , ZH , NL, aged 34.", "\n\n(1) At the age of 19, Isaak married Jacoba Maria Erwich, aged 21, on 17-06-1896 in Rotterdam , ZH , NL. ", "Jacoba was born on 20-12-1874 in Rotterdam , ZH , NL.", "\nJacoba died on 08-05-1904 in Rotterdam , ZH , NL, aged 29.", "\n\n(2) At the age of 29, Isaak married Catharina Elisabeth Bosselaar, aged 25 or 26, on 01-11-1905 in Rotterdam , ZH , NL. ", "Catharina was born in 1879, daughter of Ary Bosselaar and Johanna Cornelia de Bruijn.", "\nCatharina died.", "\n\nIX-e Gusta Pauline Kok, daughter of Henri Kok and Juliana Francina Alida Barzilay (see VIII-m).", "\nGusta married William Mitchinson. ", "William was born on 05-03-1918 in West Hartepool , Durham , England, son of William Mitchinson and Florence Edith Shield.", "\nWilliam died on 05-05-1976 in Mold , Clwyd , Wales, aged 58.", "\n\nChildren of Gusta and William:\n\n1 Moira Enid Mitchinson.", "\n\n2 Clifford William Mitchinson.", "\n\nVII-n Francina Maria Alida Barzilay was born in 1897 in Rotterdam , ZH , NL, daughter of Leendert Barzilay and Francina Maria Albers (see VI-k).", "\nFrancina died.", "\nAt the age of 21 or 22, Francina married Gerrit van der Meide, aged 29, on 30-05-1919 in Rotterdam , ZH , NL. ", "The marriage was dissolved on 28-03-1929 in Rotterdam, ZH, NL. ", "Gerrit was born on 30-09-1889 in Rotterdam , ZH , NL, son of Gerrit van der Meide and Hendrika Rowel.", "\nGerrit died.", "\n\nV-o Johanna van Baalen was born on 16-04-1850 in Delft , ZH , NL, daughter of Pieter van Baalen and Johanna Alida Hoogeveen (see IV-i).", "\nJohanna died.", "\nAt the age of 46, Johanna married Willem Johannes Bosman, aged 32 or 33, on 03-03-1897 in Delft , ZH , NL. ", "Willem was born in 1864 in Delft , ZH , NL, son of Quirinus Bosman and Anna Catharina Bouwer.", "\nWillem died.", "\n\nIV-j Johannes Hoogeveen was born on 16-01-1806 in Delft , ZH , NL, son of Reinier Hoogeveen (see III-k) and Alida Cornelisse van den Akker.", "\nHe was baptised on 19-01-1806 in Delft, ZH, NL. ", "Johannes died on 07-10-1859 in Delft , ZH , NL, aged 53.", "\n\nOccupation:\n\nwarmoesier\n\nAt the age of 49, Johannes married Jacoba Geesdorp, aged 48, on 17-10-1855 in Delft , ZH , NL. ", "Jacoba was born on 27-04-1807 in Delft , ZH , NL, daughter of Jacobus Geesdorp and Johanna van den Akker.", "\nShe was baptised on 30-04-1807 in Delft, ZH, NL. ", "Jacoba died on 07-05-1896 in Delft , ZH , NL, aged 89.", "\n\nIV-k Cornelis Hoogeveen was born on 23-09-1809 in Delft , ZH , NL, son of Reinier Hoogeveen (see III-k) and Alida Cornelisse van den Akker.", "\nHe was baptised on 26-09-1809 in Delft, ZH, NL. ", "Cornelis died on 21-03-1876 in Delft , ZH , NL, aged 66.", "\n\nOccupation:\n\nTuinier\n\nAt the age of 31, Cornelis married Cornelia Neeleman, aged about 29, on 04-11-1840 in Vrijenban , ZH , NL. ", "Cornelia was born around 1811 in Delft , ZH , NL, daughter of Ary Neeleman and Afie van Schie.", "\nCornelia died on 26-07-1870 in Delft , ZH , NL, aged about 59.", "\n\nAt the age of 33, Reinier married Geertruida Metz, aged 27, on 12-05-1847 in Delft , ZH , NL. ", "Geertruida was born on 30-10-1819 in Delft , ZH , NL, daughter of Johan Philippus Metz and Anthonia Teunis.", "\nGeertruida died on 23-02-1879 in Rotterdam , ZH , NL, aged 59.", "\n\nAt the age of 28, Philippus married Margaretha van Essen, aged 23, on 04-09-1878 in Delft , ZH , NL. ", "Margaretha was born on 10-02-1855 in Delft , ZH , NL, daughter of Jacobus van Essen and Margaretha Hulster.", "\nMargaretha died on 03-05-1937 in Rotterdam , ZH , NL, aged 82.", "\nShe was buried on 05-05-1937 in Rotterdam , ZH , NL.", "\n\nAt the age of 35, Reinier married Louisa Elizabeth van der Graaf, aged 23, on 16-07-1914 in Rotterdam , ZH , NL, after their intention to marry had been registered on 02-07-1914 in Rotterdam , ZH , NL. ", "Louisa was born on 24-11-1890 in Rotterdam , ZH , NL, daughter of Ernst Frederik van der Graaf and Geertruida Susanna Robbers.", "\nLouisa died.", "\n\n(1) At the age of 26, Reinier married Maartje Spee, aged 24 or 25, on 09-04-1881 in Sommelsdijk , ZH , NL. ", "Maartje was born in 1856 in Sommelsdijk , ZH , NL, daughter of Cornelis Spee and Jannetje Ema.", "\nMaartje died on 19-03-1904 in Rotterdam , ZH , NL, aged 47 or 48.", "\n\n(2) At the age of 51, Reinier married Maria Louise Carolina Henriette Schermers, aged 25, on 08-06-1906. ", "Maria was born on 06-12-1880 in Arnhem , Gld , NL.", "\nMaria died.", "\n\nAt the age of 25, Anthony married Maria Elisabeth Wiks, aged 26, on 14-05-1851 in Delft , ZH , NL. ", "Maria was born on 30-10-1824 in Rotterdam , ZH , NL, daughter of Jonas Wiks and Margaretha Schilperoort.", "\nMaria died on 11-02-1901 in Delft , ZH , NL, aged 76.", "\n\nAt the age of 21, Johannes married Maria Elizabeth Boode, aged 25, on 23-06-1875 in Delft , ZH , NL. ", "Maria was born on 22-02-1850 in Delft , ZH , NL.", "\nMaria died on 09-02-1914 in Delft , ZH , NL, aged 63.", "\n\nAt the age of 26, Franciscus married Margaretha Johanna Maria Mussert, aged 21, on 08-05-1942 in Delft , ZH , NL. ", "Margaretha was born on 10-10-1920 in Delft , ZH , NL.", "\nMargaretha died on 07-10-1991 in Delft , ZH , NL, aged 70.", "\nShe was buried on 11-10-1991 in Delft , ZH , NL.", "\n\nAt the age of 26, Johan married Catharina Daamen, aged 22, on 16-10-1912 in Delft , ZH , NL. ", "Catharina was born on 16-02-1890 in Delft , ZH , NL, daughter of Jacob Daamen and Catharina Zijlberger.", "\nCatharina died on 02-03-1959 in Delft , ZH , NL, aged 69.", "\nShe was buried on 06-03-1959 in Delft , ZH , NL.", "\n\n(1) At the age of 22, Antoon married Catharina Maria van Adrichem, aged about 21, on 09-06-1911 in Delft , ZH , NL. ", "Catharina was born around 1890 in Delft , ZH , NL, daughter of Arend van Adrichem and Catharina Oosterman.", "\nCatharina died.", "\n\n(2) At the age of 37, Antoon married A. van Schagen on 29-09-1926.", "\n\nIII-l Margaretha Hoogeveen, daughter of Adrianus Hoogeveen (see II-d) and Jannetje Rensen.", "\nShe was baptised on 30-10-1781 in Delft, ZH, NL. ", "Margaretha died on 02-02-1841 in Delft , ZH , NL, aged 59.", "\nAt the age of 21, Margaretha married Gijsbertus van Zellum, aged 25 or 26, on 30-05-1803 in Delft , ZH , NL. ", "Gijsbertus was born in 1777 in Delft , ZH , NL.", "\nGijsbertus died after 1844, aged more than 67.", "\n\nIV-p Adrianus van Zellum was born on 28-09-1805 in Delft , ZH , NL, son of Gijsbertus van Zellum and Margaretha Hoogeveen (see III-l).", "\nHe was baptised on 29-09-1805 in Delft, ZH, NL. ", "Adrianus died.", "\nAt the age of 24, Adrianus married Marija Bruijnse, aged 32 or 33, on 03-02-1830 in Delft , ZH , NL. ", "Marija was born in 1797 in Delft , ZH , NL, daughter of Cornelis Bruynse and Cornelia van der Steen.", "\nMarija died.", "\n\nIII-n Johannes Hoogeveen was born on 24-12-1785 in Delft , ZH , NL, son of Adrianus Hoogeveen (see II-d) and Jannetje Rensen.", "\nHe was baptised on 29-12-1785 in Delft, ZH, NL. ", "Johannes died on 19-07-1849 in Delft , ZH , NL, aged 63.", "\n\nOccupation:\n\nwarmoezier\n\nAt the age of 26, Johannes married Ardriana Avezaat, aged 21 or 22, on 13-05-1812 in Delft , ZH , NL. ", "Ardriana was born in 1790 in Delft , ZH , NL, daughter of Gerrit van Avezaat and Francina van den Berg.", "\nArdriana died on 08-09-1849 in Delft , ZH , NL, aged 58 or 59.", "\n\nGenerated with Aldfaer version 4.2 on 19-09-2014 at 12:30 by Jan Arie van Hengel" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009909685468301177, 0.0012075348058715463, 0.0008226963109336793, 0.002036061603575945, 0.0007141358801163733, 0.0011713213752955198, 0.0007089953869581223, 0.0007594787748530507, 0.0011581216240301728, 0.001430403208360076, 0.0007467182003892958, 0.0010728943161666393, 0.0012107192305848002, 0.0009396662353537977, 0.0007597078802064061, 0.0006669034482911229, 0.0011162731098011136, 0.05215781554579735, 0.0007231622585095465, 0.004027840215712786, 0.0008095857920125127, 0.001488475943915546, 0.0014927975134924054, 0.0007732876692898571, 0.0007063032244332135, 0.0012907400960102677, 0.0007053880835883319, 0.0010088691487908363, 0.0009982507908716798, 0.0007372640538960695, 0.0010094926692545414, 0.0007574362098239362, 0.0010156966745853424, 0.0015855688834562898, 0.000749301805626601, 0.0007212719647213817, 0.0012624021619558334, 0.0008613191312178969, 0.0009841180872172117, 0.034404922276735306, 0.0007039016927592456, 0.0009564397041685879, 0.0018693507881835103, 0.0007595341303385794, 0.002408122643828392, 0.0007003963110037148, 0.0015915017575025558, 0.0007556936470791698, 0.0007582064135931432, 0.0014394664904102683, 0.001314434688538313, 0.001019923947751522, 0.0009392155916430056, 0.0006404576706700027, 0.0008182368474081159, 0.0017190432408824563, 0.0006728829466737807, 0.0015756171196699142, 0.000991864944808185, 0.0006472946261055768, 0.0008905486902222037, 0.0007648366154171526, 0.001272786408662796, 0.0009080544114112854, 0.0009540492319501936, 0.03949800133705139, 0.0010929284617304802, 0.001838185009546578, 0.04623442888259888, 0.000839024898596108, 0.0010677969548851252, 0.001000899588689208, 0.0007794949342496693, 0.0011620960431173444, 0.0007989868172444403, 0.032680291682481766, 0.0007293194648809731, 0.0009163782233372331, 0.0008901457767933607, 0.0009195422753691673, 0.0010809972882270813, 0.0008900431566871703, 0.0006647469126619399, 0.0009130486287176609, 0.0008739525219425559, 0.001195454620756209, 0.001319183618761599, 0.0009484487236477435, 0.000786804361268878, 0.001198814483359456, 0.054552193731069565, 0.0012558629969134927, 0.001054332940839231, 0.0008897006046026945, 0.0014129705959931016, 0.0016057678731158376, 0.0010580351809039712, 0.0006639020284637809, 0.0009440688882023096, 0.0008393655298277736, 0.001209961250424385, 0.0009171075653284788, 0.0010234948713332415, 0.0006473535322584212, 0.0008311040000990033, 0.0008915874641388655, 0.0011843409156426787, 0.050194401293992996, 0.0008492763736285269, 0.0010263684671372175, 0.0011622061720117927, 0.0006446543848142028, 0.0007501920918002725, 0.0010106166591867805, 0.0006594395963475108, 0.0011487039737403393, 0.028834987431764603, 0.0006291544414125383, 0.0013682767748832703, 0.0009069735533557832, 0.0013126656413078308, 0.0008896874496713281, 0.000847094226628542, 0.0007095520850270987, 0.01975192315876484, 0.0007733690435998142, 0.0006077499710954726, 0.0012904769973829389, 0.0449238196015358, 0.0009610270499251783, 0.04994180426001549, 0.0007307484629563987, 0.001010501990094781, 0.05560120567679405, 0.0009782237466424704, 0.0006517985020764172, 0.0009876290569081903, 0.0007506271940656006, 0.0012434261152520776, 0.0006506338831968606, 0.0009426421020179987, 0.0010773579124361277, 0.0006480292067863047, 0.0009110807441174984, 0.0008376449695788324, 0.001249510096386075, 0.0008888299344107509, 0.0008342101937159896, 0.0012329110177233815, 0.0010962667874991894, 0.0008639637962915003, 0.0010473487200215459, 0.0008910948527045548, 0.00070855428930372, 0.0007802425534464419, 0.0010810868116095662, 0.05485561117529869, 0.0008608473581261933, 0.0015015489188954234, 0.0014232526300475001, 0.0007286581094376743, 0.0008607336785644293, 0.11867763102054596, 0.0007499225903302431, 0.0012285314733162522, 0.001255384529940784, 0.0007505120593123138, 0.0009807480964809656, 0.0013691670028492808, 0.0008189213112927973, 0.0009579047909937799, 0.001174864242784679, 0.0007909630076028407, 0.0007001557387411594, 0.0010652808705344796, 0.0011307961540296674, 0.0007645400473847985, 0.0008105681044980884, 0.00125059112906456, 0.028834987431764603, 0.000757866189815104, 0.000875961733981967, 0.0006530324462801218, 0.001140106818638742, 0.000957899319473654, 0.001124540576711297, 0.0021322453394532204, 0.0010403814958408475, 0.0006568124517798424, 0.05705321952700615, 0.0008406582055613399, 0.0011760975467041135, 0.08877535909414291, 0.0009371886844746768, 0.0006479318835772574, 0.0010566541459411383, 0.0007217621896415949, 0.0010655822698026896, 0.0010832991683855653, 0.0007792468531988561 ]

[ "Song X, Zhang X, Wang X, et al. ", "LncRNA SPRY4‐IT1 regulates breast cancer cell stemness through competitively binding miR‐6882‐3p with TCF7L2. ", "J Cell Mol Med. ", "2020;24:772--784. ", "10.1111/jcmm.14785\n\nXinyue Song and Xiaoxue Zhang are contributed this work equally.", "\n\n1. ", "INTRODUCTION {#jcmm14786-sec-0001}\n===============\n\nBreast cancer was the most common cancer in females in 2018 with an incidence of 24.2% of all cancers in females. ", "In addition, breast cancer caused 15% all cancer deaths of females in 2018.[1](#jcmm14786-bib-0001){ref-type=\"ref\"} Increasing evidence has shown that heterogeneous tumour cell clusters make up the bulk of cancer tumours and that the tumour cell clusters originate from cells that have stem cell characteristics, namely cancer stem cells (CSCs).[2](#jcmm14786-bib-0002){ref-type=\"ref\"} Cancer stem cells have abilities of multilineage differentiation, self‐renewal, high carcinogenic effect and chemoradiotherapy. ", "In addition, CSCs mainly cause metastatic lesions and growth of tumours.[3](#jcmm14786-bib-0003){ref-type=\"ref\"}\n\nBreast cancer stem cells (BCSCs) have the characteristics mentioned above. ", "In 2003, Al‐Hajj and colleagues first found that breast cancer can be derived from BCSCs, and they also identified the surface markers of BCSCs to be CD44+/CD24−.[4](#jcmm14786-bib-0004){ref-type=\"ref\"} Accumulating evidence has indicated that BCSCs are the major cause for metastasis, drug resistance and tumour recurrence. ", "Thus, it is important to explore new treatments targeting BCSCs.", "\n\nLong noncoding RNAs (lncRNAs) are transcript RNAs longer than 200 nucleotides without protein‐coding potential.[5](#jcmm14786-bib-0005){ref-type=\"ref\"} LncRNAs are involved in physiological and pathological progresses, including embryonic development, organ formation, X chromatin inactivation and tumourigenesis.[6](#jcmm14786-bib-0006){ref-type=\"ref\"}, [7](#jcmm14786-bib-0007){ref-type=\"ref\"} LncRNAs play a key role in many diseases, especially in tumours,[8](#jcmm14786-bib-0008){ref-type=\"ref\"} and they recruit transcription factors and regulate gene expression. ", "LncRNAs also interact with messenger RNAs and influence the stability of mRNAs.[9](#jcmm14786-bib-0009){ref-type=\"ref\"} SPRY4‐intronic transcript 1 (SPRY4‐IT1) is a type of lncRNA derived from an intron region within the SPRY4‐IT1 gene located at 5q31.3.[10](#jcmm14786-bib-0010){ref-type=\"ref\"} Khaitan et al first found that SPRY4‐IT1 plays a key role in apoptosis and invasion in melanoma.[11](#jcmm14786-bib-0011){ref-type=\"ref\"} SPRY4‐IT1 promotes cell growth, tumour proliferation and inhibits cell apoptosis in pancreatic ductal adenocarcinoma,[10](#jcmm14786-bib-0010){ref-type=\"ref\"} cholangiocarcinoma,[12](#jcmm14786-bib-0012){ref-type=\"ref\"} ovarian cancer,[13](#jcmm14786-bib-0013){ref-type=\"ref\"} bladder cancer,[14](#jcmm14786-bib-0014){ref-type=\"ref\"} hepatocellular carcinoma,[15](#jcmm14786-bib-0015){ref-type=\"ref\"} oesophageal squamous cell carcinoma[16](#jcmm14786-bib-0016){ref-type=\"ref\"} and breast cancer.[17](#jcmm14786-bib-0017){ref-type=\"ref\"} However, Sun et al reported that overexpression of SPRY4‐IT1 inhibits non--small‐cell lung cancer cell proliferation and metastasis.[18](#jcmm14786-bib-0018){ref-type=\"ref\"} Although SPRY4‐IT1 promotes the development of breast cancer,[12](#jcmm14786-bib-0012){ref-type=\"ref\"} it is unclear if SPRY4‐IT1 influences the stemness of breast cancer cells.", "\n\nIn this study, we focused on identifying the effect of SPRY4‐IT1 and the underlying cellular and molecular mechanisms of SPRY4‐IT1 in BCSCs. ", "We found that SPRY4‐IT1 was up‐regulated in CD44+/CD24− MCF‐7 cells compared to MCF‐7 parental cells and that SPRY4‐IT1 promoted self‐renewal and proliferation of MCF‐7 cells. ", "Dual‐luciferase reporter analysis revealed that miR‐6882 was directly bound to SPRY4‐IT1 and TCF7L2, thereby down‐regulating their expression. ", "These results indicated that SPRY4‐IT1 promotes the stemness of breast cancer cells by targeting miR‐6882 to regulate the activity of the Wnt/β‐catenin signalling pathway.", "\n\n2. ", "MATERIALS AND METHODS {#jcmm14786-sec-0002}\n========================\n\n2.1. ", "Cell culture {#jcmm14786-sec-0003}\n-----------------\n\nThe MCF‐7 and T47D breast cancer cell lines were obtained from ATCC (VA, USA) in 2017. ", "All human cell lines have been authenticated using STR profiling. ", "There were no mycoplasma contaminations in the cell lines. ", "All human cell lines have been authenticated using STR profiling. ", "There were no mycoplasma contaminations in the cell lines. ", "MCF‐7 and T47D cell lines were cultured in high‐glucose (4.5 mg/mL) DMEM (HyClone) supplemented with 10% foetal bovine serum (FBS, HyClone), 100 mg/mL penicillin (Invitrogen) and 100 U/mL streptomycin (Invitrogen). ", "MCF‐7 and T47D cell lines were maintained at 37°C in a 5% CO~2~ and 95% air incubator.", "\n\nAccording to the induction technique of breast cancer MCF‐7 CSCs and T47D CSCs in our research group,[19](#jcmm14786-bib-0019){ref-type=\"ref\"} MCF‐7 CSCs and T47D CSCs were incubated in DMEM‐F12 (HyClone) containing 2% B27 (Invitrogen), 20 μg/L EGF (Peprotech), 10 μg/L bFGF (Peprotech) at 37°C in a 5% CO~2~ and 95% air incubator.", "\n\n2.2. ", "In situ hybridization {#jcmm14786-sec-0004}\n--------------------------\n\nRNA enzymes in sections were removed by 1 mL/L DEPC‐treated water and APES glue. ", "Xylene was used to dewax the sections, and the sections were then rehydrated in a graded alcohol series. ", "Endogenous peroxidase activity was blocked by 3% hydrogen peroxide, and mRNA was exposed by 3% fresh citric acid diluted pepsin. ", "Sections were then incubated with 20 μL of digoxin‐labelled oligonucleotide probe and hybrid liquid at 37°C overnight. ", "Blocking solution, biotinylated rat anti digoxin and SABC were then sequentially added according to the manufacturer\\'s protocol of the lncRNA ISH Kit (Boster). ", "DAB reagent was used to visualize the sections.", "\n\n2.3. ", "Tumour sphere formation assay {#jcmm14786-sec-0005}\n----------------------------------\n\nMCF‐7 and T47D CSCs (2 × 10^3^/well) were grown in serum‐free DMEM‐F12 supplemented with 10 μg/L bFGF, 20 μg/L EGF and 2% B27 in ultra‐low adhesion plates (Corning). ", "Two weeks later, spheres larger than 100 μm were counted by an inverted microscope (Nikon TE2000‐U), and images were acquired.", "\n\n2.4. ", "Colony formation assay {#jcmm14786-sec-0006}\n---------------------------\n\nMCF‐7 and T47D cells (2 × 10^3^) were seeded into 6‐cm Petri dishes. ", "After 14 days of culture at 37 ℃ in 5% CO~2~, cells were washed with PBS, fixed in paraformaldehyde for 15 minutes and stained with 0.5% crystal violet for 15 minutes. ", "Images were acquired, and the colonies were counted.", "\n\n2.5. ", "Cell transfection and virus infection {#jcmm14786-sec-0007}\n------------------------------------------\n\nFor transient transfection, miR‐6882 mimic and miR‐6882 inhibitor (RIOBOBIO) were transfected into MCF‐7 and T47D cells using Lipofectamine 3000 (Invitrogen) according to the manufacturer\\'s protocol. ", "For lentiviral transfection of shRNA knockdown analysis, lentiviral vectors (GV248) were purchased from Genechem Co., Ltd. SPRY4‐IT1‐RNAi (sequences shown in Table [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}) was cloned into the hU6‐MCS‐Ubiquitin‐EGFP‐IRES‐puromycin vector (Genechem). ", "MCF‐7 CSCs and T47D CSCs were transduced with shRNAs using SPRY4‐IT1 (sh‐SPRY4‐IT1) lentiviral transduction particles (MOI = 20) in the presence of 5 µg/mL polybrene (Genechem). ", "For cDNA knock‐in analysis, lentiviral vectors (GV502) were purchased from Genechem. ", "SPRY4‐IT1 cDNA was cloned into the (polyA‐MCS‐UBI) RV‐SV40‐EGFP‐IRES‐puromycin vector (Genechem). ", "MCF7 CSCs and T47D CSCs were transduced with SPRY4‐IT1 (SPRY4‐IT1‐cDNA) lentiviral transduction particles (MOI = 20) (Genechem). ", "Twenty hours after transfection, the medium containing virus was replaced with fresh culture medium. ", "Stably transfected cells were selected by adding puromycin (1 μg/mL) into the medium. ", "This selection was repeated 2 to 3 times until green fluorescent protein (GFP) was observed in all cells under a fluorescence microscope (Nikon TE2000‐U).", "\n\n2.6. ", "Flow cytometry assay {#jcmm14786-sec-0008}\n-------------------------\n\nMCF‐7 cells, T47D cells, MCF‐7 CSCs and T47D CSCs were digested with 0.25% trypsin, and they were then stained with anti‐CD44‐APC (Biolegend) (1.25 μL/test) and anti‐CD24‐PE (Biolegend) (5 μL/test) or negative controls at 4°C for 30 minutes. ", "After staining, cells were washed three times with PBS and suspended in 300 μL of PBS. ", "Flow cytometry analysis was performed on a MACSQuant^TM^ Flow Cytometer (Miltenyi Biotec).", "\n\n2.7. ", "Dual‐luciferase reporter assay {#jcmm14786-sec-0009}\n-----------------------------------\n\nThe full‐length SPRY4‐IT1 sequences of the wild‐type (WT) and mutant (MUT) miRNA‐binding sites were purchased from Genechem. ", "SPRY4‐IT1 WT and SPRY4‐IT1 MUT were transfected into MCF‐7 cells along with miR‐6882 mimic or NC mimic. ", "Similarly, the binding sites for miR‐6882‐3p in the 3'‐untranslated region (3'‐UTR) sequence of TCF7L2 were purchased from Genechem. ", "TCF7L2 3'‐UTR WT and TCF7L2 3'‐UTR MUT were transfected into MCF‐7 cells along with miR‐6882 mimic or NC mimic. ", "Luciferase activity was measured by the dual‐luciferase reporter assay system (Promega) according to the manufacturer\\'s instructions. ", "Assays were performed in triplicates.", "\n\n2.8. ", "Data extraction and analysis from TCGA {#jcmm14786-sec-0010}\n-------------------------------------------\n\nMiRNAs with complementary sequences to SPRY4‐IT1 were searched for using online miRDB (<http://www.mirdb.org/>) and SEGAL (<https://genie.weizmann.ac.il/index.html>) datasets. ", "The RNAhybrid website (<https://bibiserv.cebitec.uni-bielefeld.de/rnahy>‐ brid/) was used to predict the binding energy of SPRY4‐IT1 and miR‐6882. ", "DIANA Tools (<http://www.microrna.gr>) and miRDB (<http://mirdb.org/miRDB/index.html>) were used to predict the target gene of miR‐6882‐3p. ", "RNA‐Seq data were downloaded from TCGA‐breast cancer (TCGA‐BRCA) (<https://cancergenome.nih.gov/>). ", "The different expression levels of SPRY4‐IT1 in the two groups were divided according to the expression of CD24 and CD44, and the differences in HIF‐1α, HIF‐2α and OCT4 expression levels between SPRY4‐IT1 low and high expression were analysed. ", "Kaplan‐Meier survival analysis for the correlation between SPRY4‐IT1 expression and survival time of breast cancer patients was performed using Kaplan‐Meier Plotter (<http://kmplot.com/analysis>).", "\n\n2.9. ", "RNA extraction and qRT‐PCR analysis {#jcmm14786-sec-0011}\n----------------------------------------\n\nTrizol reagent (CWBIO) was used to extract total RNA according to the manufacturer\\'s instructions, and RNA was converted to complementary DNA (cDNA) using the qPCR RT kit (TOYOBO) and oligo (dT) primers. ", "The method of miRNA extraction was similar to total RNA extraction. ", "MiRNA was reversely transcribed into cDNA using the miRNA qRT‐PCR Starter kit (Riobobio). ", "PCR primers for U6 and miR‐6882 were purchased from Riobobio. ", "Quantitative real‐time PCR was performed using the SYBR Green PCR Mix kit (Takara). ", "The detailed primer sequences are shown in Table [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}. ", "Results were normalized according to β‐actin mRNA or U6 miRNA expression levels. ", "The results were expressed using the ∆∆CT (cycle threshold) method for quantification.", "\n\n2.10. ", "Western Blotting and Immunohistochemistry (IHC) {#jcmm14786-sec-0012}\n-----------------------------------------------------\n\nThe NE‐PERTM Nuclear and Cytoplasmic Extraction Reagents kit (Thermo Scientific) was used to isolate and collect cytosolic and nuclear fractions following the manufacturer\\'s protocol. ", "Cells were lysed in radioimmunoprecipitation assay (RIPA) lysate buffer, and cell lysates were incubated on ice for 30 minutes. ", "Cell supernatants were collected, and protein concentrations were determined using bicinchoninic acid (BCA) protein quantitation (Beyotime). ", "SDS‐PAGE electrophoresis was performed on proteins from cell lysate proteins and transferred to PVDF membranes. ", "Membranes were incubated with primary antibody overnight at 4℃. ", "The primary antibodies and secondary antibodies are shown in Table [S2](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}. ", "Proteins in membranes were visualized using an enhanced chemiluminescence kit (BOSTER).", "\n\nFor IHC, mouse tumour sections were dewaxed and rehydrated. ", "The antigen was retrieved under high pressure using citrate buffer (pH = 6.0). ", "The Ultra‐sensitive S‐P kit (Maixin‐Bio) was used to block endogenous peroxidase activity and reduce non‐specific reactivity. ", "Sections were then incubated with primary antibodies (shown in Table [S2](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}) at 4°C overnight. ", "Mouse tumour sections were then incubated with secondary antibody and streptomycin avidin‐peroxidase using the Ultra‐sensitive S‐P kit, and the sections were visualized with DAB reagent (Maixin‐Bio).", "\n\n2.11. ", "Xenograft model {#jcmm14786-sec-0013}\n---------------------\n\nTo study the SPRY4‐IT1 stemness ability of MCF‐7 and MCF‐7 CSCs, cells (1 × 10^6^) were suspended in 100 μL of PBS and injected into mammary fat pads of 3‐ to 4‐week‐old female BALB/c(nu/nu) mice (Hua Fukang Biological Technologies Inc, Beijing). ", "Mice were randomized into the following four groups (n = 6 per group): NC‐cDNA with MCF‐7; SPRY4‐IT1‐cDNA with MCF‐7; sh‐NC with MCF‐7 CSCs; and sh‐SPRY4‐IT1 with MCF‐7 CSCs. ", "The tumour diameter and weights of mice were measured every other day. ", "Tumours were removed from xenograft models and weighed until tumours appeared to collapse. ", "Tumour volume (mm^3^) was measured using a digital calliper and calculated according to the following equation: (width)^2^ × (length/2). ", "All mice were bred at pathogen‐free conditions in the Animal Centre of China Medical University. ", "All animal studies were performed according to the National Institute of Health Guide for the Care and Use of Laboratory Animals.", "\n\n2.12. ", "Statistical analysis {#jcmm14786-sec-0014}\n--------------------------\n\nQuantitative data were expressed as the means ± SD of at least three independent experiments. ", "Graphpad Prism 7.0 (GraphPad Software) was used to evaluate all experimental values. ", "Student\\'s independent *t* test was used to perform statistical analysis between two experimental groups, while analysis of variance (ANOVA) was used to perform analyses among three experimental groups. *", "P* value \\< .05 was considered statistically significant in all cases.", "\n\n3. ", "RESULTS {#jcmm14786-sec-0015}\n==========\n\n3.1. ", "BCSCs express high SPRY4‐IT1 level compared to non‐CSC cells {#jcmm14786-sec-0016}\n-----------------------------------------------------------------\n\nBecause the induction technique of breast cancer MCF‐7 CSCs has matured in our research group and has been published in related articles,[19](#jcmm14786-bib-0019){ref-type=\"ref\"}, [20](#jcmm14786-bib-0020){ref-type=\"ref\"} this paper briefly verified the induction of breast cancer MCF‐7 CSCs.", "\n\nIn situ hybridization revealed that SRY4‐IT1 was expressed in the cytoplasm (Figure [1](#jcmm14786-fig-0001){ref-type=\"fig\"}A). ", "According to the expression of SPRY4‐IT1 in 101 samples from breast cancer patients from the First Affiliated Hospital of China Medical University (Figure [1](#jcmm14786-fig-0001){ref-type=\"fig\"}A), we divided the breast cancer patients into two groups. ", "The log‐rank test of the overall survival curves of these breast cancer patients showed that the high SPRY4‐IT1 expression group was significantly associated with worse OS and DFS compared to the low SPRY4‐IT1 expression group (Figure [1](#jcmm14786-fig-0001){ref-type=\"fig\"}B). ", "Moreover, the log‐rank test of the OS curves of breast cancer patients in Kaplan‐Meier plotter also identified that high SPRY4‐IT1 expression was significantly associated with worse OS compared to low SPRY4‐IT1 expression (Figure [1](#jcmm14786-fig-0001){ref-type=\"fig\"}C). ", "The expression of SPRY4‐IT1 in MCF‐7 cells and MCF‐7 CSC cells was detected by qRT‐PCR. ", "The expression of SPRY4‐IT1 was significantly increased in MCF‐7 CSCs compared to MCF‐7 cells (Figure [1](#jcmm14786-fig-0001){ref-type=\"fig\"}D). ", "These results suggested that SPRY4‐IT1 is associated with MCF‐7 CSC characteristics.", "\n\n{#jcmm14786-fig-0001}\n\nFurther, we downloaded RNA‐Seq data from breast cancer patients from TCGA‐breast cancer database and found that the expression level of SPRY4‐IT1 was significantly higher in patients with CD44+/CD24‐ breast cancer (n = 237) than those without CD44+/CD24− (n = 872) (Figure [1](#jcmm14786-fig-0001){ref-type=\"fig\"}E). ", "The OCT4 stemness marker was expressed at higher levels in breast cancer tissues with SPRY4‐IT1 high expression compared to tissues with low SPRY4‐IT1 expression (Figure [1](#jcmm14786-fig-0001){ref-type=\"fig\"}F). ", "In addition, drug resistance‐related genes, such as ATP‐binding cassette sub‐family C member 1 (ABCC1) and ATP‐binding cassette sub‐family B member 1 (ABCB1), were up‐regulated in the low SPRY4‐IT1 expression group compared to the high SPRY4‐IT1 expression group in TCGA‐BRCA database (Figure [1](#jcmm14786-fig-0001){ref-type=\"fig\"}G,H). ", "These results suggested that the expression of SPRY4‐IT1 may be associated with the stemness phenotype of BCSCs.", "\n\n3.2. ", "SPRY4‐IT1 influences cell stemness characteristics of MCF‐7 and T47D cells {#jcmm14786-sec-0017}\n-------------------------------------------------------------------------------\n\nWe established MCF‐7 and T47D with SPRY4‐IT1 overexpression (oe‐SPRY4‐IT1) (Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}A). ", "qRT‐PCR showed that the expression levels of cell stemness markers, including OCT4, C‐MYC, Nanog and SOX2, were increased in SPRY4‐IT1‐overexpressing MCF‐7 and T47D cells (Figure [2](#jcmm14786-fig-0002){ref-type=\"fig\"}A). ", "Western blot assay showed that Nanog, SOX2, OCT4 and C‐MYC expression levels were increased in SPRY4‐IT1‐overexpressing MCF‐7 and T47D cells (Figure [2](#jcmm14786-fig-0002){ref-type=\"fig\"}B). ", "Plate colony formation assay revealed that the number of colonies of oe‐SPRY4‐IT1 MCF‐7 and T47D cells was increased compared to negative controls (Figure [2](#jcmm14786-fig-0002){ref-type=\"fig\"}C). ", "Sphere formation assay indicated that MCF‐7 and T47D cells transfected with SPRY4‐IT1 had more spheres compared to negative controls (Figure [2](#jcmm14786-fig-0002){ref-type=\"fig\"}D). ", "Flow cytometry analysis revealed that the percentages of CD44+/CD24− cells were increased in SPRY4‐IT1‐overexpressing MCF‐7 and T47D cells (Figure [2](#jcmm14786-fig-0002){ref-type=\"fig\"}E).", "\n\n{#jcmm14786-fig-0002}\n\n3.3. ", "SPRY4‐IT1 influences cell stemness maintenance of MCF‐7 CSCs and T47D CSCs {#jcmm14786-sec-0018}\n-------------------------------------------------------------------------------\n\nWe established MCF‐7 and T47D CSCs in which SPRY4‐IT1 was stably knocked down (sh‐SPRY4‐IT1) (Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}B). ", "SOX2, Nanog, and OCT4 mRNA expression levels were down‐regulated in SPRY4‐IT1‐deficient MCF‐7 and T47D CSCs (Figure [3](#jcmm14786-fig-0003){ref-type=\"fig\"}A). ", "Western blot assay showed that the protein expression levels of cell stemness markers, including Nanog, SOX2, and OCT4, were reduced in sh‐SPRY4‐IT1 MCF‐7 CSCs and T47D CSCs (Figure [3](#jcmm14786-fig-0003){ref-type=\"fig\"}B). ", "Next, a mammosphere formation assay was performed, and the sphere‐like structures with diameters greater than 100 μm were counted. ", "The percentage of sphere‐forming cells was reduced after inhibiting the expression of SPRY4‐IT1 in MCF‐7 and T47D CSCs (Figure [3](#jcmm14786-fig-0003){ref-type=\"fig\"}C). ", "Flow cytometry analysis showed that percentages of CD44+/CD24− cells were down‐regulated in SPRY4‐IT1‐deficient MCF‐7 CSCs and T47D CSCs (Figure [3](#jcmm14786-fig-0003){ref-type=\"fig\"}D). ", "These results indicated that SPRY4‐IT1 influences breast cancer cell stemness maintenance.", "\n\n{#jcmm14786-fig-0003}\n\n3.4. ", "SPRY4‐IT1 regulates the expression of TCF7L2 by miR‐6882‐3p {#jcmm14786-sec-0019}\n----------------------------------------------------------------\n\nLncRNA can be the molecular sponge of miRNA as a ceRNA.[21](#jcmm14786-bib-0021){ref-type=\"ref\"} Using both datasets, we found that miR‐6882‐3p, miR‐616‐5p, miR‐373‐5p and miR‐371B‐5p interacted with SPRY4‐IT1. ", "As shown in Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}A, miR‐6882‐3p expression was remarkably reduced in MCF‐7 CSCs compared to MCF‐7 cells. ", "RNAhybrid showed that the predicted binding energy of miR‐6882‐3p and SPRY4‐IT1 is −31.5 kcal/mol, which suggested that they interacted (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}B). ", "The binding sites of miR‐6882‐3p in SPRY4‐IT1 are shown in Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}B. To identify if miR‐6882‐3p binds to the predicted target site of SPRY4‐IT1, we constructed SPRY4‐IT1 wild‐type and mutant luciferase reporter vectors according to the indicated binding site for miR‐6882‐3p (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}C). ", "Co‐transfection of SPRY4‐IT1 wild‐type vector (SPRY4‐IT1‐WT) with miR‐6882‐3p mimics rather than the mutant SPRY4‐IT1 vector (SPRY4‐IT1‐MUT) remarkably decreased luciferase activities in MCF‐7 cells (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}C). ", "qRT‐PCR demonstrated that SPRY4‐IT1 overexpression reduced miR‐6882‐3p expression in MCF‐7 cells (Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}C) and that knockdown of SPRY4‐IT1 remarkably increased miR‐6882 expression (Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}D). ", "In addition, the expression of SPRY4‐IT1 also influenced stemness characteristics, including Nanog, CD44 and OCT4. ", "SPRY4‐IT1 overexpression promoted MCF‐7 and T47D cell stemness characteristics (Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}E). ", "SPRY4‐IT1 knockdown inhibited MCF‐7 and T47D CSC stemness maintenance (Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}F). ", "Thus, these results indicated that SPRY4‐IT1 plays a role as a molecular sponge for miR‐6882‐3p and that the stemness promotion effect of SPRY4‐IT1 partially relies on sponging miR‐6882‐3p.", "\n\n{#jcmm14786-fig-0004}\n\nWe then studied the targets of SPRY4‐IT1 ceRNA. ", "To identify the target gene of miR‐6882‐3p, we used the mirDB database and DIANA database, and the results of these databases were combined. ", "According to a previous study,[22](#jcmm14786-bib-0022){ref-type=\"ref\"} the Wnt signalling pathway increases the number of BCSCs and is vital to the maintenance of BCSCs. ", "In the present study, we found that miR‐6882‐3p binds to TCF7L2. ", "Transcription factor 7‐like 2 (TCF7L2), also called TCF4, is an effector of the Wnt/β‐catenin signalling pathway[23](#jcmm14786-bib-0023){ref-type=\"ref\"} and a key transcription regulator that forms a TCF7L2/β‐catenin complex with β‐catenin, which transcriptionally activates downstream factors in the Wnt pathway. ", "The binding energy was predicted to be −26.5 kcal/mol by RNAhybrid, suggesting that they interact (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}D). ", "We subcloned the TCF7L2 mRNA 3'‐UTR region, including the predicted miR‐6882 recognition site, for wild‐type (TCF7L2 WT）and mutant (TCF7L2 MUT) luciferase reporter plasmids. ", "MiR‐6882 decreased luciferase activity in the wild‐type vector compared to the mutant vector (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}E). ", "Moreover, TCF7L2 and Wnt1 mRNA expression was increased by inhibiting miR‐6882‐3p expression in MCF‐7 cells but was decreased in miR‐6882‐3p‐overexpressing MCF‐7 CSCs (Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}G‐H). ", "These results suggested that TCF7L2 is a target gene of miR‐6882. ", "Furthermore, we investigated if SPRY4‐IT1 affects the miR‐6882/TCF7L2 axis. ", "Overexpression of SPRY4‐IT1 in MCF‐7 cells remarkably increased mRNA and protein expression of TCF7L2 and the Wnt1/β‐catenin pathway components (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}F and Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}I). ", "Translocation of β‐catenin from the cytoplasm to the nucleus is crucial for activation of the Wnt1/β‐catenin pathway. ", "The protein expression of β‐catenin was increased in the nuclear fraction (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}F), and the protein expression levels of TCF7L2 and Wnt1/β‐catenin (Wnt1 \\[Total\\] and β‐catenin \\[Nuclear\\]) pathway components were decreased by overexpressing miR‐6882 in MCF‐7 cells (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}F). ", "In contrast, knockdown of SPPRY4‐IT in MCF‐7 CSCs decreased the mRNA and protein expression levels of TCF7L2 and Wnt1/β‐catenin pathway (Wnt1 \\[Total\\] and β‐catenin \\[Nuclear\\]) components (Figure [S1](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}J and Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}G). ", "In addition, inhibition of miR‐6882 in MCF‐7 CSCs increased the protein expression levels of TCF7L2 and Wnt1/β‐catenin pathway (Wnt1 \\[Total\\] and β‐catenin \\[Nuclear\\]) components (Figure [4](#jcmm14786-fig-0004){ref-type=\"fig\"}G). ", "These results revealed that SPRY4‐IT1 influences TCF7L2 expression by targeting miR‐6882, which promotes β‐catenin accumulation in the nucleus, thereby activating the Wnt1/β‐catenin pathway.", "\n\n3.5. ", "SPRY4‐IT1 enhances the stemness and self‐renewal capacity of BCSCs in vivo {#jcmm14786-sec-0020}\n-------------------------------------------------------------------------------\n\nTo identify the effect of SPRY4‐IT1 on stemness promotion of MCF‐7 cells, MCF‐7 cells transfected with SPRY4‐IT1‐cDNA or NC‐cDNA were subcutaneously injected into nude mice (Figure [5](#jcmm14786-fig-0005){ref-type=\"fig\"}A). ", "Overexpression of SPRY4‐IT1 significantly increased the tumour size and weight (Figure [5](#jcmm14786-fig-0005){ref-type=\"fig\"}B‐D). ", "Western blot and IHC analyses demonstrated that the expression of the Nanog stemness marker was up‐regulated by SPRY4‐IT1 overexpression (Figure [5](#jcmm14786-fig-0005){ref-type=\"fig\"}E,F), indicating promotion of stemness. ", "The IHC staining results revealed that the expression of TCF7L2 was higher in the SPRY4‐IT1‐cDNA group compared to the NC‐cDNA group (Figure [5](#jcmm14786-fig-0005){ref-type=\"fig\"}E). ", "Furthermore, tumour sections were stained for Ki‐67 expression to assess the proliferation ability of xenograft tumours. ", "The ability of proliferation was higher in the SPRY4‐IT1 overexpression group (Figure [5](#jcmm14786-fig-0005){ref-type=\"fig\"}E). ", "TCF7L2, Wnt1 and β‐catenin (nuclear) protein expression increased in tumours overexpressing SPRY4‐IT1 (Figure [5](#jcmm14786-fig-0005){ref-type=\"fig\"}F). ", "According to these results, we concluded that SPRY4‐IT1 promotes stemness of breast cancer cells and exerts its function through TCF7L2 in vivo.", "\n\n{#jcmm14786-fig-0005}\n\nFurthermore, the results of mice infected with sh‐SPRY4‐IT1 MCF‐7 CSCs and their negative controls were consistent with the above results (Figure [S2](#jcmm14786-sup-0001){ref-type=\"supplementary-material\"}).", "\n\n4. ", "DISCUSSION {#jcmm14786-sec-0021}\n=============\n\nBreast cancer is one of the most common malignant cancers worldwide and is the leading cause of cancer‐related death in women.[24](#jcmm14786-bib-0024){ref-type=\"ref\"} Cancer stem cells are defined similarly to normal stem cells as cells that are capable self‐renewal, leading to multi‐linage differentiation of malignant tumour cells.[25](#jcmm14786-bib-0025){ref-type=\"ref\"} Moreover, cancer stem cells may explain several phenomena of cancers, such as chemoradiation resistance and metastasis.[26](#jcmm14786-bib-0026){ref-type=\"ref\"} With regard to clinical treatments, CSCs are less sensitive to antitumour drugs compared to tumour cells, contributing to the recurrence of cancers.[27](#jcmm14786-bib-0027){ref-type=\"ref\"} Recent studies have shown that lncRNAs are important for CSC biological functions in many types of cancers.[28](#jcmm14786-bib-0028){ref-type=\"ref\"} Yao et al found that lncRNA XIST is up‐regulated in glioblastoma CSCs and promotes stemness characteristics, including proliferation, migration and invasion.[29](#jcmm14786-bib-0029){ref-type=\"ref\"} Another study reported that lncRNA DGCR promotes cancer cell stemness characteristics targeting the miR‐330‐5p/CD44 axis in NSCLC.[30](#jcmm14786-bib-0030){ref-type=\"ref\"} In addition, lncGata6 maintains intestinal cell stemness and promotes tumour occurrence and progression in colorectal cancer.[31](#jcmm14786-bib-0031){ref-type=\"ref\"} Silencing of LncRNA n339260 reduces the stemness of HCC cells.[32](#jcmm14786-bib-0032){ref-type=\"ref\"} Zhang reported that lncRNA FEZF1‐AS1 regulates breast cancer stem cells by sponging miR‐30a, which targets Nanog.[33](#jcmm14786-bib-0033){ref-type=\"ref\"}\n\nSeveral studies have indicated that lncRNA SPRY4‐IT1 is associated with the progress of breast cancer. ", "LncRNA SPRY4‐IT1 is highly expressed in breast cancer cells, and N‐terminal polypeptide derived from viral macrophage inflammatory protein Ⅱ (NT21MP) inhibits the biological functions of breast cancer cells through lncRNA SPRY4‐IT1.[34](#jcmm14786-bib-0034){ref-type=\"ref\"} Another study has reported that proliferation is significantly suppressed when SPRY4‐IT1 is knocked down in breast cancer cells by targeting ZNF703.[17](#jcmm14786-bib-0017){ref-type=\"ref\"} However, it is not clear how SPRY4‐IT1 affects the stemness of breast cancer cells.", "\n\nTranscription factor 7‐like 2 (TCF7L2), also called TCF4, affects tumour development because TCF7L2 plays a key role in the Wnt/β‐catenin signalling pathway.[35](#jcmm14786-bib-0035){ref-type=\"ref\"} The Wnt/β‐catenin signalling pathway promotes cell proliferation and stem cell self‐renewal.[36](#jcmm14786-bib-0036){ref-type=\"ref\"} Activation of the Wnt/β‐catenin signalling pathway maintains stemness of breast cancer cells.[37](#jcmm14786-bib-0037){ref-type=\"ref\"} Thus, TCF7L2 mediates cell proliferation and stemness of breast cancer cells via the Wnt/β‐catenin signalling pathway.[23](#jcmm14786-bib-0023){ref-type=\"ref\"}\n\nThe proposed ceRNA (competing endogenous RNA) hypothesis suggests that crosstalk may exist among RNAs, thereby influencing biological processes independently of protein translation.[38](#jcmm14786-bib-0038){ref-type=\"ref\"} Our study was based on the ceRNA hypothesis, in which SPRY4‐IT1 is directly bound to miR‐6882, thereby targeting TCF7L2. ", "Therefore, we revealed that miR‐6882 is a new tumour suppressor‐miR in breast cancer that inhibits stemness characteristics through directly targeting TCF7L2 and further affecting the Wnt/β‐catenin signalling pathway.", "\n\nOur study first indicated that SPRY4‐IT1 promoted breast cancer cell stemness. ", "We found that SPRY4‐IT1 was highly expressed in MCF7 CSCs compared to MCF7 cells, which was further verified by data from TCGA. ", "Next, we overexpressed SPRY4‐IT1 in MCF‐7 cells and knocked down SPRY4‐IT1 in MCF‐7 CSCs, which demonstrated that SPRY4‐IT1 promoted the stemness of breast cancer. ", "We then verified that SPRY4‐IT1 is directly bound to miR‐6882 and that miR‐6882 was targeted to TCF7L2, which negatively regulated its expression. ", "We also confirmed in vivo that SPRY4‐IT1 promoted the stemness and self‐renewal of BCSCs. ", "These data suggested that SPRY4‐IT1 promotes stemness of breast cancer cells by targeting miR‐6882 through the Wnt/β‐catenin signalling pathway (see the proposed model in Figure [6](#jcmm14786-fig-0006){ref-type=\"fig\"}). ", "In our study, however, we only used MCF‐7 and T47D cell lines as experimental subjects. ", "MCF‐7 and T47D are two types of human luminal A breast cancer cells.[39](#jcmm14786-bib-0039){ref-type=\"ref\"} Our study only focused on luminal A breast cancer and did not include all types of breast cancer. ", "MCF‐7, T47D, BT474, MDA‐MB‐436 and JIMT1 cells can be reproduced in long‐term mammosphere cultures, but MDA‐MB‐231 and 468 cells are unable to form long‐term mammosphere cultures.[40](#jcmm14786-bib-0040){ref-type=\"ref\"} In the future, we will continue to investigate if SPRY4‐IT1 promotes stemness, cell proliferation and self‐renewal in other types of breast cancer cells.", "\n\n{#jcmm14786-fig-0006}\n\nOverall, the present study demonstrated that SPRY4‐IT1 is related to the stemness of breast cancer cells through miR‐6882 via the Wnt/β‐catenin signalling pathway.", "\n\nCONFLICTS OF INTEREST {#jcmm14786-sec-0022}\n=====================\n\nThe authors confirm that there are no conflicts of interest.", "\n\nAUTHOR CONTRIBUTIONS {#jcmm14786-sec-0025}\n====================\n\nXinyue Song, Xiaoxue Zhang, Lin Zhao and Minjie Wei conceived and designed the project. ", "Xinyue Song, Ming Zhang and Longyang Jiang designed and supervised experiments conducted in the laboratories. ", "Xinyue Song, Xiaoxue Zhang, Xinnan Wang, Lianze Chen and Ang Zheng performed experiments and/or data analyses. ", "Xiaoxue Zhang, Lin Zhao and Minjie Wei contributed reagents/analytic tools and/or grant support. ", "Xinyue Song and Xiaoxue Zhang wrote the paper. ", "All authors discussed the results and commented on the manuscript.", "\n\nSupporting information\n======================\n\n###### \n\n \n\n###### \n\nClick here for additional data file.", "\n\nThis work was supported by grants from the National Natural Science Foundation of China (Nos. ", "81673475, U1608281, 81573462, 31828005), Liaoning Province Doctoral Scientific Research Foundation (No. ", "20180540036), and Shenyang S&T Projects (Z18‐4‐020).", "\n\nDATA AVAILABILITY STATEMENT {#jcmm14786-sec-0024}\n===========================\n\nThe data that support the findings of this study are available from the corresponding author upon reasonable request.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.000614573888015002, 0.0009568074601702392, 0.0008921564440242946, 0.000847191084176302, 0.0006474645924754441, 0.0009391900966875255, 0.020542945712804794, 0.00094159587752074, 0.0006317012012004852, 0.0009323068079538643, 0.0005486365989781916, 0.000816811341792345, 0.001334539381787181, 0.0005412537720985711, 0.0006435209070332348, 0.0006927383947186172, 0.0008197551360353827, 0.001185585861094296, 0.0010668899631127715, 0.0006202225340530276, 0.0005664228810928762, 0.0016500594792887568, 0.0005664228810928762, 0.0016500594792887568, 0.0007931613363325596, 0.0006889504147693515, 0.000665246625430882, 0.0013893843861296773, 0.0007060195785015821, 0.0007840433390811086, 0.001527659478597343, 0.0006207922706380486, 0.0028393000829964876, 0.0005810005823150277, 0.0013590181479230523, 0.0007546900887973607, 0.0005719733890146017, 0.001303607365116477, 0.0007428476237691939, 0.0006405696622096002, 0.000623794854618609, 0.0012572675477713346, 0.0008400807855650783, 0.0006406853790394962, 0.0007079599890857935, 0.0006705319974571466, 0.0007518216734752059, 0.0006733268965035677, 0.0007131096790544689, 0.0007649761973880231, 0.0006268450524657965, 0.0012262470554560423, 0.0007142532849684358, 0.0006741692777723074, 0.0006917593418620527, 0.0012852742802351713, 0.0007454035803675652, 0.000941657810471952, 0.0006520588649436831, 0.001073541003279388, 0.0006307274452410638, 0.0007109647267498076, 0.0013313802191987634, 0.000631066330242902, 0.0006116424920037389, 0.0005931518971920013, 0.0006872591329738498, 0.0005618350696749985, 0.0006046806229278445, 0.0012863923329859972, 0.0006458683055825531, 0.0006455504917539656, 0.0006608532858081162, 0.0006146918749436736, 0.0005957678076811135, 0.0005703453789465129, 0.0006024695467203856, 0.0005849211011081934, 0.0011813916498795152, 0.0008385565015487373, 0.0009294797200709581, 0.0006435215473175049, 0.0006770280306227505, 0.0005872916080988944, 0.0005662754992954433, 0.0005848516593687236, 0.0006081698229536414, 0.000603451335337013, 0.000719563162419945, 0.0005679276073351502, 0.0006503911572508514, 0.0011795655591413379, 0.0013368463842198253, 0.0007059486233629286, 0.0005841358215548098, 0.001337619498372078, 0.0005887305596843362, 0.0006492126267403364, 0.0005476780934259295, 0.0011826391564682126, 0.0006111909169703722, 0.0005892877234145999, 0.0006320733809843659, 0.0007602999685332179, 0.00117425003554672, 0.000970478926319629, 0.0007713748491369188, 0.0005885686841793358, 0.0005815922631882131, 0.0007105843396857381, 0.0006797541282139719, 0.0006141701596789062, 0.0005881407996639609, 0.0006203706143423915, 0.0019055769080296159, 0.0008752208668738604, 0.000732082175090909, 0.0009398242691531777, 0.0006623460212722421, 0.0006251655286177993, 0.0006285692215897143, 0.0005975016392767429, 0.0005839387304149568, 0.0006032360251992941, 0.003213675692677498, 0.0006724486593157053, 0.0005781319923698902, 0.0007295641698874533, 0.0013830555835738778, 0.0007271742797456682, 0.000598178303334862, 0.0007015606970526278, 0.0005766793619841337, 0.000600381288677454, 0.0006003246526233852, 0.0019055769080296159, 0.0007100705406628549, 0.0006335998768918216, 0.0007070414139889181, 0.0006027523777447641, 0.0009773201309144497, 0.0006116715958341956, 0.0007025609957054257, 0.0008704669307917356, 0.0006623460212722421, 0.000678431591950357, 0.0005674849962815642, 0.0368925966322422, 0.0008723143255338073, 0.0006929569062776864, 0.0006570234545506537, 0.0006862999289296567, 0.0005886536091566086, 0.0006175466114655137, 0.0009348432067781687, 0.0019055769080296159, 0.0009428940247744322, 0.0006396214012056589, 0.0006991149275563657, 0.0006027523777447641, 0.0007349688094109297, 0.0008704669307917356, 0.0006623460212722421, 0.0006463387398980558, 0.0005674849962815642, 0.03856179118156433, 0.0007965408731251955, 0.0005783686647191644, 0.0005987717886455357, 0.0005927271558903158, 0.0006954113487154245, 0.0006639225757680833, 0.0005660000024363399, 0.0006116224103607237, 0.0006621996290050447, 0.0007114422041922808, 0.0019055769080296159, 0.0008579370332881808, 0.0006115235737524927, 0.0005697275628335774, 0.0006909091025590897, 0.0006841328577138484, 0.0005752870929427445, 0.0006549546378664672, 0.0007453130674548447, 0.0007238506805151701, 0.0007354540866799653, 0.0005674849962815642, 0.00840007048100233, 0.0005582739831879735, 0.0005801843362860382, 0.0006173636647872627, 0.000752899912185967, 0.0005981401191093028, 0.0007460485212504864, 0.0006222210358828306, 0.0005965621676295996, 0.0007515501929447055, 0.0006616882747039199, 0.0006243355455808342, 0.0007084054523147643, 0.0006291157915256917, 0.0006887731142342091, 0.0006059056031517684, 0.0007511234143748879, 0.0012834978988394141, 0.0008444013074040413, 0.0006245637778192759, 0.0006370940827764571, 0.0005768322153016925, 0.0007920698844827712, 0.0006267817807383835, 0.0006588189862668514, 0.0007720248540863395, 0.0019055769080296159, 0.0006383427535183728, 0.0010706414468586445, 0.0007026396924629807, 0.0006215550820343196, 0.0006155695300549269, 0.0007084429380483925, 0.0007339318399317563, 0.0006473800749517977, 0.0006873446400277317, 0.0005674849962815642, 0.0033255289308726788, 0.0012900278670713305, 0.0009243388194590807, 0.0008835382177494466, 0.0009049695800058544, 0.0007669251062907279, 0.0009566316148266196, 0.0006277358625084162, 0.0016850869869813323, 0.0006556741427630186, 0.0005719387554563582, 0.000627742731012404, 0.0005551560316234827, 0.0011411356972530484, 0.0006251747836358845, 0.0019055769080296159, 0.0006771667976863682, 0.0009032918605953455, 0.0007714321254752576, 0.0006182285724207759, 0.0006693057948723435, 0.000628158391918987, 0.0006393943331204355, 0.0005145089235156775, 0.0007207776070572436, 0.0005936094094067812, 0.0006840298301540315, 0.0006285239942371845, 0.000665937433950603, 0.001995444530621171 ]

[ "Kanal 2\n\nKanal 2 is a privately owned Estonian television channel. ", "Its literal name in English is \"Channel 2\".", "\n\nIt began broadcasting on 1 October 1993.", "\n\nProgrammes \nThe list might not reflect the current lineup of television shows.", "\n\nEstonian\n\nNews \n Reporter (daily news program)\n Reporter+ (weekly news program)\n\nReality \n Baar (The Bar)\n Tantsud tähtedega (Dancing with the Stars)\n\nDrama \n Saladused (Secrets)\n Ühikarotid (Estonian teen drama)\n\nGame Shows \n Kuldvillak (Estonian version of Jeopardy!)", "\n Kuum hind (The Price Is Right)\n\nComedy \n Jumal tänatud, et sa siin oled! (", "Thank God You're Here)\n\nForeign\n\nReality \nThe Amazing Race (series 1)\nAmerica's Got Talent\nAmerica's Next Top Model\nThe Bachelorette\nMy Bare Lady\nPussycat Dolls Present: The Search for the Next Doll\nSo You Think You Can Dance\n\nAnimation\n\nDrama\n\nTelenovelas\n\nSoap Opera \nHome and Away\n\nSitcoms \nAndy Richter Controls the Universe\nFriends\nHang Time\nJoey\nMarried... with Children\nThe Middle\nTwo and a Half Men\n\nComedy \nDesperate Housewives\nDue South\nKommissar Rex\nLas Vegas\nMen in Trees\nPushing Daisies\nUgly Betty\n\nScience Fiction \nFringe\nKyle XY\nNowhere Man\nPerson of Interest\nTerminator: The Sarah Connor Chronicles\nV\n\nDocumentary \nForensic Investigators\nI Shouldn't Be Alive\nThe Virtual Revolution\nZero Hour\n\nMini-series \nBrigada\nCategory 7: The End of the World\nSpetsnaz\n\nReferences\n\nExternal links\n \n\nCategory:Television channels in Estonia\nCategory:Television channels and stations established in 1993\nCategory:1993 establishments in Estonia\nCategory:Media in Tallinn" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.001531969173811376, 0.0006731254397891462, 0.0006264102994464338, 0.0006008355412632227, 0.0008428542641922832, 0.0059226579032838345, 0.000981614226475358 ]

[ "Mayapan\n\nMayapan (Màayapáan in Modern Maya), (in Spanish Mayapán), (pronounced mī-ä-ˈpän) is a Pre-Columbian Maya site a couple of kilometers south of the town of Telchaquillo in Municipality of Tecoh, approximately 40 km south-east of Mérida and 100 km west of Chichen Itza; in the state of Yucatán, Mexico. ", "Mayapan was the political and cultural capital of the Maya in the Yucatán Peninsula during the Late Post-Classic period from the 1220s until the 1440s. ", "Estimates of the total city population are 15,000–17,000 people, and the site has more than 4,000 structures within the city walls, and additional dwellings outside.", "\n\nThe site has been professionally surveyed and excavated by archeological teams, beginning in 1939; five years of work was done by a team in the 1950s, and additional studies were done in the 1990s. ", "Since 2000, a collaborative Mexican-United States team has been conducting excavations and recovery at the site, which continue.", "\n\nLayout\n\nMayapan is 4.2 square kilometers (about 1.6 square miles) and has over 4000 structures, most of them residences, packed into this compound within the city walls. ", "Built-up areas extend a half kilometer beyond the city walls in all directions. ", "The stone perimeter wall has twelve gates, including seven major gates with vaulted entrances. ", "The wall is 9.1 km (about 5.65 miles) long and is roughly ovate with a pointed northeast corner.", "\n\nThe ceremonial center of the site is located in Square Q of the city's grid in the center of the wider western half of the walled enclosure. ", "The ceremonial center has a tightly packed cluster of temples, colonnaded halls, oratories, shrines, sanctuaries, altars, and platforms (for oration, dancing, or stela display). ", "A.L. Smith, an archeologist with the Carnegie Institute, estimated 10–12,000 people lived within the walled city.", "\n\nAccording to Dr. Gregory Simons survey outside the city walls, there were numerous additional dwellings and he revised the total population estimate to between 15,000–17,000 people. ", "His survey results are posted online at www.mayapanperiphery.net. ", "People living outside of the city wall engaged in agriculture, animal-raising, and specialized activities such as lime production. ", "Russell also found a colonnaded hall outside the city wall, revealing much is still to be discovered regarding the complexity of this urban landscape.", "\n\nThe Temple of Kukulcan, a large pyramid also known as the Castillo, is the main temple in Mayapan. ", "It is located immediately to the east of the Cenote Ch'en Mul, which has caves radiating from it. ", "In form, the Temple of Kukulcan (Structure Q-162 on the site map) is a radial four-staircase temple with nine terraces; it is generally similar to the Temple of Kukulcan at the earlier site of Chichen Itza. ", "However, the Mayapan temple appears to be an inferior imitation of the one at Chichen Itza, and the city's buildings in general are not constructed as well as those in other Mayan cities. ", "For example, most or all of the vaulted roofs in Mayapan have collapsed, while many of the better-built buildings at Chichen Itza remain intact. ", "Other major temples in the ceremonial center include three round ones, which are unusual for the Maya area and are also linked to the deity Kukulkan/Quetzalcoatl in his wind god (Ehecatl) aspect. ", "Unlike Chichen Itza, Mayapan has no ballcourts.", "\n\nThe extensive residential zones of the site are composed of dwellings and ancillary domestic structures, with those around the ceremonial district larger and of higher quality and those toward the fringes being generally poorer. ", "The houses are often arranged in small patio groups surrounding small courtyards. ", "Houses were built haphazardly without organized streets. ", "Lanes wind among the residences and walls. ", " The residential areas of the site contain many cenotes, perhaps as many as 40. ", "Settlement was the most dense in the southwestern part of the city where cenotes are more numerous.", "\n\nHistorical overview\n\nThe ethnohistorical sources – such as Diego de Landa's Relacion de las Cosas de Yucatan, compiled from native sources in the 16th century – recount that the site was founded by Kukulcan (the Mayan name of Quetzalcoatl, the Toltec king, culture hero, and demigod) after the fall of Chichen Itza. ", "He convened the lords of the region, who agreed to found a new capital at Mayapan. ", "The lords divided the towns of Yucatán among them, and chose the chief of the Cocom family as their leader.", "\n\nThe ethnohistorical sources recount multiple different histories of the rise and fall of Mayapan (Roys 1962). ", "These histories are often confusing, chronologically implausible, and difficult to reconcile. ", "For example, some sources say that the Maya revolted in 1221 against the Maya-Toltec lords of Chichen Itza. ", "After a short civil war, the lords of various powerful cities and families met to restore a central government to Yucatán. ", "They decided to build a new capital city near the town of Telchaquillo, hometown of Hunac Ceel, the general who defeated the rulers of Chichen Itza. ", "The new city was built within a defensive wall and named Mayapan, meaning \"Standard of the Maya people\".", "\n\nThe chief of the Cocom family, a rich and ancient lineage that had taken part in the revolt against Chichen, was chosen to be king, and all the other noble families and regional lords were to send members of their families to Mayapan to play parts in the government (and perhaps act as hostages for the good behavior of the subsidiary cities). ", "Mexican mercenaries from Tabasco were also employed to keep order and maintain power. ", " Another family, the Xiu, may have been living in the Mayapan area prior to the arrival of the Cocom; the Xiu claim to be a part of the lineage from Uxmal. ", "This arrangement lasted for over 200 years. (", "An alternative account is given in a Maya chronicle from the Colonial era, claiming that Mayapan was contemporary with Chichen Itza and Uxmal and allied with those cities, but archeological evidence shows this version to be less likely.)", "\n\nMayapan became the primary city in a group of allies that included much of the northern Yucatán, and trade partners that extended directly to Honduras, Belize, and the Caribbean island of Cozumel, and indirectly to Mexico. ", " Though Mayapan was ruled by a council, the Jalach winik and the aj k’in (the highest ruler, and the high priest) dominated the political sphere. ", "Below the two primary officials were many other officials with varying responsibilities. ", "The range of classes went from the nobility, down to slaves, with intermediary classes in between. ", "The social climate of Mayapan was made complicated by the antagonistic relationship between the factions of nobles, which were often arranged by kinship (Pugh 2009; Milbrath 2003). ", "In 1441, Ah Xupan of the powerful noble family of Xiu became resentful of the political machinations of the Cocom rulers and organized a revolt. ", "As a result, all of the Cocom family, except one who was away in Honduras conducting trade, were killed, Mayapan was sacked, burned, and abandoned, all the larger cities went into decline, and Yucatán devolved into warring city-states.", "\n\nArchaeological evidence indicates that at least the ceremonial center was burned at the end of the occupation. ", "Excavation has revealed burnt roof beams in several of the major buildings in the site center.", "\n\nExcavations and investigations\n\nIn 1841 John L. Stephens was the first to document parts of the Mayapan site with two important illustrations. ", "The first was of the Q-152 round temple, and the second was of the Pyramid of Kukulkan. ", "He was the first in a long string of explorers who drew the ruins of Mayapan. ", "The first large-scale archeological site surveys were not conducted until 1938 by R.T. Patton. ", "These surveys mapped the main plaza group and the city wall, and were the basis of later maps (Russell 2008).", "\n\nIn the 1950s, archaeologists of the Carnegie Institution, including A. L. Smith, Robert Smith, Tatiana Proskouriakoff, Edwin Shook, Karl Ruppert and J. Eric Thompson conducted five years of intensive archeological investigations at Mayapan. ", "Their work was published in a mimeographed series of Current Reports. ", "The Current Reports have recently been republished in their entirety by the University of Colorado Press (John Weeks 2009). ", "The final report was published by the Carnegie Institution as Mayapan, Yucatan, Mexico, by H. E. D. Pollock, Ralph L. Roys, A. L. Smith, and Tatiana Proskouriakoff (1962, Publication 619). ", "Robert Smith published a two-volume monograph on The Pottery of Mayapan in 1971 (Papers of the Peabody Museum of Archaeology and Ethnology 66, Harvard University).", "\n\nIn the early 1990s, Clifford T. Brown of Tulane University carried out excavations in the residential zones of Mayapan as part of his doctoral dissertation research. ", "Several years later, the National Institute of Anthropology and History (INAH) of Mexico began extensive architectural excavations and consolidation under the direction of archaeologist Carlos Peraza Lope. ", "This work continues to the present. ", "It has resulted in the discovery of many important artifacts, murals, stuccoes, and architectural elements.", "\n\nFrom 2001 to 2009, further investigations were begun at the site by a team under the direction of Dr. Marilyn Masson from the State University New York at Albany, Carlos Peraza Lope of INAH, and Timothy S. Hare of Morehead State University. ", "This \"Economic Foundations of Mayapan\" (PEMY) Project performed mapping, surface survey and collection, test-pitting, and horizontal excavation across the city. ", "Major findings of this project include the identification of diverse occupational specialization among the city's commoners, who worked as craftsmen, conscripted military personnel, farmers, and domestic servants. ", "Great variation is now recognized in the types of work performed by commoners of different households and their degrees of affluence. ", "This project has also identified a probable major market plaza in Square K (between the site center and major north gate D); Richard Terry, Bruce Dahlin, and Daniel Bair have analyzed soil samples from this location to test the function of this locality. ", "In 2008 and 2009, the PEMY project focused excavations on an outlying ceremonial group by the far eastern city gate (Gate H), known as Itzmal Ch'en, as part of its study of the economic and social links between governing elites and distant neighborhoods within the city.", "\n\nChronology\n\nBefore Mayapan\n Some evidence suggests overlapping occupation of the area by different cultures. ", "Shook in 1954 said that there may have been a Puuc \"city\" somewhere near Mayapan prior to its post-classical settlement. ", "The mixture of Puuc pot sherds in the lower parts of Mayapan lots may support this, but it is a very small percentage of the material (2% in most cases and no more than 4% in others).", "\n\nSite chronology based on ceramics\n According to Robert Smith, the ceramicist for the Carnegie Institution, there were two ceramic phases in Mayapan: hocaba, which he said started around A.D. 1200 and may have included types named Mama Red and Navula Unslipped, more commonly associated with southern lowland settlements. (", "Milbrath and Pereza argue that the Hocaba phase starts in A.D. 1100, which fits better with the chronology of the southern lowland sites.) ", "The second phase is Tases, which has some overlapping typology with the Hocaba phase.", "\n\nSite chronology based on radiocarbon dates\n\nMiddle Preclassical Date\nIn an alley fill between the Templo Redondo and an adjoining hall, some charcoal was found that yielded a calibrated date of 540–820 B.C. But, most of the pottery in this fill was post-classical. ", "Researchers think that this sample represented old charcoal that predated the context in which it was found.", "\n\nTerminal Classical Dates\nA burial found on bedrock in the houselot soils of a post-classical solare dated between A.D. 600 and A.D. 780. ", "The burial appeared to be a secondary interment, and could not be completely excavated because it intruded into a wall. ", "There was no pottery with the burial; midden samples in this area suggest occupation prior to the construction of the post-classical houselots.", "\n\nCharcoal was found on the upper floor of one of the temples that was dated to A.D. 770-1020. ", "Researchers think that this sample is not associated with the context in which it was found. ", "The construction fill as well as the upper floors were of post-classical age.", "\n\nEarly Mayapan occupation\n Three separate samples form the frame for early Mayapan occupation. ", "These dates are A.D. 990–1170. ", "However, two of these dates come from inexact sources. ", "One was burned copal found in an unknown structure (apparently the label had eroded off of the structure); the researchers inferred that it was Q-95. ", "The early date would suggest that this temple was built and in use in Mayapan's early history.", "\n Carbon dating of the pits below what was assumed to be Q-97 (again the label had eroded) dated from A.D. 990–1180.", "\n Charcoal found in the early construction phase of the site's main pyramid was dated A.D. 1020–1170. ", "This sample was found in reliable context and is presumably the most accurate. ", "It is important for suggesting that the post-classical phase in Mayapan started earlier than A.D. 1200.", "\n\nLate Mayapan occupation\n Mayapan's settlement pattern radiated outwards to its fringes over time; many of the later dates are from materials outside of the main group of ruins. ", "The fall of the city is tentatively dated around A.D. 1461, based on the lack of construction of altars and burial cists after this date. (", "Lope et al. ", "2006). ", "According to Diego de Landa Calderon (1524 - 1579), the city was abandoned following the country's enslavement by a certain chieftain of the Yucatecan nation (in collusion with a garrison of Mexica Indians), and which abuse eventually led to internecine war, culminating in the city's demise in circa 1441.", "\n\nAgriculture and animals\nMilpa, or mixed, fields may have been cultivated when Mayapan was inhabited. ", "There is evidence that the area around Mayapan was regularly used for slash-and-burn agriculture. ", "Cenotes and underground limestone canals serve as the only source of freshwater in this area, making them essential to support agriculture. ", "Researchers have suggested that Mayapan was an import/export center, and that they often traded luxury goods, such as cotton, salt, and honey, for products of obsidian and metal, which they would have forged. (", "Paris 2008) (Melbrath & Peraza 2003:29). ", "Today farmers use mixed fields, called the milpa fields, to cultivate maize, beans, squash, watermelons, mangoes, papayas and other crops. ", "Also, citrus fruit such as oranges and limes are often grown within the domestic house groups of the local residents (Russell 2008:16).", "\n\nFaunal remains indicate that the local population used varying methods of animal acquisition. ", "A study done by M.A. Masson and C. Peraza Lope in 2008 looked at faunal remains from two different middens, one located in the monumental center by some houses, and the other is located in the domestic area outside the monumental compound. ", "The largest samples of recognized remains within the monumental center were from: white-tailed deer (23%), dog (4.4%), turkey (12.9%), and iguana (10.2%). ", "The combined contributions of fish make up around 1.2% of the samples. ", "These percentages as well as the ones that will follow for the settlement zone are based on recognized remains. ", "Primary animals may have made up larger portions of the diet but their remains are too difficult to recognize.", "\n\nIn the settlement zone, researchers found: white-tailed deer (8.4%), dog (1.4%), turkey (5.3%), iguana (14.5%), and fish (3.6%). ", "Both turtle and rabbit remains were found in both sites, but they were consumed in small amounts (less than 1.5%). ", "While excavating, the researchers noted many fish skeletons, but few fish heads. ", "They concluded that the fish were being traded into Mayapan, and not collected near the site. ", "If the fish had been prepared at the site, the heads would have been common refuse. ", "Within the ceremonial center, numerous deer heads and teeth were found among the remains.(M.A. Masson, C. Peraza Lope 2008).", "\n\nTrade\n\nMayapan was a major capital in the Yucatán, and there is extensive evidence that it had far-reaching trade routes, as seen in architecture and artifacts of other settlements in the region. ", " A wide variety of goods were traded, including maize, honey, salt, fish, game, cloth, and birds.", "\n\nPeten\nZacpeten on Lake Salpeten – Incense burners found at this site are nearly identical to those found at Mayapan. ", "The temple assemblages at Zacpeten are very similar to those at Mayapan. ", "Topoxte in Lake Yaxha, Peten also shares similarities of architecture and artifacts of effigy censers. ", "Topoxte architectural remains show a similar stone carving style to Mayapan. ", "Also, tiny “dwarf” shrines found at this site were very similar to shrines found at Mayapan. ", "The two sites appear to have been abandoned around the same time; which may suggest a connection between their governments.", "\n\nHighland Guatemala\nArchitectural and artifact connections are seen between Mayapan and the Utatlan in highland Guatemala. ", "Examples are similar temple assemblages, the presence of skull imagery and squatting figures, extensive and lavish use of stucco combined with crude masonry, and effigy figure censers.", "\n\nYucatan East Coast\nThis region also shows apparent influence of Mayapan, in similar temple assemblages, similarities in architecture, effigy censers at some sites, and parallels between architectural decoration at Mayapan and some east coast sites. ", "The east coast sites exported products such as cotton, salt, and honey from the Yucatán. ", "Sites in Guatemala traded back cacao. ", "El Chayal in Guatemala was the only source of the obsidian found at Mayapan.", "\n\nAztecs, Central Mexico, and the Campeche Coast\nThe presence of Matillas Fine Orange ceramics in Mayapan suggests trade with Tabasco. ", "This area may have mediated trade between Mayapan and the rest of Central Mexico. ", "Sculptures and murals at Mayapan suggest that there was contact between Mayapan and the rising Aztec empire. ", "Some Mayapan figures showed details of Aztec dress, and what appears to be an Aztec deity is carved on an altar in Mayapan.", "\n\nThis evidence suggests a: “circum-Yucatecan trade route that linked Mayapan to Peten, northern Belize, and east-coast sites in the Late Postclassic period.” (", "Melbrath & Peraza Lope 2003:24–31)\n\nSymbolism\n The symbolism present in Mayapan is particularly significant, partially because the center of the site is mainly used for ritual purposes. ", "There are many similarities between the murals in Mayapan and the art and iconography of the Aztec and Mixteca-Puebla regions. ", "Symbols that they have in common include:\n the sun disc (there are varying interpretations of what this represents\n Could represent the sun god\n However, the diving posture of the figure within the disc is a common motif used to represent a dead warrior, and because the figure is represented bound and with his heart removed it has been interpreted as a representation of a warrior sacrificed to the sun god.", "\n representations of Quetzalcoatl\n murals in structure Q.80 show reptile iconography which has been interpreted as participation in Mixteca-Puebla traditions. ", "The dentition of the reptile indicate that they are serpents. ", "There are similar representations found at Coba and on some pottery in Cholula dated to circa 1350–1550 AD.", "\n\n(Milbrath, Susan., ", "Carlos Peraza Lope, Miguel Delgado Kú. ", "2010)\n\n Serpent iconography is very common at Mayapan, serpent balustrade carvings are common throughout the ritual center in the complexes that are associated with the Cocom lineage like the Castillo (Milbrath, Susan., ", "Carlos Peraza Lope, Miguel Delgado Kú 2010). ", "In contrast depictions of the rain god Chaac are common to the temples related to the Xiu lineage. (", "Milbrath 2009:583) There are also depictions of the Monkey-man god\n Most of the iconography in Mayapan is found either in murals on the temple walls, stone carving, or carved stone covered in plaster.", "\n\nEvidence of inequality\nDirectionality may have played a role in the representation of inequality among the powerful factions of Mayapan. ", "East and west were of primary importance because it represented the track of the sun through the sky. ", "The east was associated with: life, males, and heat; whereas the west was associated with: death, females, and cold. ", "This has led many sources to believe that the Itza and the Xiw may have been associated with east and west. ", "There was very little evidence for obvious separation of residence between classes. ", "This is mostly due to the residential center of Mayapan being located around the concentration of the water filled cenotes. ", "Most residences are tandem structures made of several building within a separating wall. ", "Many of these tandem structures include multiple residential buildings; the size of these residential buildings, relative to each other, suggests that some of them were for slaves. ", "The integration of classes extends to the outer edges of the residential areas probably due to the convenience of being close to the agricultural fields. ", "Some sources indicate that the analysis of oratarios or god-houses (large house-like shrines) show boundaries that were known to the people of Mayapan. ", "This is shown in relation to the analysis of household oratarios and those oriented around the ceremonial center of Mayapan. ", "Unfortunately there is very little skeletal evidence found in this region because of the composition of the soil. ", "The goods found in different house structures do suggest different levels of social status, mainly in regard to the specialization of housing structures. ", "There are at least two examples of obsidian workshops in Mayapan. ", "The strongest evidence for inequality in Mayapan is found in the presence of deep shafts full of sacrificial victims, this suggests that the noble class had enough power to condemn some people to death.", "\n\nAbandonment\nThe site of Mayapan was abandoned sometime in the 15th century. ", "There has been some dispute over when the actual abandonment took place. ", "However, written records state that the site was abandoned in A.D. 1441. ", "There appear to be several contributing factors to the abandonment of Mayapan. ", "Around A.D. 1420 a riot was started by the Xius against the Cocom which culminated in the death of nearly all (if not in fact all) of the Cocom lineage. ", "Pestilence may have been involved in the subsequent abandonment of the site by the remaining Xiu inhabitants. ", "There were several sources of evidence to support this interpretation. ", "Evidence of burned wood was found inside of structure Y-45a as well as burned roofing material on many of the other structures that was dated to around the time of the collapse in K’atun 8 Ahua (roughly A.D. 1441–1461). ", "A mass grave in the main plaza, and bodies in a burial shaft covered in ash were dated to around the collapse and showed signs of violence, some of the bodies still had large flint knives in their chests or pelvises, suggesting ritualized sacrifice. ", "Smashed vessels litter the floors of the Y-45a complex that date to around A.D. 1270–1400, prior to the documented collapse of Mayapan. ", "A vessel bearing the glyph K’atun 8 Ahua was found on the floor of this complex. ", "From this they have posited that the complex was abandoned finally when the city fell (Lope 2006; Milbrath 2003). ", "After A.D. 1461 there is little evidence of altars and burial cists being constructed after 1461, suggesting that the site had been abandoned by this point (Lope 2006). ", "Very little evidence has been found to support later usage of Mayapan. ", "Copal from an altar was found in the Templo Redondo compound that may suggest later pilgrimages to the Castillo de Kukulkan. ", "However, these samples date to the industrial era and may not be valid, so any assumptions based on this evidence would also not be valid (Lope 2006:168).", "\n\nReferences\n\n Barrera Rubio, Alfredo and Carlos Peraza Lope. (", "2001) \"La Pintura Mural de Mayapán\", In La Pintura Mural Prehispánica en México: Área Maya, edited by Leticia Staines Cicero, Beatriz de la Fuentes, project director, pp.", " 419–446. ", "Instituto de Investigaciones Estéticas, Universidad Autónoma de México, México, D.F.\n Brown, Clifford T. (1999) Mayapán Society and Ancient Maya Social Organization. ", "Ph.D. dissertation, Dept. ", "of Anthropology, Tulane University.", "\n Brown, Clifford T. (2006) \"Water Sources at Mayapán, Yucatán, México,\" in Precolumbian Water Management: Ideology, Ritual, and Power, edited by Lisa Lucero and Barbara Fash, pp 171–188. ", "Tucson: University of Arizona Press.", "\n Brown, Clifford T. (2005) \"Caves, Karst, and Settlement at Mayapán, Yucatán,\" in In the Maw of the Earth Monster: Mesoamerican Ritual Cave Use, edited by James E. Brady and Keith M. Prufer, pp.", " 373–402. ", "Austin: University of Texas Press (Linda Schele Series in Maya and Pre-Columbian Studies).", "\n Bullard, William R., Jr. (1952) \"Residential Property Walls at Mayapán\", in Current Reports No. ", "3:36–44. ", "Carnegie Institute of Washington, Department of Archaeology, Washington, D.C.\n Bullard, William R., Jr. (1954) Boundary Walls and House Lots at Mayapán. ", "Current Reports No. ", "13:234–253. ", "Carnegie Institute of Washington, Department of Archaeology, Washington, D.C.\n Delgado Kú, Miguel Angel, (2009) La Pintura Mural de Mayapán, Yucatán: Una Interpretación Iconográfica, Tesis profesional, Facultad de Ciencias Antropológicas, Universidad Autnoma de Yucatán, Mérida, Yucatán, México.", "\n Delgado Kú, Pedro C. (2004) Estudio de la Arquitectura Pública del Núcleo Principal de Mayapán, Yucatán, Tesis profesional, Facultad de Ciencias Antropológicas, Universidad Autnoma de Yucatán, Mérida, Yucatán, México.", "\n Landa, Diego de. (", "1941) Relaciones de las Cosas de Yucatán, Translated by Alfred Tozzer. ", "Papers of the Peabody Museum of Archaeology and Ethnology 18, Harvard University Press, Cambridge.", "\n Lope, Carlos Peraza, Marilyn A. Masson, Timothy S. Hare, Pedro Candelario Delgado Kú (2006). \"", "The chronology of Mayapán: new radiocarbon evidence\", in Ancient Mesoamerica 17(2):153–175.", "\n Masson, Marilyn A. (2009) \"Appendix: Inventory and Lot Descriptions\" Carnegie Institution Current Reports on Mayapan. ", "In The Carnegie Maya II: Carnegie Institution of Washington Current Reports, 1952–1957, edited by John Weeks, pp.", " 553–609. ", "University of Colorado Press, Boulder.", "\n Marilyn A. Masson, Timothy S. Hare, and Carlos Peraza Lope (2006). \"", "Postclassic Maya Society Regenerated at Mayapán\", In After Collapse: The Regeneration of Complex Societies, edited by Glenn M. Schwartz and John J. Nichols, pp.", " 188–207. ", "University of Arizona Press, Tucson.", "\n Masson, Marilyn A. and Carlos Peraza Lope 2007 Kukulkan/Quetzalcoat, Death God, and Creation Mythology of Burial Shaft Temples at Mayapan. ", "Mexicon 29:77–85.", "\n Masson, Marilyn A. and Carlos Peraza Lope (2005). \"", "Nuevas Investigaciones en Tres Unidades Residenciales Fuera del Area Monumental de Mayapán\", In Investigadores de La Cultura Maya, Tomo II, pp.", " 411–424. ", "Universidad Autónoma de Campeche. ", "Campeche, Mexico.", "\n Masson, Marilyn A. and Carlos Peraza Lope (2008). \"", "Animal Use at Mayapan\", Quaternary International, 191:170–183.", "\n Masson, Marilyn A. and Carlos Peraza Lope (2010). \"", "Evidence for Maya-Mexican Interaction in the Archaeological Record of Mayapan\", In Astronomers, Scribes, and Priests: Intellectual Interchange between the Northern Maya Lowlands and Highland Mexico in the Late Postclassic Period, edited by Gabrielle Vail and Christine Hernandez, pp.", " 77–114. ", "Dumbarton Oaks, Washington, D.C.\n Milbrath, Susan and Carlos Peraza Lope (2003). \"", "Revisting Mayapan: Mexico’s Last Maya Capital\", Ancient Mesoamerica 14:1–47.", "\n Milbrath, Susan and Carlos Peraza Lope 2003b Mayapán’s Scribe: A Link with Classic Maya Artists. ", "Mexicon XXV:120–123.", "\nMilbrath, Susan., ", "Carlos Peraza Lope 2009 Survival and revival of Terminal Classic traditions at Postclassic Mayapán Latin American antiquity: a journal of the Society for American Archaeology 20(4):581–606.", "\n Milbrath, Susan, Carlos Peraza Lope, and Miguel Delgado Kú 2010 Religious Imagery in Mayapan’s Murals. ", "The PARI Journal X:1–10.", "\n Morley, Sylvanus Griswold. ", "The Ancient Maya (4th ed.). ", "Stanford, California: Stanford University Press, 1983.", "\n Paris, Elizabeth H. 2008 Metallurgy, Mayapan and the Postclassic World System. ", "Ancient Mesoamerica 19:43–66.", "\n Peraza Lope, Carlos 1998 Mayapán: Ciudad-capital del Postclasico. ", "Arqueología Mexicana :48-53.", "\n Pollock, Ralph L. Roys, Tatiana Proskouriakoff and A. Ledyard Smith, pp.", " 165–320. ", "Occasional Publication 619. ", "Carnegie Institution of Washington.", "\n Proskouriakoff, Tatiana (1962) Civic and religious structures at Mayapán, In “Introduction,” in Mayapán, Yucatan, Mexico, by Harry E. D. Pollock, Ralph L. Roys, Tatiana Proskouriakoff, and A. L. Smith, pp.", " 87–164. ", "Washington, DC: Carnegie Institute of Washington Publication No. ", "619\n Proskouriakoff, Tatiana and Charles Temple (1955) A Residential Quadrangle – Structures R-85 to R-90. ", "Current Reports 29:289–362. ", "Carnegie Institute of Washington, Department of Archaeology, Washington, D.C.\n Pugh, Timothy 2001 Flood Reptiles, Serpent Temples and the Quadripartite Universe: The Imajo Mundi of Late Postclassic Mayapán. ", "Ancient Mesoamerica 12:247-258.", "\nPugh, Timothy W. 2003 A cluster and spatial analysis of ceremonial architecture at Late Postclassic Mayapán Journal of Archaeological Science 30(8):941-953.", "\n Restall, Matthew 2001 The People of the Patio: Ethnohistoric Evidence of Yucatec Maya Royal Courts. ", "In Royal Courts of the Maya, Volume II, edited by Takeshi Inomata y Stephen D. Houston, pp.", " 335–390. ", "Westview Press, Boulder.", "\n Ring, Trudy, ed. ", " “Mayapan” in International Dictionary of Historic Places, Volume I: Americas. ", "New York: Routledge, 1996.", "\n Ringle, William M. y George J. Bey III 2001 Post-Classic and Terminal Classic Courts of the Northern Maya Lowlands. ", "En Royal Courts of the Maya, Volume Two: Data and Case Studies, edited by Takeshi Inomata and Stephen D. Houston, pp.", " 266–307. ", "Westview Press, Boulder.", "\n Roys, Ralph L. (1962). \"", "Literary Sources for the History of Mayapan\", In Mayapan, Yucatán, Mexico. ", "Carnegie Institute of Washington Publication No. ", "619, by Harry E.D. Pollock, Ralph L. Roys, Tatiana Proskouriakoff, and A.L. Smith, pp.", " 25–86. ", "Washington, D.C.\n Russell, Bradley W. and Bruce H. Dahlin (2007). \"", "Traditional Burnt-Lime Production at Mayapán, Mexico\", Journal of Field Archaeology 32:407-423.", "\n Russell, Bradley W. (2008) Postclassic Maya Settlement on the Rural Urban Fringe of Mayapán, Yucatán, Mexico, Ph.D. Dissertation, Department of Anthropology, University at Albany-SUNY.", "\n Serafin, Stanley. (", "2010) Bioarchaeological Investigation of Violence at Mayapan, Ph.D. dissertation, Department of Anthropology, Tulane University.", "\n Smith, A. Ledyard (1962) \"Residential and Associated Structures at Mayapán\", In Mayapán Yucatan Mexico, edited by H.E.D.\n Smith, Robert E. (1971) The Pottery of Mayapan. ", "Papers of the Peabody Museum of Archaeology and Ethnology 66. ", "Harvard University, Cambridge.", "\n\nExternal links\n\n Mayapan at Maya History - Maya History\n Grinnell College - Mayapan Project\n - Mayapan Archaeology\n Mayapan Photo Essay\n SUNY Albany - Mayapan archaeology\n\nCategory:Maya sites in Yucatán\nCategory:Former populated places in Mexico\nCategory:Tourist attractions in Yucatán\nCategory:Maya Postclassic Period" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0008874953491613269, 0.0007250806083902717, 0.0006114309653639793, 0.0005380373913794756, 0.0005212215473875403, 0.0005734401056542993, 0.000892351905349642, 0.0006689009023830295, 0.0008157677948474884, 0.0006407486507669091, 0.0007051239372231066, 0.0006167957908473909, 0.0006033736863173544, 0.0005886236322112381, 0.0008474692585878074, 0.0006405352032743394, 0.0008299964247271419, 0.0006473622051998973, 0.0006258785724639893, 0.0006859648274257779, 0.0006034249672666192, 0.0006109934183768928, 0.005498210433870554, 0.0006013622623868287, 0.0005833235336467624, 0.0012243569362908602, 0.0006228265119716525, 0.0006637618644163013, 0.0006501023308373988, 0.0007565254345536232, 0.0007253412040881813, 0.0006163145299069583, 0.000597181380726397, 0.0006345697911456227, 0.0006655881297774613, 0.0008323517977260053, 0.0012475657276809216, 0.0008984905434772372, 0.0007590497261844575, 0.0009671047446317971, 0.0006961497128941119, 0.0005591936642304063, 0.0005844206898473203, 0.0007592598558403552, 0.0017635275144129992, 0.0005852138274349272, 0.0049532451666891575, 0.0006093589472584426, 0.0014324213843792677, 0.0030783535912632942, 0.0006349993636831641, 0.0005954530206508934, 0.0005664420314133167, 0.0006753995548933744, 0.001117969979532063, 0.0006317514344118536, 0.0005803572130389512, 0.0005612571840174496, 0.0005604249308817089, 0.000562787929084152, 0.0005848853616043925, 0.0005784389795735478, 0.000569493044167757, 0.0005597269628196955, 0.0005864869453944266, 0.0005359158967621624, 0.0005785925313830376, 0.0005933150532655418, 0.0005525005399249494, 0.0008176667033694685, 0.0005532284849323332, 0.0005550814094021916, 0.000594917219132185, 0.0006716825882904232, 0.0008686176734045148, 0.0005703475326299667, 0.0005722149508073926, 0.0007037786417640746, 0.0006415563984774053, 0.0005710772820748389, 0.0006225300603546202, 0.0015203426592051983, 0.0007046731770969927, 0.0006211403524503112, 0.000584063702262938, 0.0008160371799021959, 0.0006441547884605825, 0.0006936272257007658, 0.0005921027041040361, 0.000672154885251075, 0.0005724254879169166, 0.0006384541047737002, 0.0006265950505621731, 0.0005515678785741329, 0.0006072153337299824, 0.0006338771199807525, 0.0006342572742141783, 0.0008667850052006543, 0.0007848869427107275, 0.0007679730770178139, 0.0006346834707073867, 0.0007185174617916346, 0.0005522733554244041, 0.0006028448697179556, 0.0006733115296810865, 0.0011563330190256238, 0.0005988496704958379, 0.0006159665645100176, 0.0005763400695286691, 0.0006185256643220782, 0.0006552571430802345, 0.0005913165514357388, 0.0006559928879141808, 0.0008192268433049321, 0.0006902907625772059, 0.0006064515910111368, 0.0007078456692397594, 0.011655932292342186, 0.000656449468806386, 0.0005860851961188018, 0.0006683815736323595, 0.000776221975684166, 0.0006473858957178891, 0.0030327963177114725, 0.0006782615091651678, 0.00113957142457366, 0.0005503393476828933, 0.0005655645509250462, 0.0008395247277803719, 0.0006174983573146164, 0.0006811483763158321, 0.0006373922806233168, 0.0006349881878122687, 0.000608367845416069, 0.0006670423899777234, 0.0005547223263420165, 0.00060418457724154, 0.0005718928878195584, 0.0005888396990485489, 0.0005608837236650288, 0.0006407928303815424, 0.0005751264397986233, 0.0033436710946261883, 0.0006627185503020883, 0.000779575202614069, 0.0008080023690126836, 0.000623031985014677, 0.000731922104023397, 0.0005840949015691876, 0.0008028433658182621, 0.0006003546877764165, 0.0005690432153642178, 0.0017238386208191514, 0.0006416187970899045, 0.0006335449288599193, 0.0006483285105787218, 0.0006167099927552044, 0.0012585980584844947, 0.0005691265105269849, 0.0006120530306361616, 0.0005590153741650283, 0.0005788432899862528, 0.0005483537679538131, 0.000562650675419718, 0.027293719351291656, 0.000597604492213577, 0.0005757029284723103, 0.000618369725998491, 0.0005941420095041394, 0.0019472241401672363, 0.0012506595812737942, 0.0005832520546391606, 0.0007401225157082081, 0.0008829638245515525, 0.0008242009207606316, 0.0009466669871471822, 0.0006699555087834597, 0.000656678166706115, 0.0006664380780421197, 0.0006580232293345034, 0.0005922057316638529, 0.0006410158239305019, 0.0007076247711665928, 0.0011535584926605225, 0.0006624353118240833, 0.0006959629827179015, 0.0006791544728912413, 0.0006758766830898821, 0.0006660976796410978, 0.0007067465921863914, 0.0008530858322046697, 0.0006033038371242583, 0.0006469835061579943, 0.0010557223577052355, 0.0006110385875217617, 0.0007033843430690467, 0.0011754094157367945, 0.0006465050973929465, 0.0006859501008875668, 0.0008123663137666881, 0.0007065364625304937, 0.0006650706636719406, 0.0006853597587905824, 0.0005906583392061293, 0.0006319155218079686, 0.0005857291980646551, 0.0011338060721755028, 0.0006586246308870614, 0.0006901411688886583, 0.0006452033412642777, 0.0010467551182955503, 0.0006656378973275423, 0.0006851503858342767, 0.0008534485241398215, 0.0006947145448066294, 0.0007770279189571738, 0.0008539980044588447, 0.0007032727589830756, 0.0007074056193232536, 0.0006963935447856784, 0.0006269257282838225, 0.0006943464395590127, 0.0005822667735628784, 0.0010808298829942942, 0.0014261397300288081, 0.0007087106350809336, 0.0006701387465000153, 0.0008943935390561819, 0.001112289377488196, 0.0006439915159717202, 0.0006918780272826552, 0.0006837346008978784, 0.0008070278563536704, 0.0006482710014097393, 0.0006474010297097266, 0.0006810509948991239, 0.0007645637379027903, 0.0007729958742856979, 0.0007670445484109223, 0.0006357717793434858, 0.0010567598510533571, 0.0006953587289899588, 0.0006882908055558801, 0.0006105262436904013, 0.0011245779460296035, 0.0006521175964735448, 0.0006184684461914003, 0.0006438282434828579, 0.0007476534810848534, 0.0007380570750683546, 0.0007141103269532323, 0.0006331416661851108, 0.0006303125410340726, 0.0009024776518344879, 0.0006561676855199039, 0.0007127026910893619, 0.0006214254535734653, 0.0006574743892997503, 0.0006821208517067134, 0.0006192948203533888, 0.0007849546964280307, 0.0006561676855199039, 0.0006658714264631271, 0.000572105054743588, 0.0006783427088521421, 0.0006566841620951891, 0.0009593505528755486, 0.0006405831081792712, 0.0006035695550963283, 0.0006074237171560526, 0.0007911344873718917, 0.0006236854824237525, 0.0006317872321233153, 0.0006722115213051438, 0.0007363685290329158, 0.0006282191607169807 ]

[ "The effect of heparin on osteoblast differentiation and activity in primary cultures of bovine aortic smooth muscle cells.", "\nRecent studies have suggested that aortic smooth muscle cells undergo a phenotypic transition into osteoblast-like cells and mineralize when cultured in the presence of beta-glycerophosphate. ", "Since we had previously demonstrated that heparin could inhibit osteoblast differentiation and mineralization in primary cultures of murine calvaria cells, we were interested in determining if heparin would have a similar effect when primary aortic smooth muscle cells were cultured in the presence of beta-glycerophosphate. ", "The effect of heparin and low molecular weight heparin (LMWH) on osteoblast differentiation and activity was therefore examined in primary cultures of bovine aortic smooth muscle cells (BASMC) over a 14-day period. ", "Here, we report that BASMC differentiate into osteoblast-like cells when cultured in the presence of beta-glycerophosphate. ", "Moreover, we report that heparin not only inhibits this process but that it also inhibits the ability of BASMC to mineralize as well. ", "Importantly, these effects were found not to be dependent upon heparins' anticoagulant activity since unfractionated heparin and heparins with low anti-thrombin III affinities inhibited the mineralization process equally well. ", "Sulfation, however, was found to be a major determinant of heparins ability to inhibit BASMC mineralization since neither dermatan sulfate nor N-desulfated heparin were able to demonstrate an effect. ", "We conclude that BASMC cultures can undergo a phenotypic transition into mature osteoblasts and that both the differentiation process and their ability to mineralize are inhibited by heparin." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.001605754834599793, 0.0013665023725479841, 0.0008834489854052663, 0.0009622937650419772, 0.0026561133563518524, 0.0006088904337957501, 0.0008778345072641969, 0.0010644677095115185, 0.0019996652845293283 ]

[ "///////////////////////////////////////////////////////////////////////////////\n//\n/// \\file check.h\n/// \\brief Internal API to different integrity check functions\n//\n// Author: Lasse Collin\n//\n// This file has been put into the public domain.", "\n// You can do whatever you want with this file.", "\n//\n///////////////////////////////////////////////////////////////////////////////\n\n#ifndef LZMA_CHECK_H\n#define LZMA_CHECK_H\n\n#include \"common.h\"\n\n\n// Index hashing needs the best possible hash function (preferably\n// a cryptographic hash) for maximum reliability.", "\n#if defined(HAVE_CHECK_SHA256)\n#\tdefine LZMA_CHECK_BEST LZMA_CHECK_SHA256\n#elif defined(HAVE_CHECK_CRC64)\n#\tdefine LZMA_CHECK_BEST LZMA_CHECK_CRC64\n#else\n#\tdefine LZMA_CHECK_BEST LZMA_CHECK_CRC32\n#endif\n\n\n/// \\brief Structure to hold internal state of the check being calculated\n///\n/// \\note This is not in the public API because this structure may\n/// change in future if new integrity check algorithms are added.", "\ntypedef struct {\n\t/// Buffer to hold the final result and a temporary buffer for SHA256.", "\n\tunion {\n\t\tuint8_t u8[64];\n\t\tuint32_t u32[16];\n\t\tuint64_t u64[8];\n\t} buffer;\n\n\t/// Check-specific data\n\tunion {\n\t\tuint32_t crc32;\n\t\tuint64_t crc64;\n\n\t\tstruct {\n\t\t\t/// Internal state\n\t\t\tuint32_t state[8];\n\n\t\t\t/// Size of the message excluding padding\n\t\t\tuint64_t size;\n\t\t} sha256;\n\t} state;\n\n} lzma_check_state;\n\n\n/// lzma_crc32_table[0] is needed by LZ encoder so we need to keep\n/// the array two-dimensional.", "\n#ifdef HAVE_SMALL\nextern uint32_t lzma_crc32_table[1][256];\nextern void lzma_crc32_init(void);\n#else\nextern const uint32_t lzma_crc32_table[8][256];\nextern const uint64_t lzma_crc64_table[4][256];\n#endif\n\n\n/// \\brief Initialize *check depending on type\n///\n/// \\return LZMA_OK on success. ", "LZMA_UNSUPPORTED_CHECK if the type is not\n/// supported by the current version or build of liblzma.", "\n/// LZMA_PROG_ERROR if type > LZMA_CHECK_ID_MAX.", "\nextern void lzma_check_init(lzma_check_state *check, lzma_check type);\n\n/// Update the check state\nextern void lzma_check_update(lzma_check_state *check, lzma_check type,\n\t\tconst uint8_t *buf, size_t size);\n\n/// Finish the check calculation and store the result to check->buffer.u8.", "\nextern void lzma_check_finish(lzma_check_state *check, lzma_check type);\n\n\n/// Prepare SHA-256 state for new input.", "\nextern void lzma_sha256_init(lzma_check_state *check);\n\n/// Update the SHA-256 hash state\nextern void lzma_sha256_update(\n\t\tconst uint8_t *buf, size_t size, lzma_check_state *check);\n\n/// Finish the SHA-256 calculation and store the result to check->buffer.u8.", "\nextern void lzma_sha256_finish(lzma_check_state *check);\n\n#endif\n" ]

{ "pile_set_name": "Github" }

[ 0.0009311979520134628, 0.0007157445070333779, 0.0007959513459354639, 0.0008150447974912822, 0.0007752919336780906, 0.0008504915167577565, 0.0038165694568306208, 0.0007774867699481547, 0.0015133230481296778, 0.0021950502414256334, 0.0008229778031818569, 0.001361948437988758, 0.0014635970583185554 ]

[ "\"1,400 years ago, a man born here in Mecca, in Saudi Arabia, changed the course of world history.\" \"", "If you had to rate the top people in the history of the world as leaders, the name of Muhammad would be in the top three.\" \"", "Here we have a man who began a mission.\" \"", "He gave light to the world.\" \"", "For one and a half billion Muslims, he is the last and greatest of that long line of prophets who have brought the word of God to humanity.\" \"", "He was not just a spiritual genius, but he also had political gifts of a very high order.\" \"", "He laid the foundations for a religion, Islam, that after his death developed a culture and civilization that spread around the world and inspired some of the most beautiful architecture.\" \"", "But today, Islam is at the very heart of the conflict that defines our world, and Muhammad's name is associated with some of the most appalling acts of terrorism the world has ever seen.\" \"", "Osama Bin Laden and others who have committed acts of Jihad terrorism\" \"Osama Bin Laden and others who have committed acts of Jihad terrorism consistently invoke the Qur'an and Muhammad's example to justify what they are doing.\" \"", "Obedience to one true God, Allah, and follow in the footsteps of the final prophet and messenger, Muhammad.\" \"", "Outside the Islamic world, almost nothing is known about Muhammad, whereas for Muslims, he is the ultimate role model, and his life is known in every detail.\" \"", "So, who was he?\" \"", "What was his message?\" \"", "And why are so many people, Muslims and non-Muslims, divided over his legacy?\" \"", "In this groundbreaking series,\" \"I will explore the many complexities of his life story, about the revelations he is said to have received from God, about his many wives, about his relations with the Jews of Arabia, about his use of war and peace,\" \"and about the laws that he enacted when he set up his own state.\" \"", "I want to examine his life and times and understand how they still affect today's world, and whether they are a force for good or evil.\" \"", "I want to uncover the real Muhammad, the Prophet of Islam, peace be upon him.\" \"", "Muhammad was born in Mecca in the year 570, into the ruling tribe of the city, the Quraysh.\" \"", "According to Muslim tradition, at the age of 40,\" \"Muhammad received a revelation from God, the first of many that would later become the Qur'an, the sacred text of Islam.\" \"", "He preached a new message that Allah was the one God, that he, Muhammad, was his messenger, and that all human beings would account for their behaviour on the Day of Judgement.\" \"", "He slowly built up a small band of followers, from his family, friends and the marginalised sections of Meccan society.\" \"", "But it was not a message that was always welcome.\" \"", "Right from the start, Muhammad's new message brought him into conflict with the rulers of Mecca - his own tribe, the Quraysh, who saw him as a direct threat to their control of the city.\" \"", "By the time of Muhammad's birth, the Kaaba had long been a shrine drawing people to the town of Mecca, the centre of pagan cults for the people of Arabia.\" \"", "For 13 years, Muhammad and his small band of followers endured increasingly brutal persecution at the hands of the Quraysh, until they were forced to leave Mecca and begin a new life in the city of Medina.\" \"", "Muhammad's new-found power at the head of Medina's Jewish and pagan tribes threatened the Quraysh's status as Arabia's pre-eminent tribe.\" \"", "Several times, they tried to crush Muhammad and his followers by force.\" \"", "In the final battle, it's alleged that one of Medina's Jewish tribes switched allegiances, and in retaliation, all the Jewish men of that tribe were massacred on charge of treason.\" \"", "It was one of the most controversial incidents in Muhammad's life.\" \"", "With the ending of the siege of Medina,\" \"Muhammad had overcome the most powerful Arab army ever assembled against them and, once again, he had humiliated his Quraysh opponents.\" \"", "He had seen off all local opposition to his rule and, what's more, he'd ensured the survival of the Muslim community here in Medina.\" \"", "He was by now arguably the most powerful man in all of Arabia.\" \"", "The revelations Muhammad received would go on to form the Muslim holy book, The Qur'an.\" \"", "They came to him throughout his life, and every time they occurred, it was a terrifying and exhausting experience.\" \"", "He frequently had to struggle to make sense of them.\" \"", "Some came as words, others as visions that needed intense concentration to understand their meaning.\" \"", "He would always say that \"never once did I receive a revelation\" \"\"without feeling that my soul had been torn from my body.\"\" \"", "He'd go pale, and he'd sweat, even on a cold day.\" \"", "It's an effort to speak the word of God.\" \"", "For me, the Prophet has got that sort of terrifying, brief access to divine power, and he is using that consciousness that sort of flooded into his body, and creating the words.\" \"", "Muhammad is born into an age where it is taken for granted that the veil which obscures the dimension of the heavenly, the dimension of the angelic, can be penetrated by men of peculiar vision or holiness, and this is taken for granted\" \"by Christian, Jewish and Zoroastrian holy men.\" \"", "And it's why people are able to accept his assurance that he is receiving revelations from God.\" \"", "It is why they are able to accept it.\" \"", "This kind of spiritual experience is not normally associated with Islam.\" \"", "One Muslim group, though, the Sufis, claim to try to replicate Muhammad's mystical experience of God through intense prayer, the chanting of God's name and singing verses from the Qur'an.\" \"", "TRANSLATION:\" \"When Prophet Muhammad was saying his prayers, while he was mediating and communicating with God, he used to hear the divine instructions and then act.\" \"", "That's why in Sufism, and in Islam, we also try to come close to God.\" \"", "Through our rituals, we try and be one with Him.\" \"", "Prophet Muhammad is an example of this.\" \"", "Whatever he did during his prayers or during his daily life is there for us to take example.\" \"", "The Sufis have developed their own elaborate rituals and techniques and, here in Turkey, they even dance.\" \"", "Although there is no evidence to suggest that Muhammad followed these rituals, the Sufis see him as an inspiration for their spiritual experience.\" \"", "The Prophet as a perfect human is very much a part of both theological and Sufi traditions in Islam.\" \"", "His perfection lies in the fact that it is only through him that one can know God.\" \"", "At the centre of the ceremony is the practice of zikr, or the repeated lyrical chanting of God's name, to bring people closer to God.\" \"", "CHANTING MALE VOICE SINGS\" \"The chanting is followed by a particularly Turkish Sufi practice to induce a trance-like condition through dance.\" \"", "Every religion generates its own diversity of spiritual practices.\" \"", "Islam is no exception.\" \"", "We have a number of different spiritual traditions, of which Sufism is but one.\" \"", "Now, the Prophet prayed, he meditated, he contemplated, but he also said, \"Pray, but tie your camel\".\" \"", "That means praying itself is not good enough.\" \"", "You have to do good.\" \"", "You have to create a healthy, better society at the same time.\" \"", "Anybody who follows this spiritual tradition and does good, and the emphasis on doing good is very, very important, is, in fact, following the way of Muhammad.\" \"", "But Muhammad's spiritual experiences were firmly rooted in the practical necessities of life.\" \"", "He was not someone who retired from the world, but worked continually to reform Arabian society.\" \"", "Instead of simply waiting for paradise at the end of the world,\" \"Muhammad tried to create his own ideal society in his own lifetime.\" \"", "By 627AD Muhammad had become a powerful ruler in Medina, but by all accounts, in his personal habits and way of life, he remained modest.\" \"", "He continued to live next to his small mosque that served both as a place of worship and a centre for his work.\" \"", "Everyone was free to enter and speak with him\" \" Jews, Christians, non-believers, even slaves.\" \"", "Reading the accounts, it is clear he is a very charismatic figure.\" \"", "He is a person that numerous people came to for advice.\" \"", "Constantly came for advice.\" \"", "But it was not just that he was dispensing sage advice, he was always listening to people.\" \"", "He comes out as a very humane and warm person.\" \"", "I think Muhammad does come across in many different contexts as being quite gentle, quite reluctant to find fault.\" \"", "He seemed a very fair individual.\" \"", "Muslim sources talk of his simple taste in clothes and his dislike of gold or silk or other luxuries.\" \"", "He did not care for possessions and gave much away in charity or as gifts.\" \"", "I haven't personally detected any sign that Muhammad was guided by power.\" \"", "I think his integrity remained intact.\" \"", "He was scrupulous over any corruption or financial issues.\" \"", "I think he stood out as a kind of exemplary human being who could combine that moral vision with the requirements of being a leader of a growing organization.\" \"", "He is a searcher.\" \"", "A searcher for truth and understanding throughout his life, and he's a man who used the magic of his own language.\" \"", "He was a genius of the Arab people, infused it with something worldwide, to make something that humankind could understand.\" \"", "Muhammad received revelations throughout his life, but between Mecca and Medina their content changed significantly.\" \"", "Whereas in Mecca the revelations dealt with inward principles of spirituality and faith, here in Medina the revelations would be far more practical.\" \"", "They provided a blueprint for how one should live life on a day-to-day basis as a Muslim, from the social to the political - a blueprint that many Muslims try to follow today.\" \"", "Whilst in Mecca, he is very much a religious preacher.\" \"", "He talks much more about issues such as the end of time.\" \"", "You know, it's about morality, about justice and these kinds of things.\" \"", "Once he moves to Medina, he is the functioning leader of a community.\" \"", "He therefore has to get much more involved in the day-to-day running of a community, how people interact with each other, how people manage inheritance, how people greet each other, even.\" \"", "The revelations could be quite explicit - all Muslims should pay a tax to support the sick and needy.\" \"", "Or they could be general guidelines about how to treat others to promote justice and human dignity.\" \"", "Muhammad used these principles in deciding matters brought to him as the ruler of Medina.\" \"", "Over time, a moral code was revealed to Muhammad, based on ideas of social justice for all.\" \"", "In the Qur'an, it was called Sharia or 'the way to know God'.\" \"", "We have three verses where the concept is revealed in one way or another, in one form or another.\" \"", "And, in fact, what was understood by the Prophet and his companions is that what they were trying to implement was, in fact, this way towards God.\" \"", "So, this is why we have a problem of defining the word because the scholars afterward defined Sharia as God's law, but because they were jurists, so for them Sharia is all about law.\" \"", "But what he was doing is just promoting, you know, brotherhood, justice, equality, freedom.\" \"", "This is Sharia, in fact.\" \"", "What is known today as Sharia law, the sacred law of Islam, is very different.\" \"", "It only came into existence two centuries after Muhammad's death, when Muslim legal experts devised a legal code to help run the ever-expanding Islamic Empire.\" \"", "They used a mixture of Qur'anic teachings and examples from Muhammad's life.\" \"", "Many Muslims now regard that version of Sharia as the unalterable law of God.\" \"", "The underlying principles of Islamic law appear in the Qur'an, and there are detailed regulations relating to very specific areas, such as inheritance, which you do find in the Qur'an.\" \"", "But the Sharia itself is a human edifice constructed over time.\" \"", "It's man's attempt to understand God's will and implement it.\" \"", "But there are divergent views within the Sharia, there are contradictory rulings, and so it is certainly not a code sent down directly from God.\" \"", "It's something much more flexible and fluid, and adaptive to circumstance.\" \"", "In Medina, Muhammad made many radical changes to the customs of his tribal past.\" \"", "He abolished the brutal tradition of blood feuds.\" \"", "Women acquired a share in inheritance and secured rights to own property.\" \"", "But the Qur'an also ordered more traditional penalties, such as the amputation of limbs for stealing, although there is no evidence that Muhammad ever did this.\" \"", "Many of these punishments still form part of Sharia law today.\" \"", "There was the practice of female infanticide in 7th-century Arabia.\" \"", "So, if you had a daughter and didn't want to take care of her for 13 or 15 years, until someone's going to marry her, you toss her out into the desert and she would die.\" \"", "Muhammad put an end to that.\" \"", "Muhammad put an emphasis on helping orphans and widows.\" \"", "We would look at that and say, great, that's a great teaching.\" \"", "But, certainly, we find many teachings that we would consider barbaric by today's standards.\" \"", "Stoning of adulterers and adulteresses, chopping off body parts of those who steal things.\" \"", "These are certain things I would regard as backwards.\" \"", "Today, because we are facing the West, because we are having a very narrow understanding, we come with something that Sharia is, how we are going to implement very narrow understanding of what a marriage is, of what punishments are,\" \"and I think that this is not the way.\" \"", "And this is why I am saying today if I am speaking about Sharia,\" \"I live in the West and in the West, we have laws where you and me, we are equal before law.\" \"", "This is my Sharia.\" \"", "This is where we have to come with a better, a deeper understanding of the very essence of Sharia.\" \"", "Some Muslim states, such as Saudi Arabia and Iran, base their entire legal system on Sharia law, with punishments that many regard as medieval in their brutality.\" \"", "So, calls by Muslim extremists to introduce Sharia law in Europe and in Britain have led to street protests and the rise of political parties campaigning against what they see as the spread of Islamic influence.\" \"", "This is the problem - that in the 21st century, we still have nations who are beheading people, who are cutting the limbs off people, cutting the hands and feet.\" \"", "There are women today being stoned to death by the government for sexual violations, not for murder.\" \"", "It's not for a crime of taking someone else's life.\" \"", "It's an inhumane way of killing.\" \"", "All these people who are stoning the people and are just starting with punishments say this is Sharia.\" \"", "I say no, that's not Sharia.\" \"", "This is the way you are instrumentalising religion for your own sake.\" \"", "I have one question.\" \"", "How have you been elected?\" \"", "Are you elected?\" \"", "Are you representing the people?\" \"", "Let me start with the first question because you have no legitimacy, no way for you to implement this in the name of Islam, if you are not legitimate.\" \"", "Many of the people who do, and start with this, are not really elected, and are not chosen by the people, so their own status, it's important.\" \"", "And then there is a second question, what about social justice?\" \"", "What about equal rights?\" \"", "What about education?\" \"", "Are you going to punish people without educating them?\" \"", "Is this Islam?\" \"", "No.\" \"", "Islam is starting with education.\" \"", "And as for the punishment, it's another story.\" \"", "Don't start with punishment, start with dignity and rights.\" \"", "Not with punishment, because punishment is the way you instrumentalise religion just to make yourself be legitimate while you are not.\" \"", "Like all law, Sharia law, at least in theory, is supposed to be a changing, evolving institution, but what we have under the rubric of Sharia law today is actually frozen in history.\" \"", "It is the interpretations of jurists undertaken during the 8th and 9th century.\" \"", "That is what we call Sharia law.\" \"", "That's why wherever Sharia law is implemented it recreates the conditions of the 8th and 9th century.\" \"", "What the Muslims need to do is to reformulate Sharia law, and this reformulation has to be continuous and constant.\" \"", "Because the word Sharia itself means \"the way to the watering hole\".\" \"", "Why do you go to the watering hole?\" \"", "To drink water.\" \"", "It is something that we need to drink all the time.\" \"", "That means it has to be refreshed, rethought and reformulated from epoch to epoch.\" \"", "It was now 627 AD.\" \"", "Muhammad had a secure power base in Medina.\" \"", "Although he had frustrated all the efforts of his enemies, the Quraysh, to destroy him, they were still powerful and in control of Mecca.\" \"", "If Muhammad was to succeed in bringing his message to all the people of Arabia, he had to find a solution to break this stalemate.\" \"", "One of the key lessons from the battles for Muhammad was that he was going to find it very difficult to overcome the Meccans militarily.\" \"", "He had to try to undermine them politically.\" \"", "What he needed was to strike alliances with other tribes across Arabia.\" \"", "And one of the key ways of doing this was through marriage.\" \"", "For Muhammad's critics, his polygamous marriages have always been a problem.\" \"", "But at that time in Arabia, polygamy was the norm, and it wasn't until after the death of his first wife that Muhammad had several wives at the same time.\" \"", "Some accounts say nine, others 11 or 13.\" \"", "Some were widows.\" \"", "Some were women captured after battles who, by marrying him, were granted their freedom.\" \"", "One was even a Christian Coptic slave presented to him by the Byzantine ruler of Egypt.\" \"", "But his most controversial marriage was to the daughter of his closest companion, a young girl called Aisha.\" \"", "According to some sources,\" \"Aisha is supposed to have been betrothed at age six or seven, then formally married at nine.\" \"", "Other accounts make her older, nearly 16 or 17.\" \"", "It's this lack of clarity that has left Muhammad open to serious condemnation from many critics.\" \"", "If you are a 53-year-old man, and you take a nine-year-old girl into your bed and consummate the marriage, it is not all right.\" \"", "Not only from the standpoint of 21st-century morality of the Western world, but of, what one might say, natural morality of most societies, most of the time.\" \"", "My position on this is that she was older.\" \"", "She was between 16 and 18, and not six and nine.\" \"", "So these are scholars of today, but not today, in fact last century, trying to get a sense of that might be.\" \"", "We are repeating this, but this is not really true, it is not something which is in the Qur'an, is in the prophetic tradition, and we have to check about this, and I would say that age here is problematic in itself.\" \"", "Muhammad's marriage to Aisha lasted till his death.\" \"", "And she later became a prominent political leader in her own right.\" \"", "Muslim historians claim that it was her differences with Muhammad's cousin and son-in-law Ali that eventually led to the great schism in Islam between the Sunni and the Shia sects.\" \"", "The real point in this, and that is lost in all this argument, is who was Aisha - what did she become?\" \"", "She grew up in the Prophet's household to become a really feisty, independent, intelligent, politically aware woman.\" \"", "And she is a foundation of our understanding of the Prophet's life.\" \"", "Without Aisha, half of what we know of the Prophet disappears.\" \"", "A series of further revelations defined Islamic marriage.\" \"", "They also provided Muhammad's critics with more ammunition, as they said that while Muhammad was allowed to keep all his wives, in future, Muslim men would only be allowed a maximum of four wives, as long as they could support them and treat them all equally.\" \"", "We have to understand the Prophet Muhammad in the context of his time.\" \"", "Pagan Arabia is a place where there is unlimited polygamy, that is the normal practice.\" \"", "Islam comes, and limits that polygamy.\" \"", "For Muslims, it is limited to four wives.\" \"", "The Prophet is allowed, and the Prophet is previously married up to nine wives.\" \"", "He is also prohibited from adding any more to that number, but those wives that he is married to, he is allowed to keep.\" \"", "And there is a simple reason for that - the importance of building tribal alliances.\" \"", "This is very, very important.\" \"", "The Prophet is not only a prophet, he is a leader of his people and building those alliances is hugely important.\" \"", "Now, the justification for Muhammad having more wives is sura 33:50, which gave Muhammad, and only Muhammad, permission to marry as many women as he wanted to marry, and we have to be somewhat sceptical.\" \"", "So many people have claimed to be prophets, when we look at a prophet and his revelations give him more sexual partners than anyone else is allowed to have, I say we have some reason for suspicion here.\" \"", "It would be entirely mistaken to imagine the Prophet basking decadently in a garden of earthly delights.\" \"", "These are political marriages.\" \"", "He marries Aisha because he wants to bind himself more closely with their fathers.\" \"", "He's creating a new community, not based on tribe or blood, but somehow, this helps to make the transition easier, if you make a marriage link.\" \"", "We know from Muslim sources that some of Muhammad's marriages even caused him problems during his own lifetime.\" \"", "For example, when he married the divorced wife of his adopted son, his enemies spread rumours that it was an incestuous relationship in an attempt to divide the Muslim community.\" \"", "His marriage to his former daughter in law, Zaynab bint Jahsh, when he married her, it's clear that there were protests from the community and people thought that this was a shocking, scandalising kind of thing for him to have done.\" \"", "According to the sources, Muhammad faced another marital crisis when Aisha went missing during a journey.\" \"", "She was eventually found and brought back to Medina by a man who had known her before her marriage to Muhammad.\" \"", "Again, his enemies spread rumours that something scandalous must have happened between them.\" \"", "According to Muslim tradition,\" \"Muhammad himself was at first unsure who to believe, but, eventually, after a new revelation from God, he accepted Aisha's protestations of innocence.\" \"", "At that time in Arabia, adulterers were traditionally stoned to death.\" \"", "This new revelation defined how any future allegations of adultery should be dealt with, and, surprisingly, in complete contrast to the extreme views held by groups like the Taliban.\" \"", "The punishment of stoning to death was borrowed from Christianity and Judaism.\" \"", "From the Old Testament, of course, as we know.\" \"", "In the Qur'an, punishment for having sex outside marriage is lashing 100 times on your backside.\" \"", "Only if it can be proven that four people have seen the act of penetration, which is very difficult to prove.\" \"", "Muhammad's wives lived with him in specially built rooms adjoining the courtyard of his mosque in Medina.\" \"", "It was a very busy public place, and privacy was hard to find.\" \"", "With the continual attempts of Muhammad's enemies to create division, the potential for future scandal was always there, so something had to be done.\" \"", "One day Muhammad received a new revelation that instructed his wives to cover themselves to maintain their modesty.\" \"", "This act of veiling or covering has had a profound effect on Muslim women and, also, how the outside world views Islam's attitudes to women in general.\" \"", "There are injunctions about the Prophet's wives wearing some kind of covering.\" \"", "It's not exactly clear what that covering is, but it's to distinguish them.\" \"", "And this is all part and parcel of the difficult divisions in Medina, because Muhammad's enemies in Medina were using his wives to discredit him and so some kind of distinction needed to be made, but veiling was not for all women.\" \"", "Today, the veil is seen by Islam's critics as symbolic of its attitude to women in general and its desire to oppress them.\" \"", "But the more universal veiling of women did not become an Islamic custom until more than 100 years after Muhammad's death.\" \"", "As far as the religion is concerned, there is a requirement of modesty for both men and women, but how you fulfil that requirement is open to debate.\" \"", "I don't feel I am compromising myself as a Muslim by not wearing the hijab, and I certainly don't not wear it, because I am trying to say that I am not a serious Muslim.\" \"", "You can't judge the seriousness of someone's faith and belief by what they wear.\" \"", "Over the last 20 years, in Britain as in many Western countries, the veil has become a form of identity for many Muslim women.\" \"", "Some just cover their hair, others their entire face.\" \"", "It is a controversial issue, with some European countries now banning women from using the veil.\" \"", "Fatima Barkatullah is a writer on Islamic women.\" \"", "Fatima, are you wearing the veil because you are obliged to because of your family, or do you do it out of free will?\" \"", "For me it is absolutely 100% free will.\" \"", "It's very much about a spiritual journey and about wanting to be the best I can be, in God's eyes.\" \"", "When I'm getting ready in the morning to go out,\" \"I will just cover what I would normally be wearing, you know, whether it's jeans or whatever I am wearing, with something like this.\" \"", "Which is a gown, essentially, isn't it?\" \"", "Yes.\" \"", "It's an outer garment.\" \"", "People call it the abaya or the jilbab.\" \"", "And then I wear this, which is a khimar, or a scarf.\" \"", "And then I wear this small face veil.\" \"", "This is very much my public face, if you like.\" \"", "But why do you choose to wear the full face covering as opposed to this, the khimar, the scarf, which you see a lot of other Muslim women wearing, as well?\" \"", "I believe that the more modest I can be, the more of a virtue it is.\" \"", "So, essentially, I'm doing it to please God.\" \"", "Where do you think this comes from?\" \"", "Is it in the Qur'an?\" \"", "Is it in the...\" \"Yes, you'll find it in the Qur'an.\" \"", "The verse in Surat Ahzab clearly says, \"O Prophet, tell your wives, your daughters\" \"\"and the women of the believers,\" meaning the Muslim women, when they go out of their homes they should wear their outer garments, and the word in Arabic is jalabeeb, which has two orthodox interpretations.\" \"", "That's the point.\" \"", "This is all an interpretation.\" \"", "There isn't anywhere in the Qur'an which says it is a rule for Muslim women that they must wear a veil.\" \"", "It's in the interpretation.\" \"", "As far as the face is concerned, there is some difference of opinion.\" \"", "The one verse that specifically does deal with clothing actually says cover your nakedness, not shroud yourself in a black bag.\" \"", "Now, Muslim women have interpreted it,\" \"Muslim men have interpolated practices from other societies into the interpretation of the religion, and identity politics has a great deal to do with it.\" \"", "But I say women should be free to choose, but there is no compulsion, and there is no requirement for them to veil themselves.\" \"", "Despite the best efforts of his enemies to discredit him through his marriages,\" \"Muhammad had used them to confirm and widen his power base in Arabia.\" \"", "He could now turn his attention again to Mecca.\" \"", "In early 628 AD, he told his followers that they were going to set out to perform the annual Hajj rites at the Kaaba in Mecca.\" \"", "For Muhammad and his followers, the Kaaba had become central to their worship, the place to which they turned in prayer.\" \"", "They believed it had been originally built by the Prophet Abraham, and regarded it as the ultimate symbol of their faith, the unity of the one God, Allah.\" \"", "But access to the Kaaba was controlled by Muhammad's enemies, the Quraysh, the rulers of Mecca.\" \"", "It contained shrines to the hundreds of gods worshipped by all the tribes in Arabia.\" \"", "Muhammad was now determined to challenge their control of this sacred shrine.\" \"", "The Prophet announces that he is going to make the Hajj.\" \"", "It must have been astonishing because on the Hajj you are not allowed to carry weapons.\" \"", "He was going unarmed into the enemy territory.\" \"", "It's when, again, you touch the magic of Muhammad as a man.\" \"", "He fought wars and now he just said, right, we're off to pray to God.\" \"", "Muhammad and the convoy of followers were forced to stop here at Hudaibiya, which is about eight miles outside of the Holy City, because the Quraysh had reacted with characteristic aggression and they had sent a cavalry in order to stop the convoy.\" \"", "And so began a series of frenetic negotiations with emissaries going between Muhammad and the Quraysh.\" \"", "They eventually arrived at an agreement, but the so-called Treaty of Hudaibiya, signed at a spot marked by the mosque just behind me, looked like the most humiliating of compromises for Muhammad.\" \"", "The Quraysh insisted that Muhammad and his followers return to Medina without performing the Hajj rites.\" \"", "They also insisted that all raids on Meccan caravans by the Muslim forces under Muhammad's command should stop.\" \"", "In return, they would allow Muhammad and his followers to return to Mecca as pilgrims to perform the Hajj, but only in the following year.\" \"", "And when it came to signing the documents which describes Muhammad as \"the Messenger of God\", the Quraysh emissary objected, saying that to them he was only \"Muhammad, the son of Abdullah\".\" \"", "For Muhammad's followers, this was an unbearable insult.\" \"", "According to Muslim tradition, when Muhammad's young cousin Ali, who was doing the writing, heard this he refused to strike out the words \"the Messenger of God\".\" \"", "Muhammad says, \"Give me the pen\" - point out the words \"Messenger of God\", and he strikes it out himself.\" \"", "I see it as a striking out of ego there, not standing on your rights.\" \"", "The Qur'an says that if the enemy asks for peace you must lay down your arms immediately and accept any terms, however disadvantageous.\" \"", "For Muhammad's followers, the terms of this treaty, and the treatment of Muhammad, were completely humiliating.\" \"", "It was only Muhammad's adamant attitude that kept them from mutiny.\" \"", "What Muhammad was trying to do was totally unheard of in 7th-century Arabia.\" \"", "In a society of honour, traditionally, blood feuds ruled the day.\" \"", "But after years of bloody but inconclusive conflict, Muhammad now wanted to defeat his enemies not through war, but by peace.\" \"", "By signing a truce with the Quraysh, he had not only gained access to the Kaaba, albeit at a later date, but also extracted from them the crucial acknowledgement that he and they were now equals.\" \"", "In a sense, the Hudaibiya does represent a minimal option, which is,\" \"OK, we can't get what we want now, but we can get it in the future, if we make this agreement.\" \"", "And a truce in which people were not fighting was always preferable to war.\" \"", "This is, again, something which is Qur'anically given, that, you know, peace is better than war.\" \"", "It's repeated again and again.\" \"", "So, it very much fits within that particular type of principle.\" \"", "As he and his followers were returning to Medina,\" \"Muhammad received a new revelation, confirming that the Treaty of Hudaibiya was a not a humiliating defeat.\" \"", "He said, \"I've just had a revelation.\" \"", "This was a manifest victory, says God.\" \"\"", "It may have looked like a defeat, but it was a manifest victory.\"\" \"", "The Quraysh were filled with all the violence of the old tribal spirit.\" \"", "They were filled with contempt and pride.\" \"", "It was the Muslims, the spirit of peace that filled their hearts.\" \"", "Sometimes this is forgotten.\" \"", "We hear all about Muhammad's wars, but we forget this extraordinary, non-violent offensive.\" \"", "After Hudaibiya, the tide had turned in his favour with a campaign of non-violence.\" \"", "A primary vehicle that Muhammad did use was diplomacy at the time.\" \"", "He went out, visited the tribes, engaged with major religious leaders, attempted to form pacts, created, if you look at the community at Medina, created a space for other faiths and other people.\" \"", "But when faced with resistance or aggression, did exactly what the standards of the time would have legitimated.\" \"", "And I think that that is clearly there.\" \"", "You do not see the Prophet consistently calling for wholesale killing of all those who disagreed with him.\" \"", "The Treaty of Hudaibiya marks a turning point in Muhammad's attempts to spread his message throughout Arabia.\" \"", "But it also shows that he was prepared to suffer the utmost humiliation from his worst enemies in pursuit of peace.\" \"", "And yet in today's world, the most commonly held views of Muhammad is that he is the enemy of peace, and that Islam is the religion of Jihad, commonly taken to mean \"Holy War\".\" \"", "Thousands have been killed all over the world by groups that are now called Jihadi, a term never used in Muhammad's time.\" \"", "And yet, these groups all claim the Qur'an and Muhammad himself as inspiration and justification for their actions.\" \"", "It is very clear, brothers and sisters, that the path of Jihad and the desire for martyrdom was deeply embedded in the Holy Prophet and their beloved companions.\" \"", "Most so called Jihadis usually refer to a verse in the Qur'an, now known as the Sword Verse, as justification for their violent acts.\" \"", "If you come back to the Qur'an, you have these verses, no one can deny that there are verses very, very much dealing with war and violence.\" \"", "Now, as we have to deal with the Qur'an, it's an eternal book dealing with history.\" \"", "These verses were revealed in a very specific period of time when the Muslims were under oppression and trying to resist and just to survive.\" \"", "So, we have to contextualise this.\" \"", "The mainstream classical tradition, in the Shia and the Sunni tradition, are saying you can't use these verses just to promote war and to kill innocent people, this is wrong.\" \"", "The interpretation of individual Qur'anic verses goes to the heart of this controversy, but most scholars now agree that the term Jihad does not mean Holy War.\" \"", "Its real meaning is completely different.\" \"", "The concept of Jihad emerges out of the Holy Qur'an, out of the revelation that the Prophet receives.\" \"", "And there are about 35 examples in the Qur'an of the word \"jihad\", or the term basically being used, and often in the case of striving.\" \"", "Now striving can be all sorts of things.\" \"", "It can be striving against the baseness of oneself.\" \"", "It can be a seeking to overcome evil and being good.\" \"", "It can be striving in the sense of fighting.\" \"", "But Jihad is always distinguished from fighting, and a different terminology is used for the word \"fighting\".\" \"", "In all the battles that Muhammad fought, the rules of engagement were always carefully delineated within the context of his time and what was generally acceptable.\" \"", "But there are no recorded instances of deliberate attacks on civilian populations.\" \"", "One of the points about Jihad in the early Islamic tradition, both in the Prophet's lifetime and afterwards, is that it's is a gradual evolution of an idea towards something like a just war.\" \"", "And the just war is a constraint on the army, does not attack or massacre the civilians, doesn't kill women or children, doesn't kill priests of other religions incidentally, and so on.\" \"", "And this draws on the practice in the lifetime of the Prophet.\" \"", "These rules of engagement appear to have been forgotten by today's Muslim extremists.\" \"", "Suicide bombers kill people not only in Western cities, but also in mosques and other places of worship in the Muslim world itself.\" \"", "In Britain today, no Muslim activist or group will openly defy the law by accepting or agreeing to the use of violence.\" \"", "But over the last 10 years, more than 200 Muslims have been convicted of terrorist-related offences.\" \"", "In 2008, Abdul Muhid was convicted and jailed for two years for terrorist funding.\" \"", "Mizanur Rahman was charged for soliciting murder and jailed for four years in 2006.\" \"", "Both have now served their sentences, but still have strong views about the role of Jihad in today's world.\" \"", "Has the modern interpretation of Jihad changed in any way?\" \"", "Because, for most people today, Jihad means just one thing doesn't it, it means fighting and the physical struggle?\" \"", "The scholars of Islam in the past, they all agreed that Jihad means fighting against the non-Muslims, yes, but not just for the sake of forcing them to be Muslim, but to make the word of Allah\" \"the highest by removing obstacles from the implementation of the Sharia and for the call to Islam to spread across the world.\" \"", "From your interpretation of the Prophet's life, is it permittable at any time in Jihad to attack non-combatants?\" \"", "If I just cut straight to the point, the argument of Islamic terrorists is this, if you choose a government that represents you and they decide to bomb a country or kill people, then you have blood on your hands.\" \"", "It's like hiring, for example, a murderer.\" \"", "If I pay a murderer to go and kill someone it's not just the murderer who is blameworthy.\" \"", "I share that blame.\" \"", "So, if you say by non-combatants, these people voted for a government that is carrying out crimes, then they share the blame.\" \"", "And, obviously in the eyes of the Islamic terrorists, they are blameworthy.\" \"", "These ideas are abhorrent to Muslims and non-Muslims, and would have been unrecognisable to Muhammad.\" \"", "For him, the concept of Jihad was not just simply about killing and war, but it was about striving to improve yourself in the eyes of God.\" \"", "There is the concept of just war in Islam, and Muhammad himself fought many battles, but for him, there was no justification of the killing of innocent people.\" \"", "The Qur'an verses that talk about fighting and defending yourself don't legitimize killing yourself deliberately and killing others in that process.\" \"", "Remember, in Islam, collateral damage is not allowed.\" \"", "Intentionally bombing a group of people, assuming that your target would be killed, as well as others and the others would be collateral damage, is completely disallowed in Islam.\" \"", "Muhammad's peaceful Jihad was now about to come to fruition.\" \"", "Under the terms of the Treaty of Hudaibiya he could embark on a journey that would take him back to the city of his birth, the city he had left nearly seven years ago as a refugee, penniless and in fear of his life.\" \"", "He was returning as the head of an ever-expanding religious community, the most powerful leader in Arabia.\" \"", "In February 629, Muhammad agreed with the Quraysh to be allowed back into Mecca in order to visit the Kaaba.\" \"", "The Quraysh agreed to allow Muhammad and his followers into the Kaaba for three days.\" \"", "And yet, during that time, it marked a change in people's perceptions towards Muhammad and his followers.\" \"", "The people of Mecca saw the Muslims enter the Kaaba, and observed how well behaved they were, how sincere they were, and it was important because it showed that slowly but surely, the stranglehold of the Quraysh in Mecca was beginning to crumble.\" \"", "A year later, the Quraysh broke the truce by attacking one of Muhammad's allies.\" \"", "It was a fatal mistake.\" \"", "In January 630, the Prophet gathered a massive army of 10,000 men and marched towards Mecca.\" \"", "The Quraysh were powerless to resist and they fully expected Muhammad to storm into Mecca and exact a bloody revenge for the many years of persecution and war.\" \"", "Their control of city was at an end.\" \"", "But it was what he did next, in this, hour of ultimate victory, that left people stunned.\" \"", "Muhammad declared that he forgave all his former enemies.\" \"", "He then said that there was to be a general amnesty and he said that no-one was to be forced to convert to Islam.\" \"", "Instead of revenge, Muhammad consciously chose reconciliation.\" \"", "The conquest of Mecca is very important, because there was a wide-ranging amnesty given, and people were given options of accepting the faith, or going elsewhere, or whatever.\" \"", "But, certainly, there was this notion that, OK, once Mecca is taken, and Mecca is considered to be the cultic centre now of this new faith, that certainly the first stage of the mission is complete, so there's no need for fighting.\" \"", "For Muhammad, this was the moment he had been waiting for.\" \"", "He had come back to Mecca not to kill the Quraysh, but to restore the Kaaba to its role as the sacred shrine to the one God.\" \"", "According to Muslim tradition, when he and thousands of his followers entered the Kaaba they destroyed the many gods and effigies placed there.\" \"", "He pardons the Meccans, but he doesn't just pardon them, he pardons them with kindness and he almost drowns their criticisms with gifts.\" \"", "And there is that sort of wonderful instance of just the tribal sheiks, who had never really opposed and never listened to his message, all they wanted was cattle, more camels and more silver, and he gives it to them.\" \"", "It seems to me that's the heart and the essence of the life of the Prophet.\" \"", "The moment it was building to.\" \"", "From what I understand and know of the personality of the Prophet, it is the most characteristic moment in his entire life.\" \"", "He was not a vengeful man.\" \"", "His message was not about vengeance, but about constructing a transformative, reformative process, building society by including everybody.\" \"", "So, it seems to me that when he came back to Mecca, that's when I say, yes, that's the point from which we begin, that's the model we need to build on.\" \"", "And then he goes home.\" \"", "There is no attempt to impose what we'd call today an Islamic state.\" \"", "So, we're not talking about doctrinal conformity, we're talking about ending this tribalism which sets people off against one another.\" \"", "Although Mecca was now his, Muhammad chose not to move back to the city of his birth.\" \"", "Instead he returned to his adopted home, Medina.\" \"", "And with the Quraysh defeated, it wasn't long before the rest of Arabia joined his cause.\" \"", "Muhammad's bloodless conquest of Mecca was clear proof that his movement was succeeding.\" \"", "And, what's more, his message of justice and using peace and reconciliation as a means of delivering that message was beginning to attract huge numbers of converts.\" \"", "In fact, tribes were beginning to convert wholesale.\" \"", "By 631, the last pagan stronghold of Taif fell.\" \"", "Now Muhammad was effectively the ruler of the whole of Muslim Arabia.\" \"", "More than 20 years had passed since he had received his first revelation.\" \"", "For over a decade, he and his followers had eked out a precarious existence.\" \"", "Time after time, they had been on the verge of destruction, but they had managed to survive through a combination of Muhammad's spiritual, military and political leadership, and, finally, after a seemingly humiliating treaty, to triumph over their enemies.\" \"", "Muhammad expressed and exemplified the qualities that we now see universally are characteristic of a good leader and a leader for good - enthusiasm, integrity... then the combination of toughness and demandingness and fairness is important in leaders universally,\" \"and Muhammad had all those attributes very clearly.\" \"", "I think warmth, humanity, kindness is important, too.\" \"", "And, again, if you look at the traditions of the life of Muhammad, there are plenty of examples where he showed those humane qualities.\" \"", "By the year 632, Muhammad had achieved almost all that he had set out to achieve.\" \"", "He created a level of peace and security Arabia had rarely known.\" \"", "He laid out the foundations and rules of Islam and he created the foundations of a new Muslim community.\" \"", "But by this time, he was 60 years old and his health was beginning to fail.\" \"", "In that year, he came to Mecca for the last time and he performed his first and only Hajj, The Pilgrimage, and he gave what would become known as the \"farewell sermon\".\" \"", "Sitting here on a camel, on the Plains of Arafat, he spoke to a vast crowd with strategically placed announcers relaying his words.\" \"", "It was a deeply emotional speech in which, in his own words,\" \"Muhammad summarised what he felt he and his followers had achieved.\" \"\"", "O People!\" \"", "Lend me an attentive ear,\" \"\"for I know not whether after this year I shall ever be amongst you again.\" \"\"", "Therefore, listen carefully to what I am saying and take these words\" \"\"to those who could not be present here today\".\" \"", "You see in the final sermon this heartfelt plea from the Prophet warning the Muslims about certain things, advising them about certain things.\" \"", "You can see his worries for the future of the Muslims and these words are something that they should take note of, and they should hang onto, and they should be aware, because in here is a very, very important message for every Muslim.\" \"\"", "Do not therefore do injustice to yourselves.\" \"\"", "Remember one day you will meet Allah and answer your deeds.\" \"\"", "So beware - do not astray from the path of righteousness after I am gone\".\" \"", "Remember what God's earliest message was, to Abraham, to Adam, to Moses, to Jesus, etc., ", "and remember that the only real reality, the ultimate reality, is the one true God,\" \"and that God is the creator, sustainer and judge of the universe.\" \"\"", "All mankind is from Adam and Eve.\" \"\"", "An Arab has no superiority over a non-Arab,\" \"\"nor a non-Arab has any superiority over an Arab.\" \"\"", "Also, a white has no superiority over black,\" \"\"nor a black has any superiority over white except by piety and good action\".\" \"", "He is saying all humans are one.\" \"", "God has called you from the tribalism of paganism and it's pride in ancestors, but, remember, all men came from Adam and Adam came from dust.\" \"", "And then he quotes these words from the Qur'an which really speak to our time.\" \"\"", "O, people\", God says to humanity,\" \"\"we have formed you from a male and a female and have formed you\" \"\"into tribes and nations so that you may get to know one another,\" \"\"not so that you may fight, or oppress, or occupy, or convert or terrorise,\" \"\"but so that you may get to know one another.\"\" \"\"", "All those who listen to me shall pass on my words to others,\" \"\"and those to others again, and may the last ones understand my words better\" \"\"than those who listen to me directly.\" \"\"", "Be my witness, O Allah, that I have conveyed your message to your people\".\" \"", "And he asks them, \"O, people, O, Muslims, have I fulfilled my mandate to you?\"\" \"", "And they cry, \"Na'am!\",\" \"\"", "yes\", and it rings around.\" \"", "And he asks them three times, have I, and each time they reply, \"Na'am!\"\" \"", "And I think it's a most moving moment.\" \"", "Well, that's the summation of his life, so he emphasises all the principles that he has been teaching for the last 23 years.\" \"", "He says, for example, there is no difference between Arab and non-Arab, look after your family, so it's kind of summation of his life.\" \"", "If you did nothing else but simply read the last sermon, you will get the essence of the life of Muhammad.\" \"", "The Prophet's final sermon sets the agenda for modern, contemporary Muslim society.\" \"", "It shows were we've failed, and it shows were we have to try to get to.\" \"", "It sums up the transformative mission that was the life of the Prophet.\" \"", "After his farewell pilgrimage,\" \"Muhammad returned to his small house in Medina, exhausted.\" \"", "He'd begun to have headaches and fainting fits.\" \"", "He tried to attend public prayers in the mosque, but was more and more confined to his bed, where Aisha nursed him.\" \"", "One day he appeared to get better and the news spread like wildfire around the oasis.\" \"", "But it was only a brief reprieve.\" \"", "On 8th June, 632, Muhammad died in the house of his wife Aisha.\" \"", "The news stunned his followers.\" \"", "Some refused to accept the truth.\" \"", "Panic began to take hold.\" \"", "How could the Messenger of God be dead?\" \"", "His closest companion, Abu Bakr, calmed their fears, reminding them that Muhammad had never claimed to be anything other than a mere mortal and that only God is to be worshipped, not Muhammad.\" \"", "He was buried here next to his mosque, his face turned towards Mecca, a practice still common today among Muslims.\" \"", "Within 100 years, Muhammad's message had spread across the world, as far as India and China in the east, and as far North Africa,\" \"Spain and France in the west.\" \"", "But, in many ways, his struggle for a peaceful Jihad was already in tatters.\" \"", "Within just a generation of Muhammad's death, his closest companions and family were already squabbling, breaking out into open and bloody warfare that led to the deep schism that still exists within the Muslim world today between Sunni and Shia.\" \"", "But today, Muhammad's message seems under threat like never before.\" \"", "Many Muslims feel humiliated and condemned by the sheer power of Western culture and military might, whilst many in the west see Islam as the religion of some of the most oppressive states on Earth, a violent, intolerant faith.\" \"", "But the question is, how much of this can be blamed on Muhammad himself?\" \"", "Muhammad left the world with three things - his faith in God, the example of his own life and, above all else, the Qur'an itself.\" \"", "Now, people will always choose and highlight those aspects of his life they want to support their own arguments whilst ignoring the rest.\" \"", "But if we examine his life in total, we find that he left Arabia a better place than he found it.\" \"", "When faced with persecution, he chose to suffer rather than to retaliate.\" \"", "Although he fought many military battles, he turned his back on war when he could.\" \"", "His ultimate victory came through peace, not through conflict.\" \"", "And with that victory, he chose the path of reconciliation, rather than revenge.\" \"", "And, finally, in his farewell sermon, Muhammad left us with the most important lesson of all, that we are all equal, Arab and non-Arab, Muslim and non-Muslim.\" \"", "A universal message that is as relevant today as it was in 7th-century Arabia, and it seems to me this is the true legacy of the life of Muhammad.\" \"", "Subtitles by Red Bee Media Ltd\" \"E-mail [email protected]\"" ]

{ "pile_set_name": "OpenSubtitles" }

[ 0.0006101088947616518, 0.0006392151699401438, 0.0006130405236035585, 0.0007663208525627851, 0.025451727211475372, 0.0006905276095494628, 0.0009540179162286222, 0.01833786442875862, 0.0009803364519029856, 0.0037928735837340355, 0.0006608882104046643, 0.0010049237171187997, 0.0007779874140396714, 0.0018332629697397351, 0.0006243866519071162, 0.0006386945024132729, 0.0009414012311026454, 0.0007792821852490306, 0.0007869295659475029, 0.001939831767231226, 0.0018338575027883053, 0.000619206577539444, 0.0018775727367028594, 0.0009152216953225434, 0.0014123477740213275, 0.002126963110640645, 0.002417756011709571, 0.009776187129318714, 0.0008626526105217636, 0.002591980155557394, 0.0007060986827127635, 0.0009054059628397226, 0.0008522834978066385, 0.0005565040628425777, 0.0006109678070060909, 0.0005381715018302202, 0.0008551461505703628, 0.059364333748817444, 0.0008458198281005025, 0.0006646471447311342, 0.0010598449734970927, 0.0005455150385387242, 0.0005892273620702326, 0.0007507631089538336, 0.0007211794727481902, 0.0006269203149713576, 0.000789876445196569, 0.000601898180320859, 0.000798858585767448, 0.0005792485899291933, 0.0006733622285537422, 0.0006593235884793103, 0.0006435699760913849, 0.0007055289461277425, 0.0005931264022365212, 0.0008598615531809628, 0.000742050469852984, 0.0018369611352682114, 0.0005861868849024177, 0.007203630171716213, 0.0008662198670208454, 0.0006751642795279622, 0.0007389645325019956, 0.0006422761944122612, 0.0008064439753070474, 0.0007273773662745953, 0.0008124375017359853, 0.0006395024829544127, 0.0009621874196454883, 0.12913738191127777, 0.0005592405796051025, 0.0005583814927376807, 0.0005929080653004348, 0.0006087143556214869, 0.0006418979610316455, 0.0005765257519669831, 0.0005647102370858192, 0.0035600264091044664, 0.0020855762995779514, 0.000697146519087255, 0.0005527979228645563, 0.0007515602046623826, 0.0005761890206485987, 0.03141415864229202, 0.000739159295335412, 0.0006264682160690427, 0.0005543895531445742, 0.0005288920947350562, 0.0013588842703029513, 0.0009385183220729232, 0.0005591702647507191, 0.000847896037157625, 0.0005793231539428234, 0.0005435038474388421, 0.035457953810691833, 0.0005662298644892871, 0.0005798117490485311, 0.0006999342585913837, 0.0006385989836417139, 0.0005329913110472262, 0.0005815457552671432, 0.000726458034478128, 0.0006200880161486566, 0.0007482465007342398, 0.000655991374514997, 0.0006662856321781874, 0.0006191743887029588, 0.0011621542507782578, 0.0005458127125166357, 0.0006562971393577754, 0.0007506840629503131, 0.0006524871569126844, 0.000575440120883286, 0.0006463268073275685, 0.003094079438596964, 0.015566927380859852, 0.0006896420964039862, 0.0006640668143518269, 0.0023669975344091654, 0.5950366854667664, 0.0021625380031764507, 0.0015204889932647347, 0.0005500351544469595, 0.0007895363960415125, 0.4789750576019287, 0.0006459013093262911, 0.0006565386429429054, 0.000716533453669399, 0.0010410337708890438, 0.0006285656127147377, 0.0007846076623536646, 0.001898838672786951, 0.10143914073705673, 0.5787727236747742, 0.011603851802647114, 0.19142192602157593, 0.005948105361312628, 0.0007281388971023262, 0.02065870352089405, 0.0006147431558929384, 0.0008130253409035504, 0.0008861873648129404, 0.0007137974025681615, 0.0023554516956210136, 0.0005522017600014806, 0.0006236076587811112, 0.0007298808777704835, 0.0008273717248812318, 0.017041059210896492, 0.00831480324268341, 0.0008441177778877318, 0.004931625910103321, 0.0006866018520668149, 0.0008106888853944838, 0.0025011920370161533, 0.0006121609476394951, 0.0005770661518909037, 0.0009099602466449142, 0.0005853137117810547, 0.0014237508876249194, 0.0006970734684728086, 0.004163878969848156, 0.0017828691052272916, 0.0011004165280610323, 0.0005554510862566531, 0.0007139823865145445, 0.0007401090697385371, 0.004318715073168278, 0.0010056816972792149, 0.000995646812953055, 0.0010378961451351643, 0.0014829441206529737, 0.0006440743454732001, 0.001003873418085277, 0.0006534047424793243, 0.0006341474945656955, 0.0007951579755172133, 0.0016434352146461606, 0.002028436167165637, 0.0007471242570318282, 0.0007820361643098295, 0.000712870096322149, 0.0006684891995973885, 0.2423187494277954, 0.0005937324604019523, 0.0006543903728015721, 0.0009809540351852775, 0.0005793921882286668, 0.0005751075805164874, 0.0024807588197290897, 0.0006733814370818436, 0.0013417643494904041, 0.0008113697986118495, 0.0012666108086705208, 0.0006652852753177285, 0.000635922362562269, 0.0005748650291934609, 0.0010701381834223866, 0.0005489638424478471, 0.0007293166709132493, 0.0035629915073513985, 0.007312418427318335, 0.0006044564652256668, 0.0007822809275239706, 0.0005520375561900437, 0.0005799065111204982, 0.0005731065175496042, 0.003931185230612755, 0.010710034519433975, 0.0011473485501483083, 0.0007658303366042674, 0.0006129304529167712, 0.000641918508335948, 0.0007982266251929104, 0.0019431239925324917, 0.0010201407130807638, 0.0006341965054161847, 0.0008453480550087988, 0.0008786938851699233, 0.0006171244313009083, 0.14395813643932343, 0.002748604863882065, 0.04373752325773239, 0.0006144915823824704, 0.7087550163269043, 0.0005610967637039721, 0.0006800346309319139, 0.0006277920911088586, 0.001120436587370932, 0.0010971715673804283, 0.0288317259401083, 0.0007443040958605707, 0.0005829617148265243, 0.0023249646183103323, 0.03387654945254326, 0.013313385657966137, 0.0006566111696884036, 0.0044023883529007435, 0.0006800907431170344, 0.006227696314454079, 0.05302799120545387, 0.010553013533353806, 0.008785421960055828, 0.0077345166355371475, 0.0006242995150387287, 0.0005933260545134544, 0.000700244796462357, 0.0006369593320414424, 0.0006974356365390122, 0.0008744906517677009, 0.0011740716872736812, 0.0006972735282033682, 0.0025418205186724663, 0.009995869360864162, 0.011114301159977913, 0.0005416836938820779, 0.0006575439474545419, 0.0007204784778878093, 0.0008077683742158115, 0.0007070153951644897, 0.0052412147633731365, 0.0008030571625567973, 0.0007366604986600578, 0.025322671979665756, 0.0006391417700797319, 0.0006059699808247387, 0.7072097659111023, 0.0016653054626658559, 0.013042163103818893, 0.0008428149158135056, 0.00206454424187541, 0.0007480557542294264, 0.0008933681529015303, 0.0006844693562015891, 0.001074646133929491, 0.0009817436803132296, 0.0019114400492981076, 0.0009791514603421092, 0.0008936763042584062, 0.0017218358116224408, 0.0016910020494833589, 0.001949041965417564, 0.0018234375165775418, 0.0007742558373138309, 0.0009061646414920688, 0.0009312268812209368, 0.0016783279133960605, 0.0010912539437413216, 0.0006729018641635776, 0.014396876096725464, 0.0007140501402318478, 0.001123616355471313, 0.0014087047893553972, 0.0011009323643520474, 0.0008854551706463099, 0.0012584434589371085, 0.00067344238050282, 0.0009743983973748982, 0.011094728484749794, 0.0006172297871671617, 0.0005733040161430836, 0.0008417146163992584, 0.0020675892010331154, 0.0006878501153551042, 0.0005711235571652651, 0.000871357333380729, 0.0006562620983459055, 0.0007511785952374339, 0.0009442798909731209, 0.0013952238950878382, 0.07026533782482147, 0.0008497284725308418, 0.0007054912857711315, 0.0008262205519713461, 0.0012851487845182419, 0.0005598326097242534, 0.0005960858543403447, 0.001314364024437964, 0.0006100955652073026, 0.01884324662387371, 0.000640866463072598, 0.0028113573789596558, 0.004914228338748217, 0.01921865902841091, 0.0007069588173180819, 0.0006961629842408001, 0.0012535570422187448, 0.0009435482206754386, 0.0006098310113884509, 0.000738851260393858, 0.0005675496067851782, 0.04362122714519501, 0.0006205447716638446, 0.0005967487231828272, 0.0006341496482491493, 0.0005816693301312625, 0.0011914264177903533, 0.000843901070766151, 0.0026736746076494455, 0.0006958114681765437, 0.0006451445515267551, 0.0005984143353998661, 0.0007338550058193505, 0.0007002404890954494, 0.12460840493440628, 0.0006132275448180735, 0.01992199569940567, 0.48216569423675537, 0.0013887281529605389, 0.0015197369502857327, 0.001025961828418076, 0.0015152711421251297, 0.0006117031443864107, 0.0007444800576195121, 0.0006244218093343079, 0.0007303616730496287, 0.0010605226270854473, 0.8180729746818542, 0.018143504858016968, 0.5394039750099182, 0.0008578540291637182, 0.0006154102738946676, 0.10172189027070999, 0.0026321369223296642, 0.007743041031062603, 0.004378214944154024, 0.18348786234855652, 0.0013833085540682077, 0.07426724582910538, 0.0010440486948937178, 0.0025174468755722046, 0.0006463181343860924, 0.0009131947881542146, 0.0009813930373638868, 0.0006184516241773963, 0.0008964856970123947, 0.0016802336322143674, 0.0010764960898086429, 0.0012668564449995756, 0.054863810539245605, 0.0009067042847163975, 0.0006208082777447999, 0.004266943316906691, 0.0030113724060356617, 0.0007108498830348253, 0.0005488610477186739, 0.0007621391559951007, 0.0009999654721468687, 0.004924900364130735, 0.0027958001010119915, 0.011662702076137066, 0.0011574671370908618, 0.0006348592578433454, 0.0006336859660223126, 0.0005731105920858681, 0.00299135223031044, 0.0008544301963411272, 0.0006806340534240007, 0.0057164705358445644, 0.0008988163317553699, 0.0008519137627445161, 0.0008621143060736358, 0.0006461078301072121, 0.0022708489559590816, 0.010277445428073406, 0.0006121615297161043, 0.0006695683696307242, 0.005457159597426653, 0.0013552034506574273, 0.0006069506052881479, 0.0011086361482739449, 0.001002573175355792, 0.0005567916086874902, 0.0005551983485929668, 0.0005689895479008555, 0.0006864200113341212, 0.0006186148966662586, 0.0008288626559078693, 0.0020225930493324995, 0.0010225499281659722, 0.0006393736111931503, 0.0005956360837444663, 0.0030833682976663113, 0.0010859324829652905, 0.0005392893799580634, 0.0006068806396797299, 0.0012816160451620817, 0.057564541697502136, 0.1580236256122589, 0.016659922897815704, 0.000698730640579015, 0.0009673522436060011, 0.004399837460368872, 0.0013128150021657348, 0.002556403400376439, 0.0011214760597795248, 0.005155881866812706, 0.0006110668182373047, 0.044765159487724304, 0.00085435900837183, 0.05050034821033478, 0.019905295222997665, 0.2448853999376297, 0.000620184640865773, 0.0008770176791585982, 0.0005587677587755024, 0.0006144751678220928, 0.0025064453948289156, 0.000920331571251154, 0.0007831936236470938, 0.0010942535009235144, 0.0005861748359166086, 0.0006324572023004293, 0.005563819315284491, 0.0010681923013180494, 0.0007919170311652124, 0.000712146342266351, 0.0016954729799181223, 0.0006248728022910655, 0.0006603653309866786, 0.0014831828884780407, 0.0013898065080866218, 0.0010453619761392474, 0.003910415340214968, 0.0006748982705175877, 0.0006912496173754334, 0.011439521797001362, 0.0011418027570471168, 0.06460585445165634, 0.0009494757396169007, 0.0009392088977620006, 0.0006059954175725579, 0.0005853906623087823, 0.0037230418529361486, 0.001212827512063086, 0.0005974996602162719, 0.0006938549922779202, 0.019648447632789612, 0.0005819116486236453, 0.0006871605874039233 ]

[ "Soft-Tissue Sarcomas: Assessment of MRI Features Correlating with Histologic Grade and Patient Outcome.", "\nBackground Managing soft-tissue sarcoma (STS) relies on histologic grade, which is the strongest prognostic factor and a routine assessment at biopsy. ", "However, underestimation of histologic grade may occur because of tumor heterogeneity. ", "Purpose To identify MRI features that are associated with high-grade STS (grade III) and to determine the relationship between MRI features and patient survival. ", "Materials and Methods In this retrospective single-center study, patients (age ≥16 years) were included if they presented with STS diagnosed between 2008 and 2015, had a baseline contrast material-enhanced MRI study, had a pathologic grade assessed on the whole surgical specimen, and had no history of neoadjuvant treatment. ", "Visceral sarcomas, well-differentiated liposarcomas, and angiosarcomas were excluded. ", "Images were evaluated for size, heterogeneity, architecture, margins, and surrounding tissue at T2-weighted, T1-weighted precontrast, and T1-weighted postcontrast MRI. ", "χ2 tests, Fisher tests, and multivariable binary logistic regression were performed to identify features associated with a final grade of III. ", "The associations between combinations of these features and overall survival and metastasis-free survival were investigated with Kaplan-Meier curves and multivariable Cox models. ", "Results A total of 130 patients were included (53 women [mean age ± standard deviation, 60.7 years ± 19.2]); 72 of the 130 (55.4%) STSs were grade III. ", "At multivariable analysis, three MRI features were associated with grade III STS: peritumoral enhancement (odds ratio [OR], 3.4; P = .003), presence of an area compatible with necrosis (OR, 2.4; P = .03), and heterogeneous signal intensities greater than or equal to 50% at T2-weighted imaging (OR, 2.3; P = .04). ", "The presence of at least two of these three features was an independent predictor of metastasis-free survival (hazard ratio, 4.5; P = .01) and overall survival (hazard ratio, 4.2; P = .04). ", "Conclusion MRI features including necrosis, heterogeneity, and peritumoral enhancement of soft-tissue sarcomas were associated with grade III tumors, metastasis-free survival, and overall survival. ", "© RSNA, 2019 Online supplemental material is available for this article." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007072226144373417, 0.0008874852210283279, 0.0006555847940035164, 0.0005675001302734017, 0.0005680520553141832, 0.009191908873617649, 0.0005665910430252552, 0.0007167540607042611, 0.0006314949714578688, 0.0006208422710187733, 0.0005829008296132088, 0.0006063169566914439, 0.0007682321593165398, 0.0005653799162246287 ]

[ "On Monday morning in the Mini Transat, a number of the competitors have returned to the village to watch over their boats and learn about the general mood of the race ... A small minority chose to remain on site over the weekend, dividing their time between tourist visits around the area and physical activity to maintain their fitness.", "\n\nDouarnenez Courses has taken advantage of this waiting time to review the activities of the ten days before the theoretical start date of October 13. ", "It is estimated that more than 25,000 visitors came to the village to honour the competitors, the event partners and the Mini Class, there were over thirty exhibitors on the 3000 m2 site, and the installation of the Mini Transat in Port Rhu has been declared a success. ", "To this must be added the interest aroused by the exhibition organised within the Port Musée, the strong mobilisation of volunteers and all the primary school classes that came to the village to visit the sailors as part of Operation Label Bleue.", "\n\nIt is now a week since the Mini fleet began to pace the docks of Port Rhu. ", "Overall, the sailors are coping well and are in good heart despite being faced with exceptional weather conditions. ", "To stay in the game, many competitors have not hesitated to take up various physical exercises such as jogging and stretching; anything to keep themselves in good shape. ", "Others took the opportunity to finish a few things. ", "Aboard Pas de Futur sans Numérique, Ian Lipinski took delivery of some additional electronic equipment that he has been able to add to his instrument panel. ", "This is also the time for fairing: compressed air bottles are shared and the sandpaper is at the ready, the aim being to remain mobilised without consuming too much energy.", "\n\nThe days go by and everyone looks to the Bay of Biscay. ", "The entire fleet is watching for the winds to switch to the west or northwest. ", "But the center of the low pressure remains positioned to the south and this is generating very strong southwest winds from the tip of Spain to the tip of Galicia. ", "Yesterday evening, the files suggested a possible way out for next weekend, but the latest forecasts do not encourage optimism. ", "Competitors still in Douarnenez can at least happily rely on the solidarity of the people and the Cornouaillais traders. ", "For example sailors with no where to stay were spontaneously offered free homestays with local residents, and those who spend their morning in the race center waiting for news can at least enjoy free croissants kindly provided by a baker in the city. ", "Several companies have also offered tours and tastings of local produce. ", "It is these little touches that are part of the seduction of the Douarnenez venue. ", "Now all everyone can do is wait for the next weather files, knowing that the situation may change rapidly, given the instability of this type of weather phenomena. ", "For now, Code Red still prevails.", "\n\nDavid Genest ( www.diffuselec.com): 'We enjoy the small activities offered by Douarnenez Courses, and we like to go walking. ", "The other day, we went diving just off the Pointe du Raz . ", "In any case, one is better off here than if we were at sea and a fortnight stopover in Douarnenez is really not so bad, there is so much to discover in the area. ", "In the evenings we put the world to rights, it was even suggested that one day the Mini will start from the Mediterranean!'", "\n\nIan Lipinski (Pas de Futur sans Numérique): 'I stayed in Douarnenez. ", "I did not want to leave the atmosphere of the race. ", "My girlfriend came to spend a few days ... Then we occupied ourselves picking mushrooms (except that I do not know the good places around here), doing some sport, fairing the boats. ", "I think the decision is good. ", "Just think what it would be like if we were at sea now. ", "So, we wait, and we savor the situation as best we can ... '" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005801129736937582, 0.0005731534911319613, 0.0005714891594834626, 0.0005209150840528309, 0.0006115122232586145, 0.0005212794058024883, 0.0006798817194066942, 0.0005436483770608902, 0.0006097976001910865, 0.000578603008762002, 0.0009721756214275956, 0.0006345734582282603, 0.0005987549666315317, 0.0005676150904037058, 0.0005794620374217629, 0.0005964163574390113, 0.00052448088536039, 0.0006508816732093692, 0.0006122478516772389, 0.001155336620286107, 0.0006141095072962344, 0.000715032743755728, 0.0006360338884405792, 0.0006264410330913961, 0.000844012014567852, 0.0008427915745414793, 0.0008613909012638032, 0.0005398628418333828, 0.0006107599474489689, 0.0006523391930386424 ]

[ "President Trump and Melania Trump on the phone with children on Christmas Eve at the White House.", "\n\nHey, kids under 8 years old, thanks for reading The New York Times. ", "But this time, please don’t. ", "Maybe go play Minecraft or something instead.", "\n\n… O.K., are they gone now? ", "Cool. ", "Here’s what President Trump said to a child about Santa Claus on Monday: “Are you still a believer in Santa? ", "Because at 7, it’s marginal, right?”", "\n\n“Yes, sir,” the child, Collman, responded twice. ", "She had spoken with the president for at least 10 seconds before he suggested that her parents had been lying to her all her life.", "\n\nADVERTISEMENT\n\nShe also told him she planned to put out cookies, according to The Post and Courier of Charleston, S.C., which obtained video of Collman’s side of the conversation.", "\n\nThe president made the comments from the White House while he and the first lady, Melania Trump, fielded calls from a hotline for children wondering where Santa was.", "\n\nLexington girl talks to President Trump on Christmas Eve Credit... Video by Post and Courier\n\nMr. Trump’s faux pas was roundly mocked on social media, where he was criticized for breaking the covenant in which we have all agreed to deceive our children.", "\n\nADVERTISEMENT\n\nBut in case you’re wondering: The president was right. ", "It is, indeed, marginal at 7.", "\n\nMost children stop believing in Santa somewhere between 5 and 8 years old, according to several studies. ", "That range has been largely consistent for decades; a 1978 study said that 85 percent of 5-year-olds believed, while just 25 percent of 8-year-olds kept the faith.", "\n\nOne 2015 study from Australia found that children are catching on earlier, perhaps because the internet is full of spoilers.", "\n\nIt appeared the Trumps were enjoying the occasion, which is part of the annual Santa-tracking program run by the North American Aerospace Defense Command, known as Norad. ", "Mr. Trump let out an ear-to-ear smile during his discussion with Collman, while Mrs. Trump called it “one of my favorite traditions.”", "\n\nAnd Collman, who was probably going to figure it out eventually anyway, will now have a story to tell for the rest of her life. ", "Merry Christmas to all.", "\n\nCorrection: Dec. 25, 2018 An earlier version of this article misidentified the 7-year-old who spoke with President Trump on Christmas Eve. ", "The child is a girl named Collman, not a boy named Coleman. ", "Dec. 25, 2018\n\nSign Up for On Politics With Lisa Lerer A spotlight on the people reshaping our politics. ", "A conversation with voters across the country. ", "And a guiding hand through the endless news cycle, telling you what you really need to know. ", "Sign Up" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0009846376487985253, 0.007986758835613728, 0.0007082360680215061, 0.0015583089552819729, 0.0013053027214482427, 0.0007077093468979001, 0.008228960447013378, 0.0006758007220923901, 0.0006831679493188858, 0.0010452852584421635, 0.0006529680686071515, 0.0009481433080509305, 0.0014477947261184454, 0.0005934671498835087, 0.0006262619863264263, 0.0019003014313057065, 0.0006896572303958237, 0.002800828544422984, 0.0006188555271364748, 0.000712703971657902, 0.0012373585486784577, 0.0006742530968040228, 0.000900227518286556, 0.001024740282446146, 0.0007330476655624807, 0.0006062311003915966, 0.0005530943162739277, 0.0009497381979599595 ]

[ "Related literature {#sec1}\n==================\n\nFor background to this work see: Boeckmann *et al.* (", "2010)[@bb3]; Wriedt & Näther (2010[@bb8]); Wriedt *et al.* (", "2009)[@bb9]. ", "For structures of bimetallic compounds based on potassium formate, see: Antsyshkina *et al.* (", "1983[@bb2]); Leontiev *et al.* (", "1988[@bb5]). ", "For a description of the Cambridge Structural Database, see: Allen (2002[@bb1]).", "\n\nExperimental {#sec2}\n============\n\n {#sec2.1}\n\n### Crystal data {#sec2.1.1}\n\n\\[CoK(CHO~2~)~3~\\]*M* *~r~* = 233.08Monoclinic,*a* = 10.7244 (8) Å*b* = 8.9653 (6) Å*c* = 6.8742 (5) Åβ = 95.539 (6)°*V* = 657.85 (8) Å^3^*Z* = 4Mo *K*α radiationμ = 3.22 mm^−1^*T* = 293 K0.16 × 0.09 × 0.06 mm\n\n### Data collection {#sec2.1.2}\n\nStoe IPDS-2 diffractometerAbsorption correction: numerical (*X-SHAPE* and *X-RED32*; Stoe & Cie, 2008)[@bb7] *T* ~min~ = 0.711, *T* ~max~ = 0.8176120 measured reflections892 independent reflections853 reflections with *I* \\> 2σ(*I*)*R* ~int~ = 0.031\n\n### Refinement {#sec2.1.3}\n\n*R*\\[*F* ^2^ \\> 2σ(*F* ^2^)\\] = 0.020*wR*(*F* ^2^) = 0.046*S* = 1.15892 reflections54 parametersH-atom parameters constrainedΔρ~max~ = 0.25 e Å^−3^Δρ~min~ = −0.57 e Å^−3^\n\n {#d5e433}\n\nData collection: *X-AREA* (Stoe & Cie, 2008)[@bb7]; cell refinement: *X-AREA* [@bb7]; data reduction: *X-AREA* [@bb7]; program(s) used to solve structure: *SHELXS97* (Sheldrick, 2008[@bb6]); program(s) used to refine structure: *SHELXL97* (Sheldrick, 2008[@bb6]); molecular graphics: *XP* in *SHELXTL* (Sheldrick, 2008[@bb6]) and *DIAMOND* (Brandenburg, 1999[@bb4]); software used to prepare material for publication: *XCIF* in *SHELXTL*.", "\n\nSupplementary Material\n======================\n\nCrystal structure: contains datablocks I, global. ", "DOI: [10.1107/S1600536811008737/kj2172sup1.cif](http://dx.doi.org/10.1107/S1600536811008737/kj2172sup1.cif)\n\nStructure factors: contains datablocks I. DOI: [10.1107/S1600536811008737/kj2172Isup2.hkl](http://dx.doi.org/10.1107/S1600536811008737/kj2172Isup2.hkl)\n\nAdditional supplementary materials: [crystallographic information](http://scripts.iucr.org/cgi-bin/sendsupfiles?kj2172&file=kj2172sup0.html&mime=text/html); [3D view](http://scripts.iucr.org/cgi-bin/sendcif?kj2172sup1&Qmime=cif); [checkCIF report](http://scripts.iucr.org/cgi-bin/paper?kj2172&checkcif=yes)\n\nSupplementary data and figures for this paper are available from the IUCr electronic archives (Reference: [KJ2172](http://scripts.iucr.org/cgi-bin/sendsup?kj2172)).", "\n\nWe gratefully acknowledge financial support by the DFG (project number NA 720/3-1) and the State of Schleswig-Holstein. ", "We thank Professor Dr Bensch for access to his experimental facility.", "\n\nComment\n=======\n\nIn our current investigation on the synthesis, structures and properties of new coordination polymers based on paramagnetic transition metal, small-sized anions and N-donor ligands, we have shown that thermal decomposition reactions are an elegante route for the discovery and preparation of new ligand-deficient coordination polymers (Boeckmann *et al.*, ", "2010; Wriedt & Näther, 2010; Wriedt *et al.*, ", "2009). ", "Within this project we tried to prepare new ligand-rich precursor compounds based on cobalt formate and pyrazine as coligand. ", "However, reaction of cobalt(II) chloride, potassium formate and pyrazine in acteonitrile unexpectedly resulted in single crystals of the title compound.", "\n\nIn the crystal structure of the title compound, each cobalt(II) cation is coordinated by six bridging formato anions with Co---OCHO distances between 2.0943 (10) Å and 2.1026 (9) Å. The CoO~6~ octahedron is slightly distorted with angles ranging from 82.66 (4) ° to 97.34 (4) ° and 180° (Fig. ", "1 and Tab. ", "1). ", "The K^+^ cations are coordinated by eight oxygen atoms belonging to seven formato anions within irregular polyhedra. ", "The K---O distances ranges from 2.7371 (10) Å to 2.8507 (11) Å and the O---K---O angles are between 59.81 (3) ° and 147.11 (3) °. ", "The cobalt cations are connected via *µ*-1,3 bridging formato anions into a three dimensional coordination network (Fig. ", "2). ", "Within this networks cavities are formed in which the K^+^ cations are embedded (Fig 3). ", "The shortest Co···Co distances amount to 5.6487 (3) Å and the shortest K···K distances are 3.9067 (4) Å).", "\n\nAccording to a search in the CCDC database (ConQuest Ver.1.12.2010) (Allen, 2002) mixed cobalt and potassium formates are unkown but bimetallic compounds based on potassium formate are known with different metals (Antsyshkina *et al.*, ", "1983 and Leontiev *et al.*, ", "1988.", "\n\nExperimental {#experimental}\n============\n\nPotassium formate (KCHOO) and pyrazine were obtained from Alfa Aesar and cobalt(II) chloride was obtained from Acros Organics. ", "All chemicals were used without further purification. ", "0.25 mmol (32.5 mg) CoCl~2~, 0.5 mmol (42.1 mg) KCHOO and 0.5 mmol (40 mg) pyrazine were reacted with 1 ml acetonitrile in a closed test-tube at 120°C for three days. ", "On cooling block-shaped single crystals of the title compound were obtained in a mixture with an unknown phase. ", "It must be noted, that the reaction under similar conditions without pyrazine does not lead to the formation of the title compound.", "\n\nRefinement {#refinement}\n==========\n\nThe H atoms were positioned with idealized geometry and were refined isotropic with *U*~iso~(H) = 1.2*U*~eq~(C) and C---H distances of 0.93 Å using a riding model.", "\n\nFigures\n=======\n\n{#Fap1}\n\n{#Fap2}\n\n{#Fap3}\n\nCrystal data {#tablewrapcrystaldatalong}\n============\n\n ----------------------- ---------------------------------------\n \\[CoK(CHO~2~)~3~\\] *F*(000) = 460\n *M~r~* = 233.08 *D*~x~ = 2.353 Mg m^−3^\n Monoclinic, *C*2/*c* Mo *K*α radiation, λ = 0.71073 Å\n Hall symbol: -C 2yc Cell parameters from 6120 reflections\n *a* = 10.7244 (8) Å θ = 3.0--29.2°\n *b* = 8.9653 (6) Å µ = 3.22 mm^−1^\n *c* = 6.8742 (5) Å *T* = 293 K\n β = 95.539 (6)° Block, light blue\n *V* = 657.85 (8) Å^3^ 0.16 × 0.09 × 0.06 mm\n *Z* = 4 \n ----------------------- ---------------------------------------\n\nData collection {#tablewrapdatacollectionlong}\n===============\n\n ------------------------------------------------------------------------------ -------------------------------------\n Stoe IPDS-2 diffractometer 892 independent reflections\n Radiation source: fine-focus sealed tube 853 reflections with *I* \\> 2σ(*I*)\n graphite *R*~int~ = 0.031\n ω scans θ~max~ = 29.2°, θ~min~ = 3.0°\n Absorption correction: numerical (*X-SHAPE* and *X-RED32*; Stoe & Cie, 2008) *h* = −14→14\n *T*~min~ = 0.711, *T*~max~ = 0.817 *k* = −12→12\n 6120 measured reflections *l* = −9→9\n ------------------------------------------------------------------------------ -------------------------------------\n\nRefinement {#tablewraprefinementdatalong}\n==========\n\n ---------------------------------------------------------------- ----------------------------------------------------------------------------------------------------\n Refinement on *F*^2^ Secondary atom site location: difference Fourier map\n Least-squares matrix: full Hydrogen site location: inferred from neighbouring sites\n *R*\\[*F*^2^ \\> 2σ(*F*^2^)\\] = 0.020 H-atom parameters constrained\n *wR*(*F*^2^) = 0.046 *w* = 1/\\[σ^2^(*F*~o~^2^) + (0.0276*P*)^2^ + 0.1263*P*\\] where *P* = (*F*~o~^2^ + 2*F*~c~^2^)/3\n *S* = 1.15 (Δ/σ)~max~ \\< 0.001\n 892 reflections Δρ~max~ = 0.25 e Å^−3^\n 54 parameters Δρ~min~ = −0.57 e Å^−3^\n 0 restraints Extinction correction: *SHELXL97* (Sheldrick, 2008), Fc^\\*^=kFc\\[1+0.001xFc^2^λ^3^/sin(2θ)\\]^-1/4^\n Primary atom site location: structure-invariant direct methods Extinction coefficient: 0.0126 (12)\n ---------------------------------------------------------------- ----------------------------------------------------------------------------------------------------\n\nSpecial details {#specialdetails}\n===============\n\n ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n Geometry. ", "All esds (except the esd in the dihedral angle between two l.s. ", "planes) are estimated using the full covariance matrix. ", "The cell esds are taken into account individually in the estimation of esds in distances, angles and torsion angles; correlations between esds in cell parameters are only used when they are defined by crystal symmetry. ", "An approximate (isotropic) treatment of cell esds is used for estimating esds involving l.s. ", "planes.", "\n Refinement. ", "Refinement of F^2^ against ALL reflections. ", "The weighted R-factor wR and goodness of fit S are based on F^2^, conventional R-factors R are based on F, with F set to zero for negative F^2^. The threshold expression of F^2^ \\> 2sigma(F^2^) is used only for calculating R-factors(gt) etc. ", "and is not relevant to the choice of reflections for refinement. ", "R-factors based on F^2^ are statistically about twice as large as those based on F, and R- factors based on ALL data will be even larger.", "\n ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\nFractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (Å^2^) {#tablewrapcoords}\n==================================================================================================\n\n ----- -------------- -------------- -------------- -------------------- --\n *x* *y* *z* *U*~iso~\\*/*U*~eq~ \n K1 0.0000 0.10357 (5) 0.2500 0.02582 (12) \n Co1 0.2500 0.2500 0.0000 0.01561 (10) \n O1 0.16793 (10) 0.33291 (11) 0.24238 (15) 0.0274 (2) \n O2 0.25445 (9) 0.54804 (11) 0.34563 (15) 0.0271 (2) \n C1 0.18397 (13) 0.44031 (15) 0.3568 (2) 0.0244 (3) \n H1 0.1371 0.4392 0.4638 0.029\\* \n O11 0.43048 (9) 0.31029 (12) 0.12114 (14) 0.0260 (2) \n C11 0.5000 0.2478 (2) 0.2500 0.0271 (4) \n H11 0.5000 0.1441 0.2500 0.033\\* \n ----- -------------- -------------- -------------- -------------------- --\n\nAtomic displacement parameters (Å^2^) {#tablewrapadps}\n=====================================\n\n ----- -------------- -------------- -------------- -------------- -------------- -------------\n *U*^11^ *U*^22^ *U*^33^ *U*^12^ *U*^13^ *U*^23^\n K1 0.0278 (2) 0.01932 (19) 0.0318 (2) 0.000 0.01004 (16) 0.000\n Co1 0.01611 (14) 0.01374 (14) 0.01648 (14) −0.00041 (8) −0.00102 (8) 0.00122 (8)\n O1 0.0332 (5) 0.0223 (5) 0.0277 (5) −0.0087 (4) 0.0091 (4) −0.0093 (4)\n O2 0.0300 (5) 0.0204 (4) 0.0318 (5) −0.0063 (4) 0.0076 (4) −0.0089 (4)\n C1 0.0312 (6) 0.0213 (6) 0.0215 (6) −0.0042 (5) 0.0069 (5) −0.0037 (5)\n O11 0.0215 (4) 0.0303 (5) 0.0245 (5) −0.0036 (4) −0.0063 (4) 0.0033 (4)\n C11 0.0270 (9) 0.0217 (9) 0.0310 (10) 0.000 −0.0057 (8) 0.000\n ----- -------------- -------------- -------------- -------------- -------------- -------------\n\nGeometric parameters (Å, °) {#tablewrapgeomlong}\n===========================\n\n ------------------------ ------------- -------------------------- -------------\n K1---O1 2.7371 (10) Co1---O11^iv^ 2.1026 (9)\n K1---O2^i^ 2.8193 (10) O1---C1 1.2448 (17)\n K1---O11^ii^ 2.8335 (10) O2---C1 1.2335 (17)\n K1---O11^i^ 2.8507 (11) C1---H1 0.9300\n K1---C11^i^ 3.189 (2) O11---C11 1.2356 (13)\n Co1---O1 2.0943 (10) C11---H11 0.9300\n Co1---O2^iii^ 2.1015 (10) \n \n O1---K1---O1^v^ 82.62 (5) O1---Co1---O11^iv^ 87.99 (4)\n O1---K1---O2^i^ 140.19 (3) O1^iv^---Co1---O11^iv^ 92.01 (4)\n O1^v^---K1---O2^i^ 59.81 (3) O2^iii^---Co1---O11^iv^ 94.96 (4)\n O2^i^---K1---O2^vi^ 159.66 (4) O2^vi^---Co1---O11^iv^ 85.04 (4)\n O1---K1---O11^ii^ 92.48 (3) O11^iv^---Co1---O11 180.00 (6)\n O1^v^---K1---O11^ii^ 63.08 (3) C1---O1---Co1 137.25 (9)\n O2^i^---K1---O11^ii^ 60.35 (3) C1---O1---K1 128.31 (9)\n O2^vi^---K1---O11^ii^ 126.22 (3) Co1---O1---K1 94.38 (3)\n O11^ii^---K1---O11^iv^ 148.37 (5) C1---O2---Co1^vii^ 126.81 (9)\n O1---K1---O11^i^ 147.11 (3) C1---O2---K1^viii^ 138.13 (9)\n O1^v^---K1---O11^i^ 123.09 (3) Co1^vii^---O2---K1^viii^ 91.88 (3)\n O2^i^---K1---O11^i^ 71.79 (3) O2---C1---O1 127.90 (13)\n O2^vi^---K1---O11^i^ 89.25 (3) O2---C1---H1 116.0\n O11^ii^---K1---O11^i^ 116.58 (3) O1---C1---H1 116.0\n O11^iv^---K1---O11^i^ 93.17 (3) C11---O11---Co1 129.50 (9)\n O11^i^---K1---O11^vi^ 45.45 (4) C11---O11---K1^iv^ 125.17 (6)\n O1---K1---C11^i^ 138.69 (2) Co1---O11---K1^iv^ 91.47 (3)\n O2^i^---K1---C11^i^ 79.83 (2) C11---O11---K1^viii^ 94.23 (9)\n O11^ii^---K1---C11^i^ 105.81 (2) Co1---O11---K1^viii^ 124.29 (4)\n O11^i^---K1---C11^i^ 22.727 (19) K1^iv^---O11---K1^viii^ 86.83 (3)\n O1---Co1---O1^iv^ 180.0 O11^ix^---C11---O11 126.09 (18)\n O1---Co1---O2^iii^ 97.34 (4) O11^ix^---C11---K1^viii^ 63.04 (9)\n O1^iv^---Co1---O2^iii^ 82.66 (4) O11---C11---H11 117.0\n O2^iii^---Co1---O2^vi^ 180.00 (3) K1^viii^---C11---H11 180.0\n ------------------------ ------------- -------------------------- -------------\n\nSymmetry codes: (i) *x*−1/2, *y*−1/2, *z*; (ii) *x*−1/2, −*y*+1/2, *z*+1/2; (iii) *x*, −*y*+1, *z*−1/2; (iv) −*x*+1/2, −*y*+1/2, −*z*; (v) −*x*, *y*, −*z*+1/2; (vi) −*x*+1/2, *y*−1/2, −*z*+1/2; (vii) −*x*+1/2, *y*+1/2, −*z*+1/2; (viii) *x*+1/2, *y*+1/2, *z*; (ix) −*x*+1, *y*, −*z*+1/2.", "\n\n###### Selected bond lengths (Å)\n\n ---------------- -------------\n K1---O1 2.7371 (10)\n K1---O2^i^ 2.8193 (10)\n K1---O11^i^ 2.8507 (11)\n Co1---O1 2.0943 (10)\n Co1---O2^ii^ 2.1015 (10)\n Co1---O11^iii^ 2.1026 (9)\n ---------------- -------------\n\nSymmetry codes: (i) ; (ii) ; (iii) .", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0006618450279347599, 0.0006595609011128545, 0.0007835463038645685, 0.0005616254056803882, 0.000633049348834902, 0.0007721209549345076, 0.0005718395113945007, 0.044017549604177475, 0.0006968974485062063, 0.0008374892640858889, 0.0004897303879261017, 0.0005240291357040405, 0.0006964081549085677, 0.0006759333773516119, 0.0007564739207737148, 0.0005903893033973873, 0.0006040766020305455, 0.0006724611739628017, 0.0007320803706534207, 0.0008432631730102003, 0.0008086339803412557, 0.0006994098657742143, 0.0007117324275895953, 0.0008871195605024695, 0.000879232888109982, 0.0007521545048803091, 0.000564754125662148, 0.0006558735040016472, 0.0007901035132817924, 0.0006769641186110675, 0.0006331736803986132, 0.0009751655161380768, 0.0005852542817592621, 0.0006121816695667803, 0.0008329806732945144, 0.0010219416581094265, 0.0005547354812733829, 0.0013330931542441249, 0.0005537669640034437, 0.0007565867272205651, 0.05265744775533676, 0.0008239841554313898, 0.0006133599672466516, 0.0005931414198130369, 0.0006192706641741097, 0.000754048814997077, 0.0007160293171182275, 0.0009238435886800289, 0.0009470621007494628, 0.0005574182141572237, 0.0006460382719524205, 0.014974871650338173, 0.000739694107323885, 0.001995444530621171 ]

[ "The pre-finals bye weekend is the perfect moment for some reflection, and what better case for introspection than the club that was the first beneficiary of the bye, two years ago.", "\n\nSince that drought-breaking premiership, the Western Bulldogs have failed to make finals in two successive seasons, and this year, at times, looked a long, long way off the mark.", "\n\nBeing the first team to win the premiership from seventh, and the first to do it from outside the top four under the current final-eight system, it’s tempting to view that one month of finals football as being a bit of a lucky break.", "\n\nFacebook Twitter Whatsapp Reddit Email Share\n\nThey certaintly were assisted by the bye weekend, with two or three of their better players being able to return from injury, while their opponent in that first finals game, the Eagles, lost a bit of momentum from having the break.", "\n\nHowever, we shouldn’t view that seventh position in the manner one normally would. ", "The Dogs won 15 games that year. ", "In 1993, Essendon only needed 13 wins to top the ladder, and in 1998, the Bulldogs finished second with 15 wins.", "\n\nNevertheless, the last two seasons make that 2016 premiership look like a bit of a flash in the pan.", "\n\nIn October 2016, Dogs fans were on top of the world: premiership, record memberships, record profits, all merchandise sold out, and on it went.", "\n\nOn top of that, look at all the players who were going to come back from injury: Bob Murphy, Matt Suckling, Mitch Wallis, Marcus Adams, Jack Redpath and Lin Jong – our list was rock solid!", "\n\n\n\nSo many young players in their first, second and third year of footy were in that team: Marcus Bontempelli, Josh Dunkley, Toby McLean, Tom Boyd and Caleb Daniel.", "\n\nThe immediate future looked bright, we were on the verge of a dynasty.", "\n\nThe thing is, in the history of the game, no exact team of 22 who have won a grand final have ever appeared together in a game again… ever.", "\n\nIn the Dogs’ case, this would become evident within a week of the premiership. ", "Even before celebrations had completed, Joel Hamling announced that he was returning to Western Australia.", "\n\nWithin 12 months, the whole back six had been decimated: Hamling gone, Morris and Wood injured for long periods, Fletcher Roberts barely played a senior game, Matt Boyd retired at the end of the 2017 season, and Biggs had lingering injury concerns that forced him into early retirement mid-way through this year.", "\n\nPremiership heroes Liam Picken and Tom Boyd have had to face up to their own demons – concussion and depression, respectively – and have had extended periods away from the game across the two seasons.", "\n\nLike Shane Biggs, Clay Smith has had persistent injury woes over the journey, and he too announced his intention to retire early mid-way through this season, at the tender age of 25.", "\n\n\n\nFor the whole of the last season, enigmatic forward Jake Stringer had to deal with a variety of personal issues, which ultimately forced him to consider a move to Essendon.", "\n\nElite ball-winner Tom Liberatore, son of a bulldog Brownlow winner, missed most of the season due to a serious leg injury.", "\n\nSo less than 24 months after winning the grand final, the Bulldogs had maybe 14 players to choose from who had played in the 2016 decider, and of those, a few have been out of form since that day, with others destined to go to other clubs in the off-season.", "\n\nConsidering how young the team was that won the premiership, it’s incredible that coach Luke Beveridge appears to have worked overtime to make the team even younger the last two seasons. ", "It’s unclear whether it’s by design, or forced by a long injury list, but it has been happening.", "\n\nThis season, virtually all first and second-year players have seen game time. ", "Most rounds, the Bulldogs were either the youngest team or the most inexperienced in terms of games played. ", "There was at least one game where up to five players had fewer than ten games.", "\n\nDoes this point to some masterplan on the part of Bevo which is meant to come to fruition in the next season or two?", "\n\nMost fans would like to think so, that there is method in the madness. ", "Regardless, it has been a pretty big fall in a short period of time and all we can do is what the supporters of ten other clubs are doing right now: hope for better times next season." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006079982849769294, 0.0008942832355387509, 0.000794537307228893, 0.0006929935771040618, 0.0006182981305755675, 0.001504347543232143, 0.0007269580964930356, 0.0007229461916722357, 0.0007790193776600063, 0.003168906085193157, 0.0008167490013875067, 0.000594782002735883, 0.0009325715946033597, 0.0006328856106847525, 0.0006898972205817699, 0.0009330741595476866, 0.0007455045124515891, 0.0011312573915347457, 0.0006611363496631384, 0.0014182223239913583, 0.0007994734914973378, 0.0005769492709077895, 0.0006468956125900149, 0.0007706723990850151, 0.00067116878926754, 0.0007324813050217927, 0.0007113669416867197, 0.0007687979377806187, 0.0006527866353280842 ]

[ "Association between genetic polymorphisms of the prostaglandin F2alpha receptor gene and response to latanoprost.", "\nTo evaluate the relationship between polymorphisms of the prostaglandin F(2alpha) receptor (FP receptor) gene and the effectiveness of topical latanoprost treatment in normal volunteers. ", "Prospective nonrandomized trial. ", "One hundred normal volunteers were recruited into the study. ", "Baseline intraocular pressures (IOPs) of both eyes of 100 normal subjects were measured at 3 time points. ", "Latanoprost (0.005%) was applied to one eye once daily for 7 days. ", "Diurnal IOP was measured again on day 7. ", "Response to latanoprost was evaluated by percent IOP reduction in the treated eye minus IOP fluctuations of the nontreated eye. ", "We classified subjects by the mean diurnal percent IOP reduction (%DeltaIOP) into 3 groups: low responders (%DeltaIOP<10), medium responders (10< or =%DeltaIOP<25), and high responders (%DeltaIOP> or =25). ", "Single-nucleotide polymorphisms (SNPs) in the FP receptor gene were searched, and the genotype was determined mainly by direct DNA sequencing. ", "A promoter assay with a reporter luciferase gene was also performed. ", "Mean diurnal percent IOP reduction and genotyping of SNPs in the FP receptor gene. ", "Ten SNPs were identified in this study. ", "One, rs3753380, was located in the promoter region of the FP receptor gene and was significantly correlated with %DeltaIOP (CC, 20.3%+/-1.5% [mean +/- standard error]; CT + TT, 15.6%+/-1.2%; P = 0.0316). ", "Mean diurnal percent IOP reduction was not associated with the other SNPs. ", "When the category classified by %DeltaIOP was analyzed, not only rs3753380 but also rs3766355, an SNP in intron 1, were associated with the degree of response to latanoprost. ", "The promoter assay revealed that the C allele of rs3766355 and T allele of rs3753380 were found in constructs with lower transcriptional activity of the FP receptor gene. ", "rs3753380 and rs3766355, SNPs in the promoter and intron 1 regions of the FP receptor gene, correlate with a response to short-term latanoprost treatment in normal volunteers. ", "The genotype of these SNPs may be an important determinant of variability in response to latanoprost." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008151441579684615, 0.0006147645181044936, 0.0007437425665557384, 0.0005478269304148853, 0.0006456932751461864, 0.0008120860438793898, 0.000758661306463182, 0.0007078503840602934, 0.0007053148001432419, 0.0006364968721754849, 0.00078351836418733, 0.0008565667667426169, 0.0006099182064644992, 0.0006650456925854087, 0.0008386799599975348, 0.0006900582229718566, 0.000686475308611989, 0.0006930091185495257, 0.0006322507979348302 ]

[ "Wanzhou Sports Center\n\nThe Wanzhou Sports Center () is a sports venue in Wanzhou District, Chongqing, China, on the bank of the Yangtze River. ", "It has a multi-purpose stadium with a seating capacity of 26,000, and a natatorium with 1,650 seats. ", "Construction began in March 2010, and the center was opened in October 2012.", "\n\nReferences\n\nCategory:Multi-purpose stadiums in China\nCategory:Buildings and structures in Chongqing\nCategory:2012 establishments in China\nCategory:Sports venues completed in 2012" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006692598690278828, 0.0012604460353031754, 0.000597018632106483, 0.0005589946522377431 ]

[ "Q:\n\nHow to create a dynamic p:menuButton inside a jsf dataTable?", "\n\nI have a p:menuButton in a p:column in a p:dataTable.", "\nSo far everything works fine.", "\nNow I want to make the menuButton dynamic. ", "However c:foreach is evaluated before rendering the table and primefaces doesn't like to use ui:repeat inside the p:menuButton.", "\nHow can I create a number of p:menuitem dynamically based on a collection on the row item I am looping over, i.e. what should I do instead of ?:", "someKindOfLoop in the example below?", "\n<p:dataTable value='#{something.collection}' var='item'>\n...\n <p:column>\n ...\n <p:menuButton value=\"Actions\">\n <p:menuitem value=\"View ...\"\n ...>\n <f:param name=\"something\" value=\"#{item.id}\"/>\n </p:menuitem>\n <?:", "someKindOfLoop x=\"#{item.subCollection}\" y=\"var\">\n <p:menuitem value=\"View sub list \"\n ...>\n <f:param name=\"#{var.name}\" value=\"#{var.id}\"/>\n </p:menuitem>\n </?:someKindOfLoop>\n\n </p:menuButton>\n ...\n </p:column>\n</p:dataTable>\n\nGoogling yields a number of similar cases, however I haven't found one yet that wasn't either about dynamically creating columns (like this: Why can <c:forEach> or <ui:repeat> not access <p:dataTable var>? ) ", "or that doesn't deal with primefaces.", "\n\nA:\n\nThe PrimeFaces p:menuButton, like many other components, including most menu components, supports the model attribute. ", "This is mentioned on page 329 in the PF6 documentation. ", "The 'Dynamic menus` section of this component refers to the 'common' dynamic menus section on page 323. ", "There you can read how to do this.", "\nAnd to prevent this answer to be a 'link only' (to external sites, here is the sort of duplicate of this question: Primefaces : how to create <p:menubar> dynamically in primefaces 4?", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0009203977533616126, 0.0008478714735247195, 0.0006014815298840404, 0.0031559676863253117, 0.0009114722488448024, 0.0007031976128928363, 0.001394784776493907, 0.0016849192325025797, 0.0011216887505725026, 0.0011144881136715412, 0.0007231743074953556, 0.0005942677962593734, 0.000609769718721509, 0.000579109531827271, 0.0006834831438027322, 0.001995444530621171 ]

[ "Sterling Equities\n\nSterling Equities in Great Neck, New York, is a diversified, family-run group of companies whose portfolio consists primarily of holdings in real estate, sports, and media in the New York area. ", "These include the New York Mets, the Brooklyn Cyclones, SportsNet New York, Sterling Project Development, and a number of real estate investment portfolios and real estate services businesses.", "\n\nHoldings and history \n\nSterling Equities is a diversified, family-run group of companies whose portfolio consists primarily of holdings in real estate, sports, and media in the New York area. ", "These include the New York Mets (an interest was acquired in 1980, and it became full owner in 2002), the Brooklyn Cyclones, SportsNet New York (a regional sports tv network it formed in 2005), Sterling Project Development, and a number of real estate investment portfolios and real estate services businesses (it has developed nearly 25 million square feet of commercial property).", "\n\nIt was founded in 1972 by Fred Wilpon (Chairman) and Saul Katz (President), Wilpon's brother-in-law.", "\n It has developed a number of properties, including the tower at 450 Lexington Avenue. ", "It built Citi Field $40 million under budget, and took over development of a Willets Point project.", "\n\nMadoff Ponzi Scheme \nSterling Equities was embroiled in the Bernie Madoff scandal. ", "Madoff trustee Irving Picard alleged that the Sterling Partners had pocketed millions in fictitious profits. ", "Sterling Partners had opened accounts with Bernard Madoff for themselves, their businesses, their friends and family, and business associates. ", "Sterling was associated with 483 Madoff accounts. ", "For example, Sterling partner Greg Katz had 31 accounts with Madoff dating from 1992 and withdrew over $23 million dollars in illegal profit. ", "The Sterling partners opened accounts for their wives and families. ", "Valerie Wilpon, Amy Beth Katz, and Heath Katz Knopf all had accounts with Bernard Madoff. ", "According to Picard, Sterling partners used funds withdrawn from their wives’ accounts to meet their personal and/or business financial obligations.", "\n\nThe Sterling Partners had a close personal relationship with Bernard Madoff. ", "Madoff had Mets season tickets with seats near the owners box. ", "Madoff and his wife, Ruth, traveled to Japan with the Wilpon's and Katz's. ", "Sterling assisted Madoff with securing office space in Manhattan's Lipstick Buidling. ", "The Madoff's, Katz's, and Wilpon's were involved in several charities together. ", "They attended movies together and had houses close together in Florida.", "\n\nBy 2008, Sterling Partners had withdrawn withdrawn approximately $300 million in fictitious profits. ", "In 2012, Sterling Partners including Saul Katz, Greg Katz, Fred Wilpon and Jeff Wilpon settled a lawsuit by trustee Irving Picard that alleged that they had invested in Madoff's Ponzi scheme even though it knew the returns were fraudulent. ", " Despite the allegations they were aware of Madoff's fraud and beneficiaries of it, Sterling asked the US Supreme Court to reverse a court decision and allow them access to a special fund set up for Madoff victims.", "\n\nSee also\nList of investors in Bernard L. Madoff Investment Securities\nParticipants in the Madoff investment scandal\n\nReferences \n\nCategory:Real estate investing\nCategory:Companies based in Nassau County, New York\nCategory:Real estate companies of the United States\nCategory:New York Mets owners\nCategory:Madoff investment scandal\nCategory:New York Excelsior" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006793202483095229, 0.0005682015907950699, 0.0006807726458646357, 0.0005848714499734342, 0.0006499614682979882, 0.0005683120107278228, 0.0007139674271456897, 0.007901487872004509, 0.0007463542860932648, 0.0006354882498271763, 0.0009172575082629919, 0.0006990006659179926, 0.0005948690231889486, 0.0007470733835361898, 0.000593148753978312, 0.0006344071589410305, 0.0007069935090839863, 0.0012221734505146742, 0.0009417097317054868, 0.0006581841153092682, 0.0006325410213321447, 0.0005784640670754015, 0.0007324534235522151, 0.0008223836193792522, 0.0006112254923209548 ]

[ "Isotopes of magnesium\n\nMagnesium (12Mg) naturally occurs in three stable isotopes, 24Mg, 25Mg, and 26Mg. ", "There are 18 radioisotopes that have been discovered, ranging from 19Mg to 40Mg. ", "The longest-lived radioisotope is 28Mg with a half-life of 20.915 hours. ", "The lighter isotopes mostly decay to isotopes of sodium while the heavier isotopes decay to isotopes of aluminium. ", "The shortest-lived is 19Mg with a half-life of 5 picoseconds.", "\n\nList of isotopes \n\n|-\n| 19Mg\n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 7\n| 19.03417(5)\n| 5(3) ps\n| 2p\n| 17Ne\n| 1/2−#\n|\n|\n|-\n| rowspan=2|20Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 8\n| rowspan=2|20.0187631(2)\n| rowspan=2|93(5) ms\n| β+ (69.7%)\n| 20Na\n| rowspan=2|0+\n| rowspan=2|\n| rowspan=2|\n|-\n| β+, p (30.3%)\n| 19Ne\n|-\n| rowspan=3|21Mg \n| rowspan=3 style=\"text-align:right\" | 12\n| rowspan=3 style=\"text-align:right\" | 9\n| rowspan=3|21.0117058(8)\n| rowspan=3|118.6(5) ms\n| β+ (66.9%)\n| 21Na\n| rowspan=3|5/2+\n| rowspan=3|\n| rowspan=3|\n|-\n| β+, p (32.6%)\n| 20Ne\n|- \n| β+, α (0.5%)\n| 17F\n|-\n| 22Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 10\n| 21.9995707(3)\n| 3.8755(12) s\n| β+\n| 22Na\n| 0+\n|\n|\n|-\n| 23Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 11\n| 22.99412394(17)\n| 11.317(11) s\n| β+\n| 23Na\n| 3/2+\n|\n|\n|-\n| 24Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 12\n| 23.985041697(14)\n| colspan=3 align=center|Stable\n| 0+\n| 0.7899(4)\n| 0.78958–0.79017\n|-\n| 25Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 13\n| 24.98583696(5)\n| colspan=3 align=center|Stable\n| 5/2+\n| 0.1000(1)\n| 0.09996–0.10012\n|-\n| 26Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 14\n| 25.98259297(3)\n| colspan=3 align=center|Stable\n| 0+\n| 0.1101(3)\n| 0.10987–0.11030\n|-\n| 27Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 15\n| 26.98434063(5)\n| 9.435(27) min\n| β−\n| 27Al\n| 1/2+\n|\n|\n|-\n| 28Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 16\n| 27.9838766(21)\n| 20.915(9) h\n| β−\n| 28Al\n| 0+\n|\n|\n|-\n| 29Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 17\n| 28.988617(12)\n| 1.30(12) s\n| β−\n| 29Al\n| 3/2+\n|\n|\n|-\n| rowspan=2|30Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 18\n| rowspan=2|29.990463(4)\n| rowspan=2|313(4) ms\n| β− (99.94%)\n| 30Al\n| rowspan=2|0+\n| rowspan=2|\n| rowspan=2|\n|-\n| β−, n (0.06%)\n| 29Al\n|-\n| rowspan=2|31Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 19\n| rowspan=2|30.996648(3)\n| rowspan=2|236(20) ms\n| β− (93.8%)\n| 31Al\n| rowspan=2|1/2(+)\n| rowspan=2|\n| rowspan=2|\n|-\n| β−, n (6.2%)\n| 30Al\n|-\n| rowspan=2|32Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 20\n| rowspan=2|31.999110(4)\n| rowspan=2|86(5) ms\n| β− (94.5%)\n| 32Al\n| rowspan=2|0+\n| rowspan=2|\n| rowspan=2|\n|-\n| β−, n (5.5%)\n| 31Al\n|-\n| rowspan=2|33Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 21\n| rowspan=2|33.005327(3)\n| rowspan=2|90.5(16) ms\n| β− (86%)\n| 33Al\n| rowspan=2|3/2−\n| rowspan=2|\n| rowspan=2|\n|-\n| β−, n (14%)\n| 32Al\n|-\n| rowspan=2|34Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 22\n| rowspan=2|34.00894(3)\n| rowspan=2|20(10) ms\n| β− (70%)\n| 34Al\n| rowspan=2|0+\n| rowspan=2|\n| rowspan=2|\n|-\n| β−, n (30%)\n| 33Al\n|-\n| rowspan=2|35Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 23\n| rowspan=2|35.01679(29)\n| rowspan=2|70(40) ms\n| β−, n (52%)\n| 34Al\n| rowspan=2|7/2−#\n| rowspan=2|\n| rowspan=2|\n|-\n| β− (48%)\n| 35Al\n|-\n| 36Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 24\n| 36.02188(74)\n| 3.9(13) ms\n| β−\n| 36Al\n| 0+\n|\n|\n|-\n| rowspan=2|37Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 25\n| rowspan=2|37.03029(75)\n| rowspan=2|8(4) ms\n| β−\n| 37Al\n| rowspan=2|(3/2−)\n| rowspan=2|\n| rowspan=2|\n|-\n| β−, n\n| 36Al\n|-\n| 38Mg \n| style=\"text-align:right\" | 12\n| style=\"text-align:right\" | 26\n| 38.03658(54)#\n| 1# ms [>260 ns]\n|\n|\n| 0+\n|\n|\n|-\n| rowspan=2|40Mg \n| rowspan=2 style=\"text-align:right\" | 12\n| rowspan=2 style=\"text-align:right\" | 28\n| rowspan=2|40.05191(54)#\n| rowspan=2|1# ms\n| β−, n\n| 39Al\n| rowspan=2|0+\n| rowspan=2|\n| rowspan=2|\n|-\n| β−\n| 40Al\n\nExternal links\nMagnesium isotopes data from The Berkeley Laboratory Isotopes Project's\n\nReferences\n\nCategory:Magnesium\n \nMagnesium" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0005942310090176761, 0.0006728938315063715, 0.0008127568871714175, 0.0007548403227701783, 0.0051474603824317455, 0.0008504942525178194 ]

[ "Bloodied, but Unbowed (disambiguation)\n\nBloodied, but Unbowed is an album by Desperado.", "\n\nBloodied, but Unbowed may also refer to:\nBloodied But Unbowed (HR report on Bahrain)\nBloodied but Unbowed, a 2010 Canadian documentary film\n\"Bloody, but unbowed\", a phrase from William Ernest Henley's poem \"Invictus\"" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.015194728039205074, 0.0024864706210792065 ]

[ "Q:\n\nAmbiguous grammar\n\nI am looking at the following grammar and I believe its Ambiguous at line 3, but not sure.", "\n<SL> → <S>\n<SL> → <SL> <S>\n<S> → i <B> <S> e <S>\n<S> → i <B> <S> \n<S> → x\n<S> → y\n<B> → 5\n<B> → 13\n\nI found this string xi13yi5xeyx I believe generates two different parse trees, but I'm not sure if im doing it wrong.", "\nCan some one please verify my findings?", "\n\nA:\n\nYes your grammar is an ambiguous grammar!", "\nYou have not mention But I think <SL> is start viable \nUsing your grammar rules we can draw more then one parse tree(two) for wring i5i5yey as followes: \n <SL> <SL>\n | | \n <S> <S> \n / /|\\ \\ / | \\ \n / / | \\ \\ / | \\\n / / | \\ \\ / | \\\n / / | \\ \\ i <B> <S> \n / | | | \\ | / /|\\ \\ \n i <B> <S> e <S> 5 / / | \\ \\\n / / | \\ | / / | \\ \\ \n / / | \\ y / / | \\ \\\n 5 i <B> <S> / | | | \\ \n | | i <B> <S> e <S> \n 5 y | | | \n 5 y y \n\nStructure of both parse tree are different two the grammar is an ambiguous grammar! ", "\nYou can extend above diagram to generate tree string xi13yi5xeyx, (I am leaving this as an exercise for you) \nImportant is the language generate by this grammar is not ambiguous language.", "And its possible to write an equivalent unambiguous grammar for this grammar that always generates unique tree for each string in language of grammar. ", "\nHINT: To write unambiguous grammar. ", " \nThe grammar is quite similar to grammar for if loop in C language (notice different language having different syntax for if loop). ", "and it solved in almost all compiler design book.", "\nResolving the General Dangling Else/If-Else Ambiguity \nReference: Book Compilers Principles, Technique, and tools by Aho-Ullman Section 4.5 conflicts During Shift and-Reduce Parsing. ", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005489496979862452, 0.0018027210608124733, 0.0006633792072534561, 0.0019804188050329685, 0.006207475438714027, 0.0008345652604475617, 0.0006796307279728353, 0.000735282723326236, 0.0006426931940950453, 0.0005880547687411308, 0.0006253916653804481, 0.001995444530621171 ]

[ "#SPSM brings back #ProjectClarence for it’s FIFTH YEAR, 9pCT. ", "We’ll be chatting about simple ways you can use thumbnails to increase traffic on your video content. ", "All you need are tools like PicMonkey or Canva, and to remember the secret numbers: 1920 X 1080!", "\n\nAs you know, #ProjectClarence is a nod to Clarence the Angel, in “It’s a Wonderful Life” the holiday movie classic that has forever cemented the relationship of Christmas and Suicide Prevention. ", "Whatever you celebrate this season, #ProjectClarence is a time to road test 1 new social media skill for the few weeks of hiatus, until our first show of 2018 (1/22/18, 9pCT).", "\n\nThis year we’ll be discussing how we’re using video thumbnails to increase traffic to your suicide prevention video content. ", "Maybe you’ll make a video that dispels myths about the holidays and suicide (historically the period of the year with the LOWEST suicide mortality rates in the US). ", "Make a #ProjectClarence thumbnail and be sure to tag #SPSM!", "\n\nWe’ll go from SPSM YouTube thumbnails that look like this (OUCH!):", "\n\nTo this:\n\nWatch us LIVE here:\n\nIf you want to find past years’ episodes of #ProjectClarence, check out our blogs, listed below:" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008793431334197521, 0.0005695323925465345, 0.0012363995192572474, 0.0008171740337274969, 0.0006109824171289802, 0.0008697481243871152, 0.001266187522560358, 0.006352373398840427, 0.04062311351299286, 0.0008818425703793764 ]

[ "Case Study RWTH University\n\nThe Assignment\n\nRWTH Aachen is Germany’s largest research and technical university located in Aachen, North Rhine-Westphalia. ", "With over 40,000 students, it numbers amongst its alumni several scientists who won Nobel Prizes for physics or chemistry.", "\n\nWith an increasing number of students graduating year on year, the university wanted to ensure that it had a sufficient number of classrooms to provide an optimal learning environment for its students. ", "To meet this need, RWTH constructed a purpose-built teaching facility to accommodate up to 4,200 students.", "\n\nOn top of this, the university sought a separate auditorium to provide soundproofed lecture facilities for a further 1,000 students on a site located near a railway track.", "\n\nThe Solution\n\nNeptunus specified one of its semi-permanent Evolution structures for the auditorium. ", "Despite being a re-locatable building, the Evolution has the appearance and functionality of a permanent building. ", "Equipped with central heating, air conditioning and a Wireless Local Area Network (WLAN), the structure contains all the features needed to create a comfortable environment for students.", "\n\nThe modular nature of the Evolution allows it to be easily modified or re-deployed at any point in the future. ", "At the same time, the aluminium structure is strong, stable and durable - capable of withstanding the harshest of conditions and offering the same safety standards as a permanent building.", "\n\nBased on a highly technical and innovative design with durable components, the Evolution is suitable for longer-term use. ", "The building comes as standard with insulated, rigid wall panels to retain heat and minimise external noise plus an aluminium space-frame roof for a quick and simple installation.", "\n\nThe Challenge\n\nRWTH Aachen was looking to solve their capacity problems. ", "It was of upmost importance that 1000 students could be accommodated in a lecture hall within a short period of time. ", "The chosen location of the hall was near a railroad track. ", "Given the function of the room, it was essential that this accommodation is soundproof.", "\n\nThe Verdict\n\n“The auditorium is situated right next to a train track so we needed optimal soundproof walls,” says the project leader at the RWTH Aachen. “", "Despite the capacity challenges we want to continue providing our students with the best possible surroundings to assist their education. ", "Neptunus was without doubt the perfect partner to help us with our capacity problem and they provided us with the ideal solution.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005731674027629197, 0.0006338269449770451, 0.0005167040508240461, 0.0006658146157860756, 0.000602304469794035, 0.0006746998988091946, 0.0006500128656625748, 0.0005705046351067722, 0.0005536674289032817, 0.0006029129726812243, 0.0005391275626607239, 0.0006548728561028838, 0.0006443752790801227, 0.0005646674544550478, 0.0006755676004104316, 0.0005487914313562214, 0.0005520367994904518, 0.0005293041467666626, 0.000848024501465261 ]

[ "1. ", "Introduction {#sec1-ijms-18-01877}\n===============\n\nHexavalent chromium (Cr(VI)) is widely distributed in the environment and commonly used in industries. ", "It has been demonstrated that Cr(VI) can cause lung cancer through occupational exposure to contaminated air \\[[@B1-ijms-18-01877]\\]. ", "However, the general population is exposed to Cr(VI) through consumption of contaminated drinking water, which results in severe public health issues \\[[@B2-ijms-18-01877]\\]. ", "The United State National Toxicology Program conducted short-term and long-term toxicity and carcinogenicity studies on Cr(VI) in drinking water, and reported that Cr(VI) caused oral and small intestine cancer, and liver injury in rodents \\[[@B3-ijms-18-01877]\\]. ", "Human oral exposure to Cr(VI) has been shown to produce hepatotoxicity and provided evidence that Cr(VI) accumulation occurs mostly in the liver---The largest detoxification organ by oral exposure route \\[[@B4-ijms-18-01877],[@B5-ijms-18-01877]\\]. ", "Moreover, Cr(VI) may cause primary liver cancer and increase the risk of deterioration of cancer patients \\[[@B6-ijms-18-01877],[@B7-ijms-18-01877]\\]. ", "The mechanism of Cr(VI)-induced hepatotoxicity is still not fully understood. ", "Previous studies indicated that Cr(VI) could cause liver damage through the formation of DNA double-strand breaks and Cr-DNA adducts in the nuclear DNA \\[[@B4-ijms-18-01877]\\]. ", "It has also been shown that mitochondrial dysfunction could be caused by Cr(VI) exposure: Cr(VI) could reduce mitochondrial DNA (mtDNA) copy number and inhibit mitochondria electron transport chain complex I, resulting in perturbation of mitochondrial respiration and redox homeostasis \\[[@B8-ijms-18-01877],[@B9-ijms-18-01877]\\]. ", "These reports indicate that mitochondrion is one of the most sensitive targets of Cr(VI) toxicity.", "\n\nMitochondrial biogenesis is among the self-repairing and compensatory mechanisms that can be activated by cellular stress and inflammatory response or in response to environmental stimuli to maintain energetic and redox homeostasis \\[[@B10-ijms-18-01877]\\]. ", "Cell respiratory defects and reactive oxygen species (ROS) production can activate mitochondrial biogenesis as an adaptive strategy to respond to diverse mitochondrial disturbances \\[[@B11-ijms-18-01877]\\]. ", "One main regulator of mitochondrial biogenesis is the peroxisome-proliferator-activated receptor γ coactivator-1α (PGC-1α) \\[[@B12-ijms-18-01877]\\], which is modulated by the binding of cAMP response element-binding protein (CREB), the activating transcription factor (ATF2), and the forkhead box class-O (FOXO1) \\[[@B13-ijms-18-01877]\\]. ", "PGC-1α interacts with CREB and several other transcriptional factors to control other downstream factors, including nuclear respiratory factor 1 (NRF-1) and NRF-2, and to regulate the subsequent transcription of multiple genes involved in mitochondrial biogenesis and energy metabolism \\[[@B14-ijms-18-01877]\\]. ", "Mitochondrial biogenesis takes place as part of the normal cell proliferation process to maintain the increasing cell mass in general conditions. ", "When it encounters cellular stress, mitochondrial biogenesis is extended to sustain ATP supply and to keep up with the increasing energy demand \\[[@B15-ijms-18-01877]\\]. ", "PGC-1α, NRF-1 and NRF-2 are primarily localized in the cytoplasm under general physiological conditions. ", "However, in response to stress, nuclear genes related to mitochondrial biogenesis translocate to the nucleus and bind to downstream transcription factors to process their transcriptional activity. ", "Consequently, transcription of genes related to mitochondrial biogenesis is initiated \\[[@B16-ijms-18-01877],[@B17-ijms-18-01877]\\], and includes an increase of mitochondrial transcription factor A (TFAM) \\[[@B18-ijms-18-01877]\\], which functions to replicate and transcribe mtDNA, promoting mitochondrial biogenesis, and possibly packing and repairing of mtDNA to prevent damage \\[[@B19-ijms-18-01877]\\].", "\n\nIt has been well established that Cr(VI) can disrupt mitochondrial function in liver cells. ", "However, whether mitochondrial biogenesis is involved in Cr(VI)-induced hepatotoxicity is unclear. ", "In the present study, we used Human Hepatocellular Carcinoma cells (HepG2) as a model to investigate the effect of Cr(VI) on mitochondrial biogenesis.", "\n\n2. ", "Results {#sec2-ijms-18-01877}\n==========\n\n2.1. ", "Cr(VI) Induces Cytotoxicity and Cell Death in HepG2 Cells {#sec2dot1-ijms-18-01877}\n--------------------------------------------------------------\n\nCytotoxicity experiments were performed to estimate sub-cytotoxic concentrations of Cr(VI) by determining cell viability and lactate dehydrogenase (LDH) release. ", "After exposure to Cr(VI) for 24 h, HepG2 cells did not exhibit any change in cell viability at concentrations lower than 10 μM. However, the cell viability was significantly decreased in a concentration-dependent manner over a range of Cr(VI) concentrations between 20 and 80 μM. In the LDH release assay, Cr(VI) significantly and concentration-dependently increased LDH release. ", "Apoptotic cell death was confirmed by increased activation of caspases-3/7 and caspase-8 in HepG2 cells exposed to Cr(VI) at different concentrations. ", "Apoptotic cells with activated caspase-3/7 exhibited bright green nuclei, whose intensity increased with increasing concentrations of Cr(VI) ([Figure 1](#ijms-18-01877-f001){ref-type=\"fig\"}D). ", "The mRNA levels of caspase-3 and caspase-8 were consistent with the caspase-3/7 staining change. ", "Based on the results above, it is believed that Cr(VI) induced cytotoxicity and cell death in HepG2 cells, and that these cells could tolerate Cr(VI)-induced insult at lower range concentrations up to 10 μM.\n\n2.2. ", "The Effect of Cr(VI) on the mRNA Level of Inflammatory Cytokines and Redox Reaction in HepG2 Cells {#sec2dot2-ijms-18-01877}\n-------------------------------------------------------------------------------------------------------\n\nThe mRNA levels of tumor necrosis factor (*TNF*) and interleukin 1-β (*IL-1β* ) were increased in a concentration-dependent manner ([Figure 2](#ijms-18-01877-f002){ref-type=\"fig\"}A,B). ", "As pro-inflammatory cytokines are driven by toll-like receptor (TLR)-mediated signals, *TLR2* and *TLR4* expression was examined by real-time qPCR, which showed that both *TLR2* and *TLR4* mRNA levels were significantly upregulated ([Figure 2](#ijms-18-01877-f002){ref-type=\"fig\"}A). ", "Cells stained with CellROX**^®^** Green and analyzed by a plate reader revealed that Cr(VI) increased ROS levels in a concentration-dependent manner ([Figure 2](#ijms-18-01877-f002){ref-type=\"fig\"}B). ", "However, the antioxidant enzymes superoxide dismutase (*SOD1*, *SOD2*), glutathione S-transferase O 1 (*GSOT1*), nuclear respiratory factor 2 (*NRF-2*) and kelch like ECH associate protein 1 (*KEAP1*) mRNA levels were upregulated at Cr(VI) concentrations up to 10 μM, which tended to decrease at 20 μM ([Figure 2](#ijms-18-01877-f002){ref-type=\"fig\"}C,D).", "\n\n2.3. ", "Exposure to Low Concentrations of Cr(VI) Induces Adaptive Upregulation of Mitochondrial Biogenesis {#sec2dot3-ijms-18-01877}\n-------------------------------------------------------------------------------------------------------\n\nTo evaluate mitochondrial biogenesis, mtDNA copy number and mitochondrial mass were examined. ", "Increase in mtDNA copy number and mitochondrial mass was observed in HepG2 cells exposed to up to 10 μM of Cr(VI), followed by a decrease at 20 μM ([Figure 3](#ijms-18-01877-f003){ref-type=\"fig\"}A,B). ", "Mitochondrial function was assessed by complex I (NADH: ubiquinone oxidoreductase subunit A1 (NDUFA1) or NADH: ubiquinone oxidoreductase subunit B1 (NDUFB1)) and complex V (ATP synthase, H+ transporting, mitochondrial Fo complex subunit F6 (ATP5J) or ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit (ATP5O)). ", "The mRNA level of *NDUFA*1, but not of *NDUFB1*, was significantly increased at concentrations up to 10 μM of Cr(VI), while the highest concentration produced statistically significant decrease of both *NDUFA1* and *NDUFB1*. *", "ATP5J* and *ATP5O* mRNA expression was upregulated at concentrations up to 10 μM of Cr(VI), but decreased at 20 μM ([Figure 3](#ijms-18-01877-f003){ref-type=\"fig\"}D).", "\n\n2.4. ", "Upregulation of PGC-1α Expression and Its Downstream Targets at Low Concentrations of Cr(VI) {#sec2dot4-ijms-18-01877}\n-------------------------------------------------------------------------------------------------\n\nImmunofluorescence, real-time qPCR and Western blot analyses were performed to investigate the expression of PGC-1α and its downstream targets, which regulate mitochondrial biogenesis. ", "There was a concentration-dependent increase in PGC-1α translocation into the nucleus after exposure to up to 10 μM of Cr(VI) for 24 h. Afterwards, the response declined and became fragmented at the highest Cr(VI) concentration ([Figure 4](#ijms-18-01877-f004){ref-type=\"fig\"}A). ", "NRF-1 exhibited similar translocation from the cytoplasm into the nucleus, while the expression of COX II showed no changes after exposure to Cr(VI) ([Figure 4](#ijms-18-01877-f004){ref-type=\"fig\"}A). ", "The fluorescence of TFAM was increased and localized in the mitochondria after exposure to 5 or 10 μM of Cr(VI) for 24 h, but declined at 20 μM. Interestingly, exposure to 40 μM of Cr(VI) caused mitochondrial filament elongation, and both mitochondria and TFAM were fragmented and localized to the nuclear perimeter ([Figure 4](#ijms-18-01877-f004){ref-type=\"fig\"}A). ", "The mRNA and protein expression levels of PGC-1α, NRF-1, and TFAM were upregulated, reaching a peak at 10 μM of Cr(VI), which declined thereafter ([Figure 4](#ijms-18-01877-f004){ref-type=\"fig\"}B,C).", "\n\n2.5. ", "Expression of Genes Involved in Mitochondrial Biogenesis Pathway after Exposure to Cr(VI) in HepG2 Cells {#sec2dot5-ijms-18-01877}\n-------------------------------------------------------------------------------------------------------------\n\nTo better understand the mechanism of mitochondrial biogenesis activation by low concentration of Cr(VI), genes involved in mitochondrial biogenesis pathways were analyzed by real-time qPCR. ", "mRNA expression of *FOXO1*, *SRIT1*, *AKT1* and *CREB1* was similarly increased, reaching a peak at 10 μM of Cr(VI), but showing a tendency to decrease thereafter ([Figure 5](#ijms-18-01877-f005){ref-type=\"fig\"}A,B). *", "MAPK1* and *PTEN* mRNA levels were decreased in a concentration-dependent manner ([Figure 5](#ijms-18-01877-f005){ref-type=\"fig\"}A,B), without exhibiting any significant change at low concentrations of Cr(VI).", "\n\n2.6. ", "The Effect of α-Tocopherol on Mitochondrial Biogenesis in HepG2 Cells Exposed to Cr(VI) {#sec2dot6-ijms-18-01877}\n--------------------------------------------------------------------------------------------\n\nAs Cr(VI) disturbed mitochondrial biogenesis and induced redox imbalance, HepG2 cells were pretreated with antioxidant α-tocopherol to investigate whether this component could protect mitochondrial biogenesis. ", "After incubation with 50 μM of α-tocopherol 2 h before Cr(VI) exposure, cell viability was restored ([Figure 6](#ijms-18-01877-f006){ref-type=\"fig\"}A). ", "Furthermore, mitochondrial biogenesis, comprising recovering mtDNA copy number and mitochondrial mass, and the mitochondrial biogenesis regulators PGC-1α, NRF-1, NRF-2 and TFAM were maintained in a normal range ([Figure 6](#ijms-18-01877-f006){ref-type=\"fig\"}B--E). ", "These results indicate that α-tocopherol can regulate mitochondrial biogenesis to resist Cr(VI) toxicity, and that mitochondrial biogenesis may be a sensitive target of Cr(VI) poisoning and detoxification.", "\n\n3. ", "Discussion {#sec3-ijms-18-01877}\n=============\n\nPresence of Cr(VI) in drinking water is a major public health concern worldwide. ", "Drinking water contaminated with Cr(VI) causes liver injury and may increase the risk of primary liver cancer. ", "In this study, we found that LDH release started at 5 μM of Cr(VI) without changing cell viability until reaching concentrations up to 10 μM in HepG2 cells. ", "We speculate that LDH assay is more sensitive to detect cytotoxicity than the resazurin assay and could indicate that HepG2 cells might be able to tolerate concentrations of Cr(VI) up to a toxic threshold. ", "Thus, we suspect the presence of a protective mechanism to help HepG2 cells survive from Cr(VI) insult.", "\n\nMitochondrial biogenesis is one of the major compensating mechanisms in response to cellular stress. ", "In the present study, mitochondrial biogenesis, comprising mtDNA copy number and mitochondrial mass, was increased, reaching a peak at 10 μM of Cr(VI). ", "This event was also accompanied by upregulation of mRNA levels of *NDUFA1* and *NDUFB1*, *ATP5J* and *ATP5O*, and antioxidant enzymes, including *SOD1*, *SOD2* and *GSOT1*. ", "At up to 20 μM of Cr(VI), mitochondrial biogenesis tended to decrease, exhibiting a concomitant increase in the mRNA expression of inflammatory cytokines and ROS, and inhibition of the antioxidant enzymes. ", "These results indicate that mitochondrial biogenesis was adaptively upregulated to confront cellular stress at low concentrations of Cr(VI) in HepG2 cells. ", "Small amounts of inflammatory cytokines and ROS production, which act as a retrograde nuclear signal, can improve mitochondrial biogenesis with adaptation to the stressor. ", "Consistently, our results showed that Cr(VI) increased *TLR2/4* mRNA expression, and, subsequently, elevated ROS accumulation and *TNF* and *IL-1β* mRNA level in a concentration-dependent manner. ", "Evidences have suggested that toll-like receptors (TLRs) play critical roles in the pathophysiological process of a variety of liver diseases, such as hepatitis B and hepatitis C \\[[@B20-ijms-18-01877]\\]. ", "TLR-2/4 activation leads to the production of pro-inflammatory cytokines IL-6 and TNF-α in hepatic NPCs and Hepatocytes \\[[@B21-ijms-18-01877]\\]. ", "Suliman et al. ", "\\[[@B22-ijms-18-01877]\\] demonstrated that, in the rat liver and heart, lipopolysaccharide stimulates mitochondrial biogenesis in response to inflammatory cell damage. ", "They also revealed the simultaneous occurrence of mtDNA damage and compensatory mitochondrial biogenesis after exposure to *Escherichia coli* that resulted from the activation of TLR4 signaling pathways and nuclear factor-κB (NF-κB)-dependent cytokine production \\[[@B22-ijms-18-01877]\\].", "\n\nSlightly ROS accumulation and intense inflammation increase the transcriptional activity of NRF-1 and NRF-2 and induce expression of PGC-1α/β to promote detoxification through direct induction of antioxidant defenses, including superoxide dismutase 2 (SOD2), catalase and glutathione peroxidase \\[[@B23-ijms-18-01877],[@B24-ijms-18-01877]\\]. ", "In the present study, low concentrations of Cr(VI) increased *PGC-1α*, *SOD1* and *SOD2* mRNA level as well as *NRF-2* and *KEAP1* mRNA expression. ", "Many genes encoding antioxidant enzymes are regulated by the NRF-2/KEAP1 pathway \\[[@B10-ijms-18-01877]\\]. ", "In addition, NRF-2 and its downstream factors can be activated by ROS to generate signals, resulting in co-induction of genes for mitochondrial biogenesis and countering inflammation. ", "However, when the increasing toxicity of Cr(VI) overwhelms the cytoprotective capacity, the adverse effects could result in mitochondrial dysfunction and cell death \\[[@B15-ijms-18-01877]\\]. ", "It has been reported that mitochondrion is the sensitive target that can be perturbed by Cr(VI) \\[[@B25-ijms-18-01877]\\]. ", "Mitochondrial dysfunction is linked to oxidative stress and inflammatory response, and accumulating evidence has shown that mitochondrial dysfunction could be aggravated by increased mtROS generation, extracellular ATP and mtDNA release. ", "This outcome was also demonstrated in the present study, as, at a high concentration of Cr(VI), mitochondrial biogenesis collapsed, accompanied by strong inhibition of *NDUFA1*, *NDUFB1*, *ATP5O* and *ATP5J* mRNA levels. ", "Disturbance of mitochondrial function can induce cell apoptosis, and we evidenced that Cr(VI) caused apoptosis in a concentration-dependent increase. ", "Cr(VI) induced oxidative stress and inflammatory response at low concentrations that triggered adaptively upregulated mitochondrial biogenesis and protective cell apoptosis. ", "Nonetheless, when the adverse effects exceed the cell toxic tolerance, mitochondrial function collapses as a result of ATP depletion, and cell death switches to necrosis. ", "This could be explained by the increased LDH release after Cr(VI) exposure, which is indicative of necrotic cell death \\[[@B26-ijms-18-01877]\\].", "\n\nPGC-1α/NRF-1/2-TFAM are the most acceptable regulators involved in mitochondrial biogenesis \\[[@B27-ijms-18-01877]\\]. ", "PGC-1α is the principal regulator of mitochondrial biogenesis that interacts with key nuclear transcription factors NRF-1 and NRF2, whose activation can trigger TFAM expression and then regulation of mtDNA replication and transcription \\[[@B18-ijms-18-01877]\\]. ", "In this study, both mRNA and protein levels of PGC-1α, NRF-1, NRF-2 and TFAM were upregulated at low concentration of Cr(VI) in HepG2 cells. ", "In addition, we also observed that PGC-1α and NRF-1 translocated to the nucleus, and TFAM became highly expressed in the mitochondria. ", "These data suggested that a certain extent of cellular stress can activate mitochondrial biogenesis by promoting PGC-1α, *NRF-1* and *TFAM* expression and translocation to protect the cell from Cr(VI) insult.", "\n\nMitochondrial biogenesis is regulated by multiple metabolic sensors, including silent information regulator-1 (SIRT1), MAPK, AKT, CREB, PTEN, among others \\[[@B28-ijms-18-01877]\\]. ", "We analyzed the potential involvement of sensors to regulate mitochondrial biogenesis, and found that low concentrations of Cr(VI) significantly elevated the mRNA levels of *SIRT1*, *CREB1*, *AKT1* and *FOXO1*, but not the levels of *AMPK1* and *PTEN*. ", "A number of studies have reported that silent information SIRT1 deacetylation can activate PGC-1α \\[[@B29-ijms-18-01877]\\] and is responsible for PTEN deacetylation. ", "Li et al revealed that higher levels of SIRT1 was expressed in HCC specimens in comparison to normal liver tissues and cells, indicating that SIRT1 can facilitate hepatocellular carcinoma metastasis by upregulating mitochondrial biogenesis and PI3K/AKT signaling pathway \\[[@B30-ijms-18-01877]\\]. ", "PTEN can be regulated by ROS, which can also be inhibited by the enhanced ROS-dependent insulin signaling \\[[@B31-ijms-18-01877]\\]. ", "Consistent with our results, mRNA level of *PTEN* was decreased after exposure to Cr(VI), following the increased ROS production. ", "PTEN can negatively regulate PI3K/AKT signaling pathway, a factor also demonstrated by the obtained data: When *PTEN* was decreased by Cr(VI), the mRNA level of *AKT1* was elevated at low concentrations of Cr(VI); but when the cells were exposed to higher concentrations, both mRNA levels of *PTEN* and *AKT1* were downregulated, probably as a consequence of the sub-cytotoxic effect exerted by this compound. ", "The activation of AKT induces the phosphorylation of FOXO1, leading to the exclusion of this protein from the nucleus to the cytoplasm. ", "Tobita et al reported that inhibition of SIRT1 could impair AKT/FOXO1 pathways, causing increased gluconeogenesis in human hepatocytes \\[[@B32-ijms-18-01877]\\]. ", "Puigserver et al. ", "showed that PGC-1α interacted with and co-activated FOXO1 in hepatocytes \\[[@B33-ijms-18-01877]\\]. ", "Moreover, FOXO-PGC-1α interaction is known to be involved in oxidative stress protection in vascular endothelium \\[[@B34-ijms-18-01877],[@B35-ijms-18-01877]\\]. ", "Activation of the cAMP-CREB pathway results in phosphorylation of CREB (p-CREB), which binds the CREB-response element located proximal to the PGC-1α prompter, activating its transcription \\[[@B36-ijms-18-01877]\\]. ", "Consistent with the above evidence, SITR1/CREB1/ATK1 pathways might be activated to promote mitochondrial biogenesis against Cr(VI) insult. ", "However, when mitochondrial biogenesis is collapsed by high concentration of Cr(VI), with the inhibition of protective mechanisms, the cells tended to die. ", "In the present study, we only analyzed the mRNA levels of the factors potentially involved in mitochondrial biogenesis, but it would be interesting to investigate the deacetylation and phosphorylation levels of these factors in future studies to better understand the molecular mechanism involved in Cr(VI) cytotoxicity.", "\n\nTherefore, we propose that mitochondrial biogenesis is a key adaptive mechanism to resist Cr(VI) hepatotoxicity. ", "Addition of antioxidant supplements to the diet has been shown to maintain mitochondrial biogenesis to protect cells from death \\[[@B37-ijms-18-01877],[@B38-ijms-18-01877]\\]. ", "Previous studies reported that α-tocopherol exerted a protective role in Cr(VI)-induced oxidative damage \\[[@B39-ijms-18-01877],[@B40-ijms-18-01877],[@B41-ijms-18-01877]\\]. ", "Our results corroborate this finding as, at lower concentrations of Cr(VI), α-tocopherol inhibited the adaptive upregulated genes, maintaining the mitochondrial biogenesis within the normal range. ", "This indicates that pretreatment with α-tocopherol could block the adaptive increasing mitochondrial biogenesis \\[[@B42-ijms-18-01877]\\]. ", "Truksa et al. ", "reported that mitochondrially targeted α-tocopherol succinate could reduce the level of mtDNA transcripts in cancer cells but not in normal tissue \\[[@B43-ijms-18-01877]\\], suggesting that α-tocopherol may depress the overexpression of mitochondrial biogenesis, which, in turn, could regulate mitochondrial homeostasis. ", "However, α-tocopherol restored mitochondrial biogenesis at high concentrations of Cr(VI), indicating that α-tocopherol could protect cells from protect cells from Cr(VI)-induced damage through modulating mitochondrial biogenesis. ", "Pretreatment with α-tocopherol resulted in a very strong protective role against Cr(VI)-induced hepatotoxicity and it seems that the possible mechanism involved might be similar to the mechanisms of other antioxidants, such as *N*-acetylcysteine (NAC) \\[[@B44-ijms-18-01877]\\]. ", "On the one hand, α-tocopherol effects could be attributed to extracellular reduction to prevent the cellular uptake of Cr(VI). ", "Pretreatment of cells with α-tocopherol might also be able to participate in the intracellular reduction of Cr(VI), which is expected to elevate the level of intercellular α-tocopherol to increase the capacity of ROS scavenging and maintain mitochondrial homeostasis. ", "Nevertheless, the mechanistic explanation of cellular responses to α-tocopherol is still unclear, and needs to be fully investigated.", "\n\n4. ", "Materials and Methods {#sec4-ijms-18-01877}\n========================\n\n4.1. ", "Materials {#sec4dot1-ijms-18-01877}\n--------------\n\nResazurin sodium salt, potassium dichromate (K~2~Cr~2~O~7~), α-tocopherol, and dimethyl sulfoxide (DMSO) were obtained from sigma (St. Louis, MO, USA). ", "DMEM medium, and fetal bovine serum (FBS) were purchased from Gibco (Thermo Fisher, Waltham, MA, USA). ", "All chemicals and solvents were analytical grade.", "\n\n4.2. ", "Cell Culture {#sec4dot2-ijms-18-01877}\n-----------------\n\nHuman hepatocellular carcinoma cells (HepG2) were kindly provided by Wang from the Cancer Research Center at Johns Hopkins University. ", "HepG2 cells were maintained in DMEM medium containing 10% fetal bovine serum (FBS) and a 1% mixture of penicillin and streptomycin in a 5% CO~2~ humidified atmosphere at 37 °C. ", "The medium was changed every other day, and the cells were passaged using trypsin.", "\n\n4.3. ", "Treatment and Cytotoxicity Assay {#sec4dot3-ijms-18-01877}\n-------------------------------------\n\nCells (1 × 10^5^) were plated in the 24-well plate with 500 μL of medium, and were allowed to grow to 80%--90% confluence. ", "HepG2 cells were exposed to different concentrations of K~2~Cr~2~O~7~ for 24 h. Cr(VI) working solution was prepared in Dulbecco's Modified Eafle's medium (DMEM) to reach final concentrations of 0, 5, 10, 20, 40, or 80 μM. Resazurin reduction assay was performed to determine cell viability after Cr(VI) treatment. ", "Fifty microliters of resazurin (1 mg/mL stock) was added to the 24-well plates (500 μL/well), which were incubated for 2 h at 37 °C. ", "Fifty microliters of color changed medium was transferred from each well to a 96-well plate and fluorescence was measured at 530 nm/590 nm (excitation/emission), using a multi-well fluorometric reader CytoFluor series 4000 (Applied Biosystems, Drive Foster, CA, USA). ", "Lactate dehydrogenase (LDH) assay (Promega, Madison, WI, USA) was performed to determine cytotoxicity after Cr(VI) treatment. ", "Fifty microliters of medium was transferred from each well to a 96-well plate and 50 μL of substrate mix was added to each well. ", "The 96-well plate was then incubated for 30 min at room temperature. ", "Subsequently, 50 μL of stop solution was added to each well and absorbance was measured at 560 nm using a plate reader. ", "Data are presented as mean ± SEM. ", "Three independent experiments in three replicates were performed.", "\n\n4.4. ", "Reactive Oxygen Species Measurement {#sec4dot4-ijms-18-01877}\n----------------------------------------\n\nTen thousand cells were seeded into the 96-well plate with 100 μL of medium, and after reaching 80% confluence, they were treated with different concentrations of Cr(VI) for 24 h. Cells were washed three times with serum-free medium. ", "One hundred microliters of medium containing CellROX**^®^** Green Reagent (Thermo Fisher Scientific, Waltham, MA, USA), at final concentration of 5 μM, was added to each well, and incubated for 30 min at 37 °C. ", "The cells were washed twice with PBS and 100 μL of PBS was added to each well. ", "The fluorescence was measured at 480/530 nm (excitation/emission) using a fluorometric reader (Applied Biosystems).", "\n\n4.5. ", "RNA Extraction and Quantitative Real-Time qPCR {#sec4dot5-ijms-18-01877}\n---------------------------------------------------\n\nOne million cells were plated in the 6-well plate with 2 mL of medium, and after reaching 80% confluence, they were treated with different concentrations of Cr(VI) for 24 h. Total RNA was extracted after treatment using Trizol (Thermo Fisher Scientific). ", "RNA quantity and purity were determined using NanoDrop 2000c (Thermo Fisher Scientific). ", "Five hundred nanograms of RNA was reverse-transcribed using the M-MLV Promega Reverse Transcriptase (Promega, Madison, WI, USA), according to the manufacturer's instructions. ", "The expression of genes was evaluated using TaqMan gene expression assays or SYBR Green assays. ", "Real time qPCR was performed using a 7500 Fast Real Time system machine (Applied Biosystems). ", "Fold changes were calculated using the 2(-*C*t) method. ", "GAPDH or 18 S was used as housekeeping gene for mRNA. ", "The primer sequences were showed in [Table 1](#ijms-18-01877-t001){ref-type=\"table\"} and [Table 2](#ijms-18-01877-t002){ref-type=\"table\"}.", "\n\n4.6. ", "Mito-Tracker Assay {#sec4dot6-ijms-18-01877}\n-----------------------\n\nOne hundred thousand cells were plated in the 24-well plate with coverslip in 500 μL of medium, and after reaching 80% confluence, they were treated with different concentrations of Cr(VI) for 24 h. Mito-tracker probe (Thermo Fisher Scientific) was added to each well at 50 nM final concentration, then incubated for 45 min at 37 °C. ", "Subsequently, the medium was removed and 500 μL of fresh medium was added to each well, and incubated for another 45 min at 37 °C. ", "The cells were washed twice with warm PBS and fixed in 4% paraformaldehyde; then washed twice with PBS and blocked with blocking solution (10% goat serum, 1% BSA, 0.15% saponin in PBS), and co-incubated with TFAM primary antibody.", "\n\n4.7. ", "Measurement of Mitochondrial Mass {#sec4dot7-ijms-18-01877}\n--------------------------------------\n\nTen thousand cells were seeded into the 96-well plate with 100 μL of medium, and after reaching 80% confluence, they were treated with different concentrations of Cr(VI) for 24 h. The mitochondrial mass was examined using the fluorescent probe 10-*N*-nonyl acridine orange (NAO). ", "The cells were protected from light and incubated in medium containing 5 μM NAO for 30 min at 37 °C. ", "NAO fluorescence intensity at 485 /530 nm (excitation/emission) was determined using a microplate Reader (Gemini EM, Molecular Devices, Sunnyvale, CA, USA).", "\n\n4.8. ", "Immunofluorescence {#sec4dot8-ijms-18-01877}\n-----------------------\n\nOne hundred thousand cells were plated in the 24-well plate with coverslip in 500 μL of medium, and after reaching 80% confluence, they were treated with different concentrations of Cr(VI) for 24 h. Cells were fixed in 4% paraformaldehyde, washed twice in PBS and then blocked for 30 min in blocking solution (10% goat serum, 1% BSA, 0.15% saponin in PBS) at room temperature. ", "They were incubated with primary antibody PGC-1α (1:50, Santa Cruz Biotechnology, Santa Cruz, CA, USA), NRF-1 (1:50, Santa Cruz Biotechnology), COXII (1:50, Santa Cruz Biotechnology) and TFAM (1:50, Santa Cruz Biotechnology) for 24 h at 4 °C; washed 3 times with PBS, and incubated with Goat anti-Mouse IgG/IgM(H+L) secondary antibody, Alexa Fluor 488, 1:500, or Goat anti-Rabbit IgG/IgM(H+L) secondary antibody, Alexa Fluor 568, 1:500, (Thermo Fisher Scientific) for another 1 h at room temperature. ", "Nuclei were stained with Hoechst for 5 min, and mounted on slides with coverslips. ", "Images were taken using a Zeiss UV-LSM 510 confocal microscope (Zeiss, Oberkochen, Germany).", "\n\n4.9. ", "Caspase-3/7 Staining {#sec4dot9-ijms-18-01877}\n-------------------------\n\nOne hundred thousand cells were plated in the 24-well plate with coverslip in 500 μL of medium, and after reaching 80% confluence, they were treated with different concentrations of Cr(VI) for 24 h. Cells were washed twice with serum-free medium. ", "Five hundred microliters of medium containing Caspase-3/7 Green Detection Regent (Thermo Fisher Scientific), at final concentration of 5 μM, was added to each well, and incubated for 30 min at 37 °C. ", "The cells were washed twice with PBS, and 250 μL of 4% paraformaldehyde was added to the wells. ", "The cells were then incubated for 20 min at room temperature. ", "Nuclei were stained with Hoechst for 5 min, and mounted on slides with coverslips. ", "Images were taken using a Zeiss UV-LSM 510 confocal microscope.", "\n\n4.10. ", "Western Blot Analysis {#sec4dot10-ijms-18-01877}\n---------------------------\n\nOne million cells were plated in the 6-well plate with 2 mL of medium, and after reaching 80% confluence, they were treated with different concentrations of Cr(VI) for 24 h. The cells were collected for protein extraction using lysis buffer. ", "An equal amount of concentrated proteins was loaded on 4--15% gradient SDS-polyacrylamide gel and transferred to a polyvinylidene difluoride membrane by electroblotting at 200 mA, 4 °C for 2 h. The membrane was blocked with 5% non-fat dry milk solution (TBS, 0.5% Tween-20, pH 7.4) for 1 h at 4 °C. ", "The membrane was incubated with primary rabbit anti-PGC-1α monoclonal antibody (Santa Cruz Biotechnology) diluted 1:500, or goat anti-rabbit TFAM (1:500, Santa Cruz Biotechnology), NRF-1 antibody (1:500, Santa Cruz Biotechnology), and anti-GAPDH primary antibody (1:2000, Cell signaling Technology, Danvers, MA, USA) in blocking solution overnight at 4 °C. ", "The membrane was washed thoroughly with TBST (50 mM Tris, 150mM NaCl, 0.1% Tween 20, PH 7.4) buffer and then incubated for 1 h with horseradish peroxidase-conjugated anti-rabbit IgG antibody (1:3000; Santa Cruz Biotechnology) in blocking solution, detected by chemiluminescence reagent plus, and exposed to film.", "\n\n4.11. ", "Statistical Analysis {#sec4dot11-ijms-18-01877}\n--------------------------\n\nData were expressed as mean ± standard error of the mean (SEM). ", "Comparisons of results were calculated by SPSS 19.0 software (version 19.0, IBM, Costa Mesa, CA, USA) using one-way analysis of variance, followed by the Fisher's least significant difference (LSD) to compare the difference between subgroups. ", "A level of *p* \\< 0.05 was considered significantly different.", "\n\n5. ", "Conclusions {#sec5-ijms-18-01877}\n==============\n\nOverall, the antioxidase system genes and mitochondrial biogenesis were upregulated at low concentrations of Cr(VI), indicating that a compensatory mechanism might be induced to defense the Cr(VI) insult. ", "However, if the damage overwhelms the cell protective capacity, the antioxidase system genes and mitochondrial biogenesis could be collapsed by Cr(VI). ", "However, pretreatment of α-tocopherol abolished excessive oxidative stress and inflammatory response, and maintained the mitochondrial biogenesis in balance, suggesting that maintenance of a homeostatic mitochondrial biogenesis level may be essential for survival of liver cells from Cr(VI) insult.", "\n\nThis study was supported in part by a grant from the Chinese National Natural Science Foundation (No.81172701); the Chinese Council Scholarship (201506370074); and the Graduate Student Innovation Project in the Hunan Province of China (CX2016B057). ", "The authors would like to extend their appreciation to the estimable colleagues for helping with this study.", "\n\nXiali Zhong and Caigao Zhong conceived and designed the experiments; Xiali Zhong performed the experiments; Xiali Zhong analyzed the data; Caigao Zhong contributed reagents/materials/analysis tools; Xiali Zhong and Rita de Cássia da Silveira e Sá wrote the paper.", "\n\nThe authors declare no conflict of interest.", "\n\nAKT1\n\nThreonine kinase 1\n\nAPT5O\n\nATP synthase, H\n\n\\+\n\ntransporting, mitochondrial F1 complex, O subunit\n\nATF2\n\nTranscription factor\n\nATP5J\n\nATP synthase, H\n\n\\+\n\ntransporting, mitochondrial Fo complex subunit F6\n\nCr(VI)\n\nHexavalent chromium\n\nCREB\n\ncAMP response element-binding protein\n\nFOXO1\n\nForkhead box class-O\n\nGSOT1\n\nGlutathione S-transferase omega 1\n\nHepG2\n\nHuman Hepatocellular Carcinoma cells\n\nIL-1β\n\nInterleukin 1-β\n\nKEAP1\n\nKelch like ECH associate protein 1\n\nLDH\n\nLactate Dehydrogenase\n\nMAPK1\n\nMitogen-activated protein kinase 1\n\nmtDNA\n\nMitochondrial DNA\n\nNDUFA1\n\nNADH: ubiquinone oxidoreductase subunit A1\n\nNDUFB1\n\nNADH: ubiquinone oxidoreductase subunit B1\n\nNRF\n\nNuclear respiratory factor\n\nPGC-1α\n\nPeroxisome-proliferator-activated receptor γ coactivator-1α\n\nPTEN\n\nPhosphatase and tensin homolog\n\nROS\n\nReactive oxygen species\n\nSIRT1\n\nSilent information regulator-1\n\nSOD\n\nSuperoxide dismutase\n\nTFAM\n\nMitochondrial transcription factor A\n\nTLRs\n\nToll-like receptors\n\nTNF\n\nTumor necrosis factor\n\n{#ijms-18-01877-f001}\n\n{#ijms-18-01877-f002}\n\n{#ijms-18-01877-f003}\n\n{#ijms-18-01877-f004}\n\n{#ijms-18-01877-f005}\n\n###### \n\nCr(VI) perturbed mitochondrial biogenesis, an effect restored by α-tocopherol in HepG2 cells. (**", "A**) Cell viability was assessed by resazurin reduction assays; (**B**) mtDNA copy number was measured by real-time qPCR; (**C**) mitochondrial mass of HepG2 cells exposed to Cr(VI) was detected by NAO fluorescence intensity; (**D**) gene expression related to mitochondrial biogenesis was quantified by real-time qPCR; (**E**) the **upper** panels show images of cells co-incubated with TFAM (green) and Mito-tracker (red); the **middle** panels show images of cells co-incubated with NRF-1 (green) and COXII (red); and the **lower** panels show images of PGC-α (green). ", "Images were captured by confocal microscopy with a 63× objective, scale bar: 10 μm. ", "Data are presented as mean ± SME of the values obtained in three independent experiments, each using triplicate cultures. ", "After outlier analysis, the number of values used in the calculation of the corresponding mean varied from six to nine. \\* ", "Compared with control, \\* *p* \\< 0.05; \\# Compared with Cr(VI) treatment group, \\# *p* \\< 0.05. ", "Abbreviations: nuclear respiratory factor 1, NRF-1; peroxisome-proliferator-activated receptor γ coativator-1 α, PGC-1α; mitochondrial transcription factor A, TFAM.", "\n\n![](", "ijms-18-01877-g006a)\n\n![](", "ijms-18-01877-g006b)\n\nijms-18-01877-t001_Table 1\n\n###### \n\nPrimers sequences used in SYBER Green Expression Assays.", "\n\n Gene Name Forward Primer (5′-3′) Reverse Primer (5′-3′)\n ------------- ------------------------- ---------------------------\n *PGC-1a* TCTGTGTCACTGTGGATTGGAG AGTTCAGGAAGATCTGGGCAA\n *Tfam* TGCGGTTTCCCTTCATCTCC ACTAGCGAGGCACTATGGGA\n *NRF-1* CCTGGTCCAGAACTTTACACAGA CACTCCGTGTTCCTCCATGA\n *NRF-2* AACCAGTGGATCTGCCAACT AAGTGACTGAAACGTAGCCG\n *SIRT1* GCGGTTCCTACTGCGCGA TCACTAGAGCTTGCATGTGAGG\n *MAPK1* GCCGAAGCACCATTCAAGTT GATGTCTGAGCACGTCCAGT\n *mtDNA* CAAACCTACGCCAAAATCCA GAAATGAATGAGCCTACAGA\n *AKT1* CAGGATGTGGACCAACGTGA AAGGTACGTTCGATGACAGT\n *CREB1* TTCAAGCCCAGCCACAGATT AGTTGAAATCTGAACTGTTTGGAC\n *PTEN* CTCCCAGACATGACAGCCA GCTTTGAATCCAAAAACCTTACTCA\n *Caspase3* TGGTTTTCGGTGGGTGTG CCACTGAGTTTTCAGTGTTCTC\n *Caspaase8* AGTCTGTACCTTTCTGGCGG TCTCCCAGGATGACCCTCTT\n *GAPDH* TGACAACAGCCTCAAGAT GAGTCCTTCCACGATACC\n\nijms-18-01877-t002_Table 2\n\n###### \n\nPrimers sequences used in TaqMan^®^ Gene Expression Assays.", "\n\n Assay Name Assay ID Catalog Number\n ------------ --------------- ----------------\n *18S* Hs99999901 4331182\n *ATP5J* Hs01081394_g1 4331182\n *ATP5O* Hs00919163 4331182\n *NDUFA1* Hs00915157_g1 4331182\n *NDUFB1* Hs00929425 4331182\n *TLR2* Hs02621280_s1 4331182\n *TLR4* Hs00152939_m1 4331182\n *TNF* Hs01113624_g1 4331182\n *IL-1β* Hs01555410_m1 4331182\n *SOD1* Hs00533490_m1 4331182\n *SOD2* Hs00167309_m1 4331182\n *GSTO1* Hs02383465_s1 4331182\n *FOXO1* Hs00231106_m1 4331182\n *KEAP1* hs01003430 4331182\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0009391900966875255, 0.00067505007609725, 0.006263666786253452, 0.001015842310152948, 0.0007546126726083457, 0.0008940706611610949, 0.004892244469374418, 0.000705424346961081, 0.0012773344060406089, 0.0008931519114412367, 0.000653151364531368, 0.0007172063924372196, 0.0005918575916439295, 0.0007765560294501483, 0.0007253290968947113, 0.0005767057300545275, 0.0005762966466136277, 0.0006297504878602922, 0.0006421360303647816, 0.0006811298662796617, 0.0007318914285860956, 0.0006156399613246322, 0.0005992685328237712, 0.001185585861094296, 0.0011059374082833529, 0.0009538657031953335, 0.0006390911876223981, 0.0010058153420686722, 0.0006188115803524852, 0.0006241044029593468, 0.0007191165932454169, 0.0008829562575556338, 0.0007057827897369862, 0.0006435699760913849, 0.0007060596253722906, 0.0013590181479230523, 0.0009234916651621461, 0.0005930540501140058, 0.000704577483702451, 0.0006776655209250748, 0.0006276885978877544, 0.001303607365116477, 0.0009661046206019819, 0.0006204217206686735, 0.0006159807089716196, 0.0007997634238563478, 0.0006005034665577114, 0.0012572675477713346, 0.0007210132316686213, 0.0006407446344383061, 0.0006255088374018669, 0.0012262470554560423, 0.0010327312629669905, 0.0005990206846036017, 0.0005598005373030901, 0.0007429863326251507, 0.00117425003554672, 0.0009041938465088606, 0.005479591432958841, 0.0006159452022984624, 0.0008411349263042212, 0.0009029433131217957, 0.0006573149585165083, 0.0005515905213542283, 0.0011271031107753515, 0.0006202452350407839, 0.0006338224047794938, 0.0008373640011996031, 0.0006693957257084548, 0.0006553942803293467, 0.0009120686445385218, 0.0008015873609110713, 0.0011120251147076488, 0.0007157898508012295, 0.0007769897929392755, 0.0006556982407346368, 0.0006620658095926046, 0.000598557002376765, 0.0012882824521511793, 0.00111386610660702, 0.0008655969286337495, 0.0006646319525316358, 0.0006217746413312852, 0.0007021844503469765, 0.0007132758037187159, 0.0012160189216956496, 0.0006461801822297275, 0.0007265418535098433, 0.0006470876978710294, 0.0007128032157197595, 0.0007434088038280606, 0.0005857266369275749, 0.0006143123609945178, 0.0009033650858327746, 0.0007550166337750852, 0.0007006563828326762, 0.0006457148119807243, 0.0008571089128963649, 0.0011982818832620978, 0.0008374645258300006, 0.0008955136872828007, 0.0009588037501089275, 0.0008836804772727191, 0.0008335633901879191, 0.0006622948567382991, 0.0009958924492821097, 0.0005388793651945889, 0.0007067052647471428, 0.0009720806847326458, 0.0008175354450941086, 0.0005772190634161234, 0.0007652110070921481, 0.0007932040025480092, 0.0007877976750023663, 0.0006826326716691256, 0.0008816847112029791, 0.0006431570509448647, 0.0007040999480523169, 0.000574581092223525, 0.0012900278670713305, 0.001034475164487958, 0.0007230823393911123, 0.0006267321878112853, 0.0007856685551814735, 0.0012962599284946918, 0.0006775857764296234, 0.00073075364343822, 0.0006612520082853734, 0.0013141067465767264, 0.0007156268693506718, 0.0006639886414632201, 0.0006386711029335856, 0.0005699068424291909, 0.0006569373072125018, 0.0006234332104213536, 0.0006016119732521474, 0.0005797888152301311, 0.0005886342842131853, 0.0005587208434008062, 0.0014217023272067308, 0.000659116602037102, 0.000614397635217756, 0.0006340554100461304, 0.0005917430971749127, 0.001345093478448689, 0.0006426410982385278, 0.0005498354439623654, 0.0005962205468676984, 0.0006417817785404623, 0.0006677881465293467, 0.03692329674959183, 0.0006101609906181693, 0.0006360056577250361, 0.001265891594812274, 0.0007500808569602668, 0.0005761826760135591, 0.0007975811022333801, 0.001356339082121849, 0.0006793978973291814, 0.0006732175243087113, 0.0005782036460004747, 0.0013733800733461976, 0.0007363302865996957, 0.0008012849721126258, 0.0007770249503664672, 0.0006114242132753134, 0.0013167514698579907, 0.0007206951850093901, 0.000593265809584409, 0.000717000279109925, 0.000575213402044028, 0.0007770249503664672, 0.0006375712109729648, 0.0012253148015588522, 0.0006483145407401025, 0.0006318544037640095, 0.0009042882011272013, 0.0015692597953602672, 0.0012484934413805604, 0.0006563856150023639, 0.0005532293580472469, 0.012807821854948997, 0.0013671480119228363, 0.000862599175889045, 0.0008010597084648907, 0.0007973785977810621, 0.000562639907002449, 0.0004982178215868771, 0.0007560036610811949, 0.0006131045520305634, 0.0031692085321992636, 0.0032803595531731844, 0.0008432221948169172, 0.000913575931917876, 0.0008461717516183853, 0.0005484462599270046, 0.0006811866769567132, 0.003105602227151394, 0.0009330657194368541, 0.0010634125210344791, 0.000559855776373297, 0.0006811866769567132, 0.0013954145833849907, 0.001988204661756754, 0.0005793184391222894, 0.0007546750130131841, 0.000559855776373297, 0.0006811866769567132, 0.0013954145833849907, 0.0008344550733454525, 0.0006300794775597751, 0.0007208953611552715, 0.001361388131044805, 0.000622574589215219, 0.0005484462599270046, 0.0006811866769567132, 0.0013954145833849907, 0.0008576117688789964, 0.0006828639307059348, 0.0005602921592071652, 0.0010204279096797109, 0.0005484462599270046, 0.0006811866769567132, 0.0013954145833849907, 0.0010504003148525953, 0.00069949880708009, 0.000582505133934319, 0.0005484462599270046, 0.0006811866769567132, 0.0016897862078621984, 0.0007460201159119606, 0.0012735376367345452, 0.001499048201367259, 0.0007465005037374794, 0.08435772359371185, 0.10660453140735626 ]

[ "Q:\n\nHow to set up callback channel on WCF service created via ChannelFactory?", "\n\nI need my WCF service to raise events to the clients. ", "I've read that that happens through callback channel, and I've implemented it in the following manner:\nService interfaces: \npublic interface IServiceCallback\n{\n [OperationContract(IsOneWay = true)]\n void OnNewAlert(Alert a);\n [OperationContract(IsOneWay = true)]\n void OnProductEdited(Product p);\n [OperationContract(IsOneWay = true)]\n void OnHighlightChanged(Dictionary<User, List<Product>> highlighted);\n [OperationContract(IsOneWay = true)]\n void OnCatalogUpdated();\n\n event EventHandler NewAlert;\n event EventHandler ProductEdited;\n event EventHandler HighlightChanged;\n event EventHandler CatalogUpdated;\n}\n[ServiceContract(CallbackContract = typeof(IServiceCallback))]\npublic interface IService : IDisposable\n{\n [OperationContract]\n List<Product> GetProducts(Predicate<Product> match = null, int limit = 0, string username = null);\n [OperationContract]\n Product GetProduct(Predicate<Product> match, string username = null);\n [OperationContract]\n Product GetRandomProduct(Predicate<Product> match = null, string username = null);\n [OperationContract]\n int GetFlagIndex(string flagName);\n [OperationContract]\n void SetFlag(string pid, string flagName, bool value);\n [OperationContract]\n List<Alert> GetAlerts(string username);\n [OperationContract]\n void DismissAlert(Alert alert, String username);\n [OperationContract]\n void HighlightProduct(List<string> pids, string user);\n [OperationContract]\n void EditProduct(string pid, Dictionary<string, object> fieldValues, string username = null);\n [OperationContract]\n void AttachModule(IModule m);\n [OperationContract]\n void Ping();\n\n event EventHandler NewAlert;\n event EventHandler ProductEdited;\n event EventHandler HighlightChanged;\n event EventHandler CatalogUpdated;\n}\n\nService implementation: \nnamespace Service\n{\n[ServiceBehavior(InstanceContextMode = InstanceContextMode.", "PerCall, ConcurrencyMode = ConcurrencyMode.", "Reentrant)]\npublic class ServiceInstance : IService\n{\n List<IServiceCallback> callbackChannels = new List<IServiceCallback>();\n //other vars\n\n public ServiceInstance()\n {\n //lots of stuff here\n }\n\n private User SignalUser(string username)\n {\n if (username == null)\n return null;\n\n IServiceCallback channel = OperationContext.", "Current.", "GetCallbackChannel<IServiceCallback>();\n if (!", "callbackChannels.", "Contains(channel)) //if CallbackChannels not contain current one.", "\n {\n callbackChannels.", "Add(channel);\n }\n\n User user = knownUsers.", "Find(p => p.username == username);\n if (user == null)\n {\n user = new User();\n user.username = username;\n user.highlighColor = Color.", "FromArgb(r.", "Next(0, 128), r.Next(0, 128), r.Next(0, 128));\n knownUsers.", "Add(user);\n foreach (KeyValuePair<Alert, List<User>> kvp in alerts)\n {\n kvp.", "Value.", "Add(user);\n }\n }\n user.lastOnline = DateTime.", "Now;\n if(!onlineUsers.", "Contains(user))\n onlineUsers.", "Add(user);\n\n return user;\n }\n\n //lots of other things here\n}\n}\n\nCallback implementation on Client: \nclass ServiceEventHandler : IServiceCallback\n{\n public event EventHandler NewAlert;\n public event EventHandler ProductEdited;\n public event EventHandler HighlightChanged;\n public event EventHandler CatalogUpdated;\n\n public void OnCatalogUpdated()\n {\n CatalogUpdated?.BeginInvoke(null, null, null, null);\n }\n\n public void OnHighlightChanged(Dictionary<User, List<Product>> highlighted)\n {\n HighlightChanged?.BeginInvoke(highlighted, EventArgs.", "Empty, null, null);\n }\n\n public void OnNewAlert(Alert a)\n {\n NewAlert?.BeginInvoke(a, EventArgs.", "Empty, null, null);\n }\n\n public void OnProductEdited(Product p)\n {\n ProductEdited?.BeginInvoke(p, EventArgs.", "Empty, null, null);\n }\n}\n\nBut here is my problem:\nOn the client side, I'm supposed to pass it to the service like this: \nEventHandler eventHandler = new EventHandler();\nMyServiceClient client = new MyServiceClient(new InstanceContext(eventHandler));\n\naccording to this StackOverflow answer:\nhttps://stackoverflow.com/a/1143777/2018696\nBut I don't connect to my service like this, because my client does not know about the implementation of the service, it only knows the two interfaces!", "\nSo I connect like this:\n public static IService GetService(string serviceAddress)\n {\n Uri service_uri = new Uri(serviceAddress);\n var endpoint = new EndpointAddress(service_uri, new[] { AddressHeader.", "CreateAddressHeader(settings[\"username\"], \"\", \"\") });\n IService service = ChannelFactory<IService>.CreateChannel(new BasicHttpBinding(), endpoint);\n return service;\n }\n\nSo how do I get the callbacks to work?", "\nUPDATE:\nOk, so as proposed by a comment, I replaced ChannelFactory with DuplexChannelFactory and BasicHTTPBinding with WsDualHTTPBinding, and I don't get response from the server. ", "I do get response with BasicHTTPBinding if I scratch the callback handler. ", "So essentially:\n[ServiceContract]\nBasicHttpBinding();\nChannelFactory<IService>.CreateChannel(binding, endpoint);\n\n^ this works\n[ServiceContract(CallbackContract = typeof(IServiceCallback))]\nWSDualHttpBinding(WSDualHttpSecurityMode.", "None);\nDuplexChannelFactory<IService>.CreateChannel(new InstanceContext(handler), binding, endpoint);\n\n^ this doesn't.", "\nIt works on localhost, but not on LAN or Internet. ", "Firewalls are off on both server and client. ", "I'm getting 60 second timeout when I try to contact the server.", "\n\nA:\n\nI have discovered that my connection issues are due to no port forwarding being set on the path to the client. ", "Since I can't ensure proper port access to clients, I have reverted back to non-callback model, and will be using regular request from clients to receive accumulated event data from the service. ", "Probably not efficient, but a foolproof method that seems to be working so far. ", "Thank you all for your attention.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006667168927378953, 0.0006074098637327552, 0.0011831766460090876, 0.0010633851634338498, 0.0021749320439994335, 0.0008196262060664594, 0.001419543637894094, 0.000695251626893878, 0.0006597712053917348, 0.0007058346527628601, 0.0008294496801681817, 0.0014197275741025805, 0.001089210039936006, 0.0009455208200961351, 0.0007915787282399833, 0.0007423518691211939, 0.0008416512864641845, 0.001101937610656023, 0.0007588526350446045, 0.0010463339276611805, 0.013817522674798965, 0.007690812926739454, 0.00374607159756124, 0.00082485779421404, 0.0008240289171226323, 0.0007834720308892429, 0.0007861399790272117, 0.0008451596950180829, 0.0006787814782001078, 0.0006588707328774035, 0.0009894133545458317, 0.0006951181567274034, 0.0005842705140821636, 0.0005634959088638425, 0.003305173246189952, 0.0005142189329490066, 0.001995444530621171 ]

[ "MIDVALE, Utah – Two men are dead after a murder-suicide that started in Midvale and ended in Cottonwood Heights Wednesday night.", "\n\nDetective Kevin Mallory with the Unified Police Department was somewhat tight-lipped about the relationship between the victim and the suspect, but a source shed some light on a potential motive.", "\n\n\"We’re not disclosing what that relationship is, but we do know there is a relationship,\" Mallory said. \"", "This was not a random act and it was not gang- or drug-related.\"", "\n\nA source tells FOX 13 that the shooter, 24-year-old Luis Garcia, killed his mother's boyfriend, 40-year-old Raymond Vasquez.", "\n\n\"We do believe there was a relationship between the mother of the shooter and the victim,\" Mallory said. \"", "To the degree of that relationship, I’m not positive at this point.\"", "\n\nThe reason may be tied to Vasquez's criminal history. ", "Vasquez was released from prison a few months ago for aggravated sexual abuse of a child.", "\n\nAccording to court documents, the victim in that case was the 8-year-old daughter of his ex-girlfriend. ", "A source told FOX 13 the shooter was concerned for his 8-year-old sister after his mother struck up a relationship with Vasquez.", "\n\n\"I don’t know the exact family dynamic as far as if there’s a sibling or there’s an 8-year-old sister or anything like that,\" Mallory said.", "\n\nThe source said that's what drove Garcia to shoot Vasquez at the Maverik gas station in Midvale Wednesday night around 9 p.m. From there, he drove off in his black Jeep Wrangler.", "\n\nWhen Cottonwood Heights Police caught up with him, he crashed into a fence at Peruvian Park Elementary before taking his own life.", "\n\n\"We’ve got two different crime scenes we need to process forensically and we also have all of the interviews and things like that to try to get to the bottom of why this happened,\" Mallory said.", "\n\nEven though the suspect and victim are both dead in this case, Unified Police said they’re still determined to get answers.", "\n\n\"Whether or not charges get filed – that’s not likely to happen – but we still want to make sure we’re as thorough as we possibly can be,\" Mallory said." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0019493511645123363, 0.0005827791756018996, 0.0006997288437560201, 0.0009434579405933619, 0.009460235945880413, 0.0007700677961111069, 0.0005634739063680172, 0.0008239095332100987, 0.06681115925312042, 0.00267234118655324, 0.0011374402092769742, 0.0007685727323405445, 0.009497202932834625, 0.03841535374522209, 0.0006261529633775353, 0.0007195841171778738, 0.0008733568829484284 ]

[ "Q:\n\nDisable link only for siblings - jQuery\n\nI have an accordion nav with the majority of the nav items having child pages, however a few don't. ", "The trigger to open the sub nav is the top-level link which is disabled. ", "Doing that makes it so that other top-level links with no sub pages don't work. ", "What would be the work around. ", "I tried the following:\n\n// Off-canvas menu open/close\r\n$(function() {\r\n $('.nav-main > li > a').click(function(e) {\r\n //e.preventDefault(); // disable link\r\n\r\n if( $(this).siblings().size() > 0) ) {\r\n e.preventDefault(); // disable link\r\n } \r\n\r\n // prevent expand on itself\r\n /*\r\n if ($(this).hasClass('active')) {\r\n return false;\r\n }\r\n */\r\n\r\n // toggle open/close\r\n\r\n $('.nav-main > li > a.active').next('.nav-main__sub').slideUp();\r\n\r\n if (!", "$(this).hasClass('active')) {\r\n $(this).next('.nav-main__sub').slideToggle();\r\n\r\n $('.nav-main > li > a').find('i').removeClass('fa-angle-up').addClass('fa-angle-down');\r\n $(this).find('i').addClass('fa-angle-up');\r\n $(this).find('i').removeClass('fa-angle-down');\r\n $('.nav-main > li > a').removeClass('active');\r\n $(this).addClass('active');\r\n } else {\r\n\r\n $(this).find('i').removeClass('fa-angle-up').addClass('fa-angle-down');\r\n $(this).removeClass(\"active\");\r\n }\r\n });\r\n});\n<script src=\"https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js\"></script>\r\n\r\n<div class=\"offcanvas\">\r\n <nav class=\"nav\">\r\n <ul class=\"vertical menu nav-main js-nav-main__primary\">\r\n <li><a href=\"/moving-relocation/\">Moving &amp; Relocation <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"/overview/\">Overview</a></li>\r\n <li><a href=\"\">Residential</a></li>\r\n <li><a href=\"\">Corporate</a></li>\r\n <li><a href=\"\">Military</a></li>\r\n <li><a href=\"\">Government</a></li>\r\n <li><a href=\"\">Relocation Management</a></li>\r\n </ul>\r\n </li>\r\n <li><a href=\"\">Workplace Solutions <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"\">Overview</a></li>\r\n <li><a href=\"\">Space, Furniture &amp; Move Planning</a></li>\r\n <li><a href=\"\">Office Furniture Products</a></li>\r\n <li><a href=\"\">Commercial Moving &amp; Storage</a></li>\r\n <li><a href=\"\">Vacated Space Services</a></li>\r\n <li><a href=\"\">Ongoing Program Solutions</a></li>\r\n </ul>\r\n </li>\r\n <li><a href=\"\">Global Logistics <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"\">Overview</a></li>\r\n <li><a href=\"\">Contract</a></li>\r\n <li><a href=\"\">International</a></li>\r\n <li><a href=\"\">Event</a></li>\r\n <li><a href=\"\">FF&amp;E</a></li>\r\n <li><a href=\"\">Transportation Management</a></li>\r\n </ul>\r\n </li>\r\n\r\n <li>\r\n <a href=\"\">About Us <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"\">Overview</a></li>\r\n <li><a href=\"\">History</a></li>\r\n <li><a href=\"\">Values</a></li>\r\n <li><a href=\"\">The People of Suddath</a></li>\r\n <li><a href=\"\">Affiliations</a></li>\r\n <li><a href=\"\">News</a></li>\r\n <li><a href=\"\">Policies &amp; Legal</a></li>\r\n <li><a href=\"\">Locations Map</a></li>\r\n </ul>\r\n </li>\r\n\r\n <li><a href=\"\">Careers <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"\">Overview</a></li>\r\n <li><a href=\"\">Current Jobs</a></li>\r\n <li><a href=\"\">Drive with Us</a></li>\r\n <li><a href=\"\">Career Paths</a></li>\r\n <li><a href=\"\">Benefits</a></li>\r\n </ul>\r\n </li>\r\n <li><a href=\"/contact/\">Contact</a></li>\r\n </ul>\r\n <ul class=\"vertical menu nav-main js-nav-main__contact\">\r\n <li><a href=\"\">Get a Quote <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"/overview/\">Overview</a></li>\r\n <li><a href=\"\">Residential</a></li>\r\n <li><a href=\"\">Corporate Moving</a></li>\r\n <li><a href=\"\">Relocation</a></li>\r\n <li><a href=\"\">Government Transferees</a></li>\r\n <li><a href=\"\">Military Personnel</a></li>\r\n </ul>\r\n </li>\r\n <li><a href=\"#\">Call Us</a>\r\n <div class=\"nav-main__contact\">\r\n <div class=\"contact-info\">\r\n <span class=\"contact-info__type\">Toll Free:</span>\r\n <span class=\"contact-info__number\">1-NNN-NNN-NNNN</span>\r\n </div>\r\n <div class=\"contact-info\">\r\n <span class=\"contact-info__type\">Local:</span>\r\n <span class=\"contact-info__number\">1-NNN-NNN-NNNN</span>\r\n </div>\r\n </div>\r\n </li>\r\n </ul>\r\n </nav>\r\n</div> <!-- ", "END offcanvas nav -->\n\nA:\n\nIt looks like .children() works.", "\nif( $(this).children().size() > 0) {\n console.log(\"Has children\");\n e.stopPropagation();\n}\nelse {\n console.log(\"No kids\"); \n}\n\n// Off-canvas menu open/close\r\n$(function() {\r\n $('.nav-main > li > a').click(function(e) {\r\n //e.preventDefault(); // disable link\r\n\r\nif( $(this).siblings().size() > 0 ) {\r\n e.preventDefault(); // disable link\r\n} \r\n if ($(this).children().size() > 0) {\r\n console.log(\"Has children\");\r\n e.stopPropagation();\r\n\r\n // toggle open/close\r\n\r\n $('.nav-main > li > a.active').next('.nav-main__sub').slideUp();\r\n\r\n if (!", "$(this).hasClass('active')) {\r\n $(this).next('.nav-main__sub').slideToggle();\r\n\r\n $('.nav-main > li > a').find('i').removeClass('fa-angle-up').addClass('fa-angle-down');\r\n $(this).find('i').addClass('fa-angle-up');\r\n $(this).find('i').removeClass('fa-angle-down');\r\n $('.nav-main > li > a').removeClass('active');\r\n $(this).addClass('active');\r\n } else {\r\n\r\n $(this).find('i').removeClass('fa-angle-up').addClass('fa-angle-down');\r\n $(this).removeClass(\"active\");\r\n }\r\n } else {\r\n console.log(\"No kids\");\r\n }\r\n\r\n // prevent expand on itself\r\n /*\r\n if ($(this).hasClass('active')) {\r\n return false;\r\n }\r\n */\r\n\r\n });\r\n});\n<script src=\"https://ajax.googleapis.com/ajax/libs/jquery/2.1.1/jquery.min.js\"></script>\r\n\r\n<div class=\"offcanvas\">\r\n <nav class=\"nav\">\r\n <ul class=\"vertical menu nav-main js-nav-main__primary\">\r\n <li><a href=\"/moving-relocation/\">Moving &amp; Relocation <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"/overview/\">Overview</a>\r\n </li>\r\n <li><a href=\"\">Residential</a>\r\n </li>\r\n <li><a href=\"\">Corporate</a>\r\n </li>\r\n <li><a href=\"\">Military</a>\r\n </li>\r\n <li><a href=\"\">Government</a>\r\n </li>\r\n <li><a href=\"\">Relocation Management</a>\r\n </li>\r\n </ul>\r\n </li>\r\n <li><a href=\"\">Workplace Solutions <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"\">Overview</a>\r\n </li>\r\n <li><a href=\"\">Space, Furniture &amp; Move Planning</a>\r\n </li>\r\n <li><a href=\"\">Office Furniture Products</a>\r\n </li>\r\n <li><a href=\"\">Commercial Moving &amp; Storage</a>\r\n </li>\r\n <li><a href=\"\">Vacated Space Services</a>\r\n </li>\r\n <li><a href=\"\">Ongoing Program Solutions</a>\r\n </li>\r\n </ul>\r\n </li>\r\n <li><a href=\"\">Global Logistics <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"\">Overview</a>\r\n </li>\r\n <li><a href=\"\">Contract</a>\r\n </li>\r\n <li><a href=\"\">International</a>\r\n </li>\r\n <li><a href=\"\">Event</a>\r\n </li>\r\n <li><a href=\"\">FF&amp;E</a>\r\n </li>\r\n <li><a href=\"\">Transportation Management</a>\r\n </li>\r\n </ul>\r\n </li>\r\n\r\n <li>\r\n <a href=\"\">About Us <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"\">Overview</a>\r\n </li>\r\n <li><a href=\"\">History</a>\r\n </li>\r\n <li><a href=\"\">Values</a>\r\n </li>\r\n <li><a href=\"\">The People of Suddath</a>\r\n </li>\r\n <li><a href=\"\">Affiliations</a>\r\n </li>\r\n <li><a href=\"\">News</a>\r\n </li>\r\n <li><a href=\"\">Policies &amp; Legal</a>\r\n </li>\r\n <li><a href=\"\">Locations Map</a>\r\n </li>\r\n </ul>\r\n </li>\r\n\r\n <li><a href=\"\">Careers <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"\">Overview</a>\r\n </li>\r\n <li><a href=\"\">Current Jobs</a>\r\n </li>\r\n <li><a href=\"\">Drive with Us</a>\r\n </li>\r\n <li><a href=\"\">Career Paths</a>\r\n </li>\r\n <li><a href=\"\">Benefits</a>\r\n </li>\r\n </ul>\r\n </li>\r\n <li><a href=\"/contact/\">Contact</a>\r\n </li>\r\n </ul>\r\n <ul class=\"vertical menu nav-main js-nav-main__contact\">\r\n <li><a href=\"\">Get a Quote <i class=\"fa fa-angle-down\"></i></a>\r\n <ul class=\"vertical menu nav-main__sub\">\r\n <li><a href=\"/overview/\">Overview</a>\r\n </li>\r\n <li><a href=\"\">Residential</a>\r\n </li>\r\n <li><a href=\"\">Corporate Moving</a>\r\n </li>\r\n <li><a href=\"\">Relocation</a>\r\n </li>\r\n <li><a href=\"\">Government Transferees</a>\r\n </li>\r\n <li><a href=\"\">Military Personnel</a>\r\n </li>\r\n </ul>\r\n </li>\r\n <li><a href=\"#\">Call Us</a>\r\n <div class=\"nav-main__contact\">\r\n <div class=\"contact-info\">\r\n <span class=\"contact-info__type\">Toll Free:</span>\r\n <span class=\"contact-info__number\">1-NNN-NNN-NNNN</span>\r\n </div>\r\n <div class=\"contact-info\">\r\n <span class=\"contact-info__type\">Local:</span>\r\n <span class=\"contact-info__number\">1-NNN-NNN-NNNN</span>\r\n </div>\r\n </div>\r\n </li>\r\n </ul>\r\n </nav>\r\n</div>\r\n<!-- ", "END offcanvas nav -->\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007619329844601452, 0.0015662540681660175, 0.0008704134961590171, 0.0006655117031186819, 0.0016567916609346867, 0.0018765587592497468, 0.0010368573712185025, 0.003706826828420162, 0.0028204740956425667, 0.007692326791584492 ]

[ "El Carrizo, Nuevo Laredo, Tamaulipas\n\nNot to be confused with Ciudad Miguel Alemán, Tamaulipas, in Miguel Alemán Municipality.", "\n\nEl Carrizo is town located in Nuevo Laredo Municipality in the Mexican state of Tamaulipas. ", "According to the INEGI Census of 2010, Miguel Alemán had a population of 114 inhabitants. ", " Its elevation is 136 meters above sea level.", "\n\nReferences \n\nCategory:Populated places in Tamaulipas\nCategory:Nuevo Laredo" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006745657883584499, 0.0012856703251600266, 0.0006427982589229941, 0.0006604266818612814, 0.000664438761305064 ]