Datasets:

tharindu

/

patents

like 0

a fence panel that includes a self - contained connector system which can be used to interconnect , in assembling an animal enclosure , up to four of the panels quickly and easily without the need for additional posts , connectors , or other apparatus .

there is illustrated in fig1 generally at 10 , a fence panel of the present invention . the generally rectangular panel 10 includes a top rail 12 , a bottom rail 14 , a first end rail 16 , and a second end rail 18 . a plurality of parallel , spaced - apart , horizontal rails 20 are attached at opposite end portions to the end rails 16 and 18 , and a vertical rail 22 is attached at opposite end portions centrally of the top rail 12 and the bottom rail 14 and is also secured to each of the horizontal rails 20 . in a preferred embodiment , the end rails 16 and 18 extend below the bottom rail 14 and curve upwardly to form feet 24 and 26 which support the panel 10 on the ground and ease movement of the panels 10 by a user by providing a pivot point when the opposite end of the panel 10 is elevated . the panel 10 includes one or more corresponding pairs of connection systems , including a pin connector unit 28 mounted on the first end rail 16 and a connector loop 30 mounted at a corresponding position on the second end rail 18 . in the preferred embodiment illustrated in fig1 there are two pair of the connector systems , one mounted near the top rail 12 and the other mounted near the bottom rail 14 . a pin connector unit 28 is illustrated in detail in fig5 a - d . the pin connector unit 28 includes a u - shaped bracket 32 and a pin 34 . the u - shaped bracket 32 has a pair of aligned pin openings 36 a and 36 b , one each in the end portion of each arm of the u - shaped bracket 32 , as well as a pair of aligned elongated openings 38 a and 38 b , one each in each arm of the u - shaped bracket 32 interiorly of the aligned pin openings 36 . the pin 34 has a shaft 40 and an enlarged head 42 and the shaft 40 is received in the openings 36 in the arms of the bracket 32 with the enlarged head 42 being larger than the openings 36 so that it supports the pin 34 across the arms of the bracket 32 . a connector loop 30 is best illustrated in fig2 . it is made of a piece of rod that has been bent to form a u - shaped loop 44 and a pair of downwardly extended support arms 46 that are secured to the second end rail 18 by weldments or the like . a pin connector unit 128 is secured to the first end rail 116 of a second panel 110 by weldments or the like . as illustrated , the two panels 10 and 110 are releasably interconnected to each other by removing the pin 34 from the bracket 132 , orienting the panels 10 and 110 so that the opening of the loop 44 is aligned with the pin openings 136 of the bracket 132 and then dropping the pin 134 into the aligned openings and loop thereby capturing the connector loop 30 inside the bracket 132 . while only the top connector system is shown , it is to be understood that a user typically will also capture the lower connector loop inside the corresponding lower pin connector unit . additionally , while the panels 10 and 110 are shown in substantial linear alignment , it is to be understood that the panels can be pivoted relative to each other through a wide angle until the end rail 18 of panel 10 comes into contact with the bracket 132 of the panel 110 . a third panel 210 can be interconnected to the two panels 10 and 110 , as illustrated in fig3 . the pin 234 of the third panel 210 is removed from the bracket 232 and the panel 210 is oriented to align the pin openings of the bracket 232 with the elongated openings of the bracket 132 . the pin 234 is then dropped into the two pairs of aligned openings to capture the bracket 232 inside the bracket 132 . again , it is expected that typically the user will also similarly interconnect the pin connector units of the two panels 110 and 210 at the lower portions of the two panels . note also that while the third panel 210 is shown substantially perpendicular to the first two panels 10 and 110 , all three may be pivoted relative to each other to a wide range of positions within the limits imposed by the connector systems . a fourth panel 310 can be interconnected to the three panels 10 , 110 and 210 , as illustrated in fig4 . the pin 234 of the third panel 210 is removed from the bracket 232 and the panel 310 is oriented to align the opening in the loop 344 with the elongated openings of the bracket 132 and the pin openings of the bracket 232 . the pin 234 is then dropped into the three pairs of aligned openings to capture the bracket loop 344 inside the brackets 132 and 232 . again , it is expected that typically the user will also similarly interconnect the pin connector units of the three panels 110 , 210 and 310 at the lower portions of the panels . note also that while the fourth panel 310 is shown substantially perpendicular to the other three panels , all four may be pivoted relative to each other to a wide range of positions within the limits imposed by the connector systems . the foregoing description and drawings comprise illustrative embodiments of the present inventions . the foregoing embodiments and the methods described herein may vary based on the ability , experience , and preference of those skilled in the art . merely listing the steps of the method in a certain order does not constitute any limitation on the order of the steps of the method . the foregoing description and drawings merely explain and illustrate the invention , and the invention is not limited thereto , except insofar as the claims are so limited . those skilled in the art who have the disclosure before them will be able to make modifications and variations therein without departing from the scope of the invention .

US-74208203-A

a controlled advancement laser ablation device is provided for precise ablation of body matter . the laser ablation device includes a laser energy transmission mechanism such as , e . g . a fiber optic fiber mounted for controlled translational longitudinal movement relative to a housing structure . a laser energy generator is optically connected to the laser energy transmission mechanism . a controlled advancement mechanism is provided in engagement with the laser energy transmission mechanism for advancing the mechanism through the housing structure at a controlled rated coordinated with the laser energy generator output to ablate body tissue . controlled advancement mechanisms include constant and / or variable rate springs , motors , and other mechanisms which can be coordinated with the laser energy generator to advance the laser energy transmission mechanism as the targeted substance is ablated . the device is particularly suitable for use in transmyocardial revascularization and angioplasty procedures .

preferred embodiments of the laser ablation device will now be described in detail with reference to the drawings , in which like reference numerals designate identical or corresponding elements in each of the several views . one embodiment of the presently disclosed laser ablation device will now be described with reference to fig1 - 8 . fig1 illustrates a laser ablation device shown generally at 10 . device 10 preferably includes handle portion 11 , an optical fiber advancing mechanism 12 , a laser generator 14 , a foot operated actuator 16 , and a control module 17 . the optical fiber advancing mechanism 12 is of the type capable of precisely transmitting longitudinal motion and , optionally , rotational motion , to an optical fiber , optical fiber bundle or other laser energy transmission mechanism . the controlled longitudinal and / or rotational motion can be provided by one or more motors and preferably by one or more stepper motors . the stepper motors can be of the type commercially available from haydon switch and instrument , inc . of waterbury , conn . or eastern air devices , inc . of dover , n . h . the laser generator 14 may be either a continuous wave laser or a pulsed , high energy laser ; such as , for example , an excimer , co 2 , yag , or an alexandrite laser . preferably , a pulsed high energy xenon chloride excimer laser is used , such as those available from spectranetics of colorado springs , colo ., or medolas of germany . the optical fiber advancing mechanism 12 and the laser generator 14 are operably connected to foot switch 16 . by depressing foot switch 16 , laser energy is transmitted through the optical fiber by laser generator 14 while fiber advancing mechanism 12 advances the laser fiber relative to handle portion 11 . as shown , the signal from foot switch 16 actuates control module 17 which communicates with fiber advancing mechanism 12 . control module 17 is programmable and controls the motors or similar advancing structure in advancing mechanism 12 upon actuation of foot switch 16 . control module 17 is shown with a receptacle 19 adapted to engage a terminal of a programmable computer to interface control module 17 with the computer . as such , instructions required to operate advancing mechanism 12 can then be stored in control module 17 . such instructions are commercially available , for example , through intelligent motions systems , inc . of taftville , conn . a toggle switch 15 may be provided on the control module 17 to switch from an operation mode to a test mode . in a particular test mode , when the foot actuator 16 is acted upon , the flexible optical fiber is moved sequentially from a retracted position , to a predetermined extended position , and back to the retracted position . fiber advancing mechanism 12 is preferably equipped with two internal limit switches ( not shown ). the first limit switch is preferably positioned to be activated when the optical fiber is at a desired retracted position ( i . e ., a &# 34 ; one &# 34 ; position ), wherein the mechanism that is retracting the fiber is caused to stop . the second limit switch limits / controls the maximum distance that the optical fiber can extend from handle portion 11 . most preferably , an external selector 21 is provided so that the operator can select the desired maximum extension of the distal end of the optical fiber from the handpiece . for example , selector 21 can be in the form of a rotatable knob that can be set at selectable positions , wherein each position corresponds to a predetermined maximum longitudinal position of the optical fiber . when the fiber reaches the selected position , a limit switch can automatically terminate the fiber &# 39 ; s advancement . in a most preferred embodiment , the operator can select fiber extension positions so that the distal end of the fiber extends from the distal end of the hand piece from between about 0 . 5 cm and about 5 . 0 cm , with the ability to select in increments of about 0 . 25 cm to about 0 . 5 cm . in the embodiment shown in fig2 - 32 , the fiber preferably extends form the handpiece from between about 0 . 2 cm and about 4 . 0 cm , with the ability to select in increments of about 0 . 2 cm . the minimum and maximum extensions and the selected incremental values therebetween can be varied as desired . fig2 illustrates a perspective view of the handle portion 11 of laser ablation device 10 . briefly stated , handle portion 11 includes housing 20 formed from molded housing half - sections 20a and 20b . housing 20 has an elongated body 22 with a conically tapered section 24 . an optional locator ring 26 is provided at the distal end of conically tapered section 24 that can be positioned in engagement with body tissue , i . e ., the wall of the heart during a tmr procedure , to facilitate proper orientation of the handle portion with respect to the body tissue . locator ring 26 can be formed integrally with housing half - sections 20a and 20b or can be removably fastened to tapered section 24 . a ridged surface 28 is formed on an outer wall of housing half - sections 20a and 20b to facilitate grasping of the device 10 . fig3 illustrates laser ablation device 10 with housing half - sections 20a and 20b and the internal components of the handle portion 11 separated . housing half - sections 20a and 20b define a central bore 30 , a proximal recess 32 , and a distal recess 34 . the proximal recess 32 is configured to receive a swivel connector 36 which is fastened to the optical fiber casing 38 . the swivel connector 36 has an annular flange 40 dimensioned to be received within an increased diameter section 42 of proximal recess 32 to permit rotation of housing 20 with respect to optical fiber casing 38 . as shown , the locator ring 26 has a cylindrical body portion 44 having an annular flange 46 formed at its proximal end . the cylindrical body portion 44 includes a central bore 50 and is configured to be received within the distal recess 34 defined by housing half - sections 20a and 20b . central bore 50 of cylindrical body portion 44 is aligned with a central opening 48 formed in the distal end of the housing 20 and the central bore 30 of housing 20 . locator ring 26 can either swivel , to allow independent rotation of the handle portion relative thereto , or be fixed in place . the optical fiber 18 is slidably positioned within central bores 30 and 50 such that it can be advanced through opening 48 in housing 20 . pins or screws 49 can be used to fasten the housing half - sections 20a and 20b together to secure the locator ring 26 and the swivel connector 36 to the housing 20 . fig4 - 5a illustrate laser ablation device 10 during use in a tmr procedure . locator ring 26 has been positioned against the epicardium 54 of the heart 56 . because the heart may be beating during a tmr procedure , the locator ring 26 greatly enhances the surgeon &# 39 ; s ability to position and stabilize the laser ablation device 10 with respect to the heart 56 . in fig4 the foot operated actuator 16 ( fig1 ) has not been actuated and the optical fiber 18 is in a retracted position with its distal end 60 positioned in central bore 50 of locator ring 26 . referring now to fig5 and 5a , foot operated actuator 16 ( fig1 ) has been actuated to initiate operation of laser generator 14 and the advancing mechanism 12 to ablate tissue and advance optical fiber 18 . the distal end 60 of optical fiber 18 has been advanced in the direction indicated by arrow &# 34 ; a &# 34 ; to produce a channel 57 from the epicardium through to the myocardium 58 in the ventricle of the heart 56 . during the tmr procedure , 1 or more channels can be ablated into the heart to facilitate blood delivery to ischemic areas of the heart . the distal end 60 of the optical fiber 18 which can be a single fiber or a bundle or fibers , is preferably advanced at a rate that is coordinated with the power level and the frequency of pulsing of the laser generator to form channels in the heart . for example , optical fiber 18 can be advanced at a rate of between about 0 . 5 mm / sec ( 0 . 02 in / sec ) to about 12 . 7 mm / sec ( 0 . 5 in / sec ) with a laser power level of about 10 mj / mm 2 to about 60 mj / mm 2 and a pulsing frequency of about 5 hz to about 100 hz . preferably , the optical fiber is advanced at a rate of about 1 . 0 mm / sec to about 2 . 0 mm / sec with a laser power level of between about 30 mj / mm 2 to about 40 mj / mm 2 and a pulse frequency of about 50 hz . in a most preferred embodiment , the rate of advancement of the optical fiber is no greater than the rate of ablation of tissue in order to minimize mechanical tearing by the fiber . alternatively , if some degree of mechanical tearing is desired , the advancing mechanism can be set to advance the fiber at a rate greater than the ablation rate . studies have shown that a xenon chloride excimer laser operating at a power level of about 35 mj / mm 2 can ablate about 30 - 35 microns of animal heart tissue per pulse . in one study , channels were successfully created in canine heart tissue using a xenon chloride excimer laser ( 308nm ) optically connected to a 1 . 8 mm solid fiber bundle . the laser was set to provide about 30 mj / mm 2 at a rate of about 50 hz , while the advancing mechanism was set to advance the laser fiber bundle at various constant speeds between about 1 . 3 mm / sec ( 0 . 05 in / sec ) and about 13 mm / sec ( 0 . 5 in / sec ). in a clinical trial on a human heart , the laser was set to provide about 35 mj / mm 2 at a rate of about 30 hz with a feed rate of about 0 . 95 mm / sec ( i . e ., advancing the fiber at approximately 1 . 25 thousandths if an inch per pulse ). typically , a healthy heart has a wall thickness of 10 - 15 mm . a diseased heart may be as thick as 40 mm ( measured from the outer surface of the epicardium to the inner wall of the myocardium ). at a minimum , the laser ablation device 10 and control assembly should be capable of advancing the optical fiber 18 through a stroke having a length at least as great as the thickness of the heart being treated . alternately , it is possible to create channels in the myocardium from within the heart by introducing the laser fiber into the patient &# 39 ; s vasculature or through an opposing heart wall and directing the fiber tip to the desired location . see , for example , u . s . pat . no . 5 , 389 , 096 to aita et al . in this approach , once the fiber is properly placed , controlled advancement of the fiber can be achieved as described above . however , with this approach the fiber preferably will not penetrate the epicardium . referring now to fig6 - 8 , laser fiber 18 and fiber advancing mechanism 12 ( fig1 ) can also be used to perform laser angioplasty . during the laser angioplasty procedure , the optical fiber 18 is inserted into a blood vessel 62 such that the distal end 60 of the optical fiber 18 is positioned adjacent a plaque obstruction 64 ( fig6 ), as is known in the art . the foot operated actuator 16 ( fig1 ) is actuated to initiate operation of the advancing mechanism 12 and the laser generator 14 to simultaneously advance , in the direction indicated by arrow &# 34 ; b &# 34 ;, and ablate plaque 64 to produce a channel 66 through the obstruction . as discussed above , the rate of advancement of the optical fiber 18 and the power level and frequency of pulsing of laser energy are coordinated , via control module 17 , to form the channel 66 through the plaque . by precisely controlling the rate of advancement of the laser fiber , the user can ensure that the plaque is truly ablated by the laser energy and not just pushed aside . ablation / removal of plaque reduces the likelihood of or delays restenosis as compared to mere mechanical manipulation of the plaque . an alternate , preferred embodiment of the presently disclosed laser ablation device will now be described with reference to fig9 to 12 . the handle portion of the laser ablation device shown in this embodiment has a self - biasing advancing mechanism incorporated therein . fig9 and 10 illustrate the handle portion of the laser ablation device shown generally as 100 . briefly described , handle portion 100 includes a housing 120 formed from molded housing half - sections 120a and 120b . the housing half - sections 120a and 120b are formed with mating recesses 114 configured to slidably receive the internal components . a proximal opening 115 and a distal opening 116 are formed in housing 120 to permit an optical fiber 118 to extend through the housing 120 . a swivel connector ( such as 36 in fig3 - 5a ) and fiber casing ( such as 38 in fig3 ) can also be included . an engagement assembly 113 is slidably positioned within a channel 122 defined by mating recesses 114 formed in housing half - sections 120a and 120b . the engagement assembly 113 includes a cylindrical cap 124 , a flexible engagement washer 128 , and a compression screw 130 . the cylindrical cap 132 has a threaded blind bore 126 dimensioned to receive the flexible engagement washer 128 . the compression screw 130 has a threaded end 134 dimensioned to be threaded into the blind bore 126 . the cylindrical cap 124 , the engagement washer 128 and the compression screw 130 all have a central throughbore to permit the optical fiber 118 to extend through the housing 120 . referring to fig1 a , the engagement washer 128 is positioned in the blind bore 126 of cylindrical cap 124 and compression screw 130 is threaded into the blind bore 126 . as the engagement washer 128 is compressed between the compression screw 130 and the base of blind bore 126 , the washer 126 deforms inwardly into frictional engagement with the optical fiber 118 to fasten the optical fiber 118 to the engagement assembly 113 . the advancing assembly 112 includes a guide member 136 and a biasing member 138 . the guide member 136 is positioned in abutting relation with the proximal end of the cap 124 of engagement assembly 113 . an elongated rib 140 extends along the longitudinal periphery of guide member 136 and is configured to be received within a longitudinal slot 142 formed on an internal wall of the housing 120 . the rib and slot engagement limits rotation of the guide member 136 with respect to the housing 120 to avoid inadvertent disengagement of the guide member 136 and biasing member 138 . the biasing member 138 is positioned to engage the proximal end of the guide member 136 as to bias the guide member 136 distally into the engagement assembly 113 to move the engagement assembly 113 distally in channel 122 . the biasing member 138 preferably includes a constant force spring having a first end 144 connected through an opening 146 to the housing 120 and a body portion 148 positioned in a recess 150 formed in the proximal end of the guide member 136 . the constant force spring allows for controlled advancement of the laser fiber , which has advantages in tmr and angioplasty procedures , similar to those previously described . fig1 - 12 illustrate the handle portion 100 of laser ablation device during use in a tmr procedure . fig1 illustrates the handle portion 100 prior to engagement with heart 152 . the biasing member 138 has moved the guide member 136 into abutment with the engagement assembly 113 to advance the engagement assembly distally in channel 122 . because of the frictional connection between washer 128 and optical fiber 118 , optical fiber 118 has been advanced distally with the engagement assembly 113 and extends through opening 116 in housing 120 . referring now to fig1 a , the handle portion 100 of laser ablation device has been pushed against the epicardium 154 of the heart 152 . the force on the distal end of the optical fiber 118 is sufficient to overcome the force of the biasing member 138 to retract the optical fiber 118 , in the direction indicated by arrow &# 34 ; c &# 34 ;, to a position within housing 120 . it is noted that the strength of the biasing member should be less than that capable of puncturing the heart 152 , e . g ., the optical fiber 118 should not pierce the heart when the distal end of the optical fiber is pushed against the epicardium . in fig1 , laser energy has been conducted to the optical fiber 118 to ablate heart tissue adjacent the distal end 160 of the optical fiber 118 . as the heart tissue adjacent the distal end 160 of the optical fiber is ablated , biasing member 138 continually advances the optical fiber 118 through the heart tissue until a channel 162 is formed in the ventricle of the heart from the epicardium through the myocardium 156 . the laser energy level and pulse frequency are coordinated with the rate of advancement provided by the biasing member 138 . a similar biasing mechanism can be used to controllably advance the laser fiber during laser angioplasty . a further alternate , preferred embodiment of the presently disclosed laser ablation device is shown in fig1 - 25 . the handle portion 200 of the laser ablation device in this embodiment includes a self - biasing advancing mechanism substantially identical to that incorporated in the handle portion 100 described above . the device further includes a compensating mechanism suitable for use in performing a tmr procedure on a beating heart . fig1 and 14 illustrate the handle portion of laser ablation device shown generally as 200 . briefly , handle portion 200 includes an outer housing 210 formed from molded housing half - sections 210a and 210b and an inner housing 220 formed from molded housing half - sections 220a and 220b . the inner housing 220 is slidably positioned within outer housing 210 , as indicated by arrow &# 34 ; e &# 34 ;, and includes a distal conical portion 222 having an opening 224 dimensioned to permit passage of an optical fiber 218 . referring now to fig1 and 16 , the outer housing half - sections 210a and 210b have recesses which together form a channel 226 in which the inner housing 220 is slidably positioned . proximal and distal openings 228 and 230 are also formed in the outer housing 210 and are dimensioned to permit passage of the optical fiber 218 and the inner housing 220 , respectively . as with the previous embodiment , a swivel connector ( such as 36 in fig3 - 5a ) and fiber casing ( such as 38 in fig3 ) can also be included but are not shown . a biasing member 232 is positioned within the outer housing 210 to engage and urge the inner housing 220 towards the distal end of channel 226 . the biasing member 232 can be a spring having a first portion retained in a slot 234 formed in the outer housing 220 and a second portion engaging a retainer 236 secured to the inner housing 220 . the outer housing half - sections 220a and 220b can be fastened together with pins or screws 238 to secure inner housing 220 within channel 226 . fig1 - 20 illustrate the inner housing 220 with parts separated . the internal components of the inner housing 220 include an engagement assembly and an advancing mechanism , which are similar to those disclosed with respect to the housing portion 100 and will only be briefly discussed herein . the engagement assembly includes a cylindrical cap 240 , a flexible engagement washer 242 , and a compression screw 244 . the cylindrical cap 240 has a threaded blind bore 245 which is adapted to receive a threaded end 246 of compression screw 244 . the compression screw 244 is threaded into blind bore 245 to compress and deform the engagement washer 242 into frictional engagement with optical fiber 218 , which extends through a central bore formed in the engagement assembly . the advancing mechanism includes a guide member 248 and a biasing member 250 . the guide member 248 is positioned in abutting relation to the proximal end of cap 240 . the biasing member 250 is positioned to engage and bias the guide member 248 distally within a channel 252 formed in the inner housing 220 to move the engagement assembly towards the distal end of the channel 252 . an elongated rib 254 is formed on the outer periphery of the guide member 248 and is received in a slot 256 formed along channel 252 to prevent the guide member 248 from rotating and becoming disengaged from the biasing member 250 . the inner housing half - sections can be fastened together with pins 258 to secure the engagement assembly and the advancing mechanism within channel 252 . fig2 - 25 illustrate a handle portion 200 of a laser ablation device during use in a tmr procedure . fig2 illustrates the handle portion 200 after the optical fiber 218 has been pressed against the epicardium 262 of the heart 260 but before laser energy has been conducted to the optical fiber 218 . engagement between the distal end 264 of optical fiber 218 creates a compressive force in the optical fiber 218 that overcomes the force of biasing member 250 to cause retraction of the optical fiber 218 in the direction indicated by arrow &# 34 ; e &# 34 ;. referring to fig2 , the distal end 266 of the inner housing 220 is positioned in abutting relation with the heart 260 . if the heart 260 and the handle portion 200 move towards each other with the handle portion 200 in this position , such as when the heart beats or the patient breathes , the force on the distal end 264 of inner housing 220 overcomes the force of biasing member 232 ( fig1 ), to permit the inner housing 220 to move proximally within channel 252 , in the direction indicated by arrow &# 34 ; f &# 34 ;. outer housing 210 and biasing member 232 form a compensation assembly in this respect . referring now to fig2 - 25 , laser energy has been conducted to the optical fiber 218 to ablate heart tissue adjacent to the distal end 264 of the optical fiber 218 . as the heart tissue is ablated , biasing member 250 controllably advances distal end 264 of optical fiber 218 , in the direction indicated by arrow &# 34 ; g &# 34 ;, through the heart tissue until a channel 268 is formed from the epicardium 262 through the myocardium 270 . once again , the power output of the laser generator conducting energy to optical fiber 218 is coordinated with the advancement mechanism to provide channels 268 in the heart . referring now to fig2 - 32 , an alternate laser ablation device is shown , wherein the control module ( generally shown as 17 in fig1 ) and fiber advancing assembly ( generally shown as 12 in fig1 ) have been combined into a single unit refereed herein as fiber control assembly 312 . fiber control assembly 312 is shown on top of laser energy generator 314 and is positioned to receive an optical fiber that serves to transmit laser energy from laser 314 to body tissue . laser 314 is preferably an excimer laser , however , other laser energy sources that can be coupled to an optical fiber can also be used . laser 314 is also shown with a control pad 316 and a monitor 318 . footswitch 320 is also shown and serves to actuate the laser and fiber control assembly . with reference to fig2 - 30 , fiber control assembly 312 is shown in greater detail . fiber control assembly houses motor 322 ( preferably a stepper motor ) that serves to move lower fiber securing plate 324 relative to upper fiber securing plate 326 . upon actuation , motor 322 rotates screw 328 relative to threads disposed in lower plate 324 ( not shown ) to move the lower plate relative to the upper plate . both the upper plate and the lower plate have clip recesses 341 and 343 , respectively , and clips 342 and 344 , respectively , that serve to hold portions a disposable lasing assembly , discussed in greater detail below . the motor and plates are disposed in housing portion 330 that includes movable access door 332 and upper fiber exit opening 334 and lower fiber entrance opening 336 . fiber control assembly also includes rotatable depth selector 338 that allows the user to select the desired movement of lower plate 324 relative to upper plate 326 . as discussed in greater detail , below , movement of the lower plate relative to the upper plate controls movement of the optical fiber relative to a handle portion . preferably , the selected depth is displayed on digital display panel 340 and is selectable in 0 . 2 cm increments in a range between about 0 . 2 cm to about 4 . 0 cm . turning to fig2 - 30 , a disposable lasing assembly , generally designated as 400 , is shown connected to fiber control assembly 312 and laser energy generator 314 . disposable lasing assembly 400 includes coupler 402 , optical fiber 404 , fiber casing 408 and handle portion 410 . coupler 402 is configured and dimensioned to be connected to laser generator 314 at laser output 342 , wherein energy emitted from the laser is directed into the proximal end of optical fiber 404 . optical fiber 404 is shown as a bundle of fibers but can also be a single fiber . optical fiber 404 preferably has fiber coating 406 ( see fig2 and 30 ) that is preferably at least partially stripped away from the distal end of the fiber ( see fig3 and 32 ) so that only the fiber touches body tissue . fiber casing 408 serves to provide a fixed distance between handle portion 410 and upper plate 326 . the casing can be ratably connected to either or both the handle portion ( as described above ) and the upper plate . optical fiber 404 is movable within casing 408 . handle portion 410 is similar handle portion 11 , described above . to connect disposable lasing assembly 400 to the laser and fiber control assembly , the surgeon or operator will attach coupler 402 to laser output 342 , pass optical fiber 404 ( and coating 406 disposed about the fiber , if included ) through lower fiber entrance opening 336 , secure the fiber to lower plate 324 by means of clip 344 , secure fiber casing 408 to upper plate 326 by means of clip 342 and direct the fiber casing and fiber out of the control assembly through upper fiber exit opening 334 . these steps of connecting the disposable lasing assembly to the control assembly need not be performed in any particular order . because the disposable lasing assembly passes through openings 336 and 334 , door 322 can be closed during operation . during operation , with reference to fig3 and 32 , the surgeon or operator will use depth selector 338 to select the desired depth that the distal end of optical fiber 404 will feed into the body tissue 500 . next the surgeon places the distal end of handle portion 410 at a desired location against the tissue ( i . e ., heart tissue ) and activates foot switch 320 ( fig2 ). the foot switch activates motor 322 and laser generator 314 . motor 322 rotates screw 328 to move lower plate 324 towards upper plate 326 in the direction of arrow a . because fiber casing 408 is secured at both ends ( one end to handle portion 410 and the other to upper plate 326 ) and the optical fiber is secured to the lower plate , movement of the lower plate a distance x causes the distal end of the optical fiber to move a distance x relative to the distal end the handle portion . once the desired distance x has been traveled , laser energy transmission is stopped and motor 322 reverses direction to bring the optical fiber to its initial or &# 34 ; home &# 34 ; position . the procedure can be repeated according to the discretion of the surgeon . after the surgeon has finished with a particular patient , disposable lasing assembly 400 can be discarded and laser generator 314 and fiber control assembly 312 can be cleaned for the next patient . disposable lasing assembly 400 , in combination with the relatively quick and easy to use connection to the laser generator and fiber control assembly , provides for a convenient and safe method of performing laser surgery , such as tmr . it will be understood that various modifications can be made to the embodiments disclosed herein . for example , in the first embodiment , any type of motor , such as air , hydraulic , pneumatic or other electrical motor can be used in place of a stepper motor . in addition , alternate devices can be used to actuate the laser advancing device and the laser energy source , such as a trigger mechanism associated with the handle portion . also , various other structures for securing the optical fiber and fiber casing to the fiber control assembly can be used . therefore , the above description should not be construed as limiting , but merely as exemplifications of preferred embodiments . those skilled in the art will envision other modifications within the scope and spirit of the claims appended thereto .

US-72093496-A

a ramp system for installation on a vehicle , and a vehicle for conveying wheelchair users . the ramp system includes an intermediate element having a longitudinal guide and a ride - on access plate . the ride - on access plate is moveable from a vertical transport position to a horizontal stowage position by pivoting about a movable axis . a guide pin coupled to the ride - on access plate is guided by the longitudinal guide of the intermediate element as the ride - on access plate is moved from the vertical position to the horizontal position . the ramp system further includes a guide strut that is pivotally mounted to the ride - on access plate and the intermediate element . the movement of the ride - on access plate between the vertical and horizontal positions is thereby controlled relative to the intermediate element by the longitudinal guide and guide strut .

fig1 shows an exemplary ramp system 1 installed in a vehicle 2 . in the depicted embodiment , a ride - on access plate 8 of the ramp system 1 is in an inclined ride - on access position 24 . in the illustrated ride - on access position 24 , the ride - on access plate 8 is inclined with respect to a vertical plane . the ride - on access plate 8 thereby bridges over the difference in height between the road or the pathway on which the vehicle 2 is positioned , and a lowered entry edge 9 of the interior 4 of the vehicle . the lowered entry edge 9 in this exemplary embodiment is arranged lower than the inside vehicle floor 11 on which , for example , the driver and passenger seat may be mounted . this difference in height between the inside vehicle floor 11 and lowered entry edge 9 is caused by a ramp - like access in the interior 4 of the vehicle 2 . the ramp - like access may have substantially the same inclination as the ride - on access plate 8 of the ramp system 1 in the ride - on access position 24 . an intermediate plate 7 may be arranged between the ride - on access plate 8 and the lowered entry edge 9 . the intermediate plate 7 connects the intermediate elements 6 a , 6 b ( fig2 ) to each other . the intermediate elements 6 a , 6 b may be present on both sides of ramp system 1 , and may be connected to the ride - on access plate 8 or the outside surfaces 26 a , 26 b of the plate 8 by guide struts 20 a , 20 b . as best shown in fig2 , the intermediate elements 6 a , 6 b are connected to the ride - on access plate 8 not only by the guide struts 20 a , 20 b , but also by longitudinal guides 18 a , 18 b ( 18 b is hidden ). the longitudinal guides 18 a , 18 b may be arranged on the intermediate elements 6 a , 6 b , and may be configured to engage guide pins 16 a , 16 b ( 16 b is hidden ). the guide pins 16 a , 16 b may in turn be coupled to the ride - on access plate 8 . the ride - on access plate 8 and the intermediate plate 7 may provide a constant incline , which in the illustrated example is between about 15 ° and 25 °. in this case , one side of the intermediate plate 7 terminates flush with the lowered entry edge 9 of the vehicle 2 . in this arrangement , the outside surfaces 30 a , 30 b ( 30 b is hidden ) of the guide struts 20 a , 20 b may be arranged in substantially the same vertical plane as the outside surfaces 26 a , 26 b of the ride - on access plate 8 . the side view illustrated in fig3 shows the inclination of the ride - on access plate 8 with respect to the horizontal plane in the illustrated inclined ride - on access position 24 . the functional mechanism of the ramp system 1 is shown as a detailed side view in fig4 . a movable pivot axis 10 is coincident in this embodiment with the central axis 28 of the guide pins 16 a , 16 b . in the illustrated inclined ride - on access position 24 of the ride - on access plate 8 , the guide pins 16 a , 16 b are in an end position 32 in the longitudinal guides 18 a , 18 b . the longitudinal guides 18 a , 18 b are of a partially curved or bent configuration , and / or include a curved or bent portion . at one end , the longitudinal guides 18 a , 18 b have an end seat 36 provided by a 90 ° bend or kink in the longitudinal guides 18 a , 18 b . in the illustrated embodiment , the intermediate elements 6 a , 6 b are pivotably coupled to the vehicle 2 , wherein the pivotal movement of the intermediate elements 6 a , 6 b can be performed about another pivot axis 22 . by virtue of the coupling of the ride - on access plate 8 to the intermediate elements 6 a , 6 b by the guide pins 16 a , 16 b , and the interaction of the guide pins 16 a , 16 b with the longitudinal guides 18 a , 18 b , a pivotal movement of the intermediate elements 6 a , 6 b about the pivot axis 22 also results in a pivotal movement of the ride - on access plate 8 about the pivot axis 22 . the transport position 12 of the ride - on access plate 8 as shown in fig5 and 6 can be adjusted by the pivotal movement of the ride - on access plate 8 . the ride - on access plate 8 may be oriented substantially vertically in the transport position 12 . in the illustrated embodiment , actuating levers 38 , 40 are arranged in a plane that is parallel to the ride - on access plate 8 , and which is spaced from the ride - on access plate 8 in the direction of the rear end of the vehicle . the side views of the ramp system 1 in fig7 and fig8 show the vertical orientation of the ride - on access plate 8 in the transport position 12 . as the pivotal movement from the inclined ride - on access position 24 into the transport position 12 only entails a rotary movement of the ride - on access plate 8 about the pivot axis 22 , the guide pins 16 a , 16 b are disposed in the first end position 32 in the longitudinal guides 18 a , 18 b in both the transport position 12 , and in the inclined ride - on access position 24 . accordingly , the guide struts 20 a , 20 b extend parallel to the outside surfaces 26 a , 26 b of the ride - on access plate 8 , and the outside surfaces 30 a , 30 b of the guide struts 20 a , 20 b extend substantially in the same vertical plane as the outside surfaces 26 a , 26 b of the ride - on access plate 8 . to move the ride - on access plate from the transport position 12 into the stowage position 14 , the ride - on access plate 8 is moved about the movable pivot axis 10 . as shown in fig9 , the ride - on access plate 8 is arranged in the stowage position 14 in a substantially horizontal plane , and terminates substantially flat with the inside vehicle floor 11 . as shown in fig9 and 10 , the intermediate elements 6 a , 6 b of the ride - on access plate 8 extend in a substantially vertical direction while the ramp system 1 is in the stowage position . fig9 and 10 also show that the surface of the ride - on access plate 8 , which faces upwardly in the stowage position 14 , is arranged in the stowage position 14 in substantially the same plane as the inside vehicle floor 11 . the side views in fig1 and 12 show that upon a change in position of the ride - on access plate 8 from the transport position 12 into the stowage position 14 , the movable pivot axis 10 and the guide pins 16 a , 16 b move along the longitudinal guides 18 a , 18 b from the end position 32 into the end position 34 . because the intermediate elements 6 a , 6 b have not changed their position , the guide struts 20 a , 20 b are moved from their vertical orientation into an inclined orientation relative to the vertical . in the illustrated embodiment , the guide struts 20 a , 20 b in the stowage position 14 are at an angle of approximately 45 ° both with respect to the intermediate elements 6 a , 6 b and also with respect to the ride - on access plate 8 . in a manner not shown in the illustrated embodiment , the ride - on access plate 8 can be supported by the vehicle structure in the illustrated stowage position 14 , such as by means of one or more supporting members . 26 a , 26 b outside surface of the ride - on access plate it will be understood that when an element is described as being “ connected ” or “ coupled ” to or with another element , it can be directly connected or coupled to the other element or , instead , one or more intervening elements may be present . in contrast , when an element is described as being “ directly connected ” or “ directly coupled ” to another element , there are no intervening elements present . when an element is described as being “ indirectly connected ” or “ indirectly coupled ” to another element , there is at least one intervening element present . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated .

US-201313856720-A

the invention relates to a method for producing coated sterol powder , wherein a ) a carbohydrate and / or a protein and / or a protein - containing auxiliary agent is dissolved or dispersed in water or in an aqueous suspension medium , b ) said sterol and / or stanol particles are added to the solution / dispersion , c ) the thus obtained solution is homogenised in a homogeniser or a colloid mill in the circuit , d ) one part of the homogenate is extracted in a continuous manner from the circuit and directly e ) introduced into a dry - spraying system by pulverisation and spraying . the coated sterol - containing particles produced according to said method are incorporated into food based due to their good wettability and without using complex equipment , and display , in particular , good organoleptic and sensory properties in drinks .

the present invention relates in preferred embodiments to processes for the production of coated sterol - containing powders in which a ) a carbohydrate and / or a protein and / or a protein - containing auxiliary is dissolved and / or dispersed in water and / or in a water - containing suspension medium , b ) sterol and / or stanol particles are added to the resulting solution / dispersion , c ) the suspension thus form is homogenized , preferably by circulation through a slot homogenizer or a colloid mill , d ) at least part of the homogenizate is removed from the circuit , preferably continuously , and e ) is introduced , preferably by being directly delivered , to a spray dryer and spray - dried . it is possible according to preferred processes according to the invention to produce powders even containing free unesterified sterols and stanols which enable the lipophilic active components to be more readily further processed in foods , more especially beverages . the preferred powders exhibit little tendency to agglomerate and , hence , have good flow properties . the preferred powders are distinguished by good homogeneity and , by virtue of their improved wettability , can be in many cases , further processed without major investment in equipment . in addition , the preferred powders can be uniformly distributed very quickly in the final formulation . the preferred coating greatly improves the organoleptic properties and the sensory impression . the coated powder does not stick to teeth or oral mucous membranes , so that the unpleasant sterol taste , which leads to serious losses of taste in foods containing the active components , is substantially suppressed in preferred embodiments . in accordance with preferred aspects , coating the present powder compositions with hydrophilic auxiliaries , such as carbohydrates , proteins or protein - containing additives , not only improves solubilization properties and dispersion properties , the powders surprisingly also show increased storage stability in relation to ground sterols which have a strong tendency to agglomerate . when it comes to the processing of unesterified sterols and stanols in the aqueous medium , the preferred processes reduce , and preferably eliminate , the need to use highly surface - active emulsifiers , such as lecithins , monoglycerides , diglycerides , polysorbates , sodium stearyl lactylate , glycerol monostearate , lactic acid esters and polyglycerol esters . the minimal emulsifier properties of the auxiliaries that impart hydrophilicity , more particularly the proteins , caseinates and protein - rich auxiliaries , are in many embodiments sufficient to enhance the homogeneity of the powder produced and to improve redispersibility and processability . the absence of other emulsifiers simplifies further processing by reducing possible incompatibilities with other food ingredients and reduces the occurrence of incompatibilities at the end user . the need for highly active emulsifiers , such as lecithins , monoglycerides , diglycerides , polysorbates , sodium stearyl lactylate , glycerol monostearate , lactic acid esters and polyglycerol esters , can be greatly reduces in many embodiments by use of the preferred continuous homogenization and direct removal and delivery of the homogenized suspension to the spray dryer . such preferred processes according to the invention enable powders having a very high sterol content and the favorable properties described above to be produced without any need whatever to use organic solvents . the coated sterol formulations preferably contain at least about 50 % by weight , more preferably at least about 55 % by weight and most preferably at least about 65 % by weight sterols , including sterol derivatives , such as stanols , based on the weight of the powder . the sterol - containing formulations produced by the present processes may readily be incorporated in foods , more particularly in milk , milk beverages , whey and yogurt beverages , margarine , fruit juices , fruit juice mixtures , fruit juice beverages , vegetable beverages , still and sparkling beverages , soya milk beverages and protein - rich liquid food substitute beverages and fermented milk preparations , yogurt , drinking yogurt , or cheese preparations , cereals and nutrition bars , and also in cosmetic or pharmaceutical preparations . in the first step of the preferred production process , in which a carbohydrate and / or a protein and / or a protein - containing auxiliary is dissolved or dispersed in water or a water - containing suspension medium , the hydrophilic auxiliaries serving as subsequent coating materials are dissolved or dispersed . to this end , the water or the water - containing suspension medium is preferably heated to a temperature of about 50 ° c . to about 80 ° c ., and more preferably to a temperature of about 65 to about 75 ° c . in this first step , the other auxiliaries are also preferably added as required to the aqueous phase or to the water - containing suspension medium . in a preferred embodiment , glucose and casein or caseinates are used as auxiliaries . it has proved to be particularly effective in certain embodimentsto use casein ( acid casein ) which is only converted into sodium caseinate after dispersion in heated water by the addition of sodium hydroxide to a ph of about 6 . 5 to about 7 . 5 in the dispersion medium . surprisingly , the process with this in situ formation of sodium caseinate results in a better dispersible end formulation by comparison with a process in which sodium caseinate is directly added . in another preferred embodiment , glucose and milk powder are used as auxiliaries . it has proved to be particularly effective to use skim milk powder because this auxiliary is the best at masking the typical unpleasant sterol taste and formulations containing skim milk powder have improved sensory properties in relation to other auxiliaries . instead of and / or in addition to pure water , it is also possible to use water - containing suspension media which form the basis of the sterol - containing food to be subsequently produced . thus , beverages such as , for example , milk , milk beverages , whey and yogurt beverages , fruit juices , fruit juice mixtures , fruit juice beverages , vegetable beverages , soya milk beverages and protein - rich liquid food substitute beverages and fermented milk preparations , but preferably fruit and vegetable beverages , may be directly used as the suspension medium in step a ). the sterol - containing powder obtained after spray drying may then readily be redispersed with water to give a sterol - containing beverage ready for drinking . this solution or dispersion of the hydrophilic auxiliaries is preferably heated to about 75 ° c . to about 95 ° c . and preferably to about 80 ° c . to about 85 ° c ., and sterol and / or stanol particles are preferably added to the system with stirring . it has proved to be particularly effective to use ground sterols and / or stanols having a small particle size with a d 90 % of at most about 50 μm ( as measured with a beckman coulter ls 320 laser diffractometer , expressed as volume distribution ). the measurement is conducted in a suspension containing 10 % lamegin ze 609 ( citrem ®) in the process . the addition of larger particles in turn leads to end formulations with larger particle sizes which reduce bioavailability and are therefore undesirable in many embodiments . sterols and / or stanols having a particle size distribution with a d 90 % of at most about 30 μm are preferably used . the suspension thus formed is then homogenized by circulation through a slot homogenizer or a colloid mill . the fryma mill used is based on the rotor - stator principle . the homogenization of the sterol - containing suspension merely leads to size reduction of the agglomerates , the sterol particles themselves undergoing no further size reduction during the treatment . where skim milk powder is used as the auxiliary to impart hydrophilicity , homogenization with the colloid mill is sufficient to guarantee uniform distribution of the sterol particles before introduction into the spray drying tower . at least a portion of the homogenizate is preferably continuously removed from the volume stream and delivered to the spray drying tower . without the addition of highly surface - active emulsifiers , it is difficult to maintain the strongly lipophilic unesterified sterol and stanol particles with sufficient homogeneity in the suspension medium . the suspension thus homogenized generally does not have good physical stability . accordingly , it is highly preferred for at least a portion , and in certain embodiments only a portion , of the suspension homogenized in the slot homogenizer to be directly and continuously removed and delivered to the spray drying tower . the actual coating of the particles preferably takes place through the immediate spray drying in the spray drying tower . because the particles are spray dried from a water - containing medium , the hydrophilic auxiliaries remain on the surface of the lipophilic sterol particles after evaporation of the water and form a hydrophilic coating which significantly improves the properties of the powder formed . besides their lipophilic properties , generally the ground sterol particles used in the process have uneven surfaces which easily become entangled with one another . the hydrophilic coating preferably provides substantially round particles which have much better flow properties and hence better processability . by virtue of the evaporation coldness of the water during spray drying , the suspended sterol or stanol particles do not melt , even at high feed air temperatures . the particles thus comprise a core which contains the original sterol or stanol particle and a coating of the hydrophilic auxiliaries . it is expected and understood that those skilled in the art will be able to readily adapt the spray drying conditions to the particular formulation by routine variations . in the preferred embodiment of the process , in which glucose and casein or caseinate are used as hydrophilic auxiliaries in a quantity of from about 40 % to about 80 % by weight sterols and / or stanols , from about 3 % to about 30 % by weight glucose and from about 10 % to about 30 % by weight casein and / or caseinate , based on the formulation as a whole , good results have been obtained with a feed air temperature of from about 170 ° c . to about 190 ° c ., a waste air temperature of 90 ± 15 ° c . and an atomizer speed of from about 20 , 000 to about 30 , 000 r . p . m . sterols obtained from plants and vegetable raw materials — so - called phytosterols and phytostanols — are used in the present invention . known examples are ergosterol , brassica sterol , campesterol , avenasterol , desmosterol , clionasterol , stigmasterol , poriferasterol , chalinosterol , sitosterol and mixtures thereof . of these , β - sitosterol and campesterol are preferably used . hydrogenated saturated forms of the sterols , known as stanols , are also included among the compounds used . again , β - sitostanol and campestanol are preferred . vegetable raw material sources include inter alia seeds and oils of soybeans , canola , palm kernels , corn , coconut , rape , sugar cane , sunflower , olive , cotton , soya , peanut or products from the production of tall oil . the preparations according to the invention contain from about 10 % to about 90 % by weight , preferably from about 30 % to about 70 % by weight and , in a particularly preferred embodiment , from about 35 % to about 65 % by weight sterols and / or stanols , based on the powder - form coated preparations . the present invention also relates in certain aspects to food preparations containing sterol / stanol formulations with the composition mentioned above . they are preferably used in beverages and milk products which then contain from about 0 . 1 % to about 50 % by weight and preferably from about 1 % to about 20 % by weight of the powder - form coated preparations , based on the total weight of the food . the protein - containing auxiliaries preferably used are milk powders , such as commercially available whole milk and skim milk powders , which have been obtained from corresponding types of milk by drying . they may be used in the form of mixtures with other proteins or as sole carrier . if other proteins are added or if proteins instead of milk powder are used as the carrier , these proteins are understood to be isolated proteins which are obtained from natural animal and vegetable sources and which are added in the production of the powder - form preparations . possible sources of proteins are plants , such as wheat , soya , lupins , corn or sources of animal origin , such as eggs or milk . milk powders or milk - derived proteins , such as casein and casein salts , sodium and / or calcium caseinates are preferably used . skim milk powder and / or casein and caseinates are particularly preferred for the purposes of the invention because , on the one hand , they have emulsifying properties without , at the same time , showing the disadvantages mentioned at the beginning of the food emulsifiers otherwise normally used specifically for the production of beverages and milk products , more particularly fermentation products , such as yogurt . the preparations according to the invention preferably contain from about 5 % to about 90 % by weight , preferably from about 5 % to about 70 % by weight , more preferably from about 10 % to about 40 % by weight and most preferably from about 12 % to about 35 % by weight milk powder and / or proteins , preferably in the form of skim milk powder or casein and / or sodium caseinate and / or calcium caseinate , based on the coated powder - form preparation . the compounds used as carbohydrates preferably all contain food - compatible sugars selected from the group consisting of glucose , sucrose , fructose , trehalose , maltose , maltodextrin , cyclodextrin , invert sugar , palatinose and lactose . glucose in the form of glucose syrup is preferably used as the carbohydrate . with the dispersibility and stability of the preparation in mind , it has proved to be particularly effective to use from about 0 % to about 40 % by weight , preferably from about 10 % to about 35 % by weight and , in a particularly preferred embodiment , from about 15 % to about 30 % by weight carbohydrates , based on the weight of powder - form sterol / stanol formulation . the preparations according to preferred aspects of the invention contain antioxidants , preservatives and flow promoters as further auxiliaries . examples of possible antioxidants or preservatives are tocopherols , lecithins , ascorbic acid , parabens , butyl hydroxytoluene or anisole , sorbic acid or benzoic acid and salts thereof . tocopherols are preferably used as antioxidants . silicon dioxide may be used as a flow regulator and promoter . from their production , the preferred powder - form coated sterol formulations have a lipophilic core of sterols and / or stanols , optionally with other lipophilic auxiliaries , which is covered with a coating of hydrophilic auxiliaries . they preferably comprise a ) from about 10 % to about 97 % by weight unesterified sterols and / or stanols , b ) from about 3 % to about 70 % by weight sodium and / or calcium caseinate and / or milk powder , c ) from about 0 % to about 40 % by weight carbohydrates , a ) from about 10 % to about 90 % by weight unesterified sterols and / or stanols , b ) from about 5 % to about 70 % by weight sodium and / or calcium caseinate and / or milk powder , c ) from about 0 % to about 40 % by weight carbohydrates ( a ) from about 30 % to about 70 % by weight unesterified sterols and / or stanols , ( b ) from about 10 % to about 40 % by weight sodium and / or calcium caseinate and / or milk powder , ( c ) from about 10 % to about 35 % by weight glucose , ( a ) from about 35 % to about 65 % by weight unesterified sterols and / or stanols , ( b ) from about 12 % to about 35 % by weight sodium and / or calcium caseinate , ( c ) from about 10 % to about 35 % by weight glucose , ( a ) from about 50 % to about 65 % by weight unesterified sterols and / or stanols , ( b ) from about 12 % to about 35 % by weight sodium and / or calcium caseinate and / or skim milk powder , ( c ) from about 15 % to about 30 % by weight glucose , ( a ) from about 65 % to about 75 % by weight unesterified sterols and / or stanols , ( b ) from about 25 % to about 35 % by weight skim milk powder , ( a ) from about 90 % to about 97 % by weight unesterified sterols and / or stanols , ( b ) from about 3 % to about 10 % by weight skim milk powder based on the total weight of the powder , provided that they are substantially free from highly surface - active emulsifiers selected from the group consisting of lecithins , monoglycerides , diglycerides , polysorbates , sodium stearyl lactylate , glycerol monostearate , lactic acid esters and polyglycerol esters . 129 . 2 g casein ( from meggle , nährcasein 30 / 60 mesh ) were added to 1160 g cold water and heated to ca . 72 ° c . during this heating phase , the ph was adjusted to 7 . 0 by addition of naoh . 132 . 5 g glucose syrup were then added , followed by heating to 80 - 85 ° c . the ground sterol ( 250 g vegapure ® fte ) having a particle size distribution with a d 90 % of at most 30 μm ( laser diffractometry , beckman coulter ls 320 ) was then added in portions . the suspension was passed through a fryma mill ( from fryma rheinfelden , type mz 80 r , slot width : 240 μm ) and then homogenized by circulation through an apv homogenizer ( 220 / 30 bar ). ca . 30 % of the product stream was then fed continuously from the circuit to a spray dryer ( apv anhydro , type 3 s ) and spray dried . the remaining suspension was kept circulating and gradually fed to the spray drying tower . the particle size distribution of the powder was then measured by laser diffractometry ( beckman coulter ls 320 ): d 50 % 5 μm , d 90 % 29 μm . 150 g skim milk powder ( spray - dried skim milk powder , adpi grade , supplier : almil bad homburg ) were added to water ( 1280 g ) and heated to ca . 80 ° c . the ground sterol ( 350 g vegapure fte ) was then added in portions . the suspension was repeatedly circulated through a fryma mill ( slot width : 240 μm ). ca . 30 % of the product stream was then fed continuously from the circuit to a spray dryer ( apv anhydro , type 3 s ) and spray dried . the remaining suspension was kept circulating and gradually fed to the spray drying tower . 15 g skim milk powder ( spray - dried skim milk powder , adpi grade , supplier : almil bad homburg ) were added to water ( 1000 g ) and heated to ca . 80 ° c . the ground sterol ( 485 g vegapure fte ) was then added in portions . the suspension was repeatedly circulated through a fryma mill ( slot width : 240 μm ). ca . 30 % of the product stream was then fed continuously from the circuit to a spray dryer ( apv anhydro , type 3 s ) and spray dried . the remaining suspension was kept circulating and gradually fed to the spray drying tower . the powders thus obtained were dispersed in milk and water in comparison with ground sterols comparable in their particle size distribution . to this end , ca . 250 ml of the liquid to be tested were poured into a glass beaker and stirred ( ca . 100 r . p . m .). 2 . 5 g of the powders respectively containing 50 % by weight and 70 % by weight sterol were added to the stirred liquid and evaluated for dispersion behavior . the encapsulated sterol could be very uniformly dispersed in cold water ( 15 ° c .) and hot water ( 60 ° c .) and in milk ( 18 ° c .) whereas the untreated sterol was poorly dispersed and , owing to the hydrophobic surface , remained on the liquid surface . even a preparation containing only 3 % milk powder could be dispersed far more uniformly than the pure sterol powder . sensory evaluation showed that the encapsulated sterols tasted neutral in water and did not stick to the gums or mouth whereas the untreated powder stuck to the oral mucous membrane and , besides a typical negative sterol taste , left behind an unpleasant sensory impression . whereas the casein - containing powder could be dispersed somewhat better than the powder containing skim milk , the latter showed improved taste properties in relation to the casein - containing powder .

US-28216906-A

the present invention relates to silicone compounds which have photoprotective properties and personal care compositions comprising the same . the present inventors , in developing a sunscreen that gives protection against both uv radiation and visible radiation , found that when a certain moiety generally occurring in nature i . e . hydroxyanthraquinone having uv - visible absorption activity are attached to crosslinked silicone polymers they provide not only the desired photoprotection but also excellent spreadability on skin .

the present invention provides for a novel silicone compound of the formula : the units of block e may be cross - linked with another series of block e through r3 to form a net like architecture of the general formula : in a compound of the hydroxyanthraquinone group depicted above , usually , only one of the hydroxyl groups reacts with the polymer chain . the various forms of hydroxyanthraquinone are as shown below : r is a difunctional organic moiety covalently connecting the hydroxyanthraquinone chromophore and polymer chain . r3 is an organic moiety ( or spacer ) containing carbon , nitrogen , phosphorous , sulphur , oxygen or silicon atoms . the difunctional spacer group has two terminal alkenyl or alkynyl groups . the base silicone polymer chains are covalently linked to each other through difunctional spacer groups . these difunctional spacer groups prevent excessive and three dimensional cross - linking , which leads to a gelled mass . instead they help in forming a cross - linked elastomeric compound that is relatively easier to incorporate in personal care compositions . the difunctional spacer group is preferably of the formula : where y is organic moiety containing carbon , nitrogen , phosphorous , sulphur , oxygen or silicon atoms . the difunctional spacer compound is preferably selected from the group consisting of dialkenyl polyethers , alpha omega dienes , alpha omega diynes ; alpha omega ene - ynes or di alkenyl and dialkynyl terminated polysiloxane . suitable examples of alpha omega - dienes are 1 , 4 - pentadiene , 1 , 5 - hexadiene , 1 , 7 - octadiene ; 1 , 8 - nonadiene , 1 , 9 - decadiene , 1 , 11 - dodecadiene , 1 , 13 - tetradecadiene and 1 , 19 - eicosadiene . suitable examples of alpha omega - diynes are 1 , 3 - butadiyne or 1 , 5 - hexadiyne , whereas alpha omega ene - yne is preferably hexene - 5 - yne . it is further preferred that the spacer groups are siloxane or polyether based . wherein f is an integer 1 - 10 , 000 . more preferably the number of repeat units are in the range of 300 - 500 corresponding to an average molecular weight in the range of 22 , 000 - 40 , 000 daltons . a vinyl terminated polysiloxane having 375 repeat units and molecular weight of 28 , 000 daltons is particularly preferred . the di - alkenyl terminated polyethers can be represented by the following general formula : r5 is r1 or — h ; wherein g and h are an integer 1 - 10 , 000 . units a and f are the terminal moieties . in the units a and f , the functional r1 is preferably methyl or ethyl . blocks b , c , d , and e are non - terminal moieties independently positioned between a and f in any order . thus the order may be b - c - d - e as shown in the formula in the summary of the invention , or the order could be any permutation and combination which satisfies the rule “ independently positioned between a and f in any order ” i . e . it may be b - d - c - e , b - c - e - d , d - c - e - b , and a host of other possibilities . the invention also provides for a convenient process to prepare the silicone compound of the invention . in the process of the invention , the si — h containing siloxane is of the general formula : the si — h containing siloxane is preferably present in 0 . 001 to 95 % by weight of the reaction mixture . the uv - visible absorbing moiety ( vi ) is selected from a hydroxyanthraquinone compound . the term “ uv - visible absorbing moiety ” as used herein means a moiety having a molar extinction coefficient of at least 50 units . is preferably present in 0 . 001 to 95 % by weight of the reaction mixture . the difunctional spacer compound used in the process of the invention preferably has the formula where y is organic moiety containing carbon , nitrogen , phosphorous , sulphur , oxygen or silicon atoms . y is preferably a compound selected from a group consisting of hydrocarbons , polysiloxanes , polyethers , polycarboxylic acids , or polysaccharides . the difunctional spacer compound is preferably present in 0 . 001 to 95 % by weight of the reaction mixture . the process is preferably carried out in the presence of a monofunctional organic moiety of the general formula where z is — r1 or — oh or — h . the monofunctional organic moiety is preferably present in 0 . 001 to 95 % by weight of the reaction media . the compounds most preferred for providing the functionality of block c are polyethylene glycol monoallyl ethers ( clarient ) and long chain alkenes such as octadecene ( sigma aldrich ) having general structure indicated below : where rct is reactive group containing carbon , nitrogen , phosphorous , sulphur , oxygen or silicon atoms . alternately , the monofunctional organic moiety is preferably of a general formula : block c has been found to be useful to include in the compound of the invention since it can be selected to provide useful properties like emulsification and act as a solubilizer for other oleophilic materials like sunscreens . also , when used in hair care products , this has been found to be effective in deposition of actives to hair through water based wash off or rinse systems . the reaction is carried out in the presence of a catalyst . the catalyst is preferably selected from metal complexes or their compounds or metals in free or immobilized form . transition metals such as platinum , palladium and rhodium are particularly preferred . preferred catalysts include chloroplatinic acid , complexes of platinum with unsaturated compounds e . g . platinum ( 0 )- 1 , 3 - divinyl - 1 , 1 , 3 , 3 - tetramethyldisiloxane complex ; platinum ( 0 )- 2 , 4 , 6 , 8 - tetramethyl - 2 , 4 , 6 , 8 - tetravinylcyclotetrasiloxane complex ; pt0 ( 1 , 5 cyclooctadine ) i . e . pt ( cod )]; platinum phosphine complexes ; platinum on carbon ; platinum on inorganic supports such as silica and platinum black . complexes of other metals such as palladium , rhodium may also be used for the reaction , for example , wilkinson &# 39 ; s catalyst rhcl [( c6h5 ) p ] 3 . the catalyst can be in heterogeneous phase e . g . on charcoal or , preferably , in homogeneous phase ( karstedt catalyst ). platinum ( 0 )- 1 , 3 - divinyl - 1 , 1 , 3 , 3 - tetramethyldisiloxane complex is most preferred catalyst . the catalyst is preferably used in an amount of 0 . 0001 to 20 % by weight of the reaction mixture . the reaction is carried out in the presence of a reaction media which is a solvent which is water , a silicone fluid , polar organic compound , a non - polar organic compound or mixtures thereof . typically the solvent is present in an amount of 0 . 1 to 99 . 89 weight % based on the weight of all ingredients in the reaction mixture . preferably the solvent is present in an amount of from 1 to 80 weight % and more preferably from 1 to 50 weight %. when the solvent is a polar or non - polar organic compound , it is preferred that the amount to be used is that which would create a product containing & lt ; 40 weight % solids . when used , the solvent becomes an integral part of the resulting elastomer composition and affects the structural and physical properties of the silicone elastomer . preferably the solvent is not removed from the silicone elastomer composition . silicone fluid useful as the solvents include , alkyl and / or aryl siloxanes . preferred are volatile methyl siloxanes ( vms ). preferably the volatile methyl siloxane have a normal boiling point less than about 250 ° c . representative linear volatile methyl siloxanes include , but are not limited to hexamethyldisiloxane , octamethyltrisiloxane , decamethyltetrasiloxane , dodecamethylpentasiloxane , tetradecamethylhexasiloxane , and hexadecamethylheptasiloxane . representative cyclic volatile methyl siloxanes are hexamethylcyclotrisiloxane , octamethylcyclotetrasiloxane , decamethylcyclopentasiloxane , and dodecamethylcyclohexasiloxane . representative branched volatile methyl siloxanes are heptamethyl - 3 -{( trimethylsilyl ) oxy } trisiloxane , hexamethyl - 3 , 3 , bis {( trimethylsilyl ) oxy } trisiloxane , and pentamethyl {( trimethylsilyl ) oxy } cyclotrisiloxane . illustrative of such silicone fluids are polydimethylsiloxane , polydiethylsiloxane , polymethylethylsiloxane , polymethylphenylsiloxane , and polydiphenylsiloxane . organofunctional silicone fluids can also be employed as the solvent . examples of functional silicone fluids include , but are not limited to , acrylamide functional silicone fluids , acrylate functional silicone fluids , carbinol functional silicone fluids , carboxy functional silicone fluids , chloroalkyl functional silicone fluids , glycol functional silicone fluids , ketal functional silicone fluids , mercapto functional silicone fluids , methyl ester functional silicone fluids , perfluoro functional silicone fluids , polyisobutylene ( pib ) functional silicone fluids , silanol functional silicone fluid , and vinyl functional silicone fluids . when silicone fluids are used , the resulting ultraviolet radiation absorbing silicone compound is in the form of silicone gels . non - polar organic compounds may also be used as the solvents . the commonly used organic solvents include aromatic hydrocarbons , aliphatic hydrocarbons , high molecular weight alcohols , aldehydes , ketones , amines , esters , ethers , glycols , glycol ethers , alkyl halides , or aromatic halides . when a polar or non - polar organic solvent is used , the resulting silicone compound is in the form of a silicone gel . suitable organic solvents are the ones that do not undergo a chemical reaction with any of the components of the silicone phase , under the anticipated conditions of processing and use and that is suitable for use in the intended end - use application . the reaction temperature , depending upon the reactants , is in the range of 0 - 250 ° c . and preferably about 80 - 120 ° c . and most preferably about 110 ° c . the reaction time may vary between 1 minute to about 48 hours , more preferably between 1 to 12 hours . after the reaction is taken to desired completion , the contents are then preferably added to a swelling agent . the swelling agent is preferably a solvent hereinabove described with the exception of water or low molecular weight alcohols . thus the swelling agent may be a silicone fluid , a polar organic compound , or a non - polar organic compound with the above exceptions . the swelling agent is most preferably a silicone fluid or a functional silicone fluid . the swelling agent is preferably used in an amount which is in a weight ratio of 1 : 10 to 10 : 1 , more preferably 1 : 1 to 5 : 1 with respect to the reaction mixture . an additional advantage of the present invention is that the silicone compound of the invention can be used as a delivery vehicle for active ingredients such as oil soluble vitamins , fragrances and sunscreens . fragrance oils that are compatible with silicone elastomers can be absorbed into the silicone compound of the invention and their volatility will be reduced , thereby improved the desired sensorial impact . an advantage of the present invention is that the silicone compound of the invention when incorporated in sunscreen compositions comprising well known uv - a organic sunscreens and oil - soluble uv - b sunscreens synergistically boosts the sun - protection factor ( spf ). preferred uv - a sunscreen for getting this benefit is parsol 1789 . preferred oil soluble uv - b sunscreen for getting this benefit is selected from the class of cinnamic acid , salicylic acid , diphenyl acrylic acid or derivatives thereof . examples of such oil - soluble organic sunscreens are octisalate ™, homosalate ™, neohelipan ™, octocrylene ™ or parsol mcx ™. most suitable oil - soluble uv - b organic sunscreen is parsol mcx . “ personal care composition ” as used herein , is meant to include a composition for topical application to skin and / or hair of mammals , especially humans . such a composition may be generally classified as leave - on or rinse off , and includes any product applied to a human body for improving appearance , cleansing , odor control or general aesthetics . the composition of the present invention can be in the form of a liquid , lotion , cream , foam , scrub , gel , soap bar or toner , or applied with an implement or via a face mask , pad or patch . non - limiting examples of personal care compositions include leave - on skin lotions and creams , shampoos , conditioners , shower gels , toilet bars , antiperspirants , deodorants , dental products , shave creams , depilatories , lipsticks , foundations , mascara , sunless tanners and sunscreen lotions . “ skin ” as used herein is meant to include skin on the face and body ( e . g ., neck , chest , back , arms , underarms , hands , legs , buttocks and scalp ). according to yet another aspect , the present invention relates to a personal care composition comprising the silicone compound according to the invention , in a cosmetically acceptable vehicle . it is preferred that the compound is present from 1 to 30 % by weight of the composition , more preferably from 2 to 15 %, and most preferably from 3 to 10 % by wt of the composition . these are suitable for the protection of human skin and / or hair from damaging effects of uv radiation . the personal care compositions of the invention are useful as compositions for photo protecting the human epidermis or hair against the damaging effect of uv irradiation , as antisun / sunscreen composition or as makeup product . such compositions can , in particular , be provided in the form of a lotion , a thickened lotion , a gel , a cream , cleansing milk , an ointment , a powder or a solid tube stick and may optionally be packaged as an aerosol and may be provided in the form of a mousse , foam or a spray . the personal care compositions of the invention can also contain usual cosmetic adjuvants and skin care additives commonly employed in skin care products such as liquid or solid emollients , silicone oils , emulsifiers , solvents , humectants , polymeric or inorganic thickeners , powders , pigments ( example clay mineral , barium sulfate , or pearl pigments , for example silver or gold , or any iris foil pearl pigment , having an interference color of red , orange , green , blue , or , purple ( including any iris foil pearl pigments covered with inorganic pigments , organic pigments , laked pigments , etc . ), bismuth oxychloride , bismuth oxychloride coated mica ,) organic or inorganic sunscreens with and without photostabiliser , skin lightening agents , skin conditioners , optical brighteners , propellants , healing agents ( example allantoin ), cooling agents ( example urea , menthol , menthyl lactate , frescolate ), antiseptic agents and other specific skin - benefit actives , skin care actives such as skin lightening actives , antiaging , antiacne , antibacterials , antiperspirant agents etc ,. the vehicle may also further include adjuncts such as antioxidants , perfumes , opacifiers , preservatives , colorants and buffers . the necessary amounts of the cosmetic and dermatological adjuvants and additives , based on the desired product , can be chosen by the skilled person . the composition may additionally comprise from 0 . 1 to 20 %, more preferably from 0 . 1 to 5 % of an inorganic sunscreen agent . inorganic sunscreens , which may be employed , are for e . g . titanium dioxide , zinc oxide or silica such as fumed silica and mixtures thereof . these are preferably in the micronized form . ultrafine titanium dioxide in either of its two forms , namely water - dispersible titanium dioxide and oil - dispersible titanium dioxide , may be suitable for the invention . water - dispersible titanium dioxide is ultra - fine titanium dioxide , the particles of which are non - coated or which are coated with a material to impart a hydrophilic surface property to the particles . examples of such materials include aluminium oxide and aluminium silicate . oil - dispersible titanium dioxide is ultrafine titanium dioxide , the particles of which exhibits a hydrophobic surface property , and which , for this purpose , can be coated with metal soaps such as aluminium stearate , aluminium laurate or zinc stearate , or with organosilicone compounds . by “ ultrafine or micronized form ” is meant particles of inorganic sunscreens having an average particle size of less than 100 μm , preferably 70 μm or less , more preferably less than 40 μm and most preferably from 15 to 25 μm . vitamins , which act as skin - lightening ingredients can be advantageously included in the composition to provide for additional skin lightening effects . these include vitamin b3 , vitamin b6 , vitamin c , vitamin a or their precursors and cosmetically acceptable derivatives . mixtures of the vitamins can also be employed in the composition of the invention . when present , these vitamins are used in the range of 0 . 01 to 10 . 0 % by weight of said composition . emollients , such as stearyl alcohol , glyceryl monoricinoleate , mink oil , cetyl alcohol , isopropyl isostearate , stearic acid , isobutyl palmitate , isocetyl stearate , oleyl alcohol , isopropyl laurate , hexyl laurate , decyl oleate , octadecan - 2 - ol , isocetyl alcohol , eicosanyl alcohol , behenyl alcohol , cetyl palpitate , silicone oils such as dimethylpolysiloxane , organomodified silicones such as cetyl dimethicone , steryl dimethicones ; cross - linked silicone elastomers / resins ; organo - modified cross - linked silicone elastomers / resins di - n - butyl sebacate , isopropyl myristate , isopropyl palmitate , isopropyl stearate , butyl stearate , polyethylene glycol , triethylene glycol , lanolin , cocoa butter , corn oil , cotton seed oil , olive oil , palm kernel oil , rape seed oil , safflower seed oil , evening primrose oil , soybean oil , sunflower seed oil , avocado oil , sesame seed oil , coconut oil , arachis oil , castor oil , acetylated lanolin alcohols , petroleum jelly , mineral oil , butyl myristate , isostearic acid , palmitic acid , isopropyl linoleate , lauryl lactate , myristyl lactate , decyl oleate , myristyl myristate ; propellants , such as propane , butane , isobutane , dimethyl ether , carbon dioxide , nitrous oxide ; solvents , such as ethyl alcohol , isopropanol , acetone / ethylene glycol monoethyl ether , diethylene glycol monobutyl ether , diethylene glycol monoethyl ether ; powders , such as chalk , talc , fullers earth , kaolin , starch , gums , colloidal silica sodium polyacrylate , tetra alkyl and / or trialkyl aryl ammonium smectites , chemically modified magnesium aluminium silicate , organically modified montmorillonite clay , hydrated aluminium silicate , fumed silica , carboxyvinyl polymer , sodium carboxymethyl cellulose , ethylene glycol monostearate ; plant extracts such as those from genus rubia , symplocus , curcuma and various perfume / fragrance ingredients may also be included in the composition at ranges from 0 . 001 to 40 . 0 % by weight of the composition . the emollient is preferably present in an amount from about 1 to about 20 %, preferably about 2 to about 15 %, and most preferably about 4 to about 10 % by weight of the total weight of the composition . the preservatives and antioxidants are preferably present in an amount ranging about 0 . 01 to about 10 % of the total weight of the composition . preferably the preservatives and / or antioxidants are present in an amount varying about 0 . 1 to about 1 % by weight . preferred emulsifiers that may be used to form o / w , w / o is and / or o / w / o formulations , include sorbitan oleate , sorbitan sesquioleate , sorbitan isostearate , sorbitan trioleate , polyglyceryl - 3 - diisostearate , polyglycerol esters of oleic / isostearic acid , polyglyceryl - 6 hexaricinolate , polyglyceryl - 4 - oleate , polygylceryl - 4 oleate / peg - 8 propylene glycol cocoate , oleamide dea , tea myristate , tea stearate , magnesium stearate , sodium stearate , potassium laurate , potassium ricinoleate , sodium cocoate , sodium tallowate , potassium castorate , sodium oleate , silicone based emulsifiers and mixtures thereof . the oily phase of the compositions according to the present invention may also contain natural vegetable or animal waxes such as bee wax , china wax , bumblebee wax and other waxes of insects as well as shea butter . the aqueous phase of the formulations of the present invention may contain the usual cosmetic additives such as alcohols , especially lower alcohols , preferably ethanol and so or isopropanol , low alkyl diols or polyols and their ethers , preferably propyleneglycol , glycerine , ethyleneglycol , ethylene glycol monoethyl or monobutyl ether , electrolytes and especially , one or more thickeners . thickeners that may be used in formulations of the present invention include the family of silicon dioxide , magnesium and / or aluminum silicates , polysaccharides and their derivatives such as hyaluronic acid , xanthan gum , hydroxypropyl cellulose , acrylate copolymers , preferably a polyacrylate of the family of carbopols , such as carbopols of type 980 , 981 , 1382 , 2984 , 59s4 . moisturizing agents , such as humectants , may be incorporated into the compositions according to the present invention to reduce the trans - epidermal water loss ( tewl ) of the horny layer of the skin . suitable humectants include glycerin , lactic acid , pyrrolidone carbonic acid , urea , polyethylene glycol , polypropylene glycol , sorbitol , peg - 400 , and mixtures thereof . additional suitable moisturizers are polymeric moisturizers of the familiy of water soluble and / or with water gelating polysaccarides such as hyaluronic acid , chitosan and / or fucose rich polysaccharides available , e . g . as fucoge11000 ( cas - nr . is 178463 - 23 - 5 ) from solabia s . the moisturizing agent is optionally present in an amount about 0 . 5 to about 8 %, preferably about 1 to about 5 % by weight of the total weight of the composition . suitable neutralizing agents which may be included in the composition of the present invention to neutralize components such as e . g . an emulsifier or a foam builder / stabilizer include but are not limited to alkali hydroxides such as a sodium and potassium hydroxide ) organic bases such as diethanolamine ( dea ), triethanolamine ( tea ), aminomethyl propanol , trisodium ethylenediaminetetraacetic acid and mixtures thereof ; basic amino acids such as arginine and lysine and any combination of any of the foregoing . the neutralizing agent may be present in an amount of about 0 . 01 to about 8 % by weight in the compositions of the present invention , preferably 1 to about 5 % by weight . the addition of electrolytes into the composition of the present invention may be necessary to change the behavior of a hydrophobic emulsifier . thus the emulsions may preferably contain electrolytes of one or several salts including anions such as a chloride , a sulfate , a carbonate , a borate or an aluminate , without being limited thereto . other suitable electrolytes may be on the bases of organic anions such as , but not limited to , lactate , acetate , benzoate , propionate , tartrate and citrate . as cations preferred are ammonium , alkyl ammonium , alkaline or alkaline earth metals such as sodium or magnesium . especially preferred salts are potassium and sodium chloride , magnesium sulfate , zinc sulfate and mixtures thereof . electrolytes are preferably present in an amount of about 0 . 01 to about 0 . 5 % by weight in the compositions of the present inventions . the invention will now be explained in detail with help of the following non - limiting examples , which form preferred embodiments of the various aspects of the invention . synthesis of ultraviolet - visible light absorbing linear silicone polymer compound having alizarin moiety stage 1 : synthesis of allyloxy functional alizarin derivative ( a compound of the formula vi - o —( ch 2 ) 0 - 50 — ch ═ ch 2 or vi - o —( ch 2 ) 0 - 50 — c ≡ ch i . e . component ( ii ) of the process of the invention .) stage 2 : synthesis of methylhydrogenpolysiloxane ( mhps ) copolymer ( si — h containing siloxane of component ( i ) of the process of the invention ). a 2 - liter , 3 - necked flask was fitted with condenser and additional funnel . the flask was charged with 5 g ( 0 . 014 mol ) of alizarin and 17 . 7 ml of ethanol . sodium ethoxide 2 . 268 g ( 0 . 042 mol ) as a 21 % solution in ethanol was added rapidly . the mixture was heated to 50 - 60 ° c . for 2 hours . allyl bromide ( 3 . 7 g ; 0 . 042 mol ) was added and the mixture heated to reflux ( 70 - 74 ° c .) for 20 hours . the mixture was allowed to return to room temperature and 50 ml water were added , followed by 17 ml of toluene and about 1 ml of 38 % aqueous hydrochloric acid . the organic layer was separated and washed with 50 ml of water . volatiles were removed from the organic layer by rotary evaporation at 80 ° c . and at 2 mm hg to give 5 g of allyl ether intermediate . a dark brownish yellow coloured sticky solid was obtained having , 1h - nmr ( cdcl3 ) peaks ( due to allyl and methoxy group present on alizarin molecule ) at 6 . 05 ( m , 1h , ch2 = ch — ch2 - o —), 5 . 32 and 5 . 43 ( 2h , ch2 = ch — ch2 - o ), 4 . 6 ( 2h , ch ═ ch2 - ch2 - o ), 3 . 9 ( 3h , ch3o —). 50 g of octamethycyclotetrasiloxane ( d 4 ) was mixed with 15 g of methylhydrogen - polysiloxane ( aldrich , mhps ) in a two necked round bottom flask . to the mixture 1 g of tulsion catalyst ( thermax , t63mp ) was added . the reaction mixture was stirred at 120 ° c . for 4 hours . viscous mhps copolymer obtained was cooled down to room temperature . catalyst was filtered off . unreacted d 4 was distilled off under vacuum at 125 ° c . the product obtained was a colourless and viscous oily substance . the colorless and viscous oily substance was characterised with an ftir peak due to si — h at 2115 cm − 1 , si — ch 3 at 1260 cm − 1 , — si — o — si at 1186 cm − 1 ; 1 h - nmr ( cdcl 3 ) peaks at δ 0 . 09 ( s , sic h 3 ), 0 . 17 ( s , si ( c h 3 ) h ) and 4 . 68 ( s , si — h ). 100 ml toluene were charged to a 3 - necked flask fitted with a dean and stark set - up under nitrogen atmosphere . traces of water present in toluene were removed by azeotropic distillation . 1 . 5 g allyloxy functional alizarin class ( as prepared in stage 1 above ) were charged into a moisture - free 3 - necked flask , fitted with as reflux assembly , maintained under nitrogen atmosphere . 50 ml dry toluene was added subsequently to dissolve all the reagents . one drops of platinum catalyst ( 1 , 3 - divinyltetramethyldisiloxane , sigma - aldrich ) were added to the reaction mixture and the mixture was stirred at room temperature for about 0 . 5 hours . 2 g of methylhydropolysiloxane ( mhps ) copolymer ( as prepared in stage 2 above ) was added and the reaction was stirred at about 110 ° c . for about 2 - 3 hours . the progress of the reaction was monitored by tlc and ft - ir . the product was obtained in a polymer form . the polymer was further washed with methanol to remove unreacted organic matter and platinum catalyst . the remaining traces of toluene and methanol were removed under vacuum below 60 ° c . the in - vitro absorbance of a 500 ppm solution of the compound obtained in example 1 showed two uv absorption maxima , one at 310 nm with an absorbance value of 0 . 65 units and the other at 355 nm with a corresponding absorbance value of 0 . 80 and at 440 nm with a corresponding absorbance value of 0 . 26 units , thereby confirming the presence of both the uv as well as visible absorbing moieties . thus it can be readily seen that the compound of the present invention provides protection against both uv and visible radiation as indicated by absorbance in uva , uvb and visible radiation wavelengths and the compound exhibits high photostability . the composition of example 1 was applied on a transpore tape ( 3m ) which was fixed to the quartz plate . the application was performed using transpore tape as the substrate fixed over quarts plate . the amount of cream applied was 3 mg / cm 2 . the intensity of simulated solar atlas lamp sun lamp was 5 . 5 mw / cm 2 . the quartz plate was dried and kept in the solar simulator . the transmitted energy was measured through the film present on the transpore tape / quartz , using radiometer . the % transmission (% t ) at 350 , 400 , 450 nm were recorded at zero time of solar simulated sun light exposure . next , this polymer film was exposed to solar simulated sun light for 30 , 60 and 120 minutes respectively . the % t at 350 , 400 , 450 nm were recorded after 30 , 60 and 120 minutes of solar simulated sun light exposure . the transmitted energy obtained from the transpore tape / quartz was used as the control . alizarin ( at 10 % by weight of the composition ) was mixed with methylhydropolysiloxane ( mhps ) copolymer ( as prepared in stage 2 above ) to obtain a composition of comparative example 1a . the appearance of the polymer composition ( example 1a ) obtained by physical addition of alizarin to the polymer was opaque and not homogeneous where particles of alizarin could be seen to be physically dispersed in the gel matrix when observed under microscope . on the other hand , the appearance of the polymer of example 1 where alizarin is covalently attached to silicone backbone was transparent and homogeneous and no particles could be seen when observed under microscope . thus , the composition of example 1a does not provide for uniform distribution of alizarin in the polymer thereby affording poor uv visible protection . the compositions of example 1 and example 1a were applied on a transpore tape ( 3m ) which was fixed to the quartz plate . the application was performed using transpore tape as the substrate fixed over quarts plate . the amount of cream applied was 3 mg / cm 2 . the intensity of simulated solar atlas lamp sun lamp was 5 . 5 mw / cm 2 . the quartz plate was dried and kept in the solar simulator . the transmitted energy was measured through the film present on the transpore tape / quartz , using radiometer . the transmitted energy obtained from the transpore tape / quartz was used as the control . the data in table 2 indicates that composition as per the invention ( example 1 ) provides for excellent uv - vis protection as evidenced by the low transmission values . synthesis of ultraviolet visible light absorbing silicone compound ( silicone elastomer gel ) having alizarin moiety stage 1 : synthesis of allyloxy functional alizarin derivative ( a compound of the formula vi - o —( ch 2 ) 0 - 50 — ch ═ ch 2 or vi - o —( ch 2 ) 0 - 50 — c ≡ ch i . e . component ( ii ) of the process of the invention .) stage 2 : synthesis of methylhydrogenpolysiloxane ( mhps ) copolymer ( si — h containing siloxane of i . e . component ( i ) of the process of the invention ). stage 3 : synthesis of divinyl terminated polysiloxane copolymer ( vtp ) spacer ( a difunctional spacer compound having alkenyl or alkynyl group to enable formation of crosslinked gel . 20 g of octamethycyclotetrasiloxane ( d 4 ) was mixed with 4 g of divinyltetramethyl - disiloxane ( aldrich ) in a 50 ml 2 - necked flask . to the mixture 0 . 3 g of tulsion catalyst ( thermax , t63mp ) was added . the reaction mixture was stirred at 120 ° c . for 4 hours . divinyl terminated polysiloxane copolymer ( vtp ) copolymer obtained was cooled down to room temperature . catalyst was filtered off . unreacted d 4 was distilled off under vacuum at 125 ° c . the product obtained was colorless viscous oil . this was used as the spacer compound . the colorless , viscous liquid was characterised with 1 h - nmr ( cdcl 3 ) peaks at δ 0 . 09 ( s , sic h 3 ), 0 . 17 ( s , si ( c h 3 ) h ), 0 . 8 ( m , si — c h ═ ch 2 ), 5 . 6 - 6 . 2 ( s , si — c h ═ ch 2 ). 100 ml toluene were charged to a 3 - necked flask fitted with a dean and stark set - up under nitrogen atmosphere . traces of water present in toluene were removed by azeotropic distillation . 1 . 5 g allyloxy functional alizarin ( as prepared in stage 1 above ) and 0 . 21 g divinyl terminated polysiloxane ( vtp ) ( as prepared in stage 3 above ) were charged into a moisture - free 3 - necked flask , fitted with a reflux assembly , maintained under nitrogen atmosphere . 50 ml dry toluene was added subsequently to dissolve all the reagents . one drop of platinum catalyst ( 1 , 3 - divinyltetramethyldisiloxane , sigma - aldrich ) were added to the reaction mixture and the mixture was stirred at about 25 ° c . for about 0 . 5 hours . 2 g of methylhydropolysiloxane ( mhps ) copolymer ( as prepared in stage 2 above ) was added and the reaction was stirred at about 110 ° c . for about 2 - 3 hours . the progress of the reaction was monitored by tlc and ft - ir . the product was obtained in a gel form . the gel was further washed with methanol to remove unreacted organic matter and platinum catalyst . it was further swollen in 30 g of ( decamethylcyclopentasiloxane ) d 5 and remaining traces of toluene and methanol were removed under vacuum below 60 ° c . the in - vitro absorbance of a 500 ppm solution of the compound obtained in example 2 showed two uv absorption maxima , one at 310 nm with an absorbance value of 0 . 65 units and the other at 355 nm with a corresponding absorbance value of 0 . 80 and at 440 nm with a corresponding absorbance value of 0 . 26 units , thereby confirming the presence of both the uv as well as visible absorbing moieties . thus it can be readily seen that the preferred compound ( crosslinked elastomer gel ) of the present invention provides protection against both uv and visible radiation as indicated by absorbance in uva , uvb and visible radiation wavelengths . alizarin ( at 10 % by weight of the composition ) was mixed with silicone 9040 gel ( dow corning ®) to obtain a composition of comparative example 2a . the appearance of the gel composition ( example 2a ) obtained by physical addition of alizarin to the gel was opaque and not homogeneous where particles of alizarin could be seen to be physically dispersed in the gel matrix when observed under microscope . on the other hand , the appearance of the gel of example 2 where alizarin is covalently attached to silicone backbone was transparent and homogeneous and no particles could be seen when observed under microscope . thus , the composition of example 2a does not provide for uniform distribution of alizarin in the polymer thereby affording poor uv visible protection . the compositions of example 2 and example 2a were applied on a transpore tape ( 3m ) which was fixed to the quartz plate . the application was performed using transpore tape as the substrate fixed over quarts plate . the amount of cream applied was 3 mg / cm 2 . the intensity of simulated solar atlas lamp sun lamp was 5 . 5 mw / cm 2 . the quartz plate was dried and kept in the solar simulator . the the transmitted energy was measured through the film present on the transpore tape / quartz , using radiometer . the transmitted energy obtained from the transpore tape / quartz was used as the control . the data is summarized in table 3 below . a personal care composition was prepared using the silicone compound of the invention . first the ingredients were prepared in two different phases i . e ( i ) an oil phase and ( ii ) a water ( aqueous ) phase . the ingredients in the respective phases are tabulated below in table 4 . compound prepared in example 1 was mixed with emulsifier 5225c and homogenized for 10 minutes . tio 2 was added and mixture was homogenized for 10 minutes . water was added slowly until under homogenization until a smooth cream with acceptable spreading characteristics was obtained .

US-201214111645-A

power management methods , systems and circuitry are provided for efficiently energizing implanted stimulators . efficiency is achieved by automatically adjusting the power - supply voltage of the stimulator channel so that the magnitude of the voltage of the current - sink or current - source providing the stimulation current is regulated within a narrow band just above the minimum acceptable level . adjustment is done once in every cycle of the external high - frequency power source in order to achieve regulation with a very fine time resolution throughout each stimulation period . the power supply voltage is generated and adjusted by rectifying the high - frequency voltage of the secondary coil of a transcutaneous magnetic link by closing and opening a solid - state switch at appropriate times during positive half cycles for a current - sink , and during negative half - cycles for a current - source . the timing of switch closure and opening is dictated by a logic controller on the basis of two binary signals generated by two separate comparators , one of which comparing the voltage of the secondary coil with the generated power - supply voltage , and the other comparing the current - sink or current - source voltage with a reference voltage .

shown in fig4 is an exemplary embodiment of the disclosed power management method as applied to a stimulation channel of the architecture of fig1 . the external primary coil 301 of a transcutaneous magnetic link 31 is driven with a high - frequency sinusoidal voltage v pc from an external power supply 305 . the sinusoidal voltage v sc of the implanted secondary coil 302 is half - wave rectified by turning on and off a switch 403 between nodes 404 and 405 at appropriate times , and the rectified voltage is filtered with a capacitor 304 of capacitance c to generate a positive power - supply voltage v + . optionally , a second capacitor can be connected in parallel with the secondary coil so that the capacitance of this second capacitor and the inductance of the secondary coil form a resonant tank circuit , which helps increase the amplitude of v sc . selection of a sinusoidal waveform for v pc , and hence for v sc , is for illustrative purposes only ; other alternating waveforms of gradually rising and falling edges ( e . g ., triangular waveform ) can also be employed . it is also possible to double or triple the amplitude of v sc prior to rectification . fig4 also depicts a stimulation current i being sunk from v + by the current sink 102 via electrodes e 1 and e 2 . total equivalent resistance of the two switches connecting these electrodes between v + and current sink 102 in the architecture of fig1 ( e . g ., s 1a and s 2b , or s 1b and s 2a ) is represented with r in fig4 . also shown in fig4 is the load impedance z l , which represents the combined impedance of ( i ) the two electrode - tissue interfaces at e 1 and e 2 , ( ii ) the bulk of the stimulated tissue , and ( iii ) the capacitance of electrode coupling capacitors . switch 403 is controlled according to the binary signals generated by the two voltage comparators 406 and 407 . comparator 406 compares the voltage v s of current - sink 102 with a positive reference voltage v ref provided by the voltage source 409 , and generates a binary output signal y hl whose binary levels represent the cases of v s being more positive or less positive than v ref . v ref is set slightly more positive than the minimum acceptable value of v s for which the current sink can function properly for the demanded stimulation current . alternatively , comparator 406 can be replaced with a schmitt trigger of a small hysteresis range around a built - in reference voltage equivalent to v ref . comparator 407 compares the instantaneous value of the secondary - coil sinusoidal voltage v sc with the power - supply voltage v + , and generates a binary output signal y clk whose binary levels represent the cases of v sc being more positive or less positive than v 30 . y hl and y clk are fed into a logic controller 408 , whose binary output signal y s opens or closes the switch 403 in each and every high - frequency cycle in accordance with the rule - 1 stated below : rule - 1 : in each high - frequency cycle , sample the output y hl of comparator 406 at the instant when the output y clk of comparator 407 indicates that v sc is crossing over v + , and take one of the following two actions : action - 1 of rule - 1 if the sampled level of y hl indicates a v s less positive than v ref , then , close the switch 403 , and keep it closed until ( i ) v s crosses over v ref , or ( ii ) v sc crosses under v + , whichever comes first . open the switch 403 when the earlier of these two events occurs , and keep it open until the next instant of sampling . action - 2 of rule - 1 if the sampled level of y hl is indicative of v s being more positive than v ref , then , keep switch 403 open until the next instant of sampling . shown in fig5 is a set of voltage waveforms exemplifying the periodic steady - state operation of the embodiment of fig4 in one of the high - frequency cycles of a stimulation period . for purely illustrative purposes , a binary - high level is assumed to represent ( i ) the condition v sc & gt ; v + for v clk , and ( ii ) the condition v s & gt ; v ref for y hl , and a binary - low level is assumed for the condition of switch closure for y s . those skilled in the art will appreciate that the logic controller 408 and the switch 403 can be designed to execute rule - 1 also with complementary representations of y clk y hl , and y s . execution of the power management method in periodic steady - state can now be explained in conjunction with fig4 and fig5 . fig5 shows v sc crossing over v + at time t 1 . this event is signalled to logic controller 408 by the comparator 407 raising y clk to the binary - high level . at this instant , logic controller 408 samples the output signal y hl of comparator 406 , which signals the condition of v s being less positive than v ref . in compliance with action - 1 of rule - 1 , logic controller 408 closes the switch 403 by lowering its output signal y s to the binary - low level as fast as it can . the secondary coil 302 now starts charging the capacitor 304 while also supporting the stimulation current i . as a consequence , v + starts rising . v s , tracking v + , also starts rising . eventually , at time t 2 , v s reaches v ref . this event is detected by the comparator 406 , which consequently raises its output signal y hl to the binary - high level . logic controller 408 responds by also raising its output signal y s to the binary - high level , and thus opens the switch 403 in accordance with action - 1 of rule - 1 . due to the nonzero response time of the comparator 406 , logic controller 408 and switch 403 , however , the instant of switch opening is somewhat delayed with respect to the actual instant of v s crossing over v ref . this delay causes v s to slightly overshoot v ref before switch 403 is opened . thereafter , secondary coil 302 is left open , and the stimulation current i starts draining the charge accumulated on the capacitor 304 . as a consequence , v + starts declining at a rate of i / c per unit time until v sc crosses it over again at time t 5 of the next high - frequency cycle when logic controller 408 will renew sampling and update v + in accordance with rule - 1 . during the time between t 2 and t 5 , v s tracks the declining v + with a difference v r + v l , where v r = i × r and v l = i × z l . this difference remains constant to a very good approximation because the time - constant of the possible variation of v r + v l is usually much longer than the time difference between t 2 and t 5 . therefore , the ripple on v s ( i . e ., the total variation of v s between t 2 and t 5 ) is almost the same as the ripple on v + ( i . e ., the total variation of v + between t 2 and t 5 ). assuming that the duration t 2 − t 1 of the closed state of switch 403 is negligibly short in comparison with the period t of the high - frequency cycle , the common ripple is given approximately by it / c . by selecting a sufficiently large c , this ripple can be minimized , and thus v s is stabilized within a narrow band around v ref regardless of the value of i or z l or r . notice that v + adjusts itself once in each high - frequency cycle to keep v s regulated within this band around v ref throughout an entire stimulation period . as noted before , v ref is set slightly larger than the minimum voltage needed by the current sink to function properly . therefore , the current sink 102 consumes the minimum necessary energy at all times while the prescribed stimulation current is successfully sunk independently of load and switch impedances . for a better understanding of the reasoning behind various aspects of rule - 1 , attention is now turned first to the fact that , if switch 403 is to be closed to raise v + in any high - frequency cycle , closure should not commence before v sc crosses over v + , and should not continue after v sc crosses under v + . this is because switch closure outside this interval would discharge the capacitor 304 instead of charging it . notice that action - 1 of rule - 1 mandates switch closure right at the beginning of this interval , as exemplified by time t 1 and time t 5 in fig5 , because the energy consumption of switch 403 increases with delay in closure . turning attention next to the timing of switch opening , action - 1 of rule - 1 mandates opening at the moment of v s crossing over v ref if this moment arrives before v sc crosses under v + , as exemplified by time t 2 in fig5 . this timing is indeed optimum because ( i ) a later opening would extend v s far above v ref since charging can continue until v sc crosses under v + , and ( ii ) an earlier opening would prematurely end the charging process , and thus prevent v s from reaching v ref . in any case , opening of the switch should not be delayed beyond the moment of v sc crossing under v + in order to avoid discharge . this is why action - 1 of rule - 1 mandates opening at the moment of v sc crossing under v + even if v s is still short of v ref . this case is unlikely to be encountered in any high - frequency cycle during the periodic steady - state of a stimulation period , and therefore , is not exemplified in fig5 , but may be observed in the first few high - frequency cycles of the initial transient state of a stimulation period if a large stimulation current is demanded . a large stimulation current necessitates a large v + , which , in turn , necessitates a large amount of charge to be delivered to the capacitor 304 . if such a large charge cannot be completely delivered by the time v sc crosses under v + , v s enters the next cycle with a value below v ref . however , this deficiency is progressively reduced in the following cycles , and thus the steady - state phase of the stimulation period is eventually reached . this case will be further exemplified later in fig7 . attention is finally turned to the reasoning behind action - 2 of rule - 1 . as explained before , the delay in signal propagation through comparator 406 , logic controller 408 and switch 403 causes v s to slightly overshoot v ref before switch 403 is opened . once the switch has been opened , v s starts declining , and eventually crosses under v ref again . this is seen to occur at time t 3 in the example of fig5 . in the case of a weak stimulation current i , however , the rate of decline may be so slow that v s may remain above v ref at the sampling time of the next high - frequency cycle ( e . g ., time t 5 in fig5 ). in such a case , action - 2 of rule - 1 keeps switch 403 open for the entirety of the next high - frequency cycle even if v s crosses under v ref sometime during that next cycle . this prevents switch closure at a time other than the moment of v sc crossing over v + , and thus minimizes the energy consumed by switch 403 . this case will be further exemplified later in fig7 . as understood from the description given so far , the circuitry by which the disclosed power management method is applied to the architecture of fig1 comprises the capacitor 304 , comparators 406 and 407 , the logic controller 408 and the switch 403 . these are connected to the rest of the stimulation hardware as per fig4 . except for the capacitor 304 , these circuits are preferably integrated on the same chip together with other circuitry needed for performing stimulation . considering the fact that v + is variable , a separate constant positive power - supply voltage or a combination of positive and negative power - supply voltages is preferably employed for energizing these circuits as well as other circuits needed for performing the stimulation . these separate power - supply voltages can be generated from the secondary coil 302 with any conventional method such as the one illustrated in fig3 . in regard to the implementation specifics of these circuits , the comparators 406 and 407 can be constructed in any suitable comparator topology known in the art . switch 403 can be implemented with any suitable solid - state device known in the art , most preferably with a pmosfet device . logic controller 408 should be designed as an application specific circuit because it has the specific duty of executing rule - 1 . the circuit diagram of one exemplary topology of the logic controller 408 and the switch 403 is shown in fig6 . this exemplary topology employs only a positive power - supply voltage v dd applied to node 606 , whereas node 607 is connected to the ground . those skilled in the art will appreciate that an additional negative power - supply voltage can be incorporated by disconnecting node 607 from ground and connecting it to the negative power - supply voltage . notice that the pmosfet device ms implements the switch 403 , whereas the circuit 60 implements the logic controller 408 . the gate terminal of ms is attached to the output node 603 of the logic controller 60 . node 603 carries the binary switch - control signal y s described previously in conjunction with fig4 and fig5 . the bulk terminal of m s ( not shown in fig6 ) is connected to the constant positive power - supply voltage rail v dd at node 606 . the remaining two terminals of m s are connected to node 404 of fig4 and node 405 of fig4 , respectively . the propagation delay of the logic controller 60 may be unacceptably long if the gate capacitance of m s is large . if necessary , this problem can be solved by inserting a non - inverting buffer circuit between the output of the logic controller 60 and the gate of m s instead of directly interconnecting them as shown in fig6 . logic controller 60 comprises a dynamic inverter circuit 61 and a static two - input nand gate 62 . the dynamic inverter is built with nmosfet devices m 1 and m 2 , and pmosfet device m 3 . the nand gate is built with nmosfet devices m 4 and m 5 , and pmosfet devices m 6 and m 7 . c p represents the parasitic capacitance of node 601 . notice that the dynamic inverter 61 drives one of the two inputs of the nand gate 62 with its output signal y i at node 601 , whereas the other input of the nand gate is driven at node 602 by the y clk signal described previously in conjunction with fig4 and fig5 . one of the inputs of the dynamic inverter 61 receives at node 604 the same y clk signal , and the other input receives at node 605 the y hl signal described previously in conjunction with fig4 and fig5 . node 607 is designated as ground . note that all nmosfet devices have their bulk ( not shown in fig6 ) connected to node 607 , and all pmosfet devices have their bulk ( not shown in fig6 ) connected to node 606 . the operation of the logic controller 60 can now be explained with reference to fig4 , fig5 , and fig6 . consideration is given first to the case of y clk being at ground ( i . e ., binary - low level ). as previously explained , this binary level of y clk signals the case of v sc being less positive than v + , for which the switching pmosfet m s should be kept open . indeed , whenever y clk is at ground , nand gate 62 keeps y s at v dd ( i . e ., binary - high level ), and therefore m s remains in cutoff ( i . e ., open switch state ). as to the behavior of the dynamic inverter in the case of y clk being at ground , notice that m 3 keeps the output signal y i of the dynamic inverter at the binary - high level v dd regardless of the binary level of y hl . therefore , c p is kept charged to v dd whenever y clk is at ground . consideration is given next to the case of y clk making a transition from ground to v dd while y hl is at v dd . this is the sampling moment when action - 2 of rule - 1 is to be executed . the rising y clk forces m 3 into cutoff and m 1 into conduction , and thus disconnects node 601 from v dd , and connects node 608 to ground . since m 2 is also conducting due to y hl being at v dd , c p is discharged , and hence , y i is forced to ground . now that one of its inputs being lowered to ground , the nand gate 62 keeps its output y s at v dd although its second input receiving y clk is raised to v dd . y s being at v dd , m s retains its cutoff state ( i . e ., open switch state ). notice that , even if y hl happens to return later to ground ( i . e ., v s crossing under v ref ) while y clk is still at v dd ( i . e ., v sc being more positive than v + ), m s will continue to be in cutoff because c p cannot be recharged to v dd before the next falling edge of y clk . after the arrival of the next falling edge of y clk ) y s is kept at v dd anyway , as explained in the preceding paragraph . therefore , m s remains in cutoff for the entire cycle if v s is more positive than v ref at the beginning of the cycle , as mandated by action - 2 of rule - 1 . if y hl is at the ground level when y clk makes a transition from ground to v dd , action - 1 of rule - 1 is to be executed . in this case , the rising y clk again forces m 3 into cutoff and m 1 into conduction , and thus disconnects node 601 from v dd , and connects node 608 to ground . but , since y hl is at the ground level , m 2 remains in cutoff , and despite the fact that node 608 is connecting the ground , node 601 is left afloat . this enables c p to retain its charge , and thus to keep y i at v dd . now , the nand gate 62 with both inputs at v dd , lowers y s to ground , and thus turns m s on ( i . e ., closed switch state ). if , subsequently , the rising v s crosses over v ref , and therefore , y hl rises to v dd before y clk drops to ground , then , m 2 turns on , and together with the conducting m 1 , discharges c p to ground . yr being lowered to ground , the nand gate 62 raises y s to v dd , and thus forces m s into cutoff ( i . e ., open switch state ). since c p cannot be recharged to v dd before the next falling edge of y clk , m s remains in cutoff even if y hl happens to return to ground any time before y clk drops to ground . if , on the other hand , y clk drops to ground before y hl rises to v dd , then , the nand gate 62 raises y s to v dd , and thus forces m s into cutoff ( i . e ., open switch state ) at the moment y clk drops to ground . further illustration of the transient and steady - state behavior of the entire stimulator circuit of fig4 employing the logic - controller and switch circuit of fig6 is provided in fig7 in the form of simulated waveforms . these waveforms belong to the voltages v sc , v + , v s , y s , and the stimulation current i during the first ten 5 - mhz cycles of a long stimulation period . notice that only the positive half cycles of v sc are shown for the sake of brevity . v ref is set to 0 . 9 v , v dd is set to 10 v , and a stimulation episode is started up shortly after t = 6 μs by stepwise demanding 1 - ma stimulation current from the current sink . first sampling instant after start - up arrives at the beginning of the second cycle shortly after t = 6 . 2 μs when v sc crosses over v + . since v s is smaller than v ref at this instant of sampling , y s is lowered to ground , and thus the switch 403 is closed at that instant . notice that , v sc crosses under v + in that second cycle while v s is still considerably short of v ref . the switch 403 is nevertheless opened by y s raising to v dd in order not to start discharging the capacitor 304 . since v s is left below the minimum acceptable level for the current sink to function properly , the stimulation current has not reached the demanded level of 1 ma by the end of that second cycle . the switch 403 is again closed when v sc crosses over v + in the third cycle just after t = 6 . 4 μs , and charging of v s to v ref is completed before v sc crosses under v + , and therefore , the switch 403 is opened earlier in that third cycle . notice the absence of switch closure in the fourth cycle starting at t = 6 . 6 μs . this is due to the fact that v s has somewhat overshot v ref in the previous cycle , and has not declined back to v ref yet at the sampling moment of the fourth cycle . the transient events observed in the second , third and fourth cycles come to an end at the fifth cycle , beyond which the periodic steady - state prevails . in this state , switch closure lasts for a brief interval in each cycle , v s is stabilized around v ref , but v + continues to rise to accommodate the increasing load impedance . the disclosed power management method has so far been described on the embodiment shown in fig4 , which is applicable to the stimulation channels of the architecture shown in fig1 . a second embodiment of the same method applicable to the stimulation channels of the architecture of fig2 is shown in fig8 . a comparison between fig8 and fig4 reveals three differences : ( i ) current sink 102 of fig4 is replaced with the current source 202 in fig8 , ( ii ) positive voltage reference 409 of fig4 is replaced with a negative voltage reference 809 in fig8 , and ( iii ) the positive power - supply voltage v + of fig4 is replaced with a negative power - supply voltage v − in fig8 . the voltages v r , v l , v s and v ref defined in fig8 are all negative valued . the duty of comparator 806 , comparator 807 and logic controller 808 is essentially the same as the duty of their respective counterparts shown in fig4 . these circuits as well as other circuits needed for stimulation are preferably supplied from a separate constant negative power - supply voltage or a pair of negative and positive power - supply voltages , which can be generated from the secondary coil 302 with any conventional method . the rule by which the logic controller rectifies v sc and regulates v s is based on the same principles as rule - 1 but differs from the latter in the polarity of the conditional statements in order to enable rectification at negative half cycles . the rule is stated below as rule - 2 : rule - 2 : in each high - frequency cycle , sample the output y hl of comparator 806 at the instant when the output y clk of comparator 807 indicates that v sc is crossing under v − , and take one of the following two actions : action - 1 of rule - 2 if the sampled level of y hl indicates a v s less negative than v ref , then , close the switch 803 , and keep it closed until ( i ) v s crosses under v ref , or ( ii ) v sc crosses over v − , whichever comes first . open the switch 803 when the earlier of these two events occurs , and keep it open until the next instant of sampling . action - 2 of rule - 2 if the sampled level of y hl is indicative of v s being more negative than v ref , then , keep switch 803 open until the next instant of sampling . shown in fig9 is a set of voltage waveforms exemplifying the periodic steady - state operation of the embodiment of fig8 in one of the high - frequency cycles of a stimulation period . for purely illustrative purposes , a binary - low level is assumed to represent ( i ) the condition v sc & lt ; v − for y clk , and ( ii ) the condition v s & lt ; v ref for y hl , and a binary - high level is assumed for the condition of switch closure for y s . those skilled in the art will appreciate that the logic controller 808 and the switch 803 can be designed to execute rule - 2 also with complementary representations of y clk , y hl , and y s . a person skilled in the art can also interpret the waveforms given in fig9 along the lines of the description given previously for fig5 . in regard to the implementation of the embodiment exemplified in fig8 , the comparators 806 and 807 can be constructed in any suitable comparator topology known in the art . switch 803 can be implemented with any suitable solid - state device known in the art , most preferably with an nmosfet device . logic controller 808 should be designed as an application specific circuit because it has the specific duty of executing rule - 2 . the circuit diagram of one exemplary topology of the logic controller 808 and the switch 803 is given in fig1 . this exemplary topology employs only a negative power - supply voltage v ss applied to node 907 , whereas node 906 is connected to the ground . those skilled in the art will appreciate that an additional positive power - supply voltage can be incorporated by disconnecting node 906 from ground and connecting it to the positive power - supply voltage . notice that the nmosfet device m s implements the switch 803 , whereas the circuit 90 implements the logic controller 808 . the gate terminal of m s is attached to the output node 903 of the logic controller 90 . node 903 carries the binary switch - control signal y s previously described in conjunction with fig8 and exemplified in fig9 . the bulk terminal of m s ( not shown in fig1 ) is connected to the constant negative power - supply voltage v ss at node 907 . the remaining two terminals of m s are connected to node 804 of fig8 and node 805 of fig8 , respectively . the propagation delay of the logic controller 90 may be unacceptably long if the gate capacitance of m s is large . if necessary , this problem can be solved by inserting a non - inverting buffer circuit between the output of the logic controller 90 and the gate of m s instead of directly interconnecting them as in fig1 . logic controller 90 comprises a dynamic inverter circuit 91 and a static two - input nor gate 92 . the dynamic inverter is built with pmosfet devices m 1 and m 2 , and nmosfet device m 3 . the nor gate is built with pmosfet devices m 4 and m 5 , and nmosfet devices m 6 and m 7 . c p represents the parasitic capacitance of node 901 . notice that the dynamic inverter 91 drives one of the two inputs of the nor gate 92 with its output signal y i at node 901 , whereas the other input of the nor gate is driven at node 902 by the y clk signal described previously in conjunction with fig8 and exemplified in fig9 . one of the inputs of the dynamic inverter 91 receives at node 904 the same y clk signal , and the other input receives at node 905 the y hl signal previously described in conjunction with fig8 and exemplified in fig9 . node 906 is designated as ground . note that all nmosfet devices have their bulk ( not shown in fig1 ) connected to node 907 , and all pmosfet devices have their bulk ( not shown in fig1 ) connected to node 906 . the operation of the logic controller 90 can now be explained with reference to fig8 , fig9 , and fig1 . consideration is given first to the case of y clk being at ground ( i . e ., binary - high level ). as previously explained , this binary level of y clk signals the case of v sc being less negative than v + , for which the switching nmosfet m s should be kept open . indeed , whenever y clk is at ground , nor gate 92 keeps y s at v ss ( i . e ., binary - low level ), and therefore m s remains in cutoff ( i . e ., open switch state ). as to the behavior of the dynamic inverter in the case of y clk being at ground , notice that m 3 keeps the output signal y i of the dynamic inverter at the binary - low level v ss regardless of the binary level of y hl . therefore , c p is kept charged to the negative rail voltage v ss whenever y clk is at ground . consideration is given next to the case of y clk making a transition from ground down to v ss while y hl is at v ss . this is the sampling moment when action - 2 of rule - 2 is to be executed . the falling y clk forces m 3 into cutoff and m 1 into conduction , and thus disconnects node 901 from v ss , and connects node 908 to ground . since m 2 is also conducting due to y hl being at v ss , c p is discharged to ground , i . e ., y i rises to ground . now that one of its inputs being raised to ground , the nor gate 92 keeps its output y s at v ss although its second input receiving y clk is lowered to v ss . y s being at v ss , m s retains its cutoff state ( i . e ., open switch state ). notice that , even if y hl happens to return later to ground ( i . e ., v s crossing over v ref ) while y clk is still at v ss ( i . e ., v sc is more negative than v + ), m s will continue to be in cutoff because c p cannot be recharged to v ss before the next rising edge of y clk . after the arrival of the next rising edge y clk , y s is kept at v ss anyway , as explained in the preceding paragraph . therefore , m s remains in cutoff for the entire cycle if v s is more negative than v ref at the beginning of the cycle , as mandated by action - 2 of rule - 2 . if y hl is at the ground level when y clk makes a transition from ground down to v ss , action - 1 of rule - 2 is to be executed . in this case , the falling y clk again forces m 3 into cutoff and m 1 into conduction , and thus disconnects node 901 from v ss , and connects node 908 to ground . but , since y hl is at the ground level , m 2 remains in cutoff , and despite the fact that node 908 is connecting the ground , node 901 is left afloat . this enables c p to retain its charge , and thus to keep y i at v ss . now , the nor gate 92 with both inputs at v ss , raises y s to ground , and thus turns m s on ( i . e ., closed switch state ). if , subsequently , the falling v s crosses under v ref , and therefore , y hl drops to v ss before y clk rises to ground , then , m 2 turns on , and together with the conducting m 1 , discharges c p up to ground . y i being raised to ground , the nor gate 92 lowers y s to v ss , and thus forces m s into cutoff ( i . e ., open switch state ). since c p cannot be charged to v ss before the next rising edge of y clk , m s remains in cutoff even if y hl happens to return to ground any time before y clk rises to ground . if , on the other hand , y clk rises to ground before y hl drops to v ss , then , the nor gate 92 lowers y s to v ss , and thus forces m s into cutoff ( i . e ., open switch state ) at the moment y clk rises to ground .

US-200913498898-A

the present invention is directed to a commercial tomato , namely s . lycopersicum plant , which is resistant to an arthropod pest comprising in its genome introgressed sequences from s . galapagense conferring resistance to said arthropod pest , wherein the introgressed sequences are chosen from those present in the genome of a plant of the line tut115 ncimb accession number 42109 . the commercial tomato of the invention is preferably resistant to tomv . the introgressed sequences are preferably found at one or more of the 12 loci defined by the following snp markers : snp solcap_snp_sl_59890 on chromosome 1 , snp solcap_snp_sl_15339 on chromosome 1 , snp solcap_snp_sl_40154 on chromosome 1 , snp solcap_snp_sl_32320 on chromosome 6 , snp sl10187_425 on chromosome 6 , snp ee_2362 on chromosome 6 , snp ee_2996 on chromosome 6 , snp sl10539_786_lc7260 on chromosome 6 , snp ep_0489_lc7684 on chromosome 9 , snp il2_5178 on chromosome 9 , snp ee_3482_lc7808 on chromosome 9 and snp ee_1452 on chromosome 9 .

the present inventors have identified a wild tomato accession in s . galapagense ( also known as l . cheesmanii ) which displays an important tolerance or resistance to t . absoluta infestation and they have been able to introgress into s . lycopersicum background the s . galapagense sequences conferring this resistance and / or tolerance , thus obtaining commercial tomatoes resistant and / or tolerant to arthropod pests , especially to t . absoluta . in this process , the present inventors have identified a source of t . absoluta resistance which has never been tested before , namely in a s . galapagense accession . moreover , in the transfer of the resistance sequences , the inventors have made the main selection steps on the basis of t . absoluta resistance and they have determined the best parameter to be followed for this selection . it is indeed to be noted that , in the prior art , a direct selection for pest resistance has generally not been carried out in programs for introgression of arthropod resistance into tomato cultivars , due to difficulties in maintaining the uniform infestations necessary to select for resistance and because direct selection for pest resistance is usually an expensive and slow process . therefore , the prior art is replete with indirect selection techniques , based generally on correlated traits with high heritability to speed up introgression , especially presence of given allelochemicals or type of trichomes . however , during the selection process of lines and hybrids on the basis of high allelochemical content only , other resistance - related traits that are present in the wild accessions are probably lost and thus not recovered in the selected lines and hybrids . the introgression programs disclosed in the prior art have thus failed to provide a high level of resistance in a commercial tomato line or variety . by selection directly at the level of pest resistance , the present inventors have been able to introgress the main s . galapagense sequences responsible for resistance , and not only a subset conferring only insufficient resistance . this direct selection has been made possible thanks to the identification of the best parameters to be followed during selection of resistant plants . in this respect , it is noted that the prior art discloses numerous different parameters , such as arthropod eggs and offspring counts , number of large mines per leaf , number of small mines per leaf , percentage of leaves mined , overall plant damage , leaflet lesion type , percent of attacked leaflets , overall leaf damage , and insect survival . without prior identification of the most powerful parameter , direct selection was not feasible since the nature of the resistance is not entirely clear , likely combining non - preference , antibiosis , antixenosis and tolerance . the inventors have indeed detected variance in between lines in terms of number of leaflets per total marked leaf fed on ( pla ) and the total amount of plant tissue fed on ( opd ). this observation could have been caused by differences in amount of eggs the plant was exposed to or the quality of the leaf tissue fed on . the amount of eggs has been ruled out by the inventors , since egg counts per marked leaves indicated no differences between lines . thus the only causal factor for the non - preference is the quality of the leaf tissue that influences negatively the feeding behavior of the pest , and especially the south american tomato pinworm . on the basis of the pla rating , the plants according to the invention thus present an improved tolerance or resistance to arthropod pests by comparison to any commercial s . lycopersicum plant , all the commercial tomatoes before the present invention being indeed susceptible to arthropod pests , especially to t . absolute . according to a first aspect , the present invention is thus directed to a s . lycopersicum plant , which is tolerant or resistant to an arthropod pest , comprising in its genome introgressed sequences or intervals from s . galapagense conferring resistance to said arthropod pest . the term “ resistance ” is as defined by the isf ( international seed federation ) vegetable and ornamental crops section for describing the reaction of plants to pests or pathogens , and abiotic stresses for the vegetable seed industry . specifically , by resistance , it is meant the ability of a plant variety to restrict the growth and development of a specified pest or pathogen and / or the damage they cause when compared to susceptible plant varieties under similar environmental conditions and pest or pathogen pressure . resistant varieties may exhibit some disease symptoms or damage under heavy pest or pathogen pressure . insect - resistance refers to insect - plant interactions that comprise insect - responses and plant characteristics , non - preference : refers to insect responses subject to plant characteristics that lead away from the use of a particular plant for oviposition , for food or for shelter , or for combinations of the three . antixenosis : refers to plant characteristics evoking a negative response or a total avoidance by insects . antibiosis : refers to plant characteristics that adversely affect the physiology of a herbivore insect species . those plant properties denote reduced fecundity , decreased size , reduced longevity and increased mortality of the pest insect species ( schoonhoven et al . 1998 ). by tolerance is meant the ability of a plant variety to endure biotic and abiotic stress without serious consequences for growth , appearance and yield . susceptibility : the inability of a plant variety to restrict the growth and development of a specified pest or pathogen . plants from for example the lines rehovot - 13 ( lyco2 ), komeett , plaisance or f1 daniela ( ha144 ) are susceptible s . lycopersicum plants . a plant according to the invention has thus at least improved resistance or tolerance with respect to these plants , and more generally with respect to any commercial variety of tomato . by introgression , it is meant the infiltration of the genes or of genomic sequences of one species into the gene pool of another one from an initial interspecific hybrid between these species . regarding the introgressed sequences or intervals from s . galapagense conferring the tolerance or resistance in s . lycopersicum , they are chosen from those present in the genome of a plant of the tomato seed tut115 . a sample of this tomato seed has been deposited by hazera genetics ltd , berurim , m . p . shikmim 79837 , israel , pursuant to , and in satisfaction of , the requirements of the budapest treaty on the international recognition of the deposit of microorganisms for the purposes of patent procedure ( the “ budapest treaty ”) with the national collection of industrial , food and marine bacteria ( ncimb ), ( ncimb ltd , ferguson building , craibstone estate , bucksburn , aberdeen ab21 9ya , united kingdom ), on 11 feb . 2013 , under accession number ncimb42109 . a deposit of this tomato seed is maintained by hazera genetics ltd , berurim , m . p . shikmim 79837 , israel . the deposited seeds and plants thereof have been obtained from an initial interspecific cross between a plant of s . galapagense gala1 , i . e . the introgression partner displaying the phenotype of interest , and a plant of the line s . lycopersicum lyco1 , the recurrent susceptible parent . the deposited seeds thus represent a reservoir of introgressed sequences from s . galapagense in the s . lycopersicum genome . the introgressed sequences conferring resistance and / or tolerance to pest arthropods according to the invention are chosen from this reservoir . preferably , a s . lycopersicum plant according to the invention is a commercial plant or line . such a commercial plant or line preferably also exhibits resistance to tomv ( tomato mosaic virus ), for example due to the presence of a tm - 2 ( allele tm - 2 or tm - 2 2 ( also known as tm - 2 a )) or tm - 1 resistance gene , which also confers resistance to tmv ( tobacco mosaic virus ). a plant according to this aspect of the invention preferably has also the following additional features : nematode resistance trait ( mi - 1 or mi - j ). moreover , the commercial plant of the invention gives rise to fruits in suitable conditions , which are at least 10 grams at maturity , preferably at least 25 g at full maturity and or even more preferred at least 50 g at full maturity . with regard to the desired phenotype , i . e . tolerance or resistance to arthropod pest , of a plant according to the invention , such a phenotype is conferred by introgressed sequences or intervals from s . galapagense , chosen from the introgressed sequences found in the genome of the deposited plants tut115 . said introgressed sequences or intervals may form part of larger introgression fragments from s . galapagense into the genome of a s . lycopersicum plant of the invention . introgression fragments or introgressed intervals from s . galapagense comprising sequences conferring resistance or tolerance to said pest can be found preferably on chromosomes 1 , 5 , 6 , 9 and 12 of a s . lycopersicum plant of the invention . according to a first embodiment of the invention , said introgression fragments and thus said introgressed sequences conferring resistance and / or tolerance to arthropod pests are to be found at one or more of the following loci : a ) locus encompassing snp solcap_snp_sl — 18619 on chromosome 1 , b ) locus encompassing snp solcap_snp_sl — 12348 on chromosome 1 , c ) locus encompassing snp ep — 1592_lc7762 on chromosome 1 , d ) locus encompassing snp ee — 0301 on chromosome 5 , e ) locus encompassing snp ee — 4363_lc7656 on chromosome 6 , f ) locus encompassing snp cl016475 - 0340 on chromosome 9 , g ) locus encompassing snp ep — 0502 on chromosome 9 , h ) locus encompassing snp ee — 4969_lc7529 on chromosome 9 , i ) locus encompassing snp ee — 2332 on chromosome 9 , j ) locus encompassing snp sl10204 — 1269 on chromosome 12 , k ) locus encompassing snp sgn - u573565_snp665 on chromosome 12 and l ) locus encompassing snp ee — 0924 on chromosome 12 . the 12 snps mentioned above are referred to in the following as the 12 snps of the invention . their location in the tomato genome sequence build sl2 . 40 is indicated in table 7 , and their flanking sequences are illustrated in table 10 . on the basis of the tomato genome version sl2 . 40 , said introgressed sequences are to be found at one or more of the following 12 loci : a ) locus encompassing position 68 232 900 on chromosome 1 , b ) locus encompassing position 72 528 600 on chromosome 1 , c ) locus encompassing position 83 766 400 on chromosome 1 , d ) locus encompassing position 3 636 270 on chromosome 5 , e ) locus encompassing position 166 755 on chromosome 6 , f ) locus encompassing position 22 094 800 on chromosome 9 , g ) locus encompassing position 41 847 000 on chromosome 9 , h ) locus encompassing position 49 173 600 on chromosome 9 , i ) locus encompassing position 54 692 600 on chromosome 9 , j ) locus encompassing position 124 598 on chromosome 12 , k ) locus encompassing position 155 493 on chromosome 12 and l ) locus encompassing position 1 166 000 on chromosome 12 . by “ introgressed sequences or intervals from s . galapagense at a given locus ” or “ introgressed sequences or intervals from s . galapagense present / found at a given locus ”, it is to be understood that the genomic interval found at this given locus has the same sequence as the genomic interval found in s . galapagense donor , the introgression partner , at the same locus ; thus at least the allele of the snp is the allele found in the genome of s . galapagense donor , and that the 5 ′ flanking region , or the 3 ′ flanking region , or both , are identical to s . galapagense sequences in this region . therefore , the snp may form part of the 3 ′ border or 5 ′ border of the introgressed interval , or may be within the introgressed interval conferring the desired phenotype . said introgressed sequences or intervals are preferably at least 5 kilobases long , and preferably at least 8 , 10 or 15 kb long . preferably , the introgressed sequences or intervals from s . galapagense are not too long in order to avoid introgression of non - commercial features associated with the s . galapagense genotype . it is thus preferred according to the invention that the introgressed sequences mentioned above are less than 25 cm each in length , preferably less than 10 cm and most preferably less than 5 cm in order to avoid or limit linkage drag . according to a preferred embodiment , said introgressed sequences are minimized to contain as few as possible sequences unrelated to the desired phenotype . more generally , insofar as resistance or tolerance to arthropod pest can be seen as a quantitative phenotype , the specific chromosomal intervals ( or qtl for quantitative trait loci ) that correlate with the desired phenotype can be mapped by the 12 snps recited above . the introgressed sequences at the 12 loci mentioned above thus constitute quantitative trait loci ( qtl ) underlying the desired trait . regarding the introgressed sequences or intervals from s . galapagense conferring the tolerance or resistance , they are chosen from those present in the genome of a plant corresponding to the deposited material tut115 ( ncimb 42109 ) at the corresponding loci . plants corresponding to the deposited material indeed have introgressed sequences from the s . galapagense donor gala1 at said 12 loci . a plant according to this embodiment thus encompasses in its genome introgressed sequences from s . galapagense at one locus or more of the 12 loci recited above ; such a plant thus presents the allele specific of the donor s . galapagense for at least one of the 12 snps recited above . a plant of the invention has thus at least one of the following alleles : allele g of snp solcap_snp_sl — 18619 on chromosome 1 , allele c of snp solcap_snp_sl — 12348 on chromosome 1 ; allele c of snp ep — 1592_lc7762 on chromosome 1 , allele t of snp ee — 0301 on chromosome 5 , allele g of snp ee — 4363_lc7656 on chromosome 6 , allele a of snp cl016475 - 0340 on chromosome 9 ; allele c of snp ep — 0502 on chromosome 9 , allele a of snp ee — 4969_lc7529 on chromosome 9 , allele t of snp ee — 2332 on chromosome 9 , allele c of snp sl10204 — 1269 on chromosome 12 , allele a of snp sgn - u573565_snp665 on chromosome 12 and allele t of snp ee — 0924 on chromosome 12 . according to a second embodiment of the invention , said introgression fragments and thus said introgressed sequences conferring resistance and / or tolerance to arthropod pests are alternatively to be found at one or more of the following loci : a ′) locus encompassing snp solcap_snp_sl — 59890 on chromosome 1 , b ′) locus encompassing snp solcap_snp_sl — 15339 on chromosome 1 , c ′) locus encompassing snp solcap_snp_sl — 40154 on chromosome 1 , d ′) locus encompassing snp solcap_snp_sl — 32320 on chromosome 6 , e ′) locus encompassing snp sl10187 — 425 on chromosome 6 , f ′) locus encompassing snp ee — 2362 on chromosome 6 , g ′) locus encompassing snp ee — 2996 on chromosome 6 , h ′) locus encompassing snp sl10539 — 786_lc7260 on chromosome 6 , i ′) locus encompassing snp ep — 0489_lc7684 on chromosome 9 , j ′) locus encompassing snp il2 — 5178 on chromosome 9 , k ′) locus encompassing snp ee — 3482_lc7808 on chromosome 9 , and l ′) locus encompassing snp ee — 1452 on chromosome 9 . these 12 snps will be referred to in the following as the 12 alternative snps of the invention . their location in the tomato genome sequence build sl2 . 40 is indicated in table 7 , and their flanking sequences are illustrated in table 10 . on the basis of the tomato genome version sl2 . 40 , said introgressed sequences are to be found at one or more of the following 12 loci : a ′) locus encompassing position 4 597 950 on chromosome 1 , b ′) locus encompassing position 77 112 400 on chromosome 1 , c ′) locus encompassing position 83 517 400 on chromosome 1 , d ′) locus encompassing position 5 388 530 on chromosome 6 , e ′) locus encompassing position 12 751 900 on chromosome 6 , f ′) locus encompassing position 29 418 200 on chromosome 6 , g ′) locus encompassing position 34 459 100 on chromosome 6 , h ′) locus encompassing position 35 194 800 on chromosome 6 , i ′) locus encompassing position 3 897 960 on chromosome 9 , j ′) locus encompassing position 7 854 930 on chromosome 9 , k ′) locus encompassing position 63 350 800 on chromosome 9 , and l ′) locus encompassing position 63 642 500 on chromosome 9 . more generally , insofar as resistance or tolerance to arthropod pest can be seen as a quantitative phenotype , the specific chromosomal intervals ( or qtl ) that correlate with the desired phenotype can be mapped by the 12 alternative snps recited above . the introgressed sequences at the 12 alternative loci mentioned above thus constitute quantitative trait loci ( qtl ) underlying the desired trait . regarding the introgressed sequences or intervals from s . galapagense conferring the tolerance or resistance , they are chosen from those present in the genome of a plant corresponding to the deposited material tut115 , ncimb accession number 42109 . the preferred minimal length of the introgressed sequences , as well as the preferred maximal length of such sequences , are as defined in the preceding section with respect to the first embodiment of the invention , in connection with the 12 loci of the invention . a plant according to this embodiment thus encompasses in its genome introgressed sequences from s . galapagense at one locus or more of the 12 alternative loci recited above ; such a plant thus exhibits the allele specific of the donor s . galapagense for at least one of the 12 alternative snps . a plant of the invention according to this embodiment has thus at least one of the following alleles : allele a of snp solcap_snp_sl — 59890 on chromosome 1 , allele c of snp solcap_snp_sl — 15339 on chromosome 1 ; not allele t or g of snp solcap_snp_sl — 40154 on chromosome 1 , allele c of snp solcap_snp_sl — 32320 on chromosome 6 , allele a of snp sl10187 — 425 on chromosome 6 , allele c of snp ee — 2362 on chromosome 6 ; allele c of snp ee — 2996 on chromosome 6 , allele t of snp sl10539 — 786_lc7260 on chromosome 6 , allele c of snp ep — 0489_lc7684 on chromosome 9 , not allele t or c of snp il2 — 5178 on chromosome 9 , allele c of snp ee — 3482_lc7808 on chromosome 9 and allele t of snp ee — 1452 on chromosome 9 . preferably , the 12 snps detailed for the first and second embodiments are used as markers for the detection of introgressed sequence from s . galapagense . according to a preferred embodiment , a plant according to the invention has introgressed sequences from s . galapagense at at least one of the 24 loci defined according to the first and second embodiments . the 12 snp markers according to the 1 st or 2 nd embodiment of the invention are marker loci linked to chromosomal regions or qtl that are involved in or associated with the tolerance or resistance phenotype . the allele of these markers thus indicates whether the sequences surrounding the markers are introgressed from s . galapagense or not , introgressed sequences at this locus being correlated to resistance or tolerance to arthropod pest whereas s . lycopersicum sequences at this locus are not indicative of resistance or tolerance to arthropod pests . regarding the qtl or chromosomal regions marked by the snps of the invention , either according to the first or second embodiment , and correlated with the phenotype , a single of this chromosomal region may impart the desired phenotype . according to the invention , it is preferred that at least two and preferably several of the chromosomal regions are present in a plant of the invention , as determined by the snp markers detailed above . indeed , the more of these markers are present in a plant of the invention , the more a plant can be expected to have tolerance or resistance to arthropod pest . in addition , the more of the markers are present , the more tolerant are the plants . the present invention is directed to plant having introgressed sequences from s . galapagense at a single locus of the 12 loci or of the 12 alternative loci recited above , however conferring resistance or tolerance to arthropod pest . preferably , a plant of the invention has introgressed sequences at 2 of the 12 loci or of the 12 alternative loci , and preferably at 3 , 4 , 5 , 6 , 8 , 10 of the 12 loci or of the 12 alternative loci , or of the 24 loci constituted by the 12 loci and 12 alternative loci . insofar as the introgressed sequences from s . galapagense conferring resistance to said pest can be marked by the specific alleles of the snp markers of the invention , a plant of the invention has at least one of the following alleles : allele g of snp solcap_snp_sl — 18619 on chromosome 1 , allele c of snp solcap_snp_sl — 12348 on chromosome 1 ; allele c of snp ep — 1592_lc7762 on chromosome 1 , allele t of snp ee — 0301 on chromosome 5 , allele g of snp ee — 4363_lc7656 on chromosome 6 , allele a of snp cl016475 - 0340 on chromosome 9 ; allele c of snp ep — 0502 on chromosome 9 , allele a of snp ee — 4969_lc7529 on chromosome 9 , allele t of snp ee — 2332 on chromosome 9 , allele c of snp sl102041269 on chromosome 12 , allele a of snp sgn - u573565_snp665 on chromosome 12 and allele t of snp ee — 0924 on chromosome 12 ; and preferably at least 2 , or 3 , 4 , 5 , 6 , 8 , 10 of said alleles . the allele combination can be any combination of the above - recited alleles . preferred combinations of alleles correspond inter alia to combinations of snps found on the same chromosome , for example allele g of snp solcap_snp_sl — 18619 , allele c of snp solcap_snp_sl — 12348 and allele c of snp ep — 1592_lc7762 on chromosome 1 , or the combination of allele a of snp cl016475 - 0340 ; allele c of snp ep — 0502 , allele a of snp ee — 4969_lc7529 and allele t of snp ee — 2332 on chromosome 9 , or the combination of allele c of snp sl10204 — 1269 , allele a of snp sgn - u573565_snp665 and allele t of snp ee — 0924 on chromosome 12 . other combinations also envisaged in the context of the invention combine at least one allele on each involved chromosomes 1 , 5 , 6 , 9 and 12 , for example allele g of snp solcap_snp_sl — 18619 on chromosome 1 , allele t of snp ee — 0301 on chromosome 5 , allele g of snp ee — 4363_lc7656 on chromosome 6 , allele a of snp cl016475 - 0340 on chromosome 9 and allele c of snp sl10204 — 1269 on chromosome 12 , or allele c of snp solcap_snp_sl — 12348 on chromosome 1 ; allele t of snp ee — 0301 on chromosome 5 , allele g of snp ee — 4363_lc7656 on chromosome 6 , allele c of snp ep — 0502 on chromosome 9 and allele a of snp sgn - u573565_snp665 on chromosome 12 . according to a preferred embodiment , a plant according to the invention displays introgressed sequences from s . galapagense , in at least one of the chromosomes 1 , 5 , 6 , 9 and 12 , preferably on at least two of said chromosomes , and preferably at least 3 or 4 , or on the 5 chromosomes , at the loci defined above . according to a preferred embodiment , the s . lycopersicum plant of the invention comprises , introgressed in its genome , a chromosomal region or fragment from s . galapagense , conferring resistance or tolerance to arthropod pest , especially to t . absoluta infestation . such a chromosomal region or fragment corresponds to or includes : i . the region delimited by snps solcap_snp_sl — 59890 and solcap_snp_sl — 15339 in chromosome 1 of a plant corresponding to the deposited material , ncimb accession number 42109 ; such a region comprises inter alia the following snps : solcap_snp_sl — 19066 , solcap_snp_sl — 14042 , solcap_snp_sl — 18619 , solcap_snp_sl — 12348 , ep — 0180_lc7488 , ee — 2741_lc7681 and ep — 0350_lc6805 , ii . the region delimited by snps solcap_snp_sl — 40154 and ep — 1592_lc7762 in chromosome 1 of a plant corresponding to the deposited material , ncimb accession number 42109 , iii . the region delimited by snps ee — 4363_lc7656 and sl10539 — 786_lc7260 in chromosome 6 of a plant corresponding to the deposited material , ncimb accession number 42109 ; such a region comprises inter alia the following snps : il3 — 2569_lc7566 , ee — 1008_lc7515 , solcap_snp_sl — 65595 , solcap_snp_sl — 32320 , solcap_snp_sl — 30498 , solcap_snp_sl — 30511 , solcap_snp_sl — 31156 , sl10187 — 425 , le004790 — 246 , ep — 0572_lc7445 , ee — 2362 , sl10768 — 133 , ee — 2996 and solcap_snp_sl — 14452 , iv . the region delimited by snps ep — 0489_lc7684 and ee — 1452 in chromosome 9 of a plant corresponding to the deposited material , ncimb accession number 42109 ; such a region comprises inter alia the following snps : sl10004 — 409_lc7341 , il2 — 5178 , ee — 1577_lc7366 , ee — 1758 lc7427 , cl016475 - 0340 , ep 0502 , ee — 4969_lc7529 , ee — 2332 , il2 — 1262 , ee — 1817_lc6849 , ee — 3482_lc7808 and ee — 5152_lc7199 , v . the region delimited by snps sl10204 — 1269 and ee — 0924 in chromosome 12 of a plant corresponding to the deposited material , ncimb accession number 42109 ; such a region comprises inter alia the snp sgn - u573565_snp665 . preferably , a plant according to the invention comprises , introgressed in its genome , at least one chromosomal fragment having s . galapagense sequences and corresponding to or comprising one of the chromosomal regions recited above . in a most preferred embodiment , a plant of the invention comprises at least two chromosomal fragments corresponding or comprising at least two of the regions recited above , preferably at least 3 or 4 . most preferably , a plant of the invention comprises , introgressed in its genome , sequences corresponding to or comprising the 5 chromosomal regions defined above . said introgressed chromosomal regions from s . galapagense are present in the genome of plants of the deposited seeds ( deposited at the ncimb under accession number 42109 ) and can thus be defined with respect to these plants . preferably , a plant of the invention does not comprise any introgression fragment from s . galapagense on a chromosome different from chromosomes 1 , 5 , 6 , 9 and 12 . most preferably , in the genome of a plant of the invention , any introgression fragment or introgressed sequences from s . galapagense are within one of the following chromosomal segments : a . the region delimited by snps il3 — 1821 and ee — 4184_lc7793 in chromosome 1 on said plant ; b . the region delimited by snps sl10259 — 474_lc7727 and ep — 1027_lc7889 on chromosome 1 of said plant ; c . the region delimited by the telomeric region of the short arm ( in north of chromosome 5 ) and snp ee — 3810_lc7374 on chromosome 5 of said plant ; d . the region delimited by the telomeric region of the long arm ( in south of chromosome 6 ) and snp solcap_snp_sl — 12646 on chromosome 6 of said plant , e . the region between positions 3 897 900 and 63 642 560 , according to the tomato genome sequence build sl2 . 40 , on chromosome 9 of said plant , and f . the region delimited by the telomeric region of the short arm ( in north of chromosome 12 ) and snp solcap_snp_sl — 1495 on chromosome 12 of said plant . therefore , a plant of the invention preferably does not comprise any introgressed sequences from s . galapagense donor located outside of the chromosomal segments a to f mentioned above . moreover , a particularly preferred plant comprises introgressed sequences from s . galapagense donor in every segment a to f and does not comprise introgressed sequences outside of these segments . the introgressed sequences from s . galapagense conferring resistance and / or tolerance to arthropod pest according to the present invention are preferably homozygoulsy present in the genome of a plant . accordingly , such a plant preferably exhibits , on both homologues of chromosome 1 , and / or of chromosome 5 , and / or of chromosome 6 , and / or of chromosome 9 and / or of chromosome 12 , introgressed sequences from s . galapagense capable of conferring resistance or tolerance to arthropod pest . it must be borne in mind that this thus not necessarily imply that the introgression fragments from s . galapagense on both chromosome homologues are identical . indeed , one of the homologue may comprise only the introgressed sequences necessary and sufficient to confer resistance or tolerance , whereas the other homologue comprises a larger introgression fragment , comprising said sequences in addition to further sequences from s . galapagense unrelated to resistance or tolerance . therefore a plant of the invention is homozygous for at least one of the following alleles : allele g of snp solcap_snp_sl — 18619 on chromosome 1 , allele c of snp solcap_snp_sl — 12348 on chromosome 1 ; allele c of snp ep 1592 lc7762 on chromosome 1 , allele t of snp ee — 0301 on chromosome 5 , allele g of snp ee — 4363_lc7656 on chromosome 6 , allele a of snp cl016475 - 0340 on chromosome 9 ; allele c of snp ep — 0502 on chromosome 9 , allele a of snp ee — 4969_lc7529 on chromosome 9 , allele t of snp ee — 2332 on chromosome 9 , allele c of snp sl10204 — 1269 on chromosome 12 , allele a of snp sgn - u573565_snp665 on chromosome 12 and allele t of snp ee — 0924 on chromosome 12 , and preferably homozygous for all these 12 alleles . alternatively , according to another embodiment of the present invention , a plant comprises introgressed sequences from s . galapagense conferring the desired trait on only one of the two chromosome homologues , i . e . the introgressed sequences conferring resistance or tolerance are present heterozygously in the genome of such a plant . it is also envisaged that some of the sequences conferring resistance or tolerance , present at any one of the 12 loci or 12 alternative loci defined above , are present homozygously in the genome of a plant of the invention , whereas other introgressed sequences , present at other ones of the 12 loci or alternative loci are present heterozygously in the genome of a plant according to the invention . the improved tolerance or resistance to arthropod pest is advantageously determined by comparison to a susceptible ( commercial ) line , for example rehovot - 13 ( lyco2 ) tomato plants . it is preferably determined on the basis of percent leaflet attacked rating . the present inventors have indeed identified this rating as the best criterion to represent the tolerance or resistance of the plants toward t . absoluta attacks . preferably , this criterion is determined a few days after infestation ; a perfectly suitable time - limit is between 3 to 15 days post infestation by the pest , for example 8 days post infestation . the tolerance or resistance to arthropod pest is for example determined at 8 days after exposure to the pest population , and is considered as “ improved ” if the difference between the test plant and a susceptible plant is a significant reduction of the pla . by “ significant ”, it is meant a reduction which is significant from a statistical point of view . preferably , the significant reduction is a reduction of at least 5 % of the pla for the test plant ; preferably , the reduction is of at least 10 % or even preferably a reduction by almost 25 or 30 %. plants obtained by the inventors as described in the experimental section display a reduction of at least 50 % of the pla determined at 8 days post infestation . therefore , a plant according to the invention preferably displays a pla score at 8 days post exposure to the pest population which is reduced by at least 30 %, preferably at least 50 % and most preferably at least 70 % with respect to a susceptible commercial s . lycopersicum line . with regard to the experimental conditions for rating the pla , potential suitable conditions are detailed in the experimental section of the present description . namely , the pla is scored preferably in a greenhouse or a nethouse , in presence of an abundant pest population . the climactic conditions in the greenhouse are typical conditions for tomato culture . the pla score is determined according to the scale defined in maluf et al . 1997 , and detailed in the experimental section . other criteria such as llt ( leaflet lesion type ) and opd ( overall plant damage ) criteria , as defined in the experimental section , can alternatively be used . they are preferably used in addition to the pla rating , for example to reinforce the confidence on the detected markers . a plant according to the invention is preferably a plant deriving from a plant grown from the deposited seed under accession number ncimb 42109 , for example a plant derived from one of the deposited seed by one or several backcrosses to a s . lycopersicum line . a progeny of a plant obtained from the deposited seed can be identified by one skilled in the art , for example by comparison of the introgression edges . indeed , the specificity of the location of the introgression edges allows the detection of plants deriving from the deposited plants . a plant of the invention is also advantageously obtainable by a process comprising an interspecific cross between a s . galapagense parent , and a s . lycopersicum parent , followed by at least one selfing step and at least two backcrossing steps , whereas the progeny is selected at each stage on the basis of one or more of the alleles of the markers marking the 12 loci ; i . e . snp solcap_snp_sl — 18619 on chromosome 1 , snp solcap_snp_sl — 12348 on chromosome 1 , snp ep — 1592_lc7762 on chromosome 1 , snp ee — 0301 on chromosome 5 , snp ee — 4363_lc7656 on chromosome 6 , snp cl016475 - 0340 on chromosome 9 , snp ep 0502 on chromosome 9 , snp ee — 4969_lc7529 on chromosome 9 , snp ee — 2332 on chromosome 9 , snp sl10204 — 1269 on chromosome 12 , snp sgn - u573565_snp665 on chromosome 12 and snp ee — 0924 on chromosome 12 . alternatively , the selection may be carried out on the basis of the alleles of the markers marking the 12 alternative loci , i . e . snp solcap_snp_sl — 59890 on chromosome 1 , snp solcap_snp_sl — 15339 on chromosome 1 , snp solcap_snp_sl — 40154 on chromosome 1 , snp solcap_snp_sl — 32320 on chromosome 6 , snp sl10187 — 425 on chromosome 6 , snp ee — 2362 on chromosome 6 , snp ee — 2996 on chromosome 6 , snp sl10539 — 786_lc7260 on chromosome 6 , snp ep — 0489_lc7684 on chromosome 9 , snp il2 — 5178 on chromosome 9 , snp ee — 3482_lc7808 on chromosome 9 , and snp ee — 1452 on chromosome 9 . such a process is described more in detail below with respect to the fourth aspect of the present invention . in a further embodiment of the invention , the plants as defined are resistant or tolerant to arthropod pest , wherein said arthropods are more specifically insect arthropods , inter alia lepidoptera or hemiptera , or acari arthropods . particularly preferred arthropods in the context of the present invention are pinworms , and especially the south american pinworm t . absoluta . alternatively , plants according to the invention are resistant or tolerant to one or more of the following arthropods : aphids , whitefly , thrips , leafminers ( liriomyza ), caterpillars ( spodoptera ), tomato psyllids , spider mites , rust mites and nematodes , in addition to or in place of resistance to t . absoluta . preferably , a plant of the invention is simultaneously resistant to pinworms , white flies , spider mites , tomato russet mites and thrips . according to a second aspect , the present invention is directed to parts of a plant as defined according to the first aspect of the invention , namely parts of a plant resistant or tolerant to an arthropod pest due to the presence in its genome of introgressed sequences from s . galapagense . a part of a plant is preferably a plant cell ; the invention is thus concerned with a plant cell of s . lycopersicum comprising in its genome introgressed sequences from s . galapagense conferring resistance to said arthropod pest , at one or more of said 12 loci or of said 12 alternative loci . the different features of the introgressed sequences have been defined in relation with the first aspect of the invention and apply mutatis mutandis to this aspect of the invention . the introgressed sequences are thus preferably chosen from those present in the genome of a plant corresponding to the deposited material tut115 ( ncimb accession number 42109 ). moreover , as detailed extensively in relation to the first aspect , a plant cell of the invention has preferably introgressed sequences from s . galapagense at more than one of said loci , preferably at least 2 or 3 loci , preferably at least 5 , 8 or 10 . particularly preferred plant cells are those comprising introgressed sequences from s . galapagense conferring said resistance or tolerance at the 12 loci defined above , or at the 12 alternative loci , or at the 24 loci . a plant cell according to this aspect of the invention is thus characterized by the presence in its genome of at least one of the following alleles : allele g of snp solcap_snp_sl — 18619 on chromosome 1 , allele c of snp solcap_snp_sl — 12348 on chromosome 1 ; allele c of snp ep — 1592_lc7762 on chromosome 1 , allele t of snp ee — 0301 on chromosome 5 , allele g of snp ee — 4363_lc7656 on chromosome 6 , allele a of snp cl016475 - 0340 on chromosome 9 ; allele c of snp ep — 0502 on chromosome 9 , allele a of snp ee — 4969_lc7529 on chromosome 9 , allele t of snp ee — 2332 on chromosome 9 , allele c of snp sl10204 — 1269 on chromosome 12 , allele a of snp sgn - u573565_snp665 on chromosome 12 and allele t of snp ee — 0924 on chromosome 12 . a plant cell according to the invention may also comprise introgression fragments corresponding to or including one or more of the 5 regions i ) to v ) defined with respect to the first aspect of the invention . preferably , a plant cell of the invention does not comprise introgressed sequences from s . galapagense in chromosomes other than chromosomes 1 , 5 , 6 , 9 and 12 . more preferably , a plant cell does not comprise introgressed sequences located outside of the chromosomal segments a to f mentioned above , but comprised introgressed sequences from the s . galapagense donor within all these 6 segments . a plant cell of the invention may have the capacity to be regenerated into a whole plant . alternatively , the invention is also directed to plant cells which are not regenerable , and thus are not capable of giving rise to a whole plant . according to another embodiment , the plant part is any other part of a plant of the invention , it may be in particular seeds , reproductive material , roots , flowers , fruits , rootstock or scion . such a part comprises a cell as defined above , i . e . having introgressed sequences from s . galapagense capable of conferring resistance or tolerance to arthropod pest to a s . lycopersicum plant . all the preferred embodiments detailed in the preceding section in connection with the first aspect of the invention are also preferred embodiments according to this second aspect of the invention . the invention is more particularly concerned with seed of a s . lycopersicum plant , giving rise when grown up to s . lycopersicum plant tolerant or resistant to arthropod pest as defined above , which is preferably a commercial plant also resistant to tomv ( tomato mosaic virus ). such seed are thus ‘ seed of a plant of the invention ’, i . e . seed giving rise to a plant of the invention . the invention is also concerned with seed from a plant of the invention , i . e . obtained from such a plant after selfing or crossing , provided however that the plant obtained from said seed is resistant or tolerant to arthropod pest due to introgressed sequences from s . galapagense conferring said trait . according to a third aspect , the present invention is also directed to the use of a tomato plant as detailed according to the first aspect of the invention , i . e . tolerant and / or resistant to arthropod pest , especially to t . absoluta , as a breeding partner in a breeding program for obtaining s . lycopersicum plants tolerant or resistant to pest arthropods . indeed , such a tomato plant according to the first aspect harbors in its genome introgressed sequences from s . galapagense , conferring said tolerance or resistance . by crossing this plant with susceptible or less resistant plants , it is thus possible to transfer these sequences , conferring the desired phenotype , to the progeny . a plant according to the invention can thus be used as a breeding partner for introgressing sequences conferring the desired phenotype into a s . lycopersicum plant or germplasm . the invention is also directed to the same use with plants or seed of tut115 as deposited at ncimb under accession number 42109 . said plants are also suitable as introgression partners in a breeding program aiming at conferring the desired phenotype to a s . lycopersicum plant or germplasm . in such a breeding program , the selection of the progeny displaying the desired phenotype , or bearing sequences linked to the desired phenotype , can advantageously be carried out on the basis of the allele of the snp markers . the progeny is preferably selected on the presence of one or more of the following specific alleles : allele g of snp solcap_snp_sl — 18619 on chromosome 1 , allele c of snp solcap_snp_sl — 12348 on chromosome 1 ; allele c of snp ep — 1592_lc7762 on chromosome 1 , allele t of snp ee — 0301 on chromosome 5 , allele g of snp ee — 4363_lc7656 on chromosome 6 , allele a of snp cl016475 - 0340 on chromosome 9 ; allele c of snp ep — 0502 on chromosome 9 , allele a of snp ee — 4969_lc7529 on chromosome 9 , allele t of snp ee — 2332 on chromosome 9 , allele c of snp sl10204 — 1269 on chromosome 12 , allele a of snp sgn - u573565_snp665 on chromosome 12 and allele t of snp ee — 0924 on chromosome 12 . the selection can alternatively be made on the basis of the alleles of the 12 alternative snp markers . the selection of the progeny having the desired phenotype can also be made on conditions of pest infestation , as disclosed inter alia in example 1 for t . absoluta . a plant according to the invention , or as deposited under accession number ncimb 42109 , is thus particularly valuable in a marker assisted selection for obtaining commercial tomato lines and varieties resistant and / or tolerant to arthropod pest , especially to t . absoluta . the invention is also directed to the use of said plants in a program aiming at identifying , sequencing and / or cloning the genes conferring the desired phenotype , i . e . resistance and / or tolerance to arthropod pest , especially to t . absoluta . any specific embodiment described for the 1 st and 2 nd aspects of the invention is also applicable to this aspect of the invention , especially with regard to any combination of snps amongst the 12 snps of the invention , or amongst the 12 alternative snps . according to a third aspect , the invention also concerns methods for the production of s . lycopersicum plants having the desired phenotype , especially commercial plants . preferably such plants are also resistant to tomv ( tomato mosaic virus ). a method or process for the production of a plant having these features comprises the following steps : a ) crossing a plant corresponding to the deposited seeds ( ncimb 42109 ) and a susceptible or less resistant s . lycopersicum plant , in which the desired phenotype is to be imported or improved . said susceptible plant may possess or not the feature of resistance to tomv . b ) selecting one resistant plant to arthropod pest in the progeny thus obtained , or one plant bearing sequences linked to the desired phenotype ; in one embodiment , such a plant is also resistant to tomv ; c ) optionally self - pollinating one or several times the resistant plant obtained at step b ) and selecting a plant resistant to arthropod pest in the progeny thus obtained ; in one embodiment , such a plant is also resistant to tomv ; d ) backcrossing the resistant plant selected in step b ) or c ) with a susceptible s . lycopersicum plant ( i . e . susceptible to arthropod pest ), preferably , such a susceptible plant is resistant to tomv ; e ) selecting a plant resistant to arthropod pest and preferably also resistant to tomv . a1 ) crossing a plant corresponding to the deposited seeds ( ncimb 42109 ) and a susceptible or less resistant s . lycopersicum plant , in which the desired phenotype is to be imported or improved , thus generating the f1 population . said susceptible plant may possess or not the feature of resistance to tomv . a2 ) increasing the f1 hybrid to create f2 population ; b ) selecting resistant individuals in the progeny thus obtained ; in one embodiment , such an individual is also resistant to tomv . c ) optionally self - pollinating one or several times the resistant plant obtained at step b ) and selecting a resistant plant in the progeny thus obtained ; in one embodiment , such a plant is also resistant to tomv ; d ) backcrossing the resistant plant selected in step c ) or d ) with a susceptible s . lycopersicum plant ( i . e . susceptible to arthropod pest ), preferably , such a susceptible plant is resistant to tomv ; e ) selecting a plant resistant to arthropod pest and preferably also resistant to tomv . according to another embodiment , it can be selected at steps b ), c ) and e ) either plant tolerant to arthropod pest or resistant to arthropod pest . the plant selected at step e ) is preferably a commercial plant , especially a plant having fruits which weigh at least 25 g , or at least 50 g at full maturity in normal culture conditions . preferably , steps d ) and e ) are repeated at least twice and preferably three times , not necessarily with the same susceptible s . lycopersicum plant . said susceptible s . lycopersicum plant is preferably a breeding line . resistance to nematode trait may be used in place of or in addition to resistance to tomv in the processes disclosed above . the self - pollination and backcrossing steps may be carried out in any order and can be intercalated , for example a backcross can be carried out before and after one or several self - pollinations , and self - pollinations can be envisaged before and after one or several backcrosses . moreover , such a method is advantageously carried out by using snps markers for one or more of the selections carried out at steps b ), c ) and / or e ) for selecting plants resistant to arthropod pest . the snp markers are preferably one or more of the 12 snp markers of the invention , or of the 12 alternative snp markers , or of a combination of the 24 snp markers . according to a preferred embodiment , the selection is at least partly made on the basis of the allele of one or more snp solcap_snp_sl — 18619 on chromosome 1 , snp solcap_snp_sl — 12348 on chromosome 1 ; snp ep — 1592_lc7762 on chromosome 1 , snp ee — 0301 on chromosome 5 , snp ee — 4363_lc7656 on chromosome 6 , snp cl016475 - 0340 on chromosome 9 ; snp ep — 0502 on chromosome 9 , snp ee — 4969_lc7529 on chromosome 9 , snp ee — 2332 on chromosome 9 , snp sl10204 — 1269 on chromosome 12 , snp sgn - u573565_snp665 on chromosome 12 and snp ee — 0924 on chromosome 12 . the selection is preferably carried out by detecting the alleles of at least 2 or 3 of these snps , preferably at least 5 , 8 or 10 , or on the basis of the 12 snp markers . preferably , when only a partial set of the 12 markers is used , said set combines snps on different chromosomes . alternatively , partial sets of the 12 markers combine markers which are found in the same region i ) to iv ) as defined with respect to the first aspect of the invention . the plant selected at any one of steps b ), c ) and / or e ) is preferably selected on the presence of one or more of the following specific alleles : allele g of snp solcap_snp_sl — 18619 on chromosome 1 , allele c of snp solcap_snp_sl — 12348 on chromosome 1 ; allele c of snp ep — 1592_lc7762 on chromosome 1 , allele t of snp ee — 0301 on chromosome 5 , allele g of snp ee — 4363_lc7656 on chromosome 6 , allele a of snp cl016475 - 0340 on chromosome 9 ; allele c of snp ep — 0502 on chromosome 9 , allele a of snp ee — 4969_lc7529 on chromosome 9 , allele t of snp ee — 2332 on chromosome 9 , allele c of snp sl10204 — 1269 on chromosome 12 , allele a of snp sgn - u573565_snp665 on chromosome 12 and allele t of snp ee — 0924 on chromosome 12 . the selection can alternatively be made on the basis of the alleles of the 12 alternative snp markers . the selection of the progeny having the desired phenotype can also be made on conditions of pest infestation , as disclosed inter alia in example 1 for t . absolute . the method used for allele detection can be based on any technique allowing the distinction between two different alleles of a snp , on a specific chromosome . the invention is also directed to a method or process for obtaining s . lycopersicum plants having the desired phenotype , wherein said method comprises the steps of : a ) making an interspecific cross between a s . galapagense plant and a susceptible s . lycopersicum plant , b ) selecting one resistant hybrid in the progeny thus obtained or one plant bearing sequences linked to the desired phenotype , c ) optionally self - pollinating one or several times the resistant plant obtained at step b ) and selecting a resistant hybrid in the progeny thus obtained ; d ) backcrossing the resistant hybrid selected in step b ) or c ) with a susceptible s . lycopersicum plant ( i . e . susceptible to arthropod pest ); such a susceptible plant may be resistant to tomv ; e ) selecting a plant resistant to arthropod pest , f ) self - pollinating the resistant plant obtained at step e ), and g ) selecting a plant resistant to pest arthropods and being preferably also resistant to tomv , wherein steps d ) to g ) can be repeated and wherein snps markers are used in steps b ), c ), e ) and / or g ) for selecting plants resistant to arthropod pest , as detailed for the previous method . according to another embodiment , it can be selected plants tolerant to arthropod pest . the plant selected at step g ) is preferably a commercial plant , especially a plant having fruits which weigh at least 25 g , or at least 50 g , at full maturity in normal culture conditions . the invention also concerns a method wherein steps a ) to c ) are not carried out and wherein step d ) is carried out with a plant obtained from the deposited seed ( ncimb accession number 42109 ) instead of the resistant hybrid mentioned above in step d ). resistance to nematode trait may be used in place of or in addition to resistance to tomv in the processes disclosed above . all preferred embodiments recited above for the previous method apply mutatis mutandis to this alternative method . especially , steps d ) and e ) can be repeated , they are preferably carried out twice , or three times . the same applies to steps f ) and g ) which are preferably carried out twice , three times or more . the present invention also concerns a plant obtained or obtainable by such a method . such a plant is indeed a s . lycopersicum plant having the desired phenotype according to the first aspect of the invention and is preferably also resistant to tomv . the invention is also directed to a method for obtaining commercial tomato plants , having the desired phenotype , comprising the steps of : backcrossing a plant , obtained by germinating the deposited seeds tut115 ( ncimb accession number 42109 ), with a s . lycopersicum plant , for example a s . lycopersicum plant susceptible to arthropod pest ; such a s . lycopersicum plant may be resistant to tomv ; selecting a plant tolerant or resistant to arthropod pest and being preferably also resistant to tomv . the selection in the second step is preferably carried out as detailed above for the other methods of the invention . said selection is preferably carried out on the presence of one or more of the specific alleles of the snps of the invention , as found in tut115 . the plant selected is preferably a commercial plant , especially a plant having fruits which weigh at least 25 g , or at least 50 g , at full maturity in normal culture conditions . the invention is moreover directed to a method for detecting and / or selecting s . lycopersicum plants having introgressed sequences from s . galapagense conferring resistance to arthropod pest , on the basis of the allele detection of at least one snp chosen amongst the group of snps comprising snp solcap_snp_sl — 18619 on chromosome 1 , snp solcap_snp_sl — 12348 on chromosome 1 ; snp ep — 1592_lc7762 on chromosome 1 , snp ee — 0301 on chromosome 5 , snp ee — 4363_lc7656 on chromosome 6 , snp cl016475 - 0340 on chromosome 9 ; snp ep — 0502 on chromosome 9 , snp ee — 4969_lc7529 on chromosome 9 , snp ee — 2332 on chromosome 9 , snp sl102041269 on chromosome 12 , snp sgn - u573565_snp665 on chromosome 12 and snp ee — 0924 on chromosome 12 . preferably , tolerant or resistant plants are selected if at least one of the following markers is detected : allele g of snp solcap_snp_sl — 18619 , allele c of snp solcap_snp_sl — 12348 ; allele c of snp ep — 1592_lc7762 , allele t of snp ee — 0301 , allele g of snp ee — 4363_lc7656 , allele a of snp cl016475 - 0340 ; allele c of snp ep — 0502 , allele a of snp ee — 4969_lc7529 , allele t of snp ee — 2332 , allele c of snp sl10204 — 1269 , allele a of snp sgn - u573565_snp665 and allele t of snp ee — 0924 , in a genetic material sample of the plant to be selected . according to a preferred embodiment , the allele of interest which is detected is present homozygously in the selected plant , i . e . no other allele of said snp is present . according to a particularly preferred embodiment , the selection is thus made on the simultaneous presence of the 12 following alleles : allele g of snp solcap_snp_sl — 18619 , allele c of snp solcap_snp_μl — 12348 ; allele c of snp ep — 1592_lc7762 , allele t of snp ee — 0301 , allele g of snp ee — 4363_lc7656 , allele a of snp cl016475 - 0340 ; allele c of snp ep — 0502 , allele a of snp ee — 4969_lc7529 , allele t of snp ee — 2332 , allele c of snp sl10204 — 1269 , allele a of snp sgn - u573565_snp665 and allele t of snp ee — 0924 , and the concomitant absence of the following alleles : allele t of snp solcap_snp_sl — 18619 , allele t of snp solcap_snp_sl — 12348 ; allele t of snp ep — 1592_lc7762 , allele g of snp ee — 0301 , allele t of snp ee — 4363_lc7656 , allele g of snp cl016475 - 0340 ; allele a of snp ep — 0502 , allele g of snp ee — 4969_lc7529 , allele c of snp ee — 2332 , allele t of snp sl10204 — 1269 , allele t of snp sgn - u573565_snp665 and allele c of snp ee — 0924 . such a combination of alleles is to be found in plants grown up from to the deposited seed . any specific combination of alleles described in the other parts of the application is also applicable to the present aspect of the invention . in addition to introgression of the sequences conferring resistance or tolerance to arthropod pest , as detailed in the methods of the invention , said sequences can also be introduced into s . lycopersicum background by genetic engineering in order to obtain a commercial s . lycopersicum plant resistant or tolerant to said pest . the identification and cloning of the introgressed sequences from s . galapagense conferring the desired phenotype , inter alia from the deposit , are routine for the skilled person . according to a further aspect , the present invention is also directed to hybrid plant of s . lycopersicum , obtainable by crossing a tolerant or resistant plant according to the first aspect of the invention , or a tolerant or resistant plant obtainable by the method disclosed according to the fourth aspect , with a plant of s . lycopersicum , for example a plant susceptible to arthropod pest , or a plant with a different level of resistance or tolerance to arthropod pest . a particularly preferred hybrid s . lycopersicum plant , is a plant which displays a cytoplasmic male sterility , or any other trait or phenotype of agronomical interest . fig1 illustrates the pinworm oviposition per leaf , for different germplasms in a multiple choice experiment . the pinworm under test is t . absoluta . fig2 illustrates the pinworm oviposition per leaf , for the rearing variety for t . absoluta , the recurrent line lyco1 and the germplasm gala 1 , in a three choice experiment . the pinworm under test is t . absoluta . fig3 illustrates the pinworm feeding per leaf . the pinworm under test is t . absoluta . fig5 : tomato resistance against spider mites . feeding damage was analyzed using a hsu - dunett lsmeans difference test for significance . solid dots indicate if an individual ril line is significantly different compared to recurrent parent lyco1 . udl = upper decision limit , ldl = lower decision limit . the grey area emphasizes decision limits indicating a significant difference compared to the lyco1 lsmean . fig6 : tomato resistance against thrips . feeding damage was analyzed using a hsu - dunett lsmeans difference test for significance . solid dots indicate if an individual ril line is significantly different compared to recurrent parent lyco1 . udl = upper decision limit , ldl = lower decision limit . the grey area emphasizes decision limits indicating a significant difference compared to the lyco1 lsmean . as a starting point of the realization of the invention , the present inventors have conducted several experiments to screen for tomato pinworm resistance amongst several tomato species . as of today , s . galapagense has not been identified as a possible source of resistance to t . absoluta . tomato germplasm was sown and reared in nursery trays ( 187 holes of 1 . 5 ″/ tray ). seedlings having 3 - 4 true leaves were transplanted into 1 l pots containing soil mixture of peat and volcano soil ( 2 : 1 ). plants were transferred to an insect free greenhouse for further development . plants were regularly watered and fertilizer was added ( 6 : 6 : 6 npk + micro elements ). temperatures varied between day and night and over seasons : namely 26 ° c . at day and 17 ° c . at night in winter , and 27 ° c . at day and 23 ° c . at night in summer . no insecticides were applied , and after three weeks plants were treated with the fungicide propamocarb - hcl . plants having at least 6 true leaves were used for experiments , these plants were approximately 6 weeks old and 30 - 45 cm of height . the south american tomato pinworm population is reared on lyco2 tomato plants . plants having at least 6 true leaves were placed in an insect cage ( 45 * 45 * 90 cm ; 150 mesh gauze ), to which adult pinworms were added . pinworm adults were collected from infested commercial greenhouse tomato plants . insects were reared at approximately 25 ° c . and under 16 hr : 8 hr ( l : d ) ( tld 840 36 w philips ) light conditions . under these growing conditions the pest life cycle lasts approximately 28 days . for transferring adult tomato pinworms an insect vacuum collector was used . a selection of 15 different genotypes ( see also table 1 ) were tested for differences in oviposition attractiveness for pinworm females . one plant originating from one genotype was randomly placed in an insect cage ( 45 * 45 * 90 cm ; 150 mesh gauze ). experimental plants were exposed to 100 adult moths . two days post infestation ( 2 dpi ) the total number of eggs per leaves present per genotype were scored ( 24 - 26 ° c ., 50 - 70 % rh ; 8 hr darkness and 16 hr light ( philips reflex tld 840 36 w )). differences in pinworm oviposition behavior between three genotypes , i . e . lyco2 , lyco1 , and gala1 ( see table 1 ), were studied . plants were positioned in an insect cage ( 45 * 45 * 90 cm ; 150 mesh gauze ), and were exposed to 50 adult moths . three days post infestation ( 3 dpi ) the number of eggs laid on the first fully developed leaf per genotype were counted ( 24 - 26 ° c ., 50 - 70 % rh ; 8 hr darkness and 16 hr light ( philips reflex tld 840 36 w )). pinworm larval feeding behavior was studied by exposing a selection of tomato genotypes to adult moths in a choice set - up . plants were positioned in an insect cage ( 45 * 45 * 90 cm ; 150 mesh gauze ). one cage contained 15 randomly placed individual plants from different germplasm , the experiment consisted out of two replicates . per replicate the genotypes under testing ( see also table 1 ) were exposed to 100 adult moths . seven days post infestation the exact number of mines per leaf were counted , since number of mines are indicative for feeding attractiveness by the pinworm larvae . a mine is the space created in leaf tissue between the epidermal layers by herbivore feeding ( 24 - 26 ° c ., 50 - 70 % rh ; 8 hr darkness and 16 hr light ( philips reflex tld 840 36 w )). identification of the resistant recombinant inbred lines developed from gala 1 and lyco1 experiments were conducted in a plastic greenhouse of approximately 300 m 2 . inside the greenhouse lyco2 tomato plants were used for building up a tomato pinworm population , for this end on regular basis new lyco2 plants obtained from the nursery were transplanted in the greenhouse in 15 l pots filled with clean volcano soil . lyco2 tomato plants were grown on both long outer rows of the greenhouse . the internal rows were divided into 14 different sections ( plots ) with 16 pots each ( 15 l ), in between plots also some lyco2 tomato plants were positioned . all plants that were used in the choice experiment were sown and reared in the nursery in trays ( 187 holes of 1 . 5 ″/ tray ), without the application of insecticides . seedlings having 3 - 4 true leaves were transplanted into 1 l pots containing soil mixture of peat and volcano soil ( 2 : 1 ). plants were transferred to an insect free greenhouse for further development until they reached at least 6 true leaves up to 10 true leaves . this variation in number of true leaves was caused by differences in plant growth between tomato germplasm . plants were supported by bamboo sticks using plastic clips . when tomato pinworms reared on lyco2 plants were abundantly present in the greenhouse , tomato germplasm ready for testing were transferred into the greenhouse . selected plants for testing were roughly one meter of height (+/− bbch - 18 : 8 true leaves : 7 weeks after sowing ) ( zadoks et al ., 1974 ). plants were directly positioned with their 1 l plastic pots into the 15 l pots , and a drip irrigation dropper was positioned in the 1 l pot . the tomato plants were placed in the greenhouse in a plot design with 7 experimental repetitions . within each plot plants were positioned randomly . temperatures varied between 17 ° c . at night and 40 ° c . during the day . the total ril population screen experiment was divided in sub - experiments by plantation date . from each plant in bbch - 18 , 3 consecutive fully developed leaves positioned in the upper third part of the plant were tagged . three days after positioning in the greenhouse , eggs were counted on all tagged leaves . approximately 8 and 13 days after exposure to the pinworm population in the greenhouse , the leaflet lesion type ( llt ), the percent leaflet attacked ( pla ) were scored per prior tagged leaflets , and overall plant damage ( opd ) was noticed ( see : maluf et al ., 1997 , table 1 ). analysis of means using a dunnett &# 39 ; s method . for this , the susceptible recurrent parent of the ril population , lyco1 , was used as a control . pinworm oviposition preferences were studied under climatized lab - conditions . for each tested genotype one plant was positioned in an experimental cage . plants were approximately of the same height , while number of leaves ranged between 6 and 11 . plants were exposed to 100 adult moths for 2 days , after which number of eggs per leaf per plant were scored . per tested genotype the average number of eggs per leaf were calculated . results are presented in fig1 . as can be seen from this figure , gala1 presents very low number of eggs per leaf in this type of experiment . different tomato genotypes were tested in a choice experiment for oviposition preferences by the pinworm . plants were positioned in an experimental cage ( one plant per genotype ) under controlled lab - conditions . plants were approximately of the same height , while number of leaves ranged between 7 and 11 . plants were exposed to 50 adult moths for 3 days . three days post infestation the exact number of eggs on the first fully developed leaf per plant was counted . results are presented in fig2 , which illustrates that gala1 is far less susceptible to pinworm feeding than the variety lyco2 on which the pinworm was reared , and lyco1 . pinworm larval feeding behaviour was studied by exposing tomato genotypes to 100 adult moths in a choice experiment . tested tomato genotypes were positioned in a cage under climatized lab - conditions ( two replicates with one plant per genotype ). plants were approximately of the same height , while number of leaves ranged between 6 and 11 . at 7 dpi the exact numbers of mines per leaf were counted . results are presented in fig3 . this figure illustrates that gala1 is far less susceptible to pinworm feeding than most of the tested other germplasms . in the conducted tests , the present inventors demonstrated a level of resistance for several genotypes against the pinworm . based on these results , the inventors selected gala1 as the most suitable candidate for further experiments . 3 / identification of the resistant ril - varieties developed from gala 1 and lyco1 in this experiment the inventors studied direct and indirect life cycle parameters like oviposition and feeding of the pinworm on donor gala1 ( l . galapagense ), recurrent parent lyco1 ( l . esculentum ), the rearing variety for the pinworm , i . e . lyco2 , and the individual ril - lines . the ril population created with donor gala1 and recurrent parent lyco1 , was screened for resistance against the tomato pinworm . more specifically , the used ril population was an interspecific population derived from a cross between s . lycorpersicum ( inbred cultivar lyco1 ) and s . galapagense gala1 . lyco1 was verified as susceptible to south american pinworm . this population consisted of f8 recombinant inbred lines ( rils ) developed by single seed descent . ril lines per sub - experiment with significant higher levels of resistance than their recurrent parent , lyco1 , are listed below in table 3 . means for distinct parameters from ril &# 39 ; s were statistically compared with the mean of the recurrent parent per plantation date . a ranking of only the significantly different resistant ril - lines per parameter was performed by normalization using the recurrent parent as the denominator ( if the normalized mean is & lt ; 1 , the plant is resistant ; if the normalized mean is 1 , the plant is susceptible ). within this invention the inventors characterized as most robust resistance ril lines tut101 , tut103 , tut110 and tut117 . ril - lines tut115 , tut110 and tut111 demonstrated strongest immediate , at pla1 , resistance against oviposition . observed resistance could be seen as one trait or as a combination of traits that influence the performance of the pest and or the damage caused by the pest . several underlying plant - characteristics might explain the observed non - feeding - preference . therefore , the inventors conclude that they have identified resistance ( comprising inter alia non - feeding - preference ) indicated by pla and to a lower extend also by llt and opd . tut115 has been deposited by hazera genetics ltd , berurim , m . p . shikmim 79837 , israel , with the ncimb ( ncimb ltd , ferguson building , craibstone estate , bucksburn , aberdeen ab21 9ya , united kingdom ), on 11 feb . 2013 , under accession number ncimb 42109 . phenotypic information ( based on pla ) shows that both line tut115 and tut101 display a significant reduction in leaves affected by t . absoluta . line tut115 is at the level of the donor and line tut101 only at ⅕ th of the recurrent (= susceptible ) parent . genotypic information ( see example 2 ) show no difference between line tut115 and tut101 . in this experiment , the inventors validated in a growth - chamber the earlier detected resistance levels of promising ril - leads from the greenhouse screen . promising resistant tomato ril - lines , the donor and the recurrent parent were reared as described in example 1 ( see par . tomato germplasm rearing from materials and methods ). in one experimental cage ( 90 cm * 90 cm * 130 cm ( h * w * l ); 150 mesh gauze ) 11 plants ( 6 - 10 true leaves , 5 - 8 weeks old , height 30 - 60 cm ) were tested for resistance . one experimental cage contained 4 ril lines for testing ( i . e tut101 , tut110 , tut115 and tut103 ) in replica , 2 recurrent parent plants and 1 donor plant . from each plant 3 consecutive fully developed leaves positioned in the upper third part of the plant were tagged . plants were infested by introducing 100 adult tomato pinworms per experimental cage . one experiment contained 8 experimental cages ( 24 - 26 ° c . ; 50 - 70 % rh ; 8 hr darkness : 16 hr light ( philips reflex tld 840 36 w ). three days after tomato pinworm introduction , eggs were counted on all tagged leaves . approximately 8 and 13 days after introducing the adult moths , the leaflet lesion type ( llt ), the percent leaflet attacked ( pla ), and overall leaf damage ( old ) were scored per prior tagged leaflets , and overall plant damage ( opd ) was noticed . test parameters were analyzed for significant differences with an oneway analysis of means using a dunnett &# 39 ; s method . for this , the susceptible recurrent parent of the ril population , lyco1 , was used as a control . ( see table 2 for the indexing system ). in this choice experiment selected rils were compared against the recurrent parent lyco1 . means from individual lines were adjusted by introducing a cage - effect into the linear model . individual lines were compared using the tukey kramer test . the analysis confirmed for opd2 , pla 1 & amp ; pla 2 the earlier obtained observations in the ril selection experiment ( section 3 /). recurrent parent lyco1 is significantly more susceptible compared to wild type donor gala1 , as well as individual ril lines tut101 and tut115 . regarding parameter opd1 , ril line tut110 is not different compared to lyco1 , and for both pla measurements ( i . e . timepoints one and two ) tut103 does not significantly differ from lyco1 . for measured parameters old1 , llt2 and the actual egg counting numbers , the obtained data for the ril - lines indicate no significant differences compared with the recurrent parent . donor gala1 , did also not differ significantly from the validated ril lines and lyco1 for the actual egg - counts , but did show more significant resistance for the old and llt measurements . this clearly shows the difficulty one may encounter to identify the appropriate parameter to measure the resistance . the discovery population for the experiment was an interspecific population derived from a cross between s . lycorpersicum ( inbred cultivar lyco1 ) and s . galapagense gala1 . lyco1 was verified as susceptible to south american pinworm , and gala1 was identified as resistant to south american pinworm ( example 1 ). this population consisted of f8 recombinant inbred lines ( rils ) developed by single seed descent . genomic dna from tomato leaves was extracted using qiagen dneasy plant dna extraction kit . a set of 737 - snps combination was selected based on their allelic variation and evenly spaced along the genome . high - throughput snp genotyping was carried out with the goldengate assays and the beadxpress reader from illumina . the genotypes ( of the rils and of the two parental lines ) were screened with 384 markers in a single plate . snp genotyping data was scored using the illumina genomestudio genotyping software with a no - call threshold of 0 . 25 . a snp set was designed for the illumina goldengate assay , which used locus and allele - specific oligos with cy3 / cy5 labeling to detect snp alleles at each locus . these custom oligo pool assay ( opa ) sets were then run on the illumina beadxpress reader as 384 - plex veracode assays . veracode uses cylinder microbeads with an internal barcode to differentiate bead types which correspond to different snp loci ( 384 bead types are used for a 384 - plex snp set ), and each microbead was coated with oligos that contain a unique address that hybridizes with the labeled products . during scanning on the beadxpress reader , the beads were aligned in a groove plate , and the bead codes and cy3 / cy5 signal intensities were measured across replicated sets of beads to assign the snp alleles . this procedure allowed a rapid , high - quality snp calling of 96 samples by 384 snps without requiring fixed arrays . the genomestudio software from illumina was used for clustering alleles based on the ratio of the cy3 / cy5 signal intensities to call the three genotype classes . snps with call rate below 70 % or with no polymorphism between donor and recurrent parents were removed from the analysis , resulting in 310 snps for further analysis . phenotypic data was collected as described in example 1 . in short , the resistance phenotype was identified by several measurement methods : 1 ) percent leaflet attacked ( pla ), 2 ) leaflet lesion type ( llt ) and 3 ) overall plant damage ( opd ) { maluf , 1997 }. each was measured in two time points . the first pla measurement was the only one that distributes normally , and therefore it was used for marker identification . information from the two other measurement methods was used to reinforce the confidence in the associated markers . broad sense heritability was calculated by dividing the sum of squares of the difference from the mean for all rils by the total sum of squares . since plants were grown and measured in different dates , normalization was required . phenotypic data was normalized using a mixed linear model { zar , 2010 }, including planting and measurement date as fixed effects . the adjusted means from the model were used as input for the association study described below . the genotyping information described in the snp genotyping section , and the adjusted mean of the phenotypic measurements were used as input to association mapping via one way anova , using r { broman 2009 }. each marker was considered independently in order to detect significant markers . the significant markers were then analyzed in the same model in order to retrieve their combined r 2 . in order to define the boundaries of the resistant - donor genomic segments that were introduced into the ril population ( i . e . segments that were introduced to the recurrent background as a single continuous segment with almost no recombination in the population ) the inventors investigated the ld ( linkage disequilibrium ) patterns in the ril population . pairwise ld estimation for all marker combinations in each chromosome was conducted using haploview software { barrett , 2005 }. pairwise ld was measured as the d ′ statistic { lewontin , 1964 }. haplotype - blocks were defined using the “ solid - spine ” option which was defined as a “ spine ” of strong ld running from one marker to its adjacent markers in the ld chart , meaning that the first and last markers in a block were in strong ld with all intermediate markers although the intermediate markers were not necessarily in ld with each other . some rils were phenotyped and genotyped using 310 polymorphic snps . the snps were physically mapped to the tomato genome version 2 . 1 { bombarely , 2011 } and then adjusted to the tomato genome version 2 . 40 . the broad sense heritability of the resistance to south america tomato pinworm as defined by the first pla measurement is 0 . 6 . this means 60 % of the trait as observed by this experiment can be explained by genetic factors , either additive or dominant . association analysis identified a set of markers significantly linked to resistance to south america tomato pinworm as defined by the first pla measurement . the list of associated markers and their significance are summarized in table 5 . this table comprises all significant markers resulting from the analysis of the phenotypic data , associated to snp markers by an anova model . the combined r 2 of the listed markers amounts to 0 . 55 , meaning all markers together explain 55 % of observed phenotypic variance . the allelic state of the significant markers is identical in the resistant parent and the most resistant ril , namely tut115 , as described in example 1 . b haplotype block - adjacent markers with a low recombination rate between them belong to the same haplotype block . markers from the same chromosome and haplotype block are marked by a gray background . in addition , the occurrence of several markers in one haplotype was investigated . several markers were found adjacent to each other on the same chromosome , suggesting a low recombination rate between them . therefore they were inherited as a single haplotype block . in table 5 , the relevant haplotype block ( if available ) is listed for each snp . in table 6 is given the allele of the 12 markers , for different resistant lines , as identified in example 1 . the genotype of all the 310 snp markers used in this study is given for tut115 in table 7 . in the last column of table 6 , “ 1 ” means that the allele of the snp marker corresponds to the resistant donor parent , wherein “ 2 ” means that the allele of the snp marker corresponds to the recurrent susceptible parent . the snps with an asterisk (*) and in italics are the 12 snp markers mentioned in tables 5 and 6 . the snp in bold with the symbol “ δ ” indicate the & lt ;& lt ; edge & gt ;& gt ;, in terms of snps , of the introgression fragment , start (“ δs ”) or end (“ δe ”). the chromosome position is by reference to the tomato genome version 2 . 40 . twelve markers were significantly associated with the pla measure of resistance to south america tomato pinworm , together explaining 55 % of the observed phenotypic variance . nine of these markers are also significantly associated with other measures of resistance , namely llt and opd , which reinforce the confidence of these markers . the significant correlation to different measures of the traits suggests these markers are linked to a general resistance mechanism . markers are validated by crossing line tut115 , which displayed the highest resistance relative to all tested rils , with a susceptible line . the resulting f1 is selfed , and a large population of f2 seeds is collected . plants are grown and genotyped . a selection of the f2 progeny is selfed to f3 . the f3 families are phenotyped as described in example 1 . the linkage of each marker to the resistance phenotype is assessed . from the above described f2 plants , a set is selected . each f2 plant carry a subset of the validated markers , where all selected f2 plants together cover all validated markers . each f2 plant is backcrossed to a breeding line in a marker assisted backcross scheme . plants having the relevant markers as well as the highest percentage of breeding line markers are selected to a second round of backcrossing . this process is repeated to a third backcross round resulting in a set of lines with a high percentage of breeding line background , each having a homozygous subset of the markers linked to the required resistance . next the lines are crossed in turn in order to accumulate (“ pyramid ”) all required markers into one line or commercial variety . the resistance to south american pinworm is a complex trait , probably defined by several genes { maluf 1997 , 2010a }. the inventors describe here the identification of a resistant source , and resistant recombinant inbred lines devised from this source . in addition , they identified a group of markers significantly correlated with the resistance , identifying the resistant line . since this trait is highly affected by environment { resende 2002 }, not all the observed variance is however explained by the genetic markers as shown by the calculated heritability of 0 . 6 . in an experimental choice setting , 19 genotypes were tested for their suitability to rear spider mites on . test plants were grown , as described in section tomato germplasm rearing ( example 1 ), until plants reached the stage of having 4 true leaves . a genotype &# 39 ; s suitability for spider mite rearing was measured by scoring feeding symptoms in combination with observed mites and webbings constructed by the mite species under testing . the experiment contained two experimental repetitions over time , per experimental repetition there were 3 repeats with each 11 seedlings per genotype ( 26 ° c . ; 16 hr light : 8 hr dark ). test plants were infested three weeks after sowing by placing heavily infested leaves from the spidermite rearing face down on the test plants . the leaves used for infestation were placed close to each other in order to create a surface of leaves above the test plants . after infestation , plants were irrigated using a flooding system . two days after infestation the leaves that were used for infestation were removed . the spidermite population reached a peak after two to three weeks . three weeks post infestation feeding damage levels were scored . the susceptible or resistant plants were defined by the amount and the distribution of the population and were indexed by a scale from 0 - 3 ( see below ): 0 — a clean leaf without mites or tissue - feeding damage . note : a number of mites centered on one place on the leaf could still be observed . 1 — presence of mites in a defined area that did not cover the entire leaf . in this area feeding symptoms were observed . leaves continued to develop , but the mite population did not grow . 2 — a leaf surface was covered with mites and clear feeding damage symptoms were noticed . 3 — a leaf is covered with mites and webs . leaves showed clear chlorosis or necrosis symtomps . plant symptoms from 0 - 1 indicate resistant plants . plants symptoms from 2 - 3 indicate susceptible plants ( see fig4 for illustration ). resistance levels for the individual ril - lines were compared to resistance levels from the recurrent parent , i . e . lyco1 , using an hsu - dunnett lsmeans difference test . the mean score from each tested line was adjusted by entering observation notes as an effect into the linear model . obtained data indicated that almost all tested ril lines were significantly more resistant against spider mites when compared to the recurrent parent ( see fig5 ). tested ril lines were mostly resistant , but these lines were less resistant compared to donor gala1 . therefore it is concluded that the donor and also most of the ril lines contain resistance traits that hamper population build up for the tested spidermite species , which is determined by scoring the population distribution per genotype using feeding symptoms and mite and webbing density as parameters . in a choice assay ril leads were tested for resistance against the hemiptera white fly . as a measure of resistance the success of building up a white fly population on a plant was scored by counting numbers of newly developed white fly nymphs . tested ril - lines tut103 , tut112 , tut115 , and the donor gala1 , the recurrent parent lyco1 and pinworm rear line lyco2 , were grown as described in section tomato germplasm rearing ( example 1 ). experimental plants were randomly divided over three experimental cages ( 0 . 9 m width * 8 . 0 m length * 0 . 6 m height ) in a greenhouse ( temperature : +/− 30 ° c . day and +/− 20 ° c . night ). experimental cages hosted at least 6 plants per tested germplasm . three consecutive fully developed leaves were marked starting at the top of a plant . for infestation an on cotton reared white fly colony was used . infestation was conducted by introducing approximately one hundred 5 - 10 days old adult white flies per test plant . introduced adults were allowed to oviposit for seven days after which they were killed with insecticide talstar ( pyrethroid bifenthrin ). fourteen days after infestation nymphs were counted from the bottom side of the prior marked leaves . for this end , five randomly 2 cm 2 areas per leave were screened for nymphs using a magnifying glass ( 6 ×). number of nymphs per leaf were measured . mean number of nymphs per genotype were adjusted by using the table and the leaf position as an effect in a linear model . obtained data was compared using a tukey kramer test . all ril lines were significantly more resistant all tested genotypes were more resistant against white flies compared to recurrent parent lyco1 . moreover , this bioassay indicate that tested ril line tut112 is more resistant against white fly population build ( i . e . nymph presence ) compared to donor gala1 . resistance traits from identified promising ril leads were tested against the thysanoptera insect f . occidentalis . promising resistant tomato ril - lines , the donor and the recurrent parent were sown and reared in nursery trays ( 54 holes of 2 ″/ tray ) filled with rockwool plugs . seedlings having 1 - 2 true leaves were transplanted on rockwool ( 10 * 10 * 6 . 5 cm ). sixteen plants per germplasm were transferred to an insect free greenhouse for further development , and divided over two cages . when plants had 5 - 8 true leaves , they were infested with 20 thrips per plant . feeding damage was scored by scoring the number of leaflets infested for consecutive true leaves a , b , & amp ; c , started counting from the cotyledons . resistance levels for the individual ril - lines were compared to resistance levels from the recurrent parent , i . e . lyco1 , using an hsu - dunnett lsmeans difference test ( see fig6 ). the mean score from each tested line was adjusted by entering observation notes as an effect into the linear model . ril - lines tut101 and tut115 were significantly more resistant against thrips damage compared to recurrent parent lyco1 . these two ril - lines showed gala1 levels of resistance against thrips . in a non - choice experimental setting , 5 genotypes were tested for its suitability to build up a russet mite population . test plants were grown , as described in section tomato germplasm rearing ( example 1 ), until plants reached the stage of having 6 - 8 true leaves . a genotype &# 39 ; s suitability for population build up was measured by scoring feeding symptoms in combination with observed severeness of the russet mite population . test plants were infested six weeks after sowing by placing heavily infested leaves from a tomato russet mite rearing face down on the test plants . after infestation , plants were regularly irrigated using 20 : 20 : 20 npk . two days post infestation used leaves for infestation were removed ( 26 ° c . ; 16 hr light : 8 hr dark regime ). the tomato russet mite population was scored 2 weeks after infestation by determining the severeness of the present russet mite population and the observed feeding symptoms .

US-201313828187-A

an aircraft cabin including at least two seats , which seat each include at least two elements which can be moved relative to each other and at least one actuator for the relative displacement of these movable elements , and at least one central power control unit in the cabin in order to allocate a total available power level to each seat , where each seat includes parts for reading at least one item of morphological information of the passenger sitting in the seat , and a part for transmitting information to the central power control unit in accordance with each item of morphological information , and the central power control unit is capable of allocating to each seat a total available power level in accordance with each item of morphological information .

fig1 illustrates an aircraft cabin 10 which incorporates a power control installation 12 . the installation comprises a group of subscribers 14 a , 14 b , 14 c . each subscriber is formed by the group of devices made available to a passenger and comprises in particular the actuators with which the passenger seat is equipped . for example , a cabin according to the invention controls the power made available to seventy subscribers in first class when the aircraft is capable of transporting three hundred passengers . in the installation according to the invention , each subscriber comprises a local power control unit . only three local units designated 16 a , 16 b , 16 c are illustrated for reasons of clarity . these units are all identical . each local power control unit is connected , by means of a bidirectional information transmission network 18 , to a central power control unit 20 . to this end , the information transmission network 18 is constituted , for example , by a data transfer bus to which the central unit 20 and the local units 16 a , 16 b and 16 c are connected . for reasons of clarity , in the figures , the bus is indicated by two connections , one downwards which is designated 18 a and transmits information from the central power control unit 20 to each of the local units 16 a , 16 b , 16 c , and the other upwards which is designated 18 b and transmits information from each local unit 16 a , 16 b , 16 c to the central unit 20 . furthermore , each local power control unit 16 a , 16 b , 16 c is connected to a common electrical power distribution network 22 . each subscriber comprises a group of loads which consume electrical power . each load is connected to the local power control unit 16 a , 16 b , 16 c of the subscriber . more precisely , in the example in question , a motorised seat is provided for each passenger . this seat comprises a base , a backrest and a leg rest . each seat , and therefore each subscriber , comprises two electrical actuators 24 , 26 which allow the automatic displacement of the backrest and the leg rest relative to the base of the seat . these actuators in particular allow the seat to be displaced from a seated position to a reclined position . each actuator provided for the passenger can be individually controlled by the passenger from a keyboard 28 . this keyboard is connected to the associated local power control unit 16 a , 16 b , 16 c . furthermore , sensors for the morphological measurements of the passenger are integrated in each seat . these sensors are capable of determining morphological information of the passenger , such as his weight or his size . a weight sensor 30 is thus arranged in the base . this sensor is formed , for example , by a piezoelectric element . furthermore , sensors 32 and 34 for measuring the size of the passenger are integrated in the backrest and the leg rest of the seat , respectively . these sensors are , for example , both formed by a matrix of microcontacts which are distributed along the main part of the surface of the backrest and the base . in the rest state , that is to say , when there is no weight on the microcontacts , they are open . however , when a load is applied to a microcontact , it is closed . when a passenger is sitting in the seat , the microcontacts located beneath the passenger , that is to say , behind the torso or the legs of the passenger , are closed , whilst the other contacts which are not loaded by the passenger are kept open . these sensors 32 , 34 therefore allow the torso height h t and the leg length l j of the passenger to be determined , respectively , based on the number of closed microcontacts and / or the position thereof . the weight sensor 30 and each of the microcontacts of the matrices of sensors 32 and 34 are connected to the local power control unit 16 a , 16 b , 16 c which is associated with the relevant seat . fig2 illustrates in greater detail the structure of a local power control unit 16 a . this unit is illustrated with its connection to the power distribution network 22 , to the connections 18 a , 18 b of the information transmission network 18 , to the keyboard 28 , to the actuators 24 , 26 and to the sensors 30 , 32 and 34 . each local power control unit 16 a , 16 b , 16 c comprises a control unit 36 which is constituted by an information processing unit which is capable of using a predetermined algorithm . the control unit 36 is formed , for example , by a micro - controller which is associated with a suitable environment . the control unit 36 is connected to the network 18 by means of a bi - directional communication interface ( not shown ). each actuator 24 , 26 is connected to the power distribution network 22 via a supply current shaping step , these steps being designated 44 and 46 for the loads 24 and 26 , respectively . each current shaping step 44 , 46 is connected , for the control thereof , to the control unit 36 . under the control of the control unit 36 , each current shaping step ensures that the load connected at the output is supplied with power or that the supply to the load is stopped , or that the current is shaped in a particular manner in order to reduce the power consumed by this load . in particular , the supply current shaping steps 44 , 46 are capable of producing a current which modifies the speed of the actuators in order to vary the power consumed . this variation of speed is , for example , produced using a control of the pwm type ( pulse width modulation ). in the embodiment illustrated in fig2 , the local power control unit comprises storage means 54 which are connected to the control unit 36 . these storage means 54 contain , for each actuator 24 , 26 connected to the local power control unit , a characteristic function f 24 , f 26 for determining the maximum nominal power level that can be consumed by the actuator in accordance with the morphological information of the passenger read from the seat . more precisely , the characteristic function f 24 , which is associated with the actuator 24 of the backrest , is capable of determining the maximum nominal power level p 24 consumed by the actuator 24 in accordance with the passenger weight p read by the sensor 30 and the torso height h t of the passenger read by the sensor 32 . in the same manner , the characteristic function f 26 is capable of determining the maximum nominal power level p 26 consumed by the actuator 26 for moving the leg rest based on the passenger weight p measured by the sensor 30 and the leg length l j determined by the sensor 34 . furthermore , the control unit 36 is capable of receiving , on the downward connection 18 a of the information transmission network 18 , a group of operational parameters which allow the load control input by the user from the keyboard 28 to be modified . although the information transmission network 18 can be of any appropriate type , for reasons of clarity in fig2 , each operational parameter is supposed to be communicated to the control unit 36 at a specific input . in particular , at a first input 64 , the control unit 36 receives a value pd i which represents a total available power level allocated to the subscriber i in question . in the same manner , the control unit 36 is capable of transmitting to the central power control unit 20 , on the upward connection 18 b of the information transmission network , a group of operational variables which allow the central power control unit 20 to distribute the available power between the various subscribers , and in particular to define a total available power level pd i allocated to each subscriber . as before , although the information transmission network 18 can be of any appropriate type , each operational variable is supposed to be communicated from the control unit at a specific output . a first output 72 is capable of transmitting , to the central power control unit , the maximum nominal power p 24 consumed by the actuator 24 during operation , as calculated by the control unit 36 based on the characteristic function f 24 . a second output 74 allows transmission , to the central information control unit , of the maximum nominal power p 26 consumed by the actuator 26 during operation , as calculated by the control unit 36 based on the characteristic function f 26 . a third output 76 allows the total power designated pc i effectively consumed by the subscriber i to be transmitted to the central power control unit 20 . the total power pc i is determined , for example , based on a characteristic value of the power normally consumed by each load . in one variant , the total power pc i effectively consumed is determined based on the intensity supplying each actuator , this intensity being measured by a sensor placed on the supply wire of the actuator . the central power control unit 20 is capable of calculating and of transmitting , to each local power control unit 16 a , 16 b , 16 c , the total available power pd i allocated to the corresponding subscriber i . the calculation of the total available power pd i allocated to a subscriber i will be described with reference to fig3 . the central power control unit 20 comprises an input for receiving a value pmu of maximum usable power which cannot be exceeded for all the subscribers . this maximum usable power pmu is provided by another computer of the aircraft in accordance with the power which is effectively available in the aircraft . the power control installation 12 is capable of allowing each subscriber to use only the total available power pd i which is allocated to him . to this end , the local power control unit 36 of each subscriber is capable , in accordance with the requests made by the user from the keyboard 28 , of controlling in an appropriate manner each load 24 , 26 provided for the user so that the total power consumed by the subscriber is always less than the total available power pd i allocated to the subscriber . to this end , the control unit 36 controls a reduction or an increase of the speed of the actuators , during the control thereof , using the control of the pwm type , so that the power consumed does not exceed the total available power pd i allocated to the subscriber . fig3 illustrates the algorithm which is continuously used by the central power control unit 20 during operation of the installation . this cyclical algorithm is operated in a loop and is capable of calculating and modifying the values of total available power pd i allocated to each subscriber i in accordance with the effective operation conditions of the group of subscribers and the maximum usable power pmu . in step 102 , the central power control unit 20 receives , for each local power control unit 16 a , 16 b , 16 c , the total power pc i effectively consumed by the corresponding subscriber . to this end , the local power control units 16 a , 16 b , 16 c , periodically transmit , at a frequency of a few hertz , information which represents the total power pc i effectively consumed by the associated subscriber . in a first embodiment , the total power pc i effectively consumed is given by the sum of the nominal power levels stored for the single loads j which are effectively operational . in a second embodiment , the total power pc i effectively consumed is given by the sum of the levels of instantaneous power actually consumed by the loads j of the subscriber i . according to other embodiments , the information which represents the total power effectively consumed is constituted , depending on the circumstances , either by all the nominal power levels p j of the loads which are effectively operational or , in another embodiment , by all the instantaneous power levels p j which are actually consumed by the loads of the subscriber . in step 104 , the central power control unit 20 receives the maximum nominal power levels p 24 and p 26 for each subscriber . this reception is carried out at the same frequency as the reception of the total power pc i effectively consumed by each subscriber . in step 106 , the central power control unit 20 calculates a new total available power level pd i allocated to each subscriber . each new total available power level pd i is calculated in accordance with the total power pc i effectively consumed and the maximum nominal power levels p 24 and p 26 calculated for each subscriber . in this manner , the total available power pd i allocated to each subscriber is calculated by the central power control unit 20 taking into account the morphological information of each passenger . in particular , the total available power pd i allocated to a subscriber becomes higher as the maximum nominal power levels p 24 , p 26 calculated for the subscriber become higher . for example , the new total available power level pd i is given by the formula : in step 108 , the new total available power levels pd i calculated to be allocated to each subscriber are transmitted to the subscriber so that each local power control unit 16 a , 16 b , 16 c controls the loads in such a manner that the total power consumed remains less than this new allocated total available power level . it will be appreciated that , since the power control is carried out taking into account morphological information relating to the passenger , even though the passenger does not require any power , the method for controlling power used is improved since it takes into account , in a pre - emptive manner , the future requirements of each passenger , these requirements varying in accordance with the morphological criteria of the passenger .

US-9410605-A

afoot sanding disc includes a hub ; a concentric abrasive disc having a diameter smaller than the hub diameter . a shaft concentrically attached to the bottom surface of the hub has a free end and a central cavity of a determined shape extending from the free end to a determined depth into the shaft . the shaft is shaped , sized and configured to matingly receive within the cavity a portion of a mandrel attached to an output shaft of a motorized rotary tool , thereby operably coupling the disc to an output shaft of the motarized rotary tool . a circular recess concentrically formed in a top surface of the hub receives the abrasive disc . the abrasive disc is devoid of a central aperture . the hub may include a thermochromic material in a concentration effective to cause a change in color when the hub reaches a predetermined temperature . the hub may also be rigid or flexible .

in an exemplary implementation of the invention , a foot sanding disc according to principles of the invention includes a flat abrasive sanding surface , smooth periphery and slip - on shaft for manual attachment to a rotary tool without the need for special tools . referring now to fig2 , a top perspective view of an exemplary foot sanding disc in accordance with principles of the invention is shown . a disc - shaped hub 210 supports a concentric abrasive disc 250 . the hub 210 includes a top surface 212 upon which the abrasive disc 250 is mounted , and a bottom surface 208 from which a shaft 230 stems . the diameter of the hub 210 is larger than the diameter of the concentric abrasive disc 250 . thus , the periphery of the abrasive disc 250 does not extend beyond the periphery of the hub 210 . this reduces the risk of cutting injuries caused by exposed edges of the abrasive disc 250 . by way of example and not limitation , the hub 210 may have a diameter of approximately 1 . 55 inches , while the concentric abrasive disc may have a diameter of approximately 1 . 45 inches , as conceptually shown in fig9 a - 9d . as shown in fig2 a and 4 through 6 , a circular recess 255 is concentrically formed in the top surface 212 of the hub 210 to receive the concentric abrasive disc 250 . the diameter of the circular recess 255 is slightly larger than the diameter of the concentric abrasive disc 250 . the depth of circular recess 255 is the same as or slightly less than the thickness of the concentric abrasive disc 250 . thus , the periphery of the abrasive disc 250 does not extend beyond the periphery of the circular recess 255 . by way of example and not limitation , the circular recess may have a diameter of approximately 1 . 46 inches , while the concentric abrasive disc may have a diameter of approximately 1 . 45 inches . the depth of the circular recess may be approximately 0 . 01 to 0 . 05 inches , while the thickness of the concentric abrasive disc may be approximately 0 . 01 to 0 . 05 inches . the abrasive surface of the concentric abrasive disc 250 is exposed and level with or slightly above the top surface of the hub 210 to facilitate abrasive contact with calluses and dry , flaky skin . the concentric abrasive disc 250 is preferably comprised of a substrate , such as paper or fabric , coated with an abrasive material such as a silica , garnet , silicon carbide , or aluminum oxide , suitable for smoothing and polishing . the disc 250 is devoid of a central aperture . the grit of the abrasive face could be calibrated based on the foot surface to be sanded and the type of finish desired . the disc may have a very fine , fine , medium , coarse , or very coarse abrasive surface grit . in an alternative implementation , the concentric abrasive disc 250 may be integrally formed with the foot sanding disc . in such an embodiment , abrasive material such as a silica , garnet , silicon carbide , or aluminum oxide , may be bonded directly to the surface of the circular recess 255 , with the abrasive surface being approximately level with or slightly above the top surface 212 of the hub 210 to facilitate abrasive contact with calluses and dry , flaky skin . the circular recess 255 of the top surface of the hub 210 has a planar surface 257 for engaging the abrasive disc . the concentric abrasive disc 250 is preferably bonded to the planar surface 257 of the circular recess 255 of the top surface of the hub 210 . a layer of glue , adhesive , or other bonding agent may be disposed over substantially the entire side of the concentric abrasive disc 250 which will contact the circular recess 255 of the top surface of the hub 210 . thus , the concentric abrasive disc 250 can be affixed to the hub 210 without use of a screw or other mechanical fastener that may interfere with a pedicure or harm feet . as shown in fig3 through 7 , the bottom surface 208 of the hub 210 may optionally include a recessed area 220 or may be flat or feature some other configuration . advantageously , a recessed area conserves material and reduces overall weight . advantageously , a lightweight hub requires less rotational force to spin and reduces the weight borne by the technician , thereby reducing worker fatigue . finally , thinner hubs require less material to produce , and are inherently less expensive . strengthening ribs and similar structures may be added to a thin hub , to the extent necessary to maintain structural integrity . referring now to fig3 , 5 and 7 , the shaft 230 of the foot sanding disc has free end 232 with a cavity 240 of a determined interior depth and an inner circumference that is configured to matingly receive the distal end 820 of a mandrel 800 , as described below . the cavity 240 may include a roughened surface ( i . e ., textured cavity surfaces with a high coefficient of friction ) and / or a tapered configuration to frictionally engage the mandrel . while the cavity 240 shown in fig3 - 5 , 7 and 8 is generally circular in cross section , other shapes may be used provided that they are compatible with the shape of the mandrel 800 . for example , the cavity 240 may be keyed ( i . e ., shaped ) to securely engage the mandrel 800 without slippage during rotation . by way of example and not limitation , a cavity with an oval , elliptical , triangular , square , pentagonal or octagonal cross section may be used to securely engage a mandrel with an oval , elliptical , triangular , square , pentagonal or octagonal cross section , respectively . advantageously , the shaft 230 enables manual installation and removal of the foot sanding disc without any tools . a user may manually slide the shaft 230 of the foot sanding disc onto and off of a mandrel 800 coupled to a rotary tool . such installation and removal requires relatively little effort and time to accomplish . an exemplary mandrel 800 as conceptually illustrated in fig8 , includes a distal end 820 , a flange 815 and a proximal end 810 . the distal end 820 includes a cross - sectional shape that is compatible with the cavity 240 of the shaft 230 . the proximal end 810 is configured ( i . e ., sized and shaped ) for coupling to a conventional rotary hand tool equipped with a collet and a collet nut , which are coupled to the output shaft of the rotary tool . the flange 815 , which is optional , provides a backstop and a structure for distributing stress along the free end of shaft 230 . by way of example and not limitation , the proximal end 810 may feature a generally circular cross section . likewise , the distal end 820 is configured ( i . e ., sized and shaped ) to securely fit within the cavity 240 of the shaft 230 . various shapes may be used for the distal end 820 , provided that the shape is compatible with the cavity 240 of the shaft 230 . for example , the distal end 820 may be keyed ( i . e ., shaped ) to securely engage the cavity 240 of the shaft 230 without slippage during rotation . by way of example and not limitation , a distal end 820 with a square , pentagonal or octagonal cross section may be used to securely engage a cavity 240 of a shaft 230 with a square , pentagonal or octagonal cross section , respectively . the mandrel may be comprised of any materials suitable for drill bits and the like , such as metals , alloys and composites . the hub 210 and shaft 230 are preferably comprised of a rigid plastic or polymeric material , such as polyvinyl chloride ( pvc ), polyethylene , polypropylene , polystyrene , acrylics , cellulosics , acrylonitrile - butadiene - styrene terpolymers , urethanes , thermo - plastic resins , thermo - plastic elastomers ( tpe ), acetal resins , polyamides , polycarbonates and polyesters . while many other materials may be used alone or in combination with the aforementioned materials and / or other materials , without departing from the scope of the present invention , preferably the material is relatively inexpensive and durable , easy to use in manufacturing operations and results in an aesthetically acceptable product . the material may further include additives to provide desired properties such as desired colors , structural characteristics , glow - in - the dark properties and thermal reactivity ( e . g ., color changes according to heat ). by way of example and not limitation , the hub 210 and shaft 230 may optionally be formulated to change color when they reach a predetermined or higher temperature . high temperatures attained during extended periods of use may serve as a safety indicator . this can be accomplished by mixing a thermochromic additive to the base material in an amount that is sufficient to achieve a desired color changing range . as an example , a mixture of approximately 10 % to 25 % ( pbw ) of matsui interantional co ., inc .&# 39 ; s chromicolor ® concentrate may be introduced to the base material , to provide a plastic structure that visibly changes color at a determined elevated temperature , such as approximately 105 , 110 or 120 degrees fahrenheit . a color change will alert a technician to the possibility of excessive friction and risk of possible injury . the hub 210 is preferably sufficiently strong and heat resistant such that the hub does not structurally fail from the stresses and heat generated during use . within these parameters , the hub 210 may be either rigid or somewhat flexible . illustratively , certain embodiments of the invention may utilize a hub that is formulated to exhibit flexibility and resiliency such that the hub can conform somewhat to the contours of a foot and return to its original shape without appreciable permanent deformation during normal use . the hub 210 and shaft 230 may be produced using any suitable manufacturing techniques known in the art for the chosen material , such as ( for example ) injection , compression , structural foam , blow , or transfer molding ; polyurethane foam processing techniques ; vacuum forming ; and casting . preferably the manufacturing technique is suitable for mass production at relatively low cost per unit , and results in an aesthetically acceptable product with a consistent acceptable quality . in use , the foot sanding disc is operably coupled to a rotary hand tool . the rotary hand tool contains a motor with a rotary output shaft . the mandrel 800 is mounted to the rotary hand tool by a collet and a collet nut , which are coupled to the output shaft of the rotary tool . the shaft 230 of the foot sanding disc has a cavity of a determined interior depth and an inner circumference that is configured to matingly receive the distal end 820 of the mandrel 800 . rotation of the output shat of the rotary tool induces a rotation of the mandrel 800 , which induces a rotation of shaft 230 , which induces rotation of the hub 210 and the attached abrasive disc 250 , thereby allowing sanding of a foot by applying the abrasive face of the disc 250 thereto . for illustrative purposes , fig9 a through 9d conceptually illustrate dimensioned views of a preferred foot sanding disc in accordance with principles of the invention . those skilled in the art will appreciate that the invention is not limited to the dimensions or proportions shown in fig9 a through 9d , and that the figures are not intended to illustrate every embodiment of the invention . while the invention has been described in terms of various embodiments , implementations and examples , those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the appended claims including equivalents thereof . the foregoing is not intended to limit the invention to the exact construction and operation shown and described . alternative embodiments of the invention , including variations in size , materials , components , shape , form , function , manner of operation , assembly and use that are obvious to one skilled in the art are intended to be encompassed by the invention . accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .

US-27714206-A

a system is disclosed for providing a platform for detecting pattern - based irrigation . the system comprises a data storage area to store : a property database , wherein information relating to the one or more properties is stored ; and a water usage database , wherein information pertaining to water usage of one or more properties is stored ; and one or more servers coupled to the data storage area , wherein the one or more servers are programmed to execute computer program steps , the computer program steps comprising : receiving first water and second usage rates corresponding to first and second points in time , respectfully from the water usage database relating to a property of the one or more properties ; calculating a range as a function of a percentage of the first usage rate so as to avoid incorrectly characterizing the first usage rate as an irrigation event ; comparing a similarity between the first and second water usage rates as a function of a percentage of the first water usage rate ; determining if the second water usage rate is within the range ; and determining a likelihood that first water usage rate is an irrigation event as a function of the whether the second usage rate is within the range .

fig1 depicts a block diagram of an example system 100 in which a platform for detecting pattern - based irrigation operates . ( the platform is incorporated within central system 102 discussed below .). pattern - based irrigation is defined as an automated and scheduled application of water at a given property controlled by an irrigation controller . specifically , platform is used to detect pattern - based ( e . g ., medium to high ) hourly water usage rates ( also referred to as hourly events ) that imply or indicate that a property is using a time - regulated sprinkler system ( i . e ., irrigating ). examples of property include a residential property ( also called residence or household ), commercial property , municipal property ( e . g ., park ), industrial property , multi - family property or any other property known to those skilled in the art . platform will discover both events of irrigation within a single hour as well as irrigation events that span multiple hours as described in more detail below . system 100 comprises central system 102 along with clients 104 , 106 that communicates ( wired or wireless ) with central system 102 via network 108 . network 108 may be the internet , lan or combination of both . system 100 further comprises utilities 110 and 112 and a number of properties 114 that are coupled to advanced metering infrastructures ( ami ) 116 that enable utilities 110 , 112 to collect water usage data ( i . e ., water usage rates ). ( each ami 116 may be mounted at various points ( structure ) on the owners &# 39 ; property . specifically , ami affords the utilities the opportunity to collect very detailed water usage data ( e . g ., hourly usage rates ) of each property . the data is stored in databases 110 - 1 , 112 - 1 in utilities 110 and 112 , respectively . central system 100 typically communicates with utilities 110 , 112 via network 108 ( wired or wireless ) via an application programming interface ( api ) configured to access databases 110 - 1 , 112 - 2 to retrieve property - specific water usage data ( i . e ., water usage rate ). central system 102 includes one or more servers 102 - 1 ( as shown ). the one or more servers 102 - 1 may include a web server for a website , portal and / or dashboard . each server includes several internal components ( e . g ., one or more processors , memory , storage drives , network or other interfaces , optional video cards , and other components as known to those skilled in the art etc .) as well as databases , software modules and applications ( e . g ., browser ) as known to those skilled in the art . in particular , servers 102 - 1 incorporate platform 102 - 1 a for detecting pattern - based irrigation as described above as well as water usage database 102 - 1 b for storing water usage data ( e . g ., water usage rates received from the utilities via the api ). as disclosed above , platform 102 - 1 a is accessible by clients 104 , 106 via website or dedicated application such as a dashboard . clients 104 , 106 each may be a personal computer and a monitor or mobile devices such as smartphones , cellular telephones , tablets , pdas , or other devices equipped with industry standard ( e . g ., html , http etc .) browsers or any other application having wired ( e . g ., ethernet ) or wireless access ( e . g ., cellular , bluetooth , rf , wifi such as ieee 802 . 11b etc .) via networking ( e . g ., tcp / ip ) to nearby and / or remote computers , peripherals , and appliances , etc . tcp / ip ( transfer control protocol / internet protocol ) is the most common means of communication today between clients or between clients and systems ( servers ), each client having an internal tcp / ip / hardware protocol stack , where the “ hardware ” portion of the protocol stack could be ethernet , token ring , bluetooth , ieee 802 . 11b , or whatever software protocol is needed to facilitate the transfer of ip packets over a local area network . the personal computer or mobile device ( client 104 or client 106 ) includes internal components such as a processor , memory , storage drives , interfaces , optional video cards , and other components as known to those skilled in the art etc . there are two clients shown in fig1 , but those skilled in the art know that any number of clients may be used . as described above , utilities 110 , 112 provide water and other utilities to residences and businesses as known to those skilled in the art . there are two shown in fig1 , but those skilled in the art know that any number of utilities may be used . fig2 depicts a flow diagram of example method steps of platform 102 - 1 shown in fig1 . in particular , execution beings with step 200 wherein a water usage rate ( event ) is retrieved . in one example , the water usage rate is an hourly usage rate at t 0 . in another example , the usage rate is a summation of two neighboring hourly usage rates at t 0 and at t − 1 hour . execution then proceeds to step 202 wherein the water usage rate is examined . that is , water usage rate ( e . g ., at t 0 for hourly or t 0 and at t +/− 1 hour for two - hour ) is compared to a threshold ( user defined , e . g ., utility - specific threshold ). the threshold is a minimum level in which a water usage rate may be eligible for consideration as an irrigation event . that is , the threshold acts as a filter to remove water usage rates that clearly do not constitute irrigation events that the algorithm should predict . a user may set the threshold based on his / her own knowledge and experience of indoor property - specific water usage rates . alternatively , the threshold may be selected based a process known to those skilled in the art for optimizing the threshold parameter . the threshold - optimization process employs comparing the sample usage rate data accumulated over time against actual false positive percentages for irrigation events at those rates . values for the threshold are varied to a point where the water usage rates ( events ) are not misclassified ( i . e ., identify a point at which false positive percentages markedly increase ). for example , if a residential - property does not exceed 50 gallons per hour ( gph ), then this usage rate is likely not an irrigation event . in practice , rates below 50 gph are largely not considered irrigation events to those skilled in the art because they are too low to constitute outdoor water usage . for two - hour rates , 150 gph may be selected as the threshold . a threshold may be set by a user such as a water utility or research team . execution proceeds to decision step 204 wherein it is determined if the specific usage rate actually exceeds that threshold established above . if the water usage rate does not exceed the threshold execution returns to step 200 . if the usage rate does exceed the threshold , execution proceeds to step 206 wherein the water usage rate ( event ) is compared to a property &# 39 ; s usage rates ( observations ) at other points in time ( pre - set intervals ), looking both forward and backward in time ( from that usage rate date ) in order to pick up temporal usage patterns . for hourly comparisons , water usage rate at time t 0 is compared to the water rate at the same hourly intervals on different days looking backwards and forwards . for two - hourly comparisons , the summation of two hourly rates ( e . g ., t 0 and at t +/− 1 hour ) is compared with preset - set two - hour intervals to find similarities that indicate irrigation is occurring over multiple hours . step 206 is essentially broken down in detail as follows . specifically , execution proceeds to step 206 - 1 wherein usage rates at different points in time ( e . g ., other than t 0 ) are retrieved . a table appears below with measured example usage rates . percentage of day time usage rate ( gph ) usage t 0 mon ( t 0 ) 8 am 100 100 % sat ( t + 5 ) 8 am 67 67 % fri ( t + 11 ) 8 am 94 94 % wed ( t + 16 ) 8 am 102 102 % mon ( t + 21 ) 8 am 95 95 % as can be viewed above , the usage rate ( gph ) is measured at different points in time before and after point t 0 ( as a reference ). the different points in time are effectively the same time on different dates . for the example above in the table , the usage rate at reference t 0 is 100 gph and the percentage of usage at points in time before and after are converted based on the usage rate t 0 at the reference point . in this case , a measurement at 8 am on sat ( saturday , ( t + 5 )) is 67 % ( as compared to the gph at the reference point t 0 ). execution proceeds to step 206 - 2 wherein the similarity between usage rate measured at t + 5 ( i . e ., the same time of day , 5 days following the time t 0 ) and reference t 0 are compared as a percentage of usage rate at t 0 . ( alternatively , the process may employ any number of days of the week before and after t 0 as known to those skilled in the art . e . g ., t − 14 , t − 7 , t − 3 , t − 2 , t 2 , t 3 , t 7 , t 14 .) as part of this comparison , a range is calculated to determine whether or not the water usage rate ( or summation of two hourly rates ) for the previous or subsequent point in time ( interval ) is within plus or minus a percentage of the rate ( gallon amount ) under consideration . the percentage is selected to ensure false positives for irrigation events remain low . the higher the percentage selected , the more likely a rate will be flagged as an indoor usage event ( non - irrigation event ) as known to those skilled in the art . the percentage may be based on sample water usage data set from a resident in the winter or wet - season when it is known that irrigation events do not occur . using such data , a value for the percentage is purposely varied ( for a range ) to optimize the percentage ( parameter ) in order to avoid misclassifying an event ( water usage rate ) as known to those skilled in the art . in one example , the percentage for the range may be plus or minus ten percent ( i . e ., a range of 90 % to 110 % stated differently ) to create the boundaries of the range . however , those skilled in the art know that any other percentage may be used to achieve desired result . initially for both hourly rate or two - hourly rate comparisons , the water usage rate at time t − 1 or t + 1 is retrieved , percentage of usage rate determined and a range is calculated to determine whether or not the percentage of usage rate at t 0 ( or summation of two hourly rates , e . g ., at t 0 and at t − 1 hour ) for that previous or subsequent points in time ( intervals ) is within plus or minus a ten percent ( or other pre - determined boundary condition ) of the percentage of rate under consideration ( i . e ., t − 1 or t + 1 ). as indicated above , usage rates are retrieved ( i . e ., received ) that correspond to the usage rate at the same time ( interval ) or summation of two hourly rates ) on a different day . ( while usage rates at other times are retrieved at this point in step 206 - 1 , those skilled in the art know that all usage rates may be retrieved at a different part of the process than that described to achieve the same results .) alternatively , a range may be calculated directly from the actual reference usage rate t 0 . for example , a retrieved hourly rate at t 0 is 281 gallons per hour ( gph ) and the water usage rate at t − 1 is 275 gph , then a range is calculated to be between 247 . 5 and 302 . 5 ( 10 % below and above the usage rate at t − 1 ). four two - hour windows , a process similar to the hourly comparison is applied . if for example the water usage rate at t 0 is 142 gph and the water usage rate at t − 1 hour is 216 gph ( two - hour amount is 358 gph ) and t − 168 is 145 gph and t − 169 is 217 gph ( two - hour amount is 362 gph ), then the range for the two - hour window is between 325 . 8 and 398 . 2 gph ( based on 10 % range ). this is alternatively how a range is calculated . however , the result remains the same as described above and shown in fig2 . the example described above employs one range for the comparison . however , two or more ranges may be used as known to those skilled in the art . for example , a first range may be used for hourly water usage rates below 70 gph and a second range may be used for water usage rates greater than 70 gph . the ranges are tunable to achieve desired results . in order to minimize false positives , a range may be more restrictive at the lower usage levels as those are more likely to represent indoor usage . once usage is significantly above reasonable indoor usage levels , a less restrictive range would be advisable . returning to the method in fig2 , execution then proceeds to steps 206 - 2 and 206 - 3 , the percentage of usage rate is compared to the calculated range and it is determined whether the percentage of usage rate is within the calculated range described above . if the percentage of the usage rate is not within the calculated range , execution proceeds to step 206 - 5 wherein a null value is stored ( or alternatively nothing is stored ). if the percentage of usage rate falls within the calculate range , execution proceeds to step 206 - 4 wherein the usage rate is assigned a similarity dummy value . in one example , a dummy value is set to the value of 1 . in this respect , the usage rate t 1 ( as it relates to t 0 ) is assigned a value of 1 if the rate at t 1 falls within the calculated range . if it did not fall within the calculated range , then a value assigned would be “ 0 .” value assignment may be determined as desired . execution then proceeds to step 206 - 5 wherein that similarity dummy value is stored . execution proceeds to decision step 206 - 6 , wherein it is determined if there are additional usage rates for comparison . if so , then execution returns to step 206 - 2 . in the example above , there are additional points in time ( i . e ., intervals on different days ) t − 2 , t + 2 , t − 3 , t + 3 . . . t − 14 , t + 14 . when there are no more usage rates at different points in time ( intervals ) for comparison , then execution proceeds to step 208 wherein an irrigation score is assigned for the hourly usage rate at t 0 or t 0 and t − 1 hour for two - hourly rates . the score is a summation ( σ ) of the dummy values stored at step 206 - 6 . if the values assigned in step 206 - 4 are selected to be “ 0 ” or “ 1 ” then the score will have a range between 0 and 8 for hourly intervals or between 0 and 24 , for two - hour intervals ( looking backwards and forwards ). execution then proceeds to step 210 wherein the irrigation score is compared to a threshold to determine if the water usage rate at t 0 constitutes an irrigation event . the threshold is selected based on a similar process for optimizing a threshold parameter as described above with respect to other thresholds . specifically , sample hourly usage rate data from a property ( e . g ., a residential property ) that cannot irrigate may be used . a value for this threshold is varied to a point where the water usage rates ( events ) are not misclassified . that is , threshold selection is based on known water usage data to avoid false positives for irrigation events . now , if the score does exceed the threshold at decision step 212 , then the water usage rate at t 0 ( or t 0 and t − 1 hour for two - hour ) is flagged ( classified ) as an irrigation event and it is stored at step 214 . then execution proceeds to step 216 . if it does not exceed the threshold , then execution also proceeds to step 216 wherein it is determined if there are any more water usage rates to examine . if , for example , the threshold is set to 4 , irrigation scores greater than or equal to 4 are flagged as an irrigation event . a threshold of 6 or more may be selected to indicate that the water usage rate is flagged as an irrigation event . a flag indicates that they have received the minimum amount of points to be considered an irrigation event based on the presence of a temporal pattern of water usage looking backwards or forwards . if there are additional water usage rates to be considered , then execution returns to step 200 . if there are no more usage rates , execution ends . the steps set forth in fig2 are summarized as an irrigation detection algorithm equation as follows : if ( σ i = 1 8 ( if (| t 0 − t i |& lt ; 0 . 1 * t 0 ) then 1 else 0 )) & gt ; 4 : then water usage rate at t 0 ( t 0 above ) is classified as irrigation event . if the summation is not greater than 4 , then water usage rate t 0 is not classified as an irrigation event . t 0 equals water usage in gallons at time zero and t i equals water usage rate at comparison 8 intervals ( i . e ., +/− 2 , 3 , 7 , and 14 ). those skilled in the art know that variations of this formula itself or the number of intervals will achieve the same desired results . fig3 depicts an a graph illustrating an hourly rate hour at t 0 under consideration as compared to the hourly rate at the same points in time ( intervals ) on different days looking both backwards and forwards . fig4 depicts a graph illustrating an example comparison for the two - hour window that includes the hourly rate under consideration and the previous hour ( t 0 and t − 1 hour , shown ). the water usage rates for this two - hour window are summed and then compared against similar two - hour window water usage rates ( gph ) that follow the points in time ( intervals ) used for the single - hour comparisons looking both backwards and forwards . for example , first looking backwards , the sum of the gallon amounts for t 0 & amp ; t − 1 hour is compared to the interval two days prior ( t − 48 & amp ; t − 49 ), three days prior ( t − 72 & amp ; t − 73 ), one week prior ( t − 168 & amp ; t − 169 ), and two weeks prior ( t − 336 & amp ; t − 337 ). looking forwards , the t 0 & amp ; t − 1 hour two - hour window is compared to the interval two days after ( t + 48 & amp ; t + 47 ), three days after ( t + 72 & amp ; t + 71 ), one week after ( t + 168 & amp ; t + 167 ), and two weeks after ( t + 336 & amp ; t + 335 ). fig5 depicts a chart illustrating example range calculations and dummy variables that test for an irrigation event ( hourly rate examination ). for example , when t 0 is 281 gph and t − 7 is 275 , then a dummy variable ( same_by_last_week ) is assigned a value of 1 ( as the gallon amount for t − 7 is within 252 . 9 and 309 . 1 ). if previous and subsequent gallon amounts ( by percentage ) are all within range , a single observation can have similarity dummy values of 1 for the entire series ( 8 out of 8 ). a 150 gph threshold can be parameterized to be lowered or raised based on the utility . fig6 depicts a chart illustrating additional example range calculations and dummy variables that test for an irrigation event ( hourly rate examination ). when attempting to classify lower usage hours as irrigation , a smaller comparison range is recommended . specifically , in addition to the above , for single hour water usage rates ( events ) greater than or equal to 50 gph , another series of dummy variables may be created that indicate whether or not the water usage rates for the previous or subsequent periods of time ( intervals ) is within plus or minus 5 % of the gallon amount under consideration . if the previous or subsequent amount is within this range , then the variable ( e . g . ‘ same_by_last_week_50plus ’) has a value of “ 1 .” otherwise , the similarity dummy variable has a value of “ 0 .” this calculation is performed for the previous and subsequent 2 days , 3 days , week , and 2 weeks . that is , when t 0 is 58 gph and t − 7 is 56 gph , then the dummy variable ( same_by_last_week_50plus ) would be assigned a value of 1 ( as the water usage rate for t − 7 is within 55 . 1 and 60 . 9 ). in this way , a water usage rate ( observation or event ) can receive two possible irrigation points by being within a certain range . this rewards higher gallon events that happen to display patterns that are within a tight range . fig6 depicts this irrigation verification visually . for example , the previous observation when t 0 is equal to 281 and t − 7 is 275 would receive a 1 for ‘ the dummy variable ( same_by_last_week_50plus ) as well as a 1 for another dummy variable ( same_by_last_week ). if previous and subsequent water usage rate are all within this 5 % range , a single hourly water usage rate ( event or observation ) can have dummy values of 1 for the entire series ( 8 out of 8 ). similarly , the 50 gph threshold can be parameterized to be lowered or raised based on a utility . fig7 depicts a chart illustrating example range calculations and dummy variables that test for two - hourly irrigation events ( examination ). for two - hour intervals , the hour under consideration ( gal_min_leak ) is summed with the previous hour gallon amount ( hr_and_prev ). the hour under consideration ( gal_min_leak ) is then summed with the subsequent hour gallon amount ( hr_and_next ). two - hour windows are then created for each time interval of interest ( e . g ., t − 48 + t − 49 ). these water usage rate windows are then compared with a similar process as single - hour irrigation events described above . if an hourly observation under consideration is greater than or equal to 50 gallons per hour ( gph ) and its summed neighboring two - hour window is greater than or equal to 150 gallons , then this water usage rate ( interval or observation ) can be considered for possible irrigation based on comparison to previous and subsequent two - hour windows . note that the thresholds can be parameterized by utility . however , false positive testing may lead to the selection of these parameters as known to those skilled in the art . this comparison follows the previous process that creates a series of dummy variables described above . if the previous or subsequent two - hour window is within a range of plus or minus ten ( 10 ) percent , then the variable ( e . g . ‘ range_lstwk_prv_hrs ’) has a value of ‘ 1 ’, otherwise the variable has a value of ‘ 0 ’. for example , as in fig7 , if t 0 is 142 gph and t − 1 hour is 216 gph ( for a two - hour ‘ hr_and_prev ’ amount of 358 gph ) and t − 168 is 145 gph and t − 169 is 217 gph ( for a two - hour ‘ lstwk_hr_and_prev ’ amount of 362 gph ), then the dummy variable ( r_lstwk_prv_hrs ) would be assigned a value of 1 ( as the gallon amount for the two - hour window is between 322 . 2 and 393 . 8 gph ). if previous and subsequent two - hour intervals are all within the plus or minus 10 percent range , a single water usage rate ( observation ) can have dummy values of 1 for the entire series ( 16 out of 16 ). as indicated above , a single irrigation score is simply the summation of all of the similarity dummy variables created by measuring the numerical proximity of previous and subsequent intervals ( single - hour and two - hour windows ). fig8 depicts an example graph illustrating false positive percentages by irrigation score ( using a 10 % range as discussed above ). false positives are primarily distributed when a threshold is set to 3 or less as irrigation score as shown . thus , a score threshold can also be used that requires the threshold to be an irrigation score of 3 or higher to ensure that the hourly observation is a confirmed irrigation event as known to those skilled in the art . requiring this threshold may ensure a high level of confidence in the presence of a temporal pattern while also reducing the possibility for false positives to less than 1 %. it is to be understood that the disclosure teaches examples of the illustrative embodiments and that many variations of the invention can easily be devised by those skilled in the art after reading this disclosure and that the scope of the present invention is to be determined by the claims below .

US-201615372173-A

a new and distinct variety of apple tree is described , and which is characterized as to novelty by producing an attractively colored apple which is mature for harvesting and shipment on approximately october 2 under the ecological conditions prevailing in central washington state .

size .— generally — the tree as discussed , hereinafter , is a second generation tree which is three years old , and which is described as it would be seen while growing at the earlier mentioned orchard which is located in grant county , washington . all color references are from the r . h . s . colour chart provided by the royal horticultural society of great britain . type .— the present variety of tree is trained and growing on a central leader arrangement . as trained , the variety is considered precocious . spur development .— generally — moderately heavy numbers of spurs are produced . vigor .— considered moderate for the species . shape .— generally — considered upright to upright spreading . however , to some degree , the training of the tree on a central leader type arrangement will dictate the overall shape of the tree . tree height .— at three years , about 6 . 5 feet . crown diameter .— at three years , about 4 . 0 feet . hardiness .— the present variety is considered hardy for the region it is being grown in , that is , usda zone 6a . fruit productivity .— considered moderately high for the species . size .— about 3 . 3 cm . in diameter when the trunk is measured at a height of about 20 cm . about the graft union . bark texture .— generally — considered smooth for a tree of only three years old . bark color .— grey - brown ( rhs 199c ). lenticels .— numbers — present , and moderate in number , and averaging about 10 lenticels per 4 square cm . area . lenticels .— shape — variable , oval to elongated and oriented substantially horizontally . lenticels .— width — 0 . 9 to about 1 . 7 mm . lenticels .— length — 3 . 2 to about 6 . 6 . mm . lenticels .— color — grey - yellow ( rhs 161b ). diameter .— about 4 . 2 to about 5 . 1 mm . in diameter . length .— about 20 . 9 to about 32 . 3 cm . bark color .— generally — grey - purple ( rhs 183a ). lenticels .— numbers — about 9 lenticels appear per running cm . of branch length . lenticels .— shape — elongated and oriented substantially vertically . lenticels .— length — about 0 . 7 to about 1 . 1 mm . lenticels .— width — about 0 . 3 to about 0 . 5 mm . lenticels .— color — yellow - white ( rhs 158a ). branch pubescence .— generally — present , however it is generally light in abundance . internodes spacing .— about 27 . 1 to about 40 . 1 mm . between the internodes . diameter .— about 7 . 5 to about 8 . 8 mm . spur development .— considered moderate to moderately heavy . spur length .— about 7 . 5 to about 46 . 1 mm . bud diameter .— about 6 . 0 to about 9 . 2 mm . bud color .— grey - purple ( rhs 187a ). lenticels .— numbers — numerous and averaging about 7 lenticels per square cm . lenticels .— shape — round . lenticels .— diameter — about 1 - 2 mm . lenticels .— color — yellow - white ( rhs 158a ). size .— variable , and ranging in size from about 10 to about 16 . 3 mm . in diameter when measured at a distance of about 5 cm . from the trunk . crotch angle .— generally — as trained , this measurement is moderately flat to flat , that is , about 85 to about 90 degrees from the vertical . branch color .— generally — grey - brown ( rhs n199c ). lenticels .— numbers — considered few in number . typically 2 lenticels per square cm . are found . lenticels .— shape — typically oval . lenticels .— length — about 1 . 8 to about 2 . 6 mm . lenticels .— width — about 1 . 1 to about 1 . 3 mm . lenticel orientation .— generally — horizontal . lenticel color .— orange - white ( rhs 159a ). shape .— generally — considered broadly acute , and upwardly folding . texture .— dorsal surface — smooth and leathery and having sunken veins . texture .— ventral surface — smooth , and having protruding veins . sheen .— the dorsal surface has a high sheen . pubescence .— on the ventral surface , the pubescence covers nearly the entire surface and is considered moderately dense . pubescence color .— green - white ( rhs 157b ). length .— about 82 . 7 to about 111 . 4 mm . width .— about 56 . 6 to about 69 . 2 mm . marginal form .— generally — considered serrate , and occasionally bi - serrate regions may be found . tip shape .— acuminate . base .— rounded . stipules .— generally — present on most petioles . stipules .— numbers — typically 1 to 2 are present . shape .— acicular and further curving towards the petiole . stipule length .— about 9 . 6 mm . stipule width .— about 1 . 9 mm . stipule color .— both the dorsal and ventral surfaces are considered green ( rhs 138b ). stipule pubescence .— none is evident . leaf blade color .— dorsal surface — green ( rhs 137a ). leaf blade color .— ventral surface — yellow - green ( rhs 146b ). mid - vein shape .— prominent and having a considerable amount of fine pubescence on the lower surface of the vein . mid - vein width .— about 1 . 1 mm . to about 1 . 6 mm . mid - vein upper surface color .— yellow - green ( rhs 145d ). mid - vein lower surface color .— yellow - green ( rhs 146b ). mid - vein pubescence .— generally speaking , the entire ventral surface is covered with a moderately dense pubescence which has a color that is green - white ( rhs 157b ). leaf petiole .— length — about 29 . 1 to about 47 . 6 mm . leaf petiole .— shape — a shallow groove runs the entire length of the dorsal surface . leaf petiole .— diameter — about 1 . 8 to about 2 mm . leaf petiole .— color — the dorsal surface has a grey - purple color ( rhs 186c ). the ventral surface has a yellow - green color ( rhs 194c ). occasionally , a light highlight is found at the basal end and on the ventral surface , and which is grey - purple ( rhs 185a ). petiole pubescence .— generally , considered abundant and moderately dense , and located over the entire length , and circumference of the petiole . petiole pubescence .— color — green - white ( rhs 157b ). date of full bloom .— about may 9 , 2011 under the ecological conditions prevailing near grant county , washington . number of blossoms per bud .— 5 - 6 blossoms may be found . flower size .— generally speaking , it is considered to be a medium - large flower for the species . when fully expanded , the diameter of the flowers range from about 49 . 8 to 57 . 2 mm . petals .— numbers — 5 . petals .— width — about 18 . 3 mm . petals .— length — about 24 . 5 mm . petals .— color — white ( rhs n155d ). the ventral surface has highlights which are red - purple , in color ( rhs 64b ). petal shape .— elliptic . stamen .— numbers — about 19 - 20 . filament .— length — about 4 . 2 to about 12 . 1 mm . filament .— color — white ( rhs 155c ). anthers .— shape — elongated and heart shaped . anthers .— dimensions — about 1 mm . wide and about 1 . 4 mm . long . anthers .— mature color — yellow ( rhs 10d ). pistil .— length — about 11 . 7 to about 14 . 4 mm . styles .— numbers — about 5 . styles .— form — the styles are fused together at about ⅓ the distance from the base . styles .— color — yellow - green ( rhs 145b ). stigma .— shape — round and club shaped . sigma .— diameter — about 0 . 5 mm . sigma .— color — yellow - green ( rhs 153b ). sepals .— numbers — typically 5 per blossom . sepals .— shape — considered thin , and deltoid shaped , and curved back over the peduncle . sepals .— tip shape — generally acuminate . sepals .— base shape — truncate . sepals .— length — about 11 . 1 mm . sepals .— width — about 4 . 1 . mm . sepals .— pubescence — moderate , and white in color . sepal color .— dorsal surface — yellow - green ( rhs 146c ). sepal color .— ventral surface — yellow - green ( rhs 148d ). sepal tip color .— red - purple ( rhs 64b ). peduncle .— length — about 20 . 5 to about 24 . 3 mm . peduncle .— color — yellow - green ( rhs 146b ). occasionally , the basal end of the peduncle may have highlights of a red - purple color ( rhs 64b ). peduncle .— surface texture — a white downiness is present over the entire surface . the color of this downiness is not distinctive of the variety . form .— generally — the present variety produces fruit which are considered irregularly round and conical in shape , and the fruit exhibits an overall lopsided appearance . the present fruit is not considered crowned and does not exhibit any ribbing . size .— considered medium large for the species at normal crop loading levels . diameter .— about 74 . 4 mm when measured in the axial diameter . the present variety also has an average diameter of 84 . 7 mm . when measured in the equatorial plane . stem .— length — considered stout . the length of the fruit stem is about 9 . 2 to about 22 . 9 mm . stem .— diameter — about 3 . 5 mm . stem cavity .— width — about 27 . 2 to about 36 mm . stem cavity .— depth — about 14 . 2 to about 20 . 8 mm . stem cavity .— shape — obtuse . no stem cavity lipping is evident . stem bowl .— russet — very little russet is detected , and when found , is typically located only at the base . basin cavity .— width — about 28 . 9 to about 35 . 6 mm . basin cavity .— depth — about 9 . 2 to about 14 . 4 mm . basin cavity .— shape — overall the cavity is considered wide and sloping . eye .— shape — erect in form , and occasionally having reflexed tips . sepal color .— yellow - green ( rhs 146d ). sepals .— surface texture — considered moderately downy . sepals .— downy color — green - white ( rhs 157d ). skin .— surface texture — considered smooth and having shallow lenticel dimpling which gives it a “ hammered ” look . skin bloom .— present and considered moderate in amount . skin texture .— considered brittle . skin thickness .— considered average for the species . skin appearance .— streaked . skin under color .— yellow - green ( rhs 151d ). streak over color .— red ( rhs 53a ). streak under color .— red ( rhs 46b ). as a general matter , 80 to about 95 % of the surface is colored . skin lenticels .— numbers — numerous and uniform in their distribution . typically , 8 per square cm . are found . skin lenticels .— shape — round and quite conspicuous in the streaked areas . skin lenticels .— diameter — about 0 . 7 to about 1 mm . skin lenticels .— color — white ( rhs 155b ). core position .— generally speaking , it is considered median . core line position .— basal meeting . core diameter .— about 39 . 2 mm . core length .— about 31 . 8 mm . core shape .— generally considered flat and conical . cell number per fruit .— 5 . cell shape .— considered elliptical . cell length .— about 17 . 2 mm . cell depth .— about 5 . 3 mm . tube .— shape — generally considered cone - shaped . stamen position .— generally , basal . axis .— generally , axial and closed . seed numbers .— typically 2 . occasionally 1 . seed shape .— acute . seed length .— about 8 . 1 to about 9 . 1 mm . seed width .— about 4 . 8 to about 5 . 7 mm . seed color .— brown ( rhs 200c ). flesh texture .— fine , crisp , and melting . the flesh is sub - acid and juicy . flesh color .— yellow ( rhs 11d ). the flesh of the present fruit will brown slightly following exposure to the atmosphere upon the cutting of the fruit . flesh aroma .— apple - like and moderate in intensity . date of harvest .— oct . 2 , 2011 under the ecological conditions prevailing in grant county , washington . fruit pressure .— the apple tree of the present variety produces fruit at harvesting which has a fruit pressure of about 16 . 4 pounds . in relative comparison to the fruit produced by the ‘ honeycrisp ’ apple tree ( u . s . plant pat . no . 7 , 197 ), the fruit pressure of the present variety is higher . the ‘ honeycrisp ’ apple tree produces fruit at the same geographical location which has a fruit pressure of about 15 . 1 pounds . once the fruit is subjected to storage conditions , the fruit produced by the present variety of apple tree had a fruit pressure on jan . 23 , 2012 of 15 . 9 pounds as compared to the fruit of the ‘ honeycrisp ’ apple tree which had a fruit pressure of about 13 . 5 pounds . brix .— upon harvesting , the fruit produced by the present variety of apple tree had a brix of about 13 . 5 as compared to the brix of 14 . 3 for the fruit produced by the ‘ honeycrisp ’ apple tree ( u . s . plant pat . no . 7 , 197 ) when grown under similar environmental conditions . when measured on jan . 23 , 2012 , the new variety had a brix of about 13 . 9 as compared to the fruit of the ‘ honeycrisp ’ apple tree which had a brix of about 14 . 2 . ph .— upon harvesting on oct . 2 , 2011 , the fruit of the present new variety of apple tree had a ph of about 3 . 43 as compared to a ph of about 3 . 75 for the fruit produced by the ‘ honeycrisp ’ apple tree when grown under similar conditions . when measured on jan . 23 , 2012 , the ph of the fruit produced by the present variety was about 3 . 52 as opposed to the ph of the ‘ honeycrisp ’ apples stored under identical storage conditions which had a ph of about 3 . 75 . titratable acid .— upon harvest , the fruit produced by the present variety of apple tree had a titratable acid concentration of 0 . 82 grams per 100 ml . as compared to the titratable acid found in the fruit produced by the ‘ honeycrisp ’ apple tree , when grown under similar conditions of about 0 . 52 grams per 100 ml . when measured on jan . 23 , 2012 , the fruit of the new variety of apple tree had a titratable acid concentration of 0 . 62 grams per 100 ml . as opposed to the ‘ honeycrisp ’ apple tree , when stored under identical conditions , of about 0 . 45 grams per 100 ml . keeping quality .— considered excellent . the present variety has been kept up to 5 months in cold storage with no substantial deleterious effects noted . pollination .— generally — any diploid apple maturing in approximately the same blooming season will be suitable . fruit use .— fresh dessert apple . disease and insect resistance .— the present variety is considered to be susceptible to all insects and diseases found in the region of central washington state . although the new variety of apple tree herein denominated varietally as ‘ ds 41 ’ possesses the characteristics recited above when grown under the ecological conditions prevailing in grant county , washington , it should be understood that the variations of the usual magnitude and characteristics incident to changes in growing conditions , fertilization , pruning and pest control will be expected .

US-201213506991-V

a lenticular lens case for a tablet computer , including first and second base plates that open to enable insertion of a tablet computer , and that close to firmly lock the tablet computer into place , first and second end caps connected to the first and second base plates , including tracks for sliding a frame inwards and outwards , and a lens frame for holding a lenticular lens , including extruding pins that slide along the tracks , such that when the pins reach the end of the tracks , the lens frame can be flipped approximately 180 ° over the base plates so as to tightly overlay a screen of the tablet computer , when the tablet computer is firmly locked in the base plates .

aspects of the present invention relate to a lenticular lens case for a tablet computer that mechanically aligns and retains a lenticular lens array over the screen of the tablet computer , within an accuracy of 0 . 01 mm , and eliminates an air gap between the lens and the screen . the lenticular lens case is durable , and makes it easy for a user to accurately attach and remove the lenticular lens array . reference is made to fig1 , which is an exploded view of a lenticular lens case 100 for a tablet computer , in accordance with an embodiment of the present invention . reference is also made to fig2 , which is an assembled view of case 100 , showing case 100 used as a stand for the tablet computer , in accordance with an embodiment of the present invention . case 100 includes two base plates 300 and 400 , referred to herein respectively as base plate a and base plate b . base plates a and b are connected to respective end caps 500 and 600 , referred to herein respectively as end cap a and end cap b . a tablet computer ( shown in fig1 ) is inserted into assembly 100 and fits tightly between end caps a and b . base plates a and b slide inward and outward relative to one another , to open and closed positions . when the base plates are slid into the open position , there is room for inserting the tablet computer . then , when the base plates are slid into the closed position , the tablet computer is held tightly in place . a winged bayonet 700 is used to lock the base plates in the closed position , so that the tablet computer remains locked in its place . when the tablet computer is locked into place it maintains the tablet securely , and enables access to the tablet &# 39 ; s hardware device controls and interfaces . inter alia , as shown in fig1 , a button of the tablet computer , such as a home button , is accessible via a cut - out 510 in end cap a , and a camera of the tablet computer is exposed through a cut - out 610 in end cap b . assembly 100 includes a lens frame 700 , for holding a lenticular lens array ( shown in fig1 ). when the lens array is in use , lens frame 700 is positioned and held in place over the screen of the tablet computer so that the lens array is tightly retained over the screen . lens frame 600 includes pins that slide up and down tracks within ends caps a and b , to raise and lower the lens frame . when lens frame 700 is raised so that the pins reach the ends of the tracks , then the frame flips substantially 180 ° over the base plates to the other side of the base plates , for storage when the lens array is not in use . lens frame 700 is raised and flipped again over the base plates to subsequently use the lens array . the pixel and sub - pixel structure is analyzed and based on the results , the lenslet width is determined . in the case of an ipad ®, the lenslets are attached to the screen at a 15 ° angle . as such , the lenslets do not cover each pixel completely , and a pattern like rgb , gbr , brg , follows a lenslet . assembly 100 includes a cover 200 , preferably made of a flexible protective material such as leather , which protectively covers the tablet computer . when flipped over the casing to the back of the tablet computer , cover 200 serves as a stand for supporting the tablet computer in a raised position . when used as a stand , cover 200 is in the correct landscape position for using a camera of the tablet computer , and allows for various viewing angles . rubber grips 310 on base plate a provide grip support for the base plates when the tablet computer is standing in the raised position . when lens frame is overlaid on the screen of the tablet computer , the lenticular lens is retained tightly over the screen , without an air gap between the lens and the screen . as such , if the screen of the tablet computer is touch - sensitive , then the lenticular lens array supports touch - through sensitivity ; i . e ., a tap or swipe at a location on the lenticular lens array is detected as a tap or swipe at the corresponding location on the screen of the tablet computer . reference is made to fig3 , which is an illustration of base plate a of case 100 , in accordance with an embodiment of the present invention . reference is also made to fig4 , which is an illustration of base plate b of case 100 , in accordance with an embodiment of the present invention . base plate a includes magnets 320 , molded into the surface of the base plate , for holding lens frame 700 in place when lens frame 700 overlays the screen of the tablet computer . base plate a has female tracks 330 , which slide along counterpart male tracks 430 in base plate b . tracks 330 and 430 enable the two base plates to slide outward , making room for inserting the tablet computer , and to slide inward to firmly hold the tablet computer in place . base plate a includes bayonet thread 360 , and base plate b includes bayonet thread 460 , for locking the base plates in place by turning wing bayonet 800 . base plate a includes an indent 340 for holding corresponding registration tabs of lens frame 700 , to secure lens frame 700 securely in proper alignment when lens frame is overlaid on the screen of the tablet computer . base plate a includes a grip spaces 370 , which are openings in the mold of the base plate into which rubber grips 310 are inserted . base plate also includes a male boss 380 that fits into a corresponding indent dimple of end cap a , to avoid slippage of the end cap . similarly , base plate b includes a male boss 480 that fits into a corresponding indent dimple of end cap b , to avoid slippage of the end cap . base plate b leaves an open edge space , for storage of lens frame 700 when the lenticular lens array is not in use , as shown below in fig1 . reference is made to fig5 , which is an illustration of end cap a of case 100 , in accordance with an embodiment of the present invention . reference is also made to fig6 , which is an illustration of end cap b of case 100 , in accordance with an embodiment of the present invention . end cap a has a cut - out 510 , for enabling access to a button , such as a home button , of the tablet computer . end cap b has a cut - out 610 for a camera of the tablet computer to see through . end cap a includes a track 530 , and end cap b includes a corresponding track 630 . pins of lens frame 700 slide along tracks 530 and 630 to enable lens frame to move inwards and outwards of case 100 . end cap a includes an indent dimple 580 for holding male boss 380 of base plate a , and thereby align base plate a with end cap a . similarly , end cap b includes an indent dimple 680 for holding male boss 480 of base plate b , and thereby align base plate b with end cap b . end cap a includes a perforation 540 , so as to avoid obstructing sound generated by an audio speaker in the tablet computer . reference is made to fig7 , which is an illustration of lens frame 700 of case 100 , in accordance with an embodiment of the present invention . lens frame 700 includes protruding pins 710 , which slide inwards and outwards of tracks 530 and 630 of end caps a and b , to enables lens frame 700 to move inwards and outwards of case 100 . lens frame 700 includes ferrous metal strips 720 which are held by magnets 320 of base plate a . lens frame 700 also includes registration tabs 740 that fit into indents 340 of base plate a , to secure lens frame 700 securely in proper alignment when lens frame is overlaid on the screen of the tablet computer . reference is made to fig8 , which is an illustration of wing bayonet 800 for joining base plates a and b , in accordance with an embodiment of the present invention . wing bayonet 800 includes a metal pin 810 that threads within bayonet threads 350 and 450 of base plates a and b , to lock the base plates into their closed position and thereby secure the tablet computer tightly in place . reference is made to fig9 , which is a front perspective view of case 100 , in accordance with an embodiment of the present invention . case 100 is shown with a tablet computer inside . a button 910 of the tablet computer , such as a home button , is accessible through a cut - out of end cap a . a cut - out of end cap b exposes a camera 920 of the tablet computer . a lenticular lens array 950 in lens frame 700 is overlaid on the screen of the tablet computer . a lens removal tab 750 enables a user to pull lens frame 700 away from the screen , when it is no longer in use , for storage inside case 100 behind the tablet computer . reference is made to fig1 , which is a back perspective view of case 100 , in accordance with an embodiment of the present invention . a lock and cover attachment system 820 is used to lock base plates a and b into their closed position , and to attach cover 200 . cover 200 may be sewn around wing bayonet 800 , or otherwise assembled around wing bayonet 800 . as shown above in fig2 , cover 200 may be opened and used as a stand for the tablet computer , and rubber grips 310 provide stability when the tablet computer is standing . reference is made to fig1 , which is a view of the interlocking base plates and end caps of case 100 , in accordance with an embodiment of the present invention . fig1 shows base plate a connected to end cap a , and base plate b connected to end cap b . when the base plates are open , a tablet computer 900 is placed between the base plates . as the base plates move into their closed position , ring 350 of base plate a and ring 450 of base plate b move into alignment for locking . when the base plates are locked into place , tablet computer 900 is tightly held in place between them . reference is made to fig1 , which is a view of a lenticular lens array 950 , in case 100 , being stored behind tablet computer 900 , in accordance with an embodiment of the present invention . fig1 shows lenticular lens array 950 within lens frame 700 . lens frame 700 is stored behind a screen 930 of tablet computer 900 . fig1 shows lens frame 700 in a raised position . lens frame 700 lowers into case 100 as its pins slide down the tracks of end caps a and b . reference is made to fig1 , which is a view of lenticular lens frame 700 of case 100 , in accordance with an embodiment of the present invention . reference is also made to fig1 , which is a view of the magnetic alignment mechanism , for aligning and retaining lens frame 700 of case 100 , in accordance with an embodiment of the present invention . reference is further made to fig1 , which is a view of the interior of base plate a and end cap a of case 100 , in accordance with an embodiment of the present invention . fig1 shows magnets 320 of base plate a and tracks 550 of end cap a . fig1 shows lenticular lens array 950 in lens frame 700 . protruding pins 710 slide up and down the tracks of end caps a and b , to raise and lower lens frame 700 into case 100 . when lens frame 700 is lowered into place in front of the screen of the tablet computer , ferrous metal strips 720 are held in place by magnets 320 inside base plate a . reference is made to fig1 , which is a view of magnets 320 molded in base plate a of case 100 , in accordance with an embodiment of the present invention . reference is made to fig1 , which is a bottom view of base plate a and end cap a of case 100 , in accordance with an embodiment of the present invention . fig1 shows rubber grip 310 , which holds case 100 to the ground when case 100 is in a standing position . reference is made to fig1 is an animated sequence of pictures showing how lens frame 700 pulls out and flips over case 100 , so as to overlay lenticular lens array 950 on screen 930 of the tablet computer , in accordance with an embodiment of the present invention . it will thus be appreciated by those skilled in the art that the lenticular lens case for a tablet computer described above overcomes the technical problems of alignment and retention explained above , and provides many other advantages . in particular : the case provides for accurate , reliable and easy removal and reattachment of a lenticular lens array , with alignment accuracy within 0 . 01 mm . the case has a durable attachment system . the case protects the lenticular lens array in a protected storage position . the case allows access to hardware controls of the tablet computer . the case maintains touch - through capabilities of the tablet computer touch screen . the case is scratch resistant . the case rejects reflection . it will be appreciated by those skilled in the art that the present invention has broad application to lenticular lens cases for many devices , in addition to tablet computers . such devices include inter alia gaming devices , entertainment devices , web browsers , e - readers , mobile phones , and automobile , boat and airplane decks and panels . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made to the specific exemplary embodiments without departing from the broader spirit and scope of the invention as set forth in the appended claims . accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense .

US-201414479340-A

a method is provided for treating pressure ulcers by transmitting an electrical stimulus sufficient to effect contraction of a loaded muscle , wherein the method comprises the steps of providing an electrical transmission for effecting contraction of the loaded muscle , transmitting sufficient electrical stimulation to the muscle to contract it for a predetermined short period of time , and ceasing transmission of the stimulus to the muscle for a predetermined longer period of muscle relaxation , whereby the predetermined period of relaxation is sufficient to minimize muscle fatigue and cause sustained reoxygenation .

a method for mitigating or preventing formation of pressure ulcers by transmitting electrical stimuli to a loaded muscle is provided . the source of the electrical transmission comprises a stimulator 10 , which is electrically coupled to an electrode 12 , having an anode 14 and a cathode 16 , via electrical leads 18 and 20 , respectively ( fig1 ). the stimulator 10 provides an electrical signal , such as , for example , a discrete signal ( eg . pulsatile waveform ), a continuous signal ( eg . sustained sinusoidal waveform , rectangular waveform ), or a combination of a discrete signal and a continuous signal . the electrical signal may be transmitted at a characteristic frequency of 20 hz to 60 hz , and preferably , the electrical signal is transmitted at a characteristic frequency of 40 hz . the stimulator 10 may be battery operated . the electrode 12 is positioned on a person &# 39 ; s skin such that the electrical stimulus is transmitted to skin underneath which lies the nerve controlling the contraction of a muscle at risk of developing a pressure ulcer . for instance , the electrode 12 may be positioned on a skin portion proximate to the gluteus maximus muscle of the person , where external forces ( such as a seating interface ) exert pressure upon the gluteus maximus muscle causing the tissue to be compressed and sheared between the skin portion and a bony prominence . electrode 12 placement may vary depending upon the position of the person . as shown in fig9 a - 9c , where the person is lying in a supine position , the target muscle may be the gluteus muscle , a muscle at least partially surrounding the shoulder blades of the person , or a muscle disposed in proximity to the back of the person &# 39 ; s head . where the person is disposed in a lateral recumbence position , the target muscle may be a muscle of the hip ( e . g ., gluteus medius and tensor fascia latae muscles ) or the side muscles surrounding the shoulder ( e . g ., deltoid muscle ). once the electrode 12 is in position , the method comprises transmitting an electrical stimulus to the skin portion of the person . the stimulus should effect contraction of the loaded muscle , wherein the contraction is sufficient to cause the deformation and reshaping of the muscle . the stimulus should cause temporary redistribution of pressure away of the loaded muscle away from bony prominences , thereby temporarily relieving compression and increasing oxygenation of the tissue at risk of developing an ulcer . for example , in one preferred embodiment , the electrical stimulus is sufficient to cause contraction and reshaping of the muscle , but is insufficient to effect lifting of the person ( i . e . raising the muscle off the seat of a wheelchair ) or movement of the person &# 39 ; s limbs ( i . e . effecting minimal joint movement ). movement of the person &# 39 ; s limbs may be minimized by transmitting an electrical stimulus that only changes the angle between two bones defining each joint of the person by less than approximately 10 degrees ( i . e . upon application of the electrical stimulus , none of the person &# 39 ; s joints open or close by more than 10 degrees ). in other words , depending upon the position of the person , the electrical stimulus transmitted to the person may cause isometric contraction of the muscle , while causing less than a 10 degree change in the angle of the joint nearest the stimulated muscle . where the person is in the sitting position , stimulation of the gluteus maximus would cause isometric contraction of the muscles with less than a 10 degree change in the hip joint angle ; where the person is in the supine position , stimulation of the gluteus maximus would cause an isometric contraction of the muscles with less than 10 degrees change in the hip joint angle and lumbar spine ; where the person is in the supine position , stimulation of trapezius would cause an isomeric contraction of the muscle with less than 10 degrees change in the shoulder joint angle ; where the person is in the supine position , stimulation of the muscles of the back of the head would cause an isometric contraction of the muscles with less than 10 degrees change in the angle of the neck relative to the head ; where the person is in the lateral recumbent position , stimulation of the deltoid would cause an isometric contraction of the muscle with less than 10 degrees change in the shoulder angle ; where the person is in the lateral recumbent position , stimulation of the gluteus medius muscle would cause an isometric contraction of the muscle with less than 10 degrees change in the hip angles ; where the person is in the lateral recumbent position , stimulation of tensor fascia latae would cause an isometric contraction of the muscle with less than 10 degrees change in the hip joint angle or knee angle . reducing limb movement allows the person to remain in a supine position or in a recumbence position during treatment , thereby minimizing the need to restrain the person and decreasing the risk of injury or fall . electrode burns can be mitigated by measuring the impedance of the electrode - skin interface and by regulating the amount of voltage applied by the stimulator 10 across the interface . the stimulator 10 is preferably adapted to transmit an electrical stimulus for short periods of time , in the order of seconds up to a minute ( e . g . up to 60 seconds ), and repeated every several minutes , for a duration of at least one hour of treatment . otherwise stated , the person is treated by applying short periods of either continuous or discontinuous stimulation pulses ( activation ) followed by relatively long periods of relaxation ( deactivation ), with the objectives of avoiding or minimizing muscle fatigue and enabling reoxygenation of the muscle during the relaxation period . the long periods of relaxation may be in the order of minutes up to one hour ( e . g . less than 60 minutes ). this cyclic process is repeated over a selected duration , which can be up to 24 hours per day . by way of example , fig1 ( a ) illustrates a basic electrical stimulation pattern , wherein the stimulus may be activated or “ on ” for a period of anywhere between 5 to 30 seconds , and then deactivated or “ off ” for a period of anywhere between 5 to 30 minutes . during the on period , the electrical stimulus , sufficient to effect contraction of the target muscle , activates the target muscle such that it undergoes continuous contraction for the entire on period ( e . g . the entire 5 seconds ). following the on period , the electrical stimulus is deactivated and the contracted muscle is “ relaxed ” ( i . e . not induced to contract ) for the entire off period ( e . g . the entire 5 minutes ). following the off period , the stimulus reactivates the muscle for a second on period . the second on period is then followed by a second off period , and so on for at least one hour of treatment . this on / off pattern may be repeated for all or substantially all of the treatment period . in one embodiment of the present method , the on period will activate the muscle for a duration that is sufficient to effect contraction and to reshape the muscle , while restoring blood flow and increasing oxygenation of the loaded tissue , independent of any changes to muscle mass . for instance , the on period may have a duration of at least 5 seconds , and preferably a duration of 10 seconds . the stimulation may be applied continuously for the entire on period , or it may be applied in a “ bursting ” or discontinuous pattern for the entire on period . such brief bouts of stimulation are used to parallel the effects of voluntary or assisted repositioning of the person , and to mimic postural shifting or “ fidgeting ” observed in able - bodied individuals . the method will further comprise an off period , preferably having a duration of at least 5 minutes , and more preferably 10 minutes in duration . the duration of the off period may be any duration of time that provides the target muscle sufficient rest between each on period of stimulation , thereby reducing muscle fatigue and obviating the need to pre - condition the target muscle prior to treatment . without sufficient relaxation time during the off period , the muscle may become fatigued and require an unacceptable early termination of the treatment . it is an advantage of the present invention that the muscle being contracted need not be pre - conditioned immediately prior to the treatment . as described above , the purpose of pre - conditioning is to increase muscle mass and muscle endurance ( fatigue resistance ). sufficient deactivation ( prolonged relaxation ) of the muscle during the deactivation period further provides sustained reoxygenation periods following muscle contraction , thereby reducing tissue injury caused by ischemia and / or reperfusion . fig1 b illustrates an example of intermittent electrical stimulation pattern for bilateral stimulation . bilateral stimulation refers to the application of the basic on / off intermittent electrical stimulation pattern to muscles on both sides of the body ( e . g ., left and right gluteus maximus muscles ). the on mode of pattern of stimulation can occur simultaneously to both sides of the body ( i . e . the left and right sides are activated at the same time ), or stimulation can be staggered ( i . e . the right side is activated upon the deactivation of the left side ). where the stimulation is staggered , stimulation of the second side of the body may occur anywhere between immediately up to 15 minutes after the deactivation of the first side of the body . fig1 ( c ) illustrates continuous ( or “ sustained ”) and discontinuous applications of the electrical stimulus during the activation “ on ” mode of the pattern . fig1 ( d ) illustrates the general waveforms of each stimulus pulse during the on mode of the pattern . unless otherwise indicated , all numbers expressing quantities of ingredients , properties such as distance , operating conditions , and so forth used in the specification and claims are to be understood as being modified in all instances by the term “ about .” accordingly , unless indicated to the contrary , the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained . at the very least , and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims , each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques . notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations , the numerical values set forth in the specific examples are reported as precisely as possible . any numerical value , however , inherently contain errors necessarily resulting from the standard deviation found in their respective testing measurements . embodiments of the present invention will be described in further detail with reference to the following non - limitative examples . intermittent electrical stimulation may be a useful medical intervention that allows immobilized individuals to remain seated or supine for prolonged periods of time , reducing the frequency of assisted repositioning , and , most importantly , reducing the development of dti . experiments have been conducted to investigate the effectiveness of applying intermittent electrical stimulation ( ies ) to reduce muscle injury due to the presence of persistent external pressure . experiment 1 : effectiveness of ies in the prevention of dti in the rat to investigate the effectiveness of ies in the prevention of dti , a series of experiments were conducted in four groups of rats : a control group , which received 2 hours of external load applied to the quadriceps muscle of one hind limb , experimental group 1 , which received the application of pressure and simultaneous application of a 10 - s stimulus bout ( biphasic , charge - balanced , constant current , 10 - 40 ma , 250 μs , 50 pulses / s ) to the femoral nerve of the experimental leg every 10 minutes throughout the duration of pressure application ( see fig1 c ), experimental group 2 , which received the same pressure as group 1 and simultaneous electrical stimulation to the treated leg ( 10 - s bouts ) every 5 minutes , and experimental group 3 , which received the application of ies at 5 - minute intervals but without pressure application . eighteen adult female , sprague - dawley rats were anesthetized with isoflurane ( 2 - 3 % isoflurane in 500 ml / min oxygen ) and a nerve - cuff was implanted around the femoral nerve of each hind limb . following implantation , each rat was placed on a flat surface with both hind limbs extended and restrained in place with a padded strap positioned around each ankle ( see fig1 a ). the knee and upper calf in the experimental leg were also restrained using a padded clamp to prevent any off - sagittal movement of the leg . pressure was applied to the quadriceps muscle of the experimental leg using a 3 - mm diameter indenter ( see fig1 d ). loads were measured with a miniature beam force transducer ( interface , scottsdale , ariz ., u . s . a .). the force was recorded at a sampling rate of 100 samples / s using a ced power 1401 a / d board ( cambridge equipment design , cambridge , uk ) and signal 2 software ( cambridge equipment design , cambridge , uk ) throughout the duration of the experiment . the indenter was adjusted as required using a micromanipulator ( narishige , japan ) to maintain the desired level of applied force ( fig1 b ). throughout the experiments , the pressure applied to each group was 164 ± 6 . 7 kpa for the control group , 167 ± 26 . 6 kpa for experimental group 1 , and 165 . 2 ± 25 . 1 kpa for experimental group 2 . in all animals , pressure was applied for a period of 2 hours . following the period of pressure application , the leg was unloaded , the nerve - cuffs from both limbs were removed and the skin was sutured . post - operatively , buprenorphine ( 0 . 05 mg / kg ) was administered subcutaneously , to alleviate any discomfort . the contralateral leg served as an internal control . fig1 e illustrates the force generated by contraction of muscle in rats in response to ies treatment during 2 hours of treatment . the mean and standard deviation of the force generated by the contraction of the muscle in response to the electrical stimulus during each bout of electrical stimulation over a 2 hour period are shown for 6 rats ( top plot ) and 5 rats ( bottom plot ). bouts of 10 seconds of stimulation ( stimulation on period ) delivered every 5 minutes resulted in force reduction of − 25 % after 2 hours ( top plot ). this reduction was not significant and did not significantly affect the effectiveness of the treatment . bouts of 10 seconds of stimulation ( stimulation on period ) delivered every 10 minutes resulted in no force reduction after 2 hours ( bottom plot ). deep tissue injury was quantified 24 hours later by in - vivo t2 - weighted magnetic resonance imaging ( mri ) and post mortem histological assessment of the extracted quadriceps muscles . the untreated contralateral legs of all animals served as healthy controls ( contralateral control group ). magnetic resonance imaging was used to obtain an in - vivo assessment of deep tissue injury following pressure application , and to quantify the effectiveness of electrical stimulation in preventing such injury in rats . a t2 - weighted spin - echo sequence ( echo time ( te )= 80 ms , relaxation time ( tr )= 2000 ms ) was employed to detect the presence of edema ( as indicated by increased water content ) within the quadriceps muscles in both hind limbs of each rat . data were collected during a 30 - minute scanning session and twenty mri slices ( images ) were acquired from each rat , with slice thickness of 2 mm and slice separation of 1 mm ( every other slice shown in fig2 ). the acquisition matrix size was 256 pixel × 256 pixel within a field of view ( fov ) of 120 mm × 120 mm , resulting in an in - plane resolution of 0 . 47 mm × 0 . 47 mm . both hind legs were imaged in the same slice . mri slices were obtained in the sagittal , coronal and transverse planes in relation to the rat &# 39 ; s femur . the left and right quadriceps muscles were manually selected from every slice and all analyses were restricted to the pixels inside these two regions ( fig3 a ). to quantify the amount of increased water content present within the experimental leg from each slice , the signal intensity of each pixel in that leg was compared to a threshold intensity level obtained from the contralateral leg ( fig3 b ). the mean ± 2 * standard deviations in the signal intensity from the quadriceps muscle of the contralateral leg was chosen as the threshold intensity level . if the signal intensity of a pixel in the experimental leg was higher than the threshold , the pixel was considered to have increased water content , or edema ( fig3 c ). a percentage of the affected area relative to the total area of the muscle was obtained from each slice and the total affected volume was calculated for each rat by summing the results from all slices . the threshold was also applied to each control ( contralateral ) limb from each rat to quantify the amount of increased water content that could be attributed to factors other than the application of pressure or ies , such as the electrode cuff implantation or normal variation in the signal intensity . results from the untreated contralateral limbs of all 24 rats were designated as the contralateral control group . to corroborate the extent of injury in the muscle from the mri assessment , histological evaluation of the tissue was also performed . under deep anesthesia ( sodium pentobarbital , 40 mg / kg ), the animal was transcardially perfused with a formaldehyde ( 1 %)/ gluteraldehyde ( 2 . 25 %) fixative and the quadriceps muscles from both hind limbs were removed . the muscles were photographed , weighed and their volume calculated . the muscle tissue was stored in the same fixative , and subsequently dehydrated through washing in a graded series of ethanol dilutions and embedded in paraffin . muscle sections obtained from the region identified by the mr images as containing edema were longitudinally bisected . a 2 - 3 mm thick longitudinal section was obtained , as well as five 2 3 mm thick transverse sections . a 5 μm slice was obtained from each section and stained with hematoxylin and eosin ( h & amp ; e ). a veterinary pathologist blinded to the experimental groups performed all histological analyses . a 4 . 9 mm 2 area from each slice was assessed to identify muscle fiber necrosis , inflammatory cell infiltration , hemorrhage and tissue mineralization . a necrosis score ( 0 - 4 ) was assigned to each longitudinal slice based on the approximate area exhibiting necrosis out of the slice total area . subsequently , the transverse slices from each animal were used to confirm the extension of necrosis throughout the muscle . the estimated volume of the muscle affected by necrosis from the histological assessment was compared against the estimated volume of the corresponding muscle affected by edema as calculated from mri slices . results show that edema and tissue injury can develop after a 2 - hour application of constant pressure . in all test groups and at the completion of the study , the skin under the pressure indenter did not exhibit any indication of inflammation or injury , underscoring the difficulty of identifying dti by visual inspection of the skin . as illustrated in fig4 , histological assessment of the quadriceps muscle tissue showed that the severity of muscle injury varied between the control and experimental groups . in general , the lesions within the muscle were characterized by swelling , loss of striations , and fragmentation of muscle fibers . the connective tissue surrounding affected muscle fibers was often infiltrated by numerous neutrophils admixed with smaller numbers of macrophages . hemorrhage into muscle bundles was most apparent in severely affected tissue . the control group had the largest extension of necrotic fibers in the tissue with a score of 3 . 2 ± 0 . 8 . this score represented a necrotic area occupying 25 to 50 % of the area analyzed . the extent of tissue necrosis was significantly larger in the control group than that in experimental group 1 , which had a score of 1 . 0 ± 0 . 9 ( kruskal - wallis non - parametric test , p = 0 . 01 ), representing a necrotic area of less than 10 %. experimental group 2 also exhibited a significantly smaller area of muscle necrosis than the control group ( kruskal - wallis non - parametric test , p = 0 . 03 ), with a score of 1 . 2 ± 1 . 5 , equivalent to a necrotic area between 10 % and 20 %. the necrosis score was also significantly smaller in experimental group 3 ( kruskal - wallis non - parametric test , p = 0 . 004 ), with a score of 0 . 5 ± 0 . 6 . there was no significant difference between all three experimental groups in the amount of necrosis assessed . the infiltration of neutrophils and macrophages , as well as the presence of red blood cells and mineralization of the tissue , were not significantly different between the control and experimental groups . fig5 ( right axis , open circles ) summarizes the extent of tissue necrosis in the control and experimental groups and illustrates that in the control group ( pressure , no ies ), the application of external pressure for 2 hours generated edema in 60 ± 15 % of the muscle . in contrast ( fig5 , left axis , filled circles ), experimental groups 1 ( pressure + ies every 10 min ) and 2 ( pressure + ies every 5 min ) exhibited a significantly reduced region of edema in the muscle , ( 16 ± 16 % for experimental group 1 and 25 ± 13 % for experimental group 2 ). experimental group 3 ( no pressure , ies every 5 min ) and contralateral control group ( untreated contralateral limbs ) exhibited a 5 ± 4 % and a 5 ± 4 % respectively . the extent of increased water content in all three experimental groups was significantly different from that in the control group ( one - way anova test , p = 0 . 0001 ), but was not significantly different from each other ( tukey post - hoc test , exp 1 vs exp 2 , p = 0 . 59 ; exp 1 vs exp 3 , p = 0 . 45 ; exp 2 vs exp 3 , p = 0 . 06 ). to obtain an insight into the mechanisms of action of ies , the effect of ies on tissue oxygenation was measured in two separate experiments with human volunteers . in the first experiment , tissue oxygenation measurements were obtained from an able - bodied volunteer by means of t2 * mri quantification in muscles in both unloaded and loaded conditions , respectively . in the second , changes in the surface ( bed - buttocks interface ) pressure profiles generated by the ies - elicited contractions were measured in an able - bodied volunteer . an initial experiment was conducted in an able bodied volunteer ( male , 22 yr ) to assess changes in tissue oxygenation associated with contractions elicited by ies in an unloaded muscle . the experimental setup is illustrated in fig7 a - 7 c . electrodes were placed on the body and electrical stimulation was delivered to induce muscle contractions . the change in the shape of the muscle during contraction , redistribution of surface pressure and changes in tissue oxygenation were measured using magnetic resonance imaging ( mri ) techniques and surface pressure mats . surface , non - magnetic electrodes were placed over the motor point of the medial gastrocnemius ( mg ) muscle of one leg . tissue oxygenation levels were estimated by quantifying changes in the t2 * signal in mr scans of the muscle in which an increase in the t2 * signal is attributed to an influx of oxygenated hemoglobin to the tissue . mr scans were acquired with a 1 . 5 tesla whole body siemens sonata scanner ( siemens medical solution , malvern , pa .) and a 27 - cm diameter transmit / receive knee coil circumscribing the lower leg . a custom - prepared multi - gradient - echo sequence ( tr = 51 . 8 ms , 8 tes ranging from 3 . 6 ms to 47 ms , single slice , 6 mm slice thickness , flip angle = 20 °, fov = 208 mm × 205 mm , readout matrix = 160 pixel × 158 pixel , in - plane resolution = 1 . 3 mm × 1 . 3 mm ) was utilized for all data acquisitions . baseline levels of oxygenation in mg were obtained as well as simultaneous measurements from the lateral gastrocnemius ( lg ), medial soleus ( ms ), and lateral soleus ( ls ) muscles for comparison . following the acquisition of baseline scans , successive scans were acquired immediately after 30 - s bouts of electrical stimulation delivered through the surface electrodes ( biphasic , charge - balanced , constant current , 70 ma , 250 μs , 50 pulses / s ). to mimic a simulated sitting position in which muscles are loaded ( e . g ., compressed and sheared ), albeit around the ischial tuberosities , a second experiment was performed on the gluteus maximus muscles to assess changes in oxygenation levels induced by ies on a loaded muscle . surface , non - magnetic electrodes were placed over the motor points of the left and right gluteus maximus muscles of an able - bodied volunteer ( male , 26 yr ). due to space limitations within the mri scanner , which prohibits volunteers from sitting upright , muscle compression during sitting was simulated by adding weight over the pelvis of the person lying supine inside a 1 . 5 tesla whole - body scanner . oxygenation measurements were obtained at : 1 ) rest , 2 ) with a 20 kg ( 30 % of body weight ) load applied over the pelvis , and 3 ) with a 20 kg load and ies applied simultaneously . surface coils placed below the subject and a multi - gradient - echo sequence ( tr = 90 . 3 ms , 20 tes ranging from 3 . 8 to 89 . 6 ms , single slice , 8 mm slice thickness , flip angle = 30 , fov = 223 mm × 397 mm , readout matrix = 72 pixel × 128 pixel , in - plane resolution = 3 . 1 mm × 3 . 1 mm ) were utilized for imaging the gluteus in the transverse plane . three successive 31 - s scans were acquired at rest to obtain baseline levels of oxygenation in the left and right gluteus maximus muscles . a 20 kg load was placed over the pelvic region to compress the gluteus muscles and 10 31 - s scans were acquired over a 10 - minute period of loading . subsequently , 6 31 - s scans were obtained each immediately following a 10 - s stimulus bout ( biphasic , charge - balanced , constant current , 70 ma , 250 its , 50 pulses / s , 3 - s ramp - up , 3 - s ramp - down ) applied every minute to the gluteus muscles with the load in place . the stimulation parameters utilized did not cause pain or discomfort to the volunteer . a region of interest ( roi ) was selected around each target muscle ( mg , lg , sm , and sl , or right gluteus maximus , and left gluteus maximus ) in each mr slice , and the t2 * levels in each roi were determined . the t2 * values were normalized to their corresponding baseline levels obtained at rest . the effects of ies - elicited contractions on muscle oxygenation were first tested in a condition where the muscle was at rest and unloaded . fig6 a summarizes the effect of ies on the level of oxygenation in the muscles of the lower leg . normalized t2 * levels in mg , lg , ls , and ms are shown . interestingly , ies selectively increased the t2 * level of mg , the stimulated muscle . this increase in oxygenation was maintained throughout the experiment . oxygenation levels in lg , ls , and ms did not show any change when compared to baseline measurements . the effects of ies - elicited contractions on muscle oxygenation were then examined where the muscles were loaded . these loaded muscles had a corresponding reduction in oxygen supply , a situation that represents the state of tissue around the ischial tuberosities in a seated individual . fig6 b summarizes the effect of ies on the level of tissue oxygenation in the gluteus maximus muscles in the presence of an external pressure . normalized t2 * levels in the right and left gluteus maximus muscles are shown for each condition tested ( rest , weight , weight + ies ). the oxygenation levels in both muscles decreased immediately by − 4 % after the load application ; oxygenation remained at this lower level throughout the 10 minutes in which this condition was maintained . following ies , the oxygenation levels in the muscles increased above the initial baseline levels by 6 %. in order to obtain insight into the effects of ies in reshaping the gluteus maximus muscles , and modifying the surface pressure profiles with each contraction , a second experiment was performed . the experiment was conducted in a male able - bodied volunteer , using the same testing conditions as those utilized in the first experiment to assess oxygenation levels in the gluteus maximus muscles : 1 ) rest , 2 ) weight , and 3 ) weight + ies . to elicit contractions in the left and right gluteus maximus muscles , surface electrodes were placed over the motor point of each muscle . the volunteer was placed in a supine position with the buttocks over an x - 3 system pressure sensitive mattress ( xsensor , calgary , ab , canada ). measurements of surface pressure in the sacral region of the buttocks were obtained over a 1 - minute period of rest . a 20 - kg load , equivalent to 30 % of the body weight of the volunteer , was applied over the pelvis to compress the tissue of the buttocks . surface pressure measurements were acquired for 1 minute under this condition . electrical stimulation was then applied simultaneously to both gluteus maximus muscles . a series of 3 15 - s stimulus bouts ( biphasic , charge - balanced , constant current , 70 ma , 250 μs , 50 pulses / s ) were applied with the load in place . changes in surface pressure associated with ies were measured during each bout of stimulation . in a third experiment ( fig6 c ) surface pressure measurements of the buttocks were obtained under the same three conditions previously tested ( rest , weight , weight + ies ). the average pressure throughout the buttocks at rest was 10 . 9 kpa , distributed over a 487 mm2 area . as expected , the region of highest pressure was that surrounding the bony prominence ( the sacrum in this case ), and exhibited an average pressure of 21 . 7 kpa . following the loading of the pelvis , the average pressure throughout the buttocks increased to 13 . 9 kpa and was distributed over a 511 mm2 area . the average pressure in the region around the sacrum increased to 25 . 8 kpa . simultaneous bilateral application of ies to the loaded ( compressed and sheard ) gluteus maximus muscles induced contractions which reconfigured the shape of the muscles . the average pressure throughout the buttocks became 14 . 3 kpa distributed over an area of 424 mm2 . however , the average pressure around the sacrum was reduced to 19 . 5 kpa , a level lower than that seen even during the rest condition . fig8 a - 8c illustrate an mri of the left and right gluteus muscles demonstrating the changes in muscle shape during contractions induced by electrical stimulation ( top ). they also show the redistribution of surface pressure ( middle ) and the increase in tissue oxygenation ( bottom ) during electrical stimulation . the present experiments outline in example no . 1 examined the efficacy of ies in preventing dti in a rat model and its mechanism of action in human volunteers . our results show , that within defined parameters of electrical stimulation , a considerable reduction in dti was observed . traditionally , tissue injury generated by ischemia following long periods of tissue compression , has been considered the principal etiological factor behind pressure ulcers . within this precept , more frequent stimulation should restore tissue oxygenation in the tissue to normal or near - normal levels , potentially eliminating tissue injury caused by ischemia . the finding that there was no significant difference between our experimental groups ( ies every 10 minutes vs . 5 minutes ) could indicate that the beneficial effects of an increase in oxygenation to the tissue may have reached their threshold when stimulation occurred every 10 minutes . it is possible that the amount of damage observed in both experimental groups could be attributed to damage generated directly by the high stress levels at the bone - muscle interface and excessive cell deformation , a factor that was further exaggerated in our experimental set up due to the fixation of the hind limb which led to an increase , rather than a decrease , in focal pressure during the ies - induced contractions ( evident in the increases in recorded force in fig1 b ). although the application of pressure to the rats &# 39 ; limbs was done outside the mri scanner , utmost care was taken in the placement of the indenter , such that it was as centered as possible over the qm and the femur . comparison of experimental group 3 and the contralateral control group demonstrated that the use of ies as frequently as every 5 minutes does not cause an increase in the water content of the muscle . the minimal amount of water content identified in the contralateral control group , as calculated in this study , indicates that 5 % of the tissue water content quantified in the control group and experimental groups 1 and 2 was not caused by the load application . it has been suggested that high stress levels at the bone - muscle interface is a primary factor in the development of pressure ulcers , but the extent of tissue injury that is associated with these mechanical forces ( shear and stress ) has yet to be determined . although complete elimination of dti has not been achieved , our results suggest that ies delivered every 10 minutes is sufficient to reduce greatly the extent of damage in deep tissue exposed to constant external pressure . none of the rats in this study showing indications of dti displayed injury to the overlying skin . this emphasizes that skin appearance is a poor indicator of deep tissue health , and supports the need for other alternative methods to detect dti . the results of this study show that mri is an effective tool for the detection of muscle edema associated with the presence of dti , even when injury occurs in muscles as small as those in the rat hind limbs ( fig3 a ). although mri currently may not be ideal for screening patients with dti due to cost and availability , in situations where an individual is considered to be at high risk of developing an ulcer or has a long history of ulcer development , it might be necessary to perform periodic screenings . identifying dti before it fully evolves into a pressure ulcer would not only have a significant beneficial impact on the health and quality of life of the individual , but could greatly reduce costs associated with further medical and surgical treatments . our results demonstrated that the levels of available oxygen in the tissue of gluteus maximus were reduced immediately after compressing the muscles ( fig6 a - 6 c ). however , instantly following the first ies induced contraction of the muscles , the levels of tissue oxygen increased . this increase was greater than baseline levels , and was most likely caused by reactive hyperemia , a process in which there is an increase in blood flow into the capillaries after brief periods of occlusion . this increase in oxygenation was maintained after each of the 6 ies induced contractions . while oxygenation levels in the unloaded medial gastrocnemius muscle also increased with ies , the increase was less than that in the gluteal measurements . this may be due to the fact that blood flow to the medial gastrocnemius muscle was not altered , and consequently oxygenation levels were already at normal levels . while periodical increases in tissue oxygenation should have the beneficial effect of negating tissue injury associated with ischemia - reperfusion , pressure relief is still needed to prevent further damage from persistent high stress levels of muscle cells . our results demonstrated that ies of the loaded gluteus muscles reconfigured the shape of the muscles and distributed the pressure laterally in the buttocks . the net result was a periodical relief of the superficial pressure around the bony prominence and reduction in the overall pressure throughout the buttocks . the use of superficial pressure measurements combined with recently developed finite element models of the gluteal muscles which can estimate the stress levels at the bone - muscle interface , could provide a more accurate tool for predicting the risk of developing dti . experiments were conducted in seated volunteers to evaluate the effect of various parameters of ies on : 1 ) the redistribution of surface pressure during contraction , 2 ) changes in the shape of the gluteus maximums muscles around the ischial tuberosities , and 3 ) changes in tissue oxygenation . surface pressure mats and magnetic resonance imaging ( mri ) techniques were used for the measurements . five able - bodied volunteers with intact spinal cord and four volunteers with spinal cord injury ( sci ) participated in the study . four ies patterns were tested between the two groups of volunteers as described in table 1 below . electrical stimulation was provided through surface electrodes placed on the motor points of the gluteus maximus muscles of both legs in all volunteers . redistributions in surface pressure with ies were assessed with the volunteers seated in a regular office chair ( intact ) or a wheelchair containing a standard pressure relief cushion ( sci ). a pressure mat containing a 36 × 36 array of sensors was placed between the volunteers and the sitting surface . a map of the surface pressure was obtained during the off period of ies and compared to that obtained during the on period . surface pressure was highest around the ischial tuberosities in both intact and sci individuals during the off period of ies . during the on period , contractions of the gluteus maximus muscles generated a redistribution in surface pressure in both intact and sci volunteers . there were decreases in surface pressure around the high - risk ischial tuberosity regions that are most susceptible to the formation of pressure ulcers . concomitant increases in pressure in the surrounding areas , low - risk regions , were seen . the redistribution in surface pressure produced by ies was quantified by comparing the changes in readings of each of the sensors embedded within the pressure mat during the stimulation on and off periods . fig1 shows a typical example of the distribution of sensors showing statistically significant changes in pressure readings between the on and off periods of ies . sensors with a significant reduction in pressure readings during the on period of ies relative to the off period are shown in white , those with a significant increase are shown in grey , and those with no significant change are shown in black . during the on period of ies , significant reductions in pressure were obtained around the ischial tuberosities in both able - bodied and sci volunteers , regardless of the sitting surface ( regular chair vs . wheelchair with pressure relief cushion ). during these experiments , able - bodied volunteers as well as those with sci who had some preserved sensation around the gluteal region ( n = 2 ) reported that ies relieved their discomfort due to long durations of sitting . furthermore , the relief was sustained for several minutes after the on period of ies . in comparison to standard clinical practices such as wheelchair push - ups , the volunteers reported that ies provided more relief of discomfort due to sitting and for longer durations . able - bodied volunteers preferred the continuous mode of stimulation during the on period of ies over the discontinuous patterns , even though they reported that both patterns produced a similar level of relief of discomfort due to sitting . because of their altered sensation , the sci volunteers could not subjectively compare the level of relief produced by the two durations of the continuous mode of stimulation during the on period of ies ( 7 vs . 13 seconds ). to investigate the changes in the shape of the muscle produced by ies as well as changes in oxygenation levels of deep tissue , the volunteers were transferred to a custom built mri - compatible apparatus . this apparatus positioned the volunteers in a manner that mimicked a sitting posture and produced similar surface pressure profiles to those obtained while sitting in a chair / wheelchair . fig1 provides t 2 − weighted mri scans which show the shape of the gluteus maximus muscles at rest ( off period of ies ) and during contraction ( on period of ies ) for able - bodied ( intact , left ) and injured ( sci , right ) volunteers . substantial changes in muscle shape were seen in the intact volunteers ( fig1 , left ). changes in muscle shape were also seen even in the much atrophied muscles of sci volunteers ( fig1 , right ). these changes explain the redistributions in surface pressure seen in fig1 , and demonstrate that redistributions in internal pressure are also obtained by ies . to assess the changes in tissue oxygenation , t2 * mri images were obtained and alterations in the signal intensity in the gluteus maximus muscles due to ies were quantified as previously described ( pages 31 - 32 , fig6 a , b ). fig1 summarizes the changes in tissue oxygenation ( mean ± standard deviation ) seen in intact and sci volunteers , and in response to the four ( 4 ) patterns of ies tested ( table 1 ). to compare the changes in oxygenation in response to contractions produced by ies and voluntary activation , the able - bodied volunteers were also asked to contract their gluteus maximus muscles voluntarily and to hold the contraction for 10 seconds ( mimicking the 10 sec on , continuous , ies pattern ). in all cases , significant increases ( anova , p & lt ; 0 . 05 ) in tissue oxygenation were seen following the on period of ies . these increases were at times more prominent than those produced by voluntary contraction . furthermore , the increases in oxygenation were sustained for up to 10 minutes ( longest ies off period tested to date ), which explains the sustained relief from discomfort reported by the volunteers during the surface pressure measurements described above . very importantly , the pattern of tissue oxygenation observed in volunteers with sci was similar to that seen in intact volunteers , despite their substantially atrophied muscles . while direct measurements of blood flow or oxygen were not obtained , the increases in oxygenation ( 1 - 3 % increase in t2 * signal intensity ) are estimated to reflect a 15 - 45 % increase in blood flow in the gluteus maximus muscles . some differences were observed in the level of tissue oxygenation produced by the various patterns of ies . first , the continuous pattern of stimulation during the on period of ies produced larger increases in oxygenation immediately following the cessation of stimulation compared to the discontinuous pattern . however , by 3 minutes within the off period of ies , the oxygenation levels were similar for both the continuous and discontinuous stimulation patterns . second , longer stimulation durations during the on period of ies produce larger increases in oxygenation immediately following the cessation of stimulation . however , by 2 minutes within the off period of ies , the oxygenation levels were similar for all durations of the on period of ies tested ( i . e ., 7 , 10 and 13 seconds ). third , the changes in tissue oxygenation produced by the discontinuous pattern of stimulation during the on period of ies were similar in profile to those produced by voluntary contraction . in conclusion , the experiments in the seated individuals ( intact and sci ) demonstrated that ies is an effective means for redistributing surface pressure , changing muscle shape , and producing sustained increases in deep tissue oxygenation . all tested patterns of ies were effective in achieving these outcomes . therefore , ies may provide a powerful means for prophylactically preventing the formation of pressure ulcers originating at deep bone - muscle interfaces . although the disclosure describes and illustrates various embodiments of the invention , it is to be understood that the invention is not limited to these particular embodiments . many variations and modifications will now occur to those skilled in the art of hardware . for full definition of the scope of the invention , reference is to be made to the appended claims .

US-201213550371-A

an external stent type prosthesis is provided that is extraluminal , with at least one tubular member , interconnectable in an upper end , and inflatable by a balloon with a central lumen , single but with multiple projections in equal plurality of tubular members of the stent which is adjusted in its interior , for side - to - side , end - to - end , end - to - side anastomosis without clamping and sutureless , or with expeditious clamping and sutureless , where the vascular graft , or anastomotic trunk , or any other grafts , inserted in the lumen of the balloon and prosthesis , comprising a distensible mesh and after being coated with graft , this mesh is expansible by the balloon until the necessary gauge to keep the graft wall joined together and sealed in relation to the organ wall , that can contain a bag suture around the place where the anastomosis is made .

with reference to the drawings , in which like reference numbers indicate identical elements throughout the several views , the figures illustrate one form of the present invention , in form of prosthesis for external stent type anastomosis , extraluminal , and the mesh types . fig1 illustrates external ‘ stent ’ type prosthesis , extraluminal , formed by a mesh 1 with drawing and varied sizes , insufflated by a balloon 2 , with predetermined maximum sizes . the balloon 2 also with lumen , is inserted in its interior , and insufflated with syringe 3 , or other method , under pressures controlled by the manometer 5 . fig2 illustrates the anastomotic aggregate represented by external stent 1 , balloon 2 with manometer 5 , and the graft 6 that passed through the balloon lumen 2 and recovered externally , the whole extension of the stent 1 , which was little and slightly dilated , assuming a form of an asymmetrical reel , with an internal flange slightly minor than the external . the graft is fixed to the stent 1 , in its external end , by some simple separated points . fig3 and fig4 illustrate the dilatation process of extraluminal the stent 1 and later removal of the balloon 2 . a technical achievement to its utilization in an end - to - side anastomosis , without clamping and sutureless , in any of the two or more tubular organs could be described as follows : the balloon 2 is softly inflated and it slightly dilates the stent 1 , opening the balloon 2 light . it passes through the balloon 2 light , and consequently the stent 1 , the graft 6 or anastomotic trunk ( diameter widening of any graft with its own segments longitudinally open , and can be in its whole extension or only in its end that covers the stent , or union , by an extraluminal suture , preferably , or any other method , of several ends of several grafts or in its whole extension ). the graft 6 or trunk is everted by total and external coating of the external stent 1 ( remaining on the top , because when the stent 1 is expanded , if the graft 6 is not suitably fixed , it can slip inward to a level next to the origin point of the anastomosis , it could be dangerous if the graft 6 of the stent 1 is released ). due to this fact , simple separated points shall be applied between the everted end of the graft 6 and the external end of the stent 1 . a suture is prepared in a bag , simple or double opposed ( preferably ), with seromuscular or total points . total points are safer in organs with calcified or friable walls 7 . besides fixating the organ layers among them , it also fixes any abnormal elements that are in its internal surface , such as atheromatous plates , thrombus , calcifications , avoiding thromboembolisms at the moment of the incision and introduction of the anastomotic aggregate . also , the wall 7 is more resistant to laceration . it is incised in the center of the suture in a bag , a temporary digital tamponade is made , the anastomotic aggregate is introduced , and the bag suture is slightly and externally adjusted . the balloon 2 is inflated until the total expansion of the stent 1 , which maximum expansibility is controlled by the diameter of the graft 6 or trunk that passed through its lumen . it is important to remark that in any moment , the expansion of the stent 1 by the balloon 2 , damages or put in risk the integrity of the inner layer of the grafts 6 , any of the kind . the balloon 2 compresses from inside to outward the stent 1 that will also compress from inside to outward , only the everted external surface of the graft 6 or trunk that was covered , as is easily perceived in the fig3 and fig4 . thus , the origin of the anastomosis stays intact , as it is mandatory . this not occurs in the existing stents , which are intraluminal and has contact with the fluid that flows . in this last case , besides the contact of the fluid with a foreign body that is the material of the stent , and also , its expansion , in 100 % of the cases , it can lacerate , cut and heavily damage the inner layer of the grafts , or organs . after reaching total expansion , or maximum expansion , it is joined until the two bag sutures are totally adjusted , opposed , externally to the anastomotic aggregate , adjusting organ wall 7 to it and assuring the inexistence of anastomotic leakages . the final form assumed can be of an asymmetrical reel , as presented in the fig4 , or even the external flange with a straight intraluminal tubular member in the external stents with only an intraluminal extension . fig5 a and details , illustrate a form of construction of the external stent 1 mesh that can be of just the joint 8 of the twisted , open or closed ends , with four little rods through a ring . this is in longitudinal multiple form and transversally in order to form a cylinder , in idling position , the rings are transversally next one another , and are distant when it is expanded . when it is the contrary , in longitudinal direction , when idling , they are distant and when expanded , they are nearer . therefore , the non expanded stent 1 has a minor gauge and greater extended and when expanded , it has more gauge and less extension . fig5 b and details , the joint rings are substituted by grooved microspheres 8 where the four rods with shape of halters are inserted , with massive spherical ends , which enter in the microspheres grooves of the joint . after the expansion by internal insufflation by the balloon 2 , the stent 2 has its diameter increased , reduces the extension and does not return spontaneously to its original form . fig5 c and details , present other form of connection 8 , this time by using two rings of different sizes and places , putting together also different parts of the same rod , witch are presented herein in ‘ v ’ form with flat vertex , once upward , once downward . the bigger ring ties - up transversally the twisted ends of four rods , and the minor ring ties - up only the flat vertex of two of these same rods , longitudinally . in the same manner , after the expansion through internal insufflation by balloon 1 , the diameter increases and the extension is reduced , and it does not return spontaneously to its initial form . fig5 d and details , differ from fig5 c only by changing the position of the ‘ v ’ form rods , which are laid transversally . the rings bind them equally in the same positions , the minor ring in the flat vertex , binding two rods , but transversally in this case , and the bigger ring , longitudinally binding the four twisted ends of four juxtaposed rods , two by two . in the same way , it does not return to the initial form after expanded . fig5 e and details , illustrate the mesh formed by the joint 8 of the two rods , multiple , longitudinally and transversally , by little rings , which when reach the maximum expansion present a four sided polygon format . they do not deform after expansion of internal insufflation by balloon 2 and do not return to the initial position . fig5 f illustrates other mesh in which the angles of the polygonal rods are joined - up 8 in a single piece , pre - molded , or by any mode , welding type , for example . in the same manner , it maintains its form after expanded . the rods also could be circular or semicircular with any configuration of the described joints . the stent 1 could also be prepared with a single twisted wire forming varied geometrical figures . if the external stent 1 has multiple intraluminal parts , as illustrated in fig8 , fig9 and fig1 , in variable forms and drawings , type , clover leaf shape , aligned , in square , rectangular , triangular etc ., and arranging several grafts isolatedly , but simultaneously , also has a balloon 2 equally with multiple extensions , as illustrated in fig6 , fig7 and fig1 , in equal number as the intraluminal parts , which will pass through by its lights , and also simultaneously are insufflated . the technical utilization can be exactly as described above , although other technical applications are possible . an important reason for preparing the prosthesis is that the intraluminal parts , which are separated from one another before expansion , is absolutely juxtaposed when insufflated and the everted parts of the grafts that cover them are firmly compressed one against the others . therefore , if there is no dead spaces among them , internally and externally , there will not be blood leakages or of any flowing fluids . one of the most important characteristics of these anastomosis , besides the absence of clamping or suture is that in any anastomosis , in which the graft 6 is everted , covering the intraluminal portion of the prosthesis and fixed by circumferential point or any method , there is no graft kinking , independently of its positioning and pressure it is submitted to . this is due to the fact that the grafts 6 were fixed distant from the local where they emerge in the prosthesis , being fully released inside the prosthesis . an end - to - end anastomosis without clamping and sutureless can be easily prepared , with two anastomotic aggregates represented by two stents 1 and two balloons 2 , with coated ends of any graft 6 . in the same manner , it makes the bag suture , double , in the side walls of the organ , in the places selected for anastomosis , introducing the aggregate and expanding the stent 1 by removing the 2 , and joining the bag sutures . the graft 6 is externally clamped , but the organ is not . with the same balloon 2 or other of identical of different sizing , depending on the other end to be anastomosed , after removing or cutting it ( if the prosthesis and balloons are previously mounted to the grafts , to remove them , it is necessary to cut them after tractioning them outwardly from the stent 1 and graft 6 ), mounting the second aggregate on the other end and performing the same procedure . the organ segment that was interposed in two anastomosis can be excluded by resection or simple circumferential ligaments , deviating all the fluid through the anastomosis that has been made . also a side - to - side anastomosis without clamping and sutureless can be prepared even by an endovascular or videoendoscopic procedure . with a graft of two external stent 1 type prosthesis in each end , the organs to undergo a side - to - side anastomosed can even be distant . it is identical to the procedure for end - to - side anastomosis ( and , in fact , there are two end - to - side anastomosis among the anastomotic aggregates and each organ ). fig1 , fig1 , fig1 and fig1 , illustrate an anastomosis with only one prosthesis , to tie together the adjacent organs in a side - to - side form . it will be completely coated with graft of any nature , which ends are in the middle , of each side of the perfusor 4 of balloon 2 , in this is case has a different shape and also is completely coated with graft , except its perfusor 4 , as shown in the fig1 . the balloon 2 has a virtual groove before its insufflation . the graft 6 passes by its light keeping it more closed still in order to avoid the bleeding or leakage of any fluid , as shown in the fig1 . one of the ends of the prosthesis , balloon 2 e graft 1 , are introduced on the side of the organs , and the bag suture is slightly pressed , as described . the bag suture wire can transfix the graft that coated the stent 1 , to avoid its displacement before the insufflation . as mentioned , there is no bleeding or leakage of any fluid . the other graft 6 is incised also in the center of the double ball suture , the other end of the anastomotic aggregate is introduced and the bag suture is equally and slightly adjusted . with the help of an assistant holding the bag sutures , the surgeon inflates the balloon 2 that distends the external stent 1 , until the desired limit , permeabilizing the graft 6 by which the fluid will pass through . the bag sutures are definitely joined , as illustrated in fig1 . at last , the balloon 2 is deinflated and aspirated until its total collapse , in order to occupy the minor possible area and , keeping it where it , as represented in the fig1 . here lies then the importance of the balloon 2 constituted of thinner and resistant walls as possible , and biocompatible material , in order to resist to high pressure of insufflation as soon it is aspirated , to not represent a remarkably loss of internal diameter of the anastomosis . thus , what keeps the anastomosis open until it reaches the previously determined maximum diameter in the stent 1 , which once expanded , changes its shape , diminishes the extension and increases its diameter and does not collapses spontaneously .

US-30365007-A

an endodontic file including a discontinuity formed within the file shank . the discontinuity creates a safe breakage point at which the file will fail prior to a failure occurring at any other point along the length of the file . the safe breakage point prevents the tip of the file from becoming irremovably embedded in a human tooth after file failure . substantially the entire length of the file remains connected to the tip after file failure , thereby providing a considerable portion of the file which may be gripped and manipulated in order to accomplish file removal . empirical data is presented to permit proper characterization of the region surrounding the discontinuity .

referring to fig1 , a rotary endodontic file 6 is illustrated . the file 6 is composed of a metallic material and includes an elongated tapering shank 7 . the file 6 is typically fabricated from a nickel - titanium alloy known by the trade name nitinol or by its scientific formula niti . files composed of nickel - titanium possess superior flexibility , torsional and fracture resistance properties as compared to the previous industry standard stainless steel files . the upper region 8 of the shank 6 is adapted to fit within a handle designed to be directly gripped by a chuck employed by a power driven rotary tool . the lower region 9 of the file shank is formed to include some type of cutting , abrading or shaping protrusion , ridge or edge 10 . the length 11 of the lower region 9 typically occupies most of the length of the tapering shank 7 . referring also to fig3 , the use of the rotary file 6 can be understood by viewing the partial cross section of a tooth 12 . the tooth 12 includes a supporting root structure 13 . within each root 12 is a channel or root canal 14 . the root canal 14 of the tooth 12 houses the circulatory and neural systems of the tooth . these enter the tooth 12 at the tip 15 of each of its roots 13 and extend through the narrow , tapered canal 14 until reaching the pulp chamber 16 that is adjacent to the crown portion 18 of tooth 12 . when the pulp tissue becomes diseased or injured the tooth 12 can generate severe pain , sometimes necessitating extraction of the tooth . root canal therapy involves removing the diseased tissue from the canal 14 and sealing the canal system in its entirety . if successful , root canal therapy can effectively alleviate the pain and hence the tooth need not be extracted . the first step in performing a root canal procedure is to drill into the tooth 12 and locate the root canal 14 . the dentist next uses the rotary file 6 to remove the decayed tissue from the canal 14 . the primary goal is to remove all of the decayed material within the canal 14 while leaving the root canal walls 17 relatively unaffected . preserving the structural integrity of the root canal 14 is important in order to allow proper filling of the root canal and to prevent leakage between the root canal system and the surrounding tissues of the tooth 12 . after the diseased material is removed from the root canal 14 , it is closed with a sealing material such as gutta - percha which is compressed into the canal 14 by means of a suitable condenser instrument . the root canals 14 are not necessarily straight and are often curved . clearing decayed tissue from the canal 14 must be achieved while preserving its original shape . stainless steel instruments tend to straighten or otherwise alter the natural shape of the canal 14 . this problem is exacerbated when the opening of the root canal 14 is small , as often occurs due to calcified deposits on the root canal walls . while the highly flexible nickel - titanium alloy files 6 offer superior flexibility and torsional properties as compared to stainless steel instruments , the nickel - titanium files are more prone to breakage or separation . the solution to the breakage problem is to form a weakened area or discontinuity 18 within the shank 7 . the optimum distance 20 between the location of the discontinuity 18 and the plane of engagement 19 at which the handle or chuck grips the shank 7 is in the range of approximately one to two millimeters . the selection of distance 20 within this range preserves enough of the remaining length of shank 7 to permit removal of the shank 7 from a chuck or handle . the portion of the shank 7 extending from the canal 14 is sufficient to permit removal of the shank from the tooth 12 . further , due to the low modulus of elasticity of the nickel - titanium alloy , the tip 21 does not lock tightly into the canal 14 . referring also to fig2 , the dimensions and shape of the discontinuity 18 are critical to the functioning of the present invention . however , these parameters cannot be specified directly for every file . rather , the optimum torque value that results in failure of the file 6 at the discontinuity 18 can be measured for any given file geometry , and the discontinuity can be fashioned by any convenient means in order to achieve failure at the desired torque value . the discontinuity 18 may therefore take the shape of a notch as shown in fig2 , or may be an annular groove , a helical groove , or a simple orifice passing through the shank 7 . weakening of the shank can also be achieved by other means , such as the addition of radial lands or cutting flutes above the normal file cutting and shaping region 11 , exposing the region 18 to a laser bean , compressing or pinching the shank 7 , or forming the shank 7 to have a negative taper within the two millimeter region defined by region 20 referring also to fig4 , a test fixture 34 is depicted which permits the determination of torque values as applied to the file 6 . clamp 22 grips the file 6 in a manner simulating the mounting of the file in a conventional drill chuck 23 , leaving the discontinuity 18 exposed . the chuck 22 is affixed to an axle or shaft 24 that is supported by a bearing 25 . handle 26 is rigidly affixed to the shaft 24 and permits manual rotation of the shaft 24 and hence the file 6 . as seen in fig5 , the shaft 24 can be advanced in the direction of arrow 27 , permitting the file 6 to be securely gripped by vise 28 . the vise is attached to a torque measuring instrument 29 that resists rotation of the file 6 that is induced by rotary manipulation of the handle 26 . the file 6 may be rotated until the file separates , and the torque value associated with this failure can be recorded . the nature of the discontinuity 18 may be altered to achieve a torque value that permits the file 6 to perform useful work while failing at the location of the discontinuity prior to a file failure at any other location . referring also to fig6 , the relationship between the size of the discontinuity 18 and the torque value that causes the failure to occur is depicted . the particular file tested in order to produce the graph 30 is a series 29 , size 30 file having a length of 21 mm and a taper of 0 . 04 , manufactured by the tulsa dental company of tulsa , okla . for each file tested in the fixture 34 without the presence of discontinuity 18 , the tip 21 will fail at some torque value for any given file diameter . the presence of the discontinuity 18 must therefore induce a failure of the file 6 to occur at the discontinuity 18 at a lower torque value , meaning that the discontinuity 18 must leave a remaining diameter of shank 7 which is less that the diameter which supports a torque value that permits fracture or separation of the file 6 in the region of tip 21 . table i depicts an example of data gathered for a given file , and demonstrates that the remaining diameter of shank 7 should not exceed 0 . 57 mm in order to prevent file deformation and tip failure while insuring a reliable failure at discontinuity 18 . table i remaining diameter of shank 7 ( in mm ) after condition of file 6 after formation of discontinuity 18 application of excessive torque 0 . 54 separation at discontinuity 0 . 55 separation at discontinuity 0 . 57 separation at discontinuity 0 . 58 file deformed 0 . 59 file deformed 0 . 60 file deformed 0 . 62 file deformed 0 . 63 file deformed 0 . 64 file deformed 0 . 66 file deformed 0 . 67 file deformed 0 . 68 separation at discontinuity 0 . 69 failed 2 mm from tip 21 the various data points 31 , 32 and 33 , for example , illustrate that larger diameters remaining after the formation of discontinuity 18 within shank 7 require larger torque values to induce a failure , which is a natural result of the greater cross sectional area of the larger diameter shank 7 . the curve 30 demonstrates that for any given file diameter that remains after the formation of discontinuity 18 , there is an optimum torque value at which the discontinuity will fail . for example , for a file diameter of approximately 57 mm , the torque value at which the file 6 should fail is approximately seven ounce - inches . in other words , if the discontinuity 18 induces failure at the optimum torque value , the file 6 will not fail at or near the tip 21 at a higher torque value . a curve 30 must be constructed for each particular file and discontinuity corresponding to each desired size and geometry in order to identify the optimum torque value associated with that particular file . while the characteristics of the discontinuity 18 may be determined empirically , another novel aspect of the present invention is a formula to create a file specific safe breakage point 18 regardless of the particular design or manufacturer of the file . virtually all real world dental files conform to some standards . for example , a size 30 file having a 0 . 04 taper defines the file 6 as being twenty hundredths of a millimeter in diameter at the tip 21 . the taper specification indicates that the file diameter increases by four percent over the tip 21 diameter as one travels in the direction of the shank 7 . in order to create a functional safe breakage discontinuity 18 , the diameter of shank 7 must be reduced to the value of the file diameter at a distance of four millimeters from the file tip 21 . thus , for a size 20 file having a 0 . 04 taper , the effective diameter of the shank 7 in the region of the discontinuity 18 is approximately 0 . 36 millimeter . stated for the general case , the formula is : sbp is the effective diameter , in millimeters , of the shank 7 in the region of discontinuity 18 ; ts is the diameter of tip 21 , in millimeters ; t is the taper of the file 6 ; and v is a variable that must be determined empirically due to variations in file configurations and uncertain characteristics of root canal 14 . the test fixture 34 is used with a hydrated extracted human tooth 12 placed in the clamp 22 . the canal 14 is accessed and prepared along its entire length with a no . 10 hand file having a 0 . 02 taper . a discontinuity 18 is formed in the particular file 6 for which the safe breakage point is to be determined , and the file 6 is overstressed until deformation of the file or file separation occurs . this process is repeated until an optimum value for the shape and dimensions of discontinuity 18 is determined for the particular geometry of a specific file 6 . while the foregoing description describes the preferred embodiment of the present invention , many obvious modifications may be made by those having skill in this field of endeavor . the true scope of the present invention is defined solely by the appended claims .

US-83679304-A

a balloon dilatation catheter is provided with a pleated balloon defining at least three pleats and alternating wings . when the balloon collapses , it tends to assume a pleated configuration which defines a lower profile and is better adapted to pass through narrow channels , such as a guide catheter . the balloon is formed from a polymeric material in a method that involves the steps of extruding a tube having at least three circumferentially spaced , longitudinally extending segments of less wall thickness than the remainder of the tube , and biaxially stretching the tube to a predefined shape while maintaining the longitudinal segments of reduced wall thickness .

fig2 illustrates , diagrammatically , the cross - sectional configuration assumed by a typical dilatation balloon 10 when the balloon is aspirated by applying negative pressure to the balloon interior , causing it to deflate . balloon 10 forms a pair of diametrically opposed wings 12 as the balloon collapses . the physician typically must manually wrap the wings 12 about the catheter shaft 16 , creating a low profile configuration which permits easy insertion of the dilatation catheter into the lumen of a guide catheter . difficulty may arise , following the dilation procedure , either when it is desired to withdraw the dilatation catheter through the lumen of the guide catheter or when it is desired to deflate the balloon and reposition it at another vascular location to perform another dilatation . in particular , the diametrically opposed wings 12 may not wrap closely about the catheter shaft as the catheter is withdrawn back into the guide catheter or is repositioned within the arteries . instead , the wings may catch on the distal opening of the guide catheter or may preclude reinsertion of the balloon into another stenosis . in accordance with the present invention , a deflated dilatation balloon has a low profile configuration having at least three pleats and alternating wings . when such a balloon is collapsed , each of the wings is relatively short , in its radial extent , and collapses more readily about the catheter shaft . when inflated , the balloon assumes a cylindrical configuration . in accordance with one embodiment of the present invention , as shown in fig1 and 3 , a dilatation catheter 14 includes an elongate flexible shaft 18 having a dilatation balloon 20 carried at the distal end of the shaft . an inflation lumen 22 extends through shaft 18 from the proximal to the distal end and is in fluid communication with the interior of balloon 20 . the proximal end of the shaft ( not shown ) is adapted to be connected to a suitable fitting , such as a luer fitting , by which an inflation / deflation device such as a syringe may be connected . shaft 18 may be formed from an appropriate polymeric material as will be appreciated by those familiar with the art . dilatation balloon 20 includes an elongate cylindrical portion having a pair of tapered conical sections 24 and 26 at its distal and proximal ends , respectively . a distal collar 28 and a proximal collar or an elongate sleeve 30 extend from conical ends 24 and 26 , respectively . the dilatation balloon may be formed from a polymeric material such as polyethylene terephthalate and may be formed in accordance with the method of the present invention , as described hereinafter . proximal sleeve 30 is adhesively attached to the distal end of shaft 18 as shown in fig1 . a support wire 32 extends through lumen 22 , the interior of balloon 20 , and distally therebeyond . the annual space surrounding support wire 32 provides an annular inflation / deflation lumen in fluid communication with the interior of balloon 20 . the support wire 32 has a tapered distal tip which extends into and is attached to a helically - wound radiopaque coil 34 . coil 34 has a distal tip 36 terminating with a rounded weld bead 38 . the distal collar 28 of balloon 20 is adhesively attached to the proximal end of coil 34 , as shown in fig1 . the distal tip 36 of coil 34 may include a bendable , stainless steel shaping ribbon 40 , which is secured to the distal tip of support wire 32 at one end and to weld bead 38 at the other end . catheter 14 may include a radiopaque marker band 42 , securely attached to support wire 34 , near the proximal portion of balloon 20 . the marker band provides a means by which the physician can fluoroscopically verify the position of balloon 20 . fig3 is a sectional illustration of the dilatation balloon 20 as seen along lines 3 -- 3 of fig1 . by way of example , in a catheter adapted for coronary arterial use , the balloon of the dilatation catheter illustrated may have an inflated diameter of between 1 . 5 mm to 4 . 0 mm . the cylindrical midportion of balloon 20 may be 2 cm long . the end cones 24 and 28 may be about 4 to about 7 mm long . it should be understood , however , that the invention contemplates use in dilatation balloons other than for coronary angioplasty use and that the dimensions of such other balloons may vary from those illustrated and described herein . the wall of balloon 20 is relatively thin . by way of example , for a balloon having an inflated diameter of 3 . 0 mm , an appropriate wall thickness would be between about 0 . 00025 &# 34 ; to about 0 . 00050 &# 34 ;. the cones 24 , 26 and collars 28 , 30 may be thicker because they are expanded to a lesser degree than the cylindrical midportion of the balloon during the balloon fabrication process , discussed below . as shown in fig3 balloon 20 has a plurality of circumferentially spaced lines 44 of reduced wall thickness . lines 44 extend longitudinally of balloon 20 , as shown in phantom in fig1 . for a dilatation balloon of about 3 . 0 mm diameter having a wall thickness from between 0 . 00025 &# 34 ; to 0 . 00050 &# 34 ;, the wall thickness at lines 44 may be approximately 0 . 00025 &# 34 ;. lines 44 extend longitudinally of balloon 20 from distal collar 28 to proximal sleeve 30 . when balloon 20 is deflated by aspirating inflation lumen 22 , the balloon collapses more easily along the lines 44 to create a substantially reduced profile characterized by three pleats 46 disposed intermediate three wings 48 . it will be appreciated that the radial extension of each of the wings 48 of balloon 20 is considerably less than the radial extension of wings 12 in the unpleated balloon of fig2 . the reduced profile assumed by balloon 20 upon evacuation not only minimizes the necessity for the balloon to be wrapped prior to insertion into the guide catheter , but substantially reduces the chance of damage to the balloon wall upon withdrawal through a guide catheter . it increases the ability of the deflated balloon to pass through tight stenoses . the reduced profile of balloon 20 prevents the balloon from being caught at the distal end of a guide catheter and substantially reduces the surface area of the balloon which is in contact with the guide catheter lumen during withdrawal . fig5 and 6 show alternate embodiments of the pleated dilatation balloon of fig4 . in fig5 a pleated balloon 50 has a collapsed configuration about catheter shaft 52 which is characterized by four pleats 56 disposed intermediate wings 58 . the folding of balloon 50 into the illustrated configuration results from four lines of reduced wall thickness formed along the balloon . similarly , as shown in fig6 a five pleat balloon 60 has a collapsed configuration about catheter shaft 62 which is characterized by five pleats 69 intermediate five wings 68 . from a comparison of fig4 and 6 , it can be appreciated that the profile of the pleated balloon decreases as the number of pleats increase . generally , the larger the diameter of the balloon , the greater the number of pleats which may be formed into the balloon . a further advantage of the present invention is that the lines extending longitudinally of the balloon may be manufactured to provide a minimum burst strength for the balloon . presently , if a balloon does not deflate when desired , a practitioner may over inflate the balloon to intentionally rupture the balloon wall , causing immediate deflation of the balloon and enabling withdrawal of the balloon from the lumen . lines 44 of fig3 may be formed so as to serve as rupture points which would insure that the burst pressure of balloon 20 would not exceed the delivery capability of a selected clinical inflation device . a pleated balloon in accordance with the present invention may have a minimum burst pressure of 16 to 18 bars compared to the more than 20 bar minimum burst pressure of some dilatation balloons . the invention is also useful in balloons where the nature of the material or balloon geometry is such that the balloon is susceptible to damage from handling and use . in some instances , it has been the practice to thicken the wall of such a balloon in order to make it more resistant to damage . an undesired by product of such a thickened balloon wall , however , may be that the burst pressure is increased far beyond that needed for the intended application . with the present invention , such a balloon may have the increased wall thickness while maintaining an acceptable burst pressure . a method for making a pleated balloon in accordance with the present invention involves extruding a tube of polymeric material , such as polyvinyl chloride , polyethylene , or polyethylene terephthalate so as to have at least three circumferentially spaced elongated segments of less wall thickness than the remainder of the tube . as shown in fig7 a tube 60 is formed of relatively thick wall portions 63 , 65 and 67 which are disposed intermediate relatively thin walled portions 62 , 64 and 66 . in the fig7 embodiment , thin walled portions are defined by chordal flats formed in an angular spacing of 120 ° circumferentially about the tube . each of the flats may define a chord corresponding to approximately 10 % of the outer circumference of the tube . by way of example , for a polyethylene terephthalate tube intended to be formed into a 3 . 0 mm diameter balloon , the tube may have an inner diameter of about 0 . 0169 &# 34 ;, having thick walled portions of about 0 . 0050 &# 34 ;, the thin walled portions of the tube should be about 0 . 0038 &# 34 ;. the thin walled portions 62 , 64 and 66 are implemented as thin lines which extend longitudinally of the extruded tube 60 . a balloon formed from tube 60 preferentially collapses at thin walled portion 62 , 64 and 66 while the thick walled portions 63 , 65 and 67 project radially outward to form the wings . following extrusion of tube 60 , the tube is then blow molded in accordance with the techniques disclosed in u . s . pat . no . 4 , 490 , 421 , and u . s . patent application ser . no . 001 , 759 , filed jan . 9 , 1987now abandoned , the disclosures of which are incorporated herein by reference . once tube 60 has been extruded , the tube is inserted into a mold chamber . upon heating the chamber , the tube is heated by convection and radiation thereby softening the tube material . it will be appreciated that certain polymeric materials do not require heating to soften the tube material . tube 60 is then axially stretched while positive pressure is simultaneously applied to the interior of the tube . the radial expansion , caused by the positive pressure on the tube interior , during axial stretching establishes biaxial stretching of the tube . the biaxial stretching is maintained until the tube assumes the shape of the mold . it should be noted that the cones and neck portions of the balloon also are formed from the tube 60 having alternate thick and thin wall portions . as a result , the cones 24 , 26 of the balloon also define a pleated arrangement and will tend to collapse into the pleated configuration when the balloon is aspirated . this may effectively reduce the angle made by the cone and may facilitate entry of the balloon into a tight stenosis . additionally , by including the pleats in the cone regions , it may be possible to form balloons in which the cone regions fold down closely to the shaft . from the foregoing , it will be appreciated that the invention provides a dilatation balloon having a tendency to collapse into a pleated configuration forming at least three or more pleats and alternating wings , the radial extension of such wings being relatively small . the pleated balloon folds more easily as it is withdrawn through the guide catheter . thus it will be appreciated that the invention provides a new and improved pleated balloon configuration for a dilatation catheter by which the balloon may be more readily contracted to a low profile , as well as a method for forming such a pleated balloon . it should be understood , however , that the foreqoinq description of the invention is intended merely to be illustrative thereof and that other modifications in embodiments may be apparent to those skilled in the art without departing from its spirit . for example , the invention has been illustrated in connection with a coronary dilatation catheter , it may be used with other balloon catheters such as peripheral blood vessel dilatation catheters or esophaqeal catheter . additionally , although the illustrative embodiment has been described in connection with a balloon made from polyethylene terephthalate , which is relatively inelastic , ( non compliant ) the invention also may be incorporated in balloons formed from more compliant materials , such as polyvinyl chloride or polyethylene .

US-95645492-A

the invention relates to a sensor for in vivo measurements comprising a planar substrate , and a sensor shaft bearing several electrodes , and a sensor head for connecting the sensor , wherein the sensor head has metal surfaces as contact fields for contact making , which are connected to the electrodes by way of conductor paths . the sensor head protrudes laterally to the sensor shaft so that the contact fields are arranged laterally from the sensor shaft , whereas the conductor paths extend in parallel on the sensor head transversely to the longitudinal direction of the sensor shaft . also disclosed is a system having a sensor as just described and a suitable plug connector therefor .

the embodiments described below are not intended to be exhaustive or to limit the invention to the precise forms disclosed in the following detailed description . rather , the embodiments are chosen and described so that others skilled in the art may appreciate and understand the principles and practices of these teachings . the sensor for in - vivo measurements shown in fig1 to 4 has a flat substrate 1 that forms a sensor head 1 a and a sensor shaft 1 b that originates on the sensor head 1 a . the sensor shaft 1 b bears electrodes 2 for electrochemical measurements which each are connected through strip conductors 3 to contact fields 4 that are arranged on the sensor head 1 a . the substrate 1 is planar . therefore , the sensor shaft 1 b and the sensor head 1 a have a coplanar surface , or two co - planar surfaces to be more precise , namely the top side and the bottom side of the substrate 1 , since the substrate 1 was cut from a sheet of plastic . in a lateral view , i . e . with a viewing direction perpendicular onto the narrow sides of the sensor , the sensor therefore appears as a straight strip as is shown in fig3 . the sensor head 1 a sticks out from the sensor shaft 1 b on the side such that the contact fields 4 are arranged lateral to the sensor shaft 1 b and the strip conductors 3 on the sensor head 1 a extend next to each other transverse to the longitudinal direction of the sensor shaft 1 b . in order to connect the sensor to a measuring device , the sensor head 1 a with the contact fields 4 can be plugged into a matching socket . advantageously , due to the arrangement of the contact fields 4 , the plugging motion that is thus required proceeds transverse with respect to the longitudinal direction of the sensor shaft 1 b . a motion of said type is easy to perform by a user . it allows , in particular , any risk of the sensor being pressed more deeply into the body and unnecessary pain being caused thereby to be prevented . if the substrate is thin and therefore flexible , plugging a socket onto the sensor head 1 a may be difficult for some users . as a remedy , the manufacturer can arrange the sensor head 1 a in a support part , which , together with the sensor head 1 a , forms an electrical plug connector whose connecting direction , i . e . the plugging direction , in which a matching plug connector needs to be moved in order to connect it , extends transverse with respect to the longitudinal direction of the sensor shaft 1 b . an embodiment example of a sensor having a support part 7 of this type is shown in a lateral view in fig7 and in a sectional view in fig8 . fig9 , in addition , shows a plug connector 9 that matches the plug connector formed by the support part 7 and the sensor head 1 a , and , together with the sensor , forms a system . the plug connector 9 has spring - actuated mobile line contacts 10 that extend in the plugging direction and contact one of the contact fields 4 of the sensor each when the plug connection is closed . the sensor head 1 a can form a plug connector on its own or in conjunction with a support part 7 . accordingly , regardless of the presence or absence of a support part , the sensor head 1 a can be electrically connected to a measuring device by means of a plug connection . in this context , the contact fields are arranged on the sensor head in such a manner to ensure that a plug connector for connecting the sensor to a measuring device can be plugged onto the sensor shaft 1 b only by means of a plugging motion that proceeds transverse with respect to the longitudinal direction . the plugging direction defined by the arrangement of the contact fields 4 on the sensor head 1 a forms an angle α with respect to the longitudinal direction of the sensor shaft 1 b . the contact fields 4 are arranged next to each other in a row on the plug part 1 a . the plugging direction is transverse to the direction of the row . the row of contact fields 4 forms an angle β that is drawn in fig2 with respect to the longitudinal direction of the strip - shaped sensor shaft 1 b . in the embodiment shown , the angle α deviates by 20 ° to 70 °, in particular by 30 ° to 60 °, from a right angle ; i . e . it is 20 ° to 70 °, in particular 30 ° to 60 °, in the case of an acute angle or it is 110 ° to 160 °, in particular 120 ° to 150 ° in the case of an obtuse angle . in the embodiment shown , the angle α is an acute angle . however , the sensor head 1 a can also protrude from the sensor shaft 1 b on the opposite side , as is shown in fig6 . in this case , the angle α is an obtuse angle . the angle β also deviates by 20 ° to 70 °, for example 30 ° to 60 °, from a right angle in the embodiments examples shown . the sensor head 1 a has lateral lead - in chamfers 6 that simplify for a user the process of plugging - on a coupling part that is not shown here or simplify the plugging - on of a support part 7 shown in fig7 and 8 during manufacture . said lead - in chamfers 6 are arranged on opposite side edges of the sensor head 1 a . due to the lead - in chamfers 6 , the width of the sensor head 1 a decreases towards the front end onto which a plug connector is plugged in order to connect the sensor . the substrate 1 can be coated with metal much like a circuit board in order to provide strip conductors 3 and contact fields 4 . the contact fields 4 are preferably provided to be elongate and extend transverse with respect to the longitudinal direction of the sensor shaft 1 b such that the longitudinal direction of the contact fields coincides with the plugging direction in the embodiment shown . advantageously , the reliability of an electrical contact that is established by means of the contact fields 4 can thus be increased . in the embodiment shown , a working electrode , a counter - electrode , and a reference electrode are present , whereby there is no absolute need to have a reference electrode present . said electrodes 2 are arranged on the same side of the substrate in the embodiment shown . however , as a general rule , it is feasible just as well to arrange one or more electrode ( s ) on the opposite side of the substrate , i . e . its rear side , for example in order to implement a particularly compact design . however , the rear side of the substrate can just as well be utilized to arrange further electrodes there . apart from this , it is feasible just as well to arrange multiple working electrodes on one side of the substrate 1 . this allows a sensor to be generated that has measuring sensitivities that are matched to different concentration ranges or can be used for measurements on different analytes . the electrodes 2 are schematically shown to be rectangular in the figures , but can in fact be of any shape . the substrate 1 can be manufactured inexpensively from plastic material , for example by cutting it from a sheet . for this reason , the substrate 1 is planar and has a rectangular cross - section as is evident from the lateral view shown in fig3 . in the embodiment shown , the sensor head 1 a and the sensor shaft 1 b have the same thickness . however , it is feasible just as well to provide the sensor head 1 a and / or a part of the sensor shaft 1 b that is adjacent to the sensor head 1 a to be somewhat thicker than the part of the sensor shaft bearing the electrodes 2 . by this means , the stability of the sensor can be increased such that a plug connection can be closed more easily even in the absence of a support part 7 surrounding the sensor head 1 a . the sensor head 1 a can advantageously be provided to be elongate in shape in order to make it easier to plug - on a coupling part in order to connect the sensor to a measuring or analytical device or to plug - on a support part 7 . in the embodiments shown , the sensor head 1 a and the sensor shaft 1 b , which extends straight , form the angle α . the sensor includes a cannula 5 that can be used to insert the electrode system that is arranged on the sensor shaft 1 b into the body of a patient for transcutaneous measurements . the cannula 5 has a slit that extends along its longitudinal direction and in which the sensor shaft 1 b is arranged to be upright . as is shown , in particular , in fig4 , the sensor shaft 1 b of the embodiment shown has a width that is larger than the internal diameter of the cannula 5 such that the sensor shaft 1 b protrudes from the slit . however , it is feasible just as well for the width of the sensor shaft 1 b to be smaller than the diameter of the cannula . since the substrate 1 is arranged to be upright in the slit , one narrow side of the substrate 1 faces the internal surface of the cannula that is situated opposite from the slit on the inside of the cannula 5 . the opposite narrow side of the substrate 1 , i . e . of the sensor shaft 1 b that is provided in the form of a strip to be more specific , faces away from the cannula 5 . fig5 shows the distal end of the cannula 5 . as shown in the figure , the cannula 5 has a slanted end that ends in a tip . in this context , the slit is arranged on the side of the cannula that is opposite from the side comprising the tip . in use , the sensor can be secured to a carrier unit 8 that is glued to the body of a patient . an example of a carrier unit 8 of this type is shown in fig1 . advantageously , a measuring unit supplying electrical current to the sensor by means of a plug connection can also be secured on a carrier unit of this type . while exemplary embodiments incorporating the principles of the present invention have been disclosed hereinabove , the present invention is not limited to the disclosed embodiments . instead , this application is intended to cover any variations , uses , or adaptations of the invention using its general principles . further , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims .

US-201113333153-A

a partition panel system including a partition frame with vertically spaced horizontal frame members defining first discrete attachment locations , a pair of horizontally spaced blades adjustably attached to selected ones of the first discrete attachment locations , the blades including opposing inner surfaces defining vertically spaced second discrete attachment locations , and shelves adjustably attached to selected ones of the second discrete attachment locations . this allows the shelves to be horizontally and vertically adjustably supported on the partition frame in a selected one of a variety of positions . at least one shelf has a front portion with edges that extend partially around in front of the blades , thus providing increased surface area . the shelves are supported on the blades by shelf supports . connectors on the ends of the shelves are movable between engaged and disengaged positions for securely engaging the shelf supports . antidislodgement brackets are provided on the blades that are movable between locked and unlocked positions , the antidislodgement brackets when in the locked position securing the blades to the horizontal frame members . in one form , the blades and shelf form an assembly comprising a binder bin , which includes a closeable door guided by tracks attached to sides of the binder bin .

for purposes of description herein , the terms &# 34 ; upper &# 34 ;, &# 34 ; lower &# 34 ;, &# 34 ; right &# 34 ;, &# 34 ; left &# 34 ;, &# 34 ; rear &# 34 ;, &# 34 ; front &# 34 ;, &# 34 ; vertical &# 34 ;, &# 34 ; horizontal &# 34 ;, and derivatives thereof shall relate to the invention as oriented in fig1 . however , it is to be understood that the invention may assume various alternative orientations and step sequences , except where expressly specified to the contrary . it is also to be understood that the specific devices and processes illustrated in the attached drawings , and described in the following specification are simply exemplary embodiments of the inventive concepts defined in the appended claims . hence , specific dimensions and other physical characteristics relating to the embodiments disclosed herein are not to be considered as limiting , unless the claims expressly state otherwise . the reference numeral 1 ( fig1 ) generally designates a partition panel system embodying the present invention , which is particularly designed for use in open office plans , and other similar settings and environments . in the illustrated example , partition panel system 1 includes a partition frame 2 ( fig1 b , 1c ) with vertically - spaced horizontal frame members 3 and 4 , each of which includes a row of first discrete attachment locations such as slots 5 , 6 . with reference to fig2 the partition panel system also includes a pair of horizontally - spaced blades 7 that are releasably attached to selected ones of the upper and lower rows of slots 5 , 6 . the blades include opposing inner surfaces 8 that define vertically - spaced second discrete attachment locations such as hanger slots 10 . at least one shelf 20 is releasably attached to selected ones of the hanger slots 10 such that the shelf 20 is both horizontally and vertically adjustably supportable on the partition frame 2 in a selected one of a variety of different discrete positions . as described in more detail below , the blades 7 can support either a shelf 20 , a corner shelf 130 , or a bin 110 or 225 . furthermore , if desired for a particular application , blades 7 may have a height that is somewhat greater than that of bins 225 , thereby allowing a bin 225 to be mounted between a pair of blades 7 directly above , and vertically spaced - apart from , one or more shelves 20 that are mounted to the same pair of blades as the bin . in addition , the blades can be easily moved horizontally in discrete increments by a user to provide horizontal adjustment of the shelf and / or bin location . a user can also easily remove a shelf 20 or bin 225 from the blades 7 , and reattach the shelf 20 or blade 225 at a different , discrete vertical location . accordingly , the side mounting arrangement provides simple and convenient vertical and horizontal adjustability , while minimizing the difficulties normally encountered with installation and / or removal of storage units . the partition frame 2 is substantially the same as that described in coassigned applications ser . nos . 08 / 701 , 664 , 08 / 687 , 724 and 08 / 579 , 614 identified above and incorporated by reference . accordingly , the partition frame 2 will not be described in detail herein . the partition frame 2 includes vertically spaced - apart horizontal members 3 , 4 , 11 , 12 and 13 which are connected to the uprights 14 , 15 and 16 to form a generally quadrilateral frame section . as best seen in fig1 c and 3 , the horizontal members 4 , 11 , 12 and 13 are welded to the uprights 14 , 15 and 16 on opposite sides thereof , while the upper horizontal member 3 is welded directly to the upper ends of the uprights 14 , 15 and 16 . each of the frame members is roll - formed from sheet metal . the embodiment of the partition frame 2 illustrated in fig2 and 3 has an additional horizontal member 18 located between the upper horizontal member 3 and the lower horizontal member 4 . the horizontal member 18 has substantially the same cross - sectional shape as the lower horizontal member 4 . each of the horizontal members , with the exception of the base horizontal member 13 , include a horizontal row of slots designated 5 , 6 , 19 , 21 , 22 and 23 , respectively . the horizontal rows of slots provide discrete attachment locations for the blades 7 and are located at evenly - spaced horizontal intervals , such as one inch . this arrangement provides horizontal adjustability of the blades 7 , and also allows the blades to be easily positioned with the proper spacing between the blades 7 to correspond to the length of a shelf 20 or bin 110 or 225 . each of the blades 7 comprises a planar blade portion 24 and a vertically elongated upright attachment member 25 that connects the planar blade portion 24 to the frame 2 ( fig2 ). as described in more detail below , each of the upright attachment members 25 includes an upper end such as hooked portion 26 and a lower end such as hooked portion 27 that engage the upper and lower horizontal rows of slots 5 and 6 , respectively , to removably attach the blades 7 to the horizontal members 3 and 4 . as illustrated in fig2 a , each planar blade portion 24 includes a sheet metal skin 28 that is bent around such that inner and outer sidewalls 29 , 30 of the planar blade portion 24 are parallel . the forward portion 31 of the skin 28 forms an elliptical shape with the major axis of the ellipse being parallel to , and coincident with , the center plane of the planar blade portion 24 . each planar blade portion 24 includes a brace 36 extending along a rear edge 39 that is welded to the sidewalls 29 and 30 of the sheet metal skin 28 . brace 36 is formed from sheet metal , and has a generally u - shaped cross - sectional shape . openings or slots 38 along the rear wall 40 of brace 36 removably connects the planar portions 24 of the blades to the hooks of the upright attachment member 25 as described in more detail below . the inner sidewall 29 and the outer sidewall 30 each have two vertical rows of hanger slots 10 . an oval - shaped indented portion 47 around each slot 10 is deformed inwardly , and is provided for decorative purposes . because the blades 7 have vertical rows of hanger slots 10 on each side , each blade 7 can support an end of a shelf on both the inner sidewall 29 and the outer sidewall 30 . blades 7 can be sized to accommodate various numbers and / or sizes of shelves and / or bins and required for a given application . a safety clip 41 ( fig2 a ) is spot welded to the inside of the lower u - shaped brace 37 . each clip 41 includes a pair of upwardly - oriented hooks 43 ( fig8 h ) that fit around extensions 76 of bracket 75 and engage the upper edge 55 of the opening 53 in the upright attachment member 25 ( fig8 b ). each clip 41 ( fig8 g , 8h and 8i ) includes a pair of tabs 44 that are spot welded to the lower portion of brace 36 at 42 . each clip 41 is made of a spring steel , and includes an elongated , flat body portion 45 with a rounded lower edge 46 . when the planar blade portion 24 of the blade 7 is installed on the upright attachment member 25 , and the clip 41 is in an unstressed condition , the hooks 43 engage the upper edge 55 of opening 53 thereby preventing disengagement of openings 38 from hooks 50 in upright attachment member 25 ( fig8 b ). when the clip 41 is in the unstressed condition the planar blade portion 24 of the blade 7 cannot be raised to disengage hooks 50 from openings 38 . to remove the planar blade portion 24 from upright 25 , clip 41 is flexed in the direction of the arrow &# 34 ; a &# 34 ; ( fig2 a and 8h ), moving hooks 43 out of engagement with opening 53 . during removal of planar blade portion 24 from upright 25 , the user flexes safety clip 41 to a disengaged position with one hand , while simultaneously raising the planar blade portion 24 of the blade for removal from the upright attachment member 25 . each upright attachment member 25 is formed from sheet steel and has a generally u - shaped cross - sectional shape ( fig6 ). the cross - sectional shape of the upright attachment member 25 includes a first leg or side 57 , a second leg or side 58 , and a base leg or side 59 ( fig8 ). hooks 50 open upwardly , and engage openings 38 in u - shaped brace 36 to removably support the planar blade portion 24 on the upright attachment member 25 . with reference to fig4 and 5 , lower hooked portion 27 of upright 25 includes a pair of horizontally - oriented hooks 54 that are configured to engage the slots 6 in the horizontal member 4 . a lower safety catch 60 is slidably mounted to the plate 61 for movement in the direction of the arrow &# 34 ; b &# 34 ;. safety catch 60 includes a tab 62 that provides a handle to allow a person installing or removing the uprights to slide the safety catch 60 in the slot 65 of the plate 61 . a pair of rivets 66 or similar fasteners slidably retain safety catch 60 to steel plate 61 . when safety catch 60 is in the engaged position illustrated in fig4 extension 64 of the offset portion 63 of safety catch 60 is inserted into a slot 6 , preventing sideways motion of the hooked portion 27 in the direction of the arrow &# 34 ; c &# 34 ;, and locking hooks 54 into slots 6 of horizontal member 4 . lower hooked portion 27 is attached to upright attachment member 25 by an adjustment mechanism 70 that allows the vertical spacing between the upper and lower hooked portions 26 and 27 to be changed if required to account for variations in the spacing between the upper horizontal row of slots 5 and the lower horizontal row of slots 6 . adjustment mechanism 70 includes a u - shaped section 71 that is welded to plate 61 . u - shaped section 71 includes cut - out 72 that receives a portion of a square nut 73 . a screw support bracket 75 is welded to the base side 59 of the upright attachment member 25 . as illustrated in fig8 c , each bracket 75 includes a pair of flat extensions 76 extending inwardly through opening 53 in base side 59 at the lower end of upright attachment member 25 . the head 78 of the screw 77 abuts the lower edge 74 of extensions 76 when lower hooked portion 27 is in the installed position . screw 77 extends upwardly through the square nut 73 and through the hole 80 in the tab 79 and engages the &# 34 ; e clip &# 34 ; 81 , which abuts the upper surface of the tab 79 to retain screw 77 ( fig4 ). the u - shaped section 71 is somewhat smaller than the upright attachment member 25 , and extends upwardly into the upright attachment member 25 in a telescoping manner . square nut 73 is constrained from rotation by the cut - out 72 such that screw 77 may be rotated to adjustably raise or lower the hooked portion 27 as required for a given application . with reference to fig5 a , upper hooked portion 26 includes a plate 61 with sidewardly - oriented hooks 54 . the plate 61 is welded to upper u - shaped section 82 . u - shaped section 82 fits within the upright attachment member 25 . the u - shaped section 82 includes a rectangularly - shaped opening 83 which receives a pair of tabs 84 that extend inwardly from the base side 59 of the upright 25 , thereby providing support for upper hooked portion 26 . a pair of fasteners such as screws 85 secure u - shaped section 82 within the upright attachment member 25 . the upper safety catch 60a is slidably mounted in a slot 65 in substantially the same manner as lower safety catch 60 . safety catch 60a includes an extension 64 that is received in the slots 5 in the upper horizontal member 3 upon movement of safety catch 60a in the direction of the arrow &# 34 ; d &# 34 ;. hooks 54 are thereby locked into slots 5 , preventing accidental dislodgement of upright attachment member 25 from partition frame 2 . shelf 20 is releasably attached to the hanger slots 10 by a hanger 90 located at the opposite side edges of the shelf 20 ( fig2 ). the body portion 91 of the hanger 90 forms an l - shaped support flange 92 having an outer , or horizontal leg 93 and a vertical or inner leg 94 ( fig9 - 11 ). in the illustrated embodiment , vertical leg 94 has orthogonal portions at each end forming protrusions such as upwardly - extending hook portions 97 that are configured to releasably engage openings such as hanger slots 10 in blades 7 . the &# 34 ; right hand &# 34 ; hanger 90 is a mirror image of the &# 34 ; left hand &# 34 ; hanger 90 illustrated in fig1 and 11 . as described in more detail below , the hangers 90 may be used to support either a shelf 20 or a storage bin 110 or 225 . when installing the hangers 90 to blades 7 , hangers 90 are engaged with the hanger slots 10 by inserting the hooks 97 into the slots 10 with the hangers 90 in a sideways position ( i . e ., rotated 90 ° clockwise from the position shown in fig9 ). the hanger 90 is then rotated counter - clockwise downwardly approximately 90 degrees in the direction of arrow &# 34 ; e &# 34 ; until the upright position illustrated in fig9 is reached . the hanger 90 on the opposite blade is installed in a similar manner by rotation in an opposite direction . in the upright position the inner surface 88 of the leg 94 of support flange 92 abuts the inner surface 8 of the blade 7 such that further rotation of the hanger 90 is prevented . in the upright , installed position , tip 87 of hook 97 abuts the inner surface 86 of the inner side 29 of the sheet metal skin 28 of the blade 7 , such that hanger 90 cannot be dislodged from the blade 7 without first rotating the hanger 90 upwardly to the sideways position . each hanger 90 includes an inwardly - extending tab 100 which is received into a slot 101 ( fig1 b ) formed in the rear wall of a shelf 20 , corner shelf 130 or storage bin 110 or 225 . the leg 93 of each hanger 90 includes a forwardly - extending portion 100a that is bent downward slightly to facilitate installing the shelf or bin on the hanger 90 . during installation of a shelf 20 or storage bin 110 , the hanger 90 is first installed to the blade 7 as described above . the shelf 20 or storage bin 110 is then slid rearwardly while resting on the legs 93 of the hangers 90 , until the tab 100 is received into the slot 101 located in the rear wall of the shelf 20 or storage bin 110 . the studs 123 are then installed as described above to lock the shelf 20 or storage bin 110 to the hangers 90 . each hanger 90 includes a pair of openings 122 which receive a quick - acting fastener such as a dzus half - turn stud 123 ( fig9 ). a dzus receptacle 124 clips onto an indented , notched side edge 125 of a shelf 20 or a storage bin 110 . each shelf or bin includes two indented portions 125 on each side edge . each indention 125 is spaced - apart to correspond to openings 122 in hangers 90 , and receives a dzus receptacle 124 . the one half - turn stud 123 and receptacle 124 may be purchased from dzus fastener company , inc ., islip , n . y . the dzus fastener arrangement acts as a shelf lock and releasably connects a shelf 20 , or storage bin 110 to the hanger 90 . because the dzus fasteners rigidly connect hanger 90 to the shelf 20 or storage bin 110 , the hanger 90 cannot be rotated for removal from the blade 7 after the studs 123 are installed . shelf 20 includes an upper wall 102 that is formed from sheet metal with an elliptical forward portion 103 that terminates at a rear edge 104 ( fig1 a ). flange 105 at the rear edge 106 of the shelf 20 includes an upwardly extending section 107 that is folded over and extends downward at 108 to form rear edge 106 of shelf 20 . the lower wall 109 of shelf 20 is also formed from sheet metal and is bonded or welded to the upper wall 102 adjacent the edge 104 of the elliptical forward portion 103 , and adjacent the downwardly extending portion 108 of the flange 105 . each shelf includes a hat - shaped channel 112 extending between the upper sheet metal section 102 and the lower sheet metal portion 109 for reinforcement . the hat - shaped channel 112 is welded to the upper portion 102 along the wall 114 , and is welded to the lower portion 109 along the edge flanges 113 . upper portion 102 includes downwardly extending side flanges 115 that close off the ends of the shelves 20 ( fig1 ). shelf 20 includes an end cap 118 that closes off the opposite side edges 120 of the shelves 20 adjacent the sidewardly - extending front portion 119 thereof ( fig1 ). each side edge 120 includes an elliptically - shaped section 121 such that the side edges taper outwardly adjacent the sidewardly extending front portions 119 ( fig1 , 14a ). the elliptically - shaped section 121 corresponds to the elliptically - shaped portion 31 of blades 7 such that the side edge 120 of the shelf 20 extends around the front edge of the blades 7 in a close - fitting manner . a plurality of weld clearance holes 116 in lower wall 109 provide clearance for spot welding during fabrication of shelf 20 . with reference to fig1 a , the lower sheet metal wall 109 of the shelf 20 has a pair of indented , notched portions 125 , each of which receives a receptacle 124 . as best seen in fig9 the notched portion 125 is indented , or bent upward approximately one sheet metal thickness , such that the clip portion of receptacle 124 does not protrude downwardly beyond the lower side of the shelf 20 . notch 125 locates receptacles 124 to correspond with openings 122 in hanger 90 , and also permits receptacles 124 to be mounted inboard of the shelf edge . partition panel system 1 may include a corner shelf 130 ( fig1 a , 15 ). two substantially planar partition panels 140 and 141 define orthogonal front surfaces 142 and 143 , respectively . panels 140 and 141 are joined along a vertical junction 144 . a vertically elongated corner shelf support member 145 is aligned with , and adjacent to , the vertical junction 144 . each of the panels 140 and 141 include a partition frame 2 with vertically spaced - apart horizontal members 3 , 4 , 11 , 12 and 13 . corner support 145 includes hooked upper and lower portions formed by hooked upper bracket 146 and hooked lower bracket 147 , respectively . the hooked brackets 146 and 147 removably attach corner shelf support 145 to the upper and lower horizontal rows of slots 5 , 6 of the upper and lower horizontal frame members 3 , 4 , respectively in substantially the same manner as described above with respect to shelf 20 . with reference to fig1 , corner shelf 130 includes first and second opposite side edges 131 and 132 , respectively . the opposite side edges 131 and 132 are substantially the same as the side edges 120 of a straight shelf 20 and each includes a pair of indented side edges 125 for attachment of receptacles 124 and studs 123 . corner shelf 130 may also include a slot 100 adjacent each rear corner to receive tab 100 of hanger 90 in substantially the same manner as described above with respect to shelf 20 . opposite side edges 131 and 132 each include a sidewardly - extending front portion 119 and an elliptically - shaped section 121 that corresponds to the elliptical front edge of the blades 7 . sidewardly extending front portion 119 extends around the front edge of the blade 7 , and the elliptically - shaped section 121 fits closely against the elliptical portion of the inner surface 8 of the blade 7 . the corner shelf 130 has a cross - sectional configuration that is substantially the same as that of the straight shelf 20 illustrated in fig1 a . the first and second halves 134 and 135 , respectively , of the corner shelf 130 each include a hat - shaped channel 112 that is welded between the upper the lower sheet metal surfaces 136 and 137 . the first and second halves 134 and 135 of the shelf 130 are joined together along the diagonal seam 138 by a pair of flat , rectangular sheet metal pieces 139 that are welded to the inner side of the upper and lower shelf surfaces 136 and 137 . the corner shelf 130 includes orthogonal first and second rear edge portions 148 and 149 that are configured to align with the front surfaces 142 , 143 of the partition panels 140 and 141 in close proximity thereto . the corner shelf support assembly 145 ( fig1 ) includes a rear portion 160 ( fig2 , 25 ) that is substantially v - shaped , and a front portion 161 that is substantially u - shaped ( fig2 , 23 ). the vertical flanges 162 of the u - shaped front portion are bonded or welded to the v - shaped rear portion along the edges 163 to form the joint 150 . as best seen in fig1 , the corner shelf support has a substantially tubular cross - sectional shape with orthogonal rear faces 151 that correspond to the front surfaces 142 and 143 of the panels 140 and 141 at the vertical junction 144 when in the installed position . the hooked lower bracket 147 ( fig1 , 18 ) is formed from sheet metal and includes a pair of slots 152 that receive screws 153 , thereby slidably mounting the hooked lower bracket 147 to the v - shaped rear portion of the corner shelf support adjacent the lower end thereof ( fig2 ). the slots 152 permit adjustment to account for variations in the vertical spacing between the horizontal rows of slots . the hooked lower bracket 147 also includes a pair of hooks 154 that are horizontally - oriented when the corner shelf support is in the vertical , installed position . the hooked upper bracket 146 ( fig2 , 21a ) is substantially the same as the hooked lower bracket 147 , except that the flat section 155 does not include slots . the flat section 155 of the hooked upper bracket 146 is spot welded to the v - shaped rear portion 160 of the corner shelf support at 157 ( fig2 ). the flat sections 155 and 156 of the upper and lower brackets 146 and 147 , respectively , are oriented so that the hooks 154 of the upper and lower brackets are each oriented in the same horizontal direction when the hooked upper and lower brackets 146 and 147 are connected to the v - shaped rear portion of the corner shelf support 145 . the u - shaped front portion of the corner shelf support 145 includes a vertical row of slots 158 . the v - shaped rear portion of the corner shelf support 145 includes a vertical row of relatively large slots 164 . a &# 34 ; butterfly &# 34 ; corner shelf support bracket 170 is formed from sheet metal , and includes an elongated flat portion 171 that fits through one of the forward slots 158 and also through one of the rear slots 164 in the corner shelf support 145 . with reference to fig2 - 28 , the corner shelf support bracket 170 includes two flat support portions 172 that are joined by a u - shaped section 173 . the corner shelf 130 rests on the supports 172 of the bracket 170 adjacent the corner 166 . corner shelf support bracket 170 includes a notch 174 in the elongated flat portion 171 adjacent the end 175 . when a weight , such as the corner shelf 130 , is placed on the support portions 172 of the bracket 170 , the end 175 pivots upward , causing the notch 174 to engage the upper edge 167 of the slots 164 to prevent accidental dislodgement of the bracket 170 from the corner shelf support 145 . the slots 158 and 164 are located at a height corresponding to the height of hanger slots 10 in blades 7 to support corner shelf 130 at the same height as straight shelf 20 , if a user so chooses . the corner shelf support bracket 170 is easily removed and installed in a selected pair of slots 158 and 164 to facilitate the vertical adjustment of the corner shelf 130 between selected discrete vertical locations . the blades 7 and hangers 90 may also be used to support a storage bin 110 ( fig2 ). the storage bin 110 includes a door 180 and a pair of opposing side walls 181 and 182 , a top wall 183 and a bottom wall or shelf 184 . the bin 110 also includes a rear wall 185 . as best seen in fig3 , the storage bin 110 includes a pair of indented , notched side edge portions 125 along each opposite side edge of bottom wall 184 that receive receptacles 124 . a pair of slots 101 are located at the lower corners of the rear wall 185 , and in combination with the receptacles 124 , removably connect or lock the storage bin 110 to the hangers 90 and blades 7 in substantially the same manner as described above for the shelf 20 . a channel 196 includes four vertical walls 197 and extends between walls 184 and 199 of bin 110 to provide additional structural support . y - shaped track 186 of the first embodiment of bin 110 includes an upper track 187 and a lower track 188 , each of which form a guide for opening and closing the door 180 ( fig3 ). the right hand track is a mirror image of the left hand track 186 and will not be further described herein . upper track 187 and lower track 188 include horizontal portions 191 and 192 that are parallel , and in close proximity to one another . upper track 187 includes an upper leg 189 that terminates in an approximately horizontal portion 200 adjacent the forward edge of the bin 110 . lower track 188 includes a lower leg 190 that extends downwardly forming an approximately quarter - circular shape and terminating at an approximately vertical portion 201 . track 186 is preferably molded from a polymer material such as acetal . the track 186 is secured to the bin by fasteners 194 . tracks 187 and 188 each have an inwardly - opening u - shaped cross section ( fig3 ). track 186 includes a structural brace 202 adjacent the forward lower edge . with reference to fig3 - 34 , each door 180 includes a handle 205 and a lock 206 . the door 180 illustrated in fig3 is made from sheet metal . the wood door 179 illustrated in fig3 and 32 has substantially the same functions . however , a wood material is used for aesthetic purposes . the doors 179 and 180 each have a pair of upper and lower cylindrical protrusions or pins 207 and 208 , respectively . the upper protrusion 207 engages the upper track 187 , and the lower cylindrical protrusion 208 engages the lower track 188 of the y - shaped track 186 . protrusions 207 and 208 are spaced - apart , and provide an anti - racking function , such that an equalizer assembly is not required . in a preferred embodiment , the protrusions 207 and 208 are spaced - apart about four inches to act as an equalizer . smaller dimensions , such as two inches , or three inches , or larger dimensions , such as five inches or six inches , are also functional , and provide an anti - racking feature , but are less preferred than the four inch dimension . a bracket assembly 209 is used with the wood door 179 , and a similar bracket assembly 210 is used with the metal door 180 ( fig3 , 34 ). the &# 34 ; left hand &# 34 ; guide brackets ( not shown ) are mirror images of the &# 34 ; right hand &# 34 ; guide brackets illustrated in fig3 and 34 . with reference to fig3 and 33 , the metal door guide bracket assembly 210 has a generally u - shaped cross - sectional shape with cylindrical protrusions 207 and 208 being welded thereto along the base of the u - shape . three holes 211 along a leg of the u - shape provide clearance for screws 212 which attach the bracket 210 along opposite side edges of the sheet metal door 180 . the sheet metal door 180 includes a pair of inwardly - extending flanges 215 . a generally hat - shaped channel 213 extends across the door and is bonded thereto . channel 213 is spot welded to the flanges 215 at tabs 214 . with reference to fig3 , 32 and 34 , the wood door guide bracket assembly 209 includes clearance holes 216 in the flange 218 that provide clearance for wood screws 217 ( fig3 ). both the wood door 179 and the metal door 180 are guided in the upper and lower tracks 187 and 188 during opening and closing of the door such that when moving the door from the closed position to the open position ( arrow &# 34 ; a &# 34 ;, fig3 ) the door first rotates and then begins to translate rearwardly as the door approaches the flat horizontal position . the door is then translated rearwardly along the horizontal portions 191 and 192 of the upper and lower tracks 187 and 188 , respectively . a second embodiment 225 of the bin is illustrated in fig3 . bin 225 is similar to the first embodiment discussed above , except that a scissors - type equalizer 229 ( fig4 ) is utilized to prevent racking instead of the y - shaped track 186 . the bin 225 includes a pair of notched , indented side edge portions 125 along each opposite side edge of bottom wall 199 , each of which receives a receptacle 124 to removably attach bin 225 to a pair of blades 7 in substantially the same manner as shelf 20 and bin 110 . a horizontal side flange 230 extends inwardly from each sidewall of the bin 225 for support of the door 235 ( fig3 , 40 ) when the door 235 is in the closed position . a horizontal rear flange 231 extends along the rear wall 232 of the bin 225 . with reference to fig3 and 40 , the door 235 is made from sheet metal , and includes a front wall 236 and flanges 237 that extend inwardly . a hat - shaped brace 238 is welded or bonded to the inner side of the wall 236 to strengthen the door 235 . with reference to fig4 and 42 , the equalizer assembly 229 includes first and second elongated flat members 239 and 240 that are pivotally connected at 241 . the second member 240 is slidably connected to a base member 244 at slot 243 . the first member 239 is pivotally connected to the base member 244 at 245 . a pair of hinges 246 are mounted to the base 244 , and include a flat plate 247 that is fixed to the door 235 at 248 . a slot ( not shown ) in the rear flange 231 is slidably connected to the first member 239 at 249 , and the second member 240 is pivotally connected to the rear flange 231 at 250 . the hinges 246 and the equalizer assembly 229 cooperate to permit the door 235 to be pivoted upward to a horizontal , open position and then slid rearwardly to a position where the door 235 is supported on the horizontal side flanges 230 . in the foregoing description , it will be readily appreciated by those skilled in the art that modifications may be made to the invention without departing from the concepts disclosed herein . such modifications are to be considered as included in the following claims , unless these claims by their language expressly state otherwise .

US-1504798-A

a hybrid protein contains a protein that binds to a receptor of mastocytes and basophils and is endocyted by them . the protein can be ige ; ige fragment ; ige fc fragment ; antibody against ige receptor of mastocytes and basophils ; fragment of the antibody against the ige receptor of mastocytes and basophils ; antibody against mastocyte specific potassium channel ; and mast cell degranulating peptide . the hybrid protein also contains a protease cleaving proteins of the secretion process of the mastocytes and basophils so as to inhibit the secretion process without killing the mastocytes and basophils . the protease can be light chain clostridium botulinum toxin ; proteolytically active fragment of the light chain of a clostridium botulinum toxin containing an amino acid sequence his - xaa - xaa - xaa - his - xaa - xaa - his wherein xaa is an amino acid ; light chain of the tetanus toxin ; proteolytically active fragment of the light chain of the tetanus toxin containing his - asp - leu - lie - his - val - leu - his ; iga protease of neisseria gonorrhoeae ; and proteolytic domain of the iga protease of neisseria gonorrhoeae .

the invention will now be described in detail with the aid of specific non - limiting examples . synthesis of a hybrid protein from ige and the light chain of bont / a the purified botulinum toxin ( 5 . 0 mg ) of type a was applied , after equilibration in 15 mm sodium tetraborate and 30 mm phosphate ph 8 . 4 , to a qae sephadex column ( 1 . 0 × 3 . 0 cm ), equilibrated with the same buffer . the column was subsequently washed with 10 ml 120 mm dithioerythrol , 2 m urea and 1 mm edta and incubated over night . thereafter , the light chain was eluted from the column by means of 10 mm borate buffer and dialyzed against 20 mm phosphate ph 7 . 0 . immunoglobulin e ( rat ) was purchased . 10 mg of the immunoglobulin were cleaved with 50 μg papain in 1 ml phosphate buffer ( 4 degrees c . over night ). the fc fragment was purified over a gel filtration column ( sephacryl s200 ). 3 . 0 mg of the purified fc fragment were incubated with 3 . 0 mg of a purified light chain of botulinum toxin with 10 mm dithio bis succinimidyl propionate ( bifunctional agent ) in 2 ml na phosphate , ph 7 . 0 , over a period of 16 hours . the hybrid protein thus synthesized was purified via gel filtration ( sephacryl s200 ) and analyzed for its purity via sds gel electrophoresis . the inhibition of the degranulation of the mastocytes is examined in two experimental approaches . in the first approach isolated mastocytes of the rat are incubated with the hybrid molecule . thereafter the release of histamine is stimulated . the stimulation occurs with specific histamine liberators such as the mcd peptide and concanavalin a ( the latter being an experimentally utilized substance ) and by a direct increase of the intracellular calcium concentration , respectively . the latter is achieved by an injection of calcium into distinct mastocytes . thus , one shortcircuits the above described signal cascade as the increase of the calcium concentration is the step during the secretion process which is followed by the fusion of the vesicles . the degranulation of the mastocyte reflecting the release of histamine is followed in the phasecontrast microscope . subsequently , it is possible to quantify released histamine by means of a measurement of the fluorescence . finally , the enlargement of the mastocyte caused by the incorporation of vesicle membranes into the plasma membrane during degranulation can be determined electrophysiologically . in the cells treated with hybrid protein there will , in contrast to control cells , occur ( 1 ) no morphological change , ( 2 ) no enhancement of the fluorescence in the supernatant of the cell , and ( 3 ) no enlargement of the cell . thereby it is possible to prove that the release of histamine is blocked by the hybrid protein . in the second experimental approach the hybrid protein is injected into living rats . the rats are killed after several days and their mastocytes conventionally isolated . the degranulation and release of histamine , respectively , is determined as described above . in this approach it is examined whether the conjugate is able to reach the compartment also in the living animal , in which compartment the mastocytes are located in , and whether the conjugate inactivates the mastocyte in the living animal . production of a recombinant hybrid protein by operably linking the gene encoding the light chain of clostridium botulinum type a to the gene encoding immunoglobulin e and one of its fragments ( fc fragment ), respectively the gene encoding the light chain of botulinum toxin type a is isolated by means of suitable primers via pcr ( polymerase chain reaction ). a culture of clostridium botulinum type a is prepared from which the dna is prepared . from the published sequence of the toxin gene ( binz et al ., 1990 ) a pair of primers is derived and the gene for the light subunit amplified via pcr . thereafter this gene is cloned into a commercial expression vector pqe according to the recipe of the producer . the gene encoding the fc fragment of the human immunoglobulin e ( helman , 1995 l .) was isolated via pcr from a commercial cdna library and fused in the vector construct with the gene light chain of botulinum toxin type a . with this construct competent m15 cells ( e . coli ) are transformed . as in this expression system the inserted genes are equipped with a “ his tag ”. the recombinant protein is purified through affinity chromatography over a ni nta column ( quiagen ). the process of highly purifying the protein is followed by a gel filtration through sephacryl s300 . the measurement of the biological activity was performed again on isolated mastocytes in vitro . preparation of a recombinant hybrid protein by operably linking the gene encoding the light subunit of the tetanus toxin with a mutated gene encoding the mast cell degranulating peptide ( mcd ) the “ sequence for the mast cell degranulating peptide ”, a 22 mer , is known ( gmachl and kreil , 1995 ). based thereon a corresponding oligonucleotide is synthesized . in order to isolate the sequence of the light subunit of the tetanus toxin a culture of c . tetani was prepared and dna recovered therefrom . from the known nucleic acid sequence of the tetanus toxin a primer for pcr and hence the gene for the light subunit of the toxin was obtained . as described in example 1 , both nucleic acid sequences were fused in an expression vector pqu and subsequently expressed in e . coli . the hybrid protein which , in turn , was equipped with a “ his tag ” was purified through affinity chromatography and subsequent gel filtration . the purified gene encoding the mast cell degranulating peptide is chemically synthesized including a point mutation in the active domain of the peptide . the gene is operably linked to the gene encoding the light chain of the tetanus toxin . the hybrid protein is expressed in e . coli and purified . the thus produced hybrid protein is tested in vitro in the mastocyte degranulation assay . preparation of a recombinant hybrid protein by linking the gene encoding the fc fragment of ige to the gene encoding the iga protease the gene encoding the fc fragment of ige was isolated as described in example 1 . the gene encoding the iga protease from n . gonorrhoeae is known . primers were derived therefrom , and the gene encoding the specific protease was recovered by means of pcr from a nucleic acid preparation obtained from n . gonorrhoeae . both nucleic acids were integrated into a commercial vector following the recipe giving by the producer and the hybrid protein purified by affinity chromatography ( see example 2 ). the inhibitory activity is again proven in vitro on isolated mastocytes ( see above ). preparation of a hybrid protein consisting of the fab fragment of an antibody against the ige receptor and the light chain of botulinum toxin type b a monoclonal antibody against the ige receptor on mastocytes was purchased and chromatographically repurified . 0 . 5 mg of the antibody were conjugated to 0 . 4 g of the purified light chain of botulinum toxin f . the light subunit was isolated by cleavage of the neurotoxin and subsequent purification through ion exchange chromatography , once the preparation of the neurotoxin had been performed according to the procedure in example 1 . both proteins ( light subunit of toxin type f and monoclonal antibody ) were linked to each other by using a bifunctional agent . the isolated proteins were incubated with 10 mm maleimido benzoyl n hydroxy succinimide ester for this purpose . the hybrid protein was subsequently purified from nonconjugated proteins by gel filtration over sephacryl s300 . again , isolated mastocytes were used to demonstrate that the hybrid protein synthesized inhibited the secretion of histamine . patent - related documents of interest in this connection are : u . s . pat . no . 4 , 902 , 495 ( ige fc directed delivery systems ) and pct application wo 94 / 21300 ( novel agent controlling cell activity ) 1 ) ahnert g ., bigalke h . ( 1995 ); molecular aspects of tetanus and botulinum neurotoxin poisoning . progress in neurobiology 46 : 83ff 2 ) benecke r ., kessler k . r . ( 1995 ); botulinum toxin a ; akt . neurol 22 : 209ff 3 ) bigalke , h . & amp ; shoer , l . f . ( 2000 ); clostridial toxins , handbook of experimental pharmacology and toxicology ; ed . just & amp ; aktories , springer verlag , pp . 407 - 443 4 ) binscheck t ., bartels f ., bergel h ., bigalke h ., yamasaki s ., hayashi t ., niemann h ., pohlner j . ( 1995 ); iga protease from neisseria gonorrhoeae inhibits exocytosis in bovine chromaffin cells like tetanus toxin ; j . biol . chem . 270 : 1770ff 5 ) binscheck t ., wellh ö ner h . h . ( 1997 ); tetanus and botulinum toxins zinc proteases synaptotagmin exocytosis . in : toxins and signal transduction ; ( eds . : gutman y ., lazarovici p .) 1 : 457ff 6 ) binz , t ., kurazono , h ., m ., frevert , j ., wernars k . & amp ; niemann , h . ( 1990 ); the complete sequence of botulinum toxin a and comparison with other clostridial neurotoxins ; j . biol . chem . 265 : 9153ff 7 ) cardoso , f . & amp ; jancovic , j . ( 1995 ); clinical use of botulinum neurotoxins ; current topics microbiol . immunol . 195 : 123ff 8 ) fishman , a ., lorberboum - galski h . ( 1997 ); targeted elimination of cells expressing the high affinity receptor for ige ( fc epsilon ri ) by a pseudomonas exotoxin based chimeric protein ; eur . j . immunol ., 27 : 486ff 9 ) gmachl , m . & amp ; kreil , g . ( 1995 ); the precursors of the bee venom constituents apamin and mce peptide are encoded by two genes in tandem which share the same 3 ′ exon ; j . biol . chem 270 ( 21 ): 12704ff 10 ) helman , l . ( 1995 ); characterization of four novel epsilon chain mrna and a comparative analysis of genes for immunoglobulin e in rodents and man ; eur . j . immunol . 23 ( 1 ): 159ff 11 ) liddel & amp ; weeks ( 1995 ); antik ö rper techniken ; spektrum akademischer verlag heidelberg 12 ) link e ., edelmann l ., chou j ., binz t ., yamasaki s ., eisel u ., baumert m ., s ü dhof t . c ., niemann h . & amp ; jahn r . ( 1992 ); tetanus toxin action : inhibition of neurotransmitter release linked to synaptobrevin proteolysis ; biochem . biophys . res . comm . 189 : 18423ff 13 ) magerstadt , m . ( 1991 ); antibody conjugates and malignant diseases ; crc press 14 ) hamawy m . m . ( ed .) ( 1997 ); ige receptor ( fceri ) function in : mast cells and basophils ; springer verlag 15 ) marxen p ., fuhrmann u ., bigalke h . ( 1989 ); gangliosides mediate inhibitory effects of tetanus and botulinum a neurotoxins on exocytosis in chromaffin cells ; toxicon 27 : 849 16 ) nichols d . s . t . ( 1995 ); gentechnische methoden ; spektrum akademischer verlag 17 ) vogel , c . ( ed .) ( 1987 ); immunoconjugates : antibody conjugates in radioimaging and therapy of cancer ; oxford up inc .

US-6490302-A

the invention relates to the separation of enantiomers of cimaterol , - cimaterol , the addition salts thereof and processes for preparing them and their use in pharmaceutical compositions and animal feeds .

surprisingly , it has now been found that racemic cimaterol , which may contain one of the desired enantiomers in concentrated form , can be resolved , by dissolving cimaterol and at least 2 equivalents , appropriately from 2 to 7 equivalents , but preferably 2 to 4 equivalents , of an optically active dibasic auxiliary acid such as (-)- 0 , 0 &# 39 ;- dibenzoyl - l - tartaric acid , (+)- 0 , 0 &# 39 ;- dibenzoyl - d - tartaric acid , (-)- 0 , 0 &# 39 ;- ditolyl - l - tartaric acid or (+)- 0 , 0 &# 39 ;- ditolyl - d - tartaric acid , keeping within a temperature range which is specific to each auxiliary acid and is preferably above 20 ° c . but preferably between 25 ° and 30 ° c ., in a suitable solvent , via the two diastereomeric salts thereof with subsequent liberation of the enantiomeric base . the desired diastereomeric salt is precipitated with a degree of purity of at least ee = 90 % after a short time , e . g . 1 to 5 minutes , whilst the temperature must not fall below the range which is characteristic of each auxiliary acid . preferably , the two components are dissolved simultaneously , and obviously a solution of one component can be added to a solution of the other component . it is particularly advantageous to carry out the racemate separation with 2 to 7 equivalents , preferably with 1 to 3 equivalents of (-)- 0 , 0 &# 39 ;- dibenzoyl - l - tartaric acid or (+)- 0 , 0 &# 39 ;- dibenzoyl - d - tartaric acid as the auxiliary acid at temperatures above 25 ° c ., but preferably in a temperature range between 25 ° and 30 ° c . thus , for example , after 1 mol of cimaterol and 1 mol of (-)- 0 , 0 &# 39 ;- dibenzoyl - l - tartaric acid or (+)- 0 , 0 &# 39 ;- dibenzoyl - d - tartaric acid have been dissolved in methanol simultaneously , pure (+)- 1 -( 4 &# 39 ;- amino - 3 &# 39 ;- cyano - phenyl )- 2 - isopropylamino - ethanol -(-)- 0 , 0 &# 39 ;- dibenzoyl - l - hydrogen tartrate or (-)- 1 -( 4 &# 39 ;- amino - 3 &# 39 ;- cyano - phenyl )- 2 - isopropylamino - ethanol -(+)- 0 , 0 &# 39 ;- dibenzoyl - d - hydrogen tartrate is obtained , and after a short time , e . g . 1 to 2 minutes , the pure diastereomeric hydrogen tartrate in question begins to crystalize . this salt occurs in a high degree of purity of at least ee = 94 % even after the first step . if even greater purity is required , the separation process can be repeated once or several times , if necessary , by dissolving the diastereomeric hydrogen tartrate obtained after a single precipitation and recrystallizing it at above 25 ° c . the desired pure enantiomeric base is then liberated from the diastereomeric salt thus obtained using a base , preferably dilute ammonia , and the pure base liberated is then isolated by conventional methods . the enantiomeric bases obtained may , if desired , subsequently be converted into the acid addition salts thereof , more particularly , for pharmaceutical use , into the physiologically acceptable salts thereof with organic or inorganic acids , but preferably with organic acids . suitable acids include , for example , hydrochloric , hydrobromic , sulfuric , phosphoric , fumaric , succinic , lactic , citric , tartaric or maleic acid . however , a particularly remarkable feature of the process according to the invention is that , if the temperature is accidentally allowed to fall below the prescribed range , the racemic cimaterol - 0 , 0 &# 39 ;- dibenzoyl - l - or cimaterol - 0 , 0 &# 39 ;- dibenzoyl - d - hydrogen tartrate obtained by way of example can be converted into the desired pure diastereomeric hydrogen tartrate , after resuspension and heating to above 25 ° c . the invention thus also relates to the diastereomeric salts mentioned above , namely (-)- cimaterol or (-)- cimaterol which is substantially optically pure , i . e . has an optical purity of at least ee = 90 %, preferably 94 to 100 %, the acid addition salts thereof , more particularly the physiologically acceptable acid addition salts thereof with organic or inorganic acids , and the use thereof as pharmaceutical compositions and performance enhancers in animals . the experiments described below show that the l - enantiomer of cimaterol , i . e . (-)- cimaterol ( the term (-)- cimaterol denoting the enantiomer which rotates the plane of oscillation of linearly polarized light of the sodium - d - line to the left ) is surprisingly the only carrier of the biological effects of cimaterol : 1 . the two enantiomers of cimaterol were subjected to comparative tests to investigate their β - mimetic effects on the smooth muscle of the bronchus , the skeletal musculate and the fat cells . they were also compared for their acute toxicity . the β - mimetic effect of the smooth muscle was examined in terms of a broncholytic effect in the test designed by konsett and rossler ( arch . exp . path . pharmakol . 195 , 71 - 74 ( 1940 )) compared with the acetyl choline - induced bronchospasm in guinea - pigs after i . v . administration . from the inhibition of bronchospasm achieved with the various doses of the test substance , an ed 50 was calculated by linear regression analysis as the dosage which resulted in a 50 % inhibition of bronchospasm . the l - enantiomer is about 100 times more effective on the β - receptors of the bronchus than the corresponding d - enantiomer . the β - mimetic effect on the skeletal musculature was tested using the method of bowman and nott ( pharmacol . rev . 21 , 27 ( 1969 )). this investigates the influence on the tension of the incompletely tetanically contracting m . soleus of anaesthetized cats after i . v . administration . ______________________________________ reduction in tension in % substance dose μg / kg n x sd______________________________________cimaterol 0 . 5 5 38 . 3 10 . 8 (-)- cimaterol 0 . 5 5 42 . 1 6 . 0 (+)- cimaterol 50 . 0 5 33 . 7 8 . 0______________________________________ the l - enantiomer of cimaterol is also more than 100 times more effective than the corresponding d - enantiomer on the β - receptors of the skeletal musculature . the β - mimetic effect on the fat cells was investigated in terms of a lipolytic effect on conscious rabbits after i . v . administration . the changes in the free fatty acids in the rabbit &# 39 ; s blood , achieved by means of the various doses of test substances ( measured by the method of duncombe : biochem . j . 88 , 8 ( 1963 )) was used to calculate , by linear regression analysis , an ed 150 , i . e . the dose which resulted in a 50 % increase in the free fatty acid in the blood . the doses of d - cimaterol needed to achieve a 50 % increase in the free fatty acids in the rabbit &# 39 ; s blood are about 100 times greater than those of the corresponding l - enantiomer . the acute toxicity was measured in male and female mice weighing between 20 and 25 g after intravenous administration . an ld 50 was calculated by sample analysis from the percentage of animals which died within 14 days of being given the substance . 2 . the performance enhancing effect of (-)- cimaterol was investigated on groups of 10 eight month old lambs ( suffolk x galway wether lambs ), which had been fed for 6 weeks with a feed ( dry composition per kg : 145 g of crude protein + 70 g of crude fibre + 17 g of oil + 50 g of crude minerals ) to which 2 mg / kg of the test substance had been added . at the same time steps were taken to ensure that the lambs were offered at least 10 % excess feed during the experimental period . the lambs were then killed and the following parameters were obtained : ______________________________________ (+)- (-)- control cimaterol cimaterol cimaterol______________________________________starting weight 34 . 4 34 . 8 34 . 2 34 . 9in kgfinal weight in 45 . 4 45 . 7 48 . 0 46 . 0kgweight gain in 259 268 324 275g per dayfeed utilization 190 184 220 196in g of weightgain per kg offeedweight of car - 22 . 8 22 . 5 24 . 1 24 . 0cass in kgcomposition ofcarcass tissue ( without bones ) in g per kg : water 501 501 557 556fat 248 341 252 265protein 140 151 177 167______________________________________ as already mentioned above , the biological data given show that , surprisingly , (-)- cimaterol is the sole carrier of the desired effects . however , since the d - enantiomer has the same toxicity as the l - enantiomer , the ratio of use to risk can be improved by a factor of 2 by using l - cimaterol instead of the racemate . (-)- cimaterol and the physiologically acceptable acid addition salts thereof are therefore suitable for treating obesity , obstructive lung disorders , allergic bronchial asthma , spastic bronchitis , inflammations or premature labor . in adults the single dose is between 0 . 01 and 50 μg , but preferably between 0 . 01 and 10 μg , twice to four times a day . for this purpose (-)- cimaterol or the physiologically acceptable salts thereof may be incorporated , optionally combined with other active substances , into the conventional galenic preparations such as powders , plain or coated tablets , capsules , suppositories or suspensions . furthermore , (-)- cimaterol and the acid addition salts thereof may be used , as mentioned hereinbefore , for treating obese animals such as dogs and , by virtue of their effect of reducing body weight ( their lipolytic effect ), to reduce undesirable fat deposits in animal farming , i . e . to improve the meat quality of farmed animals such as pigs , cattle , sheep and poultry . the above - mentioned compounds may be administered to the animals by oral or non - oral route , e . g . as a feed additive or by injection or by means of implanted minipumps . the daily dose is between 0 . 01 and 100 μg / kg , but preferably between 0 . 01 and 10 μg / kg of body weight . furthermore , (-)- cimaterol and the acid addition salts thereof may be used as performance enhancers in animals for promoting and accelerating growth , milk and wool production and in order to improve feed utilization , carcass quality and in order to shift the meat - to - fat ratio in favor of meat . the active substances are used in agricultural , breeding , show and pet animals . the agricultural and breeding animals include mammals such as cattle , pigs , horses , sheep , goats , rabbits , hares , deer , fur animals such as mink and chinchilla , poultry such as chickens , geese , ducks , turkeys , fish such as carp , trout , salmon , eels , tench , pike , and reptiles such as snakes and crocodiles . the show animals and pet animals include mammals such as dogs and cats , birds such as parrots and canaries and fish such as ornamental and aquarium fish , e . g . goldfish . the active substances are used during all the growth and performance phases of the animals , irrespective of the animals &# 39 ; sex . preferably , the active substances are used during the intensive growth and performance phase . depending on the type of animal , the intensive growth performance phase lasts from one month to 10 years . the quantity of active substances administered to the animals in order to achieve the desired effect may vary substantially , thanks to the favorable properties of these active substances . this quantity is preferably from 0 . 01 to 50 μg / kg , particularly 0 . 01 to 25 μg / kg of body weight per day . the correct quantity of active substance and the appropriate period of treatment depend in particular on the type of animal , its age , sex , state of health and the manner in which the animals are kept and fed and can easily be determined by anyone skilled in the art . the active substances are administered to the animals by the usual methods . the method of administration depends in particular on the type of animal , and the behavior and state of health of the animals . the active substances may be administered once . however , it is also possible to administer the active substances throughout part or all of the growth phase , temporarily or continuously . if they are administered continuously , they may be given one or several times a day at regular or irregular intervals . the substances are administered by oral or parenteral route in suitable formulations or in pure form . oral formulations are powders , tablets , granules , drenches , boli as well as feedstuffs , premixes for feedstuffs , and formulations for administering in drinking water . the oral formulations contain the active substance in concentrations of 0 . 01 ppb - 100 %, preferably 0 . 01 ppb - 10 %. parenteral formulations are injections in the form of solutions , emulsions , suspensions , as well as implants . the active substances may be present in the formulations on their own or in admixture with other active substances , mineral salts , trace elements , vitamins , proteins , colorings , fats or flavorings . the concentration of the active substances in the finished feed is normally about 0 . 01 ppb to 50 ppm , preferably 0 . 1 ppb to 10 ppm . the active substances may be added to the feed as they are or in the form of premixes or feed concentrates . thus , the feedstuffs according to the invention contain in addition to the active substance and possibly a conventional vitamin and mineral mixture , for example , for fattening pigs : barley , wheat flour , broad beans , shredded rape extract and edible fat ; for broilers : maize , soya bean flour , meatmeal , edible fat and soya oil ; for cattle : shredded sugar beet , maize gluten , malt germs , soya bean flour , wheat and molasses and for lambs : barley , soya bean flour , maize and molasses . to this feedstuff , one of the above - mentioned compounds of formula i is added as active substance in a concentration of 0 . 01 ppb to 0 . 50 %, but preferably from 0 . 1 ppb to 0 . 05 %, the compound preferably being added in the form of an active substance premix . this premix contains , for example , 5 to 10 , 000 mg , but preferably 50 to 1 , 000 mg , expediently in 1 , 000 g of corn starch . 50 . 0 g ( 0 . 23 mol ) of cimaterol and 82 . 4 g ( 0 . 23 mol ) of (+)- 0 , 0 &# 39 ;- dibenzoyl - d - tartaric acid are dissolved in 500 ml of methanol at ambient temperature . after briefly dissolving , the hydrogen tartrate of the cimaterol crystallizes out . the crystal suspension is stirred for about 2 hours at an internal temperature of 19 ° to 20 ° c ., then suction filtered and the filter residue is washed with cold methanol and dried at 50 ° c . until a constant weight is obtained . yield : 90 g ( 68 . 0 % of theory based on the racemate used ), b ) 88 g of the hydrogen tartrate obtained in a ) are refluxed in 500 ml of methanol until totally dissolved and the clear solution is cooled to an internal flask temperature of about 15 ° c . the crystals precipitated are stirred for about 2 to 3 hours at 15 ° to 18 ° c ., suction filtered , washed with cold methanol and dried . c ) 60 g of the hydrogen tartrate obtained according to b ) are dissolved in 350 ml of methanol analogously to a ) at boiling temperature , the crystals are stirred for about 12 hours at 10 ° to 15 ° c ., suction filtered , washed with cold methanol and dried . after the second recrystallization , the total yield was only 27 . 2 % of theory , based on the racemate put in , and an enantiomeric excess ( ee ) of only 45 was obtained . owing to the substantial waste , crystallization was not continued . 50 g ( 0 . 23 mol ) of 1 -( 4 &# 39 ;- amino - 3 &# 39 ;- cyano - phenyl )- 2 - isopropylamino - ethanol and 82 . 4 g ( 0 . 23 mol ) of (+)- 0 , 0 &# 39 ;- dibenzoyl - d - tartaric acid are dissolved in 500 ml of methanol in a 1 liter three - necked flask at 25 ° to 28 ° c . with stirring . after about 1 to 2 minutes , the levorotatory diastereomeric hydrogen tartrate crystallizes out of the clear solution . after about 2 hours &# 39 ; stirring at 25 ° to 28 ° c . the crystals are suction filtered , washed with a little methanol and dried at 50 ° c . in a circulating air dryer . b ) 42 g of the hydrogen tartrate obtained in example 1a are dissolved in 550 ml of methanol in a 1 liter three - necked flask at boiling temperature with stirring and the hot solution is filtered clear in a 2 liter filter press using a seitz - ek filter . the filtrate is evaporated down to about 100 to 150 ml of solution under a weak vacuum and the crystal suspension formed is stirred for about 1 hour at 25 ° to 28 ° c . the crystals are suction filtered , washed with a little methanol and dried at 50 ° c . in a circulating air dryer . 36 . 0 g of the hydrogen tartrate obtained in example 1b are added gradually to 50 ml of concentrated ammonia and 150 ml of water at ambient temperature . after 1 hours &# 39 ; stirring the crystal suspension is filtered off , washed thoroughly with deionized water and dried at ambient temperature in a circulating air dryer until a constant weight is obtained . the mother liquor obtained from the precipitation according to example 1a is evaporated to dryness in vacuo and the residue obtained is taken up in 50 ml of concentrated ammonia and 150 ml of water and stirred for 2 hours at about 5 ° to 10 ° c . after suction filtering , the filter residue is washed thoroughly with water and dried well in a circulating air dryer at ambient temperature . the crude (+)- 1 -( 4 &# 39 ;- amino - 3 &# 39 ;- cyano - phenyl )- 2 - isopropylamino - ethanol thus obtained is purified with (-)- 0 , 0 &# 39 ;- dibenzoyl - l - tartaric acid analogously to example 2 : 50 g of (-)- 1 -( 4 &# 39 ;- amino - 3 &# 39 ;- cyano - phenyl )- 2 - isopropylamino - ethanol -(+)- 0 , 0 &# 39 ;- dibenzoyl - l - hydrogen tartrate ( prepared according to reference example a ), melting point of the liberated base : 162 . 8 ° c . ; ee = 8 ) are suspended with 500 ml of methanol and stirred for 1 hour at an internal flask temperature of about 28 ° c . the mixture is then suction filtered , washed with a little methanol and dried at 50 ° c . until a constant weight is obtained . the hydrogen tartrate thus obtained is liberated analogously to example 1c ) using dilute ammonia . ______________________________________active substance 0 . 002 mglactose 82 . 498 mgpotato starch 33 . 000 mgpolyvinylpyrrolidone 4 . 000 mgmagnesium stearate 0 . 050 mg 120 . 000 mg______________________________________ the active substance and polyvinylpyrrolidone are dissolved in ethanol . the mixture of lactose and potato starch is uniformly moistened with the active substance / granulating solution . moist screening is carried out with a 1 . 5 mm mesh screen . the mixture is then dried at 50 ° c . and dry screening is carried out with a 1 . 0 mm mesh screen . the granules thus obtained are mixed with magnesium stearate and compressed into tablets . ______________________________________active substance 0 . 001 mglactose 82 . 499 mgpotato starch 33 . 000 mgpolyvinylpyrrolidone 4 . 000 mgmagnesium stearate 0 . 500 mg 120 . 000 mg______________________________________ the cores are coated by known methods with a coating consisting essentially of sugar and talc . the finished coated tablets are polished with beeswax . ______________________________________active substance 0 . 001 mglactose 59 . 999 mgcorn starch 60 . 000 mg 120 . 000 mg______________________________________ the active substance is intensively mixed with lactose and corn starch and packed into suitably sized oblong gelatine capsules . ______________________________________active substance 0 . 002 mgcitric acid 2 . 500 mgsodium hydrogen phosphate 7 . 500 mgcommon salt 4 . 600 mgwater for ampoules to 2 . 000 ml______________________________________ the active substance , buffer substances and common salt are dissolved in water for ampoules and then filtered to remove any pathogens . packaging : in brown 2 ml ampoules under protective gas ( n 2 ) ______________________________________active substance 0 . 025 mgsuppository mass ( e . g . witepsol w 45 ) 1 , 699 . 975 mg 1 , 700 . 000 mg______________________________________ the finely powdered active substance is stirred into the molten suppository mass , which has been cooled to 40 ° c ., by means of an immersion homogenizer and at 37 ° c . the mass is poured into slight chilled molds . ______________________________________active substance 0 . 04 mgbenzoic acid 0 . 10 gtartaric acid 1 . 00 gsugar 50 . 00 gorange flavor 1 . 00 gred food coloring 0 . 05 gdistilled water to 100 . 00 ml______________________________________ about 60 g of distilled water are heated to 80 ° c . and the benzoic acid , tartaric acid , active substance , coloring and sugar are successively dissolved therein . after the solution has been cooled to ambient temperature the flavoring is added and the mixture is made up to the volume specified . the syrup is filtered . ______________________________________active substance 0 . 00025 mgsoya lecithin 0 . 05000 mgpropellant gas mixture 11 / 12 / 114 ( 23 : 54 : 23 ) 69 . 94975 mg 70 . 00000 mg______________________________________ ______________________________________active substance 0 . 00025 mg99 . 9 % pure ethanol 0 . 87500 mgpropellant gas mixture 11 / 12 / 114 ( 23 : 54 : 23 ) 69 . 12475 mg 70 . 00000 mg______________________________________ solution for inhalation containing 59 mg of (-)- cimaterol per 100 ml ______________________________________active substance 0 . 59 mgsodium chloride 900 . 00 mgbenzalkonium chloride 25 . 00 mgdistilled water to 100 . 00 ml______________________________________ the active substance , common salt and benzalkonium chloride are dissolved in distilled water and then filtered to remove any pathogens . ______________________________________barley 379 g / kgwheat flour 200 g / kgmanioc flour 135 g / kgbroad beans 100 g / kgshredded rape extract 100 g / kgedible fat 65 g / kglysine - rich mineral feed for pigs 20 g / kgactive substance premix 1 g / kg______________________________________ after being carefully mixed in the quantities specified these components yield 1 kg of feed . the 1 g of active substance premix contains for example 2 mg of active substance and 0 . 998 g of corn starch . ______________________________________maize 634 g / kgsoya bean flour 260 g / kgmeatmeal 40 g / kgedible fat 25 g / kgsoya oil 17 g / kgbicalcium phosphate 12 g / kgcalcium carbonate 6 g / kgvitamin / mineral mix 5 g / kgactive substance premix 1 g / kg______________________________________ after being carefully mixed in the quantities specified , these components yield 1 kg of feed . the 1 g of active substance premix contains for example 1 mg of active substance and 0 . 999 g of corn starch . ______________________________________shredded sugar beet 600 . 0 g / kgmaize gluten 100 . 0 g / kgmalt germs 50 . 0 g / kgsoya bean flour 35 . 0 g / kgwheat 119 . 0 g / kgmolasses 60 . 0 g / kgfeed phosphates 12 . 0 g / kgcalcium carbonate 2 . 5 g / kgsalt 5 . 0 g / kgminerals 10 . 0 g / kgvitamin premix 5 . 5 g / kgactive substance premix 1 . 0 g / kg______________________________________ when carefully mixed in the quantities specified , these components yield 1 kg of feed . the 1 g of active substance premix contains for example 2 mg of active substance and 0 . 998 g of corn starch . ______________________________________barley 690 g / kgsoya bean flour 100 g / kgmaize 159 g / kgmolasses 30 g / kgvitamin / mineral mix 20 g / kgactive substance premix 1 g / kg______________________________________ when carefully mixed in the quantities specified , these components yield 1 kg of feed . the 1 g of active substance premix contains for example 2 mg of active substance and 0 . 998 g of corn starch .

US-8199693-A

starting from a herbaceous cutting , which may be derived from in vitro culture , of stock and of a herbaceous scion , the process consists of inserting the scion having a single bud , into the stock cutting , by bevelling the lower end 15 of the scion 12 &# 39 ; from two sides 17 , 18 , by slitting the upper end of the stock cutting in its middle , and by subsequently assembling the two parts 12 , 12 &# 39 ; by joining 20 , of transferring the base of the abovementioned grafted unit into a development medium 21 , of moistening the development medium 21 with a nutrient solution and of subsequently placing this unit in a container with a water - saturated atmosphere and at a temperature above 20 ° c ., while suppressing the bud 22 of the stock and growing the saplings in the greenhouse or under a polyethylene tunnel until the desired stage of growth .

in fig1 and 1a , the traditional sapling is denoted by 1 , it comprises a stock 4 and a scion 5 , the roots being represented by 7 . the length of such a sapling 1 is between 25 and 30 cm , its diameter φ 1 is 6 to 14 mm , its roots 7 are scarcely developed ( only some roots ), the internode length is approximately 10 cm , and the join of stock 4 and scion 5 is thick and often exhibits necrotic parts . the sapling according to fig1 is a sapling in the phase of dormancy , while that of fig1 a is a sapling in its growth phase , the leaves of the scion having the reference number 6 . fig2 and 2a , the grafted sapling derived from in vitro culture and obtained by grafting on a stock plant or grafting on green wood is denoted by 2 , it comprises a stock 4 &# 39 ; and a scion 5 &# 39 ;, the roots being denoted by 7 &# 39 ;. the length of such a sapling 2 is between 15 and 30 cm , its diameter φ 2 is from 1 . 5 to 5 mm , its roots 7 &# 39 ; are hairy and large , internode length is very variable and sensibly between 2 and 5 cm , and the stock 4 &# 39 ;/ scion 5 &# 39 ; join is a simple swelling . the sapling according to fig2 is a sapling in the phase of dormancy , while that of the fig2 a is a sapling in its growth phase , the leaves of the scion having the reference number 6 &# 39 ;. in fig3 and 3a , the grafted sapling according to the invention derived from in vitro culture and obtained by grafting onto a stock cutting , is denoted by 3 . it comprises a stock 4 &# 34 ; and a scion 5 &# 34 ;, the roots being denoted by 7 &# 34 ;. the length of the sapling 3 is between 15 and 30 cm , its diameter φ 3 is from 3 to 5 mm , its roots 7 &# 34 ; are hairy and large , internode length is 10 ± 2 cm , the stock 4 &# 34 ;/ scion 5 &# 34 ; join is in the future assimilated with the plant . the sapling in fig3 is a sapling in the phase of dormancy , while that of fig4 is a sapling in its growth phase , 6 &# 34 ; denoting the leaves of the scion . fig4 and 5 show the different steps for obtaining a cutting of stock 12 and of scion 12 &# 39 ;, respectively . steps i and ii in these figures corresponds to the in vitro culture 9 , 9 &# 39 ; for obtaining young saplings of stock and of scion . step iii shows the young saplings of stock 8 and of scion 8 &# 39 ;. they have been grown in the greenhouse or in a polyethylene tunnel , when the temperature conditions permit this . within 2 or 3 months , herbaceous branches of stock 10 and herbaceous branches of scion 10 &# 39 ; are obtained , according to step iv , with internodes 11 , 11 &# 39 ;, respectively , having a length of 10 ± 2 cm . according to step iv , stock cuttings 12 are taken from the stock saplings , the basal part of which is cut either just below an eye 13 or in the middle part 14 of an internode 11 , the stock saplings containing the upper eye 13 as well as the major part of the following internode 11 . the stock cutting 12 thus obtained comprises all , or part of an internode 11 , an intermediate node with its leaf and its secondary bud , and all , or part of , the upper internode . scions 12 &# 39 ; having a single bud are simultaneously taken from scion saplings according to step iv of fig5 . the success of the cutting / grafting or grafting / cutting operation , is influenced by both the stock 4 &# 34 ; and the scion 5 &# 34 ; maintaining all , or part of , the leaf each of them carries , respectively ; since this is too large , it may be reduced by a third of its surface . the base 15 of the scion 12 &# 39 ; is joined to the upper part 16 of the stock cutting 12 either by manual grafting or by mechanical grafting . whichever method is used , the principle of grafting is the same : the end 15 of scion 12 &# 39 ; is bevelled from two sides 17 , 18 , having an angle of 16 °± 4 °, while the end of the stock cutting 12 is split at 19 in its middle on a length of 5 to 10 mm . these two steps are illustrated in fig6 by i and ii . according to steps iii of fig6 the two parts 12 , 12 &# 39 ; are then assembled by joining 20 . the base of this unit is then transferred as shown in steps iv of fig6 to a development medium 21 . this development medium 12 consists either of a cube of rock wool or of a pot containing a mixture of peat and pozzolana or any other substrate ; either of these is moistened with a nutritive solution and then placed into a container under an atmosphere saturated with humidity of approximately 90 to 100 % and at a temperature of 20 ° to 30 ° c . various solutions may be used such as , for example , a solution based on calcium nitrate , potassium nitrate , magnesium sulphate , ammonium nitrate , potassium hydrogen phosphate , iron citrate and a mixture of several trace elements . the stock / scion join , as illustrated in steps v and vi in fig6 and the production of roots 7 &# 34 ; are simultaneously obtained after approximately 10 days , after which it is very easy to suppress bud 22 of the stock 12 , so that its development leaves scion 12 &# 39 ; undisturbed . the saplings 23 are thus grown either in the greenhouse or in a polyethylene tunnel . in this manner , it is possible to obtain saplings ready for planting in the vineyard seven weeks after grafting , and with a success rate of 85 ± 5 %. the present invention is described with reference to grafting grape vine saplings , but it can also be applied to the grafting of all the other saplings which are not grape vine saplings but need grafting . the herbaceous material 10 , 10 &# 39 ; derived from in vitro culture 9 , 9 &# 39 ; has a certain number of original features which ensure good success of the cutting / grafting or grafting / cutting . it exhibits exceptional rooting ability which is very highly superior to that of young herbaceous shoots taken from a plant grown under natural conditions . this holds true for grape vines but also for amygdalopersica gf 677 , rosebushes , etc . this feature is particularly striking for amygdalopersica which is known for its weak rooting ability , as far as traditional techniques of vegetative propagation ( cuttings , multiplication by layering ); starting from in vitro - derived material , root formation on young cuttings of more than 90 % can be obtained in this plant , and the process can be repeated several times after transferring from the tube before the ability to form roots decreases . also , the quality of the join of in vitro - derived products from stock 4 &# 34 ; and scion 5 &# 34 ; depends very much on the physiological age of the two partners and on their state of health . as far as the physiological age is concerned , the microplant derived from in vitro culture is undoubtedly a starting material the features of which are very similar to the material derived from seed germination ; both are provided with a cambium in the course of formation which , at the molecular level , do not yet exert all the functions which the adult plant will have . thanks to in vitro culture , biological material of stock and of scion is provided which has the same physiological age and , more precisely , which has the features of juvenile plants ; the two partners therefore have a better chance of , or less restriction in , amalgamating and allowing a rapid and excellent join which ensures an excellent connection between the vessels of the stock 4 &# 34 ; and those of the scion 5 &# 34 ;. it is important to not that , as in vitro culture - derived plants have started the molecular processes which lead to extensive synthesis of phenolic compounds , which can easily be located by the oxidation of the base of the cuttings taken from the middle part of an internode 11 , the success of the grafting process decreases considerably , i . e . by 30 to 40 %. it is possible to delay this biochemical development in young saplings of grape vine by keeping them at a temperature which is constantly higher than 20 ° c ., more particularly between 20 ° and 30 ° c . the advantages of the process of the present invention are easily understood : first of all , an economic advantages since it is possible to obtain in a very short time a vast number of saplings which can be planted in the vineyard . in the case of traditional grafting , starting from one stock cutting and one scion , 0 . 35 of a sapling is obtained in six or twelve months . with grafting of immature wood , starting from one stock cutting and one scion cutting , 0 . 80 of a sapling is obtained in 10 weeks . in contrast , in the process according to the present invention of herbaceous grafting , it is possible to obtain four stock cuttings and and four scions every four weeks , starting from one stock sapling and one scion sapling , yielding 3 . 2 saplings within seven weeks . furthermore there is an advantage in the improved quality because grafting is carried out in a herbaceous phase having young cellules having a strong multiplication potential . all these factors permit perfect adherence , without necrosis , as is the case in traditional grafting . as far as the influence of the state of health on the success of the process is concerned , it also has to be taken into account that meristem culture introduces an additional positive factor with regard to thermotherapy . in point of fact , meristem culture permits the elimination of viruses still unknown because they are only slightly pathogenic , viruses which are not destroyed by thermotherapy itself because the latter is associated with apex culture . now , multiplication of these obviously restrained viruses is not totally without effect on the development of the plant , which is the more important if two partners are linked , as is the case in grafting ; one of the two might contain a virus of very low pathogenicity for itself but which disturbs more deeply the metabolism of the other , resulting in the possibility of the occurrence of an incompatibility of stock / scion which is more or less severe . the process according to the present invention must allow this phenomenon to be restricted . the process of the invention of herbaceous grafting can be applied to all ligneous or semi - ligneous plants where production demands grafting . the product obtained by the process according to the present invention is very characteristic because of its diameter , which , for the grape vine , is in the range of 3 to 5 mm , and because the internode length is , for the grape vine , approximately 10 to ± 2 cm and , on eventually , the join is assimilated to the plant as shown in fig3 where it is seen that the stock 4 &# 34 ;/ scion 5 &# 34 ; join is neat . it should be noted that as an example in step ( g ), the saplings 23 are grown in the greenhouse or under a polyethylene tunnel for approximately seven weeks . culture of the young saplings of stock and of scion ( 8 , 8 &# 39 ;) in the greenhouse or under protective cover ensures that stock cuttings and scions are obtained during a period which can be continued until the conditions of development are not favourable any longer . the detection of viral - type diseases of which the pathogens are not characterized yet is carried out by scoring on indicator varieties . the standard system of producing joined grafts in the nursery , with transplantation into the vineyard , does not permit a definite decision before three years . modern techniques of scoring on the immature wood , or in vitro on hypocotyl axes of non - rooted seedling have allowed this limit to be shortened to a few weeks after grafting . the present invention allows the same time limit of response as the modern techniques for combating these diseases , but has the advantage of being more simple and more reliable , hence more economical .

US-41457189-A

total immersion photography is disclosed , preferably for the use of screening for various medical and cosmetic conditions . tip , in a preferred embodiment , comprises an enclosed structure that may be sized in accordance with an entire person , or individual body parts . disposed therein are a plurality of imaging means which may gather a variety of information , e . g ., chemical , light , temperature , etc . in a preferred embodiment , a computer and plurality of usb hubs are used to remotely operate and control digital cameras . the photo information is then transferred via the usb to the computer for processing and aggregation . subject information is gathered to configure the operation of the various parameters of the device .

this invention teaches a tip device that provides non - occluded images by employing an array of imaging devices and thereafter combining individual images to form a continuous image . it has been heretofore contemplated that the device could find use as an aid in screening and diagnosis of conditions of soft tissue , hair and nails . furthermore , it could also find use as a beauty aid to consult those considering cosmetic surgery or changes in personal appearance . thus , the following detailed description , read with the above - described drawings will serve to explain various preferred embodiments and components of the present invention . fig1 depicts a horizontal cross section of an embodiment of the tip system 100 in accordance with the present invention . the system may be sized in any fashion to accord with the application . for example , should the system be used to image an entire person , the system will be sized such that the person could easily stand at the center 108 of the device 100 with sufficient comfort . however , if the particular application is for the examination of something smaller , the scalp , for example , the device could be made smaller such that just a person &# 39 ; s cranium would fit comfortably at center 108 . the system 100 is comprised of several panels 109 . in this particular embodiment , fourteen ( 14 ) panels are used . the panels are interconnected to form an enclosed structure . in this particular embodiment , an 8 - sided polygon was chosen . the shape is arbitrary , however , the only requirement is that the panels are set up in mirrored pairs . each panel 109 is comprised of an imager array 102 , comprising a vertical array of imaging devices . the imaging devices could comprise standard or digital cameras , or other devices capable of capturing light , temperature , chemical information or other information of interest . in this embodiment , we assume the use of digital cameras operating in the conventional fashion . thus , in order to optimize the performance of the cameras , light sources 101 are utilized . while fluorescent tubes are the preferred means , any type of illumination can be used , for example , a wood &# 39 ; s lamp may be used . these light sources 101 can be always on , or , alternatively , only activated when the cameras are operating . supporting the imager array 102 is the perimeter wall 103 . the perimeter wall can be made of plywood , particle board or any other structural material capable of supporting the structure . in front of the light sources 101 and imager array 102 is shield 107 . shield 107 protects the imager array 102 and light sources 101 from contact with the subject . standard ⅛ ″ obscured plexiglass can be used as shield 107 , and furthermore , a shield with variable transmittance is contemplated . in between the plurality of panels 109 , there are dividers 106 . dividers 106 function to provide stability for shield 107 , and also , when made opaque , reduce light interference between adjacent imager arrays 102 . to effect access and egress , panels 104 function as a doorway . by rotating on hinge 105 , panels 104 swing outward , thus allowing access to the interior of system 100 . a system 100 is also contemplated without doorway 104 that can be used for examining small objects , such as the scalp or hands , for example . fig2 depicts an exemplary panel 200 of a tip system in accordance with the present invention . supporting the panel 200 , is perimeter wall 207 . perimeter wall 207 can be flat , curved or angled in any fashion to accommodate the desired perimeter shape . supported by the perimeter wall 207 are imaging arrays 205 and 206 and light sources 202 and 208 . while this exemplary panel utilizes dual imaging arrays 205 , 206 and light sources 202 , 208 , the panel may be configured in any fashion utilizing at least one imaging array . light sources 202 , 208 are optional , and depending on the type of imaging done , e . g ., chemical , may be unnecessary . however , in the present embodiment , light sources 202 and 208 are taken to be standard fluorescent tubes . they could also be , for example , wood &# 39 ; s lamps . imaging arrays 205 and 206 comprise a plurality of imaging devices 203 . imaging devices 203 may be a standard or digital camera , or any other type of device capable of capturing the desired information from the subject with the imaging system . imaging devices 203 are controlled through cables 204 . these cables may be used to remotely trigger a mechanical actuator or , as is contemplated herein , act as part of an electronic interface such as usb . imaging arrays 205 and 206 are depicted herein as vertical arrays of 5 imaging devices 203 . in practice , the array can vary greatly . for use in smaller examinations , e . g ., the scalp , it is suggested that less imaging devices 203 would be required to generate a complete image . fig3 depicts a horizontal cross section of an alternate embodiment of an imaging system 300 in accordance with the present invention utilizing a circular periphery . the system 300 may be sized in any fashion to accord with the application . for example , should the system be used to image an entire person , the system will be sized such that the person could easily stand at the center 308 of the device 300 with sufficient comfort . however , if the particular application is for the examination of something smaller , the scalp , for example , the device could be made smaller such that just a person &# 39 ; s cranium would comfortably at center 308 . the system 300 is comprised of several panels 309 . in this particular embodiment , eight ( 8 ) panels are used . the panels are interconnected to form an enclosed structure . in this particular embodiment , a circle was constructed . the shape is arbitrary , however , the only requirement is that the panels are set up in mirrored pairs . each panel 301 is comprised of an imager array 302 , comprising a vertical array of imaging devices . the imaging devices could comprise standard or digital cameras , or other devices capable of capturing light , temperature or chemical information . in this embodiment , we assume the use of digital cameras operating in the conventional fashion . thus , in order to optimize the performance of the cameras , light sources 303 are utilized . while fluorescent tubes are the preferred means , any type of illumination can be used . these light sources 303 can be always on , or , alternatively , only activated when the cameras are operating . supporting the imager array 302 is the perimeter wall 310 . the perimeter wall can be made of plywood , particleboard or any other structural material capable of supporting the structure . in front of the light sources 303 and imager array 302 is shield 309 . shield 309 protects the imager array 302 and light sources 303 from contact with the subject . standard ⅛ ″ obscured plexiglass can be used as shield 309 , and furthermore , a shield with variable transmittance is contemplated . in between the plurality of panels 301 , there are dividers 306 . dividers 306 function to provide stability for shield 309 , and also , when made opaque , reduce light interference between adjacent imager arrays 302 . to effect access and egress , panel 304 functions as a doorway . by rotating on a double - hinge hinge 305 and clearing angled divider 307 , panel 304 swings outward , thus allowing access to the interior of system 300 . a system 300 is also contemplated without doorway 304 that can be used for examining small objects , such as the scalp or hands , for example . fig4 depicts an exemplary imaging device 400 for use with the present invention . in practice , the imaging device 400 may be a standard or digital camera , or any other type of device capable of capturing the desired information from the subject with the imaging system . for example , devices capable of recording infrared or chemical information could be used . the present embodiment , however , contemplates the use of a digital camera as exemplified by the current figure . such a device would comprise lens 403 , mechanical actuator 402 and control cable 401 . preferably , cable 401 is used to electronically control , and further , download digital image information from imaging device 400 . as is contemplated herein , the electronic control could be usb . alternatively , control cable 401 could be used to trigger mechanical actuator 402 . although the present figure describes a specific imaging device , it should be understood that a wide variety of data collection devices could be employed without departing from the scope of the present invention . fig5 depicts a schematic of a complete image processing system 500 in accordance with the present invention . as discussed above in fig1 , imaging system 100 may be sized in any fashion to accord with the application . for example , should the system be used to image an entire person , the system will be sized such that the person could easily stand at the center 108 of the device 100 with sufficient comfort . however , if the particular application is for the examination of something smaller , the scalp , for example , the device could be made smaller such that just a person &# 39 ; s cranium would fit comfortably at center 108 . the system 100 is comprised of several panels 109 . in this particular embodiment , fourteen ( 14 ) panels are used . the panels are interconnected to form an enclosed structure . in this particular embodiment , an 8 - sided polygon was chosen . the shape is arbitrary , however , the only requirement is that the panels are set up in mirrored pairs . each panel 109 is comprised of an imager array 102 , comprising a vertical array of imaging devices . imaging arrays 507 through 519 can be identical to imager array 102 , or may vary in the information they garner in accord with the desired application . the present embodiment , however , contemplates identical imaging devices . the imaging devices could comprise standard or digital cameras , or other devices capable of capturing light , temperature or chemical information . in this embodiment , we assume the use of digital cameras operating in the conventional fashion . thus , in order to optimize the performance of the cameras , light sources 101 are utilized . each imaging array may utilize a light source 101 to enhance imaging ability . furthermore , each of said light sources could have varying characteristics to accord with the application . while fluorescent tubes are the preferred means , any type of illumination can be used . these light sources 101 can be always on , or , alternatively , only activated when the cameras are operating . supporting the imager array 102 is the perimeter wall 103 . the perimeter wall can be made of plywood , particle board or any other structural material capable of supporting the structure . in front of the light sources 101 and imager arrays 102 and 507 - 519 is shield 107 . shield 107 protects the imager arrays 102 and 507 through 519 and light sources 101 from contact with the subject . standard ⅛ ″ obscured plexiglass can be used as shield 107 , and furthermore , a shield with variable transmittance is contemplated . in between the plurality of panels 109 , there are dividers 106 . dividers 106 function to provide stability for shield 107 , and also , when made opaque , reduce light interference between adjacent imager arrays 102 and 507 through 519 . to effect access and egress , panels 104 function as a doorway . by rotating on hinge 105 , panels 104 swing outward , thus allowing access to the interior of system 100 . a system 100 is also contemplated without doorway 104 that can be used for examining small objects , such as the scalp or hands , for example . in order to effect the processing of the multiple images garnered from the plurality of imaging arrays , the imager arrays 102 and 507 through 519 are networked to a single computer 501 . the present embodiment contemplates the use of usb to network the arrays 102 and 507 through 519 . the imaging devices of arrays 102 , 507 , 508 and 509 are connected to usb hub 506 via interface cabling 102 a , 507 a , 508 a and 509 a , respectively . the imaging devices of arrays 517 , 518 and 519 are connected to usb hub 505 via interface cabling 517 a , 518 a and 519 a , respectively . the imaging devices of arrays 514 , 515 and 516 connected to usb hub 504 via interface cabling 514 a , 515 a and 516 a , respectively . the imaging devices of arrays 510 , 511 , 512 and 513 are connected to usb hub 503 via interface cabling 510 a , 511 a , 512 a and 513 a , respectively . hub 506 is connected with hub 503 via cable 520 . hub 505 is connected with hub 504 via cable 521 . hubs 503 and 504 are then connected to hub 502 via cables 522 and 523 , respectively . finally , hub 502 , which has the totality of imaging devices of imaging arrays 102 and 507 through 519 connected thereto , is connected to computer 501 via cable 524 . the computer 501 is used to process the individual images garnered from each imaging device of each imaging array 102 and 507 through 519 to create a non - occluded image of the subject within system 100 , and preferably , at center 108 . it should be noted that the arrangement of hubs 506 , 505 , 504 , 503 and 502 and the concomitant cabling presented heretofore is merely exemplary , and anyone with skill in the art will recognize the myriad ways of interconnecting the imaging devices of imaging arrays 102 and 507 through 519 to computer 501 . while the present invention has been described with reference to one or more preferred embodiments , which embodiments have been set forth in considerable detail for the purposes of making a complete disclosure of the invention , such embodiments are merely exemplary and are not intended to be limiting or represent an exhaustive enumeration of all aspects of the invention . the scope of the invention , therefore , shall be defined solely by the following claims . further , it will be apparent to those of skill in the art that numerous changes may be made in such details without departing from the spirit and the principles of the invention .

US-10281008-A

an assembly for a seafood cleaning machines provides increased efficiency and decreases loss of meat of cleaned seafood items , such as shrimp , prawns , and the like . the assembly has a plurality of parallel rollers , a plurality of secondary rollers spaced between and mounted slightly above the power rollers , and a plurality of insert rollers fitted between adjacent power rollers and secondary rollers . each insert roller has a variable diameter outside surface , gradually increasing from an upstream portion to the downstream portion . smaller diameter upstream portion forms a tighter channel between the rollers and help the rollers to grab even smaller portions of the inedible parts of the crustaceans . to remove peeled off inedible portions , the assembly provides for a two - level water spraying , from above and below the insert rollers , thereby preventing a build - up of debris on the rollers and decreasing a possibility of over - peeling .

turning now to the drawings in more detail , numeral 10 designates the assembly for a seafood cleaning machine in accordance with the present invention . as can be seen in the drawings , the assembly comprises a plurality of power rollers 12 mounted in a parallel , spaced - apart relationship to each other and secured at one of their ends to a back wall 14 of a seafood cleaning machine . the drawing of a seafood cleaning machine is omitted for clarity , it is to be understood that the seafood cleaning machine is provided with conventional power source , drive mechanism for operation of the rollers and movement of the water conduits , as will be described in more detail hereinafter . the power source may be an actuating mechanism with a pinion and rack arrangement to impart a reciprocating movement on the rollers . mounted above the power rollers 12 , in a substantially parallel relationship to the longitudinal axes of the rollers 12 is a plurality of secondary rollers 16 . the rollers 16 are also secured by their first ends , through shafts 18 to the back wall 14 for reciprocating movement about the axes of the shafts 18 . as can be seen in the drawings , the diameter of the secondary rollers 16 is smaller than the diameter of the power rollers 12 . the rollers 16 are positioned between the power rollers 12 ( see fig3 ) and cover spaces between the power rollers 12 , leaving narrow gaps between the outer surfaces of the power rollers 12 and the secondary rollers 16 . a plurality of insert rollers 20 , 22 , are mounted between the adjacent power rollers and the secondary rollers 16 to substantially close the created gap . the insert rollers 20 , 22 cover the areas , or spaces formed between the power rollers 12 and the secondary rollers 16 . in effect , the assembly 10 has a plurality of roller units , each unit formed by five rollers : one power roller 12 , two secondary rollers 16 , and two insert rollers 20 and 22 . as shown in fig3 an example of a roller unit is designated by a power roller 12 a , a secondary roller 16 a , a secondary roller 16 b , an insert roller 20 and a second insert roller 22 . a frictional contact exists between the rollers of each roller unit . a number of channels are defined by adjacent power rollers and secondary rollers 16 , with the insert rollers 20 and 22 fitted within these channels . each insert roller 20 , 22 can be composed of one or more individual sections . in the drawings , each insert roller 20 or 22 is shown to consist of four sections 24 , 26 , 28 , and 30 . each roller section 24 , 26 , 28 , and 30 is secured by a pair of tie down plates 32 , 34 . the tie down plates are secured to the central shaft 36 , which extends outwardly from the main body of each insert roller 22 , 24 . an aperture 40 is formed in a free end of the plates 32 or 34 , and a hook 42 is inserted through the aperture 40 . the hook 42 is connected to a spring 44 that allows adjustment of the relative position of the inserts 20 , 22 in relation to the channels formed between the adjacent power rollers 12 and secondary rollers 16 . the spring 44 allows for a resilient mounting of the insert rollers within a seafood cleaning machine . turning now to fig4 the design of the insert rollers is shown in more detail . the insert roller sections 24 , 26 , 28 , and . 30 ( only sections 24 , 26 , 28 are shown in fig4 ) have different outside diameters , with the smallest diameter section 30 being adjacent to the upstream portion of the assembly and the largest diameter portion 24 being adjacent to the downstream portion of the assembly 10 . for instance , section 30 may have an outside diameter of { fraction ( 5 / 16 )}″, section 28 may have an outside diameter { fraction ( 6 / 16 )}″, section 26 may have an outside diameter of { fraction ( 7 / 16 )}″ and section 24 may have the largest diameter of { fraction ( 8 / 16 )}″. each section , 24 , 26 , 28 , and 30 reciprocates independently about its longitudinal axis . when a seafood product , for example shrimp , are deposited onto the roller assembly , such as delivered by a conveyor or from the hopper , the smallest portions of the shrimp , such as appendages , are caught between the smallest diameter insert portion 30 and the adjacent secondary roller 16 and the power roller 12 . the insert roller portion 30 , being relatively narrow , allows to form a tighter pinching channel between the adjacent rollers 12 and 16 and cause even small protuberances of the shrimp shell to be caught between the rollers . at the same time , no damage is imparted on the shrimp meat . as the seafood item , such as shrimp , progresses downstream towards the insert roller portion 24 , the hull portions that are still adhering to the shrimp will be caught and pulled away from the shrimp body , leaving clean , unblemished shrimp meat intact . in addition to providing better peeling capability , the variable diameter insert rod portions prevent loss of valuable water . it was observed that when the shell buildup is created on the insert rods 20 , 22 , the rods , being tied down at opposite ends by the tie down plates 32 and 34 , tend to lift themselves from their usual contact position with the power rod 12 and the secondary rods 16 and form a “ bow .” water can seep through the created gap and be lost in the process . with the insert rollers 20 and 22 being composed of sections having gradually increasing diameters , the problem of damage to the valuable natural resource is substantially decreased or altogether eliminated . in operation , the power rollers 12 and the secondary rollers 16 reciprocate back and forth , rotating about 280 degrees about their respective axes , i . e . the rollers move about their axes in one direction , then stop and reverse the direction of movement . this reciprocating movement causes the shrimp that is deposited on the roller assembly 10 to move between the rollers and have their shells , or hulls peeled away along with whiskers , appendages , etc . it is envisioned that a one - piece insert roller 20 or 22 can be utilized for the purposes of the present invention when an insert roller has a frustoconical configuration , with an apex , that is the narrowest portion being positioned in the upstream portion of the roller assembly and the base of the frustoconical insert roller being adjacent to the downstream portion of the roller assembly . for instance , if the power roller 12 is selected to have 3 ″ in diameter and the secondary rollers 16 have an outside diameter of 2½ ″, the insert rollers 20 , 22 can gradually increase in their outside diameter from { fraction ( 5 / 16 )}″ to { fraction ( 8 / 16 )}″. it has been found that the use of the different diameter insert roller portions produces a much more beneficial result in the cleaning capability of the assembly than a conventional approach of changing the texture or the friction capability of the rollers &# 39 ; exterior . as the shrimp peeling process continues , the removed hull , appendages , whiskers , and other inedible parts are being pulled away , leaving edible portions intact . to facilitate movement of the shrimp and the removed portions downstream , the roller assembly 10 is positioned on an incline , with an upstream section being higher than the downstream section . water is used to facilitate movement of the peeled shrimp and the removed portions to the downstream end . water is supplied from above the roller assembly 10 and from a level underneath the roller assembly . the upper portion of the water supply lines comprises a plurality of transverse water conduits , or pipes 50 ( only one is shown in fig1 ), spaced from each other and arranged in a parallel relationship to each other . the pipes 50 are carried by a frame 52 and secured to a side wall 54 of a cleaning machine . the frame 52 comprises a water supply line 56 supported by a pair of support members 58 and 60 . the support members 58 and 60 are secured at a right angle to the underside of the water supply line 56 . the support members 58 and 60 are securely attached to a rail 62 . a plurality of guide rollers 64 ride on the upper surface of the rail 62 . a matching number of lower guide rollers 66 slide along the bottom surface of the rail 62 . the rollers 64 , 66 are arranged in pairs , as shown in fig1 and are secured at their free ends to a bracket 68 . the brackets 68 are fixedly attached to a bar 74 , which in turn is fixedly attached to the back wall 14 . a crank 70 is secured at one end to the water supply line 56 and , at its other end to a rotating disk 72 . the disk 72 is connected to a power source ( not shown ) which moves the disk 72 causing the fixedly attached crank 70 to move back and forth , pulling the frame 52 and , thereby moving the water pipes 50 a distance above the roller assembly 10 . the diameter of the disk 72 controls the distance to which the pipes 50 travel across the roller assembly 10 . the guide rollers 64 and 66 rotate and move along the rail 62 , facilitating reciprocating movement of the frame 52 above the roller assembly 10 . a plurality of upper spray nozzles 76 is attached to the underside of each waterline , or pipe 50 . the nozzles 76 are oriented with their openings facing down , so that jets of water , shown in phantom lines 78 in fig2 and 3 , are directed from above onto the insert rollers 20 and 22 . the spray flow 78 helps wash away the debris and facilitates movement of the cleaned seafood items downstream along the roller assembly . the distance to which the water conduits 50 travels can be as little as 6 - 7 ″ in one direction . the travel distance of the water pipes 50 is not designed to cover the entire surface of the roller assembly 10 . it was observed that with time , the buildup of removed inedible matter becomes so substantial that it prevents normal movement of the product along the roller assembly 10 , and the water supply from only the top of the roller assembly is not sufficient . in order to prevent the build - up of debris on the insert rollers 20 , 22 , an upward stream of cleaning water is provided in the assembly of the present invention . as shown in the drawings , one or more lower water supply lines 80 extend underneath the rollers 12 , each lower water conduit 80 being also connected to the frame 52 . a plurality of spray nozzles 82 is secured in fluid communication with each water supply conduit 80 on one side of the pipe 80 . a plurality of similar spray nozzles 84 is positioned on the opposite side of the pipe 80 . the spray nozzles 82 and 84 are secured at an acute angle in relation to the longitudinal axis of the pipe 80 . the angle of the direction of the jet heads 82 and 84 can be 30 to 45 degrees in relation to the longitudinal axis of the pipe 80 . as shown in fig3 the spray nozzles 82 and 84 are oriented in opposite directions , sending sprays of water shown in phantom lines 86 and 88 , respectively , between the secondary rollers 16 , towards the insert rollers 20 , 22 , where the most likely buildup is to occur . in operation , the water supply frame 52 is connected to a timer ( not shown ) for intermittent operation of the jet nozzles 76 , 82 , and 84 . the usual cycle consists of a few seconds of spray , while the frame 52 travels alongside the roller assembly 10 , then an idle pause , when the frame 52 comes to a stop . then , a flushing step takes place , when the water flow is delivered through the pipes 50 and 80 and to the spray heads 76 , 82 , and 84 , flushing the rollers with water and dislodging any accumulated debris . then the frame 52 moves in the opposite direction , while continuing to spray the rollers , stopping at the end of the travel and providing the flushing step again . the intermittent cycles of spraying continue while the peeling of the seafood items deposited on the rollers takes place . it is preferred that the spray nozzles 76 , 82 , and 84 be directed towards the insert rollers 20 , 22 , to a place where the possibility of a build - up exists . when providing the intermittent spraying and flushing steps in the cleaning cycle , the valuable natural resource , water , can be saved and not lost to a flow between the rollers , as it would be , had a buildup of peeled off inedible portions be allowed to continue . when the shells and other inedible portions are continuously removed from the rollers , the seafood items are cleaned better and the loss of the edible portions due to over peeling is substantially minimized . the flushed - away inedible portions are removed from the downstream portion of the assembly 10 and are disposed of in the usual manner . the edible portions of the seafood items , such as cleaned shrimp , are deposited into a container , from where the product can be packaged , frozen or otherwise processed for delivery to a customer . it is envisioned that the power rollers 12 and the secondary rollers 16 can be covered with soft resilient sleeves , for example made of rubber , and the insert rollers 20 , 22 be made of a non - corrosive material , such as stainless steel . the number of water lines 50 and 80 can vary depending on the length of the rollers and can be 3 or 4 in number . the spring action of the hook 42 , securing the insert rollers 20 , 22 can be easily adjusted by the selection of the spring 44 having different tensile characteristics . many other changes and modifications can be made in the design of the present invention without departing from the spirit thereof . i , therefore , pray that my rights to the present invention be limited only by the scope of the appended claims .

US-79096201-A

a dowel pin has a plurality of facets which provide numerous planes , edges and angles to constrain the dowel pin and an associated die segment to a particular orientation with respect to the base of a dental model , and to enhance the durability of the model .

referring now to the drawings in detail , wherein like reference numerals indicate like elements , there is seen in fig1 a dental model designated generally by the reference numeral 10 . the model 10 consists of a base 12 , typically cast from the materials known in dentistry as laboratory stone or plaster , and a die model 14 , typically cast from the material known in dentistry as die stone . referring to fig2 the die model 14 , which is cast in a single piece , may be cut , by sawing or the like , into individual segments , each , like the illustrated segments 16 , 18 , 20 providing a die of one or more teeth . at least one dowel pin , such as the dowel pin 22 seen in fig2 serves to position and index each of the segments 16 , 18 , 20 with respect to the base 12 . the dowel pin 22 in accordance with the invention comprises a stem 24 , which , like conventional dowel pins , may have a generally cylindrical knurled stem 24 . referring to fig4 in which the die segment 16 is seen in cross section , the stem 24 of the dowel pin 22 may be permanently embedded in the die segment 16 in a conventional manner , and affixed to the die segment 16 by adhesive or other suitable means , not shown . in conventional practice , the die model 14 is drilled to receive the stems 24 of the dowel pins 22 before being cut into individual segments . referring now to fig2 and 4 , coupled to the stem 24 of the dowel pin 22 is a body portion 26 . the body portion 26 extends axially from the stem 24 ( and vice versa ), and is axially aligned therewith . the body portion 26 is tapered , and has what may be described as a generally frusto - conical shape , tapering from an enlarged upper part adjacent to the stem 24 to a relatively narrow distal end 28 . as is perhaps best seen in fig5 the body portion 26 of the dowel pin 22 is , at its upper part , generally circular in cross section , but the circular cross - section is modified by a first facet 30 , which faces laterally outwardly with respect to the longitudinal axis of the body portion ( as is perhaps best seen in fig6 ). as is evident from fig6 the facet 30 is disposed obliquely with respect to the axis of the body portion 26 . referring now to fig2 and 4 , the body portion 26 has on it a second facet 32 , facing laterally outwardly with respect to the axis of the body portion 26 , and disposed obliquely with respect to the first facet 30 . the second facet 32 is also disposed somewhat obliquely to the axis of the body portion 26 , but , in the presently preferred embodiment , not as markedly as the first facet 30 . a third facet 34 extends transversely with respect to the axis of the body portion 26 , and faces toward the distal end 28 of the body portion 26 . the third facet 34 defines a plane which intersects both the first facet 30 and the second facet 32 . the third facet 34 is disposed , in the thicker ( upper ) part of the body portion 26 , and preferably , approximately two - thirds of the axial distance from the distal end 28 . the above - described first , second and third facets , 30 , 32 and 34 , provide a positive positioning and index means for the die segments 16 , 18 and 20 with respect to the base 12 . in this regard , it will be seen from fig2 and 4 that the dowel pin 22 , when the die segment 16 is placed in association with the base 12 , resides in a cavity 36 . because , as is conventional , the base 12 is molded in situ around the die model 14 and dowel pins 22 , each cavity 36 conforms in its contour to the outer contour of the body portion 26 of the dowel pin 22 . the above described first , second and third facets 30 , 32 and 34 provide planes , edges and angles which serve , with the taper of the body portion 26 , to positively index and position each die segment with respect to the base 12 . thus , referring to fig2 and 6 , the first facet 30 intersects the generally circular outer contour of the body portion 26 at respective edges 38 and 40 of the kinds which would be provided by certain conventional dowel pins . in reference to fig7 the intersection of the second facet 32 and the first facet 30 is defined by an edge 42 , and the intersection of the second facet 32 and the outer contour of the body portion 26 is defined by yet another edge 44 . it will be apparent from fig2 and 7 that the contours of the cavity 36 abutting the first facet 30 and second facet 32 and the interaction of the edges 38 - 44 and their counterparts in the cavity 36 prevent rotation of the dowel pin 22 . the taper of the body portion 26 , the third facet 34 and the tip of the distal end 28 abut corresponding and like - contoured walls of the cavity 36 , and serve to positively index the height of the die segment with respect to the base 12 . the above - described configuration , it has been found , assures positive repositioning of each die segment 16 , 18 , 20 , etc . after the die segment has been removed from the base 12 for study , handling and use in connection with the preparation of dental prothesis . the numerous planes , edges and angles of the dowel pin 22 and cavity 36 constrain movement of the dowel pin 22 ( and hence the die segments 16 , 18 , 20 , etc .) with respect to the base 12 , and make models 10 which use dowel pins 22 in accordance with the present invention relatively durable . thus , the present invention provides continued accurate seating of the die segments notwithstanding minor wear and tear on the cavity 36 occasioned by repeated handling and use of the model 10 . in this regard , it is believed that the numerous planes , edges and angles result in a reduction of the stress at any given locality in the cavity 36 , thus , minimizing the tendency of the cavity to erode or become enlarged through usage . this result is achieved without the need for additional structural elements which have been used from time to time with dowel pins heretofore known , such as those illustrated in u . s . pat . no . 4 , 054 , 955 , issued oct . 25 , 1977 . that patent , among others , suggests the use of sleeves , embedded in the base of the model , to receive the distal ends of a dowel pin . in the use of the present invention , molding of the base 12 is done in precisely the same manner as it would if conventional dowel pins were used . no additional parts or special techniques are needed or used . the present invention may be embodied in other specific forms without departing from its spirit or essential attributes . accordingly , reference should be made to the appended claims , rather than the foregoing specification and accompanying drawings , for an indication of the scope of the invention .

US-54217583-A

a wall mounted drop - down mirrored vanity wherein the mirrored front panel drops down when opened to produce a shelf for placement of toiletry needs , such as , makeup , razors , hair product , toothbrushes , etc ., used especially in confined spaces .

the present invention will now be described with reference to the accompanying drawing figures wherein like reference numerals correspond to like elements in the several drawing figures . a wall mounted drop - down mirrored vanity ( 10 ) according to a first embodiment of the present invention includes a rear panel ( 12 ) secured to a frame ( 14 ), see drawing fig1 . frame ( 14 ) includes a generally flat top panel ( 16 ), and a pair of parallel , downwardly depending side panels ( 18 ) oriented roughly at right angles to the top panel ( 16 ). bottom panel ( 20 ) is secured near the bottom of side panels ( 18 ) and oriented roughly at a right angle with the side panels ( 18 ). top panel ( 16 ), bottom panel ( 20 ) and side panels ( 18 ) are secured to each other and are oriented to form a generally box shaped arrangement for frame ( 14 ). frame ( 14 ) in combination with rear panel ( 12 ), defines an interior compartment ( 22 ). the rear panel ( 12 ) of the interior compartment is comprised of a mirror . a front panel ( 24 ), having a front surface ( 26 ) and a back surface ( 28 ), is pivotably secured to the frame near bottom panel ( 20 ) via a hinge type mechanism ( 50 ). the front surface ( 26 ) of the front panel ( 24 ) is comprised of a mirror . the hinge type mechanism ( 50 ) may be of any known type that is recognized by those skilled in the art . the front panel ( 24 ) is hinged near the bottom of the panel so that when the front panel ( 24 ) is placed in its opened position , the lower portion of the front panel ( 24 ) acts as a force against the bottom panel ( 20 ) to maintain the front panel ( 24 ) in a shelf like position , so that the hinge type mechanism ( 50 ) is not over stressed . additional support may be added to further secure the front panel ( 24 ) in the drop - down position . the front panel ( 24 ) is secured to the top panel ( 16 ) with a latch mechanism ( 56 ). the latch mechanism ( 56 ) may be any known type that is recognized by those skilled in the art . a second embodiment of the wall mounted drop - down mirrored vanity is shown in drawing fig2 , where like reference numerals correspond to like elements . additionally , in this embodiment are fixed storage shelf units ( 30 ). the fixed storage shelf unit ( 30 ) is secured to each side panel ( 18 ) on the left and right sides , respectively . each fixed storage shelf unit ( 30 ) comprises a side panel ( 32 ) along with shelf panels ( 34 ). each shelf panel ( 34 ) being movable . a third embodiment of the wall mounted drop - down mirrored vanity is shown in drawing fig3 , where like reference numerals correspond to like elements . additionally , in this embodiment are movable storage shelf units ( 54 ). the movable storage shelf unit ( 54 ) makes up the side panels of this embodiment . each movable storage shelf unit ( 54 ) comprises a top panel ( 36 ), bottom panel ( 38 ), and side panels ( 40 ) along with shelf panels ( 34 ). the movable storage shelf units ( 54 ) are secured to the rear panel ( 12 ) at vertical positions with hinge type mechanisms ( 42 ). the hinge type mechanism ( 42 ) may be of any known type that is recognized by those skilled in the art . a fourth embodiment of the wall mounted drop - down mirrored vanity is shown in drawing fig4 , where like reference numerals correspond to like elements . additionally , in this embodiment are movable extension mirror units ( 60 ). the movable extension mirror units ( 60 ) comprise a left and right panel ( 62 & amp ; 64 ), respectively . each panel has a front surface ( 66 ) and back surface ( 68 ). the back surface ( 68 ) of each panel comprises a mirror ( 70 ). the movable extension mirror units ( 60 ) are secured to the rear panel ( 12 ) at vertical positions with hinge type mechanisms ( 42 ). the hinge type mechanism ( 42 ) may be of any known type that is recognized by those skilled in the art . when the movable extension units ( 60 ) are opened , the wall mounted drop - down mirrored vanity functions in a panoramic view with a total of three mirrors , the rear panel ( 12 ) and the two movable extension mirror units ( 60 , 62 & amp ; 64 ). a fifth embodiment of the wall mounted drop - down mirrored vanity is shown in drawing fig5 and 6a & amp ; 6 b , where like reference numerals correspond to like elements . additionally , in this embodiment an additional decorative arched mirror section ( 52 ) is added with the rear panel ( 12 ) along with decorative lights ( 44 ) and an electrical receptacle ( 46 ). the electrical receptacle ( 46 ) may or may not be ground fault protected and further , the electrical receptacle ( 46 ) may be modified to accept foreign power plug conventions . drawing fig6 a & amp ; 6b show the wall mounted drop - down mirrored vanity in a closed position , drawing fig6 a , and an open position , drawing fig6 b . the wall mounted drop - down mirrored vanity may be constructed of any of a various type of material , but not limited to wood , plastic , glass , laminate , plexiglas , or metal . additionally , the size of the wall mounted drop - down mirrored vanity may vary from thirteen and one - half ( 13 . 5 ) inches to the approximate width of a base cabinet or pedestal sink or vanity over which the wall mounted drop - down mirrored vanity is mounted . the height of the wall mounted drop - down mirrored vanity can vary from approximately eighteen ( 18 ) inches to full ceiling height . further , the wall mounted drop - down mirrored vanity may be flush mounted to a wall structure or recess mounted between two studs . as will be realized , the invention is capable of other and different embodiments , and its several details are capable of modifications in various respects , all without departing from the invention . accordingly , the drawings and description are to be regarded as illustrative in nature , and not in a restrictive or limiting sense , with the scope of the invention being indicated in the claims .

US-80665810-A

a method of treating protracted labor in a pregnant woman comprises administering to a pregnant woman an effective amount of a depolymerised low molecular weight heparin treated with periodate to eradicate antithrombin iii binding affinities , thereby exhibiting an anticoagulant activity of 10 bp units / mg or less and an average molecular weight not higher than 10000 da to prime or curatively treat the cervix and myometrium and for treatment of slow progress of labor . a method for prophylactic priming or curative treatment of the cervix and the myometrium for establishing effective labor in a pregnant woman comprises administering to a pregnant woman an effective amount of a depolymerised low molecular weight heparin as described to prophylactically prime or curatively treat the cervix and myometrium and for establishing effective labor in the pregnant woman .

it has recently been found that the expression of heparan sulfate proteoglycans varies during the uterine remodeling during pregnancy and labor . they are thus believed to play a pivotal role in labor . it has also been found that treatment of human uterine strips with sulfated glycosaminoglycans enhances the contractile activity thereof . the present invention refers to the use of sulfated glycosaminoglycans having an anticoagulant activity of 100 bp units / mg or less for the manufacture of a pharmaceutical preparation for prophylactic priming or curative treatment of the cervix and the myometrium for establishing effective labor in women . normal labor includes a softening of the cervix and regular myometrial contractions . the anticoagulation effect was evaluated by measuring the increase in clotting time per mg sulfated glycosaminoglycan , and is stated in bp units per mg . heparin has an anticoagulant activity of 157 bp units / mg . the sulfated glycosaminoglycans , that is mainly heparin , heparan sulfate , dermatan sulfate and chondroitin sulfate , are composed of alternating hexosamine and uronic acid residues . hyaluronic acid has no sulfate groups . the presence of d - glucuronic acid ( glca ) and its c - 5 epimer l - iduronic acid ( idoa ) and the specific sulfation of hexosamines and uronosyl residues endow the polymer an extreme structural variation . the structure can range from none or very few to nearly 100 % iduronic acid - containing disaccharides . the organization of glca - and idoa - n - hexosamine containing disaccharides can vary from long blocks to an alternating disaccharide pattern . a high degree of sulfation and a high degree of iduronic acid sulfate generally involves a high biological activity of the compound . there are different well - defined polysaccharides of dermatan sulfate ( ds ), chondroitin sulfate ( cs ), heparan sulfate ( hs ) and depolymerised heparin . heparan sulfate , having glucosamine and uronic acid as repeating disaccharides and consisting of n - acetylated and n - sulfated disaccharides that are arranged mainly in a segregated manner , has ubiquitous distribution on cell surfaces and in the extracellular matrix . it is generally less sulfated and has a lower iduronate content than heparin and has a more varied structure . interactions between heparan sulfate and proteins are implicated in a variety of physiological processes , such as cell adhesion , enzyme regulation , cytokine action , virus entry and anticoagulant properties . heparan sulfates possess anticoagulant activity depending on the presence of a specific anticoagulant pentasaccharide , however considerably less than heparin . heparan sulfate is a linear polysaccharide which can be prepared from porcine intestinal mucosa or from bovine lung , from heparin side fractions using cetylpyridinium chloride fractions and sequential salt extraction as described by fransson et al ., structural studies on heparan sulphates , eur . j . biochem . 106 , 59 - 69 ( 1980 ). the invention refers to the use of a sulfated glycosaminoglycan , which belongs to the group consisting of heparan sulfates and depolymerised heparan sulfates . chondroitin sulfate is a sulfated linear polysaccharide consisting of alternating glucuronic acid and n - acetyl - galactosamine residues , the latter being sulfated in either 4 or 6 position . they can be prepared from bovine tracheal or nasal cartilage . cs is of importance for the organization of extracellular matrix , generating a interstitial swelling pressure and participating in recruitment of neutrophils . the invention also refers to the use of chondroitin sulfates or depolymerised chondroitin sulfates . dermatan sulfate is a sulfated linear polysaccharide consisting of alternating uronic acid and n - acetylated galactosamine residues . the uronic acids are either d - glca or l - idoa and the disaccharide can be sulfated in 4 and 6 and 2 on galactosamine and idoa , respectively . ds can be prepared from porcine skin and intestinal mucosa . dermatan sulfate possesses biological activities such as organization of extracellular matrix , interactions with cytokines , anti - coagulant activities and recruitment of neutrophils . the invention also refers to the use of dermatan sulfates or depolymerised dermatan sulfates . low molecular weight heparins or depolymerised heparins are linear oligosaccharides having a m r of between 2 and 10 kda , mainly consisting of alternating n - sulfated glucosamine and idoa residues and often containing the anticoagulant pentasaccharide . they can be prepared from heparins by specific chemical cleavage . their main clinical function is to inhibit factor xa , resulting in an antithrombotic effect . it is proposed to have antimetastatic properties . fragmin ® ( pharmacia , sweden ) is an example of a low molecular heparin obtained by controlled depolymerisation of heparin and having an antithrombotic effect owing to inhibition of factor xa . heparin fragments having selective anticoagulant activity , as well as methods for the preparation thereof , are described in u . s . pat . no . 4 , 303 , 651 . the anticoagulant effect is , however , normally not desirable for a preparation to be used during labor . the invention especially refers to the use of a glycosaminoglycan which belongs to the group consisting of depolymerised heparins having a relative molecular weight below 10000 da , preferably not higher than 6000 da . it is essential that the anticoagulant activity is not too high , and according to a preferred aspect the invention refers to the use of a sulfated glycosaminoglycan having an anticoagulant activity of 30 bp units / mg or less . tests in vitro suggest that low sulfated structures of low or no anticoagulative potency are preferred compounds . thus side products obtained during manufacture of heparin are good candidates for selection of starting material . compounds with the desired properties can be obtained from heparan and heparin side fractions using specific periodate oxidation to eradicate the antithrombin iii binding properties . selective n - desulfation followed by re - n - acetylation , or selective o - desulfation also yields compounds with low anticoagulant activity . selective n - deacetylation followed by specific n - and / or o - sulfation also yields compounds of desired activity . the invention especially refers to the use of a glycosaminoglycan having a sulfate / hexosamine ratio below 1 . 0 and an anticoagulant activity , or clotting time , less than 10 bp units / mg . if the amount of endogenous oxytocin has reached its optimal level at the time for onset of labor , a pretreatment with the sulfated glycosaminoglycans to be used according to the invention will initiate the onset of labor . in case of an insufficient endogenous oxytocin level , the sulfated glycosaminoglycans can be used in a single dose in combination with i . v . oxytocin for the priming of the myometrium . the invention also refers to the use of sulfated glycosaminoglycans for the manufacture of a pharmaceutical preparation which can be administered locally that is topically , such as by intracervical , vaginal , rectal , or dermal administration , or systemically that is parenteral , such as by subcutaneous or intravenous injection . the pharmaceutical composition can also be given by oral administration . for parenteral administration the active compounds can be incorporated into a solution or suspension , which also contain one or more adjuvants such as sterile diluents such as water for injection , saline , fixed oils , polyethylene glycol , glycerol , propylene glycol or other synthetic solvents , antibacterial agents , antioxidants , chelating agents , buffers and agents for adjusting the tonicity . the parenteral preparation can be delivered in ampoules , disposable syringes or as infusions . a topical preparation consists of the active sulfated glycosaminoglycans in combination with a conventional pharmaceutically acceptable carrier . the carrier or excipient can be a solid , semisolid or liquid material that can serve as a vehicle for the active substance . examples of topical preparations are an ointment , cream , gel , nasal or vaginal spray , lotion , solution or suspension . in order to bring about an effective labor the sulfated glycosaminoglycans can be administered in a single dose every 24 h for a period of 1 - 30 , preferably 1 - 10 days . the dose must be estimated as the lowest dose giving myometrial contractions . an estimated single dose is 25 - 100 mg / d , but may be up to 1 g or more . the dose is related to the form of administration . 10 g of the heparin by - product , tb 001 - 91 svcm 950130 ( kabi - pharmacia , sweden ) was dissolved in 1 l of 5 % calcium acetate - 0 . 5 m acetic acid . the solution was filtered . the filtered solution was then adjusted to an ethanol concentration of 18 %. the supernatant after centrifugation was then adjusted to an ethanol concentration of 36 %. the precipitate was collected by centrifugation . the following heparan sulfates were prepared in accordance with fransson et al ., structural studies on heparan sulphates , eur . j . biochem . 106 , 59 - 69 ( 1980 . the precipitate obtained between 18 and 36 % ethanol was dissolved in 1 . 2 m of nacl . 18 g of cetylpyridinium chloride , cpc , was added and a precipitate was allowed to develop for 24 h . the precipitate was recovered by filtration and redissolved in 2 m nacl . the filtrate was used for the preparation of hs5 . to the resolved precipitate 3 volumes of ethanol was added . the resulting precipitate was allowed to develop for 16 h and the collected by centrifugation . finally it was redissolved in water and reprecipitated with 3 volumes of ethanol — 0 . 4 % of sodium acetate . the precipitate was collected by centrifugation and dried . the yield was 4 . 34 g . the filtrate from the preparation of hs6 was then diluted with 0 . 1 % cpc to a final concentration of 1 . 0 m nacl . it was then treated as in hs6 . the filtrate was used for the preparation of hs4 . the yield was 0 . 82 g . the filtrate from the preparation of hs5 was then diluted with 0 . 1 % cpc to a final concentration of 0 . 8 m nacl . it was then treated as in hs6 . the filtrate was used for the preparation of hs3 . the yield was 0 . 51 g . the filtrate from the preparation of hs4 was then diluted with 0 . 1 % cpc to a final concentration of 0 . 6 m nacl . it was then treated as in hs6 . the filtrate was used for the preparation of hs2 . the yield was 0 . 17 g . the filtrate from the preparation of hs3 was then diluted with 0 . 1 % cpc to a final concentration of 0 . 4 m nacl . it was then treated as in hs6 . the yield was 0 . 09 g . the different heparan sulfates were analysed as to the content of glucuronic acid , iduronic acid , and total sulfate groups . the number of sulfate groups on the amino group of the hexosamine was determined as mole per mole , and the percentage of iduronic acid residues was determined . the results are given in table 1 below . the anticoagulant activity was also evaluated by measuring the clotting time per mg heparin sulfate , and stated in bp units per mg in table 1 below . the anticoagulant activity of all the heparan sulfate preparations above can be abrogated by selective periodate oxidation , see fransson l a , and lewis w , relationship between anticoagulant activity of heparin and susceptibility to periodate oxidation , febs lett . 1979 , 97 : 119 - 23 . one kg of dried pig skin was suspended in 5 l of 0 . 5 m of nacl , 0 . 01 m edta and 0 . 01 m of cysteine hydrochloride , ph 6 . 5 . 500 mg of crystalline papain was added and the digestion was allowed to proceed for 50 h . the digest was filtered and then precipitated with 75 ml of a 10 % solution of cpc . the resulting pyridinium complex was collected by filtration and the redissolved in 2m nacl containing 15 % of ethanol . this solution was diluted with 3 volumes of 0 . 5 % cpc . the precipitate was collected and dissolved in 200 ml 1 m of nacl and 40 ml of ethanol . the material was redissolved in 100 ml of water and then precipitated with 3 volumes of ethanol - 0 . 4 % sodium acetate . the resulting precipitate was collected and dried . the final yield was 2 . 32 g . see fransson et al ., structure of pig skin dermatan sulfate . 1 . distribution of d - glucuronic acid residues . ( 1971 ) eur . j . biochem . 18 , 422 - 430 . 2 . 2 g of the material obtained above was dissolved in 220 ml of 5 % calcium acetate - 0 . 5 m acetic acid . this solution was mixed with ethanol and the precipitates formed between 0 - 18 % ethanol ( ds - 18 ), 18 - 36 % ethanol ( ds - 36 ), and 36 - 50 % ethanol ( ds - 50 ), respectively , were collected . the materials were redissolved in water and reprecipitated with 3 volumes of ethanol - 0 . 4 % sodium acetate . after drying the final yield was 0 . 9 g for ds - 18 ; 1 . 02 g for ds - 36 ; 0 . 28 g for ds - 50 . the different dermatan sulfates were analyzed as to content of sulfate groups , glucuronic acid , iduronic acid and hexosamine , and the results are presented in table 2 below . in the following test heparan sulfate hs2 and hs6 obtained from the heparin side fraction tb 001 - 91 svcm 950130 ( kabi - pharmacia , sweden ) were tested . hs6 differs from hs2 by being more highly sulfated and having more l - iduronic acid residues ( see table 1 above ). uterine samples were obtained from women undergoing elective caesarian section at 38 - 39 weeks of gestation . the samples measured 20 × 10 × 10 mm and were taken from the upper part of the isthmic incision . the biopsy was immediately placed in ice - cold krebs - ringer buffer . the biopsies were cut into longitudinal strips , length 10 - 15 mm and breadth about 5 mm . the strip was mounted vertically in an organ bath of 37 ° c . containing 2 ml krebs - ringer solution . the solution was bubbled with a mixture of 95 % o 2 and 5 % co 2 in order to maintain a ph in the bath of 7 . 35 - 7 . 45 . experiments were carried out after the strips had equilibrated to a stable contractile state , usually within 1 - 2 h after mounting . the contractions were recorded isometrically with a grass model 7 polygraph ( grass instr . co ., quincy , mass ., usa ). all samples were exposed to 100 mm kcl during the experiment in order to get a standardized maximum response . different doses of heparan sulfate were then added to the bath containing the uterine strip . after 20 min 1 u oxytocin was added . addition of 1 u oxytocin only was used as a control . this procedure was repeated using 6 μg of heparan sulfate . after 20 min 1 unit of oxytocin was added . the contractions were recorded and evaluated by integrating the surface under the curve . two heparan sulfates , hs2 and hs6 , with different structure was added and as control 1 unit of oxytocin was used . see table 3 below . the combination of oxytocin and hs6 resulted in a 2 . 5 fold increase of contractile force and the combination with hs2 gave a 4 . 1 fold increase in contractile force . this shows that heparan sulfate enhances the contractile force of human uterine strips in vitro . the effect is dependent on the heparan sulfate structure , and a low sulfated structure appears to be more effective . when this test was repeated with dermatan sulfate , ds - 18 , see table 2 , contractility was registered , but the results have not yet been evaluated . test 2 . effect on ca 2 + levels in cervical fibroblasts fibroblast cultures were established from non - pregnant , and term pregnant patients and from women delivered vaginally ( after partus patients ). the cells were cultured in monolayer cultures with minimum essential medium with 10 % donor calf serum . for experiments these cells were plated on cover glasses with at semi - confluence and loaded with fluo - 4 in phosphate buffered saline containing 10 mm hepes for 30 min . initially phosphate buffered saline containing 10 mm hepes ( hepes - buffer ) was pumped into the observation chamber for 30 s , then kcl in the same buffer was pumped for 60 s followed by hepes - buffer for 30 s . then 10 ng of pdgf / ml in hepes - buffer was added . the fluorescence was monitored continuously for 3 min . in other experiments pdgf was replaced with 100 μg of hs6 . no change of fluorescence was noted in cultures established from non - pregnant and term pregnant patients . in cultures obtained from patients directly after partus kcl , pdgf and hs6 all induced a transient 4 - 8 fold increase of fluorescence , which demonstrates a transient increase of intracellular ca 2 + . this demonstrates that cells in cultures established from patients after partus are activated by hs6 . this effect is postulated to be of importance at partus for final preparation of cervix for delivery . clinical data on delivery outcome in nulliparous women have been studied . 14 nulliparous women were given fragmin ® ( pharmacia , sweden ) subcutaneous during pregnancy due to an increased risk of thrombosis . the administered prophylactic dose was 5000 ie daily in all but 4 women who had 2500 ie daily . eight of the women were treated more than 12 weeks ( range 12 - 28 weeks ) and 6 of them during 1 - 6 weeks . as matched controls served the next 13 nulliparous women without fragmin ® medication giving birth in the same clinic immediately after the women included in the study . endpoints were labor - delivery time ( hour ) and number of caesarian sections and their indications . no correlation could be found between the duration of the treatment and the duration of the parturition . the labor - delivery time turned out to be 5 . 8 ± 2 . 6 h in the patient group and 14 . 0 ± 6 . 3 h in the control group ( p & lt ; 0 . 001 ). furthermore slow progress of labor was reported in 6 out of 13 subjects in the control group compared to 1 of 14 in the treatment group . the number of caesarian sections was 3 in each group , but the indications in the study group were pre - ecklampsia , insufficient analgesia and suspected fetal asphyxia . in the control group all 3 had the main indication arrest of labor , in two women in combination with suspected fetal asphyxia . the labor - delivery time has also been investigated in 21 parous women which had been given fragmin ® as above in comparison to 9 controls . the labor - delivery time in the group given fragmin ® was 3 . 5 ± 2 . 9 h ( range 0 . 5 - 8 ) compared to 5 . 9 ± 2 . 1 h ( range 3 - 12 ) in the control group ( p & lt ; 0 . 05 ). the labor - delivery time was thus significantly lower in the medicated group .

US-201213467918-A

one embodiment of the present invention is directed to a bone plate assembly that includes a bone plate , bone screw received in aperture in the bone plate , and screw fixation member . the screw fixation member may , alone or in conjunction with the bone plate , fix the bone screw in place when such bone screw are inserted in the aperture in the bone plate . in one example when the bone screw have been received by the bone plate and inserted into bone and / or tissue , the bone plate assembly can be used to fuse anatomical structures together and / or to heal a fracture in bone .

detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely illustrative of the invention that may be embodied in various forms . in addition , each of the examples given in connection with the various embodiments of the invention are intended to be illustrative , and not restrictive . further , the figures are not necessarily to scale , some features may be exaggerated to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . referring now generally to fig1 - 3 , it is seen that a bone plate assembly 10 is provided with bone plate 12 , bone screw ( s ) 14 received in aperture ( s ) 16 in the bone plate 12 , and washer ( s ) 18 that , alone or in conjunction with the bone plate 12 , fix the bone screw ( s ) 14 in place ( e . g ., when the bone screw ( s ) 14 are inserted in the aperture ( s ) 16 in the bone plate ). each bone screw 14 has a head 20 sized so that it does not pass through the bone plate 12 . further , each bone screw 14 has a shank 22 provided with threads 24 ( e . g ., which threads 24 may extend to tip 26 ). the head 20 of bone screw 14 is further provided with an opening 15 that is dimensioned to mate with the head of a tool , so that the bone screw 14 can be installed in tissue and / or bone . in one embodiment , the head 20 of the bone screw 14 may be provided with grooves 21 ( see , e . g ., fig3 b and 5 ). bone plate assembly 10 is also provided with washer ( s ) 18 . each washer 18 has an opening 19 though which a bone screw is received ( see , e . g ., fig3 b ). referring now generally to fig3 b , it is seen that each washer 18 is provided with a sidewall 28 ( which sidewall 28 defines the aperture 19 though which the bone screw extends ) and that the sidewall 28 has a varying thickness with respect to position along the washer &# 39 ; s perimeter ( see also , for example , fig7 a ). in one embodiment , the washer 18 is provided with a first sidewall region 28 a that is relatively thicker than a second sidewall region 28 b ( i . e ., in this embodiment dimension “ a ” is greater than dimension “ b ” ( see fig3 b )). referring now to fig7 a , 7b , 8 a , 8 b , 9 and 31 , it is seen that in these examples ( which examples are intended to be illustrative and not restrictive ) the washer 18 may be provided with a series of splines 31 that are spaced at intervals around the inside perimeter of the washer ( the washer of fig3 is similar to the washers of fig7 a , 7b , 8 a , 8 b and 9 , with the exception that the washer of fig3 is a split - ring washer ). as depicted in the figures , the splines may be solid members ( which may extend from the perimeter of the washer towards the aperture 19 of the washer ), and may be spaced apart by openings 32 . the arrangement of the splines 31 and openings 32 may be complementary to a spline 41 and opening 42 arrangement provided on the head 44 of a tool 40 ( see , e . g ., fig8 a and 8b ). in operation , when the splines of the washer are engaged with the spaces of the tool , and vice versa , the application of a rotational force to the tool is translated to the washer , thereby turning the washer . the tool may , for example , be operated manually by handle 43 , or by drill , in which case drill bit receiving channel 45 may be provided . referring once again to fig7 a , it is seen that in one example ( which example is intended to be illustrative and not restrictive ) the washer 18 may be provided with a detent 50 positioned on the outside of the sidewall 28 . in this example , the sidewall of the bone plate may be provided with an indentation 52 , which is sized to receive the detent 50 provided on the washer 18 ( see , e . g ., fig1 ). when the bone plate and washer are assembled , the washer can be aligned so that the detent 50 resides in the indentation 52 . this arrangement may inhibit unwanted rotation of the washer ( e . g ., until the time to actuate it , as described below ). as seen in fig6 , bone plate 12 may be constructed with an arcuate shape . of course , plates with other shapes and / or dimensions are possible . in another example ( which example is intended to be illustrative and not restrictive ) bone plate 12 may be provided with one or more recesses 30 , positioned within the bone plate 12 ( see fig4 a , 4b , 5 and 6 ). each recess 30 may extend around the perimeter of each aperture 16 in the bone plate 12 . each recess 30 may be cut into the sidewall of the apertures in the bone plate 12 . the lateral depth to which each recess 30 is cut may vary depending on the location on the perimeter of the recess 30 . in one example ( which example is intended to be illustrative and not restrictive ), a first region 30 a of the recess 30 may have a lateral depth that is greater than the lateral depth of a second region 30 b of the recess 30 ( i . e ., in this embodiment dimension “ a ” is greater than dimension “ b ” ( see fig4 b )). in another example ( which example is intended to be illustrative and not restrictive ), the lower portion of aperture 16 may be provided with a tapered sidewall 16 a against which the bottom portion of the screw head 20 may rest ( see fig4 b ). the washer 18 may reside within the recess , aligned so that the first relatively thicker sidewall region 28 a of the washer 18 is positioned within the first relatively deeper region 30 a of the recess , and the second relatively thinner sidewall region 28 b of the washer 18 is positioned in the second relatively shallower region 30 b of the recess . in one embodiment , when the bone screw 14 is inserted into the aperture 16 of the bone plate 12 , the washer 18 is substantially coplanar with the head 20 of the bone screw 14 . referring now to fig1 , certain characteristics of the recess 30 as seen from the bottom of the bone plate 12 are shown . as shown here , the lateral depth of the second recess region 30 b may be minimal ( and may not be present at all ) and a lateral depth may be provided essentially only in the first recess region 30 a . referring now generally to fig1 a and 12b , it is seen that when the bone plate assembly is implanted in a person , the bone plate is positioned over the bone , bones , and / or tissue to be joined by the bone plate 12 . the bone screw ( s ) are inserted through the aperture ( s ) in the washer ( s ) ( which washer ( s ) may reside in the recess ( s ) provided in the aperture ( s ) of the bone plate ) and the bone screw ( s ) are installed in bone and / or tissue by known techniques . each bone screw may be installed at a preselected angle , relative to the bone plate . in the position in which a washer is unlocked , the bone screw may pass through the opening in the washer ( e . g ., so that the bone screw may be installed at a preselected angle ) ( see fig1 a ). to fix the bone screw ( e . g ., at the angle at which the bone screw is installed ), the washer may be actuated by rotating the washer ( e . g ., with the tool , as described above ). when the washer is rotated , the first relatively thicker sidewall region of the washer may move into the second relatively shallower region of the recess . such movement may effectively cause the first relatively thicker sidewall region to extend laterally into the aperture in the bone plate ( where the relatively thicker sidewall region impinges against the head of the bone screw , thereby applying a force thereto which wedges the bone screw between the washer and the opposite sidewall of the aperture ) ( see fig1 b ). such wedging of the bone screw may fix the bone screw at an angle ( e . g ., the angle at which the bone screw was inserted ). fig1 and 12 b depict the condition where the bone screw is wedged after actuating the washer . in yet another embodiment of the present invention , depicted in fig1 - 21 , another bone plate assembly is depicted . shown here is a bone plate , bone screw , and a washer . with this arrangement , a bone plate that does not have a recess can be employed with this screw and washer pairing . more particularly , fig1 depicts a bone plate assembly 100 , generally provided with bone plate 102 , bone screw ( s ) 104 received in aperture ( s ) 106 in the bone plate 102 , and washer ( s ) 108 that , alone or in conjunction with the bone plate 102 , fix the bone screw ( s ) 104 in place ( i . e ., when the bone screw ( s ) 104 are inserted in the aperture ( s ) 106 in the bone plate 102 ). each bone screw 104 has a head 110 sized so that it does not pass through the bone plate 102 . further , each bone screw 104 has a shank 112 provided with threads 114 ( e . g ., which threads 114 extend to tip 116 ). in one embodiment , the head 110 of each bone screw 104 may be provided with grooves 118 ( see , e . g ., fig4 and 5 c ). bone plate assembly 100 is provided with washer ( s ) 108 , each of which ( as described below ) is adapted to reside over a bone screw 104 and be joined therewith in a locking arrangement . as shown in fig1 and 17 - 19 , for example , in this embodiment the head 110 of bone screw 104 is provided with a number of tangs 120 , spaced apart from each other , mounted on the upper surface of the head 110 . the tangs 120 include wedges 122 , which wedges 122 are not as wide as the upper portions of the tangs 120 ( the wedges 122 are narrowed by an undercut ). the head 110 is provided with an opening 107 in which a tool can be received to apply a rotational force , which rotational force permits the installation of the screw in tissue and / or bone . each washer 108 is sized and dimensioned to fit within one of the aperture ( s ) 106 in the bone plate 102 . each washer 108 is provided with a washer body 124 through which a central opening 125 is provided . a number of lobes 126 are provided on the periphery of the central opening 125 . as depicted in the embodiment of fig1 , for example , three lobes are provided , though it should be understood that other arrangements are possible . each washer 108 is also provided with splays 127 , which are provided on the exterior of the washer 108 . the splays 127 are separated from the remainder of the washer body 124 by tracks 128 , which tracks 128 extend into the washer body 124 . the tracks 128 are provided with an entrance portion 130 , an intermediate track portion 132 , and a terminus 134 . the entrance portion 130 and the terminus 134 are wider than the intermediate track portion 132 . the width of the intermediate track portion 132 is narrowed by the presence of nubs 136 that extend into the track ( e . g ., from the washer body 124 and / or the splays 128 ). the washer 108 and the wedges 122 / tangs 120 are designed to engage with each other in a locking arrangement . relative to each other , the wedges 122 are slightly wider than the width of at least the intermediate track portion 132 . in operation , when the bone plate assembly is implanted in a person , the bone plate is positioned over the bone , bones , and / or tissue to be joined by / to the bone plate . the bone screw ( s ) are inserted through the aperture ( s ) in the bone plate and installed in bone and / or tissue by known techniques . each bone screw may be installed at a preselected angle , relative to the bone plate . to fix the bone screw at a preselected angle ( e . g ., the angle at which the bone screw is installed ), the washer is placed over the head of the bone screw , positioned so that the wedges 122 are poised to enter the track portions 128 . a tool , provided with a head adapted to fit within the central washer opening 125 and lobes 126 is inserted into the washer , which is then rotated . the wedges 122 thereby enter the track portions 128 . since wedges 122 are wider than at least the intermediate track portions 132 , the splays 127 are forced outward when the wedges enter the intermediate track portions 132 ( see , e . g ., fig2 ). the splays are forced into an abutting arrangement with the sidewalls of the aperture in which the bone screw 106 and washer reside 108 . the abutting arrangement between the splays 127 and the sidewalls of the bone plate 102 fixes the bone screw 104 ( e . g ., at the angle at which the bone screw 104 was installed ). in another example ( which example is intended to be illustrative and not restrictive ) the splays 127 may enter an undercut 140 in the aperture ( s ) 106 ( see , e . g ., fig1 ). in another embodiment fig2 depicts , in a perspective view , a double lobed washer . the double lobed washer may be shaped differently than the recess and / or aperture in the bone plate which received the washer . when the washer is rotated , it is deformed , compressing it against the bone screw , fixing the angle of the bone screw ( e . g ., the angle at which the bone screw is inserted ). the embodiment of fig3 is similar . fig3 depicts , in a perspective view , a tri - lobed washer . again , the tri - lobed washer may be shaped differently than the recess and / or aperture in the bone plate . when the washer is rotated , it is deformed , compressing it against the bone screw and fixing the angle of the bone screw ( e . g ., the angle at which the bone screw is inserted ). the embodiments of fig2 and 30 may thus operate without a recess . in another embodiment , shown in fig2 a , 22b and 22 c , there is shown a bone plate assembly 150 , generally provided with bone plate 152 , bone screw ( s ) 154 ( which bone screw ( s ) 154 are received in aperture ( s ) 156 in the bone plate 152 ), and moveable doors 158 ( which moveable doors 158 may slide and may fix the bone screw ( s ) 154 in place when the bone screw ( s ) 154 are inserted in the aperture ( s ) 156 in the bone plate 152 ). each bone screw 154 has a head sized so that the head does not pass through the bone plate 152 . further , each bone screw 154 has a shank provided with threads that extend to a tip . in one example ( which example is intended to be illustrative and not restrictive ), the head of the bone screw may be provided with grooves . bone plate assembly 150 is provided with cut out portion ( s ) 164 , on an upper surface of the bone plate assembly 150 , to which the moving doors 158 are slidably mounted . the cut out portion ( s ) 164 are positioned adjacent the aperture ( s ) 156 , at a segment of the edge thereof . in one example ( which example is intended to be illustrative and not restrictive ), each moveable door 158 is provided with two substantially flat sides 166 , 167 , cutouts of partial circles 168 , full cut out circle 169 , and arcuate side 172 . it should be apparent that other dimensional arrangements are possible . the moveable doors 158 are positioned in the cut out portion ( s ) 164 on the upper surfaced of the bone plate 152 , and are retained therein by lip 174 provided at the upper sidewall of the cut out portion 164 . dovetail undercuts may also be present along other upper sidewalls to maintain the doors in place . the cut out portion ( s ) 164 are sized slightly greater than the moveable doors . thus , when each bone screw is positioned in an aperture 156 of the bone plate 152 , the moveable door 158 can be slid in the direction of the aperture 156 , in order to cover the bone screw 154 ( and thus fix the bone screw 154 in place ). referring now to fig2 c , in one example ( which example is intended to be illustrative and not restrictive ) a channel 180 is fully or partially bored into the bone plate 152 at a location between the cut out portions ( s ) 164 . still referring to fig2 c , in another example ( which example is intended to be illustrative and not restrictive ) the moveable doors 158 are provided with stops 182 that depend from the doors , into the channel 180 . when the door is moved into the locked position , as shown in the left hand side of fig2 c , the stop engages channel sidewall 184 , inhibiting further movement of the door . detents 186 and indentations 188 may also be used if desired . another embodiment of the present invention is depicted in fig2 - 27 . in this embodiment a bone screw 200 is provided with a head 202 sized so that it does not pass through a bone plate ( not shown ) and shank 204 provided with threads ( not shown ) that extend to tip 208 . in one example ( which example is intended to be illustrative and not restrictive ), the head 202 of the bone screw 200 may be provided with grooves ( not shown ). as seen in these figures , the head 202 of bone screw 200 is provided with a number of splays 212 , spaced apart from each other , and extending around the periphery of the head of the bone screw 200 . the splays 212 are mounted on the upper surface of the head 202 , and in one example ( which example is intended to be illustrative and not restrictive ), may have an arcuate shape . each splay 212 extends around a portion of the periphery of the head of the bone screw 200 . each splay 212 is mounted upon a wedge 214 , ( wherein the wedges 214 extend up from the head of the screw ). the wedges 214 join the splay 212 at the base of the splay 212 , elevating the splay 212 off of the head of the bone screw 200 . spaces 215 are present between the portions of the splay 212 , which extend over the periphery of the head of the bone screw 200 , and the head of the bone screw 200 itself . in this embodiment , after the bone screw 200 has been inserted into an aperture in a bone plate , and installed at a preselected angle , the angle can be fixed by forcing the splays outward ( i . e ., into a locking and abutting arrangement with the sidewalls of the aperture in the bone plate ). in operation , a tool is inserted into the interior space 216 and rotated ( to force the splays outward , into an abutting and locking arrangement with the sidewalls of the apertures ). in another embodiment , shown in fig2 , a cam 218 may be utilized . in one example ( which example is intended to be illustrative and not restrictive ), the cam may be rotatably mounted to the head 202 of the bone screw 200 . in operation , the splays are forced outward , by rotating the cam 218 ( which cam 218 moves against the interior walls of the splays ). here , the cam 218 provides a counterforce against the force applied by the sidewalls of the apertures ( which counterforce facilitates the maintaining of the splays 212 in a locking and abutting arrangement with the sidewalls of the aperture in the bone plate ). in another embodiment one or more of the washers may be a split - ring washer . while a number of embodiments of the present invention have been described , it is understood that these embodiments are illustrative only , and not restrictive , and that many modifications may become apparent to those of ordinary skill in the art .

US-90100607-A

a circulatory assist system has a pump with a motor coupled to rotate the pump at a selectable speed . a controller drives the motor at a target speed and collects blood flow measurements during operation of the pump . an impaired flow condition is identified when a plurality of successive blood flow measurements are between an expected minimum flow and a low flow threshold , such that the low flow would necessitate issuing an alert . during the impaired flow condition , it is detected whether an inflow obstruction exists by determining whether a reduction in speed of the pump is correlated with a predetermined increase in the blood flow measurements . if the inflow obstruction is detected , then the speed of the pump is further reduced to further increase the blood flow measurements .

referring to fig1 , a patient 10 is shown in fragmentary front elevational view . surgically implanted into the patient &# 39 ; s abdominal cavity 11 is the pumping portion 12 of a ventricular assist device . an inflow conduit 13 conveys blood from the patient &# 39 ; s left ventricle into the pumping portion 12 , and an outflow conduit 14 conveys blood from the pumping portion 12 to the patient &# 39 ; s ascending thoracic aorta . a power cable 15 extends from the pumping portion 12 outwardly of the patient &# 39 ; s body via an incision to a compact controller 16 . a power source , such as a battery pack worn on a belt about the patient &# 39 ; s waist , and generally referenced with the numeral 17 , is connected with controller 16 . each of the conduits 13 and 14 may include a tubular metallic housing proximate the pumping portion 12 which may connect to elongated segments extending to the heart and ascending aorta , respectively . at the end of inflow conduit 13 connected to the patient &# 39 ; s heart ( preferably at the apex of the left ventricle ), and at the end of outflow conduit 14 connected to the ascending thoracic aorta , the conduits are generally attached to the natural tissue by sutures through the use of a sewing ring or cuff so that blood flow communication is established and maintained . the distal end of the inflow conduit 13 is inserted through the ventricle wall and into the heart in order to establish blood flow from the heart to the pumping portion 12 . fig2 illustrates a target flow q target at 20 and an actual flow value 25 that varies over time . a no flow threshold 21 and a low flow threshold 22 define no flow region 23 and low flow region 24 , respectively , wherein appropriate alarms are generated by a pump control unit whenever actual flow dips into these regions . the trajectory of actual pump flow value 25 may fall to a value below an expected minimum flow threshold 26 into a respective diagnostic region 27 . expected minimum flow threshold 26 may be obtained from a lookup table or a model based on empirically derived flow profiles that result from various inflow or outflow obstructions or various reductions in blood volume . the present invention is configured to detect operation in region 27 and to take steps to identify a potential cause and a remedy in order to increase flow if possible . when the actual flow falls below an expected minimum flow that should be present in view of the operating speed of the pump ( i . e ., assuming no obstructions and proper blood volume ), the present invention enters a diagnostic state for identifying a potential cause of the impaired flow such as a partial or complete obstruction of the inflow conduit or the outflow conduit , or a condition wherein a flow is saturated for a given pump speed due to a limited blood volume resulting from dehydration , etc . as shown in fig3 , a method of the invention begins in step 30 wherein a physician or other medical practitioner configures target values and performance limits pertaining to blood flow rate and pump speed to be provided for a particular patient . the circulatory assist device then monitors for physiological conditions such as heart rate or pump pulse rate in step 31 . in step 32 , a target flow rate and a target speed ( i . e ., setpoint speed ) are determined and used for controlling the system as known in the art . alternatively , a speed setpoint may be determined according to other predetermined criteria such as a setpoint configured according to a static value chosen by a physician for the particular patient . a check is performed in step 33 to determine whether the actual ( i . e ., indirectly estimated ) pump flow value ( elpm pump ) is less than an expected minimum pump flow value ( lpm expmin ) for greater than a diagnostic wait time ( t flowdiagwait ). as mentioned above , elpm pump is an estimated average pump flow for a given pump speed . if not , then a return is made to step 31 and pump operation continues normally with the pump speed being determined by a target flow that is set according to physiological conditions . if the actual pump flow value is less than the expected minimum flow value in step 33 , then a check is made in step 34 to determine whether the actual flow is less than a low flow threshold ( lpm lowflow ). in particular , step 34 preferably requires that the actual flow value be less than lpm lowflow for greater than a predetermined low flow wait time ( t lowflowwait ). when elpm pump & lt ; lpm lowflow then a low flow warning is generated in step 35 . a low flow state is then entered while the low flow warning continues . checks are made in step 36 to determine whether the actual flow value has risen above the low flow threshold for greater than the low flow wait time , and a check is made in step 37 to determine whether the actual flow value is less than a no flow threshold ( lpm noflow ) for at least a no flow wait time ( t noflowwait ). the value of t noflowwait is less than the value of t lowflowwait so that detection of a no flow condition has priority . if the actual flow value rises above the low flow threshold , then the warning is turned off in step 38 and a return is made to step 34 . if an actual flow value falls below the no flow threshold for the no flow diagnostic wait time , then a no flow warning is generated in step 40 to indicate that a greater urgency of taking corrective action . while in a no flow warning state , a check is made in step 41 to determine whether the actual flow value rises above the no flow threshold for longer than the no flow wait time . when it does , the no flow warning is turned off in step 42 , the low flow warning is turned off in step 38 , and a return is made to step 34 . when step 34 determines that the actual flow value has not stayed below the low flow threshold for the low flow diagnostic wait time , then a check is made in step 43 to determine whether the actual flow value stays below the expected minimum flow value for at least an obstruction diagnostic wait time ( t obsdiagwait ) which is longer than both the low flow diagnostic wait time and the no flow diagnostic wait time . if not , then a check is made in step 44 to determine the actual flow value has recovered above the expected minimum flow value for at least the diagnostic wait time ( t flowdiagwait ), and if so , then a return is made to step 31 for nominal pump control . if the condition is not true in step 44 , then a return is made to step 34 for continuing to monitor for either a low flow condition or an obstructed condition . when the condition in step 43 is satisfied then the method proceeds to step 45 wherein a potential obstruction is diagnosed as described below . the present invention is based in part on an observation that a nominal reduction in pump speed generally results in an increase in flow if an inflow obstructions exists . as shown in fig4 , a pump is operating at a first speed at 50 , but then a speed reduction 51 to a lower speed 52 is deliberately introduced . after a sufficient time to allow flow to stabilize at a new value for measurement , speed then increases at 53 back to the original speed at 54 . an actual pump flow q has an original value at 55 will rise to a higher flow at 56 during a reduced pump speed at 52 in the event that an inflow obstruction exists . if an outflow obstruction exists , then the actual flow instead decreases as shown at 57 during the time of reduced pump speed 52 . the change in pump speed may also affect the pulsatility index ( e . g ., the difference between the maximum and minimum flows divided by the average maximum flow ) such that an initial pulsatility at 60 decreases to a value at 61 in the presence of an inflow obstruction when pump speed is reduced at 52 . on the other hand , in the presence of an outflow obstruction the pulsatility will increase at 62 during the speed reduction . inspection of the change in flow resulting from a deliberate speed reduction may be sufficient to differentiate between an inflow obstruction and an outflow obstruction , but it may be coupled with an inspection of the change in pulsatility to potentially improve an identification . the diagnostic relationships employed by the present invention are shown in greater detail in fig5 and 6 . fig5 shows an inflow obstruction wherein a pump speed rpm setpoint and a pump flow elpm pump are measured at a first time t 1 . pump speed is reduced by a predetermined speed of rpm obsdiag at a time t 2 . at time t 2 , the actual pump flow has stabilized at a new value representing an increase by more than a threshold designated lpm obsdiag , which indicates the presence of the inflow obstruction . in a preferred embodiment , a plurality of speed modification trials of the type shown in fig5 are repeated in order to gather statistics for increasing a confidence level in detecting the inflow obstruction . in fig6 , the actual flow through the pump increases during the speed reduction by an incremental flow that is less than the value of lpm obsdiag . in a preferred embodiment , the present invention does not detect an inflow obstruction based on only the smaller increase in pump flow , but may require simultaneous change in pulsatility index in order to decide on the presence or absence of an inflow obstruction . more specifically , an inflow or outflow obstruction may be determined as shown in fig7 . when pump speed is reduced and the resultant pump flow increases while pulsatility index decreases , then an inflow obstruction is detected . on the other hand , when the speed reduction creates a decreased resultant flow together with an increased pulsatility index , then an outflow obstruction is detected . the present invention may also distinguish between different levels of confidence in judging the presence of inflow and outflow obstructions for a saturated flow condition . for example , a large jump in flow being produced by a reduction in pump speed may always generate an indication of an inflow obstruction . depending on whether pulsatility experiences a large drop or a small drop , the confidence of the inflow obstruction may be characterized as either probable or possible , respectively . as further shown in fig8 , a small jump in flow may correlate with a likely inflow obstruction if the pulsatility also experienced a large drop . if both the jump in pump flow and the drop in pulsatility are small ( i . e ., less than respective thresholds ), then the diagnostic decision may correspond to a “ no call ” with respect to whether there is any obstruction or a saturated flow . when a reduced speed generates neither a large change in flow nor a large change in pulsatility , then a saturated flow may be detected . in the presence of a saturated flow , it may be desirable to reduce pump speed to the lowest value that maintains the current flow value . an outflow obstruction may be detected according to fig8 when a large drop in the flow is correlated with the reduction in pump speed . if the large drop in flow occurs with a large jump in pulsatility , then an outflow obstruction is probable . if associated with a small jump in pulsatility , then an outflow obstruction is classified as possible . when a small drop in pump flow occurs with a large jump in pulsatility , then an outflow obstruction is classified as likely , but if coupled with a small jump in pulsatility then no call is made . based on the confidence with which either an inflow or an outflow obstruction is detected , corresponding measures can be taken to attempt to provide a greater flow or even restore the flow at least the expected minimum flow . as shown in fig9 , a plurality of speed modification trials including trials 65 and 66 are performed in order to assess the most likely obstruction . prior to the corrective action , the pump speed has a setpoint 67 and a corresponding flow value 68 . when an inflow obstruction is present , corrective action comprises gradually decreasing the pump speed at 70 to produce a gradual increase in flow at 71 . a predetermined minimum speed 72 may preferably have been established by the physician based on the physiology of the patient , and if the speed reaches that minimum then no further changes would be made . as long as further decreases in speed along line 70 generate a corresponding increase in pump flow along 71 , then the speed continues to decrease . when the resultant flow reaches a peak at 73 and then decreases at 74 , the reduction in pump speed ceases at 75 . then the speed achieving the highest flow is adopted at 76 . in the case of a detected outflow obstruction , corrective action comprises increasing the pump speed at 80 which results in an increased pump flow at 81 . the increase may continue until either reaching a maximum pump speed 82 as previously determined by a physician or until pump flow reaches the expected minimum flow . the plurality of trials and the corrective actions are further described in the method of fig1 . in step 85 , an actual flow value and a pulsatility index are measured at the current speed setpoint . in step 86 , the pump speed is reduced by a preset amount . in step 87 , a new flow value and pulsatility index are measured at the reduced speed . a check is made in step 88 to determine whether a predetermined number of trials have been obtained . if not , speed is increased back to the original setpoint in step 89 and a return is made to step 85 . once sufficient trials have been conducted , the trials are classified in step 90 . classification of each trial is performed in accordance with fig8 , for example . the classified trials are then examined statistically in order to ensure that sufficient data is present to indicate either an inflow obstruction , outflow obstruction , or saturated flow . in a preferred embodiment , a majority of trials must indicate a respective condition . in step 91 , a check is made to determine whether a majority of trials indicate that an inflow obstruction is either likely , possible , or probable . if so , then corrective action to increase pump flow begins at step 92 by dropping the pump speed by a predetermined amount . a check is performed in step 93 to determine whether the speed has been reduced to a predetermined minimum speed . if not , then a check is performed in step 94 to determine whether the latest drop in speed has instead caused a flow decrease . if not , then a return is made to step 92 to drop the speed once again . if a minimum speed is reached in step 93 , then the minimum speed is set as a new speed setpoint and the method returns to point a in fig3 . in fig3 , the method waits during a predetermined wait time ( t enddiagwait ) in step 110 before returning to normal operation . this periodic return to normal operation ensures that nominal operation is utilized whenever possible . returning to fig1 , in the event that a flow decrease is detected in step 94 then the speed setpoint is set to the last speed that obtained a flow increase in step 96 and a return is made to point a . if there are not a majority of trials detecting an inflow obstruction in step 91 , then a check is made in step 97 to determine whether a majority of trials indicate a saturated flow . if they do , then pump speed is dropped by a predetermined amount in step 98 . a check is performed in step 99 to determine whether a minimum speed has been reached . if not , then a check is made in step 100 to determine whether a predetermined flow decrease has occurred ( i . e ., whether the flow has become unsaturated ). if not , then a return is made to step 98 to drop speed once again . if a minimum speed is reached in step 99 , then the minimum speed is adopted as a new speed setpoint and the method returns to point a . if a flow decrease is detected in step 100 , then the current speed is used as a new speed setpoint and a return is made to point a . if a majority of trials do not indicate a saturated flow condition in step 97 , then a check is made in step 103 to determine whether a majority of trials indicated that an outflow obstruction is likely , possible , or probable . if not , then the flow problem has not been properly diagnosed and the method may retry to diagnose the obstruction in step 104 ( e . g ., by repeating a new plurality of trials at step 85 ). if a majority of trials indicate an outflow obstruction , then pump speed is increased by a set amount in step 105 . a check is made in step 106 to determine whether a maximum speed has been reached . if not , then a check is made in step 107 to determine whether the result flow has reached the expected minimum flow value . if not , then a return is made to step 105 to further increase the speed . if a maximum speed is detected in step 106 , then the maximum speed is adopted as a new speed setpoint in step 108 and a return is made to point a . if the flow reaches the expected minimum flow value in step 107 , then the current speed is used as a new speed setpoint in step 109 and a return is made to point a . the present invention can also be understood using a state diagram as shown in fig1 . state 115 is a normal pump control state wherein pump control may be implemented as according to u . s . pat . no . 7 , 160 , 243 , for example . as long as an actual flow remains greater than the expected minimum flow , operation continues to remain in state 115 . when pump flow falls below the expected minimum flow for greater than time t flowdiagwait , then a transition is made from state 115 to a flow diagnostic state 116 . a transition is made back from state 116 to state 115 when the flow value remains above the expected minimum flow for greater than t flowdiagwait . state 116 also checks for low flow . thus , if actual flow falls below the low flow threshold for greater than a time t lowflow then a transition is made to a low flow alarm state 117 . a transition would be made back from state 117 to 116 whenever the actual flow remains greater than the low flow threshold for greater than t lowflow . state 117 monitors for a no flow condition by comparing actual flow with a no flow threshold . if actual flow is less than the no flow threshold for at least time t noflow then a transition is made to a no flow alarm state 118 . flow continues to be compared with the no flow threshold and if it remains above the no flow threshold for at least t noflow then a transition is made back to flow diagnostic state 116 . while in state 116 , actual flow continues to be compared to the expected minimum flow value and if it remains below it for greater than a time t obsdiagwait , then a transition is made to diagnose obstruction state 120 . while in state 120 , a plurality of trials are conducted by modifying the pump speed in order to attempt to classify either an inflow obstruction , outflow obstruction , or saturated flow condition . when an inflow obstruction is detected , a transition is made to state 121 for executing a speed reduction action . when an outflow obstruction is detected , then a transition is made to state 123 for executing a speed increase action . when a saturated flow condition is detected , a transition is made to state 122 for executing a speed reduction action . after the actions in states 121 - 123 , transitions are made to wait state 124 wherein the pump continues to operate at a new speed setpoint , thus achieving the best flow results obtainable under current conditions . after a wait time ( t enddiagwait ) corresponding to an expected time in which conditions may eventually change , a transition is made back to normal pump control state 115 with a possible is reintroduction of corrective speed changes if flow again does not exceed the expected minimum flow .

US-201313916715-A

the present invention is directed to a shaving system of the wet shave type comprising a blade member and a structure which supports or holds the blade member and which has an external skin engaging portion in proximity to the blade member . the skin engaging portion includes an improved shaving aid composite which contains an inclusion complex of a skin - soothing agent , such as menthol , with a cyclodextrin . preferably the shaving aid composite comprises a matrix of a water - insoluble polymer , an effective amount of a skin lubricating water - soluble polymer dispersed within the matrix , and an inclusion complex of a skin - soothing agent with a cyclodextrin . alternatively , the shaving aid composite may comprise a sheath of water - insoluble polymer that surrounds a core which includes a skin - lubricating water - soluble polymer and an inclusion complex of a skin - soothing agent with a cyclodextrin . the improved shaving aid composite is capable of retaining during normal storage conditions substantially all of the skin - soothing agent included during fabrication of the composite and delivering an effective amount of the skin - soothing agent during use .

the shaving unit 10 shown in fig1 and 2 includes base or platform member 12 molded of high impact polystyrene that includes integral coupling groove structure 14 for attachment to a razor handle and guard structure 16 that defines a transversely extending forward skin engaging surface 18 . on the upper surface of platform 12 are disposed steel leading blade 20 having a sharpened edge 22 , steel following blade 24 having sharpened edge 26 , and aluminum spacer member 28 that maintains blades 20 and 24 in spaced relation . cap member 30 is molded of high impact polystyrene and has body portion 32 that defines skin engaging surface 34 that extends transversely between forwardly projecting end walls 36 and has a front edge 38 that is disposed rearwardly of blade edge 26 . integral rivet portions 40 extend downwardly from transversely extending body portion 32 and pass through holes in blades 20 and 24 , spacer 28 , and platform 12 to secure cap 30 , blades 20 , 24 and spacer 28 on platform 12 . adhesively affixed to skin engaging surface 34 is shaving aid composite 42 . the shaving unit 50 shown in fig3 is of the type shown in jacobson , u . s . pat . no . 4 , 586 , 255 , and includes body 52 with front portion 54 and rear portion 56 . resiliently secured in body 52 are guard member 58 , leading blade unit 60 and trailing blade unit 62 . a shaving aid composite in the form of elongated insert member 64 is frictionally locked in opening 66 of rear portion 56 . the shaving aid composite incorporates a shaving aid which , upon contact with water , leaches out of the composite onto the skin of the user during shaving to improve the shave attributes . while shown at the rear portion of this particular shaving unit , the shaving aid composite may be located at any skin - engaging portion of the shaving unit and may be fabricated in any size or shape deemed appropriate . the shaving aid composite of the present invention comprises an inclusion complex of a skin - soothing agent , particularly a volatile skin - soothing agent , with a cyclodextrin . preferably the shaving aid composite comprises a matrix of a water - insoluble polymer and , dispersed within the matrix , a skin lubricating water - soluble polymer and an inclusion complex of a skin - soothing agent with a cyclodextrin . alternatively , the shaving aid composite may comprise a sheath of water - insoluble polymer that surrounds a core which includes a skin - lubricating water - soluble polymer and an inclusion complex of a skin - soothing agent with a cyclodextrin , the sheath having a plurality of openings to facilitate release of the water - soluble polymer and skin - soothing agent . the shaving aid composite may also optionally include low molecular weight water - soluble release enhancing agents such as polyethylene glycol ( e . g . 1 - 10 % by weight ), water - swellable release enhancing agents such as cross - linked polyacrylics ( e . g . 2 - 7 % by weight ), colorants , antioxidants , preservatives , microbiocidal agents , beard softeners , astringents , depilatories , medicinal agents , conditioning agents , etc . suitable water - insoluble polymers which can be used for the matrix ( or sheath ) include polyethylene , polypropylene , polystyrene , butadiene - styrene copolymer ( e . g . medium and high impact polystyrene ), polyacetal , acrylonitrile - butadiene - styrene copolymer , ethylene vinyl acetate copolymer and blends such as polypropylene / polystyrene blend . preferably the water - insoluble polymer comprises about 10 to 50 %, more preferably about 15 to 40 %, and most preferably about 20 to 35 % by weight of the shaving aid composite . the more preferred water - insoluble polymer is polystyrene , preferably a general purpose polystyrene such as dow styron ( dow chemical company ) or a high impact polystyrene ( i . e . polystyrene - butadiene ), such as mobil 4324 ( mobil corporation ). the composite should contain a sufficient quantity of water - insoluble polymer to provide adequate mechanical strength , both during production and use . suitable skin lubricating water - soluble polymers include polyethylene oxide , polyvinyl pyrrolidone , polyacrylamide , hydroxypropyl cellulose , polyvinyl imidazoline , and polyhydroxyethylmethacrylate . preferably the water - soluble polymer comprises about 20 to 80 %, more preferably about 40 to 75 %, by weight of the shaving aid composite . the more preferred water - soluble polymers are the polyethylene oxides generally known as polyox ( available from union carbide corporation ) or alkox ( available from meisei chemical works , kyoto , japan ). these polyethylene oxides will preferably have molecular weights of about 100 , 000 to 6 million , most preferably about 300 , 000 to 5 million . the most preferred polyethylene oxide comprises a blend of about 40 to 80 % of polyethylene oxide having an average molecular weight of about 5 million ( e . g . polyox coagulant ) and about 60 to 20 % of polyethylene oxide having an average molecular weight of about 300 , 000 ( e . g . polyox wsr - n - 750 ). the polyethylene oxide blend may also advantageously contain up to about 10 % by weight of a low molecular weight ( i . e . mw & lt ; 10 , 000 ) polyethylene glycol such as peg - 100 . the inclusion complex will generally comprise about 1 % to about 25 %, preferably about 5 % to about 20 %, most preferably about 10 % to about 17 %, by weight of the shaving aid composite . any suitable cyclodextrin may be utilized to form the inclusion complex including alpha - cyclodextrin , beta - cyclodextrin , gamma - cyclodextrin and modified cyclodextrins such as hydroxypropyl - beta - cyclodextrin , methyl - beta - cyclodextrin , and acetyl - beta - cyclodextrin . the preferred cyclodextrins are beta - cyclodextrin and gamma - cyclodextrin . skin - soothing agents which can be used in the present invention may be any agents which have a soothing effect on the skin so as to improve shaving comfort . particularly suitable skin - soothing agents include menthol , camphor , eugenol , eucalyptol , safrol , methyl salicylate , menthyl lactate , menthyl ethoxyacetate , menthone glycerinacetal , 3 - l - menthoxypropane - 1 , 2 - diol , ethyl l - menthyl carbonate , ( 1s , 3s , 4r )- p - menth - 8 - en - 3 - ol , menthyl pyrrolidone carboxylate , n - substituted - p - menthane - 3 - carboxamides ( as described in u . s . pat . no . 4 , 136 , 163 , which is incorporated herein by reference ) including , for example , n - ethyl - p - menthane - 3 - carboxamide , acyclic carboxamides of the formula ## str1 ## where r &# 39 ; and r &# 34 ;, when taken separately , are each hydrogen , c 1 - c 5 alkyl or c 1 - c 8 hydroxyalkyl and provide a total of no more than 8 carbon atoms , with the proviso that when r &# 39 ; is hydrogen r &# 34 ; may also be alkylcarboxyalkyl of up to 6 carbon atoms ; r &# 39 ; and r &# 34 ;, when taken together , represent an alkylene group of up to 6 carbon atoms thereby forming a nitrogen heterocycle , the alkylene chain being optionally interrupted by oxygen ; r 1 is hydrogen or c 1 - c 5 alkyl ; and r 2 and r 3 are each c 1 - c 5 alkyl ( such acyclic carboxamides being described in u . s . pat . no . 4 , 153 , 679 , which is incorporated herein by reference ) including , for example , n , 2 , 3 - trimethyl - 2 - isopropylbutanamide , and ketal coolants ( as described in wo 93 / 23005 , which is incorporated herein by reference ) including , for example , l - menthon - ld - isomenthon glycerin ketal . the cyclodextrin inclusion complexes which are utilized in the present invention may be made in the conventional manner . typically the cyclodextrin is dissolved in an aqueous solution at or near its solubility limit at elevated temperature . the skin - soothing agent is dispersed in this solution and the insoluble complex precipitates from the solution as it is cooled . sufficient skin - soothing agent should be added to form a 1 : 1 , 2 : 1 or 3 : 1 molar ratio of skin - soothing agent to cyclodextrin . the amount of skin - soothing agent which can be complexed will depend on the size of the molecule and the size of the cyclodextrin cavity . after separation of the inclusion complex , it is dried in a conventional manner , typically by oven drying ( e . g . at about 100 °- 110 ° c .) optionally under vacuum . when gamma - cyclodextrin is utilized , it is also preferred to wash the complex with dry diethyl ether before drying and / or to dry it at about 116 ° c . overnight in order to remove all traces of water from the complex , since the presence of trace amounts of water tends to cause the skin - soothing agent to be prematurely released during fabrication of the shaving aid composites . the shaving aid composite may additionally comprise a displacing agent which displaces the skin - soothing agent from the inclusion complex upon contact with water , thereby enhancing the release of the skin - soothing agent from the shaving aid composite during use . the displacing agent will comprise about 1 % to about 10 %, preferably about 2 % to about 7 %, most preferably about 5 %, by weight of the shaving aid composite . suitable displacing agents include surfactants , benzoic acids , and certain amines ( e . g . urea ). the displacing agent is a material which is capable of forming a more stable complex with the cyclodextrin than the complex formed with the skin - soothing agent . this material will competitively displace the skin - soothing agent from the complex when the shaving aid composite is contacted with water , thus releasing the skin - soothing agent from the composite . suitable displacing agents may be readily identified by measuring the release of skin - soothing agent ( e . g . menthol ) from a 0 . 1 % aqueous solution of the inclusion complex ( e . g . β - cyclodextrin / menthol ) upon addition of about 0 . 02 % of the candidate displacing agent . in this procedure the solution is evaporated in a savant speedvac concentrator ( model rt - 490a ), leaving a cycodextrin residue which is extracted with methanol . the methanol extract is analyzed for non - released skin - soothing agent by gas chromatography . the following table illustrates the displacement potential of various candidate displacing agents . ______________________________________displacement of menthol from 0 . 1 % β - cd / m complex in water mentholdisplacing agent released______________________________________sodium lauryl sulfate 100 % sodium dodecyl benzene sulfonate 100 % disodium lauryl sulfosuccinate 48 % disodium cocamido mea sulfosuccinate 47 % sodium diamyl sulfosuccinate 38 % cetylpyridinium chloride 52 % cetyldimethylethylammonium bromide 50 % benzalkonium chloride 44 % benzethonium chloride 43 % poloxamer 188 45 % poloxamer 217 45 % nonoxynol - 100 42 % poloxamer 407 39 % poloxamer 238 38 % laureth - 23 36 % oleth - 20 36 % benzoic acid 46 % salicylic acid 43 % urea 61 % control ( β - cd / m only ; no displacing agent ) 27 % ______________________________________ especially preferred displacing agents include sodium lauryl sulfate , sodium dodecylbenzene sulfonate , disodium cocamido mea sulfosuccinate ( mackanate cm - 100 ), disodium lauryl sulfosuccinate ( mackanate lo - 100 ), poloxamer 188 ( pluronic f68 ), poloxamer 217 ( pluronic f77 ), and nonoxynol - 100 ( iconol np - 100 ). also preferred are benzoic acid and salicylic acid . shaving aid composites of the present invention may be fabricated by any appropriate method , including injection molding and extrusion , the latter being preferred . all of the components of the composite are blended prior to molding or extrusion . for best results , it is preferred that the inclusion complex is dry and has a particle size range of about 25 to 100 microns , most preferably about 40 to 75 microns . the particle size can be controlled by screening using known methods . drying can be performed in a vacuum or convection oven at about 90 °- 120 ° c . for about 3 to 15 hours . the blended components may be extruded through a haake system 90 3 / 4 inch diameter extruder with a barrel pressure of about 1000 - 2000 psi , a rotor speed of about 10 to 50 rpm , and a temperature of about 150 °- 185 ° c . and a die temperature of about 170 °- 185 ° c . alternatively , a 1 1 / 4 inch single screw extruder may be employed with a processing temperature of 175 °- 200 ° c ., preferably 185 °- 190 ° c ., a screw speed of 20 to 50 rpm , preferably 25 to 35 rpm , and an extrusion pressure of 1800 to 5000 psi , preferably 2000 to 3500 psi . the extruded strip is air cooled to about 25 ° c . to injection mold the strips it is preferred to first extrude the powder blend into pellets . this can be done on a 1 1 / 4 or 1 1 / 2 inch single screw extruder at a temperature of 120 °- 180 ° c ., preferably 140 °- 150 ° c ., with a screw speed of 20 to 100 rpm , preferably 45 to 70 rpm . the pellets are then molded in either a single material molding or multi - material molding machine , which may be single cavity or multi - cavity , optionally equipped with a hotrunner system . the process temperature can be from 165 ° to 250 ° c ., preferably from 180 ° to 225 ° c . the injection pressure should be sufficient to fill the part completely without flashing . depending on the cavity size , configuration and quantity , the injection pressure can range from 300 to 2500 psi . the cycle time is dependent on the same parameters and can range from 3 to 30 seconds , with the optimum generally being about 6 to 15 seconds . the invention may be further illustrated by the following examples in which all parts and percentages are by weight . preparation of β - cd / m . a 10 % aqueous solution of beta - cyclodextrin is prepared and maintained at 40 °- 45 ° c . with stirring . sufficient menthol is added to provide a 1 : 1 molar ratio of cyclodextrin to menthol . after mixing for about three hours , the solution is allowed to cool to room temperature while maintaining continuous stirring . the precipitate is collected and dried overnight in a vacuum oven at 110 ° c . preparation of hp - β - cd / m . a 75 % aqueous slurry of hydroxypropyl - beta - cyclodextrin is prepared and maintained at 40 °- 45 ° c . with stirring . sufficient menthol is added to provide a 1 : 1 molar ratio of cyclodextrin to menthol . after mixing for about one hour , the solution is allowed to cool to room temperature while maintaining continuous stirring . the precipitate is collected by filtration and dried overnight in a vacuum oven at 110 ° c . preparation of γ - cd / m . three 20 % aqueous solutions of gamma - cyclodextrin are prepared and maintained at 40 °- 45 ° c . with stirring . sufficient menthol is added to each solution to provide a 1 : 1 , 1 : 2 or 1 : 3 molar ratio of cyclodextrin to menthol respectively . after mixing for about three hours , the solutions are allowed to cool to room temperature while maintaining continuous stirring . the precipitates are collected , dried overnight in a vacuum oven at 110 ° c ., washed with dry diethyl ether and , after removal of the ether by water aspiration , dried in a hood . alternatively , the collected complexes are dried in a vacuum oven at 110 ° c . overnight . the recovered complexes contain about 10 %, about 17 % and about 19 % menthol respectively . preparation of β - cd / menthyl lactate . a 10 % aqueous solution of beta - cyclodextrin is prepared and maintained at 40 °- 45 ° c . with stirring . sufficient menthyl lactate is added to provide a 1 : 1 molar ratio of cyclodextrin to menthyl lactate . after mixing for about three hours , the solution is allowed to cool to room temperature while maintaining continuous stirring . the precipitate is collected and dried overnight in a vacuum oven at 110 ° c . shaving aid composites similar to insert member 64 shown in fig3 are fabricated from the blends indicated below by extruding the blends through a haake system 90 3 / 4 inch diameter extruder with a barrel pressure of about 1000 - 2000 psi , a rotor speed of about 10 to 50 rpm , and a temperature of about 150 °- 185 ° c . and a die temperature of about 170 °- 185 ° c . the extruded strip of composite is cooled and sliced to appropriate lengths for securing into openings 66 of shaving units 50 . in the blends listed below , the polystyrene is dow styron or mobil 2824 , the high impact polystyrene (&# 34 ; hips &# 34 ;) is mobil 4324 , the polyethylene oxide ( 60 / 40 ) is a blend of 60 % polyox coagulant ( m . w . 5 million ) and 40 % polyox wsr - n - 750 ( m . w . 300 , 000 ), and the polyethylene glycol (&# 34 ; peg &# 34 ;) is dow 4500 peg ( mw = 4500 ). ______________________________________blend a blend b28 . 5 % hips 26 . 8 % hips46 . 8 % polyethylene oxide 44 . 0 % polyethylene oxide8 . 5 % peg 8 . 0 % peg15 . 0 % β - cd / m 15 . 0 % β - cd / m1 . 2 % colorant / antioxidant 5 . 0 % disodium cocamido mea sulfosuccinate 1 . 2 % colorant / antioxidantblend c blend d26 . 8 % hips 26 . 8 % hips44 . 0 % polyethylene oxide 44 . 0 % polyethylene oxide8 . 0 % peg 8 . 0 % peg15 . 0 % β - cd / m 15 . 0 % β - cd / m5 . 0 % poloxamer 188 5 . 0 % sodium dodecyl - 1 . 2 % colorant / antioxidant benzenesulfonate 1 . 2 % colorant / antioxidantblends e , f , & amp ; g blend h28 . 5 % hips 28 . 5 % hips46 . 7 % polyethylene oxide 46 . 7 % polyethylene oxide8 . 5 % peg 8 . 5 % peg15 . 0 % γ - cd / m ( 1 : 1 , 1 : 2 & amp ; 1 : 3 resp .) 15 . 0 % hp - β - cd / m1 . 2 % colorant / antioxidant 1 . 2 % colorant / antioxidantblend j blend k23 . 8 % polystyrene 26 . 8 % hips54 . 8 % polyethylene oxide 44 . 0 % polyethylene oxide5 . 0 % salsorb 88 8 . 0 % peg15 . 0 % γ - cd / m ( 11 . 4 % menthol ) 15 . 0 % β - cd / m1 . 4 % colorant / antioxidant 5 . 0 % salicylic acid 1 . 2 % colorant / antioxidantblend l blend m27 . 8 % hips 33 . 5 % hips45 . 7 % polyethylene oxide 37 . 3 % polyethylene oxide8 . 3 % peg 8 . 0 % peg15 . 0 % β - cd / m 15 . 0 % β - cd / m2 . 0 % na dodecylbenzenesulfonate 5 . 0 % disodium cocamido1 . 2 % colorant / antioxidant mea sulfosuccinate 1 . 2 % colorant / antioxidantblend n blend o26 . 8 % hips 23 . 8 % polystyrene44 . 0 % polyethylene oxide 49 . 8 % polyethylene oxide8 . 0 % peg 5 . 0 % salsorb 8815 . 0 % β - cd / menthyl lactate 20 . 0 % γ - cd / m ( 1 : 2 ) 5 . 0 % nonoxynol - 100 1 . 4 % colorant / antioxidant1 . 2 % colorant / antioxidantblend p23 . 8 % polystyrene59 . 8 % polyethylene oxide15 . 0 % γ - cd / m ( 11 . 4 % menthol ) 1 . 4 % colorant / antioxidant______________________________________ each of the foregoing strips retains a substantial portion ( i . e . & gt ; 50 %) of the skin - soothing agent ( i . e . menthol or menthol analog ) included during fabrication when stored at 45 ° c . for four days . in addition , each of the foregoing strips releases skin - soothing agent when contacted with water .

US-49686095-A

1 - phenyl - 2 - pyridinyl alkyl alcohol compounds are effective as inhibitors of the phosphodiesterase 4 enzyme and may be used to prevent and / or treat certain diseases or conditions .

the term “ halogen atoms ” as used herein includes fluorine , chlorine , bromine and iodine . as used herein , the expression “ linear or branched c 1 - c x alkyl ” where x is an integer greater than 1 , such as c 1 - c 6 or c 1 - c 4 alkyl , refers to straight or branched chain alkyl groups wherein the number of carbon atoms is in the range 1 to x ( e . g . 1 to 6 or 1 to 4 ). examples of alkyl groups may thus include methyl , ethyl , n - propyl , isopropyl , t - butyl , pentyl , hexyl and the like . optionally in said groups one or more hydrogen atoms can be replaced by halogen atoms , preferably chlorine or fluorine . as used herein , the expression “ c 3 - c 7 cycloalkyl ” refers to cyclic non - aromatic hydrocarbon groups containing 3 to 7 ring carbon atoms . examples of them may thus include cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl and cycloheptyl . unless otherwise provided , when referring to chiral compounds , a degree of purity “ substantially pure ” here means at least greater than about 97 % chirally pure , preferably greater than 99 % and most preferably greater than 99 . 9 %. the invention is directed to compounds acting as inhibitors of the phosphodiesterase 4 ( pde4 ) enzyme . said compounds inhibit the conversion of cyclic nucleotides , in particular cyclic adenosine monophosphate ( camp ), into their inactive 5 ′- mononucleotide forms . in the airways , the physiological responses to elevated intracellular levels of cyclic nucleotides , in particular of camp , lead to the suppression of the activity of immune and pro - inflammatory cells such as mast cells , macrophages , t lymphocytes , eosinophils and neutrophils , resulting in a decrease of the release of inflammatory mediators which include cytokines such as il - 1 , il - 3 and tumor necrosis factor - alpha ( tnf - α ). it also leads to an airway smooth muscle relaxation and a decrease in oedema . the catalytic site of pde4 has been previously identified : it mainly comprises a hydrophobic region in which two sub - pockets are present , e . g . s 0 and s 1 and a hydrophilic region containing the metal ions zn 2 + and mg 2 + , that in turn comprises the sub - pocket s 2 spreading around the metal ions and a sub - pocket s 3 which branches approximately 90 ° from the middle of the hydrophobic pocket . most of the known compounds are provided with a moiety capable of interacting with the sub - pockets s 0 and s 1 of the hydrophobic region such as a substituted cathecol group and with another moiety able of indirectly interacting with the metal ions of the s 2 sub - pocket , for example a heterocycle such as pyridine or pyrrolidone . the present invention is directed to compounds that can maintain the interactions with the sub - pockets s 0 and s 1 by means of the substituted catechol moiety and the interaction with the metal ions region by means of the pyridine ring like other known pde4 inhibitors , but differing from them , for the presence of a sulfonylamino - benzoic acid group , which enable them to establish an additional interaction with the sub - pocket s 3 . in particular the present invention relates to compounds of formula ( i ) as defined earlier , including the pharmaceutically acceptable inorganic and organic salts , hydrates , solvates or addition complexes thereof . r1 is — nhso 2 r4 , wherein r4 is methyl , r2 is — or3 , wherein r3 is cyclopropylmethyl , and n is 0 ; r1 is — nhso 2 r4 , wherein r4 is methyl , r2 is — or3 , wherein r3 is cyclopropylmethyl , and n is 1 ; r1 is linear or branched c 1 - c 6 alkyl , r2 is — nhso 2 r4 , and n is 0 ; r1 is methyl , r2 is — nhso 2 r4 , wherein r4 is methyl , and n is 0 ; r1 is linear or branched c 1 - c 6 alkyl , r2 is — nhso 2 r4 , and n is 1 ; r1 is methyl , r2 is — hnso 2 r4 , wherein r4 is methyl , and n is 1 ; r2 is linear or branched c 1 - c 6 alkyl , r1 is — nhso 2 r4 , and n is 0 ; r2 is methyl , r1 is — hnso 2 r4 , wherein r4 is methyl , and n is 0 ; r2 is linear or branched c 1 - c 6 alkyl , r1 is — nhso 2 r4 , and n is 1 ; r2 is methyl , r1 is — nhso 2 r4 , wherein r4 is methyl , and n is 1 ; r1 is — or3 wherein r3 is cyclopropylmethyl , r2 is — nhso 2 r4 and r4 is methyl , and n is 1 ; both r1 and r2 are — nhso 2 r4 , and n is 0 ; both r1 and r2 are — nhso 2 r4 , wherein r4 is methyl , and n is 0 ; both r1 and r2 are — nhso 2 r4 , and n is 1 ; and both r1 and r2 are — nhso 2 r4 , wherein r4 is methyl , and n is 1 . it will be apparent to those skilled in the art that compounds of formula ( i ) contain at least one asymmetric center , presently represented by the carbon atom with an asterisk , and therefore exist as optical stereoisomers . the present invention is directed to the compounds of formula ( i ) which are (−) enantiomers with configuration ( s ) at the carbon atom represented with an asterisk . the present invention is also directed to the intermediate compounds of formula ( ii ) wherein the carbon atom represented with an asterisk has the ( s ) configuration . the compounds of formula ( i ) show an in vitro inhibitory activity toward the pde4 enzyme in the nm range , and they are endowed with a remarkable activity in the lungs upon intra - tracheal administration in an animal model of copd . they may also exhibit sustained pulmonary levels in the lungs , being undetectable in plasma , which is an index of a short systemic action . according to preferred embodiments , the present invention provides the compounds of formula ( i ) reported below : the above compounds have been conveniently identified as (−) enantiomers which , however , have ( s ) configuration at the carbon atom marked with an asterisk . as such , these same compounds can be also identified as per the following table : advantageously , the compounds of the invention are characterized by selectivity toward lpde4 higher than that toward hpde4 , as obtained by the determination of their ic 50 values . in the case of lpde4 , the ic 50 is the molar concentration of the test compound producing 50 % inhibition of camp disappearance , assessed as described in cortijo j et al ., br . j . pharmacol ., 1993 , 108 : 562 - 568 , which is incorporated herein by reference in its entirety . in the case of hpde4 instead , the ic 50 is the molar concentration of the test compound producing 50 % inhibition of the binding of [ h 3 ] rolipram , assessed as described in duplantier a j et al ., j . med . chem ., 1996 ; 39 : 120 - 125 , which is also incorporated herein by reference in its entirety . preferably , the hpde4 / lpde4 ic 50 ratio for the compounds of the invention is higher than 5 , more preferably higher than 10 , even more preferably higher than 20 and most preferably higher than 100 . the compounds of formula ( i ) may be prepared conventionally according to known methods . some of the processes which can be used are described below and reported in scheme 1 . according to a particular embodiment of the present invention , the compounds of formula ( i ) may be prepared , for example , following the synthetic pathways described in scheme 1 . racemic alcohol ( 3 ) may be prepared by reacting aldehyde ( 1 ) with methyldichloropyridine ( 2 ). racemic alcohol ( 3 ) may be separated into (−) ( 12 ) and (+) ( 14 ) enantiomers by known methods , such as by reacting the racemic mixture with a suitable chiral auxiliary thus obtaining a mixture of diastereoisomers . such diastereoisomers may be separated by crystallization or by chromatography or by means of enzymes according to known methods . subsequently , the chiral auxiliary may be removed from diastereoisomers to give the desired chiral alcohol as a single enantiomer . alternatively , the alcohol racemic mixture may be resolved by means of chromatography with a chiral stationary phase , according to known methods ( see , “ enantiomer separation : fundamentals and practical methods ” f . toda , springer - verlag 2004 ; and “ drug stereochemistry : analytical methods and pharmacology ”, irving w . wainer , crc press , 1993 , which are both incorporated herein by reference in their entireties ). in particular , racemic alcohol ( 3 ) may be condensed with a chiral acid such as ( s )- naproxen and the obtained diastereomeric mixture ( 10 ) may be separated into the two single diastereoisomers ( 11 ) and ( 13 ) by chromatography . after cleavage of the single diastereomeric esters by hydrolysis in an aqueous solvent or by alcoholysis in an alcoholic solvent , using acidic or basic conditions , enantiomeric pure alcohol intermediates (−) ( 12 ) and (+) ( 14 ) may be obtained . racemate ( 4 ), obtained by oxidation of racemate ( 3 ) carried out according to conventional methods , may be reacted with a chiral acid such as ( s )- acetylmandelic acid so obtaining a mixture of two diastereoisomers ( 5 ). by trituration with diethyl ether and crystallization in a solvent such as isopropanol , ethanol or methanol , or by chromatographic separation , single diastereomeric esters ( 6 ) and ( 8 ) may be obtained . after cleavage of single diastereomeric esters by hydrolysis in an aqueous solvent or by alcoholysis in an alcoholic solvent , using acidic or basic conditions , enantiomeric pure alcohol intermediates (+) ( 7 ) and (−) ( 9 ) may be obtained . compounds of formula ( i ) wherein n is 0 may be prepared by reacting the proper enantiomeric alcohol (+)( 14 ) with benzoic acid ( 15 ) in the presence of a suitable strong base such as lithium diisopropylamide ( lda ), nah , or dimethylaminopyridine ( dmap ) and in the presence of a condensing agent such as 1 - ethyl - 3 -[ 3 - dimethylaminopropyl ]- carbodiimide hydrochloride ( edc ) or n - hydroxybenzotriazole ( hobt ) in a solvent such as dichloromethane . other solvents may be used , such as dimethylformamide ( dmf ), tetrahydrofuran ( thf ), chloroform , dioxane or any other aprotic solvent known to those skilled in the art . in a particular embodiment , the reaction may also be carried out in the absence of solvents . compounds of formula ( i ) wherein n is 1 may be prepared by oxidizing corresponding compounds of formula ( i ) wherein n is 0 by means of an oxidizing agent such as 3 - chloroperbenzoic acid , peracetic acid or hydrogen peroxide in solvents such as chloroform , dichloromethane or acetic acid ( route b ). alternatively , compounds of formula ( i ) wherein n is 1 may also be prepared by first oxidizing alcohol enantiomers (+) ( 14 ), by means of the aforementioned operative conditions , thus obtaining alcohol enantiomers (+) ( 7 ). subsequent reaction between the given alcohol enantiomer with a benzoic acid of formula ( 15 ), thus provides the above compounds of formula ( i ) wherein n is 0 ( route a ). separation of (+) ( 7 ) and (−) ( 9 ) enantiomers from racemic alcohol ( 4 ), which in its turn be obtained by oxidation of racemic alcohol ( 3 ), may be carried out by known methods , as described above for separation of enantiomers of racemic alcohol ( 3 ). the skilled person should be aware that optional variations to the synthetic steps reported in scheme 1 may be applied as well to the preparation of the compounds of the invention . in particular , the order of reactions may be performed so as to get the desired compounds or intermediates thereof , as well as to the choice of operative conditions being adapted , including solvents , optional oxidizing agents , condensing agents , and the like . as an example , in case chemically reactive substituents are present in any of the starting materials or intermediates thereof , that might give rise to unwanted side reactions , suitable protection of those same substituents may be carried out before the reaction takes place . by analogy , subsequent deprotection may be then carried out , so as to obtain again the above chemically reactive substituent or group in the free form . the protection and deprotection of functional groups is described in “ protective groups in organic chemistry ,” 3rd edition , t . w . greene and p . g . m . wuts , wiley - interscience ( 1999 ) and in “ protecting groups ,” p . j . kocienski , georg thieme verlag ( 1994 ) both of which are incorporated herein by reference in their entireties . according to the present process for the preparation of the compounds of the invention , and variants thereof , the starting materials of formula ( 1 ) and ( 2 ) as well as any additional reactant [( e . g . of formula ( 15 )], auxiliar of chirality , solvent or agent being employed , is known or may be easily prepared according to known methods . the present invention also provides pharmaceutical compositions of compounds of formula ( i ) in admixture with one or more pharmaceutically acceptable carriers , for example those described in remington &# 39 ; s pharmaceutical sciences handbook , xvii ed ., mack pub ., n . y ., u . s . a , which is incorporated herein by reference in its entirety . examples include diluents ( such as sucrose , mannitol , lactose , starches ) and known excipients , including suspending agents , solubilizers , buffering agents , binders , disintegrants , preservatives , colorants , flavours , lubricants and the like . time release capsules , tablets and gels are also advantageous in administering the compounds of the present invention . administration of the compounds of the present invention may be accomplished according to patient needs , for example , orally , nasally , parenterally , e . g . subcutaneously , intravenously , intramuscularly , intrastemally and by infusion , by inhalation , rectally , vaginally , topically , locally , transdermally , and by ocular administration . various solid oral dosage forms may be used for administering compounds of the invention including such solid forms as tablets , gelcaps , capsules , caplets , granules , lozenges and bulk powders . various liquid oral dosage forms may also be used for administering compounds of the invention , including aqueous and non - aqueous solutions , emulsions , suspensions , syrups , and elixirs . such dosage forms can also contain known suitable inert diluents such as water and known suitable excipients such as preservatives , wetting agents , sweeteners , flavours , as well as agents for emulsifying and / or suspending the compounds of the invention . the compounds of the invention may be injected , for example , intravenously , in the form of an isotonic sterile solution . other preparations conventionally known in the art are also possible . suppositories for rectal administration of the said compounds of the invention may be prepared by mixing the compound with a suitable excipient such as cocoa butter , salicylates and polyethylene glycols . formulations for vaginal administration may be in the form of cream , gel , paste , foam , or spray formula containing , in addition to the active ingredient , conventional carriers . for topical administration , the pharmaceutical compositions may be in the form of creams , ointments , liniments , lotions , emulsions , suspensions , gels , solutions , pastes , powders , sprays , and drops suitable for administration to the skin ; eye , car or nose . topical administration may also involve transdermal administration , e . g . by means of transdermal patches . for the treatment of the diseases of the respiratory tract , the compounds of the invention are preferably administered by inhalation . inhalable preparations include inhalable powders , propellant - containing metering aerosols or propellant - free inhalable formulations . for administration as a dry powder , single - or multi - dose inhalers known from the prior art may be utilized . in that case , the powder may be filled in gelatine , plastic or other capsules , cartridges or blister packs or in a reservoir . a diluent or carrier , generally chemically inert to the compounds of the invention , e . g . lactose or any other additive suitable for improving the respirable fraction may be added to the powdered compounds of the invention . inhalation aerosols containing propellant gas such as hydrofluoroalkanes may contain the compounds of the invention either in solution or in dispersed form . the propellant - driven formulations may also contain other ingredients such as co - solvents , stabilizers and optionally other excipients . the propellant - free inhalable formulations comprising the compounds of the invention may be in form of solutions or suspensions in an aqueous , alcoholic or hydroalcoholic medium and they may be delivered by jet or ultrasonic nebulizers known from the prior art or by soft - mist nebulizers such as respimat ®. the compounds of the invention may be administered as the sole active agent or in combination with one or more other pharmaceutical active ingredients including those currently used in the treatment of respiratory disorders , e . g . β 2 - agonists , corticosteroids and m3 antagonists . the dosages of the compounds of the invention may depend upon a variety of factors including the particular disease to be treated , the severity of the symptoms , the route of administration , the frequency of the dosage interval , the particular compound utilized , the efficacy , toxicology profile , and pharmacokinetic profile of the compound . advantageously , the compounds of formula ( i ) may be administered for example , at a dosage comprised between 0 . 001 and 1000 mg / day , preferably between 0 . 1 and 500 mg / day . when they are administered by inhalation route , the dosage of the compounds of formula ( i ) is advantageously comprised between 0 . 01 and 20 mg / day , preferably between 0 . 1 and 10 mg / day . preferably , the compounds of formula ( i ) alone or combined with other active ingredients may be administered for the prevention and / or treatment of any obstructive respiratory disease such as asthma , chronic bronchitis and chronic obstructive pulmonary disease ( copd ). however the compounds of formula ( i ) may be administered for the prevention and / or treatment of any disease wherein the activity of pde4 receptors is implicated and inhibition of pde4 receptor activity is desired , or a disease state which is mediated by pde4 activity ( for instance a disease state in which pde4 is overexpressed or overactive ). examples of such diseases include ; allergic disease states such as atopic dermatitis , urticaria , allergic rhinitis , allergic conjunctivitis , vernal conjunctivitis , eosinophilic granuloma , psoriasis , inflammatory arthritis , rheumatoid arthritis , septic shock , ulcerative colitis , crohn &# 39 ; s disease , reperfusion injury of the myocardium and brain , chronic glomerulonephritis , endotoxic shock , cystic fibrosis , arterial restenosis , atherosclerosis , keratosis , rheumatoid spondylitis , osteoarthritis , pyresis , diabetes mellitus , pneumoconiosis , toxic and allergic contact eczema , atopic eczema , seborrheic eczema , lichen simplex , sunburn , itching in the anogenital area , alopecia areata , hypertrophic scars , discoid lupus erythematosus , systemic lupus erythematosus , follicular and wide - area pyodermias , endogenous and exogenous acne , acne rosacea , beghet &# 39 ; s disease , anaphylactoid purpura nephritis , inflammatory bowel disease , leukemia , multiple sclerosis , gastrointestinal diseases , autoimmune diseases , and the like . they also include neurological and psychiatric disorders such as alzheimer &# 39 ; s disease , multiple sclerosis , amylolaterosclerosis ( als ), multiple systems atrophy ( msa ), schizophrenia , parkinson &# 39 ; s disease , huntington &# 39 ; s disease , pick &# 39 ; s disease , depression , stroke , and spinal cord injury . other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof . a solution of 3 - cyclopropylmethoxy - 4 - difluoromethoxy - benzaldehyde ( 5 . 00 g ) and 3 , 5 - dichloro - 4 - methylpyridine ( 2 . 57 g ) in 50 ml dry thf was cooled to − 30 ° c . solid potassium t - butoxide ( tbuok , 1 . 96 g ) was added portionwise maintaining the temperature between − 30 ° c . and − 20 ° c ., thus obtaining a dark red solution . after completion of the addition , the mixture was stirred at − 30 ° c . for 1 hour . a saturated aqueous solution of nh 4 cl ( 50 ml ) was then added to the reaction mixture , maintaining the temperature between − 5 ° c . and − 10 ° c . the color of the reaction mixture turned to yellow . the mixture was then extracted with etoac . the organic layer was dried over na 2 so 4 and the solvent was removed by evaporation . the residue was treated with 30 ml of a mixture of petroleum ether / etoac = 8 / 2 ; the precipitate was filtered and dried , obtaining 4 . 83 g of the title compound that was employed in the next step without further purification . compound ( 3 ) ( 13 . 0 g ) was dissolved in ch 2 cl 2 ( 250 ml ) then m - chloro perbenzoic acid ( 16 . 5 g ) was added , and the resulting solution was stirred at room temperature for 2 hours . na 2 s 2 o 3 ( 25 . 4 g ) was added , and the mixture was vigorously stirred at r . t . for 1 hour . the solid residue was filtered off , the solution was washed with 1n naoh ( 3 × 100 ml ) then the organic phase was dried over na 2 so 4 and the solvent was removed by evaporation to give 10 . 3 g of the desired product ( 4 ) as a white solid that was used in the next steps without further purification . compound ( 4 ) ( 19 . 95 g ), ( s )- acetylmandelic acid ( 9 . 22 g ), 1 - ethyl - 3 -( 3 - dimethylamino propyl ) carbodiimide hydrochloride ( 18 g ), and 4 - dimethylaminopyridine ( 2 . 89 g ) were dissolved , under n 2 atmosphere , in dry ch 2 cl 2 ( 300 ml ). the reaction mixture was stirred at room temperature overnight . a 5 % aqueous solution of nahco 3 ( 200 ml ) was added and the aqueous phase was extracted with ch 2 cl 2 ( 3 × 100 ml ). the combined organic phases were dried over na 2 so 4 and the solvent was evaporated under reduced pressure to give the title compound ( 5 ) as mixture of two diastereoisomers ( 32 g ); separation of the two diastereoisomers is described in examples 4 and 6 . the crude diastereomeric mixture ( 5 ) ( 32 g ) was triturated with et 2 o ( 100 ml ), sonicated and filtered . the procedure was repeated four times in order to obtain a solid mixture enriched in diastereoisomer ( 6 ). this solid was crystallized from iproh ( 80 ml ) and filtered to give 9 . 65 g of compound ( 6 ) with diastereomeric purity & gt ; 95 %. the diastereomeric purity was determined by hplc analysis and by analytical chiral hplc performed on chiracel od column ( isocratic elution with hexane : isopropanol 40 : 60 , flow 0 . 45 ml / min , retention time = 27 . 2 min ). 1h nmr ( 300 mhz , dmso - d6 ) ppm 8 . 57 ( s , 2h ), 7 . 27 - 7 . 44 ( m , 5h ), 6 . 91 - 7 . 18 ( m , 1h ), 7 . 03 ( t , 1h ), 6 . 71 - 6 . 79 ( m , 2h ), 5 . 95 ( dd , 1h ), 5 . 85 ( s , 1h ), 3 . 72 ( dd , 1h ), 3 . 60 ( dd , 1h ), 3 . 41 ( dd , 1h ), 3 . 23 ( dd , 1h ), 2 . 13 ( s , 3h ), 1 . 07 - 1 . 31 ( m , 1h ), 0 . 48 - 0 . 72 ( m , 2h ), 0 . 21 - 0 . 44 ( m , 2h ) compound ( 6 ) ( 6 . 42 g ) was suspended in methanol ( 350 ml ) then a saturated solution of nahco 3 ( 175 ml ) was added . the white suspension was vigorously stirred at room temperature overnight . the reaction mixture was diluted with ch 2 cl 2 ( 700 ml ) and washed with a 5 % aqueous solution of nahco 3 ( 300 ml ); the aqueous phase was extracted with ch 2 cl 2 ( 2 × 300 ml ), the combined organic layers were dried over na 2 so 4 , and the solvent was removed by evaporation under vacuum . the crude white solid obtained was triturated with et 2 o ( 2 × 100 ml ) and filtered to give 3 . 88 g of compound ( 7 ) with enantiomeric purity & gt ; 99 %. the enantiomeric purity was determined by analytical chiral hplc performed on chiracel od column ( isocratic elution with hexane : isopropanol 30 : 70 , flow 0 . 35 ml / min , retention time = 22 . 3 min ). 1 h nmr ( 300 mhz , dmso - d6 ) ppm 8 . 51 ( s , 2h ), 7 . 11 ( d , 1h ), 7 . 05 ( d , 1h ), 6 . 88 ( dd , 1h ), 7 . 01 ( t , 1h ), 5 . 59 ( d , 1h ), 4 . 84 ( dd , 1h ), 3 . 89 ( dd , 1h ), 3 . 84 ( dd , 1h ), 3 . 18 ( dd , 1h ), 3 . 02 ( dd , 1h ), 1 . 03 - 1 . 35 ( m , 1h ), 0 . 46 - 0 . 67 ( m , 2h ), 0 . 24 - 0 . 46 ( m , 2h ) the crude diastereomeric mixture ( 5 ) was triturated with et 2 o ( 100 ml ), sonicated and filtered . the procedure was repeated four times , and the filtrates were collected and evaporated under reduced pressure to give a solid mixture enriched in diastereoisomer ( 8 ) that was crystallized from iproh ( 100 ml ) to give 6 . 4 g of compound ( 8 ) as a white solid with diastereomeric purity & gt ; 99 %. the diastereomeric purity was determined by hplc analysis and by analytical chiral hplc performed on chiracel od column ( isocratic elution with hexane : isopropanol 40 : 60 , flow 0 . 45 ml / min , retention time = 21 . 6 min ). 1 h nmr ( 300 mhz , dmso - d6 ) ppm 8 . 27 ( s , 2h ), 7 . 27 - 7 . 45 ( m , 5h ), 7 . 20 ( d , 1h ), 7 . 08 ( d , 1h ), 7 . 00 ( dd , 1h ), 7 . 08 ( t , 1h ), 5 . 97 ( dd , 1h ), 5 . 85 ( s , 1h ), 3 . 93 ( dd , 1h ), 3 . 89 ( dd , 1h ), 3 . 33 ( dd , 1h ), 3 . 17 ( dd , 1h ), 2 . 07 ( s , 3h ), 1 . 14 - 1 . 38 ( m , 1h ), 0 . 50 - 0 . 71 ( m , 2h ), 0 . 21 - 0 . 47 ( m , 2h ) compound ( 8 ) ( 1 . 18 g ) was suspended in methanol ( 50 ml ) then a saturated solution of nahco 3 ( 25 ml ) was added . the white suspension was vigorously stirred at room temperature for 24 hours . the reaction mixture was diluted with ch 2 cl 2 ( 700 ml ) then a 5 % aqueous solution of nahco 3 ( 300 ml ) was added , and the phases were separated . the aqueous phase was extracted with ch 2 cl 2 ( 2 × 100 ml ), the combined organic layers were dried over na 2 so 4 and the solvent was removed by evaporation under vacuum . the crude white solid obtained was triturated twice with et 2 o ( 50 ml ) and once with ch 2 cl 2 ( 20 ml ), then was filtered to give 0 . 74 g of compound ( 7 ) with enantiomeric purity & gt ; 99 %. the enantiomeric purity was determined by analytical chiral hplc performed on chiracel od column ( isocratic elution with hexane : isopropanol 30 : 70 , flow 0 . 35 ml / min , retention time = 24 . 0 min ). 1 h nmr ( 300 mhz , dmso - d6 ) ppm 8 . 51 ( s , 2h ), 7 . 11 ( d , 1h ), 7 . 05 ( d , 1h ), 6 . 88 ( dd , 1h ), 7 . 01 ( t , 1h ), 5 . 59 ( d , 1h ), 4 . 84 ( dt , 1h ), 3 . 89 ( dd , 1h ), 3 . 84 ( dd , 1h ), 3 . 18 ( dd , 1h ), 3 . 02 ( dd , 1h ), 1 . 08 - 1 . 32 ( m , 1h ), 0 . 47 - 0 . 66 ( m , 2h ), 0 . 26 - 0 . 45 ( m , 2h ) 2 -( 6 - methoxy - naphthalen - 2 - yl )- propionic acid 1 -( 3 - cyclopropylmethoxy - 4 - difluoromethoxy - phenyl )- 2 -( 3 , 5 - dichloro - pyridin - 4 - yl )- ethyl ester ( 10 , mixture of diastereoisomers 11 and 13 ) compound ( 3 ) ( 12 . 0 g ) was dissolved in dmf ( 100 ml ) then ( s )- 2 -( 6 - methoxy - naphthalen - 2 - yl )- propionic acid ( 7 . 5 g ), 4 - dimethylaminopyridine ( 3 . 6 g ), and 1 - ethyl - 3 -[ 3 - dimethylaminopropyl ] carbodiimide hydrochloride ( 5 . 7 g ) was added . after stirring at rt for 4 hours , water ( 1000 ml ) is added . the mixture was extracted with etoac ( 500 ml × 2 ), the combined organic layers are dried over sodium sulphate , and the solvent was removed by evaporation under reduced pressure to afford 17 . 0 g of an oil which is crystallized from etoh thus obtaining 11 . 5 g of the title compound as mixture of diastereomers ( 11 ) and ( 13 ). 1 h nmr ( 200 mhz , cdcl 3 ) ppm 8 . 43 and 8 . 60 ( 2s , 1h each , 2h ), 7 . 51 - 7 . 68 ( m , 3h ), 7 . 10 - 7 . 23 ( m , 3h ), 6 . 85 - 6 . 97 ( m , 2h ), 6 . 51 - 6 . 68 ( m , 1h ), 6 . 22 - 6 . 97 ( t , 1h , chf 2 ), 6 . 00 - 6 . 13 ( m , 1h ), 3 . 93 - 3 . 95 ( s , 3h , och 3 ), 3 . 72 - 3 . 84 ( m , 2h ), 3 . 07 - 3 . 57 ( m , 3h ), 1 . 42 - 1 . 45 ( d , 3h , ch 3 ), 0 . 94 - 1 . 25 ( m , 1h ), 0 . 51 - 0 . 67 ( m , 2h ), 0 . 12 - 0 . 36 ( m , 2h ). the compound was isolated from the diastereomeric mixture of example 8 by hplc separation using a daisogel 10 μm , 50 × 300 mm column ; eluent : n - hexane / methyl - tert - butyl - ether / isopropyl alcohol : 90 / 9 . 9 / 0 . 1 ; flow : 80 ml / min . ; loading : 300 mg per injection ; elution time : from 11 to 20 min . the collected fractions were evaporated and the residue was crystallized from n - hexane / isopropyl - alcohol . 1 h nmr ( 200 mhz , cdcl 3 ) ppm 8 . 60 ( s , 2h ), 7 . 68 - 7 . 75 ( m , 2h ), 7 . 58 - 7 . 59 ( m , 1h ), 7 . 27 - 7 . 29 ( d , 1h ), 7 . 12 - 7 . 24 ( m , 2h ), 6 . 98 - 7 . 04 ( m , 1h ), 6 . 73 - 6 . 78 ( dd , 1h ), 6 . 67 - 6 . 68 ( d , 1h ), 6 . 60 - 7 . 35 ( t , 1h , chf 2 ), 5 . 99 - 6 . 06 ( m , 1h ), 3 . 84 - 3 . 87 ( m , 3 . 47 - 3 . 55 ( m , 2h ), 3 . 32 - 3 . 41 ( dd , 1h ), 3 . 22 - 3 . 29 ( m , 1h ), 1 . 33 - 1 . 37 ( d , 3h , ch 3 ), 0 . 96 - 1 . 03 ( m , 1h ), 0 . 43 - 0 . 52 ( m , 2h ), 0 . 13 - 0 . 21 ( m , 2h ). the compound was isolated from the diastereomeric mixture of example 8 by hplc separation using a daisogel 10 μm , 50 × 300 mm column ; eluent : n - exane / methyl - tert - butyl - ether / isopropyl - alcohol : 90 / 9 . 9 / 0 . 1 ; flow : 80 ml / min . ; loading : 300 mg per injection ; elution time : from 7 to 10 min . the collected fractions were evaporated and the residue was crystallized from n - hexane / isopropyl - alcohol . 1 h nmr ( 200 mhz , cdcl 3 ) ppm 8 . 27 ( s , 2h ), 7 . 64 - 7 . 80 ( m , 2h ), 7 . 56 - 7 . 57 ( m , 1h ), 7 . 28 - 7 . 29 ( d , 1h ), 7 . 14 - 7 . 20 ( m , 3h ), 6 . 68 - 7 . 42 ( t , 1h , chf 2 ), 6 . 93 - 6 . 98 ( m , 2h ), 6 . 00 - 6 . 07 ( m , 1h ), 3 . 88 - 3 . 92 ( m , 4h ), 3 . 71 - 3 . 84 ( m , 2h ), 3 . 39 - 3 . 51 ( dd , 1h ), 3 . 16 - 3 . 25 ( dd , 1h ), 1 . 33 - 1 . 37 ( d , 3h , ch 3 ), 1 . 08 - 1 . 23 ( m , 1h ), 0 . 50 - 0 . 59 ( m , 2h ), 0 . 34 - 0 . 26 ( m , 2h ). to a suspension of (+)- 2 -( 6 - methoxy - naphthalen - 2 - yl )- propionic acid - 1 -( 3 - cyclopropyl methoxy - 4 - difluoromethoxy - phenyl )- 2 -( 3 , 5 - dichloro - pyridin - 4 - yl )- ethyl ester ( 13 ) ( 14 . 0 g ) in methanol ( 110 ml ), potassium tert - butoxide ( 5 . 1 g ) was added . the resulting mixture was stirred at rt for 2 hours , obtaining a clear solution . water was slowly added under stirring to incipient precipitation ( turbid solution ). after stirring for a further 60 minutes , the precipitated solid was filtered , washed with water and dissolved in chloroform ( 100 ml ). the solution was dried over sodium sulphate and the solvent removed under vacuum . the residue was crystallized in chloroform / hexane = 1 / 2 . 5 to obtain 8 . 1 g of white solid . 1 h nmr ( 200 mhz , cdcl 3 ) ppm δ 8 . 45 ( s , 2h ), 7 . 19 - 7 . 08 ( d , 1h ), 7 . 06 - 7 . 00 ( d , 1h ), 6 . 95 - 6 . 85 ( dd , 1h ), 6 . 99 - 6 . 24 ( t , 1h , chf 2 ), 5 . 18 - 5 . 00 ( m , 1h ), 3 . 98 - 3 . 78 ( m , 2h ), 3 . 54 - 3 . 35 ( m , 1h ), 3 . 31 - 3 . 15 ( m , 1h ), 2 . 04 - 1 . 94 ( d , 1h , oh ), 1 . 40 - 1 . 14 ( m , 1h ), 0 . 75 - 0 . 53 ( m , 2h ), 0 . 50 - 0 . 29 ( m , 2h ). starting from diastereoisomer ( 11 ), following the procedure of example 10 , alcohol ( 12 ) was obtained . compound ( 14 ) ( 3 . 0 g ) was dissolved in ch 2 cl 2 ( 100 ml ). 70 % m - chloro perbenzoic acid ( 5 . 4 g ) was added , and the resulting solution was stirred at room temperature for 18 hours . solid na 2 s 2 o 3 ( 5 g ) was then added , and the mixture was vigorously stirred at r . t . for 30 minutes . the solid residue was removed by filtration ; the organic solution was diluted with additional 100 ml of ch 2 cl 2 and washed with aqueous saturated nahco 3 solution ( 3 × 100 ml ). the organic phase was dried over na 2 so 4 , and the solvent was removed by evaporation . the residue was triturated in etoac ( 20 ml ) to give 1 . 9 g of the desired product 7 as a white solid , which was used in the next step without further purification . 1 h nmr ( 200 mhz , cdcl 3 ) ppm 8 . 14 ( s , 2h ), 7 . 18 - 7 . 09 ( d , 1h ), 7 . 07 - 7 . 02 ( d , 1h ), 6 . 92 - 6 . 83 ( dd , 1h ), 7 . 01 - 6 . 22 ( t , 1h , chf 2 ), 5 . 10 - 4 . 96 ( m , 1h ), 3 . 96 - 3 . 84 ( d , 2h ), 3 . 45 - 3 . 29 ( m , 1h ), 3 . 23 - 3 . 07 ( m , 1h ), 3 . 24 - 3 . 17 ( d , 1h , oh ), 1 . 41 - 1 . 67 ( m , 1h ), 0 . 75 - 0 . 53 ( m , 2h ), 0 . 50 - 0 . 29 ( m , 2h ). alcohol ( 9 ) may be obtained following the procedure described in example 13 , using alcohol ( 12 ) in place of alcohol ( 14 ) as starting material . 1 - ethyl - 3 -[ 3 - dimethylamino propyl ] carbodiimide hydrochloride ( 2 . 85 g ) was added to a solution of alcohol ( 14 ) ( 2 . 0 g ), 4 - dimethylaminopyridine ( 0 . 3 g ), 3 - cyclopropylmethoxy - 4 -( n - tert - butoxycarbonyl - n - methanesulfonyl )- amino - benzoic acid ( 2 . 0 g ) in dry ch 2 cl 2 ( 180 ml ) at r . t . under nitrogen atmosphere . after stirring at r . t . overnight , the mixture was washed with 5 % aqueous hcl ( 2 × 100 ml ); the organic phase was separated and washed with a saturated aqueous solution of nahco 3 ( 2 × 100 ml ), dried over na 2 so 4 and evaporated to dryness . the crude was purified by flash chromatography on silica gel in gradient elution ( hexane / etoac 10 / 1 to 6 / 4 ) to afford 1 . 4 g of the title compound . 3 - cyclopropylmethoxy - 4 -( n - tert - butoxycarbony - n - methanesulfonyl )- amino - benzoic acid 1 -( 3 - cyclopropylmethoxy - 4 - difluoromethoxy - phenyl )- 2 -( 3 , 5 - dichloro - pyridin - 4 - yl )- ethyl ester ( 1 . 4 g ) was dissolved in ch 2 cl 2 ( 140 ml ). a 4m solution of hcl in dioxane ( 40 ml ) was added and the resulting mixture was stirred at r . t . for 24 hours . the reaction mixture was then evaporated to dryness , and the residue was triturated in iproh ( 50 ml ) and subsequently in etoh ( 50 ml ) followed by et 2 o ( 70 ml ) to afford 0 . 880 g of compound ( c1 ). compound ( c2 ) was prepared according to the same synthetic procedure of example 15 , starting from alcohol intermediate ( 7 ). alternatively , compound ( c2 ) can be prepared starting from compound ( c1 ) as described in the following example 17 . preparation of (−)- 3 - cyclopropylmethoxy - 4 - methanesulfonylamino - benzoic acid 1 -( 3 - cyclopropylmethoxy - 4 - difluoromethoxy - phenyl )- 2 -( 3 , 5 - dichloro - 1 - oxy - pyridin - 4 - yl )- ethyl ester ( c2 ) starting from compound ( c1 ) compound ( c1 ) ( 0 . 69 g ) was dissolved in ch 2 cl 2 ( 20 ml ). 70 % m - chloro perbenzoic acid ( 0 . 355 g ) was added , and the resulting solution was stirred at room temperature for 18 hours . solid na 2 s 2 o 3 ( 0244 g ) was then added , and the mixture was vigorously stirred at r . t . for 30 minutes . the solid residue was removed by filtration ; the organic solution was diluted with additional 20 ml of ch 2 cl 2 and washed with aqueous saturated nahco 3 solution ( 3 × 20 ml ). the organic phase was dried over na 2 so 4 and the solvent was removed by evaporation . the residue was triturated in etoh ( 20 ml ) to give 0 . 710 g of the desired compound ( c2 ) as a white solid . the following compounds shown in table 2 were prepared following the same route using suitable reagents . the carboxylic acid intermediates employed in the synthesis of the described final compounds are commercially available or are already known or are synthesized according to known methods . 3 - hydroxy - 4 - nitro - benzoic acid ( 10 g ) was dissolved in meoh ( 500 ml ). 96 % h 2 so 4 ( 2 ml ) was added , and the mixture was heated to 60 ° c . for 18 hours . the reaction mixture was concentrated to approx . 200 ml , diluted with etoac ( 200 ml ) and washed with an aqueous saturated solution of nahco 3 ( 2 × 20 ml ). the organic layer was dried over na 2 so 4 and the solvent was removed by evaporation to yield 10 . 5 g of the desired intermediate . 3 - hydroxy - 4 - nitro - benzoic acid methyl ester ( 10 . 5 g ) was dissolved in dry dmf ( 150 ml ) under n 2 atmosphere . k 2 co 3 ( 24 . 3 g ), k1 ( 2 . 6 g ) and cyclopropylmethylbromide ( 10 . 3 ml ) were added and the mixture was stirred at 50 ° c . for 6 hours . the reaction mixture was diluted with water ( 300 ml ) and extracted with et 2 o ( 2 × 200 ml ); the combined organic layers were dried over na 2 so 4 and the solvent was removed by evaporation to yield 12 . 7 g of the desired intermediate . 3 - cyclopropylmethoxy - 4 - nitro - benzoic acid methyl ester ( 12 . 7 g ) was dissolved in meoh ( 100 ml ) and etoac ( 100 ml ); 10 % pd / c ( 1 . 0 g , suspended in 20 ml of water ) was added , and the mixture is hydrogenated in a parr apparatus ( h 2 : 20 psi ) for 5 hours . 37 % hcl was added ( 10 ml ), and hydrogenation was continued for additional 2 hours to obtain complete conversion . the catalyst was filtered over a celite pad , the mixture was diluted with etoac ( 200 ml ) and washed with an aqueous saturated solution of nahco 3 ( 2 × 100 ml ). the organic layer was dried over na 2 so 4 and the solvent was removed by evaporation to yield 10 . 7 g of the desired intermediate . methyl 3 -( cyclopropylmethoxy )- 4 - aminobenzoate ( 8 . 86 g ) was dissolved in pyridine ( 80 ml ) at room temperature under n 2 atmosphere . methanesulfonyl chloride ( 4 . 04 ml ) was added and the mixture was stirred at r . t . for 18 hours . the reaction mixture was evaporated to dryness , the crude was treated with 1n hcl ( 500 ml ) and extracted with ch 2 cl 2 ( 3 × 200 ml ). the organic layer was dried over na 2 so 4 and the solvent was evaporated off to yield 11 . 7 g of the desired intermediate . 3 - cyclopropylmethoxy - 4 - methanesulfonylamino - benzoic acid methyl ester ( 3 . 0 g ) was dissolved in ch 2 cl 2 ( 150 ml ). dimethylaminopyridine ( dmap , 1 . 22 g ) and boc 2 o ( 2 . 18 g ) were added and the mixture was stirred at r . t . for 1 hour . the reaction mixture was washed with 5 % aqueous hcl ( 2 × 50 ml ), the organic layer was dried over na 2 so 4 and the solvent was removed by evaporation . the residue was triturated in et 2 o and filtered to afford 4 . 0 g of the desired intermediate that was used in the next steps without further purification . cyclopropylmethoxy - 4 -( n - tert - butoxycarbonyl - n - methanesulfonyl )- amino - benzoic acid methyl ester ( 4 . 0 g ) was dissolved in meoh ( 100 ml ). 1n naoh ( 15 ml ) was added , and the resulting mixture was stirred at r . t . for 1 hour , then was heated to 50 ° c . for 2 hours . the reaction mixture was then diluted with etoac ( 250 ml ) and washed with 1n hcl ( 2 × 100 ml ). the organic layer was dried over na 2 so 4 and the solvent was evaporated off to give 3 . 5 g of the desired acid derivative . in vitro determination of pde4 inhibitory activity in the peripheral blood mononuclear cells ( pbmcs ) assay the assay , which is based on the known inhibitory activity exerted by pde4 inhibitors on the lipopolyshaccarides ( lps )- induced tumour necrosis factor - alpha ( tnf - α release in peripheral blood mononuclear cells ( pbmcs ), is performed according to a method previously described ( hatzelmann a et al ., j . pharmacol . exp . ther ., 2001 ; 297 : 267 - 279 ; and draheim r et al ., j . pharmacol . exp . ther ., 2004 ; 308 : 555 - 563 , both of which are incorporated herein by reference in their entireties . cryopreserved human pbmcs , ( 100 μl / well ) are incubated in 96 - well plates ( 10 5 cells / well ), for 30 minutes , in the presence or absence ( 50 microl ) of the test compounds whose concentrations range from 10 − 12 m to 10 − 6 m . subsequently , lps ( 3 ng / ml ) is added . after 18 hours incubation at 37 ° c . in a humidified incubator under an atmosphere of 95 % air and 5 % co 2 , culture medium is collected and tnf - α is measured by elisa . the results regarding compounds c1 to c6 , expressed as mean ± 95 % confidence limits of the molar concentration of the test compound producing 50 % inhibition of lps - induced tnf - a release ( ic 50 ), are comprised between 0 . 06 and 4 . 4 nm . the effects of the tested compounds are calculated as percentage of inhibition of tnf - α release , assuming lps - induced tnf - α production in the absence of inhibitor compound as 100 % and basal tnf - α production of pbmcs in the absence of lps as 0 %. evaluation of the ability to inhibit the low affinity lpde4 versus the ability to compete for the high affinity hpde4 the affinity toward lpde4 and hpde4 is assessed as previously described respectively in cortijo j et al ., br . j . pharmacol ., 1993 , 108 : 562 - 568 and duplantier a j et al ., j . med . chem ., 1996 ; 39 : 120 - 125 , both of which are incorporated herein by reference in their entireties . the concentration of the test compound ranges between 10 − 12 m and 10 − 5 m . the values of affinity toward lpde4 and hpde4 tested on compounds c1 to c6 are comprised between 82 and 477 . in the case of lpde4 , the ic 50 is the molar concentration of the test compound producing 50 % inhibition of camp disappearance , while in the case of hpde4 , the ic 50 is the molar concentration of the test compound producing 50 % inhibition of the binding of [ h 3 ] rolipram . the results indicate that the compounds of the invention inhibit lpde4 with subnanomolar affinity and are considerably more selective toward lpde4 versus hpde4 . synergistic activity of fixed dose combination of carmoterol / c1 on carbachol - induced contraction in guinea - pigs trachea zig - zag tracheal segments are obtained from male ovoalbumin ( oa )- sensitized guinea pigs and two preparations are obtained from a trachea . each preparation is placed in 20 - ml organ bath filled with oxygenated ( o 2 95 % and co 2 5 %) normal krebs - henseleit solution and maintained at 37 ° c . tracheal preparations are connected to isometric force transducers under a resting tone of 1 g . after an equilibration period of 60 minutes , tracheal preparations are pretreated for 30 minutes with c1 ( 10 − 7 m ), carmoterol ( 3 * 10 - 10 m ), the association c1 and carmoterol or vehicle , respectively , followed by cumulative administration of oa ( 10 − 10 - 10 − 5 g / ml ). at the end of the oa administration a maximal concentration of carbachol ( 10 − 5 m ) is added to obtain the maximal contraction of each preparation . the effects are expressed as percent values of the carbachol - induced maximal response ( 100 %). 30 - minute pre - treatment of the preparation with c1 ( 10 − 7 m ) caused an inhibition of the oa - induced contraction of 23 %. similarly the inhibition produced by carmoterol ( 3 * 10 - 10 m ) is 18 %. c1 ( 10 − 7 m ) and carmoterol ( 3 * 10 − 10 m )- combination caused a reduction of the oa - induced contraction of the 93 %. this study shows that both carmoterol and c1 are potent in antagonizing carbachol - induced contraction in guinea - pig airways . moreover , in line with their complementary molecular mechanism of action , in the frame of a functional agonism - antagonism , fixed combinations display synergistic effect in the control of cholinergic contraction in guinea - pig trachealis . where a numerical limit or range is stated herein , the endpoints are included . also , all values and subranges within a numerical limit or range are specifically included as if explicitly written out . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . all patents and other references mentioned above are incorporated in full herein by this reference , the same as if set forth at length .

US-201314108731-A

a method and apparatus for spectrophotometric in vivo monitoring of blood metabolites such as hemoglobin oxygen concentration at a plurality of different areas or regions on the same organ or test site on an ongoing basis , by applying a plurality of spectrophotometric sensors to a test subject at each of a corresponding plurality of testing sites and coupling each such sensor to a control and processing station , operating each of said sensors to spectrophotometrically irradiate a particular region within the test subject ; detecting and receiving the light energy resulting from said spectrophotometric irradiation for each such region and conveying corresponding signals to said control and processing station , analyzing said conveyed signals to determine preselected blood metabolite data , and visually displaying the data so determined for each of a plurality of said areas or regions in a comparative manner . reexamination results the questions raised in reexamination proceeding no . 90 / 010 , 128 , filed mar . 31 , 2008 , have been considered , and the results thereof are reflected in this reissue patent which constitutes the reexamination certificate required by 35 u . s . c . 307 as provided in 37 cfr 1 . 570 for ex parte reexaminations , or the reexamination certificate required by 35 u . s . c . 316 as provided in 37 cfr 1 . 997 for inter partes reexaminations .

fig1 depicts an illustrative patient 10 on whom an instrument 12 in accordance with the present invention is being employed . as illustrated , the forehead 14 of patient 10 has a pair of sensors 16 , 116 secured to it in a bilateral configuration , i . e ., one such sensor on each side of the forehead , where each may monitor a different brain hermisphere . each of the sensors 16 , 116 is connected to a processor and display unit 20 which provides a central control and processing station ( sometimes hereinafter , referred to as the “ oximeter ”) by a corresponding electrical cable 16 a , 116 a , which join one another at a dual - channel coupler / pre - amp 18 , 118 and then ( preferably ) proceed to the control and processor 20 as an integrated , multiple - conductor cable 22 . as will be understood , the electrical cables just noted include individual conductors for energizing light emitters and operating the related light detectors contained in sensors 16 , 116 , all as referred to further hereinafter and explained in detail in the various prior patents . the general nature of a typical structure and arrangement for the sensors 16 , 116 ( which are identical in nature and which may if desired be incorporated into a single physical unit ) is illustrated in fig2 , and comprises the subject matter of certain of the earlier patents , in particular u . s . pat . nos . 5 , 465 , 714 ; 5 , 482 , 034 ; 5 , 584 , 296 ; and 5 , 795 , 292 , wherein the structure and componentry of preferred sensors are set forth in detail . for present purposes , it is sufficient to note that the sensors 16 , 116 include an electrically actuated light source 24 for emitting the selected examination spectra ( e . g ., two or more narrow - bandwidth leds , whose center output wavelengths correspond to the selected examination spectra ), together with a pair of light detectors 26 , 28 ( e . g ., photodiodes ) which are preferably located at selected and mutually different distances from the source 24 . these electro - optical ( i . e ., “ optode ”) components are precisely positioned upon and secured to , or within , a sensor body having a foam or other such soft and conformable outer layer which is adhesively secured to the forehead ( or other desired anatomical portion ) of the patient 10 , as generally illustrated in fig1 , and individual electrical conductors in cables 16 a , 116 a provide operating power to the sources 24 while others carry output signals from the detectors 26 , 28 , which are representative of detected light intensities received at the respective detector locations and must be conveyed to the processor unit 20 , where processing takes place . fig3 generally illustrates , by way of a pictorialized cross - sectional view , the sensors 16 , 116 in place upon the forehead 14 of the patient 12 . as illustrated in this figure , the cranial structure of patient 12 generally comprises an outer layer of skin 30 , an inner layer of tissue 32 , and the frontal shell 34 of the skull , which is of course bone . inside the skull 34 is the periosteal dura mater , designated by the numeral 36 , and inside that is the brain tissue 38 itself , which is comprised of two distinct hemispheres 38 ′, 38 ″ that are separated at the center of the forehead inwardly of the superior sagital sinus by a thin , inwardly - projecting portion 36 a of the dura 36 . thus , in the arrangement illustrated in fig3 , sensor 16 accesses and examines brain hemisphere 38 ″, while sensor 116 does the same to brain hemisphere 38 ′. as explained at length in various of the above - identified prior patents , the preferred configuration of sensors 16 , 116 includes both a “ near ” detector 26 , which principally receives light from source 24 whose mean path length is primarily confined to the layers of skin , tissue , skull , etc ., outside brain 38 , and a “ far ” detector 28 , which receives light spectra that have followed a longer mean path length and traversed a substantial amount of brain tissue in addition to the bone and tissue traversed by the “ near ” detector 26 . accordingly , by appropriately differentiating the information from the “ near ” ( or “ shallow ”) detector 26 ( which may be considered a first data set ) from information obtained from the “ far ” ( or “ deep ”) detector 28 ( providing a second such data set ), a resultant may be obtained which principally characterizes conditions within the brain tissue itself , without effects attributable to the overlying adjacent tissue , etc . this enables the apparatus to obtain metabolic information on a selective basis , for particular regions within the test subject , and by spectral analysis of this resultant information , employing appropriate extinction coefficients , etc . ( as set forth in certain of the above - identified patents ), a numerical value , or relative quantified value , may be obtained which characterizes metabolites or other metabolic data ( e . g ., the hemoglobin oxygen saturation ) within only the particular region or volume of tissue actually examined , i . e ., the region or zone generally defined by the curved mean path extending from source 24 to the “ far ” or “ deep ” detector 28 , and between this path and the outer periphery of the test subject but excluding the analogous region or zone defined by the mean path extending from source 24 to “ near ” detector 26 . as will be understood , particularly in view of applicants &# 39 ; above - identified prior patents as well as is explained further hereinafter , this data analysis carried out by the “ control and processing unit ” 20 is accomplished by use if an appropriately programmed digital computer , as is now known by those skilled in the art ( exemplified in particular by the somanetics ® model 4100 cerebral oximeter ). the present invention takes advantage of the primarily regional oxygen saturation value produced by each of the two ( or more ) sensors 16 , 116 , together with the natural hemispheric structure of brain 38 , by use of a comparative dual or other multi - channel examination paradigm that in the preferred embodiment or principal example set forth herein provides a separate but preferably comparatively displayed oxygen saturation value for each of the two brain hemispheres 38 ′, 38 ″. of course , it will be understood that each such regional index or value of oxygen saturation is actually representative of the particular region within a hemisphere actually subjected to the examining light spectra , and while each such regional value may reasonably be assumed to be generally representative of the entire brain hemisphere in which it is located , and therefor useful in showing and contrasting the differing conditions between the two such hemispheres of the brain 38 , the specific nature and understanding of these hemispheric interrelationships and of interrelationships between other and different possible sensor locations relative to each different hemisphere 38 ′, 38 ″ are not believed to be fully known and appreciated as of yet . consequently , it may be useful or advantageous in at least some cases , and perhaps in many , to employ a more extensive distribution and array of sensors and corresponding inputs to the oximeter 20 , such as is illustrated for example in fig8 . thus , as seen in fig8 , a more extensive array of sensors 16 , 116 , 216 , etc ., may be deployed around the entire circumference of the head or other such patient extremity , for example , each such sensor sampling a different regional area of each brain hemisphere or other such organ or test site and outputting corresponding data which may be contrasted in various ways with the analogous data obtained from the other such sensors for other test site regions . in this regard , it will be appreciated that the extent of each such regional area subjected to examination is a function of a number of different factors , particularly including the distance between the emitter or source 24 and detectors 26 , 28 of each such set and the amount of light intensity which is utilized , the greater the emitter / sensor distance and corresponding light intensity , the greater the area effectively traversed by the examining light spectra and the larger the size of the “ region ” whose oximetric or other metabolic value is being determined . it may also be possible to use only a single source position and employ a series of mutually spaced detector sets , or individual detectors , disposed at various selected distances from the single source around all or a portion of the perimeter of the subject . each such single source would actually illuminate the entire brain since the photons so introduced would scatter throughout the interior of the skull ( even though being subject to increased absorption as a function of distance traversed ), and each such emitter / detector pair ( including long - range pairs ) could produce information characterizing deeper interior regions than is true of the arrays illustrated in fig3 and 8 , for example . of course , the smaller - region arrays shown in these figures are desirable in many instances , for a number of reasons . for example , the comparative analysis of information corresponding to a number of differing such regions , as represented by the array of fig8 , lends itself readily to very meaningful comparative displays , including for example computer - produced mapping displays which ( preferably by use of differing colors and a color monitor screen ) could be used to present an ongoing real - time model which would illustrate blood or even tissue oxygenation state around the inside perimeter of and for an appreciable distance within a given anatomical area or part . the multiple detector outputs from such a single - source arrangement , on the other hand , would contain information relative to regions or areas deep within the brain , and might enable the determination of rso 2 values ( or other parameters ) for deep internal regions as well as the production of whole - brain mapping , by differentially or additively combining the outputs from various selected detectors located at particular points . the dual or bilateral examination arrangement depicted in fig1 and 3 will provide the highly useful comparative display formats illustrated in fig4 , 5 , 6 , and 7 ( as well as on the face of the oximeter 20 shown at the right in fig1 ), for example . in the arrangement shown in fig1 and 4 , each sensor output is separately processed to provide a particular regional oxygen saturation value , and these regional values are separately displayed on a video screen 40 as both a numeric or other such quantified value , constituting a basically instantaneous real - time value , and as a point in a graphical plot 42 , 44 , representing a succession of such values taken over time . as illustrated , the plots or graphs 42 , 44 may advantageously be disposed one above the other in direct alignment , for convenient examination and comparison . while the instantaneous numeric displays will almost always be found useful and desirable , particularly when arranged in the directly adjacent and immediately comparable manner illustrated , the graphical trace displays 42 , 44 directly show the ongoing trend , and do so in a contrasting , comparative manner , as well as showing the actual or relative values , and thus are also highly useful . graphic displays 42 , 44 may also advantageously be arranged in the form shown in fig5 , 6 , and 7 , in which the two such individual traces are directly superimposed upon one another , for more immediate and readily apparent comparison and contrast . each of the examples shown in fig5 , 6 , and 7 does in fact represent the record from an actual surgical procedure in which the present invention was utilized , and in each of these the vertical axis ( labeled rso 2 ) is indicative of regional oxygen saturation values which have been determined , while the horizontal axis is , as labeled , “ real time ,” i . e ., ongoing clock time during the surgical procedure involved . the trace from the “ left ” sensor ( number 16 as shown in fig1 and 3 ), designated by the numeral 42 for convenience , is shown in solid lines in these graphs , whereas the trace 44 from the right - band sensor 116 is shown in dashed lines . the sensors may be placed on any region of their respective test areas ( e . g ., brain hemispheres ) provided that any underlying hair is first removed , since hair is basically opaque to the applied light spectra and thus greatly reduces the amount of light energy actually introduced to the underlying tissue , etc . with further reference to fig5 , 6 , and 7 , and also inferentially to fig4 , it will be seen that at certain times , ( e . g ., the beginning and end of each procedure , when the patient &# 39 ; s condition is at least relatively normal ) there is a certain amount of direct correspondence between the two different hemispheric traces 42 , 44 , and that in at least these time increments the shape of the two traces is reasonably symmetrical and convergent . an idealized such normal result is shown in fig1 , wherein both the numeric values and the curves are basically the same . in each of the procedures shown in fig5 , 6 , and 7 , however , there are times when the detected regional cerebral oxygen saturation differs markedly from one brain hemisphere to the other . this is particularly noticeable in fig6 , in which it may be observed that the left band trace 42 is at times only about one half the height ( i . e ., value ) of the right hand trace 44 , reaching a minimal value in the neighborhood of about 35 % slightly before real time point 12 : 21 as compared to the initial level , at time 10 : 50 - 11 : 00 , of more than 75 %, which is approximately the level of saturation in the right hemisphere at the 12 : 21 time just noted , when the oxygenation of the left hemisphere bad decreased to approximately 35 %. as will be understood , the various differences in cerebral blood oxygenation shown by the superimposed traces of fig5 , 6 , and 7 occur as a result of measures taken during the corresponding surgical procedures , which in these cases are carotid endarterectomies and / or coronary artery bypass graft ( cabg ), which are sometimes undertaken as a continuing sequence . in the illustrated examples , fig5 represents a sequential carotid endarterectomy and hypothermic cabg , in which the vertical lines along the time axis characterize certain events during surgery , i . e ., index line 46 represents the time of the carotid arterial incision , line 48 represent the time the arterial clamp was applied and the shunt opened ( resulting in reduced arterial blood flow to the left brain hemisphere ), index line 50 represents a time shortly after the shunt was removed and the clamp taken off , and the area from about real time 17 : 43 to the end of the graph was when the hypothermic brain surgery actually took place , the lowest point ( just prior to time 18 : 23 ) occurring when the heart - lung machine pump was turned on , and the indices at time 19 : 43 and 20 : 23 generally show the time for blood rewarming and pump off , respectively . while illustrative and perhaps enlightening , it is not considered necessary to give the specifics of the surgical procedures portrayed by the graphical presentations of fig6 and 7 , although it may be noted that the procedure of fig6 was a carotid endarterectomy of the left side and that of fig7 was a similar endarterectomy on the right side of a different patient . sufficient to say that these graphs represent other such surgical procedures and show comparable states of differing hemispheric oxygenation . the importance and value of the information provided in accordance with the present invention is believed self - apparent from the foregoing , particularly the graphical presentations of and comments provided with respect to fig5 , 6 , and 7 . prior to the advent of the present invention , no such comparative or hemispheric - specific information was available to the surgeon , who did not in fact have any quantified or accurately representative data to illustrate the prevailing hemispheric brain oxygenation conditions during a surgery . thus , even the use of a single such sensor ( 16 , 116 ) on the side of the brain on which a procedure is to be done is highly useful and , as of the present time , rapidly being recognized as essential . of course , it is considerably more useful to have at least the bilateral array illustrated in fig1 , to provide comparative data such as that seen in fig4 - 7 inclusive . fig9 is a schematic block diagram generally illustrating the componentry and system organization making up a typical implementation of the invention , as shown pictorially in fig1 ( to which reference is also made ). as shown in fig9 , the oximeter 20 comprises a digital computer 50 which provides a central processing unit , with a processor , data buffers , and timing signal generation for the system , together with a keypad interface ( shown along the bottom of the unit 20 in fig1 ), display generator and display 40 ( preferably implemented by use of a flat electro - luminescent unit , at least in applications where a sharp monochromatic display is sufficient ), as well as an audible alarm 52 including a speaker , and a data output interface 54 by which the computer may be interconnected to a remote personal computer , disk drive , printer , or the like for downloading data , etc . as also shown in fig9 , each of the sensors 16 , 116 ( and / or others , in the multi - site configuration illustrated in fig8 ) receives timing signals from the cpu 50 and is coupled to an led excitation current source ( 56 , 156 ) which drives the emitters 24 of each sensor . the analog output signals from the detectors ( photodiodes ) 26 , 28 of each sensor are conveyed to the coupler / pre - amp 18 , 118 for signal conditioning ( filtering and amplification ), under the control of additional timing signals from the cpu . following that , these signals undergo a - to - d conversion and synchronization ( for synchronized demodulation , as noted hereinafter ), also under the control of timing signals from cpu 50 , and they are then coupled to the cpu for computation of regional oxygen saturation rso 2 data , storage of the computed data , and display thereof , preferably in the format discussed above in conjunction with fig4 , 5 , 6 , and 7 . as will be apparent , each sensor ( 16 , 116 , etc .) preferably has its own signal - processing circuitry ( pre - amp , etc .) upstream of cpu 50 , and each such sensor circuit is preferably the same . while implementation of a system such as that shown in fig9 is as a general matter well within the general skill of the art once the nature and purpose of the system and the basic requirements of its components , together with the overall operation ( as set forth above and hereinafter ) have become known , at least certain aspects of the preferred such system implementation are as follows . first , it is preferable that the light emitters 24 ( i . e ., leds ) of each of the different sensors 16 , 116 etc ., be driven out - of - phase , sequentially and alternatingly with one another ( i . e ., only a single such led or other emitter being driven during the same time interval , and the emitters on the respective different sensors are alternatingly actuated , so as to ensure that the detectors 26 , 28 of the particular sensor 16 , 116 then being actuated receive only resultant light spectra emanating from a particular emitter located on that particular sensor , and no cross - talk between sensors takes place ( even though significant levels of cross - talk are unlikely in any event due to the substantial attenuation of light intensity as it passes through tissue , which is on the order of about ten times for each centimeter of optical path length through tissue ). further , it is desirable to carefully window the “ on ” time of the detectors 26 , 28 so that each is only active during a selected minor portion ( for example , 10 % or less ) of the time that the related emitter is activated ( and , preferably , during the center part of each emitter actuation period ). of course , under computer control such accurate and intricate timing is readily accomplished , and in addition , the overall process may be carried on at a very fast rate . in a multi - site ( multiple sensor ) system , such as that shown in fig8 , the preferred implementation and system operation would also be in accordance with that shown in fig9 , and the foregoing comments regarding system performance , data sampling , etc ., would also apply , although there would of course be a greater number of sensors and sensor circuit branches interfacing with computer 50 . the same would also be basically true of a single - source multi - site detector configuration or grouping such as that referred to above , taking into consideration the fact that the detectors would not necessarily be grouped in specific or dedicated “ near - far ” pairs and bearing in mind that one or more detectors located nearer a source than another detector , or detectors , located further from the source could be paired with or otherwise deemed a “ near ” detector relative to any such farther detector . in any such multiple - site configuration , it may be advantageous to implement a prioritized sequential emitter actuation and data detection timing format , in which more than one emitter may be operated at the same time , or some particular operational sequence is followed , with appropriate signal timing and buffering , particularly if signal cross - talk is not a matter of serious consideration due to the particular circumstances involved ( detector location , size and nature of test subject , physiology , signal strength , etc .). as illustrated in fig1 , a multi - sensor or multiple sector - emitter array may be so operated , by using a number of different emitter - detector pair groupings , with some detectors used in conjunction with a series of different emitters to monitor a number of differing internal sectors or regions . a system as described above may readily be implemented to obtain on the order of about fifteen data samples per second even with the minimal detector “ on ” time noted , and a further point to note is that the preferred processing involves windowing of the detector “ on ” time so that data samples are taken alternatingly during times when the emitters are actuated and the ensuing time when they are not actuated ( i . e ., “ dark time ”), so that the applicable background signal level may be computed and utilized in analyzing the data taken during the emitter “ on ” time . other features of the preferred processing include the taking of a fairly large number ( e . g ., 50 ) of data samples during emitter “ on ” time within a period of not more than about five seconds , and processing that group of signals to obtain an average from which each updated rso 2 value is computed , whereby the numeric value displayed on the video screen 40 is updated each five seconds ( or less ). this progression of computed values is preferably stored in computer memory over the entire length of the surgical procedure involved , and used to generate the graphical traces 42 , 44 on a time - related basis as discussed above . preferably , non - volatile memory is utilized so that this data will not be readily lost , and may in fact be downloaded at a convenient time through the data output interface 54 of cpu 50 noted above in connection with fig9 . as will be understood , the foregoing disclosure and attached drawings are directed to a single preferred embodiment of the invention for purposes of illustration ; however , it should be understood that variations and modifications of this particular embodiment may well occur to those skilled in the art after considering this disclosure , and that all such variations etc ., should be considered an integral part of the underlying invention , especially in regard to particular shapes , configurations , component choices and variations in structural and system features . accordingly , it is to be understood that the particular components and structures , etc . shown in the drawings and described above are merely for illustrative purposes and should not be used to limit the scope of the invention , which is defined by the following claims as interpreted according to the principles of patent law , including the doctrine of equivalents .

US-21929805-A

a personal vehicle system including a control system and at least one wheel motor coupled to the personal vehicle system and subject to control by the control system . a control system for a personal vehicle system including steps for calibrating the control system , where the control system includes a sensor system having load sensors incorporated into the personal vehicle system and also having lean forward and lean backward outputs , a user interface that prompts a user to lean forward and backward and allows a user to input a sensitivity value , and an electronic hardware component for calculating a normalization value where the wheel motor current is controlled as a function of the normalization value .

as shown in fig1 , 6 and 9 , a personal vehicle system 110 (“ pvs ”) includes four wheels , two front self - contained , powered wheel motors 220 , and two back wheels 210 . the wheels 210 , 220 spin about a wheel rotation axis 690 defined by a truck axle 235 that is supported by a truck 230 , 230 ′. the two trucks 230 , 230 ′ are attached to opposite ends of a deck 225 creating a stable four wheel vehicle . the top of the deck 950 is substantially flat and is of sufficient area to support a user 120 . in other embodiments the shape and size of the deck vary . the wheels 210 , 220 support the user 120 above a surface , for example a road , and the pvs 110 allows the user to travel about in a supported and balanced fashion . the user &# 39 ; s 120 right foot 140 and left foot 130 control the steering of the pvs 110 by tilting the deck 225 relative to the trucks 230 , 230 ′ and wheels 220 , 210 . the speed , acceleration , and braking of the pvs 110 are determined by the relative deck position and weight distributions between the right foot 140 and left foot 130 . in one embodiment , the deck 225 is made from a strong , durable , and light weight carbon fiber . the carbon fiber deck 225 allows the pvs 110 to remain light weight and thin in profile without sacrificing durability or performance . fig8 show the thin , sleek profile of the pvs 110 as seen from the side , taken along line b - b of fig2 . fig9 shows the thin profile of the cross section of the pvs 110 when the deck 225 is cut in half , as taken along line a - a of fig2 . in other embodiments the deck is made from wood , metal , composite , or a combination of materials . in one embodiment the personal vehicle system 110 also includes two wheel motors 220 attached to the front truck 230 and two unpowered wheels 210 attached to the rear truck 230 ′, in another embodiment the two wheel motors are attached to the rear truck and the two unpowered wheels are attached to the front truck . in another embodiment all four wheels are wheel motors , and in another embodiment only one wheel is a wheel motor . the wheel motors 220 each contain an internal electric motor that produces the required force to drive and thus rotate the wheel motors . further , the wheel motors 220 are operated without belts , gears , or mechanical power couplings connected thereto . the wheel motors 220 can be in a powered or a free state . while in the powered state the wheel motors 220 can provide different levels of torque , acceleration , speed , braking , and regenerative braking . while in the free state the wheel motors 220 act similar to conventional unpowered wheels . the wheel motors 220 are powered and controlled through wheel motor wires 50 connected to a control system 280 . the wheel motor wires 50 run from the control system 280 , across the deck 225 , through the truck 230 , and to the wheel motors 220 by running through the wire slot 370 on the truck 230 . the wheel motor wires 50 enter the wheel motor through the center of the inner bearing 2 and along the wire groove 45 on the stator shaft 1 . in one embodiment the wheel motor wires connect to the rotor position sensor 9 and the stator 6 . the control system 280 is housed in the control system port 270 which is a part of the deck 225 . the control system is coupled to the deck 225 with an adhesive technology . in one embodiment the adhesive technology is velcro or other hook - and - loop type fastener . the control system 280 has a top surface made from a material with a high heat transfer coefficient to remove excess heat , and bottom surface made from an electrically insulating material . in one embodiment the top surface of the control system is made from aluminum and the bottom surface is made from plastic . in one embodiment the control system 280 receives power from one battery 215 ; in another embodiment the control system receives power from two or more batteries 215 . the battery 215 and the control system 280 are connected by wires . the battery 215 is located between the deck 225 and the battery cover 240 . the battery cover 240 provides a watertight chamber for the battery 215 . the control system 280 is also water tight . in one embodiment the battery 215 is a lithium ion battery that can be recharged with a recharging unit or through regenerative braking applied by the wheel motors 220 . in another embodiment the battery is made from a conventional battery technology . one battery 215 can power two wheel motors 220 with a standard weight user 120 over standard terrain for approximately five miles and reach speeds up to twenty miles per hour . the control system 280 is an electronic hardware component and software assembly that both sends output signals via wiring to the wheel motors 220 and receives input signals from the wheel motors 220 . the control system 280 is replaceable to allow for maintenance , repair , and upgradability . the control system 280 is pre - programmed to allow for plug and play operability and can automatically recognize connected wheel motors . the control system has multiple connection ports that allow for multiple wheel motors or wheel motor axle assemblies to be connected to the control system . in one embodiment the control system can connect to four wheel motors or two wheel motor axle assemblies . the control system 280 coordinates the operations of the two wheel motors 220 and also synchronizes the two wheel motors 220 so that the pvs 110 can be properly controlled . by varying current , the control system 280 regulates the torque , rotational speed , ground speed , acceleration , and deceleration of the wheel motors 220 . in one embodiment in which two wheel motors 220 are coupled to the same truck 230 , the control system is able to independently control each wheel motor 220 . the wheel motors 220 send operating parameters , for example temperature , motor serial number , motor id , rotor position and rotational speed ( e . g . rpm ) back to the control system 280 . the control system 280 determines the operations of the wheel motors based on calibration parameters and force output signals received from force sensors 250 , 250 ′ (“ sensor ”) embedded in the deck 225 . in one embodiment the pvs 110 has four sensors 250 , 250 ′ embedded in the deck 225 , two sensors 250 near the front of the deck and two sensors 250 ′ near the rear of the deck ; in other embodiments there may be one sensor , two sensors , three sensors , or more than four sensors . sensors 250 , 250 ′ may be embedded or otherwise concealed within the deck 225 in order to create a more aesthetic appearance , and so as to not interfere with the user &# 39 ; s feet 130 , 140 . the sensors 250 , 250 ′ measure force . in one embodiment the force measured by the sensors 250 , 250 ′ is a load or weight . in another embodiment the force measured by the sensors 250 , 250 ′ is deck displacement strain in the deck material . the sensors 250 , 250 ′ may be load cells , strain gauges , or other suitable technology . the varying amount of force applied to the different sensors 250 , 250 ′ is based on the user &# 39 ; s 120 weight distribution and foot placement with respect to the deck 225 . if more force is detected by the front sensors 250 in comparison with the back sensors 250 ′ the control system 280 activates motion or acceleration of the wheels motors 220 . if the reverse is true , the control system 280 deactivates the wheel motors 220 or initiates deceleration , braking , or stoppage . if no weight or force is detected on the front sensors 250 ( e . g ., the user 120 is no longer on the pvs 110 ) the control system 280 signals the wheel motors 220 to apply full braking until they stop . the calibration parameters of the control system 280 and hence the performance of the wheel motors 220 are based on the weight and technical level of the user and can be adjusted to set a limit on the maximum speed or to optimize battery life . the weight and technical level of the user can be inputted manually or wirelessly into the control system 280 . the data can be manually entered into the control system 280 using input controls 205 and a digital display 290 . the data can be wirelessly entered into the control system 280 using a wireless mobile device 700 executing a wireless mobile application 710 . two - way communication between the wireless mobile device 700 and the control system 280 is achieved directly through bluetooth or another wireless technology , and / or is achieved indirectly via a network 720 , such as the internet . the wireless mobile application 710 can display on the mobile device 700 real - time parameters from the wheel motors 220 and the control system 280 , for example wheel motor temperature , wheel motor serial numbers , wheel motor id numbers , battery life , and rotational speed ( e . g . rpm ). using the data from the control system 280 and the wheel motors 220 , the wireless mobile application 710 calculates one or more of average speed , top speed , travel time , travel distance , battery time remaining , maximum distance on remaining battery charge , average distance on remaining battery charge , and in combination with a gps application , estimated time of arrival . the control system 280 , in combination with the embedded sensors 250 , 250 ′, permits the user 120 to control the pvs 110 , including forward motion , braking , forward acceleration , and turning , without the use of any hands , and without the use of any handlebars or any handheld or hand - controlled mechanism , simply by shifting the weight balance among the right and left feet 140 , 130 . fig1 , 11 , and 12 further show the interactions between the control system 280 , wireless mobile application 710 , sensors 250 , 250 ′ and the wheel motors 220 . the main screen 1100 of the wireless mobile application 710 shows outputs and calculation derived from such outputs received from the control system 280 ( for example , battery life 1120 and miles per hour 1110 of the pvs 110 ; other values can be shown by clicking on different areas of the pvs diagram ). in one embodiment the main screen 1100 allows for one touch wireless communication with the control system 280 via the wireless button 1130 . the configuration button 1200 ′ leads to the configuration screen 1200 . on the configuration screen 1200 , the sensitivity slider 1210 adjusts the sensitivity value 1060 of the control system 280 . the calibration button 1220 starts a calibration algorithm which records a lean back calibration value 1070 and lean forward calibration value 1080 based on the feedback from the sensors 250 , 250 ′. in one embodiment , when the calibration button 1220 is activated the user 120 is instructed to lean forward on the pvs 110 and the control system records a lean forward calibration value 1080 based on outputs from the sensors 250 , 250 ′; then the user 120 is instructed to stand centered on the pvs 110 ; then the user 120 is instructed to lean back on the pvs 110 and the control system records a lean back calibration value 1070 . with the calibration parameters the control system 280 is able to control the pvs 110 while in operation by the user 120 . while in operation the sensors 250 , 250 ′ send a force sensor value 1000 to the control system 280 . the control system 280 runs the force sensor value 1000 through a box car moving average filter 1010 , then subtracts the lean back calibration value 1020 , then divides the remaining value by the ( lean forward calibration value minus the lean back calibration value ) divided by two hundred ( 200 ), which may be done for normalization . the normalized value is then capped be a saturation limit 1040 which uses the sensitivity value 1060 to ensure that the wheel motors 220 do not obtain a speed higher than desired by the user 120 . the value capped by the saturation limit 1040 is converted to a motor current command 1050 which is sent to the wheel motors 220 . via the control system 280 the wheel motors 220 and control system 280 send outputs to the wireless mobile application ( see 1090 ). examples of outputs to the wireless mobile application 710 include : wheel motor speeds , wheel motor temperatures , wheel motor errors , wheel motor rotor position , wheel motor currents , battery charge values , and force sensor values . in one embodiment the control system 280 runs calculations , for example the calculations process shown by fig1 , at a frequency of ten hertz . in some cases , a truck package kit may be provided in order to retrofit an existing conventional or non - powered pvs . such a kit may include at least one truck assembly , where the control system and at least one sensor are integrated into a truck ; at least one wheel motor ; and an instruction manual . the truck package kit allows for the modification of different types of personal vehicles , for example unpowered skateboards . the instruction manual aids in the use of the kit , describing how to convert an unpowered vehicle and how to calibrate the control system . in another embodiment , a truck package kit includes : at least one truck , at least one wheel motor , a control system , at least one sensor , and an instruction manual . as shown in fig2 and 3 , the front and rear trucks 230 , 230 ′ are composed of several components . the truck 230 is composed of a first portion 320 which is coupled to the deck 225 , and a second portion 310 . the trucks 230 , 230 ′ are coupled to the deck 225 with truck bolts 295 . in other embodiments the trucks are coupled to the deck in other ways . the second portion 310 tilts or pivots with respect to the first portion 320 about a truck pivot 330 . wheels 210 or wheel motors 220 are mounted on the truck axle 235 which is rigidly and / or fixedly coupled to the second portion 310 . tilt performance is controlled and improved by two truck springs 340 which are coupled to the first portion 320 and the second portion 310 , and which serve to bias the second portion 310 toward a “ wheels straight ” position in the absence of turning forces . in other embodiments , fewer than two springs , more than two springs , or other biasing technologies may be used to bias the second portion 310 toward the “ wheels straight ” position . the tilt of the trucks 230 , 230 ′ ( which is based on the user &# 39 ; s 120 left to right weight distribution ) allows the pvs 110 to be steered left or right . when the pvs 110 is turning , two wheel motors coupled to the same truck cover different amounts of distance and therefore spin at different speeds . the control system 280 allows the two wheel motors to operate at different speeds by maintaining substantially equal force for each wheel motor . operating the two wheel motors at substantially equal force allows for traction control by preventing excess wheel slippage and spin outs . the independent operation of the two wheel motors allows the pvs 110 to smoothly turn either left or right . the base damper 350 further improves performance and control of the pvs 110 . as shown in fig3 , 5 a , 5 b , and 6 , the wheel motors 220 are wheels with an internal self - contained electric motor . the wheel motors 220 do not require external motors , external belts or chains , external gears or gear systems , external transmissions , or power couplings . in one embodiment the wheel motors 220 are both gearless and brushless electric motors . in one embodiment the wheel motors 220 are comprised of a wheel motor assembly including a non - rotational stator shaft 1 which prevents the stator 6 from turning , an inner bearing 2 , an inner endcap 4 , a rotor position sensor 9 , magnets 17 which are fixed to the inside of a flux ring 3 , a traction surface 22 which surrounds the flux ring 3 ( see fig8 ), an outer endcap 5 , an outer bearing 11 , a washer 12 , and a compressing connector 20 , such as a nut , for example . the inner endcap 4 and the outer endcap 5 enclose the two outermost ends of the wheel motor assembly . the traction surface 22 provides adequate friction with the travel surface . in one embodiment the traction surface 22 is rubber . the rotor position sensor 9 communicates with the control system 280 through connecting wires . the rotor position sensor 9 monitors the position and rotational velocity ( e . g . in rotations per minute or rpm ) of the rotating magnets 17 . in one embodiment the rotor position sensor is a hall effect and / or hall sensor . in one embodiment , the stator shaft 1 is prevented from rotating on the truck axle 235 by a pin 35 ; where the pin is inserted or flexibly coupled with a pin hole 360 on the axle 230 and a pin grove 40 on the stator shaft 1 . in other embodiments the stator shaft is prevented from rotating by other mechanical means . a single compressing connector 20 in combination with the stator shaft 1 compresses the components of the wheel motor 220 by coupling the compressing connector 20 to the truck axle 235 . in one embodiment the truck axle is threaded and the compressing connector is a nut . in another embodiment the truck axle has a hollow and threaded center core and the compressing connector is a bolt . using only one compressing connector 20 to compress the wheel motor 220 allows for an efficient , compact , lightweight , watertight , and dust tight design . the stator shaft 1 , stator 6 , and rotor position sensor 9 form the non - rotating stator assembly (“ stator assembly ”). the magnets 17 , flux ring 3 , traction surface 22 , inner endcap 4 , and the outer endcap 5 form the rotating rotor assembly (“ rotor assembly ”). in one embodiment the wheel motor 220 is assembled by inserting the stator shaft 1 over a truck axle 235 , inserting the inner bearing 2 over the stator shaft 1 , inserting the inner endcap 4 over the stator shaft 1 , inserting the rotor position sensor 9 over the stator shaft 1 , inserting the stator 6 over the stator shaft 1 , inserting the magnets 17 , flux ring 3 , and traction surface 22 over the stator 6 ; inserting the outer endcap 5 over the stator shaft 1 , inserting the outer bearing 11 over the stator shaft 1 , and compressing the components with a washer 12 and single compressing connector 20 where the compressing connector 20 couples to the truck axle 235 . the wheel motor 220 operates by passing electrical current through electrically conductive wiring in the stator 6 which generates a magnetic field . in one embodiment the stator is a three phase stator . the magnetic field exerts a magnetic force on the magnets 17 causing the magnets 17 , which are part of the rotating rotor assembly , to spin . a small gap between the stator 6 and the magnets 17 called a flux gap prevents the non - rotating stator assembly and the rotating rotor assembly from touching . the inner bearing 2 and the outer bearing 11 help maintain the proper position between the non - rotating stator assembly and the rotating rotor assembly . while in operation the inner bearing 2 and the outer bearing 11 reduce the friction between the moving and stationary parts of the motor . for maximum efficiency the flux ring 3 may be made out of a magnetically conductive material , according to some embodiments . the flux ring 3 may also be made from a strong and durable material as it provides structural support for the wheel motor , according to some embodiments . to maximize power , torque , efficiency , and durability of the wheel motor 220 , the wheel motor 220 benefits from proper cooling . magnets in wheel motors operate more efficiently at cooler temperatures . in one embodiment , the magnets 17 are permanent magnets that lose efficiency at high temperature , for example temperatures exceeding eighty degrees celsius ; further extended exposure to excess heat may in some cases damage the magnets 17 and reduce their lifespans . the wheel motor 220 uses two forms of passive cooling . the flux gap between the stator 6 and the magnets 17 prevents efficient heat transfer between the stator assembly and the rotor assembly . therefore , both the stator assembly and the rotor assembly may include separate passive cooling mechanisms . the stator assembly is in conductive thermal communication with the truck axle 235 and the truck 230 . the truck axle 235 and the truck 230 are made of a material with a high heat transfer coefficient , which allows the truck axle 235 and the truck 230 to act as heat sinks for the stator assembly . further , convective cooling is achieved as the pvs 110 moves and air passes over the truck 235 . in one embodiment the trucks 230 , 230 ′ are made of aluminum . the rotating rotor assembly , which includes the magnets 17 , is cooled by convective cooling which is assisted by the inner endcap 4 and the outer endcap 5 . the magnets 17 and the flux ring 3 are in conductive thermal communication with both the inner endcap 4 and the outer endcap 5 . the flux ring 3 is made from a material with a high heat transfer coefficient . in one embodiment the flux ring 3 is made from aluminum or iron . the endcaps 4 , 5 are made from a material with a high heat transfer coefficient , and include at least one fin 510 . as the wheel motor 220 spins , the endcaps 4 , 5 spin with the flux ring 3 and the magnets 17 . the spinning of the endcaps 4 , 5 and the attached fins 510 , which extend in a radial orientation from the wheel rotational axis , increases convective cooling from the endcaps 4 , 5 . the profile of the fins 510 increases convection by increasing the movement and turbulence of the surrounding air . the fins 510 also increase the surface area of the endcaps 4 , 5 which increases heat dissipation . in one embodiment multiple fins 510 are located on each endcap 4 , 5 and the fins 510 are equally distributed angularly along the radius of the endcap 4 , 5 to improve heat dissipation . in one embodiment there are an equal number of fins 510 on inner endcap 4 and the outer endcap 5 so that heat transfer and cooling of the magnets 17 is substantially equal along the length of the wheel rotational axis 690 ( see fig6 ) of the wheel motor . according to other embodiments , the inner endcap 4 has more fins 510 , and / or smaller fins 510 , than the fins 510 on the outer endcap 5 . as illustrated in fig5 , divots 520 in the endcaps 4 , 5 provide additional cooling benefits and reduce the weight of the endcaps 4 , 5 . in one embodiment the endcaps 4 , 5 and the fins 510 are made from aluminum . according to some embodiments , one or more fins 510 are substantially straight along a radius of the endcap 5 . according to other embodiments , one or more fins 510 have varying geometries ; for example , one or more fins 510 may be curved over part of or their entire lengths . as shown in fig4 and 6 , a wheel motor 220 is most efficient and produces the most torque when the ratio of the length of the torque arm of the wheel motor , compared to the length of the total wheel radius of the wheel motor , approaches one . the magnets 17 , flux ring 3 , and traction surface 22 form the rotating flux canister (“ flux canister ”). a first radius 625 is the distance between outermost circumference of the stator 620 and the wheel rotational axis 690 . a second radius 615 is the distance between the innermost circumference of the flux canister 610 and the wheel rotational axis 690 . a third radius 605 is the distance between the outermost circumference of the flux canister 600 and the wheel rotational axis 690 . the gap or area between outer surface 610 and inner surface 600 may be referred to as the flux gap . the length of the torque arm is the average of the length of the first radius and the length of the second radius . in one embodiment the length of the torque arm is the distance between the middle of the flux gap and the wheel rotational axis 690 . the length of the total wheel radius is the length of the third radius . by constructing the wheel motor 220 out of strong , durable materials , using a one bolt 20 assembly , and by utilizing the two passive cooling systems , the wheel motor 220 is able to be compactly designed . the compact design of the wheel motor 220 allows the ratio of the length of torque arm compared to the length of the total wheel radius to approach one . in one embodiment the length of the torque arm ( average of lengths 605 and 615 ) is at least 59 % the length of the total wheel radius 605 . in other embodiments , the length of the torque arm ( average of lengths 605 and 615 ) is between 30 % and 90 %, or 40 % and 80 %, or 50 % and 75 %, or 55 % and 65 % of the length of the total wheel radius 605 . various modifications and additions can be made to the exemplary embodiments discussed without departing from the scope of the present invention . for example , while the embodiments described above refer to particular features , the scope of this invention also includes embodiments having different combinations of features and embodiments that do not include all of the described features . accordingly , the scope of the present invention is intended to embrace all such alternatives , modifications , and variations as fall within the scope of the claims , together with all equivalents thereof .

US-201715441505-A

an eye medication delivery system for treating an infected eye having a cornea and a conjunctiva , where the medication delivery system comprises a liquid medication applied directly to a surface of a contact lens and placing the contact lens onto the eye such that the liquid medication and the contact lens surface are proximate to the cornea and the conjunctiva . the surface of the contact lens holds the liquid medication in contact with the cornea and conjunctiva .

reference will now be made in detail to presently preferred embodiments of the invention , one or more examples of which are illustrated in the accompanying drawings . each example is provided by way of explanation of the invention , not limitation of the invention . in fact , it will be apparent to those skilled in the art that modifications and variations can be made in the present invention without departing from the scope and spirit thereof . for instance , features illustrated or described as part of one embodiment may be used on another embodiment to yield a still further embodiment . thus , it is intended that the present invention covers such modifications and variations as come within the scope of the appended claims and their equivalents . referring to fig1 , a human eye 10 has an iris 12 , a pupil 14 , a cornea 16 covering the iris and pupil , a sclera 18 , and two eye lids 20 a and 20 b . a mucus membrane known as a conjunctiva 22 covers sclera 18 and coats the inner lining of eye lids 20 and 20 b . the cornea and conjunctiva may become irritated or infected resulting in a painful or uncomfortable inflammation of the various parts of the eye . one such infection is conjunctivitis , commonly known as “ pink eye ,” and results in an inflammation of the conjunctiva that causes itching , swelling and redness in the eye . optometrists , ophthalmologists and other physicians often prescribe a solution - based medication to treat such infections that may be carried in a squeezable bottle 30 so that the patient can squeeze the bottle to release drops 32 of the medicine into the eye . alternatively , the medicated solution may reside in a dropper bottle with an removable eye dropper or other similar device for releasing medicated eye drops 32 into the eye . referring to fig2 , after placing eye drops 32 ( fig1 ) in eye 10 , the patient may apply a contact lens 40 onto the surface of the cornea 16 and conjunctiva 22 . referring to fig3 , when the contact lens 40 is properly placed on the surface of the cornea 16 , the lens ensures that the eye drops remain in contact with the affected area of the eye and reduces the likelihood that perspiration will wash the eye drops out . additionally , the contact lens reduces the likelihood that the patient will inadvertently rub the eye drops out of the eye . contact lenses are presently sold in two standard varieties : rigid gas permeable ( rgp ) lenses such as the boston envision lenses available from bausch & amp ; lomb of rochester , n . y ., and soft contact lenses such as the accuvue available from johnson & amp ; johnson of skillman , n . j . it should be understood that either type of lens performs equally well in keeping the eye drops in the eye . most frequently , optometrists and ophthalmologists prescribe contact lenses to correct specific vision problems , but some contacts offer cosmetic advantages , such as changing the color of the eye without affecting visual acuity . in either instance , the lenses may be used to retain the liquid eye medication on the eye . once the lens is applied to the eye , the patient may wear the lens until the eye condition heals or a new application of the eye drops becomes necessary . in a second embodiment shown in fig4 , a patient may use squeezable bottle 30 to apply medicated eye drops 32 directly onto a contact lens 40 just as one would apply saline solution to the contact lens . referring back to fig2 , once the patient properly wets contact lens 40 with the eye drops , the patient may apply contact lens 40 to the eye . this alternative method of applying the medicated solution and the contact lens offers the same advantages as previously described with other embodiments . fig5 shows a third embodiment of the present invention in which a contact lens 40 may be pre - packaged in a disposable tray 50 with a sealed lid 52 . during the packaging process , the lens is inserted into the tray along with a medicated solution 54 so that the lens is largely submerged in the solution . preferably , lid 52 is made of metallic foil , but may also be plastic , cellophane or any other material suitable for such packaging and is sealed onto tray 50 by an adhesive agent or other suitable sealing process . in this way , the lid holds the lens and solution in the tray without any risk of leakage or contamination . the patient may simply peel the seal off of the tray in the direction of arrow 56 , remove the lens , and apply it directly to the eye , thus delivering the medicated solution to the affected eye . fig6 shows a fourth embodiment of the present invention in which a contact lens 40 may be pre - packaged in a disposable pouch 60 having a top panel 62 and a bottom panel 64 . the top and bottom panels are preferably made of a medical - grade packaging polymer , such as mylar or tyvek asuron available from dupont of wilmington , del . during the packaging process , the top and bottom panels are sealed together by heat - sealing or other appropriate sealing process , but the panels are only partially sealed so that pouch 60 remains open to receive contact lens 40 and medicated solution 54 . once the pouch is filled , the opening is sealed , leaving the lens submerged in the solution within the sealed pouch , and the pouch holds the lens and solution without any risk of leakage or contamination . the patient may simply tear open the pouch in the direction of arrow 66 , remove the lens , and apply it directly to the eye , thus delivering the medicated solution to the affected eye . it should be appreciated by those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope and spirit of the invention . it is intended that the present invention cover such modifications and variations as come within the scope and spirit of the appended claims and their equivalents .

US-62054307-A

a rake for a litter box for collecting pet excrements , the litter box containing a bottom surface , a front wall , a rear wall , a first and second sidewall to define a litter chamber for holding a supply of litter , the rake includes a bar having first and second ends and extends from the first sidewall to the second sidewall and is movable between the front and rear walls . the bar includes a plurality of tines . a rake support is attached to the bar for supporting the first and second ends of the bar for slideable movement between the front and rear walls . a rake arm is connected to the first and second ends of the bar for slideably engaging the rake supports , such that said bar is selectively connectable to the rake supports without using fasteners .

fig1 - 3 illustrate self - cleaning litter box 20 . in a preferred embodiment , litter box 20 includes a base 22 , a litter pan 24 for holding a supply of litter , a lower hood 26 and an upper hood 28 . litter box 20 further includes a rake 30 disposed in litter pan 24 , a rake support assembly 32 to support rake 30 , a drive assembly 34 ( fig7 ) to move the rake while installed in the litter pan , and a waste box 36 to receive waste clumps from litter pan 24 . referring to fig3 and 4 , litter pan 20 is illustrated connected to base 22 with lower and upper hoods 26 and 28 removed . referring specifically to rake 30 , rake 30 includes a plurality of tines 38 attached to a cross support bar 40 . cross support bar 40 includes a first end 42 having an offset portion 44 and a second end 46 having an offset portion 48 ( fig4 ) to engage litter pan 24 . cross support bar first and second ends 42 and 46 each contain a rake arm 50 and 52 to support bar 40 when connected to litter box 20 . rake 30 is preferably fabricated from a metal material such as stainless steel . it should be realized by one of ordinary skill that tines 38 can be fabricated from any other material , such as plastic , so long as tines 38 have a sufficient strength to rake through litter pan 24 without being deflected or destroyed . rake 30 is lightweight in order to reduce the load on the motor ( described in detail below ). this permits a greater volume of litter to be stored inside litter pan 24 without having to increase to size of the motor . since cats enjoy scratching and digging the litter , a deep litter level is desirable . a protective coating may be used to protect tines 38 in order to reduce or eliminate pitting or other damage to tines 38 . the coating may include , for example , chrome , nylon , or teflon ®. furthermore , the coating acts as a barrier to prevent residue from attaching to the rake during operation . residue collected on rake tines 38 can increase the weight of the rake , which oftentimes can damage the drive motor or even require additional power to move the rake through litter pan 24 . residue collected on rake tines 38 also prevents the tines from effectively sifting through the litter , causing excess litter to be removed from litter pan 24 . in addition , litter will spread unevenly inside pan 24 . by having a material that contains a high strength to weight ratio , rake tines 38 can be fabricated smaller to reduce the tine surface area contacting the litter . in a preferred embodiment , tines 38 contain a circular cross section ; however , it should be realized by one of ordinary skill that any cross sectional shape can be used including square , oval , teardrop , rectangular , triangular , etc . referring specifically to fig3 , a rake support 32 supports rake 30 when installed on litter box 20 . rake support assembly 32 includes posts 54 and 56 , and post supports 58 and 60 . posts 54 and 56 include end openings 62 and 64 defining entranceways to hollow interiors 66 and 68 . each post 54 and 56 includes a slot 70 and 72 , respectively , extending longitudinally along the length of each post to receive cross support bar 40 . rake arms 50 and 52 ( fig4 ) are sufficiently sized so as to slideably engage hollow interiors 66 and 68 respectively . when rake 30 is connected to posts 54 and 56 , gravity acts on the rake to keep the rake mounted inside hollow interiors 66 and 68 . rake 30 can be removed from rake support 32 in a simple manner and without the use of tools in order to clean or replace the rake as necessary . to remove rake 30 , the rake is lifted so that arms 50 and 52 are removed from posts 54 and 56 . likewise , to install rake 30 , rake arms 50 and 52 are aligned with openings 62 and 64 and are inserted therein . as seen in fig3 and 6 , litter pan 24 includes a bottom wall 74 and spaced apart first and second sidewalls 76 and 78 , an inclined front wall 80 ( fig6 ) and a rear wall 82 , defining a litter chamber 84 . litter pan 24 has an open top to allow cats to enter and exit chamber 84 and is sized to accommodate multiple cats at one time . each sidewall 76 and 78 contains a planar surface 86 and 88 extending along the top of the sidewalls to support rake cross support member 40 at offset portions 44 and 48 ( fig4 ). as rake 30 sweeps between front and rear walls 80 and 82 , the rake is supported by surfaces 86 and 88 . planar surfaces 86 and 88 contain elevated sections 222 - 228 to raise rake 30 as it travels between front wall 80 and rear wall 82 . litter pan bottom wall 74 includes strengthening members 90 extending between litter pan front wall 80 and rear wall 82 to provide additional strength to bottom wall 74 . members 90 are preferably ribs integrally molded into bottom wall 74 to prevent warping or sagging . in addition , a shoulder 92 extends along sidewalls 76 and 78 . shoulders 92 are positioned above bottom wall 74 to indicate the litter fill level . thus , litter can be filled inside chamber 84 until the litter level reaches a height adjacent shoulders 92 . as illustrated in fig2 b , a pan liner 94 is provided to fit inside and to protect walls 74 - 82 of litter chamber 84 . the liner contains walls 96 - 104 and is preferably vacuum molded with a poly vinyl chloride ( pvc ) material . however , other materials may be used including those having biodegradable polylactide . typical prior art litter pan liners are fabricated from a polyethylene bag . these bags are typically attached loosely to the litter boxes and , if used in conjunction with a raking system , the bag can become tangled with the rake tines . a molded liner provides advantages over polyethylene liners because molded liners will not tangle with rake tines 38 . in addition , as cats scratch and dig , the polyethylene liner may become rearranged . by using liner 94 , the pet owner can keep the litter box clean without having to expose litter box 20 to soap , water or other moisture that might damage the electrical components . also , the vacuum formed liner 94 for litter pan 24 prevents walls 74 - 82 from being scratched and worn from the constant movement of the abrasive litter materials . if walls 74 - 82 become scratched , the walls will tend to hold odor and waste . referring to fig2 b and 6 , waste box 36 can be seen . waste box 36 is located adjacent litter pan front wall 80 and contains a bottom wall 106 , a rear wall 108 , a front wall 110 , a pair of sidewalls 112 and 114 and a lid 116 pivotably mounted to hinge 118 . as seen in fig2 b , waste box 36 and litter pan 24 are illustrated as being integrally molded as one piece ; however , it should be realized by one of ordinary skill that waste box 36 can be a separate component attachable to litter pan 24 . as will be explained in greater detail below , as rake 30 travels upward along inclined wall 80 ( fig6 ), lid 116 pivotably opens so that litter clumps ( not shown ) collected by rake 30 during the raking cycle can be deposited inside waste box 36 . once the litter clumps are deposited inside waste box 36 , the rake returns to rear wall 82 and lid 116 closes to seal any odors from the surrounding area . as illustrated in fig2 b , waste box 36 can optionally include an inner tray 120 that is removable when cleaning or servicing the waste box . inner tray 120 includes sidewalls 122 and 124 , end walls 126 and 128 and a bottom wall 130 . inner tray 120 is configured to be inserted inside waste box 36 . a disposable waste box liner 132 , as illustrated in fig1 , can be optionally used to protect inner tray 120 , or , if waste box 36 is being used without tray 120 , liner 132 can be used to protect waste box walls 106 - 114 . disposable liner 132 contains pleated sidewall portions 134 and 136 and end walls 138 and 140 to form a pocket 144 to receive and hold waste clumps . end walls 138 and 140 each contain a strap or handle 146 and 148 . a top wall or flap portion 150 is also included and is sized to connect and to protect the underside of waste box lid 116 from dirt and waste . flap portion 150 is substantially the same dimension as lid 116 and contains a pocket 152 along the length of the bag to attach to lid edge 116 ′. during installation of waste box liner 132 , handles 146 and 148 allow the user to open the bag so that pleated sidewalls 134 and 136 can open to conform to the width of inner tray 120 , or waste box 36 , if tray 120 is not being used . sidewalls 134 and 136 and handles 146 and 148 are designed to tuck in and around inner tray 120 after waste box liner 132 is installed . when removing liner 132 from waste box 36 , waste box lid 116 is opened using a handle 154 ( best seen in fig6 ). flap 150 is then disconnected from lid 116 and flap 150 is used to cover pocket 144 . as discussed in further detail below , any litter particulate that may exist between lid 116 and flap 150 will act to hold down the flap over pocket 144 to contain odors inside the pocket . disposable liner 132 can be removed from waste box 36 by handles 146 and 148 . upon removal , handles 146 and 148 can then be used to further seal pocket portion 144 by tying the handles together . the liner is a plastic bag , preferably fabricated from polyethylene or a polypropylene material . when closed , waste box lid 116 serves as a step or platform to allow the cat to enter litter chamber 84 . after the cat exits waste box 20 , any litter particulate that is attached to the cat &# 39 ; s paws may eventually collect on waste box lid 116 . to prevent litter particulate from sliding off lid 116 and onto the surrounding floor when lid 116 pivotally opens , waste box lid 116 contains openings 156 to receive the litter particulate . thus , as lid 116 opens during the raking cycle ( fig6 ), any litter particulate that has settled on lid 116 will slide toward openings 156 and into waste box 36 , instead of scattering on the surrounding floor . referring to fig7 , base 22 and drive assembly 34 can be seen . base 22 includes a front wall 158 , a rear wall 160 , and a pair of sidewalls 162 and 164 to house drive assembly 34 . in a preferred embodiment , litter pan 24 rests above and is supported by base 22 . litter pan 24 covers and encloses drive assembly 34 to insulate operational noises during the raking cycle which also preventing injury to animals or pet owners . in addition , the litter inside litter chamber 84 insulates the noise produced during the raking cycle . drive assembly 34 includes an electric motor 166 , a first shaft 168 connected to a second shaft 170 by belts 172 and 174 . a belt and pulley system includes belts 172 and 174 that are supported by pulleys 176 located on opposed ends of shafts 172 and 174 . while only pulleys 176 are illustrated attached to belt 172 , it should be realized by those of ordinary skill that the identical configuration can be seen in mirror image on belt 174 . a stabilizer bar 178 attaches to belts 172 and 174 so as to be moved by the belts between walls 158 and 160 . in this configuration , both ends of stabilizer bar 178 travel at exactly the same rate . stabilizer bar 178 connects to rake post supports 58 and 60 and is operable to move between base front wall 158 and rear wall 160 . in operation , motor 166 drives first shaft 168 that in turn rotates pulleys 176 to move belts 172 and 174 . motor 166 is a standard dc motor that can be powered by batteries or by standard household electricity . base 22 includes a groove 180 having groove endwalls 182 and 184 and groove sidewalls 186 and 188 . groove 180 extends parallel to base sidewalls 162 and 164 and between base front and rear walls 158 and 160 . groove 180 is sufficiently sized to receive an offset portion 178 ′ of stabilizer bar 178 so that as stabilizer bar 178 travels between front wall 158 and rear wall 160 , offset portion 178 ′ travels inside groove 180 . groove sidewalls 186 and 188 prevent stabilizer bar 178 from movement in the lateral direction between base sidewalls 162 and 164 . the ends of stabilizer bar 178 extend through slots 198 and 200 and are adapted to connect to rake post supports 58 and 60 . thus , when rake supports 58 and 60 are connected to stabilizer bar 178 , the stabilizer bar moves rake 30 ( when installed ) between litter pan front wall 80 and litter pan rear wall 82 . during the raking cycle , stabilizer bar 178 is transported from base rear wall 158 toward forward wall 160 until stabilizer bar triggers a relay 202 . once relay 202 is triggered , a signal is sent to a microprocessor ( not shown ) which in turn sends a signal to motor 166 to reverse the direction of stabilizer bar 178 in the direction of base rear wall 158 . if however , relay 202 fails , offset portion 178 ′ will contact groove end wall 182 to prevent the stabilizer bar from traveling further and potentially damaging other components , such as shaft 168 likewise , as stabilizer bar nears base rear wall 158 , stabilizer bar 178 will trigger relay 204 to send a signal to shut off motor 166 . if relay 204 fails , offset portion 178 ′ will contact groove end 184 so as to prevent further movement of stabilizer bar 178 . referring to fig3 , 4 and 8 , rake movement is partially controlled by sensors 206 and 208 that detect the presence of a cat or foreign object in the box . sensors 206 and 208 preferably include infrared photocell detectors that detect when a beam has been disturbed or broken . sensors 206 and 208 each include a transmitter designated by the letter “ t ” and a detector or receiver , designated by the letter “ r ”. as illustrated in fig8 , transmitter 206 t and receiver 208 r are disposed along litter pan sidewall 76 . a receiver 206 r is also disposed along litter pan sidewall 78 and is aligned with transmitter 206 t . transmitter 208 t is disposed on sidewall 78 opposite receiver 208 r . receivers 206 r and 208 r , which detect signals generated by transmitters 206 t and 208 t , operate to detect the presence of a cat or a foreign object within the litter chamber 84 . it should be realized by one of ordinary skill that a greater or fewer number of photo cell detectors can be used if litter chamber 24 is larger or smaller . transmitters 206 t and 208 t are disposed on opposite sidewalls 76 and 78 to prevent transmitter 206 t from interfering with receiver 208 r and to prevent transmitter 208 t from interfering with receiver 206 r . in this configuration , transmitter 206 t is independent of transmitter 208 t ; therefore , when rake 30 enters the beam spread area 206 b for transmitter 206 t , transmitter 208 r will remain operable to detect cats or other obstructions . the same is true when rake 30 enters beam spread area 208 b . in order to permit the litter pan sensors to detect objects in the widest area inside litter chamber 84 , transmitters 206 t and 208 t are spaced apart so that beam spread areas 206 b and 208 b are adjacent each other or have minimal overlap , as seen in fig8 . in operation , the user supplies power to litter box 20 by actuating an on / off switch ( not shown ). an initial “ power up ” rake sweep cycle begins after a set time delay . rake 30 begins the sweep cycle by moving from the “ home position ,” located adjacent litter pan rear wall 82 ( fig3 and 9 ), and continuing through the middle portion of litter chamber 84 ( fig5 and 9 ) toward inclined front wall 80 . during this time , any litter clumps ( not shown ) present in litter chamber 84 are pushed toward inclined front wall 80 . once rake 30 reaches inclined front wall 80 , rake 30 pushes the litter clumps ( not shown ) upward along inclined front wall 80 , as best seen in fig6 . as rake 30 travels upward along inclined wall 80 , lid ramps 210 and 212 engages rollers 214 and 216 , located on ear ears 218 and 220 . ears 218 and 220 are attached to waste box lid 116 so that as rollers 214 and 216 travel upward along lid ramps 210 and 212 , lid 116 will pivotably open . during this time , cross member 40 is pushed upward by planar surface ramps 222 and 224 so that rake arms 50 and 52 ( fig4 ) raise inside and slideably engaged hollow interiors 66 and 68 . as rake 30 travels to the uppermost portion of inclined wall 80 and planar surface ramps 222 and 224 , the litter clumps will fall off rake 30 into the waste box 36 . movement of rake 30 is terminated at the top end of inclined front wall 80 when the position of stabilizer bar 178 is detected by relay 204 ( fig7 ). when relay 204 is triggered , a signal is sent to a microcontroller which in turn sends a signal to motor 166 to reverse directions to move rake 30 to the “ home ” position ( fig3 ). upon approaching litter pan rear wall 82 , movement of rake 30 is terminated when the stabilizer bar position is detected by relay 202 ( fig7 ). as seen specifically in fig9 , tines 38 are angularly disposed with respect to rake arms 50 and 52 . this angled configuration permits the waste clumps to gravitally fall from rake 30 into waste box 36 . referring back to fig3 , sidewall planar surfaces 86 and 88 include ramps 226 and 228 which are inclined to lift rake 30 upward as the rake approaches litter pan rear wall 82 . in addition , litter pan bottom wall 74 includes a ramp 230 . this configuration ensures that rake 30 can continue to travel to and from the home position to overcome the natural buildup of litter that occurs adjacent rear wall 82 . litter buildup occurs as a result of rake 30 traveling to the “ home ” position . in addition , at the commencement of the raking cycle , the inclined planar surface ramps 226 and 228 and bottom wall ramp 230 enable rake 30 to gradually dig “ down ” into the litter as rake 30 travels toward inclined front wall 80 along ramp 230 . ramps 226 and 228 are sufficiently sized to raise rake 30 ; however , tines 38 still remain below the top surface of the litter level . after the initial power up sweep , as described above , litter box 20 is ready for use . when the cat enters litter chamber 84 , sensors 206 and / or 208 detect the presence of the cat . once sensors 206 and / or 208 detect that the cat has exited litter chamber 84 , a signal is sent to a timer to delay the commencement of the sweeping cycle after a predetermined delay period . a switch 232 ( fig7 ) can be optionally provided to allow the pet owner to determine the predetermined length of the delay period before commencing the sweeping cycle . in a preferred embodiment , switch 232 is a three position switch that allows the pet owner to set the delay period for either ten , fifteen or twenty minutes as some litter clumps require different time lengths to sufficiently harden before being swept by rake 30 . in the alternative , a remote control 280 ( fig1 ) can include a switch 232 to permit the pet owner to select the predetermined delay period . when the delay period expires , sensors 206 and 208 confirm that no cat or foreign object is present in litter chamber 84 . if a cat or foreign object is detected , raking operation will not start . if no cat or foreign object is detected , rake moves forward until reaching waste box 36 . upon reaching waste box 36 , rake 30 stops to permit the litter clumps to fall inside waste box 36 . after a short period of time elapses , rake 30 then reverses directions , as previously described , and returns to the “ home ” position ( fig3 ). during the raking cycle , sensors 206 and 208 continue to detect whether a cat or foreign object has entered litter chamber 84 . if , during the raking cycle , a cat or foreign object is detected , the raking sequence stops until the cat or foreign object is no longer in litter chamber 84 . a motor load sensor ( not shown ) will detect if rake 30 encounters a waste clump or pile of litter that is too great to be moved by the rake . motor load sensor operates by monitoring the load on motor 166 such that when the load across the motor reaches a predetermined value , a signal will be sent to the microcontroller which in turn sends a signal to reverse the direction of motor 166 to return rake 30 to either litter pan front wall 80 or litter pan rear wall 82 , whichever is in the reverse direction of the path . rake 30 will then reverse direction and travel toward the waste clump in an additional attempt to move the clump . if after multiple attempts the clump cannot be moved , the pet owner will be alerted that litter box 20 requires maintenance . as can be best seen in fig9 rake tines 38 extend downward and are located adjacent bottom wall 74 . a slight gap g extends between tines 38 and bottom wall 74 to prevent rake from scratching floor 74 . however , gap g should be a minimal distance so as to prevent litter clumps from remaining inside the bottom of litter chamber 84 . as seen in fig1 , lower hood 26 is installed to surround litter pan 24 . hood 26 includes a forward wall 234 , a pair of sidewalls 236 and 238 , and a rear wall 240 to surround and protect litter pan 24 and base 22 . lower hood 26 is mounted on hood supports 242 and 244 and is locked to base 22 with latch 246 ( additional hood supports 242 and 244 and latch 246 are also located in mirror image along sidewall 236 ). as can be seen , lower hood sidewalls 236 and 238 conceal rake supports 58 and 60 , posts 54 and 56 , and lid ramps 210 and 212 . by concealing these moving elements , the litter box 20 is maintained clean and better protected from litter , cat hair , spray , etc . interior sidewalls 248 and 250 and rear wall 252 are a sufficient height above litter pan 24 to protect the areas surrounding the litter pan from litter scatter and cat spray . in addition , a rim 254 extending along interior walls 248 and 250 cover cross member offset portions 44 and 48 ( offset portions best seen in fig4 ). a rim 256 also extends along rear wall 252 . rims 254 and 256 reduce spray and litter scatter that may damage the moving elements described above . in addition to reducing litter scatter and spray , rims 254 prevent rake 30 from rising above and separating from planar surface 86 and 88 . during the raking cycle , rake 30 tends to rise up as it moves through the litter . thus , the shape of rims 254 correspond to the shape of planar surfaces 86 and 88 and are sufficiently spaced apart such that cross support bar offset portions 44 and 48 can be placed between rims 254 and planar surfaces 86 and 88 . this prevents rake 30 from rising above planar surfaces 86 and 88 during the raking cycle . latches 246 are used to secure lower hood 26 to base 22 to prevent rake 30 from pushing hood 26 upward . when it is desired to remove rake 30 from litter box 20 , lower hood 26 is detached from base 22 by unlocking latches 246 . once unlocked , lower hood 26 is lifted away from base 22 thereby exposing rake offset portions 44 and 48 being connected to rake supports 32 . as previously explained , rake 30 is lifted so that arms 50 and 52 are removed from posts 54 and 56 . to install rake 30 in litter box 20 , rake arms 50 and 52 are aligned with openings 62 and 64 and inserted therein . hood 26 is then re - attached to base 22 and locked by latches 246 . as seen in fig1 and 12 , an entrance ramp 258 can be attached to litter box 20 to allow a cat to easily enter and exit litter chamber 84 . ramp 258 is removable such that litter box 20 can be used with or without the ramp . a rug 260 can be used to overlay ramp 250 to catch any litter that is spread when the cat exits litter chamber 84 . referring to fig1 and 14 , rug 260 includes a backing layer 262 and a twisted fabric loop material 264 attached the backing layer . twisted fabric loop material 264 is preferably a twisted cotton loop that is approximately 1 - 1 . 25 inches in length . twisted loops 264 are spaced apart such that litter can be trapped between each fabric loop material 264 . this prevents litter from scattering on the surrounding floor area . alternatively , twisted fabric loop material 264 may be substituted for twisted , but non - looped material , if desired . rug backing 262 contains a plurality of elastic loops 266 ( fig1 ) attached to backing 262 so that rug 260 can be easily attached to hooks 268 on ramp 258 . in addition to being attachable to ramp 258 , rug 260 can be sufficiently sized overlay the floor area surrounding or adjacent to litter box 20 . multiple sections can be attachable together , using a hook and pile fastener for example , to protect the surrounding areas . referring back to fig1 and 2 a , upper hood 28 is used to cover litter pan 20 . it should be realized by one of ordinary skill that litter box 20 can be used without upper hood 28 if it is desired to operate as a “ non - hooded ” or an “ open ” litter box . hood 28 includes a removable visor portion 270 located above waste box 36 . visor portion 270 extends over waste box 36 so that as waste box lid 116 opens , odors will be directed by visor portion 270 into hood 28 . a filter 272 is mounted to hood 28 toward the rear portion of litter box 20 . thus , odors that rise from litter chamber 84 or those that are released from waste box 36 , when open , can be filtered by filter 272 . the filter is most preferably a polyester substrate with charcoal and zeolite particles stored in a polyethylene bag . visor portion 270 can be completely detached from hood 28 ( as seen in fig2 a ) to allow access to waste box 36 without detaching hood 28 entirely from litter box 20 . in the alternative , visor portion 270 can be pivotably mounted to hood 28 so that it remains attached at all times ; thus when it is desired to access waste box 36 , visor portion 270 can be pivotably opened . visor portion 270 is preferably fabricated from a translucent or transparent , but slightly tinted material , so that the consumer can view litter chamber 84 while also providing the cat sufficient privacy . in addition , hood 28 includes a storage compartment 274 that is sized to receive and store pet supplies such as replacement waste box liners . storage compartment 274 contains a lid 276 that can be opened for easy access inside storage compartment 274 . the pet owner can remove lid 276 to gain access inside interior 274 by using finger grips 277 to completely lift lid 276 away from hood 28 . hood 28 also can optionally include a storage compartment or receiving area 278 for holding remote control 280 ( fig1 ) to operate litter box 20 . other alterations and modifications of the invention will likewise become apparent to those of ordinary skill in the art upon reading the present disclosure , and it is intended that the scope of the invention disclosed herein be limited only by the broadest interpretation of the appended claims to which the inventors are legally entitled .

US-73932603-A

the invention relates to fatty acid stimulation of rectal mucosa initiating the process of defecation , acting as a laxative . furthermore , the invention relates to the usage of free fatty acids , fatty acid mixtures and fatty acid extracts from marine lipids in pharmaceutical formulations such as suppositories , ointments , tablets and gelatin capsules for treatment and prevention of multiple disorders like constipation , hemorrhoids , bacterial infections , viral infections and inflammations , as well as against fissura ani and pruritus ani .

the invention provides in a first aspect a pharmaceutical dosage form for administration to rectum and / or the large intestine for the purpose of inducing defecation ( bowel movements ), i . e . inducing and / or stimulating the process . the dosage form comprises as an active ingredient one or more fatty acid . the one or more fatty acid is suitably in a form selected from free fatty acid , salt of fatty acid with a pharmaceutically acceptable counter ion , fatty acid ethyl ester and fatty acid monoglyceride . free fatty acids are the presently preferred embodiment . the one or more fatty acid preferably has a chain length in the range of four to 36 carbon atoms , such as a chain length in the range of 4 to 24 and more preferably a chain length in the range of 8 to 24 carbons . more preferably the one or more fatty acid comprise a mixture of fatty acids , which can be derived from suitable natural lipid material such as oils of animal or vegetative origin , fractions thereof or a mixture thereof . fatty acids useful in the invention include saturated fatty acids such as hexanoic acid ( caproic acid ) ( 6 : 0 ), heptanoic acid ( enanthic acid ) ( 7 : 0 ), octanoic acid ( caprylic acid ) ( 8 : 0 ), nonanoic acid ( pelargonic acid ) ( 9 : 0 ), capric acid ( 10 : 0 ), undecylenic acid ( 11 : 0 ), lauric acid ( 12 : 0 ), tridecylic acid ( 13 : 0 ), myristic acid ( 14 : 0 ) palmitic acid ( 16 : 0 ), and stearic acid ( 18 : 0 ). unsatured fatty acids which are useful include palmitoleic acid ( 16 : 1 n - 7 ), oleic acid ( 18 : 1 n - 9 ), elaidic acid ( 18 : 1 ), linoleic acid ( 18 : 2 n - 6 ), linolenic acid ( 18 : 3 ), arachidonic acid ( 20 : 4 n - 6 ), gadoleic acid ( 20 : 1 n - 11 ), gondoic acid ( 20 : 1 n - 9 ; cis - 11 eicosenoic acid ), erucic acid ( 22 : 1 n - 9 ) and cetoleic acid ( 22 : 1 n - 11 ). useful vegetable oils as raw material for the fatty acids of the invention include safflower oil , corn oil , almond oil , sesame oil , soybean oil , linseed oil , rapeseed oil , grape seed oil , sunflower oil , wheat germ oil , hemp oil , and any mixtures thereof . in preferred embodiments the fatty acids are derived from oil material which is pharmaceutically acceptable and defined according to pharmacopoeia standards ( pharmaceutical grade oils ). such oils include marine omega oils such as omega - 3 fish oil ( lysi , iceland ). in a preferred embodiment the one or more fatty acids comprise a mixture of fatty acids comprising at least about 20 wt % of unsaturated fatty acids and at least about 5 wt % polyunsaturated fatty acids . the term poly - unsaturated fatty acid indicates a fatty acid with more than one double bond in its acyl sidechain and is used herein interchangeable with the term highly - unsaturated fatty acid or hufa . many natural oils provide such fatty acid composition , e . g . the vegetable oils mentioned above , and fish oils and other marine oils as well , which provide a high fraction of pufa . among poly - unsaturated fatty acids useful in the invention are the omega - 3 fatty acids alpha - linolenic acid ( 18 : 3 ), stearidonic acid ( 18 : 3 ), moroctic acid ( 18 : 4 n - 3 ), eicosatrienoic acid ( 20 : 3 ), eicosatetraenoic acid ( 20 : 4 ), eicosapentaenoic acid ( 20 : 5 ; epa ), docosapentaenoic acid ( 22 : 5 ), docosapentaenoic acid ( 22 : 5 ), and docosahexaenoic acid ( 22 : 6 ; dha ), tetracosapentaenoic acid ( 24 : 5 ), and tetracosahexaenoic acid ( 24 : 6 ). other useful polyunsaturated fatty acids are omega - 6 fatty acids including linoleic acid ( 18 : 2 n - 6 ), gamma - linolenic acid ( 18 : 3 n - 6 ), eicosadienoic acid ( 20 : 2 ). the designation in parantheses indicates the total number of carbon atoms in the acyl chain and the number of double bonds , thus 18 : 3 is a fatty acid with 18 carbon atoms and three double bonds . the omega number indicates how far from the lipophilic end of the acyl chain the first double bond is situated , also indicated with n , as is used for other unsaturated fatty acids above . in a useful embodiment , the pharmaceutical dosage form comprises a mixture of fatty acids derived from marine organisms . marine organisms useful as sources of the fatty acid material include marine animal oil derived from an animal source selected from fish liver oil including cod liver oil , tuna oil ; fish flesh or fish meal including flesh or meal from herring , capelin , mackerel , menhaden , sardine , anchovy , horse mackerel , blue whiting , and tuna ; planktonic organisms , squid and molluscs . oils such as the above mentioned are readily converted to free fatty acids by hrolysis as mentioned above , the pharmaceutical dosage form of the invention for laxative action is suitably formulated for administration to rectum and / or lower intestines . consequently , any type of dosage form suitable for administration at said site is within the scope of the present invention . currently contamplated dosage forms include suppositories , ointment , cream , lotion , paste , gel , and formulations for enema delivery . suppositories are well known in the art , they are generally formulated to be solid at room temperature and up to at least about 30 ° c . but having a melting temperature below the normal human body temperature of 37 ° c . it is therefore common to formulate suppositories with a fat base , such as cocoa butter , which fulfils the above melting point criteria . cocoa butter is a mixture of triglycerides of saturated and unsaturated fatty acids which can be manipulated in solid form at room temperature but melts completely at body temperature . more recent materials include so called cocoa butter substitutes ( cbs ), which include the following categories : interesterified fully hydrogenated palm kernel oil , fully hydrogenated palm kernel stearine , mid fractions of hydrogenated vegetable oils which are rich in trans - fatty acids and semi - synthetic glycerides . useful commercially available fat bases suitable for the present invention include suppocire ™ ( gattefosse ) lipophilic bases , a semi - synthetic vegetable based oil base available in several grades including suppocire ™ as , as2x , na , novata ™ ( henkel int .) including novata a , novata b , and novata bc , witepsol ™ ( dynamit nobel ab ) such as witepsol ™ h5 , h12 , h15 , h32 , h35 , w25 , w31 , w32 , w32 , w35 , and w45 ; massa estarinum ™ ( sasol ), incl . massa estarinum ™ of the grades b , bc , e and 299 . the suppositories of the present invention may suitably comprise any of the above mentioned materials as base . hydrophilic waxes can also be used in the invention , such as the polyethylene glycols ( eg peg 1500 , peg 3000 , peg 4000 and mixtures thereof ). suppocire ap , is an amphiphilic base comprising saturated polyglycolysed glycerides . further base components may suitably be added , such as beeswax , carnuba wax or the like . th suppository dosage form may also in some embodiments comprise further excipients such as but not limited to binders and adhesives , lubricants , disintegrants , colorants and bulking agents . suppository dosage forms of the invention will generally comprise in the range of 50 - 2000 mg of the fatty acid active ingredient , and preferably in the range of 50 - 1000 mg , such as in the range of 100 - 750 mg , including about 100 mg , about 200 mg , about 300 mg , about 400 mg or about 500 mg . smaller suppositories for pediatric use are also within the scope of the invention , which generally would be smaller and comprising in the range of 50 - 750 mg fatty acid active agent , such as in the range of 50 - 500 , e . g . about 50 mg , about 75 mg , about 100 mg , about 200 mg , about 300 mg or about 400 mg . depending on the desired dose and the desired total size of the suppository the amount of fatty acid active ingredient may comprise in the range of about 5 wt % to about 75 wt % of the total weight of the dosage form , such as in the range of about 5 - 50 wt %, including in the range of about 10 - 50 wt %, such as in the range of about 10 - 40 wt %. a common size of molded or kneaded suppositories for adult use according to the invention is in the range of about 2 - 3 ml , such as about 2 . 0 ml , about 2 . 2 ml or about 2 . 5 ml . depending on the excipient composition , this would generally correspond to a weight in the range of about 1 . 5 to about 3 g , accordingly , the suppositories according to the invention are suitably in said weight range , such as about 1 . 8 g , about 2 . 0 g , about 2 . 2 g or about 2 . 5 g . a suitable size for pediatric suppositories would generally be about half the above size , such as in the range of 0 . 5 - 1 . 5 ml , e . g . about 0 . 5 ml , about 0 . 8 ml , about 1 . 0 ml , about 1 . 2 or about 1 . 5 ml . it has been found useful to include in the suppository dosage form of the invention an excipient oil component such as a triacylglyceride oil ( the term triacylglyceride oil indicating herein a natural , synthetic or mixed oil which comprises dominantly triglycerides , such as any of the above mentioned oils , but may also include some fraction of diacylglycerides and monoacylglycerides ), to reduce discomfort during action of the medicament and bowel movements . accordingly , the dosage form of the invention preferably comprises in the range of about 5 - 50 wt % triacylglyceride oil , including the range of about 5 - 35 wt % triacylglyceride oil , such as more preferably in the range of about 5 - 25 wt %, such as about 5 wt %, about 10 wt %, about 15 wt % or about 20 wt %. the base is in these embodiments composed accordingly in order to have a desired melting point of the overall composition of the dosage form . preferably the triacylglyceride oil is a pharmaceutical gradeoil , such as fish oil derived omega oil as mentioned above , or anyother suitable well defined pharmaceuticall acceptable oil . it is useful to include anti - oxidants in the dosage forms of the invention , such as but not limited to butylated hydroxyanisole ( bha ), butylated hydroxytoluene ( bht ), ascorbic acid or a salt thereof , a sulfatide salt , citric acid , propyl gallate , alfa - tocopherol , and ascorbyl palmitate . depending on the selected antioxidant compound , a suitable amount is e . g . in the range of about 0 . 05 - 0 . 5 wt %, such as in the range of 0 . 1 - 0 . 3 wt %. further preservative agents may included in some embodiments , such as any of those of the group consisting of benzoic acid or derivatives thereof , including of c 1 - 6 - alkyl - p - hydroxy - benzoic acids , such as methyl - p - hydroxy - benzoic acid , ethyl - p - hydroxy - benzoic acid , propyl - p - hydroxy - benzoic acid , butyl - p - hydroxy - benzoic acid , and mixtures thereof . in a particular interesting embodiment , the preservative is a mixture of methyl - p - hydroxy - benzoic acid and propyl - p - hydroxy - benzoic acid , in the proportion of from about 3 : 1 to about 5 : 1 by weight , preferably in the proportion of about 4 : 1 by weight . the preservative or preservatives is / are preferably present in the formulation in such a concentration of about 0 . 05 - 0 . 2 % by weight calculated on the formulation , that it does not to any substantial extent impair the activity of the lipid or lipids . the suppository dosage form of the invention are preferably provided in isolating packaging to further inhibit air oxidation , such as alu - alu blister packaging , duma containers or the like . enema formulations are generally liquid or semi - liquid formulations to be administered with suitable pharmaceutical grade enema rectal applicator . preferred applicators are those that deliver the suitable dose of the formulation by breaking open a sealed dosage form container , such as e . g . described in u . s . pat . no . 4 , 657 , 900 . in another aspect , the invention provides a method for stimulating and / or initiating the process of defecation , which comprises administering to the rectum and / or lower intestines one or more fatty acids . the method is based on the stimulating effect of the fatty acids on the polymodal nocireceptors in the rectal mucosa . the fatty acid is preferably selected from any of the above mentioned fatty acids and mixtures of fatty acids and can formulated in a suitable form such as in any of the forms described above . as can be understood from the above discussion , free fatty acids are the preferred form of fatty acids in the method , although other forms are contemplated , such as fatty acid ethyl esters , salt of fatty acids and fatty acid monoglycerides . the method will generally comprise administering in the range of about 100 to 2000 mg fatty acids , such as in the range of 100 - 1000 mg , or any of the above mentioned ranges and amounts . in the presently preferred embodiment , the method comprises administration of the active ingredient to the rectum and / or lower intestines . accordingly , the method preferably comprises administering dosage forms as described above , including suppositories , enemas or other formulation types introduced through the anus . a further aspect of the invention provides fatty acid for use as a medicament for stimulating and inducing the process of defecation . the examples provided herein demonstrate a clear clinical effect of the fatty acids acting as active ingredient for the stated medical indication and clinical action . as illustrated in example 6 , the effect is attributed to fatty acids but not triacylglyceride oil used as excipient . the fatty acid of the invention is preferably in the form of free fatty acid or any of the other defined forms above and preferably the fatty acid is provided as a mixture of fatty acids . suitably and practical mixtures can be obtained from natural sources , derived from animal or vegetative oils or mixture thereof , as those mentioned above . in the below example 1 is described how a preferred extract of free fatty acids is produced by acid hydrolysis of a marine fish oil . accordingly , a fatty acid mixture obtainable from hydrolysis of natural oil , such as from a vegetable oil or fish oil , for use as a laxative medicament is included in the invention . the fatty acid of the invention is preferably formulated in a dosage form of the invention , such as in particular as a suppository , preferably as further described herein . fatty acids for use in the invention can be suitably provided by hydrolysis of natural oils such as those above mentioned . hydrolysis of triglycerides can be acid or base catalysed . as illustrated in the accompanying examples , acid hydrolysis of a natural oil such as fish oil yields useful fatty acids , the composition of the resultant fatty acid mixture is substantially similar to the fatty acid composition of the oil raw material and will vary depending on the natural source and any desired composition can be derived by mixing different sources , either mixing natural oils prior to hydrolysis or mixing individual fatty acids or fatty acid mixtures . the fatty acid composition of different fish species and fish oil is well documented and known to the skilled person . ethyl esters of fatty acids for use in the invention can be obtained by esterification of free fatty acids such as with a suitable lipase , such as but not limited to lipase from rhizomucor miehei ( mml ), pseudomonas sp . lipase ( psl ) and psedomonas fluorescens lipase ( pfl ). see e . g . halldorsson et al ( 2004 ), wo 95 / 24459 , wo 00 / 49117 and u . s . pat . no . 7 , 491 , 522 . monoglycerides can be obtained by selective esterification with glycerol with lipase under suitable reaction conditions , for an overview see , osman et al . ( 2006 ). a further aspect of the invention provides pharmaceutical formulations and dosage forms with fatty acids and cyclodextrins . cyclodextrins are cyclic oligosaccharides and are ueful for forming host - guest complexes with hydrophonic molecules . the inventors have found that dry fatty acid powders can be readily provided in combination with cyclodextrins . cyclodextrin compounds that are useful in the invention include alfa - ayclodextrin , beta - cyclodextrin and gamma - cyclodextrin and their derivatives , such as 2 - hydroxypropyl - alfa - cyclodextrin , 2 - hydroxypropyl - gamma - cyclodextrin and sulfobutylether gamma - cyclodextrin . useful dry fatty acid powders can comprise about 1 : 1 ratio of fatty acids and cyclodextrins , or in the range of from 1 : 2 to 2 : 1 fatty acids to cyclodextrins , e . g . a ratio of about 2 : 1 ( 67 : 33 ) fatty acids : cyclodextrin , or a ration of about 3 : 2 , or about 1 : 1 , or about 2 : 3 , or 2 : 1 . cyclodextrin - fatty acid compositions according to the invention were found to be substantially more stable than the fatty acids . the dosage form is in some embodiments a dosage form for oral administration , such as a tablet , sachet or capsule . such dosage forms can be formulated by conventional methods with the fatty acid - cyclodextrin complex converted to dry form as described herein . tablets are a preferred embodiment , they can be readily formulated by e . g . direct compression , dry granulation ( slugging or roller compaction ) or wet granulation . direct compression is preferred for this invention . dry granulation consists of blending , slugging the ingredients , dry screening , lubrication , and compression . the wet granulation method is used to convert a powder mixture into granules having suitable flow and cohesive properties for tableting . the procedure includes mixing the dry ingredients in a suitable blender followed by adding a granulating solution under shear to the mixed powders to obtain a granulation . the damp mass is screened through a suitable screen and dried by tray drying or fluidized bed drying . alternatively , the wet mass may be dried and passed through a mill . the overall process includes : weighing , dry powder blending , wet granulating , drying , milling , blending lubrication and compression . direct compression is a relatively quick process where the powdered materials are compressed directly without changing the physical and chemical properties of the drug . the fatty acid compound , direct compression excipients and any other auxiliary substances , such as a glidant and lubricant are blended , e . g . in a twin shell blender or similar low shear apparatus before being compressed into tablets . excipients which may be present include one or more of diluents , binders , disintegrants , lubricants , glidants and colorants . a glidant may be added to improve the flow of powder blend in the hopper and into the tablet die . lubricants are typically added to prevent the tableting materials from sticking to punches , minimize friction during tablet compression , and allow for removal of the compressed tablet from the die . lubricants are commonly included in the final tablet mix in amounts usually less than 1 % by weight . lubricants which can be used in the invention include but are not limited to magnesium stearate , stearic acid , hydrogenated oil , and sodium stearyl fumarate . tablets of the invention can further comprise one or more diluent , added to increase the bulk weight of the blend resulting in a practical size for compression and / or affect the properties of the blend for compression . typical diluents which can be used include for example dicalcium phosphate , calcium sulphate , lactose , dextrates , dextrins , cellulose ( preferably microcrystalline cellulose ), mannitol , sodium chloride , dry starch , pregelatinized starch and other sugars . binders are used to impart cohesive qualities to the powdered material . useful binders include starch , gelatin , sugars such as sucrose , glucose , fructose , mannitol , sorbitol , dextrose , and lactose , natural and synthetic gums , carboxymethylcellulose , methylcellulose , polyvinylpyrrolidone , ethylcellulose and waxes . a disintegrant may be incorporated to ensure that the tablet has an acceptable rate of disintegration . typical disintegrants include starch derivatives , crospovidone , croscaramelose and salts of carboxymethylcellulose . some binders , such as starch and cellulose , are also excellent disintegrants . another useful dosage form of the invention is a capsule . suitable capsules of appropriate size for a given dosage size are well known to the skilled person and include but are not limited to hard gelatine capsules , soft gelatine and are more preferably hydroxypropyl methylcellulose capsules . in the dosage form of the invention , the amount of active ingredient can be relatively large , such as in the range of about 50 - 2000 mg fatty acids , including the range of about 100 - 2000 mg , such as in the range of about 100 - 1000 mg , such as about 200 - 1000 mg , including about 200 mg , about 250 mg , about 300 mg , about 500 mg , about 750 mg or about 1000 mg . consequently , it is preferred that the total amount of excipients in a tablet or capsule of the invention does not add too much mass to the dosage form . accordingly , it is preferred that excipients comprise less than about 25 wt %, such as less than about 20 wt % and more preferably less than about 15 wt %. further useful embodiments include dosage forms for topical administration such as but not limited to an oinment , cream , lotion , gel , emulsion , liposomes , or paste . these dosage forms are suitably formulated with conventional ingredients and excipients . gels , such as for iontopophoresis , suspensions and emulsions , including oil / water ( w / o ), w / o , o / w / o , w / o / w emulsions or microemulsions . these dosage forms are suitably provided by mixing a dry powder of fatty acid - cyclodextrin complex with suitable ingredients , in a hydrophobic or hydrophilic basis . the basis may comprise hydrocarbons such as hard , soft or liquid paraffin , glycerol , waxes ( e . g ., beeswax , carnauba wax ), metallic soap , a mucilage , an oil of natural origin such as corn , almond , castor , or olive oil , mineral oils , animal ols ( perhydroxysqualene ); or a fatty acid such as stearic or oleic together with an alcohol such as ethanol , isopropanol , and propylene glycol . the formulation may include any suitable surface active agent such as an anionic , cationic , or non - ionic surfactant such as sorbitan esters or polyoxyethylene derivatives thereof . suspending agents such as natural gums , cellulose derivatives or inorganic materials such as silicaceous silicas may also be included . the formulations may additionally comprise absorbtion promoters , stabilizers , e . g . protein stabilizing agents , known in the art . the topical dosage forms preferably include an antioxidant such as any of those mentioned above for oral dosage forms . preparation of the fatty acid mixture from fish oil : the fatty acid mixture is extracted from fish oil ( such as fish - liver oil , for example cod - liver oil ) after hydrolysis in aqueous media . sodium hydroxide ( 130 grams ) is dissolved in a mixture of 1 . 0 liter of ethanol and 1 . 5 liter of purified water . then 1000 grams of cod - liver oil is added and the mixture heated under reflux at 85 ° c . for 8 hours . then after cooling to 5 ° c . 800 ml of 6m hydrochloric acid is added and the oil phase separated from the aqueous solution . the oil is then washed four times with 800 ml of purified water at 50 ° c . and finally dried at room temperature under vacuum . the fatty acid composition of the extract and the cod - liver oil used to prepare the extract is determined by gas - chromatography . the relative fatty acid composition of the extract is approximately the same as in the unhydrolyzed oil ( table 4 ). suppositories were prepared by the fusion method . white beeswax ( apifil gattefosse , france ; 50 grams ), glycerol dibehenate ( compritol 888 , gattefosse ; 19 grams ) and hard fat ( suppocire na 0 , gattefosse ; 530 grams ) were melted and mixed at about 75 ° c . and allowed to cool to 50 ° c . then tocopherol antioxidant mixture ( coviox t70 , cognis , germany ; 1 gram ), cod - liver oil ( 100 grams ) and the fatty acid extract ( 300 grams ) were added and after thorough mixing and cooling to 45 ° c . the mixture was poured into a suppository mold ( 2 . 2 ml ) and cooled at room temperature . suppositories containing 10 % and 20 % fatty acid extract , as well as suppositories containing either cod - liver oil ( 100 grams ) or fatty acid extract ( 300 grams ), where additional amounts of suppocire na 0 replaced the other ingredient , were prepared by the same method . ointments were prepared by the fusion method . beeswax ( apifil , gattefosse ; 49 grams ), glyceryl distearate ( precirol ato , gattefosse ; 20 grams ) and petrolatum ( white soft paraffin ph . eur ; 330 grams ) were melted together over water bath at 65 to 75 ° c . after cooling to 50 ° c . cod - liver oil ( 300 grams ), fatty acid extract ( 300 grams ) and tocopherol antioxidant mixture ( coviox t70 , cognis ; 1 gram ) were added to this base . then , after cooling to room temperature , the ointment was filled into 30 ml aluminum tubes . a double - blind study was conducted with 30 healthy volunteers . on day 1 the participants underwent an anal examination and randomized into study group , receiving the active ingredients ( suppositories and ointments containing 30 % omega enriched fatty acid mixture , see table 2 and examples 2 and 3 ), and control group , receiving placebo ( identical suppositories and ointments without fish - liver oil and the fatty acid mixture ) for a total study period of two weeks . the study group consisted of 3 males and 12 females , with the mean age of 46 years . the control group consisted of 6 males and 9 females with the mean age of 43 years . the participants administered the suppositories in the rectum and applied the ointment to the perianal area twice a day with clinical examination after the first week with anal examination where any sign of erythema , inflammation , blood or sores were recorded . after the second week the volunteers underwent final examination . the participants also answered a questionnaire about the effect of the suppositories on their bowel movement during control examination after week one and two . the anal examination conducted after week one and at the final control did not reveal any toxic skin reactions in either group . there was no statistically significant difference regarding complaints of itching or mild pain between the groups . in the study group 93 % felt the urge for defecation and passed stools , most within 10 minutes after administration of suppositories . in the control group only 37 % felt the urge for defecation after administration of suppositories . the difference was statistically significant ( p = 0 , 000 ). the suppositories clearly stimulated bowel movement causing defecation without causing diarrhea , mucosa secretion or any prolonged effect after defecation . five healthy volunteers participated in this study . on day one they administered rectally one suppository containing 10 % omega enriched fish - liver oil and 30 % omega enriched fatty acid mixture ( see table 2 and example 2 ) and on day seven they administered identical suppository containing only the fish - liver oil ( 40 %) but no free fatty acids . the suppositories containing the fish - liver oil and the fatty acid mixture stimulated bowel movement causing defecation in all participants while suppositories containing only the fish - liver oil did not . dry powder containing free fatty acids were prepared by weighing 10 grams γ - cyclodextrin , 3 grams carboxymethylcellulose sodium ( molecular weight 90 , 000 da ) and 0 . 02 grams benzalkonium chloride in a beaker glass and add pure water ad 90 ml . then 9 grams of cod - liver oil and 1 gram of free fatty acid mixture ( example 1 ) was added to this solution . after thorough mixing the emulsion formed was lyophilized to form dry complex powder . then 98 . 5 grams of the complex powder was mixed with 0 . 5 grams of silicon dioxide and 1 gram of magnesium stearate , and tablets ( diameter 15 mm , weight 0 . 75 grams ) prepared by direct compression . γ - cyclodextrin ( gamma - cyclodextrin ; 15 grams ) was dissolved in 85 ml of water and 15 grams of the fatty acid mixture ( example 1 ) added to the solution ( ph 7 . 4 ). after thorough mixing the emulsion formed was lyophilized to form dry complex powder . monolayers of cv - 1 cells ( african green monkey kidney cell line ) in 96 - well cell culture plates ( nunc , denmark ) were use to determine virus infectivity titers . the cell culture medium was eagle &# 39 ; s minimum essential medium ( mem ) with 10 % fetal bovine serum ( fbs ) and the maintenance medium ( mm ) was mem with 2 % fbs . the fatty acid extract from cod - liver oil , fatty acid extract ( example 1 ) or fatty acid extract / γ - cyclodextrin complex ( example 7 ) was dissolved in mm to the desired concentration ( 0 . 5 % and 1 . 0 %) by vortexing for one min . the extract dilutions in mm were mixed with stock solution of herpes simplex virus type 1 ( hsv - 1 ) in ratio 4 : 1 and incubated at room temperature for 10 min . the viral infectivity in the mixtures was then immediately titrated by inoculation of 10 - fold dilutions in mm into wells with cv - 1 monolayers , 100 μl per well and four wells per dilution . the cell culture plates were incubated for 5 days at 37 ° c . and 5 % co 2 in air . virus infectivity titers were then read and expressed as log 10 ccid 50 ( 50 % cell culture infective dose ) per 100 μl . the titers in mixtures with fatty acid extract were subtracted from the titer of the control mixture in which hsv - 1 was diluted 4 : 1 in mm . the difference , i . e . reduction of titer , was used as a measure of antiviral activity ( see table 5 ).

US-201313737992-A

an apparatus and method for detecting indications of skin cancer , includes a magnifying glass for magnifying a lesion on an area of skin to be tested and indicia for determining the presence or absence of skin disease indications . the magnifying glass and the indicia are formed on a clear , flexible plastic sheet . the indicia include a circle for detecting whether the diameter of the lesion indicates the presence of melanoma and a cross for detecting whether the symmetry of the lesion indicates the presence of melanoma .

referring now to fig1 and 2 a melanoma detection device 10 according to the present invention is shown . the melanoma detection device 10 comprises a sheet 12 preferably constructed of a thin flexible material , for example , plastic . also preferably , the sheet 12 is transparent . the sheet 12 has an upper flat surface 14 and lower flat surface 16 as shown in fig2 . the device 10 also includes a magnifier 20 having an upper convex surface 22 as shown in fig2 . the magnifier 20 magnifies objects placed adjacent to either the upper convex surface 22 or a portion of the lower flat surface 16 directly beneath the upper convex surface 22 . preferably , the magnifier 20 is constructed of the same material as sheet 12 and is integrally formed with sheet 12 to enable ease in manufacturing of the melanoma detection device 10 . the melanoma detection device 10 also includes indicia 30 and 32 . indicium 30 is a circle having a predetermined diameter while indicium 32 is a cross comprising intersecting lines 34 and 36 each having a predetermined length . preferably , the lengths of lines 34 and 36 are equal , however , this condition is not absolutely necessary . the indicia 30 and 32 can be printed on the upper or lower surface 14 , or 16 , respectively , of sheet 12 or can be engraved or otherwise formed in sheet 12 . alternatively , the indicia 30 and 32 may extend fully through the sheet 12 , in which case indicium 30 is a circular hole extending through sheet 12 while indicium 32 comprises slits extending fully through the sheet 12 . indicia 30 and 32 comprise means for detecting the presence or absence of a visible skin disease indication . the melanoma detection device 10 also includes further indicia , formed , for example , by printing 40 , comprising the words : &# 34 ; a asymmetric &# 34 ;; &# 34 ; b irregular borders &# 34 ;; &# 34 ; c multiple colors &# 34 ;; and &# 34 ; d large diameter &# 34 ;. an &# 34 ; a &# 34 ; is printed or otherwise formed directly beneath indicium 32 at a location 42 , a &# 34 ; d &# 34 ; is printed or otherwise formed directly beneath indicium 30 at location 44 and an &# 34 ; m &# 34 ; is printed or otherwise formed directly below magnifier 20 at location 46 . the printing 40 lists the four skin disease indications to be observed with the melanoma detection device 10 . furthermore , the &# 34 ; a &# 34 ; at the location 42 and the &# 34 ; d &# 34 ; at the location 44 correspond to the &# 34 ; a &# 34 ; and the &# 34 ; d &# 34 ; in the printing 40 and enable the user to determine the disease indication to be detected by each of the indicia 30 and 32 . thus , the symmetry of an area of skin is determined with the use of the indicium 32 while the diameter of an area of skin is determined with the use of the indicium 30 . the various steps described below may be performed in any order to check disease indications . in operation , the melanoma detection device 10 is placed adjacent to or in contact with an area of skin , usually a lesion , to be tested . when doing so , an operator may conform the flexible sheet 12 to the skin adjacent the lesion by bending or wrapping the sheet 12 around the skin as necessary to obtain as close a fit as possible between the melanoma detection device 10 and the lesion . the operator may move the sheet 12 so that the indicium 30 is directly atop the lesion , placing the center of the lesion in approximately the center of the circular - shaped indicium 30 . in this fashion , the operator may visually determine if the diameter of the lesion is larger or smaller than the diameter of the circular indicium 30 . a lesion diameter larger than the indicium 30 indicates that one of the disease indications has been found and that , therefore , the lesion may be a melanoma . also , the operator may move sheet 12 so that the cross - shaped indicium 32 is atop the lesion such that the center of the lesion aligns approximately with the intersection point of the lines or slits 34 and 36 . once again , the operator bends the sheet 12 as necessary so that the sheet 12 lays flat on the lesion . in this fashion , the operator may determine the symmetry of the lesion by observing and comparing the lesion portions in the quadrants defined by the lines 34 , 36 . for example , if the end points of the line 34 lie directly on the edges of the lesion while one or both of the end points of the line 36 extend over the edge of the lesion , the lesion is asymmetrical . the operator can rotate the sheet 12 and thus the indicium 32 as necessary to observe the symmetry of the lesion at other points thereon , if desired . the operator may further place the magnifier 20 above the lesion and view the lesion and the surrounding skin through the magnifier 20 . in this manner , the operator can check for irregular lesion borders and for multiple - colored tissue within the lesion . as noted above , the order in which the operator tests for the skin disease indications is not important . therefore , the operator can use magnifier 20 first , the cross - shaped indicium 32 second and the circular - shaped indicium 30 third , or may use some or all of the elements 20 , 30 , 32 in a different order , if desired . typically , the presence of one or more of the above - tested indications indicates a substantial probability of melanoma . it should be noted , however , that a large diameter in and of itself , is less a prediction of melanoma than the other abovementioned indications . with the apparatus as described above , an experienced physician can quickly and efficiently determine whether a lesion is potentially a melanoma , and can therefore determine whether further tests are required . on the other hand , an inexperienced physician or a lay person can use the device to determine whether an experienced physician should be contacted to run more complete tests . this prevents costly medical bills arising from unnecessary physician consultation when there is little or no chance of the presence of melanoma . specifically , the inexperienced physician and / or the lay person can refer to the printing 40 to determine the exact indications to look for in testing for melanoma and further , to determine which indicium to use in testing for each of the specific disease indications . this is accomplished by matching the letters in the printing 40 to the letters at locations 42 and 44 . in the preferred embodiment , the sheet 12 is approximately 12 centimeters long and 5 centimeters wide , while the magnification factor of the magnifier 20 is seven . it should be understood , however , that any size sheet 12 can be used and any magnification factor can be used so long as the magnification is great enough to enable an operator to determine whether multi - colored tissue or irregular borders are present in the lesion being tested . also preferably , the circular shaped indicium 30 has an approximate diameter of 6 millimeters , the lines 34 and 36 of indicium 32 have an appropriate length of 12 millimeters and an approximate width of 0 . 5 millimeters , and the magnifier 20 has an approximate diameter of 25 millimeters . numerous modifications and alternative embodiments of the invention will be apparent to those skilled in the art in view of the foregoing description . accordingly , this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the best mode of carrying out the invention . the details of the structure may be varied substantially without departing from the spirit of the invention , and the exclusive use of all modifications which come within the scope of the appended claims is reserved .

US-98496892-A

a toy for testing and simulating the guidance skills of a user is provided . the toy includes a support unit for removably mounting the toy drum upon the limb of the user and a circular drum removably mounted for rotational upon said support unit . a travel path is formed upon the outer diameter of the drum and a travel element is positioned above the drum . a control mechanism is provided for altering the position of the travel element relative to the travel path . in operation , a motor rotates the drum in a first direction and an opposite direction relative to the support unit and a circuit selectively controls the rotation direction of the motor .

referring to the drawings , and initially to fig1 and 5 there is illustrated a totally unique game or toy device 12 for testing and simulating the guidance or driving skills of a user made in accordance with the principles of the present invention . generally , toy 12 includes a drive unit 14 , a support unit 16 and a drum 18 . the support unit 16 serves to release , engage and support the drum 18 . the drive unit 14 serves to rotate the drum 18 upon the support unit 16 . drive unit 16 also serves to adjustably support a travel element or toy car 21 that is positioned slightly over or above drum 18 when drum 18 is properly positioned on the support unit 16 as shown in fig5 . support unit 16 includes a circular axle 20 upon which drum 18 is supported for rotation . axle 20 includes an opening 22 that allows the axle 20 to be slipped over a user &# 39 ; s hand . more particularly , with the drum 18 positioned on axle 20 , the axle 20 may be slipped over a user &# 39 ; s hand and then moved up along the user &# 39 ; s forearm 19 until the inner wall 23 and flange 24 of the support unit 16 and the bottom wall 25 of the drive unit 14 frictionally engage the user &# 39 ; s forearm 19 , thereby securely mounting the toy 12 upon the user &# 39 ; s forearm 19 as shown in fig5 . as explained in greater detail below , once the toy 12 is secured to a user &# 39 ; s forearm 19 , the toy 12 is energized causing the drum 18 to rotate . the position of the car 21 is then manipulated or adjusted by the user thereby simulating the driving of an automobile along a pathway or roadway . axle 20 includes a rim 26 formed along its inner edge . rim 26 includes a protruding circular bearing 28 and an upstanding lip 30 . upon placement of the drum 18 on axle 20 , the inboard edge of the inner annular surface 34 ( indicated in fig6 ) of the drum 18 rides along and is supported by the circular bearing 28 , while the lip 30 serves to help prevent the lateral movement of the drum 18 on the axle 20 . mounted along the bottom or lower portion of rim 26 is an end cap assembly 40 . end cap assembly 40 includes a battery compartment 42 having pivotally mounted at its distal end an end cap 44 . battery compartment 42 includes a removable cover 46 for allowing a user to insert , remove and replace a conventional &# 34 ; aa &# 34 ; size battery 47 which serves as an electrical power source for the toy 12 . as shown in fig1 cover 46 includes rails 48 that extend from the lateral edges of the bottom leg 50 of the cover 46 . formed in side walls 52 of the compartment 42 are grooves 51 . cover 46 is securely attached to compartment 42 by inserting rails 48 into grooves 51 . as shown in fig2 end cap 44 includes a circular rim 58 having an upstanding lip 60 and a circular bearing 62 . extending from the lip 60 are a pair of struts 64 . pivotally connecting the struts 64 to the distal end of the battery compartment 42 is a pivot pin 66 . pin 66 allows the end cap 44 to pivot in the direction generally indicated by arrow 72 shown in fig1 . once the drum 18 is placed upon the axle 20 , the end cap 44 is pivoted by a user upwardly towards the axle 20 . more particularly , the upstanding lip 60 of the end cap 44 is positioned immediately adjacent the outer edge 67 of axle 20 such that the end portion 68 of axle 20 is received within the confines of circular bearing 62 and the outer edge 67 of the axle 20 abuts the inner surface 73 of the upstanding lip 60 . end cap 44 is held in releasable frictional engagement with axle 20 by protruding tab 78 which clamps the circular bearing 62 of the end cap 44 securely against the outer diameter or surface 80 of the axle 20 . in this position , the drum 18 is held securely upon the axle 20 , the upstanding lip 60 serving to limit the lateral or horizontal movement of the drum 18 . drum 18 includes an inner surface 90 having mounted thereon an annular or continuous rack 92 . mounted on the outer surface 95 of drum 18 are multiple upwardly extending or protruding obstacles 96 . obstacles 96 serve to form a travel path or roadway or contour generally designated 97 . obstacles 96 may simulate anyone of a variety of objects such as , for example , trees , embankments , mountains , other vehicles or the like . similarly , the present invention contemplates the use of any one of a variety of travel elements and is in no way limited to the illustrated toy car 21 . for example , such alternative travel elements may comprise a model tank , airplane , bus , truck or the like . thus , depending on the type of obstacles and travel elements utilized , any one of a variety of driving type activities may be simulated , such as , for example , driving a bus , flying a plane or spaceship , or navigating a submarine or boat . as shown in fig8 drive unit 14 includes a housing 100 that contains a direct current motor 102 that through multiple shafts 104 and gears 106 drives a pinion gear 108 which is positioned within and extends slightly above slot 110 formed in axle 20 . upon placement of the drum 18 on axle 20 the pinion gear 108 engages the rack 92 allowing the gear 108 to drive the rack 92 and thus rotate the drum 18 . although a particular arrangement of gears is illustrated in fig8 it will be appreciated that the present invention contemplates the use of any one of a variety of alternative gear arrangements or configurations that transmit the rotational energy of the motor 102 to the drum 18 . partially contained within housing 100 is steering rack 120 . steering rack 120 is partially supported upon a platform 119 that extends from the end walls of housing 100 and is located beneath rack 120 as shown in fig4 and 5 . steering rack 120 extends through a pair of slots 121 formed in housing 100 that are about the same height or thickness as rack 120 and almost twice as wide as rack 120 . steering rack 120 supports toy car 21 above or over the drum 18 . engaging steering rack 120 is steering pinion gear 122 . secured for rotation , at its distal end in the bottom wall 25 of the housing 100 , is steering shaft 126 . steering shaft 126 extends through and is attached to steering pinion gear 122 . steering shaft 126 is also attached at one of its ends to steering wheel 128 . steering shaft 126 is connected at its other end to an electrical switch 129 ( schematically shown in fig9 ) that is biased in the &# 34 ; off &# 34 ; position and which is placed in the &# 34 ; on &# 34 ; position by depressing the steering wheel 128 . the horizontal position of steering rack 120 , and thus toy car 21 , is determined by steering pinion gear 122 and steering wheel 128 . more particularly , when steering wheel 128 is turned or rotated clockwise , and steering pinion 122 is thus rotated clockwise , the steering rack 120 and the toy car 21 are moved to the right as viewed in fig2 . similarly , when steering wheel 128 is rotated counterclockwise , and steering pinion 122 is thus rotated counterclockwise , the steering rack 120 and the toy car 21 are moved to the left as viewed in fig2 . motor 102 is energized by first turning or rotating the key 131 of switch 130 , which simulates the ignition key of an automotive ignition system , in the clockwise direction as viewed in fig1 to an &# 34 ; on &# 34 ; position . then , switch 132 ( which comprises a double pole triple throw switch having a &# 34 ; neutral &# 34 ; or center &# 34 ; off &# 34 ; position ) must be manipulated out of the center &# 34 ; off &# 34 ; position . more particularly , moving the lever 134 which is attached to switch 132 forward as indicated by arrow 136 in fig2 to a first &# 34 ; on &# 34 ; position and depressing upon the steering wheel 128 ( which closes an electrical circuit with switch 129 that is normally biased in the open position ) results in the motor 102 rotating in a first or forward direction causing the drive pinion 108 to drive the drum 18 in a counterclockwise direction ( as viewed from the end cap 44 in the direction indicated by arrow 138 in fig2 ). moving the lever 134 of switch 132 rearwardly as indicated by arrow 140 to a second &# 34 ; on &# 34 ; position and depressing upon the steering wheel 128 results in the motor 102 rotating in a second or reverse direction causing the drive pinion 108 to drive the drum 18 in a clockwise direction ( as viewed from the end cap 44 in the direction indicated by arrow 141 in fig2 ). as drum 18 rotates in the forward or counterclockwise direction , a user utilizing steering wheel 128 can manipulate the toy car 21 , which is positioned immediately above the outer surface of drum 18 , to the right or left of the obstacles 96 formed on drum 18 as viewed in fig5 . upstanding lips 30 and 60 , in addition to limiting the horizontal or lateral movement of the drum 18 , also serve to limit the horizontal or lateral movement of the toy car 21 . steering rack 120 is biased in a forward position in engagement with pinion gear 122 as shown in fig8 by spring assembly 146 against inner guide walls 147 and 148 which extend downwardly from the top 159 of housing 100 . in the event the protruding pin 139 of model car 21 contacts an obstacle 96 as shown in fig7 steering rack 120 is pivoted rearwardly about inner guide wall 148 which extends upwardly from the base of housing 100 . inner guide wall 148 helps to ensure that steering rack 120 maintains its engagement with steering pinion gear 122 while steering rack 120 pivots . simultaneously therewith , steering rack 120 is pushed rearwardly against reed switch 150 which causes switch 150 , which is normally biased in an &# 34 ; on &# 34 ; position or closed position , to break the electrical circuit to motor 102 thereby immediately and automatically discontinuing the forward or counterclockwise rotation of drum 18 . switch 150 is held in position adjacent rack 120 by spring 146 and rod 149 . when switch 150 is tripped however , it does not disrupt the electrical circuit as far as allowing the motor 102 to be powered in the reverse or clockwise direction , and thus the drum 18 may be rotated in the clockwise direction after switch 150 is tripped . more particularly , after the toy car 21 has contacted the obstacle 96 and the switch 150 has been tripped thereby disabling motor 102 , the user can manipulate lever 134 rearwardly to the second &# 34 ; on &# 34 ; position , and then depress the steering wheel 128 thereby completing the electrical circuit so as to cause the drum 18 to rotate in the clockwise direction . this spaces the toy car 21 from the obstacle 96 and allows the steering rack 120 to return to its unbiased forward position wherein the switch 150 is no longer tripped . a user may then rotate steering wheel 128 and reposition the toy car 21 so that when lever 134 is forwardly manipulated to the first &# 34 ; on &# 34 ; position and the steering wheel 128 is depressed and drum 18 rotates in the counterclockwise direction , the protruding pin 139 of the toy car 21 avoids and thus does not contact obstacle 96 . although lever 134 may be manipulated rearwardly to the second &# 34 ; on &# 34 ; position to cause the drum 18 to rotate in the clockwise direction after switch 150 is tripped , the rearward manipulation of lever 134 to the second &# 34 ; on &# 34 ; position and the depression of steering wheel 128 will cause the clockwise rotation of drum 18 even when switch 150 is not tripped . generally , the more skilled the user of toy 12 is , the less likely the pin 139 of the toy car 21 is to contact one of the obstacles 96 . if the user is sufficiently skilled , the user can avoid contacting the pin 139 of the toy car 21 with an obstacle for one or more rotations of the drum 18 . of course , the skill required to manipulate the position of toy car 21 is a function of the obstacle course or pathway 97 created by the obstacles 96 on drum 18 . since drum 18 is easily removed and installed upon the support unit 16 , toy 12 may be provided with multiple drums having obstacles 96 forming any one of a variety of pathways or roadways ranging from extremely simple pathways to very difficult pathways . preferably , as shown in fig1 rack 92 is offset between the lateral edges of drum 18 in order to ensure that drum 18 is properly placed upon support unit 16 . more particularly , if drum 18 is placed upon support unit 16 in the wrong direction , the rack 92 will not line up with pinion 108 and pinion 108 will thus not be capable of driving rack 92 and drum 18 , thereby notifying a user that the drum 18 is on backwards . referring now to fig9 there is shown an electrical schematic illustrating the circuit formed by motor 102 , battery 47 , and switches 129 , 130 , 132 , and 150 . this circuit allows the electrical motor 102 to selectively drive the drum 18 in a first ( forward or counterclockwise ) and a second ( reverse or clockwise ) direction , and it prevents the drum 18 from continuing to rotate in the first ( forward or clockwise ) direction when the pin 139 of the toy car 21 contacts an obstacle 96 , while at the same time allowing the direction of the drum 18 to be reversed thereby allowing a user to disengage the toy car 21 and pin 139 from the obstacle 96 , and then steer or maneuver around the obstacle 96 . preferably , as shown in fig3 a pin 139 comprises a pivot pin mounting 190 located within toy car 21 which allows the pin 139 to pivot approximately 90 degrees from its normal position wherein the pin 139 is perpendicular to the major axis of the toy car 21 as shown in fig3 . thus , when the drum 18 is rotated in a forward or counterclockwise direction while a user is attempting to disengage an obstacle 96 , the pin 139 will not obstruct the forward or counterclockwise rotation of the drum 18 in the event the pin 139 contacts an obstacle 96 during such counterclockwise rotation . although a user when competing with other persons using toy 12 may count the laps or number of revolutions of drum 18 manually , and such users may also monitor the time involved in completing one or more laps using an extraneous device such as a stopwatch or wristwatch , it will be appreciated that toy 12 may be outfitted to include an electronic lap counter and an electronic time keeping device . such electrical devices may include digital displays mounted on housing 100 at the location generally indicated by numeral 160 in fig2 . such digital displays would serve to simulate the instrument panel of an automobile . preferably , all of the elements which comprise toy 21 , exclusive of the electrical components , are produced using a suitable thermoplastic . however , it will be appreciated that any one of a variety of materials may be utilized . it will also be appreciated that the present invention is not limited to a device for use upon a user &# 39 ; s forearm . more particularly , the present invention contemplates structural modifications to the toy which would allow the toy to stand freely upon a table or other horizontal surface , or allow a user to grasp the toy with the palm of a user &# 39 ; s hand . furthermore , it will be appreciated that the present invention contemplates the use of alternative electrical power sources and is not limited to the disclosed battery . for example , the present invention also contemplates the use of household current that has been properly rectified and stepped down in voltage to accommodate motor 102 . additionally , it will be appreciated that the present invention is not limited to a toy or device for simulating the driving skills of a user and that the principles of the present invention may be applied to various other types of devices , machines or applications . although the invention has been shown and described with respect to a certain preferred embodiment , it is obvious that equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification . the present invention includes all such equivalent alterations and modifications , and is limited only by the scope of the following claims .

US-46076690-A

a respiratory face mask is provided suitably sized and configured to engage the nose portion , mouth portion and chin portion of a patient &# 39 ; s face . the face mask is characterized by a cup - like shell or receptacle member defining a peripheral flange and a flexible inflatable hollow sealing cushion on the shell member flange . headstrap fastener projections extending upright on the flange are adapted to accommodate an elastic headstrap that adjustably may be removably slidingly coupled to the projections to hold the mask in place on a patient &# 39 ; s face and head .

with reference now to the drawings , and initially to fig1 - 9 thereof , there is shown a preferred embodiment of the new and improved respiratory face mask and headstrap assembly of the present invention generally comprising a face mask 10 and a headstrap 12 removably attachable to the face mask for helping to stabilize the mask on the face and head of person , preferably before , during and / or after surgery . the face mask is similar to that fully disclosed in my prior application ( ser . no . 11 / 809 , 435 ), which application has been incorporated herein by reference . the departures of the invention ( s ) of this application over that disclosed in my prior application will be readily apparent from the ensuing description . thus , face mask 10 comprises a shell or receptacle member 14 and a flexible pneumatic ( inflatable ) cushion sealing member 16 . the flexible inflatable cushion / sealing member 16 defines a generally donut - shaped hollow annular member on and along substantially the entire peripheral extent of the shell member and more specifically , preferably is suitably joined to the bottom surface of an annular flange 18 on the peripheral edge or rim of the shell member ( see fig2 - 5 ). the shell member preferably is of one - piece or unitary construction fabricated in a known manner ( e . g . injection molding ) from a synthetic polymeric resin such as polyvinyl chloride , for example , and is transparent so that when face mask 10 is worn on the face of a patient substantially as depicted in fig1 , the portion of the patient &# 39 ; s face covered by the mask is clearly visible at all times . as disclosed in my prior application , shell member 14 has a first cylindrical hollow inlet member or port 20 suitably sized to removably receive in snug sliding ( and sealing ) engagement therein the nipple of a conventional two - branch breathing circuit ( not shown ) and to define a passageway such that anesthesia gas or other gases are adapted to pass from a source ( not shown ) through the breathing circuit and the passageway into the interior of shell member 14 . the breathing circuit also is adapted to receive returned or exhaust 10 gas or gases through the same passageway and convey such exhausted gas or gases to a conventional gas evacuation or scavenging apparatus ( not shown ). shell member 14 also includes a second cylindrical hollow outlet member or port 22 . the outside diameter of outlet member 22 suitably is sized to be snugly ( and sealingly ) removably fitted to one end of a flexible tube ( not shown ) the other or distal end of which is adapted suitably to be connected to a conventional co2 monitoring device or capnograph for sensing end - tidal co2 of a breathing patient . as further disclosed in my prior application , the unique configuration of the face mask 10 enables the mask readily to be attached to the head of the patient using a relatively simple elastic headband or strap member selectively attachable to the mask shell 14 preferably by way of a pair of protruding integral t - shaped lugs extending oppositely and radially from the flange of the shell member , respectively . in accordance with the present invention , the t - shaped radially - oriented protrusions shown in my prior application ( and to which the ends of a simple elastic headstrap removably may be attached ) are dispensed with and replaced by a pair of strap fastener members located directly on the upward - facing or top surface of the flange ( i . e the surface opposite to the surface on which the cushion 16 is affixed ). the strap fastener members preferably are in the form of substantially cylindrically - shaped riser posts 24 , 26 extending substantially perpendicular to the plane of the shell member flange ( see fig1 - 7 ) and integral therewith . more specifically , and as shown most clearly in fig6 and 7 , each riser post has a stem portion 28 extending along longitudinal central axis 46 which axis is substantially perpendicular to the upward facing surface of flange 18 and the flat top portion of cushion 16 . preferably , the remote or distal end of each stem portion terminates in an enlarged head portion 30 which is offset with respect to stem portion 28 laterally in a direction toward the sloping wall of shell member 14 ( fig5 ). thus , substantially as shown in fig5 , the enlarged head portion 30 of riser post 24 is offset to the left whereas the enlarged head portion 30 of riser post 26 is offset to the right . in accordance with the invention , the base portion of each stem portion 28 forms an “ elbow ” with the surrounding surface on flange 18 and the “ crook ” of that elbow functions to capture and secure the headstrap thereagainst after the enlarged head portion 30 together with stem portion 28 are received through and in a selected opening 44 in headstrap 12 ( fig2 ). thus , broadly speaking , the riser posts 24 , 26 define extremely compact and effective fastening “ hooks ,” respectively , each of which is adapted to anchor or ensnare the corresponding arm extension end portion of the headstrap 12 by being removably slidingly received in a selected opening 44 in each headstrap end portion as will be explained further below . preferably , riser posts 24 , 26 can be formed integrally with flange 18 when shell member 14 is conventionally molded as will be appreciated by those of ordinary skill in the art . an important feature of the present invention is the location of the riser posts 24 , 26 on flange 18 of shell member 14 . with special reference to fig3 , it will be observed that riser posts 24 , 26 are substantially diametrically oppositely located on the flange 18 on an imaginary transverse axis 52 ( horizontal as viewed in fig5 ) which axis is substantially perpendicular to the axis of symmetry 48 of face mask 10 . the riser posts 24 , 26 also are located on flange 18 relative to an imaginary axis 50 passing transversely though the centerpoint of breathing circuit portal 20 which axis 50 also is substantially perpendicular to axis 48 . more specifically , headstrap fastener member location axis 52 is positioned , in accordance with the invention , a distance “ d ” from the imaginary transverse axis 50 . in using face mask 10 , it is desired that any displacement of the face mask toward the surface of the face of a patient , caused by tension in the headstrap , will result in substantially even compression of the flexible cushion on opposite sides of the axis 52 . such even cushion compression is important to avoid undesirable “ tilting ” of the cushion about axis 52 , which in turn , might result in imperfect sealing efficacy or an uncomfortable fit . it will be appreciated that the foregoing requirement of obtaining substantially uniform or even sealing cushion compression is met in accordance with the present invention , by positioning location axis 52 proximal to or at the center of mass of mask 10 between the center of breathing circuit portal 20 and the center of co2 monitoring portal 22 . in the preferred embodiment of the present invention , that position is substantially indicated by the distance “ d ” in fig3 . without limiting the present invention , and merely for purposes of illustration , a face mask 10 according to the present invention suitable for use on an “ average adult ” may having the following approximate dimensions : height of shell member ( measured above flat table to top of port 126 )= 2 . 239 inches . distance of center of port 20 from top ( nose portion ) of mask shell measured along axis 48 = 2 . 5 inches . spacing “ d ” between center of port 20 ( axis 50 ) and axis 52 measured along axis 48 = 0 . 25 inches . maximum dimension of top surface of enlarged head portion 30 of riser posts 24 , 26 = 0 . 164 inches . although the simple elastic strap disclosed in my prior application may be used to fit the mask 10 on the face of a patient and maintain the mask comfortably stable in its operative position , it has been found to be advantageous to use the improved strap of the present invention shown in fig1 , 2 and 8 - 10 . thus , in accordance with the invention , a new and improved headstrap 12 is provided comprising an annular shaped pressure - distributing central portion and a pair of arm portions extending laterally and oppositely from the central portion . the pressure - distributing central portion is generally oval - shaped and as viewed in fig8 comprises opposed first and second end portions 36 , 38 and opposed first and second top and bottom portions 40 , 42 joined to end portions 36 , 38 substantially as depicted . the center ( unlabeled ) of the oval - shaped headstrap central portion preferably is open permitting first and second portions 40 , 42 to be moved closer or further up or down relative to each other . laterally extending from end portions 36 , 38 , respectively , are a pair of first and second arm extensions 32 , 34 each terminating distally , remotely and oppositely from the headstrap oval - shaped central portion . a series of evenly spaced openings 44 are centrally disposed substantially as shown ( fig8 ) along substantially the entire longitudinal extent of first and second arm extensions 32 , 34 , respectively . openings 44 are sized sufficiently to easily and slidingly receive therethrough the enlarged head portion 30 of each riser post 24 , 26 . inasmuch as headstrap 12 preferably is fabricated from a suitable “ elastic ” or stretchable material ( i . e material with elastic memory ), openings 44 may be sized slightly smaller than the maximum transverse dimension of enlarged head portion 30 on riser posts 24 , 26 . the strap material then will stretch and cause the somewhat smaller openings to open sufficiently in order to easily enable each headstrap arm extension end portion to slide over a corresponding enlarged head portions 30 and then slide down the stem portion 28 to the base thereof when fitted in the manner described below in more detail in use , headstrap 12 is placed under the head of a patient with the central oval - shaped portion engaging the back of the head or skull and with the first and second arm extensions 32 , 34 extending laterally ( fig8 ). the face mask 10 then is fitted to the patients &# 39 ; s face in the correct position as disclosed in my prior application . next , the first arm extension 32 is connected to riser post 26 by positioning the distal end of the strap over the riser post and pressing the strap arm extension end portion down until the riser post enlarged end 30 passes through the opening 44 and the arm extension end portion slides down stem portion 28 , until ultimately bottoming on the flange 18 substantially as shown in fig2 . the other or second arm extension 34 is pulled sufficiently taught and attached to second riser post 24 on the opposite side of mask 10 in the same manner . when so properly attached , the elastic portions 40 , 42 will be stretched somewhat across the rear of the patient &# 39 ; s head or skull and will be displaced above and below each other substantially as shown schematically in fig9 . such displacement may be adjusted easily merely by repositioning portions 40 , 42 after the headstrap has been attached to mask 10 by engaging the headstrap arm extension ends onto riser posts 24 , 26 as described above . it will be appreciated that because the first and second portions 40 , 42 engage respectively different portions or areas on the rear of the patient &# 39 ; s head or skull , these portions 40 , 42 , particularly when in a stretched or taught condition , will distribute the tensioning pressure of the headstrap over a relatively wide area on the back of the patient &# 39 ; s head and thereby will tend to comfortably hold mask 10 in place without either the mask or the headstrap slipping or otherwise being displaced even during relatively long durations of face mask use . when the mask and headstrap assembly is fitted in operative position as aforesaid , it will be appreciated that the tension pulling force in the stretched portions of the headstrap indicated by arrow 47 in fig2 will cause the strap arm extension end portions to firmly and securely apply an axial fastening force opposite to the axial extent of each riser post 24 , 26 along axis 46 . this oppositely directed tension , pulling or fastening force automatically will maintain the headstrap arm extension end portions securely bottomed at the juncture where the base or bottom portion of each riser post stem portion meets the flange 18 ( i . e . in the “ crook ” of the “ elbow ”) and thus , in accordance with the invention , provides an extremely effective , efficient and easy - to - use headstrap fastening mechanism suitable for maintaining the mask 10 in a stable and comfortable position on the patient &# 39 ; s face for relatively long periods and without requiring excessive strap tension pressure or bulky , cumbersome strap arrangements . it will be particularly noted that because the headstrap extension arm end portions are removably attached to the fastener members on the flange of the face mask shell member in accordance with the invention , the headstrap arm extensions or end portions do not obscure the face mask shell member and the patient &# 39 ; s face remains clearly visible during use . headstrap 12 advantageously may be manufactured efficiently by die - cutting the strap configurations from a web of material . this process is schematically depicted in fig1 which shows a punching or cutting die 56 having a die tool 58 formed in the shape of a pair of staggered headstraps . fig1 shows the die tool and the web after a pair of headstraps has been cut . by the foregoing staggering arrangement , a maximum number of headstraps may be cut from the web of material while minimizing material waste . any suitable medically acceptable ( non - latex ) elastic or stretchable material may be employed to fabricate the headstraps 12 . a particularly preferred material for use with the present invention is a pliable , durable , synthetic rubber material commercially made available from hygenic corporation , akron ohio , which material prior to this invention was widely used to make tourniquets . and although the headstrap 12 has been shown as being fabricated of a unitary piece of material , it will be appreciated that the headstrap may be made by taking separate pieces of material or dissimilar material and joining them together as by sewing , gluing , or heat - fusing for example . without limiting the present invention , and merely for purposes of illustration , a headstrap 12 according to the present invention suitable for use with the “ average adult ” face mask described above , may having the following approximate dimensions : length of central pressure distribution portion measured between end portions 36 , 38 = 8 inches . as to any further manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention as defined in the annexed claims .

US-22137908-A

because reprocessing or refurbishing of physiological sensors reuses large portions of an existing sensor , the material costs for refurbishing sensors is significantly lower than the material costs for making an entirely new sensor . typically , existing reprocessors replace only the adhesive portion of an adhesive physiological sensor and reuse the sensing components . however , re - using the sensing components can reduce the reliability of the refurbished sensor and / or reduce the number of sensors eligible for refurbishing due to out - of - specification sensor components . it is therefore desirable to provide a process for refurbishing physiological sensors that replaces the sensing components of the sensor . while sensing components are replaced , generally , sensor cable and / or patient monitor attachments are retained , resulting in cost savings over producing new sensors .

reprocessing includes operations performed to render a used reusable or single - use device patient - ready or to allow an unused product that has been opened to be patient - ready . reprocessing can be done in - house or by a third - party reprocessor . whether reprocessesing is done in - house or through a third party , reprocessing generally involves cleaning , sterilization , function testing and / or replacement of components . in this context , cleaning can mean removal of visible contaminants and environmental debris ( including microscopic particles of tissue , body waste , body fluids , dirt , and / or dust ). function testing verifies that a device will perform as intended . sterilization in the context of reprocessing can mean meeting domestic and / or international sterilization standards , such as meeting a sterility assurance level of 10 - 6 ( i . e . a theoretical one in a million chance that an organism could survive ). fig1 a illustrates a top view of an example non - invasive physiological sensor 100 which can be used with a sensor refurbishing process according to embodiments of the disclosure . in certain embodiments , the sensor 100 may allow for the measurement of blood constituents and related parameters , including oxygen saturation , hbco , hbmet and / or pulse rate . the sensor 100 may advantageously be a non - invasive optical sensor capable of emitting light and outputting one or more signals indicative of attenuation of that light by body tissue . for example , the sensor 100 may be a pulse oximeter sensor including , for example , a red emitter , an infrared emitter , and a photodiode detector . the sensor 100 may be attached to a patient &# 39 ; s finger , earlobe , or foot . for a finger , the sensor can be configured so that the emitters project light from one side of the finger , through the outer tissue of the finger , and into the blood vessels and capillaries contained inside . the photodiode can be positioned at the opposite side of the finger to detect the emitted light as it emerges from the outer tissues of the finger . the photodiode can generate a signal based on the emitted light and relay that signal to the sensor 100 . the sensor 100 can determine blood oxygen saturation by , for example , computing the differential absorption by the arterial blood of the two or more wavelengths emitted by the sensor . in certain embodiments , the sensor 100 can be adapted to attach to a tissue site . the sensor 100 can include a sensor assembly 105 , a patient monitor connector 110 , a sensor cable 115 operatively connecting the sensor assembly 105 and a monitor connector 110 . the monitor connector 110 can be adapted to connect to a patient monitor which may include a display providing readouts of measured parameters , such as oxygen saturation , pulse rate , hbco and / or hbmet to name a few . the sensor assembly 105 can comprise one or more emitters 120 and a detector 125 . in certain embodiments , the sensor 100 utilizes an adhesive attachment mechanism 130 , such as an adhesive layer , for attaching the sensor 100 to a tissue site . in some embodiments , the sensor can be disposable , re - usable , or partially re - usable and partially disposable . after the sensor 100 is used on a patient , the used sensor can be refurbished through a refurbishing process . typically , refurbishing or reprocessing of medical sensors can include disassembling sensors into sub - components , testing sensor components , replacing sensor components , reassembly of the components , testing of the sensor and / or sterilization of the sensor . in some embodiments of the reprocessing process , the entire sensor assembly 105 can be replaced , reusing only the cable 115 and monitor connector 110 . in certain embodiments , the cable 115 and / or monitor connector 110 can also be replaced . in some embodiments , only portions of the sensor assembly 105 , such as the sensing components , 120 , 125 are replaced . in some embodiments , the whole sensor assembly 105 is replaced . replacing the whole sensor assembly 105 can reduce or eliminate the need to disassemble the sensor and / or test components during the refurbishing process . for example , the replacement sensor can be pre - tested and / or calibrated beforehand , such as during production , so that testing the sensor components is not required . during reprocessing , the old sensor assembly 105 can be detached from the cable 115 , for example , by cutting along a section of the cable 140 . the cable 115 can be cut along any section , but preferably is cut near the sensor assembly 105 so that a larger portion of the cable 115 can be reused . after the old sensor assembly 105 is removed , a new sensor assembly is attached to the old cable and tested to determine whether the sensor 100 operates correctly . in some embodiments , the new sensor assembly includes a cable portion , typically of short length , for attachment to a reprocessed cable . in some embodiments , the cable portion can terminate in a connector for simplified attachment to the reprocessed cable . fig1 b and 1c illustrate the attachment of a new sensor assembly to a reused sensor cable 115 of fig1 a . the sensor cable 115 having a number of wires 145 is attached to a new sensor assembly having a number of wires 155 . in one embodiment , the sensor assembly 150 includes a cable portion extending from the sensor assembly containing the sensor assembly wires 155 . in one embodiment , at least part of the cable covering the wires 145 , 155 is removed to expose the wires 145 , 155 for easier access . in fig1 c , the wires 145 , 155 are attached to operatively connect the sensor cable 115 and the sensor assembly 150 . the connection can be both mechanical and electrical . attachment of the wires 145 , 155 can be through soldering , pressure , tying , adhesive and / or the like . a cable covering 160 can be applied over the connection area to cover exposed wires and / or strengthen the mechanical connection between the cable 115 and the sensor assembly 150 . although disclosed with reference to the above sensor 100 , an artisan will recognize from the disclosure herein a wide variety of oximeter sensors , optical sensors , noninvasive sensors , medical sensors , disposable sensors , reusable sensors or the like that may benefit from embodiments of the refurbishing process disclosed herein . fig2 illustrates a perspective view of a sensor embodiment 200 having a detachable sensor assembly 205 usable in a refurbishing process . the sensor 200 includes the sensor assembly 205 and a cable assembly 207 . the sensor assembly 205 includes a sensor , a cable 215 and a connector 220 . the cable assembly includes a connector 245 , a cable 250 and a monitor connector 255 . the sensor connector 220 is attachable to the cable connector 245 . the connectors 220 , 245 form a releasable mechanical and electrical connection between the sensor assembly and the cable assembly . the connectors 220 , 245 can include pins 230 and corresponding pin connectors for forming an electrical connection between the sensor portion 205 and cable portion 207 . connector assemblies are disclosed in u . s . application ser . no . 12 / 248 , 856 assigned to masimo corp . and is incorporated by reference herein . during reprocessing , the connectors 220 , 245 facilitate replacement of either the sensor assembly 205 or the cable assembly 207 of the sensor 200 . for example , the sensor portion 205 can be replaced whole by detaching the old sensor assembly 205 from the cable assembly 207 via the sensor connector 220 and replacing with a new sensor assembly by attaching the new sensor connector to the old cable connector 245 . the use of a connector also allows replacement of the sensor assembly 205 on - site , for example at a hospital . the sensor assembly 205 can then be sent for refurbishing without also sending the cable assembly , thus reducing shipping costs . fig3 a illustrates an exploded perspective view of a disposable sensor assembly 300 . the sensor assembly includes one or more tape layers 305 , 315 and a sensor portion 310 . the sensor portion 310 includes a base material 318 , one or more sensing components 320 , 325 such as emitters and / or detectors , and an electrical connector 330 . the sensor portion can further include a sensor cover 345 for one or more of the sensing components . sensor components can be replaced individually or together as part of the sensor portion 310 . in one embodiment , the base material 318 , preferably a flexible material , comprises a flex circuit . the flex circuit can comprise a copper / mylar ™ or copper / capton ™ laminant , or similar material . alternatively , the flex circuit can be formed by depositing a conductive ink on mylar ™, polyester , or plastic film . the flex circuit allows electrical communication between the sensing components 320 , 325 and electrical connector 330 through the conductive material on the flex circuit . the sensing components 320 , 325 can be attached to the base material 318 through pressure sensitive adhesive ( psa ), solder , clip holder , pressure fit or the like . in one embodiment , the emitter and detector are placed such that the transmission and detection field of view are through detector and emitter windows formed on the base material . in one embodiment , the sensing components 320 , 325 are attached to the flex - circuit using pressure or thermally sensitive adhesive configured to provide a temporary bond , advantageously allowing the sensing components 320 , 325 to be detached from the sensor portion 310 by pulling the sensing components from the base material 318 . as will be apparent , other attachment methods can be used that facilitate removal of sensor components in order to simplify the refurbishing process , such as nodular metal paste , mechanical attachments , or the like . in another embodiment , the sensing components are attached to the flex - circuit using low temperature solder paste . the sensing components can be desoldered from the flex circuit . the solder can be reheated and reused or new solder can be dispensed on contacts for the detector connections and / or emitter connections in order to attach new sensing components . the solder operation is preferably performed through a direct heat reflow of the low temperature solder . the sensor portion 310 can further comprise a flex circuit shield including an insulator film , conductive and / or non - conductive psa . when attached to a flex circuit , a flex circuit shield can insulate the signal traces of the flex circuit from the metallization of the flex circuit shield to prevent short circuits . the sensor portion 310 can be attached to a base layer 305 . in one embodiment , the base layer comprises avery base material . each side of the base layer can be coated with psa adhesive . a face stock 315 can be attached to the base layer 305 such that the sensor portion 310 is secured between the face stock and the base material . in one embodiment , the face stock 315 is advantageously constructed from a non - woven , flexible material , though woven materials can be used . adhesive can be applied on one side of the face stock . pressure applied to the face stock 315 bonds the face stock with the base material 305 and / or sensor portion 310 . preferably , the face stock has an aperture 340 to allow a portion of the cover 345 to protrude through the face stock . a release liner can be placed on the other side of the base material from the face stock in order to protect adhesive on that side . the release liner can be removed when the sensor is attached to a patient . during reprocessing , the sensor assembly 300 can be disassembled into its constituent parts . for example , the face stock 315 can be detached from the base material 305 to expose the sensor portion 310 . the sensing components 320 , 325 on the sensor portion can be replaced individually or together as part of the sensor portion 310 . in one embodiment , the sensing components 320 , 325 are replaced individually with at least some of the sensor portion 310 retained . after replacing the sensing components , the sensor can be reassembled . the base layer 305 , face stock 315 , and / or cover 345 can be replaced or reused . new adhesive can be applied to the sensor assembly 300 and a release liner attached . once reassembled , the sensor assembly 300 can be sterilized and then packaged for use . fig3 b illustrates the disposable sensor of fig3 a attached to a tissue site and a cable assembly . the cable assembly 350 comprises a cable and a connector attachable to the sensor assembly 300 via its sensor connector 330 . the cable assembly 350 operatively connects the sensor assembly 300 to a patient monitor . the cable portion 350 can also be reprocessed with the sensor assembly 300 and replaced if defective . however , as the cable portion generally receives less wear than the sensor assembly 300 , the cable portion can likely be reused without replacement of components , reducing the cost of reprocessing the sensor . fig4 illustrates a perspective view of a neonate sensor assembly 400 with a detachable sensor portion 405 usable in a refurbishing process . the sensor includes the sensor portion 405 , an elongated body 410 , and a connector portion 412 . the sensor portion 405 incorporates one or more emitters 420 , a detector assembly 425 , and a sensor portion pinout 435 . the sensor portion pinout 430 is configured to connect with a body pinout 430 so as to mechanically and electrically connect the sensor to the body 410 . connection can be accomplished by solder , adhesive , mechanically such as by tab , sleeve or clip , or by other connection mechanism . the body 410 includes signal traces between the sensor portion pinout 435 and the connector portion 412 . the connector portion 412 has a plug portion configured to insert into a mating patient cable connector so as to mechanically and electrically connect the sensor 400 to a patient cable , for example . the connector portion 412 is configured with a connector tab 415 supporting sensor pinouts 440 . as the sensor portion 405 is detachable from the elongate body 410 , reprocessing of the sensor is simplified . for example , the sensor portion 405 can be detached from the elongate body and replaced with a new sensor portion 405 . by incorporating sensing elements , such as the emitters 420 and the detector 410 on the detachable modular portion , the sensing elements can be easily replaced as a whole rather than individually , thus reducing refurbishing costs and refurbishing time . in one embodiment , the sensing elements can be pre - tested in order to eliminate or reduce the need for testing the sensor elements . fig5 a , 5 b and 6 illustrate flow charts for embodiments of a refurbishing process replacing sensor components . the refurbishing process can be used for the sensors described in fig1 a - 4 and fig7 - 9b , as well as other types of sensors . in some embodiments , the refurbishing process may be performed by a computing system comprising one or more computing devices , the one or more computing devices configured to perform one or more of the logical blocks described below . the logical blocks of the refurbishing process can be embodied as software , hardware , or a combination of software and hardware of the computing system . for example , the refurbishing process may be embodied in software stored on non - transitory , physical computer storage such as a hard drive , optical disk or flash memory . in some embodiments , the computing system may be part of a refurbishing system comprising one or more machines configured to dissemble sensors , replace sensor components , test sensors and / or sterilize sensors . in one embodiment , the computing system directs or monitors the operation of the refurbishing machines . in one embodiment , the machines operate automatically . in some embodiments , one or more logical blocks may be performed by or directed by a person . for example , the entire refurbishing process may be performed by or directed by one or more persons . in fig5 a the process 500 begins at block 505 with disassembling the sensor , in whole or in part , into subcomponents or individual components . sensors can be disassembled through desoldering , removing adhesive , detaching connectors , or the like . at bock 510 , the sensor components can optionally be tested . for example , sensor components can be tested to determine if performance is within specification . sensor components within specification can be reused . testing of components can be skipped to reduce cost and / or speed up the refurbishing process . in one embodiment , testing can be conducted before disassembly to determine if the sensor as a whole is within specification . generally , sensors need to meet specified sensor performance criteria determined by the manufacturer or purchaser . by testing before disassembly , out - of - specification sensing components can be detected beforehand and the sensing portion can be replaced as a whole without disassembly . in contrast , by testing after disassembly , a specific out - of - spec component can be identified , allowing reuse of the other parts of the sensing portion that are still in - spec . the timing of the testing can be chosen based on the costs of disassembly versus the savings from reusing still in - specification components . after block 510 , the refurbishing process proceeds to block 515 . at block 515 , sensor components are replaced . in one embodiment , sensor components are replaced if determined to be out - of - spec . in another embodiment , no testing is performed and pre - determined sensor components are replaced . for example , as part of the refurbishing process , all or some of the sensing components can be replaced without testing . advantageously , predetermined replacement of components can eliminate or reduce the need for testing or disassembly . after block 515 , the refurbishing process proceeds to block 520 . at block 520 , the sensor is reassembled . reassembly can comprise soldering , adhesively connecting , and / or mechanically connecting various components together . typically , the assembled sensor comprises both new components and at least some of the original components . after block 520 , the refurbishing process proceeds to block 525 . at block 525 , the assembled sensor is optionally tested to determine if the sensor works and is within specification for the particular sensor type . testing can include testing of the assembly of the sensor components , testing of the electrical connection between sensor components , testing of sensor performance , and / or the like . if the test fails , the sensor can reenter the refurbishing process at block 505 or can be disposed of . if the sensor passes the test , the refurbishing process proceeds to block 530 . in some embodiments , testing may be unnecessary during reprocessing , such as when the sensor components are pre - tested before assembling the sensor . at block 530 , the sensor is sterilized . sterilization can occur before or after the sensor is packaged for use . the sensor can also be cleaned before sterilization . after sterilization , the sensor can be packaged for use , ending the refurbishing process . fig5 b generally illustrates the same process as fig5 a , except that optional block 510 , testing of the sensor components , occurs before block 505 , disassembling the sensor . testing of the components can be individually , by group , or of the whole sensor . by testing the sensor components before dissembling the sensor , components that need to be replaced can be identified before disassembly , potentially reducing the number of components to be detached . fig6 illustrates another embodiment of a refurbishing process 600 for a sensor comprising replaceable modular assemblies . the refurbishing process can be used for the sensors described in fig1 a - 4 and fig7 - 9b , as well as other types of sensors . in one embodiment , the sensor is composed of modules , such as a sensor assembly and a cable assembly . in some embodiments , a sensor assembly comprises a modular sensor portion . the sensor portion can further comprise adhesive portions , a sensor body , and / or electrical or mechanical connectors . during reprocessing , the modular assembly is replaced . by replacing the modular assembly as a whole , the need for testing sensor components can be reduced or eliminated , thus reducing costs . for example , in fig1 a , the sensor assembly 100 can be replaced as whole . likewise with the sensor assembly 205 of fig2 , the sensor portion 310 of fig3 , and the sensor portion 405 of fig4 . furthermore , modular assemblies can be pre - tested during their production , simplifying the refurbishing process . at block 605 , the refurbishing process begins by detaching the modular assembly from the sensor . in some embodiments , a sensor portion 405 ( in fig4 ) is detached from a sensor assembly 400 . in some embodiments , a sensor assembly 105 ( in fig1 ) is detached from a cable assembly 140 , for example , by cutting the sensor assembly from the cable . in some embodiments , detaching of the modular assembly can be simplified by using a connector 220 ( in fig2 ), 405 ( in fig4 ). after block 605 , the refurbishing process proceeds to block 610 . at block 610 , the modular assembly is attached to the sensor . the attached modular assembly can be a sensor portion attached to a sensor assembly or a sensor assembly attached to a cable assembly . typically , the assembled sensor comprises both new components and at least some of the original components . generally , the cable assembly receives less wear and tear during use and is likely to perform within specification without replacement . however , in some situations , the cable assembly can be replaced in addition or instead of the sensor portion or assembly . reattachment can be accomplished through use of a connector , splicing of wires , adhesive connection , soldering , or the like . as replacement is accomplished by replacing groups of components , such as a sensor assembly , cable assembly , and / or a sensor portion , reassembly of the sensor is simplified in comparison to replacement of individual components . if component costs are cheap relative to assembly and disassembly cost , the simplified reassembly can reduce the costs of refurbishing . after block 610 , the refurbishing process proceeds to block 620 . at block 620 , the assembled sensor is optionally tested to determine if the sensor works and is within specification for the particular sensor type . testing can include testing of the assembly of the sensor components , testing of the electrical connection between sensor components , testing of sensor performance , and / or the like . if the test fails , the sensor can reenter the refurbishing process at block 605 or can be disposed of . if the sensor passes the test , the refurbishing process proceeds to block 625 . in some embodiments , testing during reprocessing may be unnecessary , such as when the sensor portion is pre - tested before assembling the sensor . at block 625 , the sensor is sterilized . sterilization can occur before or after the sensor is packaged for use . the sensor can also be cleaned before sterilization . once packaged , the sensor can be delivered to an end - user . fig7 illustrates a perspective view of one embodiment of reusable sensor 700 usable in a refurbishing process according to embodiments of the disclosure . the reusable sensor can be a clip - type sensor including an upper housing 722 , a lower housing 724 and a hinge element 726 . the upper and lower housings 722 , 724 house electrical and / or optical components ( not shown ) of the non - invasive physiological sensor 720 . for example , the upper and lower housings 722 , 724 can house sensing elements 730 , 732 , such as one or more light emitters or leds and a detector or light sensor . the sensor 720 can be connected to a patient monitor via a cable 728 . for example , the detector outputs a signal to the monitor over the cable 728 which then processes the signal to provide a numerical readout of physiological parameters such as oxygen saturation ( spo2 ) and pulse rate . during refurbishing , one or both the sensing elements 730 , 732 can be removed and / or replaced from the reusable sensor 700 . the sensor elements can be tested separately or as part of the reusable sensor . other components of the reusable sensor can also be replaced during the refurbishing process , fig8 a illustrates an exploded perspective view of an embodiment of a disposable sensor 800 usable in a refurbishing process according to embodiments of the disclosure . the sensor includes one or more tape layers 805 , 810 , a cable assembly 815 , and a sensor portion 818 . the cable assembly 815 can terminate at an electric connector 816 and can be attached to one of the tape layers 805 . the sensor portion 818 includes a base material 819 , one or more sensing components 820 , 825 such as emitters and / or detectors , and an electrical connector 830 . sensor components can be replaced individually or together as part of the sensor portion 818 . the sensor portion &# 39 ; s electrical connector 830 can attach to the cable assembly &# 39 ; s electrical connector 816 to form an electrical connection between the sensor portion and the cable . the sensor portion 818 can be attached to the cable assembly 815 and / or one or more tape layers 805 , 810 by various ways , such as adhesive , solder , clip holder , pressure fit and / or the like . in one embodiment , the sensor assembly 815 and sensor portion 818 are sandwiched between a first layer 805 and a second 810 tape layer . as the sensor portion 818 is detachable from the cable assembly 815 and / or tape layers 805 , 810 , reprocessing of the sensor is simplified . for example , the sensor portion 818 can be detached from the elongate body and replaced with a new sensor portion . by incorporating sensing components 820 , 825 , such as emitters and / or detectors on the detachable modular portion , the sensing components can be easily replaced as a whole rather than individually , thus reducing refurbishing costs and refurbishing time . in one embodiment , the sensing components can be pre - tested in order to eliminate or reduce the need for testing the sensing components during the refurbishing process . fig8 b illustrates a perspective view of the bottom side of the sensor portion 818 of fig8 a . the electrical connector 830 is shown on the bottom side of the sensor portion . however , the electrical connector can also be placed on the top side . fig9 a and 9b illustrate embodiments of mechanical sensor component holders . fig9 a illustrates a cross - sectional view of a sensor component attached to a sensor via a clip holder . the sensor component 905 is held in place by one or more clip arms 910 extending over the sensor component . the sensor component 905 can be detached for replacement by pushing the clip arms 910 outward and removing the sensor component 905 . fig9 b illustrates a cross - sectional view of a sensor component attached to a sensor via a pressure or snug fit holder . the sides of the holder 915 are biased inwards , holding the sensor component together via pressure . the sensor component 905 can be detached for replacement by pushing the sides of the holder 915 outward and removing the sensor component 905 . the reusable nature of the mechanical holders allows replacement of the sensor component without requiring new attachment mechanisms , such as replacement adhesive or solder , thus reducing refurbishing costs and / or complexity . as will be apparent , other types of mechanical holders can be used and mechanical holders can be used with both disposable and reusable sensors . depending on the embodiment , certain acts , events , or functions of any of the algorithms described herein can be performed in a different sequence , can be added , merged , or left out all together ( e . g ., not all described acts or events are necessary for the practice of the algorithms ). moreover , in certain embodiments , acts or events can be performed concurrently , e . g ., through multi - threaded processing , interrupt processing , or multiple processors or processor cores or on other parallel architectures , rather than sequentially . the various illustrative logical blocks , modules , and algorithm steps described in connection with the embodiments disclosed herein can be implemented as electronic hardware , computer software , or combinations of both . to clearly illustrate this interchangeability of hardware and software , various illustrative components , blocks , modules , and steps have been described above generally in terms of their functionality . whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system . the described functionality can be implemented in varying ways for each particular application , but such implementation decisions should not be interpreted as causing a departure from the scope of the disclosure . the various illustrative logical blocks and modules described in connection with the embodiments disclosed herein can be implemented or performed by a machine , such as a general purpose processor , a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ) or other programmable logic device , discrete gate or transistor logic , discrete hardware components , or any combination thereof designed to perform the functions described herein . a general purpose processor can be a microprocessor , but in the alternative , the processor can be a controller , microcontroller , or state machine , combinations of the same , or the like . a processor can also be implemented as a combination of computing devices , e . g ., a combination of a dsp and a microprocessor , a plurality of microprocessors , one or more microprocessors in conjunction with a dsp core , or any other such configuration . the steps of a method , process , or algorithm described in connection with the embodiments disclosed herein can be embodied directly in hardware , in a software module executed by a processor , or in a combination of the two . a software module can reside in ram memory , flash memory , rom memory , eprom memory , eeprom memory , registers , hard disk , a removable disk , a cd - rom , or any other form of computer - readable storage medium known in the art . an exemplary storage medium can be coupled to the processor such that the processor can read information from , and write information to , the storage medium . in the alternative , the storage medium can be integral to the processor . the processor and the storage medium can reside in an asic . the asic can reside in a user terminal . in the alternative , the processor and the storage medium can reside as discrete components in a user terminal . data may be stored in various types of data stores , such as tables , files , databases , directories or the like . conditional language used herein , such as , among others , “ can ,” “ could ,” “ might ,” “ may ,” “ e . g .,” and the like , unless specifically stated otherwise , or otherwise understood within the context as used , is generally intended to convey that certain embodiments include , while other embodiments do not include , certain features , elements and / or states . thus , such conditional language is not generally intended to imply that features , elements and / or states are in any way required for one or more embodiments or that one or more embodiments necessarily include logic for deciding , with or without author input or prompting , whether these features , elements and / or states are included or are to be performed in any particular embodiment . also , the term “ or ” is used in its inclusive sense ( and not in its exclusive sense ) so that when used , for example , to connect a list of elements , the term “ or ” means one , some , or all of the elements in the list . various reprocessing and refurbishing processes have been disclosed in detail in connection with various embodiments . these embodiments are disclosed by way of examples only and are not to limit the scope of the claims that follow . indeed , the novel methods and systems described herein can be embodied in a variety of other forms ; furthermore , various omissions , substitutions and changes in the form of the methods and systems described herein can be made without departing from the spirit of the inventions disclosed herein . the claims and their equivalents are intended to cover such forms or modifications as would fall within the scope and spirit of certain of the inventions disclosed herein . one of ordinary skill in the art will appreciate the many variations , modifications and combinations . for example , the various embodiments of the reprocessing and refurbishing process can be used with sensors that can measure any type of physiological parameter and with both disposable and reusable sensors .

US-201113041803-A

an apparatus for automatically dumping a hatchery tray is disclosed . the apparatus comprises : a lifting platform suitably fitted with a tray sensing limit switch to control a double acting air cylinder which lifts the hatchery tray on the platform up and through a 100 ° arc past vertical onto the open top of a hopper which receives the waste from the tray . initial spring loaded starting and stopping devices are included as well as kick - off - arms to remove the hatchery tray from the hopper after dumping .

the instant invention was developed for a hatchery in which the daily capacity was 125 , 000 eggs , yielding about 55 , 000 pullets . the waste consisted of eggshells , unhatched eggs , dead embryos , and about 55 , 000 cockerels . about 12 , 000 pound of waste per day or 1 , 700 pounds per hour was generated . under manual conditions , four men were required to dump and collect in 55 gallon barrels all of the waste and eventually empty it into an open - bed dump truck for transport to a rendering plant . all empty chick trays were manually fed into the tray washer . in general , a waste handling system for a layer chick operation is as shown in fig6 . trays ( not shown ) containing approximately twelve dozen eggs are moved on a roller conveyor past a sexing station where operators remove the pullets from the cockerels and each is sent on separate conveyors for further processing . the waste in the trays is sent to the dumping platform which lifts the tray and inverts it onto a shell hopper which receives and gathers the waste . once the tray is inverted onto the top of the shell hopper , the kickoff arms remove the tray onto another conveyor which transports it to a tray washer where it is cleaned and returned to reuse . simultaneously , the dumper platform returns to the roller conveyor and receives another tray from the sexing station for dumping . the waste is conveyed pneumatically to a receiver which ultimately empties into a dump truck which carries the waste to a rendering plant . turning now to the specific embodiment of the invention of the automatic hatchery tray dumper wherein 1 ( of fig1 and 2 ) represents a hopper which is to receive waste when a hatchery tray is lifted and inverted onto the top thereof . the hatchery trays are moved directly from hatchery carts and placed on a roller conveyor ( fig6 ) that moves the trays past the sexers , who remove and segregate the chicks . as the trays progress forward the first tray strikes a ram limit switch 20 ( fig4 & amp ; 6 ) located on the end of the conveyor ( fig6 ). limit switch 20 actuates a double acting air - cylinder ram 39 ( fig6 ) which in turn pushes tray 34 ( fig1 ) sideways off the conveyor ( fig6 ) toward the dumper lifting platform 16 ( fig1 ). when the tray breaks contact with ram limit switch 20 ( fig4 ), the air - cylinder ram 39 ( fig6 ) retracts to accept another . thus subsequent trays progress forward until first tray 34 slides onto lift platform 16 , and makes contact with lift platform electronic limit switch 12 ( fig1 and 4 ), which is located in the top of the lift platform where contact with the tray can be easily made . the tray dumper is designed to operate in conjunction with hopper 1 and air lock valve 2 ( fig1 ). the dumper has a pneumatic cylinder 6 which carries a lifting platform 16 with a hatchery tray 34 seated thereon up and through a 100 ° arc , tilting tray 34 past vertical , and inverting it onto the open top of hopper 1 thereby dumping the contents into hopper 1 . pneumatic cylinder 6 is affixed to a solid base support member 33 on its lower end . on its upper end cylinder 6 is affixed to a hinge shaft 31 . thus , when limit switch 12 which is located at the edge of the underside of platform 16 is actuated , one set of normally open contacts close and thereby actuate lift platform solenoid air valve 11 which is located adjacent to the affixed support of cylinder 6 and communicates with cylinder 6 , thus causing lift platform double - acting air - cylinder 6 to extend , thus raising lift platform 16 which is initially in a horizontal position . simultaneously , one set of normally closed contacts ( nc ) 12 ( fig4 ) actuates an electronic time - delay relay 22 . as platform 16 beings the ascent , cam 35 actuates limit switch 15 ( fig2 & amp ; 4 ) which is located on the pusher - arm shaft 29 ( fig2 ) to open the circuit to ram solenoid 24 ( fig4 ) which will not allow the ram air - cylinder ( fig6 ) room to push another tray forward during the dumping operation . as platform 16 ascends , cam 35 rotates longitudinally counterclockwise on shaft 29 , to open or close limit switch 15 . at this point lift platform 16 must traverse an arc of 100 ° to lift tray 34 to a point just pass vertical in order to make the tray fall off platform 16 and onto the top of hopper 1 . to start platform 16 upward , a compression spring 9 ( fig1 and 2 ) communicates with air - cylinder 6 and is used to assist air cylinder 6 in starting the upward motion . compression spring 9 is connected between rigid mount 36 ( fig1 ) and lever support member 40 ( fig2 ). lever arm 37 is connected to support member 40 and is pivotally connected to arm 37a , which in turn is fixed to shaft 31 . the constant downward pull exerted by compression spring 9 on lever support member 40 and lever 37 results in a counter - clockwise rotational force on shaft 31 through arm 37a thereby exerting an outward force on air cylinder 6 and a lifting force on the tray support or platform 16 . therefore , when platform 16 ascends , thus compression spring 9 actuates to assist air cylinder 6 to lift . after lift platform 16 starts upward under maximum airflow , cam 32 actuates airswitch 14 ( fig2 & amp ; 5 ), on the shaft of kick - off arm 7 which bypasses air flow control valve 30 ( fig5 ), in the &# 34 ; extend &# 34 ; exhaust port of solenoid valve 11 . valve 11 has 4 ports , one of which is the extend exhaust port . after platform 16 moves through the first 70 ° of travel , air switch 14 ( fig2 & amp ; 5 ) reduces the air flow for the final 30 ° of travel , thus allowing the tray to fall softly onto the top of hopper 1 in an inverted position . after the tray falls onto the top of hopper 1 , the previously mentioned electronic time - delay relay 22 ( fig4 ) which electrically operates air valve 30 , continues to hold platform 16 in a vertical position for one and one - half seconds , allowing tray 34 to settle onto the top of hopper 1 . when tray 34 breaks contact with limit switch 12 ( fig1 ) which is located on platform 16 , and when time - delay relay 22 , ( fig4 ) times out and then de - energizes solenoid 11 ( fig1 ), double - acting air cylinder 6 is retracted , thus bringing platform 16 back to the original starting position . simultaneously , on the downward movement of platform 16 , spring loaded kick - off - arms 7 ( fig1 ) which communicate with shaft 31 of lifting platform 16 by means of bevel gears 10 ( fig2 ), pushes tray 34 off rails 5 beneath striker plate 4 on the top of hopper 1 and sends tray 34 to a washing cycle . when lift platform 16 reaches the bottom , limit switch 15 closes the circuit to ram solenoid 24 ( fig4 ), thus starting the cycle over again . more specifically , the top of hopper 1 , ( fig2 ) is fitted with stainless steel guide rails 5 across the top . these rails 5 extend beyond the top of hopper 1 to keep the trays 34 from falling into hopper 1 and allowing the trays to be moved off of the top of hopper 1 and removed to the washer ( fig6 ) by a chain conveyor . the main components of the dumper are the lift platform 16 , the kick - off arms 7 , and the cam operated pneumatic limit switch 14 . the lift platform 16 is a spring loaded , pneumatically controlled table on which a hatchery tray sits for dumping . the platform table is slightly wider than a tray and has tapered uprights 38 ( fig6 ) as guides so that tray 34 will be centered over the hopper when dumped . platform 16 is raised and lowered by a commercial 12 - inch - long , double - acting pneumatic air cylinder 6 . to assist air cylinder 6 in starting the load upward , an adjustable compression spring 9 is so situated that it developes enough thrust to override the weight of a loaded tray , thus requiring less air pressure . lift platform 16 is hinged on a 11 / 4 - inch shaft 31 and supported on both ends by flange - mounted pillow blocks ( not shown ). the complete assembly is fabricated out of angle iron and square tubing except for the platform itself , which is made from 16 - gage sheet steel . lift platform 16 is affixed to an angled support member 18 . angle support member 18 is located on the bottom of lifting platform 16 . platform 16 is set to rotate through an arc of 100 °. lifting platform 16 is designed to thus give support to the hatchery tray through this angle taking it just past the vertical so that it can turn over and onto the open top of hopper 1 . thus lifting platform 16 starts from the horizontal plane where it accepts the hatchery tray and takes it up and through 100 ° of arc travel turning it over onto the open top of hopper 1 so that the waste material contained in the hatchery tray may fall out into hopper 1 . the angle of angled support member 18 will depend on the height of the conveyor ( not shown ) that feeds the trays . therefore , the angle must be adjusted to allow for correct movement between the top of the conveyor to the top of hopper 1 . the height of the conveyor of the instant invention was approximately 34 &# 34 ; from the floor . the distance between the top of the conveyor and the top of the hopper 1 was approximately 181 / 2 &# 34 ;. the angle set is approximately 110 ° in the case of the instant invention and is set to accommodate the existing height : any adjustment to height or distance would change the angle . all necessary bracing is also made of light weight angle iron . the platform has two stainless steel stops 13 , ( only one shown ) on the inner side to help position the tray and keep it from sliding off . situated between the stops is the lift - platform ( tray table ) limit switch 12 ( fig1 and 4 ), with two sets of normally closed ( nc ) contacts and one set of normally open ( no ) contacts that sense the presence or absence of a tray . the ( no ) contacts sense the presence of the tray and actuate the air cylinder to lift platform 16 . one set of ( nc ) contacts is utilized in conjunction with a time delay relay 22 ( fig4 ) to hold platform 16 at a maximum ascent for 11 / 2 seconds , while the other set of ( nc ) contacts disables the tray - loading mechanism so that another tray cannot be moved until platform 16 is ready to accept it . since platform 16 is moved swiftly through an arc of 100 °, it is necessary to have some kind of air switch to reduce the air pressure on the last 30 ° to 40 ° of the arc of travel , and thus keep the tray from being thrown into striker plate 4 ( fig2 ), with excessive force . striker plate 4 is located on top of hopper 1 . this is accomplished by a cam actuated air switch 14 that reduces the pressure on air cylinder 6 through the last portion of the arc . this switch 14 bypasses the airflow control valve 30 ( fig5 ) in the &# 34 ; extend &# 34 ; exhaust port of spring - return solenoid valve 11 . switch 14 communicates with valve 30 by means of cam 32 ( fig2 ) which rotates into contact with switch 14 . cam 32 is preset to rotate into contact with switch 14 depending upon the angle of arc desired . in the case of the instant invention the last 30 ° to 40 ° were found to be the optimum distance in order to allow for the tray to settle on the top of hopper 1 correctly . after the tray falls upside down onto hopper 1 it must be removed before the next tray can be dumped . two kickoff arms 7 ( fig1 ) automatically push the tray off the top of hopper 1 onto the washer conveyor . as lift platform 16 descends , arms 7 mounted on shaft 29 are rotated by bevel gears 10 which communicate with hinge shaft 31 of platform 16 . thus , arms 7 push tray 34 off hopper 1 as a result of downward movement of platform 16 . hinge shaft 31 communicates between cylinder 6 and platform 16 . because this is a direct - drive mechanism , something is needed to prevent damage to the tray if it becomes lodged . normally , torsion springs 8 , put over the kickoff arm 7 &# 39 ; s shaft that turn the kickoff arms , produce enough force to slide the tray off the top of hopper 1 . the top and bottom of the spring assemblies are rigidly mounted to the vertical shafts of arms 7 and the arms are mounted so that they will slip if pressure becomes too great on the tray . this is accomplished by using a lugged locking collar 26 and a notched collar 28 ( fig3 ) on each vertical shaft . when a lodged tray will not move , the spring 8 absorbs the torsion , leaving the tray with only the pressure of spring 8 against it . kick - off arms 7 are made from 131 / 2 - inch - long , 1 - inch , square tubing . they are located 15 inches apart to the left and right of the center of hopper 1 . each arm 7 is connected to its vertical 1 - inch shaft by means of the 1 - inch lugged locking collar 26 mentioned above , which turns on the shaft .

US-24837181-A

a handheld flashlight has a housing with a handle for accepting a user &# 39 ; s hand to grip and hold the housing , a first light source positioned in the housing for projecting a beam of light into a distance in front of the user , a second light source positioned in the housing for projecting a beam of light toward a surface proximate the user &# 39 ; s feet and a tail light positioned in the housing to provide additional visibility of the user to people who approach the user from behind . a switch energizes and deenergizes the lights . a spring biased reel is rotatably mounted in said housing and a leash is wound on the reel and extends from the housing such that a portion of the leash can be extended from the housing and the reel will automatically retract the extended leash portion .

the u . s . patent application ser . no . 11 / 351 , 769 is hereby incorporated herein by reference . the following detailed description and appended drawings describe and illustrate various exemplary embodiments of the invention . the description and drawings serve to enable one skilled in the art to make and use the invention , and are not intended to limit the scope of the invention in any manner . in respect of the methods disclosed , the steps presented are exemplary in nature , and thus , the order of the steps is not necessary or critical . a handheld flashlight of the present invention is generally illustrated at 10 in fig1 . the handheld flashlight 10 has a housing 11 that is constructed of a left half 12 and a right half 13 . the housing halves 12 , 13 are held together by a plurality of fasteners 14 . the housing 11 has a generally elliptical shape in side elevation with substantially flat side surfaces connected by a peripheral wall 15 . however , the side surfaces may have other configurations besides being substantially flat . while an elliptical shape is preferred , other configured flashlights are within the scope of the present invention including a polygonal perimeter or circular perimeter . the elliptical perimeter substantially evenly distributes the weight of the flashlight along a length which allows a user of the flashlight to grip and use the flashlight for an extended period of time without causing the user &# 39 ; s grip to become fatigued . the left and right halves 12 , 13 are preferably constructed from a light weight plastic or polymeric material that is substantially impact resistant and able to withstand an impact when accidentally dropped . however other materials of construction are within the scope of the present invention . the left and right halves 12 , 13 have an internal aperture 16 formed therethrough that is of generally oval shape . the internal aperture 16 is shaped to accept the fingers or digits of a human hand . a top edge of the aperture 16 includes a plurality of inwardly extending portions 17 that define a gripping surface . the user positions his / her fingers into the aperture 16 while positioning a palm at the peripheral wall 15 above the portions 17 . thus , the portion of the housing 11 between the upper edge of the aperture 16 and the adjacent peripheral wall 15 defines an integral handle 18 for gripping the flashlight 10 . the left and right housing halves 12 , 13 each include a front foot 11 a and a back foot 11 b extending outwardly from a bottom portion of the peripheral wall 15 . the front and back feet 11 a , 11 b allow the flashlight 10 to be positioned in a selected position on a flat surface without rolling or tipping to either side . the feet 11 a , 11 b allow the user to not only use the flashlight 10 for an athletic activity such as walking , hiking or running , but also allow the flashlight 10 to be used for other activities where a stationary flashlight is required . various components of the handheld flashlight 10 are mounted in the peripheral wall 15 . a pushbutton switch 19 is positioned within an aperture formed in the wall 15 at the handle 18 . the switch 19 is proximate the user &# 39 ; s thumb when the hand is gripping the handle 18 . the switch 19 is preferably a multi - positional switch for controlling a plurality of lights as discussed below . moving in a counterclockwise direction about the housing 11 shown in fig1 , an end of a lever 20 extends through an aperture formed in the peripheral wall 15 . the lever 20 also is proximate the user &# 39 ; s thumb for controlling a leash as discussed below . a first light emitting source 21 is mounted in an aperture formed in the peripheral wall 15 . the light source 21 is turned on and off by the switch 19 . the first light emitting source 21 is preferably a light emitting diode ( led ) device having a beam that is dispersed through a lens . however , the lens is not necessary to practice the present invention . preferably , the first light emitting source 21 is a flood light aimed forward for a distance to allow the user to see and avoid potential hazards . the led device 21 may include one or more leds or light bulbs . the flood light 21 projects a broad beam of light that illuminates the ground or terrain for a substantial distance . below the light 21 is a leash 22 extending from an aperture formed in the peripheral wall 15 and terminating in a hook 22 a for attachment to a collar worn by an animal . the leash 22 extends from and retracts into the housing 11 utilizing a spring biased reel or spool as described below . pushing the lever 20 in a forward direction toward the light 21 locks the leash 22 in place . pulling the lever 20 in a rearward direction frees the leash 22 for extension and retraction . the switch 19 also controls a second light emitting source 23 mounted below the leash aperture . the second light emitting source 23 is positioned to project two beams of light at a substantially 45 ° angle to each other between a horizontal direction of the light 21 and a vertical direction . however , other configurations of the two beams are within the scope of the present invention . the second light emitting source 23 preferably projects a narrow , high intensity beam proximate the user &# 39 ; s feet . a cluster of more than one led or light bulb which act together to form the narrow , intense beam can be used . thus , the user does not have to maneuver the flashlight 10 to shine the beam of the light 21 between the user &# 39 ; s feet and out in the distance . the switch 19 further controls a third light emitting source 24 mounted in the peripheral wall 15 opposite the light 21 . the light 24 is a tail light that allows individuals approaching the user from behind to ascertain the user &# 39 ; s position . the light 24 is useful in making the user visible whether the user is being approached by a pedestrian or a person in a vehicle . the tail light 24 is preferably a pair of red leds covered by a clear lens . however , a white led can be used with a red transparent lens . the tail light 24 preferably blinks to attract attention to the light . while an led is typical , other illuminating devices are within the scope of the present invention . further , a transparent lens having a color other than a red lens is also within the scope of the present invention as is no lens . a multi - positionable pushbutton switch is preferred for the switch 19 . a first actuation turns on the first light 21 . a second actuation of the switch 19 turns on the second light 23 while the first light 21 remains on . a third actuation of the switch 19 turns on the third light 24 while the first light 21 and the second light 23 remain on . a fourth actuation of the switch 19 turns off all of the lights . other types of switches can be used to obtain the same functionality or to control the lights in different combinations of “ on ” and “ off ” within the scope of the present invention . fig1 also shows a battery cavity cover 25 positioned to close a recess or cavity ( not shown ) formed in the housing left half 12 for retaining a plurality of suitable batteries ( not shown ) that provide electrical power to the lights through the switch 19 . the cover 25 is releasably retained by a pair of fasteners 26 . the flashlight 10 is typically powered with three aa batteries to minimize the weight of the flashlight . however , the flashlight 10 may use one or more batteries that may be a different size than an aa battery . as shown in fig2 and 3 the housing left half 12 and the housing right half 13 each include one half of the peripheral wall 15 . formed in each half of the peripheral wall 15 are the following aperture portions : pushbutton aperture 27 ; lever aperture 28 ; first light aperture 29 ; leash aperture 30 ; second light aperture 31 ; and third light aperture 32 . as shown in fig2 , an interior wall 33 of the battery cavity extends inwardly from the inner surface of the housing left half 12 . also formed in the side wall of the housing left half 12 are a plurality of apertures 34 for receiving the fasteners 14 . the housing right half 13 has a corresponding plurality of posts 35 extending from an interior surface of the side wall for threadably receiving the fasteners 14 in bores thereby attaching the two halves of the housing 11 together . however , other fastening devices such as glue , adhesive and a snap fit are also within the scope of the present invention for retaining the halves 12 , 13 together . there is formed on the interior surface of each of the housing halves 12 , 13 a lever pivot post 36 positioned between the hand aperture 16 and the first light aperture 29 . the posts 36 each have a bore formed therein for receiving an associated pin 37 ( fig4 ) extending from the lever 20 to form a pivot point at a midpoint of the lever . as shown in fig4 , an upper end of the lever 20 has a hollow knob 38 mounted thereon . there is a compression spring ( not shown ) positioned inside the knob 38 in contact with the lever 20 to bias the knob upwardly . the knob 38 has a pair of pins 39 extending from opposite sides . each of the pins 39 slides along a bottom surface an associated rib 40 ( fig2 and 3 ) formed on the interior surface of a respective one of the housing halves 12 , 13 . at the end of each rib 40 closest to the lever aperture 28 is formed a downwardly opening depression 40 a for accepting a corresponding one of the pins 39 . thus , when the knob 38 is closest to the switch aperture 27 , the user can slide the knob toward the lever aperture 28 until the spring moves the pins 39 into the depressions 40 a to hold the lever 20 when the user removes his / her thumb from the knob . the lower end of the lever 20 engages a pawl 41 as shown in fig4 . there is formed on the interior surface of each of the housing halves 12 , 13 a pawl pivot post 42 positioned adjacent to the leash aperture 30 . the posts 42 each have a bore formed therein for receiving an associated pin 43 ( fig4 ) extending from the pawl 41 to form a pivot point at one end of the pawl . thus , pivoting of the lever 20 will produce a pivoting of the pawl 41 . the first light 21 includes a reflector 44 mounted in the aperture 29 and having a cone shaped reflective surface . mounted at an interior end of the reflector 44 is an led assembly 45 ( fig4 ) that is exposed through a central aperture in the reflector . mounted in the leash aperture 30 is a leash guide 46 to guide the leash 22 out of and into the housing 11 . the guide 46 has an arcuate opening through which the leash 22 passes . the second light aperture 31 receives a second light mount 47 upon which the two leds are mounted . extending through the mount 47 is a pair of apertures 47 a ( fig4 ) each receiving one of the leds . as shown in fig4 , a reel assembly 48 for receiving the leash 22 is rotatably mounted on a tubular axle 49 extending from the inner surface of the housing right half 13 . the reel assembly 48 includes an internal spirally coiled spring ( not shown ) as is conventional in automatically retracting electrical cord reels ( e . g ., see u . s . pat . no . 3 , 450 , 369 ). as shown in fig3 , the axle 49 extends through a central aperture of a flat ring shaped sound absorbing pad 50 attached to the inner surface of the housing right half 13 . the pad 50 can be formed of any suitable material such as ethylene vinyl acetate ( also known as eva ) which is adhesively attached to the housing . a second pad 50 is attached to the inner surface of the housing left half 12 as shown in fig2 . a tubular axle retainer 51 extends from the inner surface of the housing left half 12 and through a central aperture of the sound absorbing pad 50 . the retainer 51 has an inner diameter greater than an outer diameter of the axle 49 and an internal wall 51 a that is received in a slot 49 a formed in the wall of the axle 49 for a positive engagement . as shown in fig4 , the reel 48 has a plurality of ratchet teeth 52 formed on a side surface for cooperation with the pawl 41 . the pawl 41 has to parallel arms and the arm closer to the inner surface of the housing right half 13 engages a similar plurality of teeth formed on the opposite side surface of the reel 48 . when the knob 38 is closest to the switch aperture 27 , the pawl 41 is rotated out of engagement with the teeth 52 and the reel 48 is free to rotate on the axle 49 . in this position , the leash 22 can be pulled out of the housing 11 and will be automatically retracted if the pulling force is released . when the user slides the knob 38 toward the lever aperture 28 , the pawl 41 engages the teeth 52 to prevent rotation of the reel 48 in the retracting direction . the tail light 24 includes a lens 53 covering a tail light module 54 mounted in the third light aperture 32 . the module 54 includes one or more sources of light and can include conventional circuitry ( not shown ) for flashing the light sources to better attract attention . the flashlight apparatus 10 of the present invention has an ergonomically designed handle and gripping surface at the hand aperture 16 to minimize fatigue to the user &# 39 ; s grip over time . the flashlight 10 of the present invention also eliminates the need to point a single beam intermittently between proximate the user &# 39 ; s feet and into the distance . the user can position his / her hand in a natural position while walking or moving while having the first and second light emitting sources 21 , 23 project the beams in the desired directions . the flashlight also includes an automatically retracting leash 22 that is manually controlled at the knob 38 to prevent retraction . in accordance with the provisions of the patent statutes , the present invention has been described in what is considered to represent its preferred embodiment . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope .

US-82486710-A

optical mapping apparatus for imaging an object , comprising an optical coherence tomography system including an oct source , an oct reference path leading from the oct source to an oct receiver , an oct object path leading from the object to the oct coupler , an oct depth scanner adapted to alter at least one of the oct reference path and the oct receiver path . a confocal system is provided including a confocal optical receiver a confocal path leading from the object to the confocal optical receiver via a confocal input aperture . an adaptive optics system is provided to correct optical aberrations in the oct object path and the confocal path .

fig1 shows a first embodiment of the high resolution imaging system according to an embodiment of the invention . light from a low coherence source 11 is collimated via focusing element 110 and divided by an oct beamsplitter , 3 into two beams , a reference beam and an object beam . the object beam is sent towards a wavefront corrector 22 , wherefrom the beam is transferred via the a telescope , equipped with curved mirrors 51 , 52 towards focusing optics 5 , constructed from curved mirrors 53 , 54 and flat mirrors 55 , 56 in a badal configuration . the object beam is then sent to a transverse scanner 6 , constructed from a line scanner 61 and a frame scanner 62 . the scanner 6 is arranged to scan beams from the source 11 over a predetermined area . interface optics 7 , consisting of curved mirrors 71 - 74 and flat mirror 75 are provided to transfer a beam from the scanner 6 to the object to be imaged , 8 . the curved mirrors 51 - 54 and 71 - 74 could be parabolic or spherical . in fig1 , the object 8 is the retina behind the imaging focusing element , which in fig1 is the anterior chamber of an eye . in this case the imaging element 9 represents the compound focusing achieved by the cornea and the eye lens . for applications in microscopy , the object 8 could be a microscope specimen while the imaging focusing element 9 is a microscope objective . light back - reflected from the object 8 is transferred via the interface optics 7 , transverse scanner 6 and focusing optics 5 back to the wavefront corrector 22 and via the oct beamsplitter 3 , towards a beamsplitter 31 . beamsplitter 31 sends a fraction of the light provided to it towards a beam - splitter oct / confocal 32 and to a wavefront sensor 23 . the wavefront corrector 22 is controlled by the wavefront sensor 23 , via the feedback loop electronic processing circuit 24 . the wavefront sensor 23 , wavefront corrector and the feedback loop electronic processing circuit 24 constitute a closed loop ao system 2 . in all embodiments , the wavefront sensing source receives a wavefront sensing beam , and it will be appreciated that the circuit 24 processes information output from the wavefront sensor 23 relating to the aberrations collected by the wavefront sensing beam . the wavefront sensor 23 therefore can control the actuation of the wavefront corrector via the circuit 24 and the feedback loop so as to correct for aberrations . the imaging instrument , 1 contains an oct and a confocal channel . the reference beam from the source 3 is sent via a reference path towards the fibre input 113 of a balanced splitter 103 , implemented in single mode fibre as a single mode directional coupler in fig1 . the optical path from the source 3 to the balanced splitter 103 forms the reference path for the oct channel . light is launched into the reference input 113 of the coupler 103 using a focusing element 114 . to keep the losses low , most of the light , for instance 90 - 96 % from the oct / confocal beam - splitter 32 , is sent towards the object fibre input 101 of the splitter 103 , focused by a focusing element 115 . polarisation controllers , 104 and 105 match the polarisation from the two input apertures 101 and 102 . the object beam interferes with the reference beam in 103 and the strength of the interference signal is read by a balanced receiver equipped with photodiodes 106 and 107 and differential amplifier 108 . the signal is then processed in an oct signal processing unit , 109 , which creates a signal proportional with the strength of the interference signal , either in linear or logarithmic format . phase information could also be recovered by conventional means and implemented in the signal processing unit , 109 . a small fraction of the beam input to the splitter 32 is sent towards the input aperture of a confocal receiver 12 . the confocal receiver uses a high sensitive photosensor , 121 , such as an avalanche photodiode or a photomultiplier tube , behind a focusing element 122 and an aperture 123 . the confocal receiver can use a pinhole or the aperture of a fibre and different versions are known , such as these detailed in u . s . pat . no . 6 , 769 , 769 . the signal delivered by the photosensor 121 is amplified and processed in an amplifier unit 125 to supply a confocal channel image . it will be apparent to those skilled in the art that where beam - splitters are in fibre as discussed , equally they could be implemented in bulk and vice - versa . the signals from the two electronic units 125 and 109 are sent to a dual input display unit 4 , which may incorporate a computer system such as a personal computer ( pc ) which controls the regimes of operation of the system , the type of scanning , its sequence of operation and data acquisition . the display unit 4 is arranged to process and display images produced by the oct channel and the confocal channel . the path starting after the beamsplitter 3 , along the wavefront corrector 22 , the focussing elements , the scanner 6 and the interface optics 7 to the object 8 , and then back via the same elements towards the beam splitter 3 , then via splitter 31 and to the coupler 103 constitutes an object path . the coupler 103 represents one of many possible oct optical receivers , as will be appreciated . interference in the oct channel is obtained when the length of the reference path matches the length of the object path . scanning of the optical path difference to generate b - scan images , or collect c - scan images from different depths is accomplished with a translation stage 112 , which moves the fibre end 113 and the focusing element 114 . other possibilities are known to implement depth scanning in oct , such as using a transmissive spectral scanning delay line , as described in the gb application no 0419383 . 5 . the wavefront sensor 23 could operate in the conventional manner , and could be implemented as a shack hartman device as described in paper by j . liang , b . grimm , s . goelz and j . f . bille , “ objective measurement of wave aberrations of the human eye with the use of a hartmann - shack wave - front sensor ”, j . opt . soc . am . a ., vol . 11 , no . 7 , ( 1994 ), pp . 1949 - 1957 . this may incorporate a lenslet array , 231 , behind focusing elements 232 , 233 acting as telescope to adapt the size of the incoming beam to that of the lenslet array . light from the lenslet array is focused onto a 2d photodetecting array , 235 , such as a ccd . the wavefront sensor could equally well be based on any other principle of wavefront sensing such as interferometry , phase diversity , curvature sensing or other methods of slope sensing such as embodied in the pyramid wavefront sensor . the path from the object 8 via scanners 6 , interface optics 7 , wavefront corrector 22 up to the lenslet array 231 forms a wavefront sensing path . the path from the object 8 via scanners 6 , interface optics 7 , wavefront corrector 22 up to the coupler 103 forms an oct object path . the path from the object 8 via scanners 6 , interface optics 7 , wavefront corrector 22 up to the pinhole or fibre input 123 forms a confocal path . the intersection of wavefront sensing path , oct path and confocal path forms a common 3 - path . the path between beamsplitters 31 and 32 forms an uncommon 2 path , while the path between the splitter 32 and the coupler 103 forms an uncommon oct path and that between the splitter 32 and the confocal input aperture 123 an uncommon confocal path . the wavefront corrector 22 could operate according to a conventional manner of adaptive optics , and could be implemented as a deformable mirror , based on piezoelectric or electrostrictive materials , or using bimorph devices , magnetic force devices , or mems . liquid crystals working in transmission have also been developed for this application , as described in g . t . bold , t . h . barnes , j . gourlay , et al , “ practical issues for the use of liquid crystal spatial light modulators in adaptive optics ”, opt . commun . 148 ( 4 - 6 ): 323 - 330 , mar . 15 ( 1998 ). the corrector , wavefront sensor 23 and input aperture of the oct channel and of the confocal receiver are all generally different from the eye pupil or microscope objective &# 39 ; s aperture . in fig1 , the oct aperture is determined by the diameter of the emergent beam from fibre at the position where element 115 is , if light was sent from one of the two outputs connected to photodetectors 106 and 107 . standalone oct systems generally operate with small diameter beams , 2 - 3 mm in order to obtain images from the retina with un - dilated eyes . ao systems for the eye are used to compensate aberrations from within larger diameter pupils , is 4 - 7 mm . conventional ao correctors vary in diameter from a few mm up to over a few cm . conventional wavefront sensors for instance , when based on ccd cameras , have apertures depending on the ccd chip . therefore , incorporating all these elements in the same optical path require adaptation of the beam diameter and careful consideration on their positioning in such a way , that the corrector and the wavefront sensor are conjugate to the imaging focusing element , the eye pupil , while the retina is conjugate with the input fibre , 101 , in the oct and the pinhole of fibre input 123 in the confocal channel . matching of beam diameter is achieved by telescopes equipped with lenses or mirrors , spherical or parabolic . it is known that such telescopes introduce their own aberrations and losses . generally oct system use single mode fibres while confocal channel may use a pinhole . this means that the numerical aperture ( na ) of the oct input aperture is approximately 0 . 1 while the na of the confocal channel could be much larger . therefore , there is scope in implementing different embodiments , where the size of different elements may suggest separation of the input paths leading to the oct channel and to the confocal channel and interleaving other system components between them . by doing so , the number of telescopes in the system which match the size of different optical components is reduced with consequence in lowering the internal aberrations and losses in the system . an optimum number of telescopes should also be used , to minimize aberrations , for instance an even number is recommended . in fig1 , the position of the corrector 22 is conjugate with the pupil of the imaging focusing element 9 and with the two transverse scanners , 61 and 62 . in fig1 , as one of the multiple possibilities , parabolic mirrors are used and their radius is adjusted to achieve desired beam diameters at different points . for instance , focusing element 110 could be a microscope objective or a telescope which in conjunction with the na of fibre produces a beam diameter of 9 . 2 mm , matching the diameter of a conventional commercial 37 actuators mirror corrector , 22 . the intermediate elements up to the first scanner , 61 , reduce the diameter to 2 . 3 mm and the next elements increase it again to that of the pupil to be used , i . e . for instance 7 mm . while a system combining an oct system with confocal microscopy can tolerate grouping the line and frame scanners into a 2d compact scanner , it is desirable that this be avoided in a system of low aberrations , as that required for a system incorporating ao elements . this is why the scanners 61 and 62 are separated and interleaved with interface optics elements in fig1 . the absence of scanning aberrations makes the operation of the wavefront sensor 23 and of the wavefront corrector 22 easier . this is because the relative distance between the two transverse scanners 61 and 62 when grouped together lead to a distortion of the wavefront within the image raster . if the line scanner is placed in conjugate point with the eye pupil , then constant phase is obtained along the line in the raster , but the raster is curved along the frame direction . furthermore , if the frame scanner is conjugate to the eye pupil , then the wavefront is flat along the frame scanning direction and curved along the line scanning direction . if transverse scanners are not separated and interleaved with focusing elements to have them both conjugate to the eye pupil , then the system aberrations pulsate with the transverse scanning . this would impose a further constraint on the aberrations corrections . frame scanners are slower and consequently , their mirror size is larger than that of line scanners which are faster . this means that a telescope may be placed between the two transverse scanners and suitable size correctors can be placed here too . in this embodiment , the wavefront sensor 23 is placed in the beam returning form object after the corrector 22 , i . e . the corrector 22 is closer to the eye than the wavefront sensor as well . for instance , the components could be mounted in the following order ( from the source ) with a large size corrector : corrector 22 , frame scanner 61 , telescope to reduce the beam diameter to the aperture of the line scanner 61 and the eye pupil . equally possible is the sequence : frame scanner 62 , corrector 22 , telescope , line scanner 61 . a problem remains with accommodating a large diameter beam , of over 1 cm , into a single mode fibre of 5 . 5 μm core usually with 0 . 12 na . this requires another telescope to reduce the beam diameter to values which allows efficient injection into the single mode fibre , which may be introduced before the focusing element 115 ( not shown ). the comments above show that a wavefront sensor 23 and a corrector 22 cannot simply be placed in any point of the object beam in a given oct system or combined oct / confocal system to obtain an oct / ao or an oct / c / ao system respectively . it is desired that their positions be optimally chosen to satisfy conjugation with eye pupil and within parts of the object beam with corresponding diameters . as a possible alternative , if the corrector 23 can operate as fast as the frame scanner 62 ( i . e . 1 - 10 hz ), then grouping of the line scanner 61 and frame scanner 62 into a compact xy transversal scanning head could be tolerated . in such cases , calibration is used prior to imaging , where a curve of compensation parameters is stored versus the angle of the frame scanner which is subsequently used in the aberration compensation process when scanning the eye or the specimen . at the level of current technology , ao wavefront sensors and actuators can operate at rates over 1 khz , therefore it is possible to operate them to dynamically compensate the aberrations while scanning along the line in the raster . once such fast elements are in place , correction could be applied dynamically along x and y in the raster , at 500 hz in the line and at 2 hz in the frame , rates known for current t - scan oct systems . another problem is connected to the carrier required to transfer the information on tissue reflectivity , into brightness in the final oct image . this carrier could be created by an external phase modulator or by the path modulation introduced by the very process of transversal scanning . in order to see smaller pixels in the image when using ao , the image size is generally much smaller , e . g . a few degrees , than that used in conventional clinical oct and slo systems , which are typically 40 degrees or more . therefore , the frequency of the carrier created by the very process of transverse scanning may be so low , that it is rejected by the high pass filter within the electronic processing unit 109 , used to reduce the 1 / f noise after the photodetectors 106 , 107 . the carrier results by scanning the beam over a virtual sampling function , as described in the papers by podoleanu mentioned above . the same papers show that the sampling function depends on the object as well as on the adjustment of the beam in relation to the scanning mirrors . for an aberration - free system , when the object is a mirror , the sampling function is in the form of newton rings . if the mirror is replaced by a collection of scatterers , their spatial pattern modulates the newton rings sampling function , which distorts the shape of the rings until disappearance . the result is b - scan and c - scan images , with speckle where fringes are superposed over the shape of scatterers , shape which determines the morphologic structure . to reproduce the shape of scatterers , the fringe pattern has to be eliminated , as this fringe pattern takes the role of the sampling function in podoleanu &# 39 ; s papers when the object was a mirror . if only a few fringes are superposed over the shape of the scaterrer , by scanning the beam over this fringe pattern , the frequency generated may be too small to be passed by the high pass filter within signal processing unit 109 . only a sufficient number of fringes over a scattering feature would reproduce correctly the shape of the feature . therefore , to benefit from the increase in the transversal resolution brought by the ao , the spatial period of the sampling function in the oct channel should be smaller than the ao improved transversal resolution . this could be achieved by fast phase modulation of the optical path in the interferometer to phase modulate the fringe pattern at a rate faster than that of t - scanning . for instance , for a strength of the phase modulation equivalent to a path modulation of λ / 4 , the bright fringe is replaced with a dark fringe . doing this sufficiently fast , will generate a high frequency , which when larger than the t - scanning rate can be demodulated with a band pass filter tuned to the phase modulation frequency . for instance , for a 500 hz t - scan , and a small size of 100 pixels , at least 400 khz is required . this can be obtained by using electro - optic or acousto - optics modulators . it is known that introduction of such modulators in a low coherence reflectometer leads to dispersion problems . uncompensated dispersion spoils the depth sectioning profile of the oct channel . this shows the interrelation of problems to be addressed when blending en - face oct with ao . 1 . use of an electro - optic phase modulator in conjunction with dispersive compensation elements , either a similar modulator in the other arm of the interferometer ; or a scanning delay line using at least a dispersion element , a focusing element and a tilted mirror , as shown in . gb application no 0419383 . 5 . fig1 shows two phase modulators , 119 and 111 driven by generators 118 . to generate a carrier frequency of 1 mhz , only one modulator can be driven with the other used to compensate for dispersion . when bragg cells are employed , they are excited at 40 or 80 mhz ., therefore to bring the carrier frequency down , one is excited at 81 and the other at 82 mhz , with the beat , 1 mhz being the carrier . the oct system in fig1 can use a phase modulator , such as an electro - optic modulator , an acousto - optic modulator placed in one arm of the oct interferometer , or two could be placed in the same arm , but preferably one in each arm of the interferometer for better compensation of dispersion . 2 . use of a scanning delay line consisting of at least a dispersion element , a focusing element and a fast galvo - mirror , preferably a resonant scanner , as shown in the gb application no 0419383 . 5 , to create a high sufficient carrier frequency by shifting the beam away from the pivot of the fast vibrating mirror . 1 . however , path modulation introduced by the transverse scanner determining the line in the raster could still be used on its own , in which case phase modulators 119 and 111 are not necessary and this is why they are shown dashed in fig1 . in this case , an improvement in the signal to noise ratio is expected when closing the ao loop , but less improvement in the transversal pixel size than in the case of using an external phase modulator . 2 . when using external phase modulation , improvement in both the oct signal strength and transverse resolution is expected . a summary of the improvements after applying the ao is presented for eye imaging and confocal microscopy in table 1 . when imaging specimens and not the eye , due to the high numerical aperture ( na ) that could possibly be achieved by bringing the tissue close to the microscope objective , the depth resolution in the confocal core of the oct channel may become comparable or better than that of the oct itself . therefore , by applying ao . the depth resolution improves in the oct channel as well , in comparison with low na imaging , where the improvement is masked by the narrow oct depth sectioning profile . the table shows that in all circumstances , the confocal channel reports improvements of its parameters . therefore , non - improvement of transversal resolution in the oct without a phase modulator could be tolerated when a pair of oct / confocal images is generated , where the morphology in transversal section is made visible in the confocal channel . when the present disclosure is applied to microscopy imaging , even if the oct channel does not show improvements in its depth resolution , an oct channel is useful in addition to a confocal channel for the higher sensitivity of oct . it is known that for skin systems , oct could achieve at least double penetration depth . therefore , there is still scope to combine the two channels , oct and confocal , which by aberration control using ao as described in the present disclosure , could achieve an enhanced penetration depth . no conventional systems are capable of producing high resolution images in both regimes , oct and confocal . none are capable of producing b - scan images in both regimes , oct and confocal . none are capable of producing c - scan images in both regimes , confocal and oct . the herman &# 39 ; s and zhang &# 39 ; s papers mentioned above reported enhancement of the signal to noise ratio and of the signal strength when ao feedback was closed the roorda and zhang papers have shown improvement in the transverse resolution as well . however , none refer to oct t - scan nor to oct c - scans obtained based on the flying spot concept . wo 2003 / 105678 to c - scan oct , but this operates on the full field principle ( or coherence radar ), of less sensitivity , and zhang &# 39 ; s oe paper refers to improved c - scan in the fundus camera regime ( using a 2d ccd , which is well below the depth resolution of a confocal aperture ). in the embodiment in fig1 , the line in the raster image is determined by fast transversal scanning , i . e . by using one of the scanners only to generate a horizontal line or a vertical line over the object , or both to generate any profiles , such as ovals or circles , according to conventional scanning principles for handling a 2d scanner head . the 1d reflectivity profiles obtained this way are t - scans , which are generated in both channels , oct and confocal . the configuration in fig1 ensures pixel to pixel correspondence between the pixels in the two t - scans . t - scanning ensures : 2 . less cross - talk between transverse pixels than a full field with flood illumination set - up . none of the documents mentioned above on combination of imaging principles with ao have generated t - scans , therefore could not take advantage of points 1 and 2 . when closing the loop in the ao channel , the depth of focus shrinks due to improvement in the depth resolution of the confocal channel at the core of the oct configuration . this affects the strengths of both t - scans , as explained below and opens several scanning strategies not contemplated by conventional imaging systems equipped with ao , nor conventional imaging systems alone , strategies allowed by the combination of focus scanning in the confocal channel with the coherence gate scanning in the oct channel . when the ao channel compensates for aberrations , the axial resolution narrows to the level expected for an ideal focusing element in front of the object being imaged . this raises the problem of signal strength from depths outside the axial sampling profile of the confocal receiver at the core of the oct channel . when imaging the retina , due to aberrations , the confocal core is known to have a depth sectioning profile not better than 300 μm . by applying ao , an axial profile as narrow as 50 μm could be achieved , which is an interval smaller than the retina thickness . consequently , the improvement of the axial resolution due to ao leads to a reduction of signal for depths outside the confocal profile . therefore , depth of focus shrinkage requires control of the focus in the oct channel and open the perspective of generating b - scan images in the confocal channel as explained below . 2 . focus position in ao versus the desired focus position in oct and confocal channels the ao channel may dictate a shift in the focusing towards the depth where the maximum signal originates from . for instance , when imaging the eye , a layer of highest reflectivity , such as the retinal pigment epithelium ( rpe ) determines the closed loop ao channel to focus at the depth where the rpe is . consequently , there are two effects , due to ao , narrowing of the axial sampling profile and shift of such peak towards the depth dictated by the ao channel . dynamic focus procedure comprises moving the focus depth in the confocal core of the oct in synchronism with the coherence gate , and in this way selecting signal in the oct from that depth where the two optical paths , in the object and reference paths are matched . this is possible by controlling the following element 5 and the translation stage 112 in synchronism by signals 5 c and 112 c sent by the controlling pc 4 . however , in an oct system equipped with dynamic focus , with the function of aberration compensations active in the ao , it is difficult to predict the operation of the dynamic focus . when the convergence of the beam is altered by actuating the focusing element , the corrector 22 tries to compensate this change in convergence and counteracts its effect by curving the corrector 22 . under closed ao loop , the ao system maintains the best focus at the depth of the rpe level while the dynamic focus tries to move the focus to different depths in synchronism with depth scanning as required for generation of b or c - scans . therefore , different solutions for addressing the conflict between the wavefront corrector and dynamic focus are required in order to maximise the strength of signal in both channels and even more , select the depth where such strength is maximum for diagnostic reasons . 3 . 1 . a bias correction could be applied to the signal sent by the wavefront sensor 23 to adjust the focus away from rpe , by changing the convergence of the corrector 22 . such a signal could be applied to the ao feedback loop 24 , in the form of a bias , to implement depth focus scanning as required for b or c - scanning regime . under perfect adjustment , the focus points of the lenslet array 23 , are on their axes and coincide with a grid of points for aberrations zero . no correction signal is applied to the corrector 22 . in the presence of aberrations , the focus points created by the lenslet array deviate from the grid points for aberrations zero . these deviations are read by the photo detector array 235 which are translated to controlling signals for the actuators of the corrector 22 , to create a wavefront with opposite aberrations at the cornea and create a flat wavefront surface immediately after . part of errors signals generated by the feedback loop 24 refer to focus correction , which controls the 22 to spherical curb . the error signal of the closed loop , which tells the loop where to stop correction , could be mismatched by applying bias signals . in that case , the loop will interpret distribution of focus points on the array 235 as points of null correction . while the maximum strength of the signal still comes from the rpe , under such bias signal , the corrector curves the beam to focus away from the rpe . in this case , the focus points of the lenslet array deviate from the regular grid corresponding to perfect correction and the ccd array 235 outputs signals corresponding to a defocus . however , the other aberrations are still compensated , if the bias signals represent only the aberration of defocus . in this way , focus correction can be applied with the ao loop closed . by applying adjusting signals via the ao electronic feedback link to the wavefront corrector , the position in depth where both channels , confocal and oct focus is changed . t - scans are collected from such new focus positions , which could be changed according to the depth scanning procedure controlled by the pc , 4 , b or c scan , i . e . synchronous with depth scanning in the oct channel , line 112 c . in this case , to avoid a conflict between the corrector 22 and the focusing element 5 , the system operates under open ao loop , according to the following steps : ( 1 ) with no depth scanning , the ao system is used to evaluate and then correct for the aberrations in the at least correcting path , step which proceeds with no or with t - scanning present , ( 2 ) control signals towards the wavefront corrector are stored , ( 3 ) the link between the wavefront sensor 23 and the wavefront corrector 22 is interrupted and ( 4 ) focus adjusting signals are applied to the wavefront corrector 22 , to modify the position in depth where both channels , confocal and oct focus and t - scans are collected from , while the same correction of aberrations according to the stored values in step ( 2 ) is maintained . 3 . 3 . using the wavefront sensor 23 under closed loop conditions another focusing modality could be implemented by altering the distance between the lenslet array 231 and the photodetector array 235 . by moving the lenslet array 231 towards the photo detector array 235 , points behind the rpe , i . e . deeper will be focused on the photodetector array 235 and the array 235 will supply the same aberration information as before plus a defocus information . this will determine a different curvature of the corrector 22 to focus the object beam back on the rpe . in doing so , the corrector 22 will now focus the oct and confocal beams at points in front of the rpe . similarly , by moving the lenslet array 231 away from the photodetector array 235 , the corrector 22 will bring the rpe in focus and by doing so , the corrector 22 will now focus the oct and confocal beams at points behind the rpe . this type of focus is compatible with closed loop correction to correct the aberrations other than focus and scan in depth in the confocal channel and in the confocal core of the oct system . 3 . 4 . using the curvature of the beam generating the reference point for aberration evaluation another focus method that embodiments of the invention could use introduces defocus into the wavefront sensing beam . the embodiment in fig1 does not allow such an approach , as the same source , 11 is employed for imaging as well as for the ao system . this method will be described in conjunction with the embodiments discussed in relation to in fig3 to 7 . 3 . 5 . using the focus element 5 under open loop conditions focus for both oct and confocal channels can be shifted away from that of the wavefront sensor 23 using the focusing element 5 . focus is changed by moving the translation stage 5 a , which supports the two mirrors 55 and 56 . in this case , to avoid a conflict between the corrector 22 and the focusing element 5 , the system operates under open ao loop , according to the same steps as before . the wavefront sensor receives most of the light from the bright scatterers at the level of the retinal pigment epithelium ( rpe ) layer and determines the corrector to focus at the same depth . the focusing elements 115 ( in the uncommon oct path ) and 122 ( in the uncommon confocal path ) are adjusted for the best focus of the oct channel and confocal receiver channel respectively using a non - aberrated object . then , when the system is directed to the eye , both channels will focus at the depth where the wavefront sensor 23 selects maximum intensity , i . e . at the rpe . then , actuating on the elements 115 and 122 , the focus in the two channels can be adjusted at different depth positions . they could be adjusted at the same depth but different from that of the wavefront sensor , or at two different depths to allow independent adjustment of the imaging depth in the oct system and the confocal system . alternatively , it is also possible to use a combination of focus adjustment 5 , with that of elements 115 and 122 to reduce the amount of adjustment applied on the corrector 22 , which will reduce the dynamic range of correction . alternatively , instead of controlling two focusing elements 115 and 122 , only one focusing element in the uncommon 2 - path , placed between splitters 31 and 32 could be used . it should be apparent to those skilled in the art that the methods above could be combined to extend the focusing range or modify the start depth and end depth of the two depth ranges in the oct and confocal channel . for instance , controlling the corrector or moving the lenslet array 231 which act on both channels could be combined with methods which change focusing in one channel only . furthermore , the improvements in focusing obtained by using the corrector 22 , the wavefront sensor 23 , focusing element 5 , focusing elements 115 ( for the oct channel ) and focusing element 122 ( for the confocal channel ) could provide advantages in scanning for single channel systems , whether the system is implemented as either oct or confocal systems . focus adjustment is very important in the process of dynamic focus , which means maintaining the confocal gate in the confocal system at the core of the oct channel in synchronism with the coherence gate . by changing the optical path difference in the oct channel , for instance by using the translation stage in via the line 112 c , the coherence gate is placed at different depth or moved through depth of the object 8 , and scanning in depth is performed to generate b - scans and acquire c - scans from different selected depth positions . because under the ao regime , the coherence gate could be as narrow as 50 μm , it is important to ensure a dynamic focus procedure to achieve maximum sensitivity in the oct channel . any of the possibilities explained above or a combination of such possibilities could be applied , to extend the focus range or to make it different from that in the confocal channel . several t - scans are acquired for different depths either by altering the depth in steps or by changing it continuously at a much slower pace than that of t - scanning , to generate t - scans from essential the same depth . in this way , ( x , z ), or ( y , z ) images , with z along the optic axis could be generated . by actuating on both transverse scanners to generate an oval profiled t - scan , cylindrical images could be equally generated . oct channel : a b - scan is obtained by changing the optical path difference in the interferometer , by actuating on the optical path difference between the object path length and reference path length , by acting on stage 112 via control line 112 c . this could be obtained with or without dynamic focus procedure explained above . in case dynamic focus is applied , then controlling signal via one or a combination of lines 24 c , 231 c , 5 c , or 115 c are sent synchronously with control signal 112 c . a b - scan is obtained by changing the focus control line , using one or a combination of the possibilities mentioned above , by actuating on the 24 c , 231 c , 5 c , or 122 c . pairs of b - scan oct and confocal images have been obtained as described in wo03086181a1 . fig8 in this application shows such a pair , where due to the large depth of focus ( due to aberrations left uncompensated ) in the confocal channel , the b - scan confocal image does not provide any depth information , and therefore , all t - scans , at different depths are the same . the embodiment in fig1 allows generation of a meaningful confocal image due to the much improved resolution depth . such a pair of images display images which could provide diagnosis value not available by examining the oct or the confocal b - scan image alone . generally , the oct image will display the maximum depth resolution in the pair when imaging the eye , while the confocal image will display a less speckled image than in the oct image , speckle which masks less the improved transversal resolution along the t - scans in the image . the oct image and confocal image should display a lateral transverse resolution of less than 3 microns , sufficient to observe photoreceptors and tiny vessels in the retina . however , due to the interference principle , speckle will affect the oct image but less the confocal image , therefore simultaneous presentation will provide the user insights into the intimate structure of the tissue not possible by interpreting the oct or confocal image alone . a depth resolution in the confocal image of 50 - 100 microns is sufficient to observe large vessels as well as for profile measurements of the foveal pit and optic nerve . such measurements , of the optic nerve cup and other spatial parameters are essential in diagnosis of glaucoma . depth resolution of sub - micron is achievable in the oct channel of the retina by using a sufficient large band optical source 11 . therefore , if sufficient information along the t - scan is obtainable from the confocal b - scan , due to ao improved transverse resolution , it may not be necessary to introduce external phase modulation in the oct channel , according to comments on the influence of the type of phase modulation employed on the transverse resolution in the oct channel above . in producing such improved resolution pairs of images under ao control , several focus procedures are possible , as derived from the presentation of different focus alternatives above . several t - scans are acquired for different values of the rectangular transverse coordinate either by altering the frame scanner in steps or by changing it continuously at a much slower pace than that of t - scanning , to generate t - scans from essential the same rectangular transverse coordinate . a c - scan from a given depth is obtained by controlling the two transverse scanners 61 and 62 while maintaining the optical path difference in the interferometer constant . by changing the optical path difference , a c - scan from a different depth is obtained and in this way , stacks of oct c - scan images can be obtained . this could be done with or without dynamic focus procedure explained above . in case dynamic focus is applied , then controlling signal via one or a combination of lines 24 c , 231 c , 5 c , or 115 c are sent synchronously with control signal 112 c . the depth change can also be applied continuously at a pace slower than the frame scanner . a c - scan is obtained from a given focus , by controlling the two transverse scanners 61 and 62 while maintaining the same focus . by changing the focus , a c - scan from a different depth is obtained and in this way , stacks of confocal c - scan images . this could be obtained using or a combination of the possibilities mentioned above , by actuating on the 24 c , 231 c , 5 c , or 122 c . the depth change can also be applied continuously at a pace slower than the frame scanner . pairs of oct and confocal c - scans have been reported by using one of the embodiments in u . s . pat . no . 5 , 975 , 697 and u . s . pat . no . 6 , 769 , 769 patents . however , stacks of such pairs collected with the methods described in these two patents show anunchanged confocal image , due to the very large depth of focus in the aberrated confocal channel . the c - scan confocal image in the pair does not provide any depth information , and therefore , all c - scans , at different depths are the same . the embodiment in fig1 allows generation of a more meaningful confocal image due to the much improved resolution depth . such a pair of images provide diagnosis value not available by examining the oct or the confocal c - scan image alone . this strategy , of collecting pairs of depth resolved c - scan images in both channels , allowed by ao aberration correction , is illustrated in fig2 a , where the confocal image in the pair is scanned in synchronism with the oct image . the oct image will be the thinnest in the pair , while the confocal image will display a less speckled c - scan image than the oct image , speckle which masks less the improved transversal resolution along the t - scans in the image . ( ) depth guidance of c - scan oct images via a fixed depth confocal c - scan image in c - scan regime , it may be advantageous not to produce stacks of confocal c - scan images , but to provide guidance in collection and interpretation of c - scan oct images from different depths . due to much enhanced depth resolution in the confocal channel when applying ao correction , better selection in depth is possible . in conjunction with independent focus adjustment in the confocal channel as explained above , for instance by actuating in the non common path , via 122 c , on the lens 122 in the uncommon confocal path , allows fixing the depth of the confocal c - scan image . this strategy , allowed by ao aberration correction , is illustrated in fig2 b . this could be left at the depth selected by the ao channel , usually at the rpe level as shown in fig2 b , or could be independently set at other depth position , depending on the user choice investigating the pathology , either in the choroid , below the rpe , or above the rpe , at the level of the retinal nerve fibre layer . such guidance was not possible in conventional combined oct / confocal instruments , where the confocal image had usually a low depth resolution c - scan image , close to that of a fundus camera , i . e an image where the brightness of each pixel in the raster was given by an integration over 300 - 500 microns in depth . such low resolution did not allow separation between choroid and the fiber layer , which are apart by approximately 500 microns . in the embodiment in fig1 , the oct and confocal channels can operate simultaneously to produce pairs of oct and confocal images at the same time . alternatively , the confocal channel 12 and splitter 32 could be eliminated and the core of the oct system could be sequentially used , as disclosed in the application us20040233457a1 to generate an equivalent slo image . the switch between the confocal and the oct regime can be implemented by using an opaque screen to block the reference beam , shown in dashed line , 116 , where the two photodetectors 106 and 107 are apds . their gain is self adjusted depending on the incident power , low in the oct regime due to the high power from the reference beam and high in the confocal regime , when the only power is that from the object . such embodiments have the advantage of being less complex and that more signal returned from object 8 is used in each channel , oct or confocal than being shared by the two channels via the beam - splitter 32 . in this case , a confocal b - scan image is obtained after the blocking screen 116 is in place , by scanning the focus based on one of the procedures described for focus adjustment in the confocal channel at the core of the oct channel . similarly , c - scans at different depths in the confocal channel are obtained via the same focus procedures after the screen 116 is in place . oct b - scan and c - scan images can be obtained for the case of simultaneous oct / confocal imaging . in comparison with sequential oct / confocal images obtained with conventional systems via non - corrected aberrated paths , the images collected with the embodiment in fig1 have better signal to noise ratio . alternatively , because the signal strength is enhanced due to correction of aberrations , less power could be sent to the eye to obtain similar signal to noise ratio as that in images generated via aberrated paths . in a different aspect , embodiments of the invention provide solutions for imaging with high resolution in an oct and fluorescence confocal channel by compensating the aberrations using an ao closed loop channel . by suitably combining dichroic beam - splitters with the excitation wavelength , different possibilities exist . illustrated here is an example of how to reconfigure the embodiment in fig1 to excite and image the indocyanine green ( icg ) fluorescence in the eye . the source 11 could be chosen as a superluminiscent diode operating at 793 nm and the beamsplitter 32 could be a hot mirror which transfers ( reflects as an example in fig1 ) the fluorescence , which peaks at 835 nm towards the confocal receiver 12 . a supplementary filter , 124 , shown in dashed line in fig1 , could be provided to eliminate the excitation wavelength at 793 nm and enhance the contrast , as presented in the u . s . pat . no . 6 , 769 , 769 . filter 124 could be a long pass filter , and could be mechanically inserted or pulled out , customising the channel on either the fluorescence or on the excitation wavelength , residually reflected by the dichroic splitter 32 . this leads to a system with 3 channels , oct , confocal and fluorescence . by using another dichroic splitter in the output path towards the confocal channel 12 , to spectrally separate the excitation light from the fluorescence light , a confocal channel on the excitation wavelength and a confocal channel on the fluorescence could operate simultaneously and not sequentially . in this case , 4 is equipped with a three channel simultaneous display system . the ao system corrects for aberrations and in this way , high resolution is achieved in the oct channel at 793 nm and in the fluorescence channel at 835 nm . such a system could be valuable in distinguishing very small vessels in the retina flown by the icg , with potential diagnostic in age related macula degeneration and choroidal neovascularisation . a further possibility for the embodiment in fig1 is for the ao system to operate in single path correction . wavefront correction could be introduced in single and double path configurations . one can use correction in single path when the corrector operates on the beam emerging from the object but not on the beam going to the object . in such systems , the beam still suffers the aberration while propagating to the object through the imaging focusing element , such as the eye lens . by using a very thin beam towards the eye pupil , aberrations are kept low because the beam is sent via the centre of the eye . the larger the beam diameter , the better the resolution . therefore , for the returned beam , the eye pupil is kept large , 5 - 7 mm , in which case the beam cumulates aberrations and by correcting for these aberrations , transverse and depth resolutions corresponding to the large beam diameter value are possible to be achieved . in double path , the corrector 22 responds to aberration introduced in the beam while propagating to the retina as well as to the aberration cumulated in the return path of the beam , in which case the beam diameter is generally the same for the incident and for the emerging beam . the single pass correction has advantages in terms of less aberrations to be collected and corrected for . the embodiment in fig1 can be used single pass , by restricting the object beam diameter out of 110 , by using a short focal length focusing element 110 . in this way , confocal channel and oct channel operate under single path aberration correction . when the confocal channel 12 is tuned on the fluorescence generated in the object , 8 , by beam of source 11 , single pass correction is applied to corrector 22 for both oct object beam and fluorescence beam . because the wavefront sensor 23 operates on the wavelength of source 11 , in fig1 , the interface optics elements should preferably be mirrors . those skilled in the art will recognise that other possibilities exist in terms of customising the beam - splitters in fig1 , without diverting from the scope of the invention , to achieve similar functionality on different other pairs of excitation and fluorescence wavelengths , to address imaging of other fluorescent drugs for the eye or confocal microscopy . fig3 shows a second embodiment of the invention , where the confocal channel 12 and the ao system 23 use a different source 21 to that used by the oct channel . features of the second embodiment that are the same as those in the first embodiment will not be discussed . light from source 21 is collimated by the focusing element 210 . the two systems ( i . e . oct and confocal ) operate at different wavelengths . for instance , for imaging the retina , the preferred wavelength is in the 700 - 1100 nm range . this embodiment is especially useful for an oct channel for skin , where the source 11 operates at 1300 nm for better penetration depth in the oct channel than at 800 nm ( scattering in tissue is less at 1300 nm than at 800 nm ). however , at this wavelength , avalanche photodiodes ( apd ) and photo - multipliers have low gain and the wavefront corrector and confocal channel may not achieve the same sensitivity as in the embodiment in fig1 . therefore , in order to use silicon apds , the wavelength of the source 21 is chosen in visible or infrared such as 800 nm . in this case , the beam - splitter 33 used to inject light from source 21 into the common path is dichroic , beamsplitter 32 is also dichroic , for instance a cold mirror , to allow 1300 nm through and reflect 800 nm . in this way , less oct signal is lost than in the embodiment in fig1 . in such an embodiment , oct operates at a wavelength of 1300 nm , while the confocal receiver and the wavefront sensor in the ao channel operate at a different wavelength , 800 nm . light from 21 is sent towards 32 along the confocal uncommon path , then to uncommon 2 - path to 31 , to the common path up to the object . light returned from object 8 , if of wavelength of the source 21 will be reflected by 32 towards 12 and if of wavelength of source 11 will reach 101 . light of both wavelengths reach the wavefront sensor 23 , therefore splitter 31 is a neutral splitter . in this case , the ao system can be customised on the oct wavelength , of source 11 . if the wavelength is 1300 nm , photodetector array 235 is an ingaas array . as a different functionality , source 21 can be used to provide the wavefront sensing beam only . for instance , 21 could be a visible source , or 670 - 800 nm and source 11 operates at 850 nm . in this case , the confocal and oct channel operates at the same wavelength , 850 nm , which for analysing of tissue could be 1300 nm and the photodetector 121 in the confocal channel 12 uses a germanium apd . as another possibility provided by such embodiments , involves using a spectral filter 236 in front of the wavefront sensor 23 , using either the wavelength of source 11 or 21 can be chosen to serve as wavefront sensing beam . in this case both wavelengths should fit within the spectral sensitivity of the photodetector array used , silicon or ingaas . for instance , for the eye imaging source 21 could operate at 670 - 800 nm and the oct at 820 - 920 nm . in terms of the focusing possibilities allowed by the embodiment in fig1 , all are possible here too . however , in this case if a focusing element is used in the uncommon 2 - path , its utilisation will separate in depth the confocal depth selection from that of the confocal core of the oct channel . in addition to the focusing alternatives compatible with the embodiment in fig1 , this embodiment allows a supplementary solution , opened by using the curvature of the beam generating the reference point for aberration evaluation . the embodiment in fig1 does not allow such an approach , as the same source , 11 is employed for imaging as well as for the ao system . in the embodiment in fig3 , another novel possibility is created if the source 21 is also used to generate the wavefront sensing beam . by moving the focusing element 210 which respect to source 21 , the convergence of the wavefront sensing beam is changed and the beam will focus in front or behind the rpe . in such circumstances , the wavefront sensor 23 will detect a defocus and actuate on the corrector 22 to focus the wavefront sensing beam back at the rpe depth . in doing so , the convergence of the confocal and oct beam will also change , resulting in the oct fibre input 101 and pinhole or fibre input 123 being conjugate with points other than the rpe . to generate the depth focus scanning as required by b and c - scanning regimes , the relative position of the focusing element 210 to source 21 could be changed under control line 210 c . consider that 210 was moved closer to source 21 . in that case , the wavefront sensing beam will focus behind the rpe , the corrector will be actuated to bring it back to the rpe and the confocal channel and the oct channel will consequently focus at a point in front of the rpe . similarly , by increasing the distance between source 21 and focusing element 210 , the oct and confocal channel will be focused at points behind the rpe . it will be clear that , the method operates in closed loop . it should be obvious for those skilled in the art that this method could be combined with any other method of focusing presented in connection with the embodiment in fig1 ., to extend the focusing range or modify the start depth and end depth of the two depth ranges in the oct and confocal channel . a version of the embodiment in fig3 is shown in fig3 a . the beam - splitter 33 is incorporated in line with the wavefront sensor , 23 , after beam - splitter 31 , in which case the beam - splitter 31 could be dichroic . light from source 21 is launched into the common path and if splitter 31 is dichroic , only light of the same wavelength will reach the wavefront sensor 23 . in this case , it is possible for the oct and confocal channel to operate on the same wavelength and for the wavefront sensor to operate on a different wavelength , of the source 21 . in this case the splitter 32 is neutral . similar to the embodiment in fig3 , the confocal channel could be tuned at the same wavelength as that of source 21 , in which case 31 is neutral and 32 is dichroic . such an example is for imaging of skin , where source 11 operates at 1300 nm , and as explained above , by using silicon based ccd array in 235 and silicon apd in 121 , higher sensitivity is achievable than that when operating at 1300 nm . it may also be possible , that source 21 serves the confocal channel only , in which case apart from splitter 33 , splitter 32 would also be dichroic . splitter 33 could be placed between oct splitter 3 and splitter 31 , but this path is shared by both confocal and oct paths and any splitter here will introduce losses in both channels . the source 21 to be used in fig3 and 3 a could be low coherence or lasers , while the source 11 could be a low coherence source . a different solution is shown in the embodiment in fig4 to minimise the losses in the oct channel . in this case , the source 21 delivers the wavefront sensing beam . the beam from the source 21 is introduced in the common path via a neutral or dichroic splitter 33 , and via the oct splitter 3 . to stop light from 21 reaching the reference input fibre 102 , blocking filter 36 is used to reject light of the frequency of the source 21 . this is feasible especially when the wavelength of the two sources are different and easier if the source 21 is a laser . rejection of light is easier if the band to be rejected is narrow instead of wide band . consider that the wavelength of source 11 is 850 nm and the wavefront source 21 operates at 670 nm . all the signal at the oct source wavelength returned from the object 8 is sent towards the object input fibre 101 of the oct channel by using a dichroic beam - splitter 31 , to reflect the oct wavelength , e . g . 850 nm , and transmit the wavelength from source 21 ( 670 nm ). at the other output of the beam - splitter 31 , the beam of wavelength of the source 21 is sent towards the wavefront sensor 23 and confocal receiver 12 via a beam - splitter 32 , with element 35 being a mirror . the splitting ratio of the splitter 32 is chosen depending on the sensitivity of the confocal channel 12 and the wavefront sensor 23 . in the embodiments described in relation to fig3 , 3 a and 4 , the corrector 22 is used by both wavelengths , of the two sources , 21 and 11 to offer a reduced aberration beam to the confocal channel and oct channel operating at different wavelengths . therefore , optical elements in the paths traversed by both wavelengths have to be achromatic , therefore mirrors are preferably used in the interface optics 7 and focusing element 5 . further functionality is achieved if the two beams emergent from the two sources , 11 and 21 have different beam diameters . in the spirit of single path correction as explained in connection with the embodiment of fig1 above , essential is to launch an object beam sufficiently thin for the aberration in the launching path to be neglected . consider that focusing element 110 is of long focal length , so source 11 generates the wavefront sensing beam for dual path and the focusing element 210 is of short focal length , so source 21 generates the wavefront sensing beam for single path correction . using sources with sufficient separated wavelengths , a band pass filter 236 could be provided in the wavefront sensor 23 to select between single path and dual path . the two sources ( source 11 and source 21 ) could be two similar low coherence sources operating at similar wavelength values with similar optical bandwidth . in this case , the selection single path or dual path is obtained by switching on and off one or the other optical source . a blocking filter , 36 , would not therefore be necessary . fig5 shows another embodiment of the system for high resolution imaging , where the correction of aberrations is applied in single path . a source 21 is provided to send light via a focusing element 210 , through a beamsplitter 76 , which creates a reference spot on the object , retina 8 in fig5 , to be used by the wavefront corrector 23 . to reduce losses on the splitter 76 , its splitting ratio can be optimised to allow most of the beam from the common path pass towards and from the object , 80 - 98 %, and this could be achieved by using a sufficient power source 21 . the beam out of source 11 can be also prepared thin by using a short focal length focusing element 110 , such as a short focal length lens or a high power microscope objective or very curved spherical mirror . for instance , for the eye , a thin beam could be considered when in the range of 0 . 5 to 1 mm . in this way , the aberrations incurred when the beam from 11 passes through the imaging focusing element 9 can be ignored . in this case , aberrations are incurred by the two beams , of the source 11 and 21 when light backscattered from the object 8 traverses the imaging element 9 only . because scattering is of wide angle , both beams gain the diameter of the imaging focusing lens 9 , the pupil in case of the eye . therefore , the wavefront sensor 23 practically senses single path aberrations and the wavefront corrector 22 is driven to minimise the aberrations for the wavefront sensing beam generated by the source 2 in return from the object 8 along the common path . by doing so , single pass aberrations for the beam of the source 11 are also compensated for . source 21 could be a laser or a low coherence source of different wavelength than that of the source 11 . the wavefront sensor 23 could be set to work on the wavelength of source 11 or source 21 , by using a band pass filter 236 , in front of the wavefront corrector 23 to select the desired wavelength band . when the wavefront sensor 23 works on the beam of source 21 , it is possible to use lenses instead of mirrors in the interface optics between the object 8 and the corrector 22 . in other words , all elements 51 to 54 and 71 to 74 could be lenses , whereby using a blocking filter 236 in the wavefront sensor 23 , the reflections of the beam from source 11 by lenses will not reach the photodetector array 235 in the wavefront sensor 23 . lenses are of lower cost and introduce less aberrations than mirrors when utilised on axis . to further reduce losses in the oct and confocal channels , beamsplitter 31 could be dichroic , allowing most of the light from 11 to pass towards the oct fibre input 101 and confocal receiver and most of the light of 21 to pass towards the wavefront sensor 23 . however , to collect the aberrations , the scanners 61 and 62 have to be set at an angle to route the object beam along the wavefront sensing beam , usually on - axis . at any other angle , the wavefront sensor is deprived from the wavefront sensing beam generated by the source 21 . therefore such an ao system can only operate in open loop when using source 21 , according to the following steps : ( 1 ) with no depth scanning and no t - scanning , i . e . with the scanners 61 and 62 fixed on tilts to direct the object beam along the direction of the wavefront sensing beam , the ao system is used to evaluate and then reduce the aberrations in the at least correcting path ; ( 2 ) control signals towards the wavefront corrector 22 are memorised , ( 3 ) the link between the wavefront sensor 23 and the wavefront corrector 22 is interrupted and ( 4 ) t - scan are performed , while the same correction of aberrations according to the stored values in step 2 is maintained . the signals provided to corrector 22 can be combined with controlling signal to change the focus of the object beam , as described in connection with the embodiments in fig1 and fig3 . these focus adjusting signals are applied to the wavefront corrector , to modify the position in depth where both channels , confocal and oct focus and t - scans are collected from . if mirrors are used in the interface optics 7 in fig5 , the group of beamsplitter 76 and source 21 could be placed anywhere along the common and uncommon oct and confocal paths . if the group is placed before scanners 61 and 62 , it allows aberration compensation at any tilt of the scanners 61 and 62 and not only along single axis . if mirrors are used in the interface optics 7 in fig5 , then source 11 could also serve as providing the wavefront sensing beam . a band pass filter 236 could be chosen to select either the wavelength of the source 11 or that of the source 21 . to allow for good spectral selection , the wavelengths should be sufficient distant apart . for instance , 11 could be a low coherent source operating at 820 nm and 21 a laser or another low coherent source operating at 750 nm . when selecting the wavelength of the source 21 using the filter 236 , the correction is single path . when selecting the wavelength of the source 11 , the correction is either single path or double path , depending on the focal length of the focusing element 110 . if a short focal length element is used , then the correction is single path too , if a long focal element is used , then the correction is dual path . such a selection allows such an embodiment to correct aberrations either : 1 . in dual path for the oct and confocal channels or in single path for the fluorescence channel only ; 2 in single path for all channel , oct , confocal and fluorescence . such a versatile system could be used in research to evaluate how important is for the fluorescence generation the enhanced concentration of radiation which takes place when dual correction is used . the same comments in terms of best choice of neutral beamsplitters or dichroic beamsplitters are valid as mentioned during the presentation of the embodiment in fig1 , in order to minimise the losses in the 3 channels . however , by using a different source 21 for the wavefront sensor 22 , as shown in fig5 , a dual system oct / fluorescence channel could be implemented using lenses instead of mirrors in the interface optics , i . e . elements of interface optics 51 to 54 and 71 to 74 could be lenses , as the reflection of the beam from source 11 does not upset the photodetector 235 in the wavefront sensor 23 , if the wavefront sensor beam is from source 21 , preferably chosen close to the fluorescence band . such an embodiment could operate in open loop only , according to the following steps : ( 1 ) with no depth scanning and no t - scanning , i . e . with the scanners 61 and 62 fixed on tilts to direct the object beam along the direction of the wavefront sensing beam , the ao system is used to evaluate and then reduce the aberrations in the at least correcting path ; ( 2 ) control signals towards the wavefront corrector 22 are stored , ( 3 ) the link between the wavefront sensor 23 and the wavefront corrector 22 is interrupted and ( 4 ) source 21 is switched off and t - scan are performed , while the same correction of aberrations according to the stored values in step 2 is maintained . the signals provided to corrector 22 can be combined with controlling signal to change the focus of the object beam , as described in connection with the embodiment in fig1 to produce b - scans and c - scans in the oct and the fluorescence channel . if a large beam diameter is launched by source 11 , then the oct and confocal channels are not corrected for aberrations while the fluorescence channel only is . focus adjusting signals can be applied to the wavefront corrector 22 , to modify the position in depth where the three channels , fluorescence , confocal and oct focus and t - scans are collected from . however , if aberrations are not corrected in the oct and confocal channels , depth resolved b - scans and c - scans are obtained in the oct and fluorescence channel . the system could operate as a 3 imaging channel system , oct , confocal on the same wavelength as that of the oct channel and fluorescence channel , as described in the presentation of the embodiment of fig1 , either sequential confocal / fluorescence by shifting the spectral filter 124 or simultaneous confocal / fluorescence by using a dichroic beamsplitter to separate after beamsplitter 32 , the wavelength of source 11 for the confocal channel and the fluorescence signal for the fluorescence channel . the confocal aperture 123 in the confocal channel is sufficient to eliminate or reduce reflections from the interface elements 51 , 52 , 71 and 72 , and from the focusing elements 53 , 54 , if they are lenses . fig6 shows a fifth embodiment of the system for high resolution imaging , where a common focus element 110 is used for both oct and confocal channels in the uncommon path . the oct splitter 3 is in single mode fibre and tied by fibre to transfer light from the object 8 to the input 101 of the balanced splitter 103 . the aperture of the confocal receiver at the core of the oct is now at the fibre tip 106 of the fibre 126 , behind the splitter 32 . light diverges out from the aperture fibre . 100 . by axially moving the collimating element 110 , the convergence of the beam sent to the interface optics 7 changes . the aperture of the oct input , 100 , is conjugate by virtue of beamsplitter 32 with the confocal aperture 106 , here implemented in fibre 126 , which could be single mode or multimode . input 110 could be moved under computer , e , g , pc 4 control , showed by control line 110 c . irrespective of focus correction by elements 55 and 56 , or the deformation of the corrector 22 , the two fibre apertures 100 and 106 are all the time conjugated . these could be moved away from the conjugate initial points , in case separate depth adjustments are required in the two channels , in which case similar functionality is achieved as described in the focus procedures presented in connection to the embodiment in fig1 . control lines could equally be applied to the two fibre tips , 100 and 103 , as shown by 100 c and 106 c . the reference beam exists the splitter 3 and is collimated via focusing element 18 and rerouted via mirrors 37 and 38 ( optional ) towards the reference input of the balanced splitter 103 . the combination of input 110 and apertures 100 and 106 is maximised for maximum signal collected in the splitter 3 . the beam diameter captured into the fibre is the same with the beam diameter generated by the output beam from 100 , therefore such a configuration can only be used for dual path correction . ( single path correction as discussed in connection with fig1 and 5 requires different beam diameters of the incident and emergent beams ). due to fiber end reflection in 100 , this configuration cannot be used for sequential oct / confocal operation , only for simultaneous regime using a separate confocal receiver 12 as shown in fig5 . however , the embodiment in fig6 has the advantage of using a compact interferometer , in fibre and focusing via a lens or microscope objective 110 in the uncommon 2 - path , which can eliminate the need for the focusing element 5 in the path to the object . a single element 110 could now be moved to keep both confocal and oct apertures in focus . preferably , to keep the dispersion low , the splitter 32 is used in reflection by the oct and in transmission by the confocal channel . fig7 shows another embodiment of the system for high resolution imaging that is generally similar to fig1 , where the wavefront sensing beam is sent towards the object 8 , via a fixation lamp filter , 76 and the wavefront sensor 22 does not sense the effect of the corrector . this is a dichroic filter or a hot mirror , which reflects the light from the source 11 , in case of the eye , 800 nm . this also allows light from fixation lamp , 77 to be transferred towards the eye 9 , preferably yellow or green . by moving spatially the optical source 77 , the eye is guided and such an operation is known for those in the art of eye imaging . a low reflectivity splitter , 78 is used to send light from the fixation lamp 77 to the eye . for maximum transmittance of the light reflected from the object , 8 , towards the wavefront sensor 23 , preferably splitters 78 and 79 have a high transmittance . the fixation filter 76 is incorporated within the interface optics , by means known in the art . equally , it could be placed between mirrors 73 and 74 with matched convergence to the common path beam . in this embodiment , the confocal receiver and the oct use a different wavelength to that of the ao channel . the source 21 could be a low coherence source or a laser while source 11 is a low coherence source . this embodiment may have the disadvantage of different optical path for the ao and the imaging system oct and confocal , which may lead to noncompensation of aberrations in the oct and confocal channel due to interface optics and scanning . however , as long as the main distortions are due to the object , this may not be too disadvantageous . the common path reduces in this embodiment to the path from splitter 76 to the object 8 . in the embodiment in fig7 , it is considered that the main aberrations are due to the object and the scanning and interface optics do not add any wavefront distortions . while the corrector 22 in fig7 is used to compensate for the object aberrations , it is also possible to include a second corrector in series with a different time constant , to correct for the internal system aberrations . this will require another wavefront sensor , possible like in the embodiments in fig1 , 3 or 4 . such an embodiment will have two correctors , 22 , in series , one external , under the control of the wavefront sensor 23 in the fixation lamp , as shown in fig7 and the other one internal , under the control of the wavefront sensor in fig1 . the two correctors could be sensitive to two different types of signal . the internal corrector is trained using a non - aberrated object and corrections are stored depending on the inclination of the scanning beam . then , in the process of scanning an object , the internal corrector is driven by the stored values of control signals while the external corrector is under the real time control of the wavefront sensor in the fixation lamp . in this way , aberrations due to scanning and aberrations due to the object are compensated for . the correctors could be customised for these two different tasks , for example , one corrector with the main task of compensating for scanning corrections , for large defocus aberrations , using a smaller number of actuators , and the other for higher aberrations due to the object , which requires a large number of actuators . in figures above mirrors are used for the focus and interface optics , however lenses could equally be used if antireflection layers are optimally used to avoid stray reflections and chromatic elements to accommodate the large band of the oct source 11 and the large spread of frequencies when using different wavelengths for oct , confocal receiver , fluorescence and wavefront correction . it will be apparent that the above mentioned improvements in focussing using the wavefront corrector 23 and the wavefront sensor 22 could equally be applied to arrangements that combine a oct system and an ao system , without a confocal system present . such embodiments could produce a t - scan , a c - scan or a b - scan as described above . similarly , the above mentioned improvements in focussing using the wavefront corrector 23 and the wavefront sensor 22 could equally be applied to arrangements that combine a confocal system and an ao system , without an oct system present . such embodiments could produce a t - scan , a c - scan or a b - scan as described above .

US-23967705-A

the present invention provides a game having accentuating light emanating through or from a translucent playing surface , sidewalls , and / or representative players .

the present invention will be further explained with reference to fig1 to 4 . with reference to fig1 and 2 , a representation of a soccer field is generally illustrated by playing field 10 . playing field 10 may include indicia of a regulation soccer field including , for example , goalie box 12 , center kickoff circle 14 , center line 16 , and the like . playing field 10 is surrounded by sidewall 18 . instead of regulation markings , playing field 10 may have indicia of players , whimsical designs , or the like . playing field 10 is made , at least in part , of a material clear , transparent , translucent , or semi - translucent to light . for simplicity , the term translucent as used in this application , is intended to encompass anything other than opaque . for example , playing field 10 could be a clear plastic , glass , colored plastic , colored glass , a frosted glass like surface , or the like . further , playing field 10 could have portions of the playing surface translucent ( including varying degrees of translucence ) or opaque to form patterns and designs in the playing surface . still further , playing field 10 could be designed to have a lighting effect that may reflect , refract , or disburse light , such as , for example , a prism . a light source , which will be explained further below , can be placed below the playing field 10 , providing a lighted surface on which foosball could be played . referring now to fig2 a side plan view of the foosball table is provided . residing beneath playing field 10 , is at least one light source 20 . as shown , light source 20 could be a single florescent light tube extending down the center of the playing surface . of course , the tabletop game could be designed so that the light is completely or partially enclosed by the sidewalls . however , multiple rows of florescent light tubes may be used . further , light tubes could be arranged parallel or diagonal to the long or short dimension of the playing field 10 . other types of lights , however , could also be possible , such as , incandescent lights , halogen lights , light strings ( such as christmas lights ), lcds , leds , lasers , electro luminescent light sources , chemical light sources , light tubes , flexible light wires , or the like . still further , one or more light sources may be mounted in sidewalls so lights tubes , such as florescent lights would not have to run the length of the playing field . in general , almost any arrangement of light can be provided depending on the lighting effect desired . further , light source 20 could be a strobe light or other light that has an on and off feature , similar to a timer , or a string of blinking christmas lights . still further , it would be possible to have a dimmer to manually or automatically control the brightness of light source 20 . finally , a timer could be used to control an on and off pattern of the lights and the dimmer . instead of having light source 20 reside beneath the playing field 10 as shown , it would be possible to mold a glass or plastic playing surface such that one or more tubes or conduits 32 existed in the playing field 10 , as shown in phantom in fig3 . for example , fig3 shows three conduits 32 molded in playing field 10 . in this case , conduits 32 are open to each end 34 of playing field 10 , but conduits 10 could be open on one , both , or neither side . if ends 34 and conduits 32 are not open , light could be coupled , refracted , or reflected into conduits 32 through a solid end 34 . while conduits 32 are shown generally straight and parallel the longer dimension of playing field 10 , other configurations are possible . conduits 32 , for example , do not need to be identical , could be curved , could be part curved and part straight , could be diagonal , or the like . further , conduits 32 are shown with a cylindrical geometric shape , but other shapes are possible whether irregular , random , or geometric . further , ridges , grooves and other imperfections in the conduits may cause desirable lighting effects ( such as a prism effect ). [ 0018 ] fig3 shows optional reflective layer 36 . instead of reflective layer 36 , a reflective surface 38 could be supplied , which is shown in phantom . reflective layer 36 or reflective surface 38 can be any conventional light reflecting surface , such as a mirror or mirrored coating on , for example , glass . while reflective layer 36 or reflective surface 38 could be used with any light source mentioned to provided various lighting effects , it is contemplated that reflective layer 36 or reflective surface 38 would enhance the ability of light source ( s ) 20 residing along a sidewall to illuminate areas of playing field 10 not substantially adjacent light source ( s ) 20 . it is believe using reflective layer 36 or reflective surface 38 will reduce the amount of light the light source needs to provide . by reducing the amount of light the light source needs to provide , it is hoped that the number of lights that need to be packaged will be reduced . a light source ( not shown in fig3 ) could be placed such that light from the source shines down conduits 32 . instead of simply providing a light source , conduits 32 could be lined to enhance the light or light carrying ability . further , emitting tubes could be placed in conduits 32 to assist in light transmission . such light carrying tubes are described in , for example , u . s . pat . no . 5 , 879 , 076 , titled “ method and apparatus for light transmission ,” issued on mar . 9 , 1999 . other light tubes include electro luminescent lights as described in , for example , u . s . pat . no . 5 , 485 , 335 , titled “ electroluminescent light sources ,” issued on jan . 16 , 1999 , u . s . pat . no . 5 , 860 , 930 , titled “ electroluminescent light source with a mixture layer filled with a transparent filler substance ,” issued on feb . 9 , 1999 , and u . s . pat . no . 6 , 400 , 093 , titled “ flexible electroluminescent light source with active protection from moisture ,” issued jun . 4 , 2002 , incorporated by reference . electro luminescent light sources are sometimes known as flexible light wire . other light sources include chemical luminescent compositions , which are sometimes known as light sticks , such as u . s . pat . no . 4 , 313 , 843 , titled “ superior oxalate ester chemical lighting system ,” issued on feb . 2 , 1982 , and u . s . pat . no . 4 , 678 , 608 , titled “ chemiluminescent composition ,” issued on jul . 7 , 1987 . all of which are incorporated herein by reference . referring back to fig1 residing substantially about playing surface 10 are a plurality of representative players 22 . while not shown in detail , one or more players 22 could incorporate various types of lights also . for example , flexible light wire could be used to illuminate an edge of one or more players 22 , lcd light sources could be used to illuminate a strike surface 22 s on one or more players 22 . it is contemplated that players 22 could have some type of electro luminescent light source or chemical luminescent light source because , for manufacturing purposes , it would be difficult to supply a power source to players 22 . however , other styles of light sources can be used , such as , conventional lights , lasers , strobes , halogens , fluorescents , and the like . power for lights could be supplied by running power through bars 24 on which players 22 reside , in this case , by batteries ( not shown ) contained in players 22 , or the like . other style games may have more or less options for supplying power to players 22 . for example , a hockey style game typically has runners in playing surface 10 instead of bars 24 for players 22 . thus , contacts could be supplied along the runners to enable power to players 22 . tabletop games , be they foosball games , table hockey games , football games , or baseball games , basketball games , or the like generally define playing field 10 by a sidewall 18 . as mentioned above , sidewall 18 may have lights affixed to reduce other lighting requirements . further , sidewall 18 may also be translucent , opaque , or a combination thereof to provide reflective light from light source 20 or a separate light source ( not shown ). moreover , in some embodiments of the present invention , playing field 10 may be completely opaque , but sidewall 18 may be at least partially translucent to allow light to pass . referring now to fig4 a tabletop game 400 is shown using the reflective surface 38 . as shown by the cross sectional view , game 400 has a playing surface 10 surrounded by sidewalls 18 . for convenience , one representative player 22 ( the goalie ) is shown on a series of cross bars 24 . under playing surface 10 is light source 20 arranged on sidewall 18 . sidewall 18 can be arranged as shown to have a continuous side , or sidewall 18 could be broken into separate parts , such as a playing field portion above playing field 10 and a support portion below playing field 10 . in this case , a single light source 20 is shown between playing field 10 and a reflective surface 38 , such as a mirror . arrows 42 indicate how the single light source 20 can illuminate the entire playing field by reflecting light off of surface 38 . if playing surface 10 had a layer or coating 44 of a partially reflective material , more light would be transmitted to side 200 opposite light source 20 . partially reflective means some light passes through layer 44 and some is reflected back to reflective surface 38 . the amount of light actually passed by the partially reflective material is a matter of design choice . fig4 also shows a ball drop 46 . if , as mentioned above , lights are provided on players 22 , power could be supplied to the players by wires 48 running through cross bars 24 . while the invention has been particularly shown and described with reference to particular embodiment ( s ) thereof , it will be understood by those skilled in the art that various other changes in the form and details may be made without departing from the spirit and scope of the invention .

US-42449403-A

a method and apparatus for the dilatation of obstructed body vessels , orifices and conduits , combined with a controlled and regulated incision of the dilated body vessels using a bipolar or quasi - bipolar electrosurgical cutting wire arrangement is presented .

unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs . although any methods , devices and materials similar or equivalent to those described herein can be used in the practice or testing of the invention , the preferred methods , devices and materials are now described . all publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing , for example , the structures and / or methodologies that are described in the publications which might be used in connection with the presently described invention . the publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application . nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention . the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventors of carrying out their invention . various modifications , however , will remain readily apparent to those skilled in the art , since the general principles of the present invention have been defined herein specifically to provide a method and apparatus for the combined dilatation and bipolar electrosurgical dissection of tissue . to better understand the benefits and advantages of the invention in comparison to prior - art systems , we will describe the combined dilatation and electrosurgical cutting process in more detail . fig1 depicts the distal end of a conventional dilatation catheter assembly , generally designated 10 , that may be used for dilating a body vessel or conduit for treating a blockage or other obstruction , such as a catheter or urethra . the main elements of catheter assembly 10 are : a catheter body 14 , having a double lumen and an inflatable balloon 15 . a stiffening guide wire or stylet 16 extends longitudinally within one of the two inner catheter body lumens , facilitating guidance of the dilatation catheter assembly during insertion into a body conduit vessel or orifice towards an obstruction site . once the catheter is correctly positioned , the body vessel can be dilated by inflating the balloon by pressurizing it with a fluid through the second lumen of the catheter body . the supply / drainage of fluid is realized by providing the distal end of the catheter body with a series of supply / drain holes 18 , connecting the balloon to the second lumen of the catheter assembly 10 . a dilatation catheter assembly with ( monopolar ) electrosurgical cutting element is schematically shown in fig2 a and 2 b ; a drawing showing two views of such a catheter assembly is shown in fig2 c . as with the dilatation catheter assembly shown in fig1 , the main components are a catheter body 14 , this time with a three - lumen configuration ; an inflatable balloon member 15 ; a stiffening guide or stylet 16 ; and a cutting element or electrode 17 , preferably activated by a radiofrequency electrosurgical cutting power source . an adapter 11 defines the proximal end 12 of the assembly 10 and provides a site for various ports to the assembly 10 . as illustrated in fig2 a and 2 b , one of the three inner lumens serves as an inflation / deflation passageway 18 , the second lumen carries the guide wire or stylet 16 and serves as a drainage / infusion passageway , and a third lumen carries the cutting element 17 . the adapter 11 serves as a site for a balloon inflation / deflation port 19 that is attached to a source of inflation medium ( not shown ) for inflating the balloon 15 , or to a suction source ( not shown ) for deflating the balloon 15 . port 19 has a valve 20 for regulating the inflation medium or suction , as required . port 19 connects into the proximal end of an inflation / deflation passageway 18 that extends from the port 19 to the inflatable balloon 15 . the adapter 11 also serves as a site for the drainage tube inlet / outlet port 22 and a cutting element port 23 . the drainage port 22 is connected to the proximal end of the lumen that carries the guide wire or stylet 16 . the drainage port 22 may serve as a site for removing fluid from the lumen or as a site for infusing fluid into the lumen . the distal end of the catheter body has a series of drain holes 18 to facilitate flushing the lumen with fluid or voiding the balloon 15 . a “ banana plug ” cutting element connector 25 is affixed to the end of the cutting element port . the cutting element 17 extends from the connector 25 through the lumen of the catheter body 14 , exits therefrom via an aperture 26 , and continues along the exterior of the balloon 15 . the inflatable balloon 15 is preferably of the non - distensible variety , i . e ., it can , when expanded , assume only a specific size and shape . thus , the balloon member 15 cannot extend or bulge longitudinally within the body conduit beyond its predetermined diameter or length . unlike elastic or elastomeric balloons , it must exert the inflation force radially against the enclosing body conduit or the like . in contrast , if an elastic or elastomeric balloon is expanded within the narrowed or constricted body conduit , the balloon will simply elongate rather than acting radially against the constriction . one material suitable for the balloon is low density polyethylene ( ldpe ). in addition , however , the inflatable balloon preferably can maintain a constant temperature , even when current is passing through the cutting element . ldpe balloons alone may not maintain a constant temperature under these conditions . accordingly , the ldpe balloon can be covered with a second balloon made from a material , such as silicone , which can withstand high temperatures ( i . e ., temperatures generated during electrosurgical cutting ) and protect the ldpe from bursting during the heating process . this balloon - within - a - balloon arrangement provides both the non - distensible qualities and the temperature profile desired for use with a cutting element as described above . the electrosurgical cutting element 17 is in the nature of a wire that extends generally parallel to the longitudinally extending inflatable balloon 15 . the material used for the wire can be any kind of materials currently used for electrosurgical cutting . for example , the wire can be made of stainless steel or tungsten . the wire is encapsulated in an electrical insulation sheet , with an external incising edge that exposes the wire outwardly from the balloon member . alternatively , the cutting element 17 may be a sharp - edged or a cutting element activatable by a radiofrequency power source . the portion of the exterior of the inflatable balloon 15 that is exposed to the cutting element 17 may carry a protective cover ( not shown ) to further guard against the inflatable balloon 15 being incised by the cutting element 17 . the cutting element 17 may be carried at a predetermined spacing from the balloon surface or directly on the surface . when carried on the surface the cutting element 17 may be an integral part of the surface or may be attached to the surface . in one embodiment , the cutting element 17 is manually extendable or retractable via the connector 25 into and out of the catheter body 14 . in some embodiments , the cutting element 17 is disposed parallel to the balloon 15 . with inflation of the balloon within a body conduit , the inflation causes the cutting element 17 to move radially outward until the cutting element contacts the surrounding tissue . continued radial expansion of the balloon 15 causes the balloon to exert pressure on the tissue , subjecting the tissue to a substantially uniform tangential tension . then , a radiofrequency current can be passed through the cutting element 17 . this combined cutting and dilating action expands the tissue without building up excess stress within the tissue that can lead to tearing . instead , the tissue is electrosurgically cut in a clean , concentrated , generally longitudinally fashion by the cutting element 17 , without the dilatation causing uncontrollable tearing of the tissue and excessive trauma and bleeding . the process of electrosurgical incision is visualized under fluoroscopy and is witnessed by a full dilatation of the balloon . after the vessel , conduit , or orifice is incised and dilated , and the blockage or obstruction is relieved , the power through the radiofrequency cutting element 17 is discontinued . the inflated balloon 15 now provides the additional benefit of acting as a tamponade to reduce bleeding . if desired , the cutting element 17 can be retracted prior to complete deflation of the balloon , and the balloon may be left in place to act as tampon . then the balloon can be deflated by operation of the inflation / deflation port valve and retracted out of the body conduit or orifice . monopolar dilatation catheter assemblies are described in detail in u . s . pat . nos . 5 , 628 , 746 and 5 , 904 , 679 , both to clayman , both of which are hereby incorporated by reference in their entireties . one example of a monopolar dilatation catheter assembly arrangement comprises a 0 . 015 - inch stainless steel cutting wire , 0 . 0035 - inch fluorinated ethylene propylene ( fep ) wire insulation , a low density polyethylene ( ldpe ) balloon with 0 . 0015 - inch wall thickness surrounded by a silicone balloon with approximately 0 . 0025 - inch wall thickness when inflated ( or approximately 0 . 004 - inch when non - inflated ). typically , the outer diameter of the inflated balloon ( s ) is approximately 24 french . the described monopolar cutting process is schematically depicted in fig3 . here , the dilatation balloon 15 is shown in inflated condition , pressing the electrosurgical cutting element 17 against the tissue to be dissected 28 as described in previous section . the opposing electrode to the cutting wire is the return electrode patch 30 , which is firmly attached to the patient &# 39 ; s skin . the electrical circuit between cutting wire element and the return electrode composes of the entire tissue between the two electrodes , which includes — but is not limited to — the tissue in immediate contact and proximity to the cutting wire element . as the cutting wire element is applied with electrical power from an electrosurgical power supply , the electrical current will flow from the exposed wire section of the cutting element 17 to the tissue in immediate contact to the wire . from there , the same amount of electrical current will quickly disperse within the surrounding tissue towards the return electrode path , where it is collected and returned to the electrosurgical generator . in terms of electrosurgical processing , the only noticeably affected area during this process is the tissue in immediate contact and very close proximity to the exposed cutting wire element . here , both the voltage drop and current density are high ( and eventually lead to the formation of an electrical arc ), whereas in the remaining bulk of the tissue towards the return electrode both the voltage drop and current density are low . in other words , the energy deposited into the tissue is very high in density in close proximity to the cutting wire , whereas the energy density in the remaining bulk tissue is very low . as a result , the very high energy density in the tissue close to the cutting wire leads to quick evaporation of the tissue ( electrosurgical cutting ), while the very low energy density in the remaining bulk tissue towards the return electrode merely causes an insignificant raise in tissue temperature . the transition region of moderate energy density is in immediate contact to the evaporated tissue , and expands maximally to a few millimeters into the bulk tissue . in electrosurgical processing , this region is also referred to as the “ thermal spread ”. even though the electrosurgical effect in the bulk tissue — where the energy density is very low — is insignificant to practically non - existent , there is still a considerable amount of total energy deposited in the tissue overall . while is this is not a problem per se as long as the total energy is distributed in the bulk tissue , it allows the possibility of two failure modes . both risks are based on an inadvertent increase of the current density ( and thereby energy density ) within the bulk tissue , as the electrical power is traveling towards the return electrode . the first failure mode occurs when the return electrode partially delaminates from the patients &# 39 ; skin tissue , resulting in a reduction of the contact area . this in turn will increase the current density ( and energy density ) at the contact area between return electrode and the patients &# 39 ; skin . instead of the electrical current continuously dispersing through the bulk tissue towards the return electrode , a delaminating return electrode results in the electrical current concentrating again when reaching the return electrode patch . if the energy density is high enough , this can lead to severe burns of the patient &# 39 ; s skin . most modern return electrode patches use strong , electrically conductive adhesives that firmly attach to the patient &# 39 ; s skin , as well as a “ split ” electrode arrangement that allows the esu to monitor that the entire return electrode patch is firmly connected to the patients &# 39 ; skin . nonetheless , the possibility of delamination , however minimal , poses ad hoc some risk as current is traveling through large volumes of tissue . the second failure mode is similar in principle and occurs when the monopolar electrical current flows through constrictions in the tissue as it travels through the bulk tissue towards the return electrode . this is illustrated in fig4 , showing the cutting element 32 pressed firmly against the tissue 34 to be cut . instead of the electrical current dispersing throughout the bulk tissue 36 as it travels towards the return electrode 38 , a constriction in the cross section of a tissue segment 40 will exhibit an increase in current density . if the resulting current density ( i . e ., energy density ) is high enough , this can lead to severe burns , or even cuts of the constricted tissue . this failure mode is of particular concern as it can occur outside of the surgeon &# 39 ; s view . other potential problems with monopolar electrosurgical cutting devices have been discussed above . for example , capacitive coupling , resulting from activation of a monopolar electrosurgical cutting device without making contact with tissue , may lead to unintended burns where another metallic component nearby conducts electricity away from the intended cutting site . cutting may fail in the presence of saline , urine , contrast solution or other conductive solutions , and training is required to ensure that surgeons apply current before expanding the balloon to create a spark gap for efficient cutting . the invention described herein , a bipolar or quasi - bipolar electrosurgical cutting device , greatly reduces or eliminates these potential problems . a first embodiment of the current invention is shown schematically in fig5 a , describing a bipolar , two cutting wire arrangement . a catheter body 42 with a three - lumen configuration is employed with a non - distensible balloon 44 . materials suitable for the balloon include low density polyethylene ( ldpe ), polyetheretherketones ( peek ), polyether block amides ( peba ), polytetrafluoroethylene ( ptfe ), nylon 11 , nylon 12 , and other similar compounds , as will be appreciated by those skilled in the art . non - distensible balloons made from materials having melting temperatures below about 180 ° c . may be covered by a second balloon composed of a high melting temperature ( greater than about 180 ° c .) material , such as silicone , to prevent damage to the underlying non - distensible balloons during the heating process . some materials exhibit both the desired non - distensible qualities and high - melting - temperatures and can be used in balloons without a secondary covering . examples of such materials include , but are not limited to , nylon 11 and nylon 12 , and other non - distensible balloon materials having a melting temperature greater than about 180 ° c . in one embodiment , a balloon composed of ldpe , peba , peek or nylon 12 and having a wall thickness of approximately 0 . 0015 - inch is used with a silicone balloon having a wall thickness of approximately 0 . 0025 - inch ( in the inflated state ). in another embodiment , a balloon composed of nylon 11 or nylon 12 and having a wall thickness from about 0 . 0015 - inch to about 0 . 005 - inch is used without a silicone balloon covering . the inflated outer balloon ( s ) diameter typically is from about 24 french to about 30 french . while one lumen carries a guide wire , and a second lumen provides the channel for the insufflation fluid , the third lumen carries two electrical cutting wires 46 and 48 , imbedded in an electrical insulation sleeve 50 . alternatively , each wire may be separately imbedded in an electrical insulation sleeve . in either case , the portions of the insulation sleeve facing away from the balloon ( s ) are cut or sliced or otherwise open to leave the wire ( s ) exposed . fig5 b shows the two cutting wires on the outside of the inflated balloon 44 . fig7 a and b show close - ups of the electrical cutting wires imbedded in a single insulation sleeve ( 7 a ) or in separate insulation sleeves ( 7 b ). as with the monopolar catheter assembly , the material used for the cutting wires in the bipolar catheter assembly can be any kind of materials currently used for electrosurgical cutting , such as , for example , stainless steel or tungsten . in one embodiment , 0 . 010 - inch to 0 . 015 - inch stainless steel cutting wire is used with approximately 0 . 0025 - inch fluorinated ethylene propylene ( fep ) insulation material . in this bipolar arrangement , the electrical current is flowing from one cutting wire — through the tissue — to the second wire . with this configuration , the return electrode patch applied to the skin of the patient when using a monopolar device is not required . moreover , the bipolar configuration creates its own spark - gap between the two wire electrodes . the current density in the tissue immediate to the exposed cutting wires 46 and 48 is exposed to a high current ( and energy ) density 52 , and is quickly cut . unlike the monopolar case , the electrical current in the bipolar case does not travel through large volumes of tissue , and instead is restricted to the tissue in very close proximity to the cutting site . the electrical current between the two cutting wires actually “ spills ” over into neighboring tissue , following the electrical field generated within the tissue . this is illustrated in fig5 by the electrical field lines 54 . because electrical energy is directed only entirely into the tissue between the two wires , resulting in the high current ( and energy ) density that results in cutting , and because the electricity does not have to travel through large volumes of bulk tissue , the bipolar configuration shown in fig5 requires less total power to achieve the same cutting effect as the monopolar configuration . at the same time , the absence of current traveling through large volumes of bulk tissue ( outside the view of the surgeon ), eliminates the risk of electrical burns through constricting tissue elements or delaminating return electrode patches . another embodiment of the present invention is depicted in fig6 , showing a quasi - bipolar cutting arrangement . here , the cutting wire 56 is again positioned on the outside balloon surface , as in the monopolar configuration , while a second electrode 58 is arranged on the outside surface of the entire balloon surface 60 . when inserting the balloon arrangement into a restricted body cavity or orifice , dilatation of the balloon leads to electrical contact between both the exposed section of the cutting wire 56 and the return electrode 58 with the tissue . the electrical insulation on the cutting wire 62 prevents immediate contact and electrical shorting between the cutting wire and the return electrode . when applying electrical power to the arrangement shown in fig6 , electrical current flows from the exposed section of the cutting wire 56 into the contacting tissue . because of the small contact area , the current density close to the cutting wire is high ( shown schematically in fig6 at 64 ), leading to electrosurgical cutting of the constricted tissue . from here , the electrical current follows the electrical field lines 66 toward the return electrode 58 , which is the entire outer balloon surface 60 . because of the relatively large contact area , the current density disperses through the entire tissue in contact with the return electrode . similar to the return electrode patch in the monopolar configuration , the relatively large area of the return electrode causes dispersion of the electrical current , reducing the deposited energy density to an insignificant level . in addition , as electrical energy is essentially directed only into the tissue contacting the cutting wire , and since the electricity does not have to travel through large volumes of bulk tissue , the bipolar configuration shown in fig6 will again call for less total power to achieve the same cutting effect as the monopolar configuration . at the same time , the absence of current traveling through large volumes of bulk tissue , outside the view of the surgeon , eliminates the risk of electrical burns through constricting tissue elements or delaminating return electrode patches . other embodiments of the present invention appropriate for an arrangement as shown in fig6 would involve a metallized balloon , generated by vacuum - coating or sputter - coating a non - distensible balloon with a metal or metal alloy . other embodiments of the present invention can include any provision of material on the outside surface of the balloon , making it electrically conductive ( such as metallized pastes , indium tin oxide ( ito ), etc .) yet another embodiment of the present invention can include a balloon made of a non - distensible , electrically conductive polymer . although the present invention has been described in certain specific aspects , many additional modifications and variations would be apparent to those skilled in the art . it is therefore to be understood that the present invention may be practiced otherwise than specifically described , including various changes in the size , shape and materials , without departing from the scope and spirit of the present invention . thus , embodiments of the present invention should be considered in all respects as illustrative and not restrictive . also , all the examples provided throughout the entire description should be considered in all respects as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the following claims rather than by the foregoing description . all changes , modifications , and variations coming within the meaning and range of equivalency of the claims are to be considered within their scope .

US-74895507-A

liquid applicators having a flexible elongated hollow body are provided . more specifically , provided are hand - held liquid applications having a flexible elongated hollow body within which at least two liquid - filled , glass ampoules are received , and a mechanism for fracturing the ampoules to release the liquid for dispensing .

a liquid applicator for applying a desired liquid to a surface , the applicator comprises a hollow body defining an internal chamber to receive at least two elongated ampoules formed of a frangible material and containing the liquid to be applied is described . the liquid applicator further comprises a lever projecting from the body , the lever flexing said body inwardly to fracture the ampoules substantially simultaneously when the lever is depressed toward the body . the liquid applicator further comprises a porous element secured to the body of the applicator and closing off an open end , such that liquid flows through the porous element to be applied to a surface . the following are examples of embodiments of the present invention and are illustrative rather than restrictive . with reference fig1 , fig2 and fig3 in particular , where like reference numerals identify like elements in the various views , an embodiment of the liquid applicator is illustrated and designated generally by the numeral 10 . liquid applicator 10 generally includes a body 12 , and a porous element 16 secured to flange 24 of body 12 and a lever 26 . two ampoules 14 and 15 are received in body 12 . ampoules 14 and 15 may be used for containing various liquids such as medicaments , cleansing agents , cosmetics , polishes or the like . in the illustrated embodiment , ampoules 14 and 15 contain antiseptic solution to be applied to a patient &# 39 ; s skin prior to surgery . ampoules 14 and 15 are illustrated as elongated cylinders each with a central longitudinal axis . however , it will be appreciated that the principles of the present invention also may be applied to spherical or elongated polygonal ampoules . furthermore , it will be appreciated that the principles of the present invention may be applied to more than two ampoules . preferably , ampoules 14 and 15 are formed of glass , although other materials are entirely within the scope of the present invention . in the illustrated embodiment , ampoules 14 and 15 are placed side by side within body 12 . the wall of glass ampoules 14 and 15 is of a thickness sufficient to contain the desired liquid during transport and storage , yet allow ampoules 14 and 15 to be fractured upon the application of localized pressure . referring now to fig4 , 5 , 6 and 7 body 12 is generally hollow and oval or elliptical in shape and includes axially opposed first and second ends 18 , 20 . the proximal first end 18 is open and distal second end 20 is closed with cap 19 shown in fig6 . illustrated body 12 is formed of high density polyethylene , although any material exhibiting similar flexibility and integrity may be used . in the illustrated embodiment , body 12 and cap 19 were molded with 100 % virgin material dow , hdpe , resin # 12454n , as defined in fda master file number 4251 . in the preferred embodiment , second end 20 is closed with cap 19 , however second end may also be closed during the molding process obviating the need for a cap or the like . referring again to fig1 , 2 , 3 and 4 , body 12 includes an interior wall 21 which defines an internal chamber 22 within body 12 . interior wall 21 is shaped to conform generally to the shape of ampoules 14 and 15 which are received within internal chamber 22 . the circumference of interior wall 21 is slightly larger than the outer surface of the two ampoule bodies . dividing wall 17 of hollow body 12 separates ampoules 14 and 15 and maintains ampoules 14 and 15 within internal chamber 22 . illustrated body 12 is elongated and defines a central longitudinal axis “ x ”. the thickness of the wall of the applicator may be between 0 . 040 to 0 . 080 inches and preferably is approximately 0 . 060 inches , except thin wall 40 . the thickness of the wall of body 12 is reduced around crush area 42 . thin wall 40 may be between 0 . 020 to 0 . 040 inches and preferably is 0 . 030 inches . however , it will be appreciated that different wall sizes may be used within the scope of the embodiment of the invention . thin wall 40 makes it easier for crush portion 36 of lever 26 to fracture multiple ampoules when lever 26 is depressed . this will be discussed in more detail later . body 12 further presents a flange 24 protruding from proximal end 18 along the periphery thereof . in the preferred embodiment , flange 24 is continuously molded to body 12 and is disposed at an angle . preferably , flange 24 is disposed an angle of 45 °, with respect to the central longitudinal axis of the body . it will be appreciated that flange 24 may be disposed at a variety of angles with respect to the central longitudinal axis of body 12 . flange 24 is adapted to support porous element 16 , as more fully described below . porous element 16 , such as a sponge or the like , closes off open end 18 of body 12 . porous element 16 is received on flange 24 and encloses ampoules 14 and 15 within internal chamber 22 . porous element 16 may be formed of felt or an open - celled foam material . in the illustrated embodiment , porous element 16 was formed of sif -# 3 - 1000z felt , ( natural color non - pigmented ) reticulated polyester urethane . this felt is hydrophobic and works well with alcohol - based liquids . in another embodiment , aquazone ™ polyurethane foam , manufactured by e . n . murray co . in denver , colo ., is used . the aquazone ™ foam is hydrophilic and works well with water based liquids . porous element 16 is cut from a sheet of foam or felt material having the desired porosity for the liquid to be dispensed . porous element 16 is preferably generally square in shape although it will be appreciated that the element may be of any desired size and shape which is capable of being supported on flange 24 . in the illustrated embodiment , a woven or non - woven laminate material is laminated to porous element 16 . the material laminate material may be a woven or non - woven polyester material . in the illustrated embodiment , novonnete ® sp - 64 ( 3905 ) polyester ( non - woven ) was laminated to 0 . 360 ″± 0 . 032 ″ sif -# 3 - 1000z felt , ( natural color non - pigmented ) reticulated polyester urethane . the laminate material is positioned between porous element 16 and flange 24 of body 12 . as such , the laminate material functions to prevent shards of glass from the fractured ampoules from pushing through the porous element during use of the applicator . the laminate material also provides a suitable welding material for securing the porous element in place on the body when an ultrasonic welding operation is used to manufacture the applicator . in the illustrated embodiment , porous plug 46 is positioned between porous element 16 and ampoules 14 and 15 . porous plug 46 may be an open - celled foam material or felt . in the illustrated embodiment , novonette ® sp - 64 ( 3905 ) polyester ( non - woven ) was laminated to 0 . 360 ″± 0 . 032 ″ sif -# 3 - 1000z felt , ( natural color non - pigmented ) reticulated polyester urethane . porous plug 46 helps control the rate liquid flows from the body and prevents shards of glass from pushing through porous element 16 during use of the applicator . porous plug 46 is cut from a sheet of foam or felt material having the desired porosity for the liquid to be dispensed . body 12 also includes a lever 26 projecting from the top portion of body 12 . however , it will be appreciated that lever 26 may project from any portion of body 12 . lever 26 is any mechanism for fracturing more than one ampoule at substantially the same time . lever 26 , includes hinge portion 38 , crush portion 36 and handling portion 34 extending from the distal end of lever 26 . preferably , lever 26 extends outwardly from body 12 at an angle of between 20 ° and 40 ° with respect to the central longitudinal axis of body 12 . more preferably , lever 26 extends from body 12 at approximately 27 ° with respect to the central longitudinal axis “ x ” of body 12 . it will be appreciated that lever 26 may be disposed at a variety of angles with respect to the central longitudinal axis of body 12 . in the illustrated embodiment , lever 26 is continuously molded with body 12 . it will be understood and appreciated , however , that separately formed levers coupled to the body are contemplated to be within the scope of the present invention . handling portion 34 of lever 26 of the illustrated embodiment is spaced between 0 . 5 and 1 . 5 inches from body 12 . preferably , handling portion 34 is spaced approximately 1 . 0 inch from body 12 . handling portion 34 of lever 26 includes a textured outer surface to facilitate handling of applicator 10 and to inhibit slippage from the user &# 39 ; s hand during application . in the illustrated embodiment , lever 26 includes crush portion 36 and hinge portion 38 attached to body 12 . it will be appreciated , however , that the principles of the present invention are equally applicable to various other structures for fracturing ampoules 14 and 15 , such as multiple crush portions , multiple hinge portions and a crush portion that may be attached or detached to body 12 . the hinge portion 38 anchors one end of the lever 26 against the body 12 of the applicator , thus when the lever 26 is depressed , force is transferred into the crush portion 36 of the lever 26 . handling portion 34 of lever 26 presents a gripping area which is significantly larger than the area of crush portion 36 . upon depression of lever 26 , crush portion 36 , flexes body 12 inwardly at thin wall 40 , thereby localizing the forces effected by depressing lever 26 toward body 12 and enhancing fracturing of ampoules 14 and 15 as more fully described below . several features of lever 26 of the illustrated embodiment enhance the ability to fracture at least two ampoules at the same time including : the thickness of lever 26 , the curvature of lever 26 , support rib 37 ( as illustrated in fig2 ), the thickness of hinge portion 38 and the width of crush portion 36 . the thickness of lever 26 is approximately 0 . 080 to 0 . 15 inches and preferably is 0 . 11 inches . in the illustrated embodiment , lever 26 is approximately 2 . 35 inches long . hinge portion 38 of the illustrated embodiment is thinner than the rest of lever 26 . hinge portion 38 is approximately 0 . 040 to 0 . 080 inches thick , preferably 0 . 060 inches thick . the curvature of lever 26 and support rib 37 increase the leverage of handling portion 34 of lever 26 making it easier for the user to fracture two ampoules substantially simultaneously . the ratio of the width of crush portion 36 to the width of ampoules 14 and 15 side by side is important with respect to reliable breakage of ampoules 14 and 15 . in the illustrated embodiment , the width of the crush portion 36 had to be at least approximately ⅕ the width of the two ampoules side by side to produce breakage of the ampoules almost simultaneously . the width of the two ampoules side by side was approximately 1 . 03 inches . the minimum width of the crush portion of the lever that produces breakage of the ampoules almost simultaneously was 0 . 200 inches . thus , a length aspect ratio for reliable ampoule break was 1 . 03 / 0 . 200 or 5 . 15 . all of these features , either singularly or in combination , along with thin wall 40 , help enhance the ability of the lever to break multiple ampoules at the same time . in the preferred embodiment of the present invention , the crush portion of the lever was 0 . 675 inches . the width of the two ampoules side by side is approximately 1 . 03 inches . thus , the preferred length aspect ratio is 1 . 03 / 0 . 675 or 1 . 53 . with reference to fig7 and fig8 , vent 56 of the illustrated embodiment is shown . vent 56 is located at distal end 20 of body 12 . vent 56 is a small cut out portion of body 12 allowing air to flow from internal chamber 22 of body 12 to the outside of body 12 and vice versa . this is accomplished by a small cut out portion of body 12 starting on the outside of body 12 , going over the lip of body 12 and continuing inside body 12 . internal cut out portion 54 , external cut out portion 50 and cut out lip 52 allow air to flow in and out of internal chamber 12 of body 12 underneath cap 19 . cap 19 entirely seals off internal chamber 22 except for cut out vent 56 . with reference to fig9 and fig1 , restraint element 44 is positioned between ampoules 14 and 15 and porous plug 46 . restraint element 44 allows liquid to flow from body 12 , through porous plug 46 and into porous element 16 . restraint element 44 restrains ampoules 14 and 15 in a position to facilitate proper breaking . restraint element 44 holds the ends of ampoules 14 and 15 near crush point 42 so that the ends of ampoules are properly broken and do not restrict the flow of liquid . restraint element 44 may take a variety of shapes depending on the type of liquid to be applied . in the illustrated embodiment , restraint element 44 has two fan - shaped openings as may be seen in fig1 . with reference to fig5 , 9 , 10 and 11 , in use , applicator 10 presents a hand - held liquid applicator wherein lever 26 is depressed to release the desired liquid contained within ampoules 14 and 15 therein for application to a surface . applicator 10 of the illustrated embodiment is grasped by one hand of a user . the bottom of body 12 is grasped with the palm and fingers of user , the user &# 39 ; s fingers wrap around the bottom and side of the body 10 so the tips of the user &# 39 ; s fingers rest on the top of body 12 . the thumb of the same hand is positioned on handling portion 34 of lever 26 allowing for single - handed operation . the user depresses lever 26 toward body 12 to fracture ampoules 14 and 15 . the movement of lever 26 is transferred by crush portion 36 to thin wall 40 of body 12 to deform body 12 inwardly and exert discrete localized fracturing forces against ampoules 14 and 15 . lever 26 provides an action that gains mechanical advantage as lever 26 is depressed toward body 12 . accordingly , if the user has limited gripping strength , or if the wall of the ampoule is exceptionally thick , the lever ensures fracturing of the ampoules . once lever 26 has been sufficiently depressed , the resulting forces fracture ampoules 14 and 15 almost simultaneously , thus releasing the liquid contained in each ampoule . once ampoules 14 and 15 are fractured , the released liquid saturates porous plug element 46 which controls the rate of the flow and then the liquid saturates porous element 16 . consequently , body 12 essentially functions as a reservoir of the desired liquid . when the applicator is manipulated for scrubbing with the distal end oriented away from the surface to be scrubbed and the porous element oriented toward the surface as shown in fig1 , the liquid will flow from the fractured ampoule under the force of gravity down body 12 , through porous plug 46 the through open end 18 and through porous element 16 . thereafter , application of the liquid is accomplished by bringing porous element 16 into contact with the desired surface . the user may then use a painting or scrubbing motion to apply the liquid to the surface . the entire process of fracturing ampoules 14 and 15 and applying the liquid to a desired surface is achieved with the use of only one hand of the user . in this embodiment , the liquid applicator 10 is constructed to house two 13 ml ampoules . the thickness of the walls of the 13 ml ampoules is 0 . 3 mm . it will be understood and appreciated , however , that ampoules of various sizes with various wall widths may be utilized and such is contemplated to be within the scope of the present invention . in the illustrated embodiment , the distance between the lateral line defined by the most upwardly positioned portion of the flange and the distal end of the handling portion of the lever is approximately 3 . 75 inches . it will be understood and appreciated , however , that this distance will vary based upon the size of the applicator and ampoule utilized . such variations are contemplated to be within the scope of the present invention . during formation of the applicator , the porous element is welded to the applicator body in three steps . first , the flange of the body is pre - heated with the aid of an infrared heater that is set at a temperature ranging between 620 and 625 ° f . the flange and the body are held in place with a nesting fixture , and a gap between the flange and the heating element is set to 0 . 125 ″. the flange is heated for approximately fifteen seconds to achieve a temperature of approximately 150 to 160 ° f . next , the porous plug is manually inserted into the applicator body while the flange area is still warm . finally , while the pre - heated body and flange containing the porous plug are still in the nesting fixture , a porous element is centered onto the flange . the flange and the porous element are bonded together with a sonic welding machine . it will be appreciated that other suitable securing expedients could be employed in place of the ultrasonic welding operation . for example , the porous element could be secured in place by an adhesive or stitching , or by heat sealing or chemically bonding the element in place . such alternative securing expedients are contemplated to be within the scope of the present invention . the completed applicator body containing the porous plug with the porous element secured to the flange is removed from the fixture . two 13 ml ampoules are inserted through the distal opening into the applicator body . the cap is inserted into position using a customized pneumatic press and nesting fixture . finally , the cap is compressed into its final position closing the applicator body at the distal end . constructed and operated as previously described , this invention provides a hand - held liquid applicator of quality construction having a body with a lever that may be depressed toward the body to fracture at least two ampoules of liquid contained within the body . further , this invention provides a disposable liquid applicator which permits single - handed operation in order to free the second hand of the user for use in assisting application of the liquid to the desired area . the liquid applicator of the present invention also is simple to construct and assemble and , therefore , may be manufactured more economically than prior art applications . from the foregoing , it will be seen that this invention is one well adapted to attain all the ends and objects hereinabove set forth together with other advantages which are obvious and which are inherent in the structure . it will be understood that certain features and subcombinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . since many possible embodiments may be made of the invention without departing from the scope thereof , it is to be understood that all matter herein set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense .

US-74889603-A

the topical use of 5 , 6 , 7 - trihydroxyheptanoic acid and analogs are disclosed for the treatment of dry eye disorders and uveitis .

unless indicated otherwise , all component amounts are presented on a % ( w / v ) basis . according to the methods of the present invention , a composition comprising a compound of formula i is topically administered to a mammal in need thereof : r 1 is c 2 h 5 , co 2 r , conr 2 r 3 , ch 2 or 4 , or ch 2 nr 5 r 6 , where : r is h , c 1 - 6 straight chain or branched alkyl , c 3 - 6 cycloalkyl , or phenyl , or r 1 is a carboxylate salt of formula co 2 − r + , where r + is li + , na + , k + , or an ammonium moiety of formula + nr 10 r 11 r 12 r 13 ; r 2 , r 3 are independently h , c 1 - 6 alkyl , c 3 - 6 cycloalkyl , benzyl , phenyl , oh , och 3 , or oc 2 h 5 , provided that at most only one of r 2 , r 3 is oh , och 3 , or oc 2 h 5 ; r 4 is h , c ( o ) r 14 , c 1 - 6 alkyl , c 3 - 6 cycloalkyl , benzyl , or phenyl ; r 5 , r 6 are independently h , c ( o ) r 14 , c 1 - 6 alkyl , c 3 - 6 cycloalkyl , benzyl , phenyl , oh , och 3 , or och 2 h 5 , provided that at most only one of r 5 , r 6 is oh , och 3 , or c 2 h 5 ; r 7 , r 8 , and r 9 are independently h , ch 3 , c 2 h 5 , c ( o ) r 14 , or co 2 r 15 ; or r 7 and r 8 or r 8 and r 9 together constitute a carbonyl group ( c ═ o ), thus forming a cyclic carbonate ; or or 8 r 1 together form a cyclic ester ( a lactone ); r 10 - r 13 are independently h or c 1 - 6 alkyl , each alkyl group optionally bearing an oh or och 3 substituent ; r 14 is h , c 1 - 6 alkyl , c 3 - 6 cycloalkyl , benzyl , or phenyl ; r 15 is c 1 - 6 alkyl , c 3 - 6 cycloalkyl , benzyl , or phenyl ; and indicates that the or 9 substituent can be arranged to afford the r or s absolute configuration : r 1 is c 2 h 5 , co 2 r , ch 2 or 4 , or a carboxylate salt of formula co 2 − r + ; r + is li + , na + , k + , or nh 4 + ; r is h , ch 3 , c 2 h 5 , n - c 3 h 7 , or i - c 3 h 7 ; r 4 is h , coch 3 , or ch 3 ; and r 7 , r 8 , r 9 are independently h , ch 3 , ch 3 co ; or r 7 and r 8 or r and r 9 together constitute a carbonyl group ( c ═ o ), thus forming a cyclic carbonate ; or or 8 r 1 together form a cyclic ester ( a lactone ). among the especially preferred compounds are compounds 1 - 6 . compound 1 is commercially available from biomol research laboratories , plymouth meeting , pa ., and compound 2 can be prepared as detailed in lee et . al ., biochemical and biophysical research communications 1991 , 180 ( 3 ), 1416 - 21 . compounds 3 - 6 can be prepared as described in examples 14 below . a solution of methyl ester 1 ( 20 mg , 0 . 104 mmol ) in meoh ( 2 . 1 ml ) containing 1 m lioh ( 0 . 5 ml , 0 . 5 mmol ) was heated in a microwave heater at 120 ° c . for 6 minutes . the reaction was concentrated and the residue was chromatographed on a 10 mm diameter × 18 cm tall c18 reverse - phase silica gel column eluting with 7 : 3 v : v 0 . 05 m hcl : acetonitrile to afford a crude white solid after concentration ( 40 . 9 mg ). the solid was rinsed with hot ch 3 cn ( 2 × 2 ml ) and the filtrate was concentrated to afford lactone 3 ( 7 . 8 mg , 47 %). 13 c nmr ( 150 mhz , dmso - d 6 ) δ 171 . 12 ( c ), 79 . 86 ( ch ), 72 . 44 ( ch ), 62 . 03 ( ch 2 ), 29 . 39 ( ch 2 ), 21 . 67 ( ch 2 ), 17 . 55 ( ch 2 ). a solution of methyl ester 1 in aqueous meoh is heated to reflux in the presence of 3 equivalents of lithium hydroxide . after 6 h the reaction is cooled to room temperature and the ph of the solution is adjusted to 6 by the addition of 70 - 9 mesh sulfonic acid resin mp ( commercially available from novabiochem / emd biosciences , 10394 pacific center court , san diego , calif . 92121 ). the solution is filtered through a 0 . 2 μm poly - terfluoroethylene syringe filter and concentrated to afford the lithium carboxylate 4 as a white solid . 1 h nmr ( d 2 o , 400 mhz ) δ 3 . 69 - 3 . 64 ( m , 1h ), 3 . 55 - 3 . 47 ( m , 3h ), 2 . 16 - 2 . 12 ( m , 2h ), 1 . 67 - 1 . 64 ( m , 1h ), 1 . 54 - 1 . 48 ( m , 2h ), 1 . 38 - 1 . 34 ( m , 1h ). 13 c nmr ( d 2 o , 100 mhz ) δ 183 . 46 ( c ), 74 . 61 ( ch ), 71 . 67 ( ch ), 62 . 49 ( ch 2 ), 37 . 26 ( ch 2 ), 31 . 55 ( ch 2 ), 22 . 04 ( ch 2 ). a solution of lactone 3 in thf is treated with 3 to 5 equivalents of an ethanolic solution of sodium ethoxide . after 10 h the reaction is quenched by the addition of saturated aqueous potassium dihydrogen phosphate until the ph is about 6 . the solution is extracted with ethyl acetate , the organic layer is dried over mgso 4 , filtered , and concentrated , and the residue is chromatographed on a silica gel column to afford ethyl ester 5 . a solution of lactone 3 in thf is treated with 3 to 5 equivalents of an sodium isopropoxide in isopropanol . after 10 h the reaction is quenched by the addition of saturated aqueous potassium dihydrogen phosphate until the ph is about 6 . the solution is extracted with ethyl acetate , the organic layer is dried over mgso 4 , filtered , and concentrated , and the residue is chromatographed on a silica gel column to afford isopropyl ester 6 . protective effect of compound 1 in a rabbit model of dry eye compound 1 was evaluated in a rabbit model of dry eye . new zealand white rabbits ( approximately 2 . 5 kg ; obtained from myrtle &# 39 ; s rabbitry , thompson station , tenn .) were randomized and dosed topically twice a day with either 50 μl of compound 1 formulated in 0 . 064 %/ bss ® at concentrations of 1 , 10 , or 100 μm , or with 0 . 064 %/ bss ® vehicle . after 24 h the rabbits were anesthetized by subcutaneous administration of ketamine hydrochloride ( 30 mg / kg ) and xylazine ( 6 mg / kg ) and each rabbit received bilateral injections of conconavilin a ( cona ) ( 300 μg / 30 μl ) or saline ( 30 μl ). desiccation was initiated one day following lacrimal gland injection by placing conscious animals in an environmental chamber ( 20 - 30 % humidity , 75 ° c .). following 72 hours of exposure to environment , the animals were assessed for corneal staining upon exposure of the cornea to the dye methylene blue ; less staining indicates less damage to the cornea . the rabbits were anesthetized by subcutaneous administration of ketamine hydrochloride ( 30 mg / kg ) and xylazine ( 6 mg / kg ). sutures were placed in each upper and lower eyelid and lifted to form a corneal / conjunctival cup . methylene blue dye ( 1 ml , 1 % in distilled water ) was added to the cup for five minutes and the excess removed by washing with 200 ml of bss ®. the contralateral eye was then stained using the same procedure . rabbits were euthanized immediately following the staining procedure and the eyes were excised . the corneas were isolated and a 9 . 5 mm punch of the cornea was placed overnight in 2 ml of acetone / saturated sodium sulfate ( 7 : 3 v / v ). the concentration of the extracted dye was determined spectrophotometrically by measuring its absorbance at λ = 660 nanometers ( a660 ). percent inhibition was calculated as { 1 −[( a660 test item − a660 normal )/( a660 bss − a660 normal )]}× 100 , where a660 test item is the absorbance of dye from cona - injected eyes dosed with compound 1 , a660 normal is the absorbance of dye from saline - injected eyes , and a660 bss is the absorbance of dye in cona - injected eyes dosed with 0 . 064 % ethanol / bss ® solution vehicle . a higher percent inhibition of staining indicates more protection of the cornea from damage . a second group of animals was evaluated for tear film quality by measuring each animal &# 39 ; s tear breakup time ( tbut ). using the same experimental protocol as above for inducing rabbit ocular damage , tbut was determined daily by instilling 5 μl of sodium fluorescein into the cul de sac and manually blinking the lids to distribute the fluroescein within the tear film . under slit lamp observation , the eye was held open and the time whereby one or more black spots or streaks appeared in the precorneal tear film was recorded . the rabbits were euthanized 3 days following cona injection . larger tbut values indicate better tear film quality and more protection from ocular damage . tbut data is expressed as % of baseline , with baseline tbut being that observed for saline - injected , vehicle - treated eyes . the % inhibition of corneal staining and tbut data are presented below in table 1 , with 15s - hete ( biomol research laboratories , plymouth meeting , pa .) treatment of cona - injected eyes used as a positive control . compound 1 was evaluated for its ability to suppress neutrophil influx into the rat eye in a model of endotoxin - induced uveitis . the compound was prepared at concentrations of 0 . 01 %, 0 . 1 %, 1 . 0 % w / v in an ophthalmic suspension vehicle , and dexamethasone ( sigma - aldrich company , st . louis , mo .) formulated in the same vehicle served as reference compound . uveitis was induced by subplantar injection of endotoxin ( 200 μg in 0 . 1 ml saline ) in the right hind paw of female lewis rats ( 5 / group ). test compound of vehicle ( 5 μl ) was administered topically to each eye of the experimental animals at the time of endoxtoxin injection and again 4 hours later . twenty four hours post endotoxin injection , animals were sacrificed by co 2 inhalation , and total ocular neutrophil ( pmn ) content was assessed indirectly by determination of myeloperoxidase activity . ocular pmn content in each group was then compared with that observed in the vehicle - treated group using dunnet &# 39 ; s t - test . the results are shown below in table 2 . according to the methods of the present invention , a compound of formula i is administered in a pharmaceutically acceptable carrier for topical ophthalmic administration . the compositions are formulated in accordance with methods known in the art . the compositions may contain more than one compound of formula i . additionally , the compositions may contain a second drug , other than a compound of formula i . the compositions of the present invention contain a pharmaceutically effective amount of a compound of formula i . as used herein , “ a pharmaceutically effective amount ” means an amount sufficient to reduce or eliminate uveitis or dry eye symptoms . generally , the compositions of the present invention will contain from 0 . 00001 to 0 . 01 % of a compound of formula i for treating dry eye , and from 0 . 01 % to 3 % of a compound of formula 1 for treating uveitis . preferably , the compositions of the present invention will contain from 0 . 00003 to 0 . 001 % of a compound of formula i for treating dry eye , and from 0 . 1 % to 1 % of a compound of formula 1 for treating uveitis . the compositions administered according to the present invention may also include various other ingredients , including but not limited to surfactants , tonicity agents , buffers , preservatives , co - solvents and viscosity building agents . various tonicity agents may be employed to adjust the tonicity of the composition , preferably to that of natural tears for ophthalmic compositions . for example , sodium chloride , potassium chloride , magnesium chloride , calcium chloride , dextrose and / or mannitol may be added to the composition to approximate physiological tonicity . such an amount of tonicity agent will vary , depending on the particular agent to be added . in general , however , the compositions will have a tonicity agent in an amount sufficient to cause the final composition to have an ophthalmically acceptable osmolality ( generally about 150 - 450 mosm , preferably 250 - 350 mosm ). an appropriate buffer system ( e . g ., sodium phosphate , sodium acetate , sodium citrate , sodium borate or boric acid ) may be added to the compositions to prevent ph drift under storage conditions . the particular concentration will vary , depending on the agent employed . preferably , however , the buffer will be chosen to maintain a target ph within the range of ph 5 . 5 - 8 . other compounds designed to lubricate , “ wet ,” approximate the consistency of endogenous tears , aid in natural tear build - up , or otherwise provide temporary relief of dry eye symptoms and conditions upon ocular administration to the eye are known in the art and may be included in the compositions of the present invention . such compounds may enhance the viscosity of the composition , and include , but are not limited to : monomeric polyols , such as , glycerol , propylene glycol , ethylene glycol ; polymeric polyols , such as , polyethylene glycol , hydroxypropylmethyl cellulose (“ hpmc ”), carboxy methylcellulose sodium , hydroxy propylcellulose (“ hpc ”), dextrans , such as , dextran 70 ; water soluble proteins , such as gelatin ; and vinyl polymers , such as , polyvinyl alcohol , polyvinylpyrrolidone , povidone and carbomers , such as , carbomer 934p , carbomer 941 , carbomer 940 , carbomer 974p . topical ophthalmic products are typically packaged in multidose form . preservatives are typically required to prevent microbial contamination during use . suitable preservatives include : benzalkonium chloride , chlorobutanol , benzododecinium bromide , methyl paraben , propyl paraben , phenylethyl alcohol , edetate disodium , sorbic acid , polyquaternium - 1 , or other agents known to those skilled in the art . such preservatives are typically employed at a level of from 0 . 001 to 1 . 0 % w / v . unit dose compositions of the present invention will be sterile , but typically will not contain a preservative and will be unpreserved . generally , 1 - 2 drops of such compositions will be administered from once to many times per day . representative eye drop formulations are provided below in example 7 for treating dry eye and in example 8 for treating uveitis . this invention has been described by reference to certain preferred embodiments ; however , it should be understood that it may be embodied in other specific forms or variations thereof without departing from its special or essential characteristics . the embodiments described above are therefore considered to be illustrative in all respects and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description .

US-26830105-A

the invention is a device encompassing and warming the extremity of a wor in a cold wet environment . the device can take the form of a glove , sock and / or arm and / or leg warmer . the device contains a coil surrounding the extremity . the coil forms an envelope surrounding each extremity and each digit of an extremity . a water free , rf transmitting zone encompasses the coil envelope . the coil , extremity and rf transmitting zone combine to provide a resonant frequency with the operating frequency with which the coil is driven . the combination warms the interior of the extremity . the rf energy is provided from a source carried at some other point on the subjects body . the entire combination on each extremity and the power source can be encompassed in a shield layer which absorbs or reflects rf energy into the extremity .

the device of this invention in its different embodiments is a means of maintaining the extremities , including digits on the extremities , warm . the device is an active means actually producing extremity warming as opposed to passive means such as insulating gloves . in its most useful embodiment , the invention is used by divers to provide warmth to extremities when working in cold water . water is an excellent heat sink and can rapidly absorb heat from an exposed heat generator such as the human body . insulating materials only reduce heat conduction away from the heat generator . insulators do not stop heat conduction altogether . the colder the water the greater the quantity of heat conducted away . the body is a limited heat generator . when the amount of heat conducted away from the diver &# 39 ; s body , even through insulating garments , exceeds the heat generated by the body , the diver will get cold and lose mobility and flexibility . as is well known to anyone living in a cold clime , the extremities , particularly the digits , are the first to get cold enough to lose flexibility . to maintain flexibility , it is necessary to provide heat to the extremity . in the embodiment illustrated in fig1 a scuba diver 50 wears a wet suit 56 having boots 16 within flippers 52 and gloves 54 . a power source 20 is carried in a convenient place on the divers body such as part of the belt 21 . the power source 20 is connected through a cable 18 to each warming unit on each extremity . the power source can be a radio frequency oscillator / amplifier circuit powered by a battery pack such as subassemblies from eni inc ., model acg - 3 - 27 rf source powered by batteries totaling about 40 v . the invention is a coil envelope formed of wrap of wire also known as turns , pitches , windings , etc . ostensibly helical for the forearm and foot , and somewhat modified for the hand . the coil wraps are wound over the skin using common insulated 18 - 30 awg hook - up wire . in the most convenient form the coil wraps are wound and affixed to a glove structure 31 or sleeve or sock 13 . this sleeve , sock or glove facilitates the rapid donning of the coil structure . for convenience the glove , sock or sleeve structures are referred to generically as &# 34 ; foundation sleeve &# 34 ;. it was found that to operate successfully in a wet or underwater environment , it was necessary to prevent water from interposing itself between the coil wraps by providing an rf transmitting zone . in fig2 the rf transmitting zone 14 is formed of a material which insures a water free , rf transmitting zone between the coils 101 through 107 of the wire 10 . a water free zone does not mean that each wire turn should be water proof and dry , which of course it must be for electrical reasons . a water free zone means that the &# 34 ; line of site between each coil wrap must be free of water or any other rf absorbing material . the rf transmitting zone , such as 14 , is formed of an rf transmitting material which will exclude water or other rf absorbers or reflectors from the space between the coil wrap . in the simplest form , the zone 14 can be formed from layers of petroleum jelly impregnated cloth wrapped around the coil envelope formed by wire 10 . the zone can be formed from any suitable water - displacing material that will provide an rf transmitting zone for fluctuating electromagnetic fields around the coils . of course , an rf transmitting zone should be non - conducting in the electrical sense ( a dielectric material ). in the foot embodiment of fig3 the zone 14 can take the form of a sock made of water impervious material which has sufficient thickness that an rf transmitting zone is left between the coil wrap after the sock 14 has conformed to the height of the coil wrap formed by the wire 10 . polymeric materials are preferred . most preferred are those materials which form artificial fibers and non - woven materials . wetable materials , such as cotton or wool can be used as the rf transmitting zone if the material is sealed to prevent water from entering the structure of the fabric . to be useful in this invention , it is not necessary for the material of the rf transmitting zone itself to be impervious to water . the techniques for rendering materials water impervious or the lists of water impervious materials are well known . referring to fig2 forearm warmth is provided by a helical coil formed by wire 10 . the wire forming the coil envelope 10 can be wound directly about the forearm 12 of a diver or , more preferably , the coil is attached to an inner liner shaped to conform to the body part to be warmed . an rf transmitting zone 14 is formed around the coil wrap 10 . in its preferred form , the rf transmitting zone is formed from a water impervious light weight and flexible material which will conform to the coils and keep water or other rf reflecting or absorbing materials from interposing between the coil wrap . wire leads 10a and 10b connect the ends of the coil through a suitable waterproof connection 16 to a cable 18 which , in turn , is connected to a source of rf energy 20 having variable frequency capability and adjustable output power . the rf source 20 provides energy at the resonant frequency of the coil / extremity / transmitting zone combination when immersed in water . of course , wet or dry diving suits may be worn over the combination . referring to fig3 foot warmth is provided by the helical coil 10 wound about the foot 12 including the toes . in most instances the toes will not be treated individually , as are the fingers , but they can be as needed . in this embodiment , the rf transmitting zone comprises a thermal insulating sock 14 in combination with the divers boot 16 . in this case the sock 14 can be wet but the boot 16 prevents wetting and retains the necessary rf absorber reflector free atmosphere . a small coaxial cable 18 delivers the rf energy and connects the coil 10 through the sock . the cable is routed through the inside of the suit for exit at some convenient location . in the preferred embodiment , as illustrated in fig1 a and fig3 the coil is mounted on a liner 13 in the form of a sock . the rf transmitting zone can be permanently formed over the coil 10 to form an easily donned assembly 11 . referring to fig4 and fig1 c , hand warmth is provided by a helical coil envelope 10 wound serially over the fingers 15 . spacers 114 provide clearance of at least several wire diameters in places where the coil crosses over itself . this avoids internal localized interactions of the rf signal . in the foot , arm and leg embodiments crossover problems are avoid by running the wire above and below the rf transmitting zone or by other techniques to avoid &# 34 ; shorting &# 34 ; the coil envelope . the spacers 114 can take the form of plastic tubing or other insulating and spacing material including cloth , plastics , paper and the like . the ends of the coil 10 are connected at a central location on the back of the hand and connected to a 3 - 50 pf variable capacitor 17 . a coaxial coil 18 delivers rf energy directly to the coil 10 . it is preferred that the coil and all parts be attached to a liner 13 in the form of a glove . the rf transmitting zone can be the divers glove 54 or , more preferably , a zone formed permanently over the coil . the rf hand coil assembly 10 was fashioned as a series connection of finger coils from 1 . 8 m of solid , 18 awg insulated copper hook - up wire . the coil 10 was wound over a ( right hand ) cotton work glove to facilitate repeated use by multiple subjects . radio frequency energy at 27 . 12 mhz , an industrial , scientific , and medical ( ism ) channel , was fed to the central portion of the hand coil through a length of rg / 58a coaxial cable 18 and a 1 - ampere , type 3ag fuse . a banana plug and jack formed the other electrical connection , and insulating tape covered all bare conductors . in actual use , adjustment to a 50 - ohm impedance match at 27 . 12 mhz was made with the aid of a network analyzer . small subject - to - subject offsets in resonant frequency were accommodated by adjusting the variable capacitor to permit operation entirely at 27 . 12 mhz . the rf signal generated by the coil will broadcast from the wearers extremities . this signal may interfere with devices and equipment being handled by the diver . the signal may also disclose the divers location if it can be detected at great distances . it is therefore preferred to extend an rf energy absorbing or reflecting layer , illustrated as 40 in fig2 and 3 , over the rf transmitting zone encompassing the entire rf transmitting zone and preventing the escape of at least the major portion of the rf energy back into the extremity . the layer 40 can take the form of a metal foil , carbon impregnated cloth or the like . in tests , a 12 - channel , optical fiber thermometry system ( clinitherm model t - 1200 ) was used to determine temperatures of the hand . before donning the glove - mounted hand coil assembly , ten temperature probes were attached to the subject &# 39 ; s right hand , two each on the palm side of each finger ( ball of fingertip opposite the nail and fleshy region between the two most distal joints ). two additional probes were placed on the top and bottom of the central palmar region . temperature probe output was printed at 30 - second intervals during each experiment . a four - channel optical fiber thermometry system ( luxtron model 750 ) was used in the foot warming experiments . before the subject placed his foot in the nylon sock 13 , a temperature probe was taped in place on the bottom of the big toe , on bottom of the little toe , on the top of the foot under the central portion of the coil , and on the bottom of the foot at the instep . as in the hand warming experiments , temperature probe output was printed at 30 - second intervals . the rf system for tests is a 50 - watt military radio transmitter ( an / wrc - 1 ) generating and amplify a 27 . 12 mhz rf signal . a bird model 43 in - line power meter was used to monitor net rf power applied to the coils . for the hand - and foot - warming experiments , both control and irradiation experiments were conducted with each subject serving as his own control . control experiments were identical to those involving rf irradiation except that the rf generating apparatus was not energized . hand - warming experiments used 20 w net rf power , and foot - warming experiments used 25 w . these power levels were selected as being comfortable for all subjects and less than the average , whole - body specific absorption rate ( sar ) allowed by ansi c95 . 1 - 1982 . after the coil assembly had been secured to either the right hand or the right foot , two polyethylene bags were placed over the extremity before it was immersed into a 15 - gallon plastic tub containing simulated sea water , a three percent ( by weight ) salt solution at room temperature ( 24 °± 2 ° c . the rectangular plastic bags were sufficiently long to encase the submerged limb within a protective dam ; thereby , excluding the simulated sea water from intimate contact with the coil assembly . in the foot - warming experiments , three layers of elastic bandages were wrapped over the coil assembly to simulate the insulating effect of a heavy sock and dry boot . no bandages were used over the hand coil to simulate the limited insulating effect of a lightweight work glove . after immersion , data acquisition from the thermometry system was started . a 15 - minute equilibration period was then commenced followed by a 10 - minute irradiation ( rf experiments only ) which was followed by a five - minute post irradiation period for a total immersion time of 30 minutes . data analysis . for the 10 - minute period of rf irradiation , experimental and control temperatures were statistically compared at two - minute intervals beginning with the start of irradiation . for each subject and probe location , a normalized temperature increment ( delta t ) was obtained by subtracting the &# 34 ; irradiation &# 34 ; temperature from the &# 34 ; control &# 34 ; temperature and further subtracting any initial temperature offset such that at zero irradiation time , the normalized temperature increment ( delta t ) was zero . the resulting distributions of normalized rf - induced thermal rises were analyzed using a repeated measures analysis of variance ( anova ) and tested at the p = 0 . 05 level of significance for any change over time . the tests show that when the coil is driven at its resonant frequency , typically in the range of about 10 mhz to about 50 mhz at a power level of about 10 to 50 watts , the internal heating of the forearm , foot , and hand serves to greatly reduce the decrease in manual dexterity and discomfort in the extremities that are otherwise experienced in cold water . fig5 shows a comparison of heating in the submerged small toe of six human subjects who were fitted with a coil energized at 27 . 12 mhz with 25 watts . the water temperature was approximately 21 ° c . fig6 shows a similar comparison of finger warming in six subjects who were fitted with a coil energized at 27 . 12 mhz with 20 watts . the water temperature was about 21 ° c . manual dexterity tests in cold water using a standardized task such as unscrewing nuts from one set of studs and threading them onto another with varying levels of power applied to a forearm coil similar to that illustrated in fig2 shows the effectiveness of rf heating of the forearm . exclusion of water from a zone outside the outer envelope of the coil avoids the disruption of the electromagnetic field and lack of effective tissue heating in extremities that occurs when water , particularly salt water , intrudes between the coil wrap per se . the coil and rf transmitting zone may be incorporated into diving gear in many forms such as built into sleeves and leggings , gloves , gauntlets and the like . obviously , many modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that , within the scope of the appended claims , the invention may be practiced otherwise than as specifically described .

US-48916190-A

a novel garden bean cultivar , designated 208996 , is disclosed . the invention relates to the seeds of garden bean cultivar 208996 , to the plants of garden bean 208996 and to methods for producing a garden bean plant produced by crossing the cultivar 208996 with itself or another garden bean variety . the invention further relates to hybrid garden bean seeds and plants produced by crossing the cultivar 208996 with another garden bean cultivar .

garden bean cultivar 208996 has superior characteristics and was developed from the cross m 9227 ( female ) and m 9079 ( male ), which was made in the fall of 1994 in the greenhouse at harris moran research in california . the f 1 hybrids were grown in a greenhouse during the spring of 1995 . f 2 selection , plot number 1y1007 , was made at heath farm , coloma , wis . in the summer of 1995 . the f 3 selections were made in the fall of 1995 at san juan bautista , calif . f 4 plants were selected in a field plot in california in september 1996 ; f 5 selections were made in the summer of 1997 in heath farm , coloma , wis ,; f 6 generation was bulked in field plots near los mochis , sinaloa , mexico in february , 1998 for observation at selected location in summer 1998 . f 7 plants were selected in a field plot at san juan bautista , calif . in summer 1998 from the previous bulked plants . f 8 plants were selected and bulked in field plots near los mochis , sinaloa , mexico in february , 1999 . the f 1 generation is a stock seed increase at san juan bautista , calif . 208996 is a green snapbean with attractive , dark , glossy pods and rust resistance to three key races of rust that gives 208996 a superior advantage domestically but also internationally where rust disease is a limiting factor . in trials in the united states , japan and south africa , 208996 has shown excellent fresh pod yielding ability and plant adaptability . some of the criteria used to select in various generations include : pod appearance and length , fresh pod yield , pod set height , emergence , maturity , plant architecture , seed yield and quality , and disease resistance , especially rust resistance . rust resistance is an especially desired trait for a new bean variety . indeed , the bean rust pathogen uromyces appendiculatus may cause yield losses which can approach 100 % and that are related to earliness and severity of infection . the disease occurs worldwide . bean rust most frequently affects leaves but also affects pods , stem , and all other above ground , green portions of bean plants . the common sign of bean rust is the reddish brown , circular uredinial pustule on leaves or pods which ruptures the epidermis to produce abundant , powdery urediniospores . larger uredinia are often surrounded by a halo of yellow host tissue and may be surrounded by a ring of smaller secondary uredinia ( compendium of bean diseases , 1991 . edited by robert hall . aps press ). some bean are resistant to a few races of the rust pathogen , but only a few are resistant to the most infectious ones . 208996 , being resistant to races 38 , 53 and 72 can face a broad range of worldwide infections . resistance reactions are graded as immune ( no symptoms ) non sporuling necrotic spots , ranging from less than 0 . 3 to 5 or more mm in diameter and very small , small or moderate uredinia . 208996 is immune to races 38 and 72 and clearly demonstrate a very good resistance to race 53 , this resistance being characterized by pustules having a diameter less than 3 microns , not likely observable in field condition and causing no observable harm to the plant . the cultivar has shown uniformity and stability , as described in the following variety description information . it has been self - pollinated a sufficient number of generations with careful attention to uniformity of plant type . the line has been increased with continued observation for uniformity . garden bean cultivar 208996 has the following morphologic and other characteristics ( based on data collected at san juan bautista ). variety description information 1 . market maturity days to edible pods : 72 days number of days earlier than &# 39 ; paulista &# 39 ;: 0 days 2 . plant habit : determinate height : 36 cm taller than &# 39 ; paulista &# 39 ; by 6 cm spread : 31 cm narrower than &# 39 ; paulista &# 39 ; by 3 cm plant shape : high bush form 3 . leaves surface : intermediate size : medium color : dark green 4 . anthocyanin pigment flowers : absent stems : absent pods : absent seeds : absent leaves : absent petioles : absent peduncles : absent nodes : absent 5 . flower color color of standard : white color of wings : white color of keel : white 6 . pods ( edible maturity ) exterior color : dark green , glossy ( shiny ) processed pods : dark green dry pod color : buckskin pod shape : 2 . 5 − [ 3 = round ; 4 = figure eight ] creaseback : present pubescence : none constriction : none spur length : 7 mm fiber : none number seeds / pod : 6 suture string : absent seed development : slow machine harvest : adapted distribution of sieve size at optimum maturity : 3 % 4 . 76 - 5 . 76 mm - sieve 1 16 % 5 . 76 - 7 . 34 mm - sieve 2 53 % 7 . 34 - 8 . 34 mm - sieve 3 28 % 8 . 34 - 9 . 53 mm - sieve 4 average length of 3 sieve : 13 . 5 cm average length of 4 sieve : 14 . 5 cm 7 . seed color seed coat luster : semi - shiny seed coat : monochrome primary color : white hilar ring : absent 8 . seed shape and size hilum view : elliptical cross section : oval side view : oval to oblong seed size : 20 . 6 gm / 100 seeds lighter than &# 39 ; labrador &# 39 ; by 6 . 5 gm / 100 seeds 9 . disease resistance bean common mosaic virus ( bcmv ) - resistant beet curly top virus ( bctv ) resistant bean rust ( uromyces appendiculatus ) races 38 immune race 53 resistant race 72 immune the cultivar 208996 has dark , glossy , attractive fresh market pods , with a high pod set height , which are on an erect machine harvestable bush . 208996 is resistant to bean common mosaic virus and beet curly top virus . 208996 is immune to rust races 38 , and 72 and resistant to rust race 53 . the frozen product of 208996 is attractive with a uniform dark pod color . the cultivar 208996 is most similar to ‘ paulista ’ but differs in that 208996 is resistant to rust races 38 , 53 and 72 whereas ‘ paulista ’ is susceptible . 208996 is also easily distinguished by a much darker pod than ‘ paulista ’. in table 1 that follows , the percentage of bean pod with different sieve sizes is shown for year 1998 . the first column lists the variety tested . the second shows the location . columns 3 - 5 show the percentage of beans for different sieve sizes 2 , 3 and 4 respectively . column 6 lists the yield in tons per acre and column 7 has days to maturity . in table 2 that follows , the yield in tons per acre is shown for year 1999 . the first column lists the variety tested . the second shows the location and the third shows the yield . column 4 shows the days to maturity , related to the location . this invention is also directed to methods for producing a garden bean plant by crossing a first parent garden bean plant with a second parent garden bean plant , wherein the first or second garden bean plant is the garden bean plant from the line 208996 . further , both first and second parent garden bean plants may be from the cultivar 208996 . therefore , any methods using the cultivar 208996 are part of this invention : selfing , backcrosses , hybrid breeding , and crosses to populations . any plants and seeds produced using cultivar 208996 as a parent are within the scope of this invention . still further , this invention is also directed to methods for producing a garden bean line 208996 - derived bean plant by crossing bean line 208996 with a second bean plant and growing the progeny seed , and repeating the crossing and growing steps with the bean line 208996 - derived garden plant from 0 to 7 times . the 208996 - derived garden plant are also part of the invention . as used herein , the term “ plant ” includes plant cells , plant protoplasts , plant cells of tissue culture from which garden bean plants can be regenerated , plant calli , plant clumps , and plant cells that are intact in plants or parts of plants , such as pollen , flowers , embryos , ovules , seeds , pods , leaves , stems , roots , anthers and the like . the present invention contemplates a bean plant regenerated from a tissue culture of a variety ( e . g . 208996 ) or a hybrid plant of the present invention . as used herein , the term “ tissue culture ” indicates a composition comprising isolated cells of the same or a different type or a collection of such cells organized into parts of a plant . exemplary types of tissue cultures are protoplasts , calli , plant clumps , and plant cells that can generate tissue culture that are intact in plants or parts of plants , such as embryos , pollen , flowers , leaves , stems , roots , pods , anthers , and the like . in a preferred embodiment , tissue culture is embryos , protoplast , meristematic cells , pollen , leaves or anthers . means for preparing and maintaining plant tissue culture are well known in the art . as is well known in the art , tissue culture of garden bean can be used for the in vitro regeneration of a garden bean plant . tissue culture of various tissues of garden beans and regeneration of plants therefrom is well known and widely published . for example , reference may be had to mcclean , p . ; grafton , k . f . ( 1989 ): “ regeneration of dry bean ( phaseolus vulgaris ) via organogenesis .” plant sci . 60 , 117 - 122 . mergeai , g . ; baudoin , j . p . ( 1990 ): “ development of an in vitro culture method for heart - shaped embryo in phaseolus vulgarism ” b . i . c . invit . papers 33 , 115 - 116 . vanderwesthuizen , a . j . ; groenewald , e . g . ( 1990 ): “ root formation and attempts to establish morphogenesis in callus tissues of beans ( phaseolus - vulgaris l . ).” s . afr . j . bot . 56 ( 2 , april ), 271 - 273 . benedicic , d ., et al . ( 1990 ): “ the regeneration of phaseolus vulgaris l . plants from meristem culture .” abst . 5th i . a . p . t . c . cong . 1 , 91 (# a3 - 33 ). genga , a . ; allavena , a . ( 1990 ): “ factors affecting morphogenesis from immature cotyledons of phaseolus coccineus l .” abst . 5th i . a . p . t . c . cong . 1 , 101 (# a3 - 75 ). vaquero , f ., et al . ( 1990 ): “ plant regeneration and preliminary studies on transformation of phaseolus coccineus .” abst . 5th i . a . p . t . c . cong . 1 , 106 (# a3 - 93 ). franklin , c . i ., et al . ( 1991 ): “ plant regeneration from seedling explants of green bean ( phaseolus - vulgaris l .) via organogenesis .” plant cell tissue org . cult . 24 ( 3 , march ), 199 - 206 . malik , k . a . ; saxena , p . k . ( 1991 ): “ regeneration in phaseolus - vulgaris l .— promotive role of n6 - benzylaminopurine in cultures from juvenile leaves .” planta 184 ( 1 ), 148 - 150 . genga , a . ; allavena , a . ( 1991 ): “ factors affecting morphogenesis from immature cotyledones of phaseolus coccineus l .” plant cell tissue org . cult . 27 , 189 - 196 . malik , k . a . ; saxena , p . k . ( 1992 ): “ regeneration in phaseolus vulgaris l . l .— high - frequency induction of direct shoot formation in intact seedlings by n - 6 - benzylaminopurine and thidiazuron .” 186 ( 3 , feb . ), 384 - 389 . malik , k . a . ; saxena , p . k . ( 1992 ): “ somatic embryogenesis and shoot regeneration from intact seedlings of phaseolus acutifolius a ., p . aureus ( l .) wilczek , p . coccineus l ., and p . wrightii l .” pi . cell . rep . 11 ( 3 , april ), 163 - 168 . chavez , j ., et al . ( 1992 ): “ development of an in vitro culture method for heart shaped embryo in phaseolus polyanthus .” b . i . c . invit . papers 35 , 215 - 216 . munoz - florez , l . c ., et al . ( 1992 ): “ finding out an efficient technique for inducing callus from phaseolus microspores .” b . i . c . invit . papers 35 , 217 - 218 . vaquero , f ., et al . ( 1993 ): “ a method for long - term micropropagation of phaseolus coccineus l .” l . pi . cell . rep . 12 ( 7 - 8 , may ), 395 - 398 . lewis , m . e . ; bliss , f . a . ( 1994 ): “ tumor formation and beta - glucuronidase expression in phaseolus vulgaris l . inoculated with agrobacterium tumefaciens .” journal of the american society for horticultural science 119 ( 2 , march ), 361 - 366 . song , j . y ., et al . ( 1995 ): “ effect of auxin on expression of the isopentenyl transferase gene ( ipt ) in transformed bean ( phaseolus vulgaris l . l .) single - cell clones induced by agrobacterium tumefaciens c 58 .” j . plant physiol . 146 ( 1 - 2 , may ), 148 - 154 . thus , another aspect of this invention is to provide cells which upon growth and differentiation produce garden bean plants having the physiological and morphological characteristics of variety 208996 . the present invention encompasses methods for producing a bean plant containing in its genetic material one or more transgene and the transgenic bean plant produced by that method . the molecular techniques allow to engineer the genome of plants by adding or modifying foreign or endogenous genes ( referred here as transgenes ) in such a manner that the traits of the plant can be modified in a specific way . plant transformation involves the construction of an expression vector comprising one or more genes under control or operatively linked to a regulatory element ( e . g . a promoter ). such vector can be used to provide transformed bean plants , using transformation methods as described hereafter to incorporate the gene or the genes into the genetic material of the bean plant . to facilitate the identification of transformed plant cells , the vector of this invention may include plant selectable markers . selectable markers and uses are well known in the art and include enzymes which provide for resistance to antibiotics such as gentamycin ( hayford et al ., plant physiol . 86 : 1216 ( 1988 )), hygromycin ( vanden elzen et al ., plant mol . biol ., 5 : 299 ( 1985 )), kanamycin ( fraley et al ., proc . natl . acad . sci . u . s . a ., 80 : 4803 ( 1983 )), and the like . similarly , enzymes providing for production of a compound identifiable by color change such as gus , ( beta .- glucuronidase jefferson , r . a ., plant mol . biol . rep . 5 : 387 ( 1987 )), or luciferase are useful . gus expression vectors and gus gene cassettes are available from clone tech laboratories , inc ., palo alto , calif . while luciferase expression vectors and luciferase gene cassettes are available from pro mega corp . ( madison , wis .) genes included in expression vectors must be driven by a nucleotide sequence comprising a regulatory element , for example , a promoter . several types of promoters are now well known in the transformation arts , as are other regulatory elements that can be used alone or in combination with promoters . as used herein “ promoter ” includes reference to a region of dna upstream from the start of transcription and involved in recognition and binding of rna polymerase and other proteins to initiate transcription . a “ plant promoter ” is a promoter capable of initiating transcription in plant cells . “ tissue - specific ” promoters initiate transcription only in certain tissues , such as a pollen - specific promoter from zm13 ( guerrero et al ., mol . gen . genet . 224 : 161 - 168 ( 1993 ). “ inducible ” promoter is under environmental control , such as the inducible promoter from a steroid hormone gene , the transcriptional activity of which is induced by a glucocorticosteroid hormone . schena et al ., proc . natl . acad . sci . u . s . a . 88 : 0421 ( 1991 ). tissue - specific and inducible promoters are “ non - constitutive ” promoters . a “ constitutive ” promoter is a promoter which is active under most environmental conditions such as the 35s promoter from camv ( odell et al ., nature 313 : 810 - 812 ( 1985 ) or the promoters from such genes as rice actin ( mcelroy et al ., plant cell 2 : 163 - 171 ( 1990 )). these regulatory sequences will allow the expression of the transgenes in the transformed cells , in the transformed plants . the transgenes may code for proteins including plant selectable markers but also proteins adding a value trait to the crop such as agronomic , nutritional or therapeutic value or proteins conferring resistance to diseases and / or pathogens ( e . g . bacterial , fungal , insect or herbicide resistance ). several techniques , depending on the type of plant or plant cell to be transformed , are available for the introduction of the expression construct containing a dna sequence encoding an protein of interest into the target plants . see , for example , miki et al ., “ procedures for introducing foreign dna into plants ” in methods in plant molecular biology and biotechnology , glick , b . r . and thompson , j . e . eds . ( crc press , inc ., boca raton , 1993 ) pages 67 - 88 . in addition , expression vectors and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are available . see , for example , gruber et al ., “ vectors for plant transformation ” in methods in plant molecular biology and biotechnology , glick , b . r . and thompson , j . e . eds . ( crc press , inc ., boca raton , 1993 ) pages 89 - 119 . methods of introducing expression vectors into plant tissue include the direct infection or co - cultivation of plant cells with agrobacterium tumefaciens , horsch et al ., science , 227 : 1229 ( 1985 ). descriptions of agrobacterium vectors systems and methods for agrobacterium - mediated gene transfer provided by gruber , et al ., supra . procedures for garden bean transformation have been described by : mcclean , p ., et al . ( 1991 ): “ susceptibility of dry bean ( phaseolus - vulgaris l .) to agrobacteriumlnfection — transformation of cotyledonary and hypocotyl tissues .” plant cell tissue org . cult . 24 ( 2 , feb . ), 131 - 138 . russell , d . r ., et al . ( 1993 ): “ stable transformation of phaseolus vulgaris l . via electric - discharge mediated particle acceleration .” pi . cell . rep . 12 ( 3 , jan . ), 165 - 169 . franklin , c . i ., et al . ( 1993 ): “ genetic transformation of green bean callus via agrobacterium mediated dna transfer .” pi . cell . rep . 12 ( 2 , jan . ), 74 - 79 . aragao , f . j . l ., et al . ( 1992 ): “ particle bombardment - mediated transient expression of a brazil nut methionine - rich albumin in bean ( phaseolus vulgaris l . l . ).” plant mol . biol . 20 ( 2 , oct . ), 357 - 359 . aragao , f . j . l ., et al . ( 1993 ): “ factors influencing transient gene expression in bean ( phaseolus vulgaris l . l .) using an electrical particle acceleration device .” pi . cell . rep . 12 ( 9 , july ), 483 - 490 . francisco aragao ( 1996 ): “ inheritance of foreign genes in transgenic bean ( phaseolus vulgaris l . l .) co - transformed via particle bombardment .” theor . appl . genet . 93 : 142 - 150 . zhang , z ., et al . ( 1997 ): “ factors affecting agrobacterium - mediated transformation of common bean .” j . amer . soc . hort . sci . 122 ( 3 ): 300 - 305 . kim , j . ; minamikawa , t . ( 1996 ): “ transformation and regeneration of french bean plants by the particle bombardment process .” plant science 117 : 131 - 138 . saker , m . ; kuhne , t . ( 1997 / 98 ): “ production of transgenic kidney bean shoots by electroporation of intact cells .” biologia plantarum 40 ( 4 ): 507 - 514 . useful methods include but are not limited to expression vectors introduced into plant tissues using a direct gene transfer method such as microprojectile - mediated delivery , dna injection , electroporation and the like . more preferably expression vectors are introduced into plant tissues using the microprojectile media delivery with the biolistic device agrobacterium - medicated transformation . transformant plants obtained with the protoplasm of the invention are intended to be within the scope of this invention . following transformation of bean target tissues , expression of the above - described selectable marker genes allows for preferential selection of transformed cells , tissues and / or plants , using regeneration and selection methods now well known in the art . the transgenic lines produced by the forgoing methods could then be crossed , with another ( non - transformed or transformed ) line , in order to produce a new bean plant . when the terms bean plant , bean cultivar or bean line are used in the context of the present invention , this also includes any single gene conversions of that line . the term single gene converted plant as used herein refers to those bean plants which are developed by a plant breeding technique called backcrossing wherein essentially all of the desired morphological and physiological characteristics of a line are recovered in addition to the single gene transferred into the cultivar via the backcrossing technique . backcrossing methods can be used with the present invention to improve or introduce a characteristic into the line . the term backcrossing as used herein refers to the repeated crossing of a hybrid progeny back to one of the parental bean plants for that line . the parental bean plant which contributes the gene for the desired characteristic is termed the nonrecurrent or donor parent . this terminology refers to the fact that the nonrecurrent parent is used one time in the backcross protocol and therefore does not recur . the donor parent may , or may not be transgenic . the parental bean plant to which the gene or genes from the nonrecurrent parent are transferred is known as the recurrent parent as it is used for several rounds in the backcrossing protocol ( poehiman & amp ; sleper , 1994 ,; fehr , 1987 ). in a typical backcross protocol , the original cultivar of interest ( recurrent parent ) is crossed to a second line ( nonrecurrent parent ) that carries the single gene of interest to be transferred . the resulting progeny from this cross are then crossed again to the recurrent parent and the process is repeated until a bean plant is obtained wherein essentially all of the desired morphological and physiological characteristics of the recurrent parent are recovered in the converted plant , in addition to the single transferred gene from the nonrecurrent parent . the selection of a suitable recurrent parent is an important step for a successful backcrossing procedure . the goal of a backcross protocol is to alter or substitute a single trait or characteristic in the original line . to accomplish this , a single gene of the recurrent line is modified or substituted with the desired gene from the nonrecurrent parent , while retaining essentially all of the rest of the desired genetic , and therefore the desired physiological and morphological , constitution of the original cultivar . the choice of the particular nonrecurrent parent will depend on the purpose of the backcross , one of the major purposes is to add some commercially desirable , agronomically important trait to the plant . the exact backcrossing protocol will depend on the characteristic or trait being altered to determine an appropriate testing protocol . although backcrossing methods are simplified when the characteristic being transferred is a dominant allele , a recessive allele may also be transferred . in this instance it may be necessary to introduce a test of the progeny to determine if the desired characteristic has been successfully transferred . many single gene traits have been identified that are not regularly selected for in the development of a new line but that can be improved by backcrossing techniques . single gene traits may or may not be transgenic , examples of these traits include but are not limited to , herbicide resistance , resistance for bacterial , fungal , or viral disease , insect resistance , enhanced nutritional quality , industrial usage , yield stability and yield enhancement . these genes are generally inherited through the nucleus . several of these single gene traits are described in u . s . pat . nos . 5 , 777 , 196 ; 5 , 948 , 957 and 5 , 969 , 212 , the disclosures of which are specifically hereby incorporated by reference . a deposit of the garden bean seed of this invention is maintained by harris moran seed company , 100 breen road , san juan bautista , calif . 95045 . access to this deposit will be available during the pendency of this application to persons determined by the commissioner of patents and trademarks to be entitled thereto under 37 cfr 1 . 14 and 35 usc 122 . upon allowance of any claims in this application , all restrictions on the availability to the public of the variety will be irrevocably removed by affording access to a deposit of at least 2 , 500 seeds of the same variety with the american type culture collection , manassas , va . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding , it will be obvious that certain changes and modifications may be practiced within the scope of the invention , as limited only by the scope of the appended claims .

US-72612600-A

this invention relates to novel colonic purgative compositions in a solid dosage form , comprising at least one purgative and at least one soluble , or soluble , nonfermentable binder , such as polyethylene glycol . further , this invention relates to methods of using the colonic purgative compositions . the present compositions and methods are designed to improve patient tolerance and compliance , while at the same time improving the quality of bowel cleansing . the formulations and methods of this invention are particularly useful to cleanse the bowel prior to diagnostic and surgical procedures and can also be employed in lower dosages as a laxative to promote elimination and / or to relieve constipation .

in order that the present invention may be more readily understood , certain terms are first defined . additional definitions are set forth throughout the detailed description . the term “ purgative ” refers to any substance that promotes defecation . thus , the term purgative encompasses a range of cathartic effects . for instance , the term purgative encompasses mild catharsis , producing laxation (“ partial purgation ”), as well as stronger catharsis , providing complete or near - complete emptying of the large bowel (“ complete purgation ”). in one embodiment of the invention , the term refers to diarrhea . in another embodiment of the invention , the term refers to a softening or loosening of the feces or laxation . unless modified by “ partial ” or “ complete ,” purgative or purgation encompasses the full range of purgative processes , including both complete purgation and laxation (“ partial purgation ”). the term “ osmotic ” refers to any substance that promotes the passage of a solvent from a solution of lesser to one of greater solute concentration when the two solutions are separated by a membrane that selectively prevents the passage of solute molecules , but is permeable to the solvent . in the present invention , the term “ osmotic ” may refer to the ability of a substance to draw water into the intestines . the term “ fermentable ” refers to any substance that can be anaerobically catabolized to simpler compounds , usually by bacteria and / or yeast . there are many types of fermentation , differing in the waste products formed and the fermentable substance . fermentable substances include , but are not limited to , sugars , sugar - alcohols , polysaccharides , lactose , sorbitol , and mannitol . a fermentable substance releases explosive gases upon fermentation . the compound mannitol , for instance , can be fermented by bacteria that are typically resident in the colon of most humans and other mammals , during which hydrogen gas is released . the term “ nonfermentable ” refers to a substance that is not fermentable . the term “ soluble ” or “ water soluble ” refers to an aqueous solubility that is higher than 1 / 10 , 000 ( mg / ml ). the solubility of a substance , or solute , is the maximum mass of that substance that can be dissolved completely in a specified mass of the solvent , such as water . “ practically insoluble ” or “ insoluble ,” on the other hand , refers to an aqueous solubility that is 1 / 10 , 000 ( mg / ml ) or less . water soluble or soluble substances include , for example , polyethylene glycol . the term “ binder ” refers to any substance that exerts a physicochemical attractive force between molecules , and hence may be used in formulation of a dosage form . in one embodiment of the invention , the binder may be mixed with other components of the composition , so that it is distributed uniformly throughout the dosage form . the binder may also provide a matrix upon which any additional components can associate . in one embodiment of the invention , the binder is soluble and nonfermentable . soluble and nonfermentable binders suitable for use in the invention include , but are not limited to , polyethylene glycol ( peg ). as used herein , the term “ salt ” or “ pharmaceutically acceptable salt ” refers to acidic salts formed with inorganic and / or organic acids , as well as basic salts formed with inorganic and / or organic bases . examples of these acids and bases are well known to those of ordinary skill in the art . salts according to the present invention may be used in a variety of forms , for example anhydrous or a hydrated crystalline form . the salts may also be those that are physiologically tolerated by a patient . many binders used in solid dosage formulations are insoluble . applicants discovered that insoluble binders , such as microcrystalline cellulose ( mcc ), are retained in the colon , hamper visualization of the colon , and prolong colonoscopy procedure time ( fig1 ). commonly used soluble binders , however , including sugars , sugar - alcohols , and polysaccharides , can be fermented by the intestinal flora . the formation of explosive gases during the fermentation process is an undesirable property during certain surgical and diagnostic procedures involving the colon , such as during a colonoscopy using equipment that may produce a spark . in some documented cases , the presence of these gases during colon electrosurgery has led to explosion ( dewilt et al . ( 1996 ) j . r . coll . surg . edinb . 41 : 419 ). gases produced during the use of a laxative can also be unpleasant and embarrassing . in one embodiment of the invention , such as to prepare the colon for a colonoscopy , the solid dosage form colonic purgative formulation comprises at least one soluble , nonfermentable binder and at least one purgative . in another embodiment , such as , to prepare the colon for a diagnostic procedure that cannot produce a spark in the colon , such as x - ray imaging , virtual colonoscopy ( helical ct ), and capsule endoscopy , any soluble binder may be used in the composition . in these instances , it is not necessary that the binder or other ingredients be nonfermentable . soluble , nonfermentable binders may , however , be used in compositions to prepare the colon for procedures that cannot produce a spark . any binder that is soluble , or soluble and nonfermentable , may be used in the present invention . however , binders that are fermentable , like any other fermentable ingredient , should only be used in embodiments where a spark would not be produced in the colon . a soluble , nonfermentable binder that may be used in the formulations of the invention includes , but is not limited to , polyethylene glycol ( peg ). applicants discovered that a purgative composition containing the soluble , nonfermentable binder peg , leaves little or no residue after use for bowel preparation , thereby increasing visualization of the colon ( fig2 ). peg is represented by the structural formula : hoch 2 ( ch 2 och 2 ) m ch 2 oh , wherein m represents the average number of oxyethylene groups . any peg polymer may be employed in the compositions contemplated herein . in one embodiment , the peg polymers are solid at room temperature ( i . e ., 25 ° c .) and / or soluble in ( or miscible with ) water at room temperature . in one embodiment of the invention , the average molecular weight of the peg polymer is at least 200 , at least 400 , at least 600 , at least 1 , 000 , at least 1540 , at least 3000 , at least 4 , 000 , or at least 8 , 000 . in one embodiment of the invention , the average molecular weight of the peg polymer is from 7 , 000 to 9 , 000 . the amount of soluble and / or non - fermentable binder may vary depending on the desired characteristics of the solid dosage form and can be determined by one of ordinary skill in the art . in one embodiment of the invention , a peg binder comprises 5 - 20 %, in another embodiment 7 . 5 - 15 %, and in an additional embodiment 10 % by weight . in one embodiment of the invention , the composition of the invention is free of insoluble binder or only contains levels of insoluble binder that do not impede the visualization of the colon . various purgatives are available commercially , and any available form of the material can be used in the practice of this invention . purgatives that may be used in the invention include , but are not limited to , non - osmotic , osmotic , and bulk - forming purgatives . the invention may contain one purgative , more than one purgative from the same category , or more than one purgative from different categories may be used . many purgatives may have more than one role or function , or may be classified in more than one group . such classifications are descriptive only , and not intended to limit any use of a particular purgative . in one embodiment of the invention , at least one osmotic purgative is used in the formulation of the invention . osmotic purgatives act by increasing intestinal osmotic pressure thereby promoting retention of fluid within the bowel . osmotic purgatives that may be included in the composition include salts , for example , magnesium citrate , magnesium chloride , magnesium hydroxide , magnesium phosphate , magnesium sulfate , magnesium tartrate , sodium phosphate , sodium tartrate , sodium sulfate , potassium tartrate , magnesium oxide , sodium sulfate , or salts thereof . other examples of osmotic purgatives include glycerin , sorbitol , mannitol , lactitol , alcohol sugars , l - sugars , polyethylene glycol , and lactulose . however , purgatives that are fermentable should only be used in embodiments where a spark would not be produced in the colon . in one embodiment of the invention , the at least one purgative is sodium phosphate or a salt thereof . in an additional embodiment of the invention , the at least one purgative is monobasic sodium phosphate , dibasic sodium phosphate , or tribasic sodium phosphate . salts according to the present invention may be used in a variety of forms , for example anhydrous or a hydrated form . it is also contemplated that a change in the form of a salt may increase or decrease its molecular weight . to account for any change in molecular weight , components of the purgative formulation and / or amounts of the purgative salts may be adjusted according to the knowledge of the person of ordinary skill in the art . in one embodiment of the invention , monobasic sodium phosphate is used in a monohydrate form . in another embodiment of the invention , dibasic sodium phosphate is used in an anhydrous form . in one embodiment of the invention , the formulation of the invention comprises at least one non - osmotic purgative . non - osmotic purgatives include prokinetic laxatives that stimulate the motility of the gastrointestinal tract , as well as stimulant laxatives that act by directly stimulating nerve endings in the colonic mucosa . emollient laxatives and mucosal protectants may also be used in the invention . examples of non - osmotic purgatives that may be used in the invention include , but are not limited to , mineral oil , aloe , bisacodyl , sodium picosulfate , casanthranol , cascara , castor oil , danthron , dehydrocholic acid , phenolphthalein , sennosides , docusate , bethanachol , colchicines , misoprostol , cisapride , norcisapride , paraffin , rhein , and tegaserod . in one embodiment of the invention , the colonic purgative composition contains at least one osmotic purgative and at least one non - osmotic purgative . in addition to at least one osmotic purgative and / or at least one non - osmotic purgative , the colonic purgative formulations of the invention may also comprise at least one bulk - forming purgative . bulk - forming purgatives cause retention of fluid and an increase in fecal mass , resulting in stimulation of peristalsis . bulk - forming laxatives may include various natural and semisynthetic polysaccharides , cellulose derivatives , or other substances that dissolve or swell in water to form an emollient gel or viscous solution that serves to maintain the feces soft and hydrated . examples of bulk - forming purgatives that can be used in the invention include , but are not limited to , methylcellulose , sodium carboxymethyl cellulose , bran , psyllium , sterculia , and testa ispaghula . additional optional components may be included in the formulations of this invention to , for example , enhance the characteristics of the solid dosage form , maintain the integrity of particles of the active ingredient during the formulation process , and / or enhance the safety of the formulation . any additional components may be compatible with the other ingredients in the formulations of the invention , in particular the active ingredients , and may not adversely affect the osmolarity of the formulations . additional optional ingredients that may be used in the formulations of the invention include , for example , coatings , diluents , binders , glidants , lubricants , colors , disintegrants , flavors , sweeteners , polymers or waxes . lubricants , for example , may be included in the formulations of the invention . such lubricants include , but are not limited to , magnesium stearate , potassium stearate , talc , stearic acid , sodium lauryl sulphate , and paraffin . in one embodiment of the invention , the colonic purgative formulation further comprises magnesium stearate . lubricants serve to facilitate the manufacturing of a solid dosage form . additional suitable ingredients also include , but are not limited to , carriers , such as sodium citrate and dicalcium phosphate ; fillers or extenders , such as stearates , silicas , gypsum , starches , lactose , sucrose , glucose , mannitol , talc , and silicic acid ; binders , such as hydroxypropyl methylcellulose , hydroxymethyl - cellulose , alginates , gelatin , polyvinyl pyrrolidone , sucrose , and acacia ; humectants , such as glycerol ; disintegrating agents , such as agar , calcium carbonate , potato and tapioca starch , alginic acid , certain silicates , colloidal silicon dioxide , sodium starch glycolate , crospovidone , and sodium carbonate ; solution retarding agents , such as paraffin ; absorption accelerators , such as quaternary ammonium compounds ; wetting agents , such as cetyl alcohol and glycerol monostearate ; absorbents , such as kaolin and bentonite clay ; stabilizers , such as fumaric acid ; coloring agents ; buffering agents ; dispersing agents ; preservatives ; organic acids ; and organic bases . in one embodiment of the invention , an additional component in the formulations of the invention may function to maintain the electrolyte balance in a patient . for example , formulations of the invention may further comprise calcium , phosphate , potassium , magnesium , other anions , or salts thereof , which may normally be lost in diarrhea fluid . acidic or basic compounds may also be optionally added to the composition to adjust the ph of the compound or to alter the disintegration characteristics . acidic or basic compounds that may be included in the formulations of the invention include , but are not limited to , sodium carbonate , sodium bicarbonate , sodium phosphate , calcium carbonate , magnesium hydroxide , potassium hydroxide , magnesium carbonate , and aluminum hydroxide . the aforementioned ingredients are given as examples only and are not meant to include all possible choices . additionally , many may have more than one role or function , or be classified in more than one group . such classifications are descriptive only , and not intended to limit any use of a particular component . to optimize the solid dosage formulations , components and amounts of the colonic purgative formulations of the invention may be adjusted according to the knowledge of the person of ordinary skill in the art . sample ingredient ranges for a colonic purgative formulation example are provided in table 1 . not all of the components are necessary , but are provided for illustration only . for example , it may not be necessary to have two distinct purgatives and it may also not be necessary to have a lubricant , such as magnesium stearate . the present invention also encompasses methods of using the colonic purgative formulations . the colonic purgative formulations of the invention produce a broad range of activities , depending on the dosage administered . the present invention encompasses methods of purging the colon comprising administering to at least one patient a colonic purgative formulation and allowing said formulation to purge the colon . the formulations of the invention may also be used at lower doses in order to regulate , soften or loosen the stool . thus , the present invention also encompasses methods of maintaining the elimination or increasing the elimination of feces in the bowel , comprising administering to at least one patient a colonic purgative formulation and promoting the elimination of feces in the bowel . the colonic purgative formulations of the invention may also be used to treat a patient with constipation . the constipation may be caused by a variety of factors including , but not limited to at least one of travel ; change in daily routine ; lack of exercise ; immobility caused by injury , illness , or aging ; dehydration ; irritable bowel syndrome ; pregnancy ; diabetes ; hypothyroidism ; hypercalcemia ; cancer of the colon or rectum ; uterine prolapse ; vaginal vault prolapse ; rectal prolapse ; scarring from surgery ; injury of the colon or rectum ; parkinson &# 39 ; s disease ; multiple sclerosis ; stroke ; hemorrhoid or anal fissures ; delaying bowel movements ; anxiety ; depression ; eating disorders ; and obsessive - compulsive disorder . the constipation may also be idiopathic , i . e . of unknown causation . in another embodiment of the invention the composition of the invention is used to treat a patient suffering from , or susceptible to , constipation due to administration of a medication that causes constipation . a medication that may cause constipation includes , but is not limited to antacids that contain aluminum ; antidepressants ; blood pressure medications ; calcium channel blockers ; calcium supplements ; chemotherapy medications ; cold medicines ; antihistamines ; diuretics ; iron supplements ; medications for parkinson &# 39 ; s disease ; lipid - lowering agents ; pain medications ; opiates ; codeine ; and tranquilizers . one of skill in the art will recognize that the appropriate dosage of the colonic purgative compositions may vary depending on the individual being treated and the purpose . for example , the age , body weight , and medical history of the individual patient may affect the therapeutic efficacy of the therapy . further , a lower dosage of the composition may be needed to produce a mild catharsis , while complete purgation may require a higher dose . a competent physician can consider these factors and adjust the dosing regimen to ensure the dose is achieving the desired therapeutic outcome without undue experimentation . it is also noted that the clinician and / or treating physician will know how and when to interrupt , adjust , and / or terminate therapy in conjunction with individual patient response . dosages also depend on the strength of the particular purgative ( s ) chosen for the formulation . in one embodiment of the invention , the total dosage is administered in at least one application period . in an additional embodiment of the invention , the total dosage is administered in two or more separate application periods , or separate doses . the dose of the colonic purgative formulations may vary . for example , a lower dose of a colonic purgative formulation of the invention may be needed to produce a mild catharsis , while complete purgation may require a higher dose . a total daily dosage used for mild catharsis , for example , can range from 1 g to 30 g of a purgative . for example , in general , a total daily dosage of a purgative , such as sodium phosphate , in formulations of the present invention ranges from 1 to 30 g , 2 to 25 g , 3 to 20 g , 4 to 18 g , 5 to 16 g , 6 to 14 g , or 8 to 12 g . a total daily dosage may be formulated to contain 1 , 2 , 4 , 6 , 8 , 10 , 12 , 14 , 16 , 18 , 20 , 22 , 24 , 26 , 28 , or 30 g of a purgative , such as sodium phosphate . additional doses of the colonic purgative formulation may be necessary to produce the desired therapeutic effect . in one embodiment of the invention , the total daily dosage is administered every 24 hours until the desired therapeutic effects are reached . a higher dose of a colonic purgative formulation of the invention may be needed to produce a complete purgation of the colon . a total dosage used for complete purgation , for example , can range from 20 g to 100 g of a purgative , optionally provided over a period of time of up to 24 hours . for example , in general , a total daily dosage of a purgative , such as sodium phosphate , in formulations of the present invention may range from 20 to 100 g , 30 to 90 g , 40 to 80 g , or 50 to 70 g . a dose may be formulated to contain 20 , 30 , 40 , 50 , 60 , 70 , 80 , 90 , or 100 g of a purgative , such as sodium phosphate . optionally , in both the laxative and complete purgative embodiments , the total daily dosage may be separated into divided doses . in one embodiment of the invention , the total daily dosage is divided into two doses , separated by a period of up to 24 hours . for instance , a total daily dosage of 60 g of a purgative , such as sodium phosphate , may be divided into two doses of 30 g each . one dose of 30 g may be administered in the evening before a colon procedure , while the second dose of 30 g may be administered in the morning , 3 to 5 hours before the colon procedure . in another embodiment of the invention , the total daily dose is divided into three , four , or more doses . in one embodiment of the invention , the addition of one or more purgatives to the composition , for example a colonic purgative composition comprising sodium phosphate and bisacodyl , may lower the amount of active ingredient in each dose , the number of doses , the administration time , and / or the number of tablets administered in a dose . in one embodiment of the invention , the colonic purgative formulation is in an easily administered , solid dosage form . solid dosage forms include , for example , a tablet , capsule , or caplet . the dosage form may be coated or encapsulated . in one embodiment of the invention , the colonic purgative formulation is in the form of a tablet . the number of tablets administered in a dose may vary depending on the desired effect and on the amount of active ingredient in each solid dosage form . clear liquids may be taken with each dose . a colonic purgative composition of the invention may be part of a kit . in one embodiment of the invention , the kit further comprises materials to assist in the administration of the composition , for instance a cup . in another embodiment of the invention , the kit further comprises compositions that assist in laxation or complete purgation . additional compositions that may be included in a kit with the colonic purgative compositions of the invention include , but are not limited to , at least one non - osmotic purgative , osmotic purgative , and / or bulk - forming laxative . in one embodiment of the invention , the kit comprises a colonic purgative composition of the invention and a composition containing bisacodyl . a colonic purgative composition of the invention may be administered by various routes . in one embodiment of the invention , the purgative composition is administered orally . in an additional embodiment of the invention , the purgative composition is administered through a tube , for instance a feeding tube or nasogastric tube . the colonic purgative formulations of the invention may be manufactured in a variety of ways . in one embodiment of the invention , the formulations may be produced using a direct - compression or hot - melt process . in an additional embodiment of the invention , a process of producing a colonic purgative formulation comprises mixing the components , warming the mixture to the melting point of the polyethylene glycol , and compressing the mixture into tablets . in the hot melt process , for instance , the ingredients may be mixed in a high - shear mixer equipped with a jacketed mixing bowl . the blend may be warmed up to the melting point of peg during mixing and cooling down when the end - point is reached . the blend may be cooled down overnight , milled , lubricated , and compressed into tablets . one of ordinary skill in the art will recognize methods of varying the manufacturing process to optimize the dosage form or increase the product amount for large scale manufacturing . preparation and use of colonic purgative formulations containing an insoluble binder two colonic purgative formulations ; comprising the components set forth in table 2 , were produced by milling and blending , followed by direct compression . the target weight of each diacol ® tablet ( inkine pharmaceutical company , blue bell , pa .) was 2000 . 0 mg , which was consistently achieved by the manufacturing process . the target weight of each visicol ® tablet ( inkine pharmaceutical company , blue bell , pa .) was 1764 . 8 . 0 mg , which was consistently achieved by the manufacturing process . physical testing of both formulations revealed that the tablets exhibited an appropriate strength , hardness , and disintegration time . visicol ® tablets were administered to humans in two , twenty tablet doses . one dose was administered the night before the colonoscopy procedure and the second dose was administered in the morning , 3 to 5 hours before the procedure . colonoscopy revealed the presence of the binder , mcc , in the colon of patients . as shown in fig1 , mcc leaves a white powdery substance in the colon after use for bowel preparation , which significantly impairs visualization of the colon . a colonic purgative formulation comprising the components set forth in table 3 , was produced using a hot melt process via high - shear granulation followed by milling , lubrication , and compression . specifically , sodium phosphate monobasic monohydrate ( 295 . 9 kg ) was passed through a sieve equipped with a 10 mesh stainless steel screen . sodium phosphate dibasic anhydrous ( 106 . 9 kg ) and polyethylene glycol 8000 ( 45 . 0 kg ) were each passed through a sieve equipped with a 20 mesh stainless steel screen . the sieved sodium phosphate monobasic monohydrate , sodium phosphate dibasic anhydrous , and polyethylene glycol 8000 were loaded into a 250 l bin and blended for 23 minutes ± 60 seconds at 12 rpm in a bin blender . the blended mixture was then transferred into suitable double poly - lined containers and milled through a cone mill , equipped with a stainless steel screen , at an impeller speed of 1400 - 1500 rpm . the milled mixture was then transferred back to the bin blender and further blended for 45 minutes ± 60 seconds at 12 rpm . after the blending was complete , the materials were discharged into double poly - lined containers and divided into three sections . the lower jacket temperature on a mixer was set to 59 ° c ., the upper jacket was turned on , and the heating water began circulating through the jacketed mixing bowl . when the lower jacket temperature reached 59 ° c .- 60 ° c ., the first section of blended materials was loaded into the mixing bowl of the mixer and the impeller speed was set at 30 rpm ( with the granulator not running ). the lower jacket temperature was then set to 66 ° c . and the impeller speed at 50 rpm . when the product temperature reached 40 ° c .- 41 ° c ., the impeller speed was increased to 100 rpm . when the product temperature reached 52 ° c ., the granulator was set to speed 1 ( slow ) and the lower jacket temperature was set to 58 ° c . when the product temperature reached 54 ° c .- 55 ° c ., the granulation process was stopped . the lower jacket temperature was reduced to 20 ° c ., the upper jacket was turned off , and the impeller speed was decreased to 10 rpm . the mixture was cooled until the product temperature reached 52 ° c . the granulation was then discharged into double poly - lined containers and stored in a closed container at room temperature overnight . the process detailed above was repeated for divided sections two and three of the blended materials . the next day , the temperature of the granulation was checked to ensure that it was less than 30 ° c . the granulation was then milled through the cone mill , equipped with a stainless steel screen , at an impeller speed of 1400 - 1500 rpm . the milled granulation was loaded into a 1200 l bin and blended for 23 minutes ± 30 seconds at 12 rpm in a bin blender . magnesium stearate ( 2 . 26 kg ) was passed through a 30 mesh stainless steel hand screen and then added to the milled granulation in the 1200 l bin . the magnesium stearate was blended with the milled granulation for 10 minutes ± 30 seconds at 12 rpm in the bin blender . the blended mixture was then compressed into tablets using a tablet press and dedusted using a tablet deduster . the target weight of each tablet was 1676 . 0 mg , which was consistently achieved by the manufacturing process . physical testing of the tablet revealed that the tablet formulation exhibited an appropriate strength , hardness , and disintegration time . surprisingly , the inkp - 102 tablet could be formulated successfully as a smaller tablet than the prior art compositions , diacol ® and visicol ®, even though the same amount of active ingredient ( 1102 mg sodium phosphate monobasic monohydrate and 398 mg sodium phosphate dibasic anhydrous ) was used in each of the three compositions ( table 4 ). this surprising result is very beneficial as the improved formulation is more tolerable to patients , allowing them to more easily administer the active ingredients . further , the disintegration time of the inkp - 102 tablet is decreased , resulting in a more rapid response to the colonic purgative composition . additionally , this decrease in disintegration time cannot be accounted for merely by the reduced size of the tablet , as there is a steeper decline in disintegration time compared to tablet size . this more rapid response would be especially beneficial whether a patient administered the composition of the invention to treat constipation or to completely purge the colon . a colonic purgative formulation , comprising the components set forth in table 5 , is produced using a hot melt process via high - shear granulation followed by milling , lubrication , and compression . physical testing of the tablet formulation includes weight variation , strength , hardness , and disintegration time . it is expected that a tablet formulated according to the above parameters will have appropriate physical properties . a patient undergoing a surgical or diagnostic procedure involving the colon is administered 40 tablets of a colonic purgative composition , such as the composition described in example 2 or 3 . the evening before the surgical or diagnostic procedure , 3 tablets are taken with at least 8 ounces of clear liquids every 15 minutes ( the last dose will be 2 tablets ) for a total of 20 tablets . optionally , the day of the colonoscopy procedure , ( starting 3 to 5 hours before the procedure ) 3 tablets are taken with at least 8 ounces of clear liquids every 15 minutes ( the last dose will be 2 tablets ) for a total of 20 tablets . it is expected that the results of such treatment will provide an adequately cleansed bowel , demonstrate little or no residue that impairs visual inspection of the colon , and is tolerable to the patient both in its palatability and side effect profile . a colonic purgative composition containing an osmotic and non - osmotic purgative to purge the colon a colonic purgative formulation of the invention may also be administered in a single application or dose . a patient undergoing a surgical or diagnostic procedure involving the colon is administered 20 tablets of a colonic purgative composition , such as the composition described in example 3 . the evening before the surgical or diagnostic procedure , 3 tablets are taken with at least 8 ounces of clear liquids every 15 minutes ( the last dose will be 2 tablets ) for a total of 20 tablets . it is expected that the results of such treatment will provide an adequately cleansed bowel , demonstrate little or no residue that impairs visual inspection of the colon , and is tolerable to the patient both in its palatability and side effect profile . further , it is expected that no morning dose will be required to obtain quality cleansing of the bowel . a patient with constipation is treated with a colonic purgative composition , such as the composition described in example 2 or 3 . the composition is administered in a total daily dose of 3 to 18 g , which is given over a period of up to 30 minutes . the dose may be repeated daily . it is expected that the results of such treatment will facilitate the passage of feces and promote elimination , by loosening or softening of the stool and / or the promotion of peristalsis due to increased amounts of water in the colon . it is beneficial to be able to use the same dual function composition for complete purgation and laxation . the primary objective of this study was to compare , by direct visualization , the colon cleansing efficacy of a composition of one embodiment of the invention ( see table 3 ; hereinafter “ inkp - 102 ”) versus the marketed visicol ® tablets ( see table 2 ; inkine pharmaceutical company , blue bell , pa .) in patients undergoing colonoscopy . in addition , the safety of the inkp - 102 composition was evaluated . the components of inkp - 102 ( 1676 mg tablet ) were as set forth in table 3 above . visicol ® tablets were comprised of the same amount of active ingredient as inkp - 102 ( 1102 mg sodium phosphate monobasic monohydrate and 398 mg sodium phosphate dibasic anhydrous ). however , the inert ingredients of visicol ® tablets included mcc , colloidal silicon dioxide , and magnesium stearate , as set forth in table 2 above . patients were randomly assigned ( approximately 30 patients per group ) to one of the seven treatment arms ( arms a - g ). each arm had a unique dosing regimen , as described in table 6 . patients received either visicol ® tablets ( arm a ; 60 g sodium phosphate dose , as label recommends ) or one of 6 dosing regimens of inkp - 102 ( arms b - g ; 42 - 60 g of sodium phosphate ). there were two scheduled visits : a screening visit ( visit 0 ) and the colonoscopy visit ( visit 1 ). the screening visit took place up to 14 days prior to visit 1 . patients self - administered the trial medication . two hundred and fourteen patients took at least one dose of the study drug and completed their colonoscopy . unless otherwise noted , this population (“ all - assessed ” population ) was evaluated for treatment efficacy . patients that completed at least 90 % of their designated study regimen , were not known to have dosed & gt ; 2 hours outside of the recommended time frame , and had their colonoscopy , were designated as the “ per protocol ” population and numbered 192 . the primary objective of the study was to evaluate the colon cleansing efficacy of inkp - 102 compared with visicol ® tablets in patients undergoing colonoscopy . the overall quality of the colonic cleansing was evaluated based on ( 1 ) the amount of stool ( liquid , semisolid , or solid ) observed during the procedure and ( 2 ) the amount of “ colonic contents ” ( including all liquid , semisolid , and solid material in the lumen of the colon ) observed during the procedure rather than only “ stool .” both the “ stool ” and “ colonic contents ” endpoints were based on endoscopist assessment using the following 4 - point scale : 1 = excellent : & gt ; 90 % of mucosa seen , mostly liquid colonic contents ( or stool ), minimal suctioning needed for adequate visualization . 2 = good : & gt ; 90 % of mucosa seen , mostly liquid colonic contents ( or stool ), significant suctioning needed for adequate visualization . 3 = fair : & gt ; 90 % of mucosa seen , mixture of liquid and semisolid colonic contents ( or stool ), could be suctioned and / or washed . 4 = inadequate : & lt ; 90 % of mucosa seen , mixture of solid and semisolid colonic contents ( or stool ), which could not be suctioned or washed . using this 4 - point scale , endoscopists assessed the patients &# 39 ; colons overall , and also specifically assessed patients &# 39 ; ascending colons , where mcc residue especially impairs visualization of the colon . tables 7a and 7b display the results of endoscopist assessment of “ colonic contents ” overall and in the ascending colon , respectively , in the “ all - assessed ” population . comparison of visicol ® versus inkp - 102 treatments revealed that mean overall colonic contents scores were significantly better with inkp - 102 dosages ( arms b , c , and e ) than with visicol ® ( p & lt ; 0 . 05 ; arm a ). similarly , assessment of colonic contents in the ascending colon revealed that inkp - 102 treatment with arms b , c , and e resulted in significantly better mean colonic contents scores than with visicol ® treatment ( p & lt ; 0 . 05 ; arm a ). surprisingly , treatment with arm e resulted in these significantly better mean colonic contents scores , even though the amount of sodium phosphate ( 48 g ) was lower than the sodium phosphate content of the marketed visicol ® ( 60 g ). in addition , treatment arms d , f , and g performed as well as the marketed visicol ® ( no statistically significant difference ), even though the amount of sodium phosphate ( 48 g , 42 g , and 42 g , respectively ) was lower than the sodium phosphate content of the marketed visicol ® ( 60 g ). this surprising result is very beneficial as the improved formulation allows patients to use a lower dose of active ingredients to achieve the same result . it is expected that the same will hold true for laxative uses of the composition . because the dosing regimens of treatment arms d and f only involve an evening dose , they may be more preferable to patients who do not want to get up early before a procedure to complete a dosing regimen and more preferable to anesthesiologists who require that the patient receive nothing by mouth on the morning of the procedure . analysis of the smaller “ per protocol ” population yielded similar results . additionally , in the per protocol group , improvement in “ colonic content ” overall and in the ascending colon upon inkp - 102 arm g treatment versus arm a visicol ® treatment reached statistical significance ( p & lt ; 0 . 0346 ). surprisingly , treatment with arm g resulted in these significantly better mean colonic contents scores , even though the amount of sodium phosphate ( 42 g ) was lower than the sodium phosphate content of the marketed visicol ® ( 60 g ). * p - values were obtained using an anova with factor treatment used to compare the means between inkp - 102 and visicol ® groups . * p - values were obtained using an anova with factor treatment used to compare the means between inkp - 102 and visicol ® qroups . tables 8a and 8b display the results of endoscopist assessment of “ stool ” overall and in the ascending colon , respectively , in the “ all - assessed ” population . mean “ stool ” endpoint scores overall and in the ascending colon generally favored inkp - 102 dose groups over visicol ®. however , only inkp - 102 arm e showed statistically significant improvement over visicol ®, and only in the ascending colon . in contrast , treatment with visicol ® was statistically superior to inkp - 102 arm f in the anova comparisons of means for both the overall “ stool ” score and ascending colon stool scores . these results were comparable in the analyses of the per protocol population . surprisingly , treatment with arm e resulted in the significantly better mean stool score in the ascending colon ( p & lt ; 0 . 05 ) and a similar mean stool score in the overall colon ( no statistically significant difference ), even though the amount of sodium phosphate ( 48 g ) was lower than the sodium phosphate content of the arm a visicol ® ( 60 g ). further , treatment with arms d and g performed as well as the marketed visicol ®, even though the amount of sodium phosphate ( 48 g and 42 g , respectively ) was lower than the sodium phosphate content of arm a visicol ® ( 60 g ). this surprising result is very beneficial as the improved formulation allows patients to use a lower dose of active ingredients to achieve the same result . it is expected that the same will hold true for laxative uses of the composition . because the dosing regimen of treatment arm d only involves an evening dose , it may be more preferable to patients who do not want to get up early before a procedure to complete a dosing regimen and more preferable to anesthesiologists who require that the patient receive nothing by mouth on the morning of the procedure . * p - values were obtained using an anova with factor treatment used to compare the means between inkp - 102 and visicol ® groups . * p - values were obtained using an anova with factor treatment used to compare the means between inkp - 102 and visicol ® groups . analysis of the two efficacy endpoints together demonstrates that the inkp - 102 treatment arms were generally rated higher than the visicol ® treatment arm in the “ colonic contents ” efficacy endpoint versus the “ stool ” efficacy endpoint . these results indicate that components of the colon other than stool , such as microcrystalline cellulose ( mcc ), do not hinder visualization of the colon after inkp - 102 treatment to the extent that visicol ® treatment hinders visualization . at the same time , inkp - 102 is able to effectively purge the colon of stool in liquid , semisolid , or solid form . both “ colonic contents ” and “ stool ” efficacy endpoints were also analyzed by dividing the 4 - point assessment scale into “ responder ” and “ non - responder ” categories . for each assessment , a patient was considered to be a “ responder ” if colon cleansing was rated as “ excellent ” or “ good ” and a “ non - responder ” if colon cleansing was rated as “ fair ” or “ inadequate . table 9a and 9b display the number of “ responders ” and “ non - responders ” to the various treatment arms using a “ colonic contents ” and “ stool ” endpoint , respectively , in the “ all - assessed ” population . * p - values were obtained using a fisher &# 39 ; s exact test to compare the response rates between treatment arm a and the other treatment arms ( b - g ). * p - values were obtained using a fisher &# 39 ; s exact test to compare the response rates between treatment arm a and the other treatment arms ( b - g ). the results indicate that treatment arms b , c , and e had higher responder rates among all treatment groups , and had lower or negligible nonresponder rates . these rates were higher than those of visicol ® tablets ( arm a ), although the differences were not statistically significant . further , arm e ( inkp - 102 ; 48 g split dose ) demonstrated comparable or better colon - cleansing efficacy when compared with high - dose treatments ( 60 g dose ; arms a , b , and c ). on the other hand , dosages given only on the evening prior to the patient &# 39 ; s colonoscopy demonstrated poorer efficacy than those doses given as “ split doses .” the lower - dose ( 42 g ) evening - only regimen of arm f , only had a 72 % responder rate , which was significantly lower than arms b , c , and e ( p & lt ; 0 . 05 ; fisher &# 39 ; s exact test ). the safety of the various dosing regimens was also evaluated by adverse event monitoring , changes in clinical laboratory evaluations , physical examination , and vital signs assessment ( heart rate , blood pressure , respiratory rate , temperature , and testing for postural hypertension ). no patients experienced a serious adverse event during the course of the study . nearly all patients experienced mild to moderate adverse events related to the system organ class of gastrointestinal disorders , regardless of dosage or treatment . such adverse events included abdominal distention , nausea , and abdominal pain . however , because the purpose of the treatment is to rapidly eliminate bowel contents , such events were to be expected . significant changes in clinical laboratory parameters from visit 0 ( screening ) to visit 1 ( colonoscopy ) were observed in all patient groups . specifically , there was a significant increase ( p & lt ; 0 . 0001 ) in mean levels of inorganic phosphorus in all patient groups . there was a significant increase in mean levels of sodium in 6 of the 7 patient groups ( p & lt ; 0 . 02 ) and a significant decrease of bun , potassium , calcium , magnesium , and bicarbonate from baseline in one or more patient groups ( p & lt ; 0 . 05 ). mean levels of chloride and creatine in all patients , on the other hand , did not significantly change from baseline after treatment . of all the clinical parameters examined , only levels of inorganic phosphorus exhibited a significant , after - treatment difference between the inkp - 102 and visicol ® treatment arms . increases from baseline in inorganic phosphorus were anticipated and occurred with a mean increase of 88 % over baseline levels in all patients , regardless of treatment arm . these increases in inorganic phosphorus levels were significantly higher among arm a ( visicol ® tablets ) than in patients in treatment arms d , e , f , and g ( inkp - 102 ; p & lt ; 0 . 0170 ). the inorganic form of phosphate in the circulating plasma is excreted almost entirely by the kidneys and therefore some patients , such as those with renal disease , may have difficulty excreting a large phosphate load . thus , use of inkp - 102 beneficially reduces the burden on the kidneys during sodium phosphate treatment . this effect may be attributable to the reduced sodium phosphate doses in arms d , e , f , and g . as described in several efficacy analyses above , however , inkp - 102 more effectively cleanses the colon than a larger sodium phosphate dose of visicol ®, while at the same time reducing the increase in inorganic phosphorous normally observed with visicol ® administration . all references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes . to the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification , the specification is intended to supercede and / or take precedence over any such contradictory material . all numbers expressing quantities of ingredients , reaction conditions , and so forth used in the specification and claims are to be understood as being modified in all instances by the term “ about .” accordingly , unless indicated to the contrary , the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention . at the very least , and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims , each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches . many modifications and variations of this invention can be made without departing from its spirit and scope , as will be apparent to those skilled in the art . the specific embodiments described herein are offered by way of example only and are not meant to be limiting in any way . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims .

US-69038410-A

a suspension system for the ground engaging powered and / or caster wheels of a power wheelchair utilizes three links , two of which are universally pivotally connected between the frame of the wheelchair and a wheel mounting transaxle housing or subframe so that the wheels can tilt relative to the frame of the wheelchair in a vertical plane . a third link is connected between the vehicle frame and the wheel mounting structure which can only pivot in a vertical plane , thus restraining the wheels from any lateral displacement relative to the vehicle frame . fluid cylinders operable between the links and the vehicle frame provide cushioning of the frame and also , by subtraction of fluid from the fluid cylinders , can lower the entire frame of the wheelchair relative to the ground engaging wheels to permit the wheelchair and occupant to drive into the side door opening of a conventional van .

referring to fig1 a powered wheelchair 1 of the type described in detail in u . s . pat . no . 5 , 275 , 248 and our pending application ser . no . 08 / 652 , 975 , filed may 24 , 1996 is schematically illustrated . such wheelchair comprises an elongated articulated frame 2 , which , at its forward end , defines a leg rest portion 2a while the medial portion of the elongated frame defines a conventional mounting for an occupant seat 2b above the frame 2 and a battery compartment 2c beneath the frame 2 having a forward vertical wall 2d and a rearward vertical wall 2e . the frame 2 is supported and powered by two ground engaging wheels 3 shown at the forward end of the elongated frame 2 , and a pair of caster wheels 4 at the rearward end of the frame 2 . those skilled in the art will understand the terms &# 34 ; forward &# 34 ; and &# 34 ; rearward &# 34 ; are relative terms and the positions of the powered wheels 3 and the caster wheels 4 relative to the frame 2 may be reversed . the two powered wheels are mounted on opposite ends of a transaxle housing 5 which is described in detail in the above referred to issued patent and pending application . for clarity of the drawings , the transaxle housing is deliberately shown in greatly reduced size , but such housing will be understood to contain a dual planetary transmission for applying driving and steering power to the powered wheels 3 as controlled by the occupant , as is fully described in the aforementioned issued patent and pending application . steering of the wheelchair 1 is accomplished by providing a differential in direction or speed of rotation of the two powered wheels 3 . the mounting of the transaxle housing 5 to the frame 2 thus controls the vertical position of power wheels 3 relative to frame 2 , while the mounting of the subframe 8 to the frame 2 controls the vertical position of caster wheels 4 relative to the frame 2 . in accordance with this invention , the mountings for the powered wheels 3 and the caster wheels 4 are functionally identical . a pair of mounting links 6 respectively have their one end connected in horizontally spaced relation to the depending front wall 2d of the battery compartment 2c by universal pivot bearings 2f . the other ends of mounting links 6 are connected by universal pivot bearings 5a provided on the bottom wall of the transaxle housing 5 , or any other convenient location which disposes the mounting links in generally parallel relationship . due to the universal pivot mountings of both ends of the mounting links 6 , the powered wheels 3 may assume a plurality of vertical positions relative to the frame 2 as they follow the contour of the ground or road traversed by such wheels . to prevent lateral shifting of the transaxle housing 5 , hence lateral shifting of the powered wheels 3 relative to frame 2 , a stabilizing link 7 is provided which is of a generally triangular or t shaped configuration , having a wide base portion 7a and a vertex portion 7b , as best shown in fig3 . a pair of horizontally spaced , horizontal axis pivot mountings 2g are provided on the forward battery compartment vertical wall 2d to respectively receive pivot pins traversing pivot holes 7c provided at the lateral end of stabilizing link 7 . thus stabilizing link 7 can only move in a vertical plane about a horizontal axis defined by the pivot bearings 2g , and can be either above the links 6 , as shown in fig3 or below such links . the vertex end 7b of stabilizing link 7 is secured to the transaxle housing 5 by a universal pivot 5c , thus permitting the transaxle housing 5 to tilt in a vertical plane , due to the powered wheels 3 following ground contours , but there is no significant lateral displacement of the transaxle housing 5 relative to the elongated frame 2 . to similarly mount the caster wheels 4 to the frame 2 , a subframe 8 ( best shown in fig4 ) is provided having a generally t - shaped configuration with a horizontal caster wheel mounting leg 8a and a generally vertical link mounting leg 8b . one or preferably two caster wheels 4 are conventionally swivelly mounted on horizontal leg 8a of subframe 8 . to secure the subframe 8 to the elongated frame 2 , a pair of mounting links 9 are respectively connected to a pair of universal pivot mountings 8c provided in horizontally spaced relation on the horizontal leg 8a of subframe 8 . the other ends of mounting links 9 are respectively connected to a pair of horizontally spaced , universal pivot mountings 2j provided on the rearward vertical wall 2e of the battery compartment 2c . thus the subframe 8 may freely pivot in a vertical plane as the caster wheels follow the road or ground contours . to prevent lateral movement of the subframe 8 relative to the elongated frame 2 , a generally triangular or t shaped stabilizing link 10 is provided . link 10 has a wide base portion 10a terminating in two horizontally spaced single axis pivot bores 10b which are respectively secured to two horizontally spaced , horizontal axis pivot mountings 2k provided on the rearward wall 2e of the battery compartment . the vertex portion 10c of stabilizing link 10 is universally pivotally secured to a pivot bearing 8d on subframe 8 . thus no significant lateral movement of the caster wheels 4 can occur as the wheelchair moves over an uneven surface . stabilizing link 10 may be either below ( as shown in fig4 ) or above the mounting links 9 . preferably a torsion rod 14 is connected between mounting links 6 and also between mounting links 9 to maintain the parallelity of the mounting links 6 and 9 relative to each other . while the aforedescribed mounting structures for the powered and caster wheels of a powered wheelchair will permit such wheels to follow the road or ground contours , such mounting structures also provide for effecting occupant controlled vertical raising and lowering of the frame and seat relative to the wheels . this highly desirable feature is accomplished by providing a pair of fluid pressure cylinders 12 operating between the stabilizing link 10 and the elongated frame 2 , as shown in fig4 or by utilizing a pair of fluid pressure cylinders 13 respectively operating between the mounting links 6 and the frame 2 , as shown in fig3 . in either modification , the supply of pressured fluid , either air or hydraulic , to the fluid pressure cylinder will cause such cylinders to expand and elevate the entire frame 2 and the seat occupant relative to the wheels as shown in fig1 . removal of fluid from such cylinders will cause elongated frame 2 to lower relative to the ground engaging wheels 3 and caster wheels 4 to permit the wheelchair with an occupant to enter the side door of a conventional van , as shown in fig2 . the occupant controlled fluid circuit is fully illustrated in fig5 . the applied legends on fig5 make such circuit self - explanatory . it should be particularly noted that separate control of the vertical positions of the powered wheels 3 and the caster wheels 4 relative to frame 2 may be effected by appropriate movement of the control stick 20 which is mechanically connected to switch blades 20a and 20b . the frame elevating and lowering fluid pressure cylinders perform another desirable feature , particularly when such cylinders contain air as the activating fluid . a conventional air bag can be employed . since the fluid pressure cylinders are respectively connected between the wheel mounting links 6 and 9 and the elongated frame 2 , the vertical movements of such links caused by a powered wheel encountering a ridge or depression are cushioned by the fluid pressure cylinders , thus reducing shock forces imparted to the frame , hence to the occupant of the wheelchair . fig6 illustrates the manner in which the powered wheels 3 conform to a ridge in the road or ground surface by tilting of the transaxle housing in a vertical plane . obviously , the caster wheels 4 will equally conform by the tilting of the subframe 8 in a vertical plane . all of the wheels will also ride through depressions with minimum shock to the occupant , as illustrated in fig7 . referring now to fig8 of the drawings , there is shown a modification of this invention which is particularly suited for powered wheelchairs having large transaxle housings 5 . such large transaxle housings would interfere with the location of the fluid cylinders 12 as shown in fig1 . instead , the links 6 are extended forwardly as shown at 6a , and an airbag - type fluid cylinder 15 is mounted between the frame 2 and a ledge 6b formed on the transaxle housing 5 . the functioning of this embodiment is the same as previously described . pressured air is supplied to , or withdrawn from airbags 15 which function to raise or lower frame 2 relative to the power wheels 3 by pivoting the mounting links 6 and stabilizing link 7 . a similar airbag 15 is applied between stabilizing link 10 and a projection 2m on frame 2 to control the vertical position of frame 2 relative to caster wheels 4 . such airbags thus function to reduce rough road shocks transmitted to frame 2 , without interfering with the vertical movements of powered wheels 3 or caster wheels 4 to follow the road or ground contours . obvious modifications of this invention can be made by those skilled in the art , and it is intended that all such modifications fall within the scope of the appended claims . obvious modifications of this invention can be made by those skilled in the art , and it is intended that all such modifications fall within the scope of the appended claims .

US-74420496-A

a disposable device is provided which accurately and reliably delivers an infusable liquid to a patient . the infusion device includes a housing which defines a bladder chamber . a compressible bladder is disposed in the bladder chamber and is compressed by the housing upon filling the bladder with an infusable liquid to create a pressurized bladder . the infusion devices further includes a delivery system for subcutaneously delivering the infusable liquid to a body . the delivery system includes a collapsible member that supports an injection needle and a cannula . the injection needle is used to insert the cannula into the skin of the body being treated . the cannula is in communication with the bladder during delivery of the infusable liquid . the housing includes microfluidic passageways that allow communication between fluid in the bladder and the cannula .

a description of preferred embodiments of the invention follows . fig1 illustrates a limited - life , disposable infusion device or pump , generally designated as reference numeral 10 . the infusion device 10 is used to deliver predetermined amounts of infusable liquid , such as liquid medicines , insulin , etc ., to an injection site on the patient or user in a controlled and reliable manner . it is important that the device 10 deliver controlled amounts of infusable liquid so as to not deliver more infusable liquid than required , would could be fatal . the infusion device 10 includes a housing 12 which is preferably constructed of a strong , heat - stable material , such as polycarbonate or a high impact styrene . the housing 12 , in one embodiment , can be flexible to conform to the body to which it is attached . the housing 12 defines a bladder chamber 14 in which a bladder 16 is situated . in one embodiment , the bladder 16 is filled with insulin prior to use via an injection port 18 with a syringe . as the bladder 16 is filled , the housing 12 including a member comprising , for example , an integral cantilevered arm 20 , compress the bladder to create a biasing force pressurizing the bladder for expelling the infusable therein when the pressure is relieved by actuating buttons 26 as will be described later . in alternative embodiments , arm 20 can be formed from a different material than the housing 12 and attached thereto . the bladder 16 can formed from sheets of a durable material such as silicon , polypropylene , or vinyl sealed together to form a fluid tight compartment . in one embodiment , the bladder 16 holds up to 300 units of u - 100 , u - 50 , or u - 40 insulin . typically , the average diabetic uses about 40 units per day , not including initial priming . the infusion device 10 is capable of delivering various types of insulin , for example , ultra - fast , rapid , intermediate , and long - lasting insulin . in alternative embodiments , more than one bladder can be included in the housing 12 for delivering different types of insulin with the same infusion device 10 . prior art devices have employed mechanisms such as stepper motors and peristaltic pumps to force the insulin from a reservoir into the user . these devices typically require heavy , powerful batteries which are carried by the user . in contrast , in one embodiment of the present invention , the housing itself provides the force for delivering the insulin to the user . this avoids heavy and costly stepper motors and the like . preferably , the infusion device 10 is relatively small and flexible , such as the size of a credit card . the device 10 preferably includes an adhesive 13 on the backside thereof ( see fig4 and 5 ), such that the device can be adhered to the skin of the user for a predetermined amount of time , such as 3 - 5 days . preferably , the adhesive 13 forms a seal around the injection site 15 for sanitary purposes . thus , the device 10 can be worn at virtually all times , such as during water activities ( swimming / showering ) and even while sleeping . as illustrated in a top cut - away view of the inside of device 10 in fig2 a plurality of microfluidic passageways or channels 22 provide fluid communication between the bladder 16 and the cannula 28 . in one embodiment , the channels 22 vary in both length and width , as illustrated in the view of the channels in fig2 and 3 . the channels 22 can be formed by laminating different layers 24 of bladder material with each layer having a channel formed therein . the channels 22 can be formed by such methods as laser etching and die - cutting . the channels 22 facilitate accurate and varying dosage levels to the user . for example , the six channels can correspond to six basal dosages . these basal rates can correspond to a range of about 0 . 0 to 35 . 0 units / hour wherein the insulin is delivered in 0 . 1 unit increments . in alternative embodiments , conventional tubing , such as miniature spaghetti tubing , can be used to provide fluid communication between the bladder 16 and the cannula 28 . a plurality of buttons 26 actuate stop cocks ( not shown ) and function as switches which can be actuated by the user to control which of the channels 22 is selected and placed in fluid communication with the cannula 28 . alternatively , micro - electro - mechanical systems or mems can be used to control the channels 22 in accordance with the present invention . the buttons / switches 26 correspond , in one embodiment , to six different basal dosages . it is understood that more basal dosages can be easily incorporated into the preferred embodiment of the invention . furthermore , an additional button can be provided to correspond to a bolus dosage which is an additional dose of insulin . typically , this bolus dosage is administered at or before mealtime , when glucose levels will increase with the ingestion of food . the buttons 26 can have embossed numbering thereon to aid the visually impaired . alternatively , or in addition to , the buttons 26 can provide feedback to the operator , such as tactile or sound feedback , to confirm activation of the buttons . as is well known in the art , the cannula 28 may be subcutaneously inserted by an injection needle or introducer needle 30 . in one embodiment , the injection needle 30 is a 26 gauge needle potted in a retaining member 32 . the cannula 28 is preferably made of a soft and flexible material , such as polytetrafluorethylene ( pfte ). the housing 12 can be substantially transparent such that the user can visually inspect the bladder 16 , the channels 22 , and the injection site 15 . as shown in fig4 the injection needle 30 and cannula 28 are supported and protected by a collapsible member 46 prior to injection . to insert the cannula 28 below the skin of the user , the retaining member 32 and needle 30 are extended toward the body being injected . fig5 illustrates the introducer needle 30 in the extended position outside the housing 12 inserting the cannula 28 to a sufficient depth below the skin of the user . because the infusion device 10 attaches directly to the skin of the user , the cannula 28 is relatively short such that kinking is avoided . furthermore , the collapsible member 46 provides a stable base such that the cannula 28 is not easily moved around under the skin of the body . the retaining member 32 and needle 30 are withdrawn leaving the cannula 28 in place . a firing mechanism can be used to inject the needle 30 and cannula 28 into the body . for example , a spring - loaded injector device can be used , such as disclosed in u . s . pat . no . 5 , 851 , 197 , issued on dec . 22 , 1998 to marano et al ., the contents of which are incorporated herein by reference in its entirety . in alternative embodiments , the retaining member 32 can be manually pushed into the skin by the user . the infusion device 10 can also include an electro / mechanical start button 34 for initiating the insulin delivery process . a controller 36 , powered by a power source or battery 38 , functions to control operation of the device 10 . in a preferred embodiment , the controller 36 is a programmable microcontroller to control functionality of the device such as varying the basal dosage ( s ). preferably , the power source is permanently attached to the housing 12 . in one embodiment , a remote control device 42 can be used to control operation of the device 10 . preferably , the device 42 includes a controller 43 , such as a microcontroller , to control operation of the infusion device 10 . the device 42 can employ any wireless connectivity standards , such as rf , ir , and bluetooth standards , the latter being a trademark of telefonaktiebolaget lm ericsson , a sweden corporation . the remote control device 42 can include functional buttons , such as a start button or bolus button to reduce accidental actuation of the same . additionally , the device 42 can be used to program the controller 36 to vary the basal rates , for example . the remote control device 42 in one embodiment includes a memory storage device 44 to store the programmed instructions sent to the device 10 . these instructions can be later uploaded to a computer for tracking . additionally , the memory storage device 44 can receive other information from the infusion device 10 , such as how much insulin has been delivered to the body , i . e ., the history of the infusion treatment . a signaling device , such as an audible or visual indicator ( led or lcd ) can be incorporated onto the device 10 to confirm receipt of the instructions . another signaling device can be incorporated onto the remote control device 42 which alerts the user when the device 42 is out of programming range , i . e ., when the device 42 is too far from the infusion device 10 to program the same . this type of an alarm can be referred to as a proximity alarm . in a preferred embodiment , the remote control device 42 is small enough so as to be operable by one hand . preferably , the device 10 includes an alarm 40 which can be , for example , an audible alarm or a vibrational alarm . in one embodiment , the alarm 40 signals to the user when the bladder 16 is substantially or nearly empty . in another embodiment , the alarm 40 can signal when a predetermined number of insulin units ( e . g ., 2 - 4 units ) are missed . this type of an alarm can be referred to as an occlusion alarm . the housing 12 can include a unidirectional breathable material , such as tyvek ® material , disposed on the side of the housing which contacts the skin of the user . tyvek ® is a registered trademark of e . i . du pont de nemours and company . a light coating of adhesive 13 is applied over the breathable material . this allows the user &# 39 ; s skin to breathe allowing the device 10 to remain comfortably on the user for an extended period of time . preferably , the device 10 is waterproof such that it can be worn continuously , even in the shower . the operation of the device will now be described . the device is provided in a sterile package and is removed therefrom for use . the bladder 16 is filled by a syringe by the user via injection port 18 . the device 10 is pre - primed by the user to fill the cannula 28 with insulin . the user then removes a release liner ( not shown ) from the adhesive side of the infusion device 10 . the device 10 is then adhered to the user , for example , at a sanitarily cleaned area of the abdomen . the cannula 28 is inserted into the skin via injection needle 30 by pressing insertion button 32 . the user activates the device by pressing the start button 34 and chooses the desired dosage level by pressing a button 26 . preferably , the device 10 is discarded after a predetermined amount of time , for example , 3 - 4 days . another disposable device 10 can be attached to the skin to continue the delivery process , preferably at another injection location . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .

US-54277700-A

the invention features a composition that includes a substantially pure recombinant gas vesicles which have at least one heterologous peptide inserted into at one of their structural proteins . the recombinant gas vesicle , when administered to a mammal , is capable of eliciting antibodies which specifically bind to the heterologous peptide . the heterologous peptide can be any peptide against which one wishes to raise antibodies , e . g ., a peptide found in the gp12o protein of human immunodeficiency virus .

described below are methods which can be used to prepare recombinant gas vesicles having a heterologous peptide inserted into protein component of the vesicle . preparation of recombinant vesicles for use in eliciting antibodies includes four basic steps : ( 1 ) insertion of dna encoding the peptide of interest into a coding sequence of a halobacterium gas vesicle protein to create a chimeric gas vesicle protein ; ( 2 ) transformation of halobacterium or some other suitable bacteria capable of producing gas vesicles with the dna encoding the chimeric protein ; ( 3 ) growing the bacteria under conditions which permit the expression of the chimeric protein and formation of gas vesicles ; and ( 4 ) and harvesting and purifying the gas vesicles . u . s . patent application ser . no . 08 / 271 , 270 ( recombinant vector and process for cell floatation ), now abandoned , includes useful methods related to gas vesicles and is incorporated by reference . any selected peptide , e . g ., a peptide of a pathogen , can be introduced into a gas vesicle protein to produce recombinant gas vesicles capable of eliciting an immune response to the selected peptide when the vesicle is introduced into a mammal . recombinant gas vesicles can bear a peptide normally found in hiv , plasmodium falciparum , salmonella typhi , mycoplasm , or any other pathogenic organism . in some cases it may be desirable to introduce two or more heterologous peptides into a single recombinant gas vesicle . the several peptides can be derived from the same or different pathogenic organisms and can be inserted into the same gas vesicle protein or into different gas vesicle proteins . the recombinant gas vesicles of the invention can be used to present a wide variety of antigens . among the suitable peptides are peptides derived from the coat protein of hiv , particularly the principal neutralizing domain of hiv ( dedieu et al ., j . virol . 66 : 3161 , 1992 ); peptides derived from herpes simplex virus type 1 glycoprotein d ( notkins et al ., science 228 : 737 , 1985 ); and peptides derived from hepatitis b virus core - pre - s protein ( schodel et al ., infect . immun . 62 : 1669 , 1994 ). other useful peptides can be derived from peptide toxins produced by pathogens . generally , many of the peptides presented by genetically engineered vaccines can be used . a detailed description of peptides used in genetically engineered vaccines can be found in ciardi et al ., &# 34 ; genetically engineered vaccines &# 34 ; ( plenum press , new york , 1992 ). the selected heterologous peptide can be inserted into a gas vesicle structural protein at any suitable location . the peptide may also be place at the carboxy terminus of the protein , e . g ., at the carboxy terminus of gvpc or gvpa . preferred locations for insertion are within the repeats of the gvpc protein or a gvpc - related protein . under some circumstances it may be desirable to insert two or more peptides into a particular structural protein . the presence of multiple antigens can often elicit a stronger or more protective immune response . when two or more peptides are inserted into a single gas vesicle structural protein , they can be derived from the same or different pathogenic organism . when multiple peptides are inserted they can be inserted at different locations within the gas vesicle structurallprotein or adjacent to each other at the same location . it is not necessary that the peptides be different . thus , one can insert multiple copies of the same peptide into a gas vesicle structural protein . the recombinant gas vesicles can be used to create compositions suitable for expression library immunization . in this technique a library of peptide - encoding random dna fragments is prepared and inserted into one or more selected locations in a dna molecule encoding a gas vesicle structural protein , e . g ., a plasmid bearing the gvpmlkjihgfedacn gene cluster of halobacterium halobium . this process results in the creation of a population of dna molecules which can be used to transform bacteria . the resulting clones can be used for the production of recombinant gas vesicles . by purifying gas vesicles from a mixture of gas vesicle - producing clones , it is possible to create a &# 34 ; cocktail &# 34 ; of recombinant gas vesicles which can be injected into a patient in order to elicit an immune response . a preferred site for insertion of peptides is between the v and e of the following gvpc sequence of halobacterium halobium : eadadv insertion site ! eaeae ( seq id no : 3 ). simon et al . ( archaea -- a laboratory manual -- halophiles , dassarma et al ., eds ., cold spring harbor laboratory press , 1995 ) describes useful techniques for working with halophilic bacteria . the preferred means of inducing a bacterial cell to produce gas vesicles is to transform the cell with a plasmid bearing the gvpmlkjihgfedacn gene cluster of halobacterium halobium . the plasmids pnrc100 , pjhgv3 , and pfl2 ( dassarma et al ., j . bact . 176 : 7646 , 1994 ) is a suitable plasmid bearing genes required for expression of gas vesicles . the plasmids pjhgv3 and pfl2 are h . halobium - eschericia coli shuttle plasmids that are particularly useful for the preparation of recombinant gas vesicles . it is preferable that the heterologous plasmid be inserted into the gvpa gene or the gvpc gene which have been identified in haloferax mediterranei ( englert et al ., j . biol . chem . 268 : 9329 , 1993 ), halobacterium halobium ( halladay et al ., j . bateriol . 175 : 684 , 1993 ), and other bacteria ( walsby et al ., j . gen . microbiol ., 134 : 2647 , 1990 ). walsby ( microbiol . rev . 58 : 94 , 1994 ) describes bacteria that express gas vesicles . under some circumstances it is desirable to engineer suitable restriction sites into gvpa , gvpc , or other gas vesicle proteins . suitable insertion sites , e . g ., restriction sites , can be generated by site - directed mutagenesis . current protocols in molecular biology , ( john wiley & amp ; sons , new york , 1994 ) describes the use of site - directed mutagenesis , as well as a wide variety of other techniques that can be used to construct recombinant gas vesicles useful in the invention . h . halobium can be cultured in a medium containing 4 . 3m nacl as described by dassarma et al . ( proc . nat &# 39 ; l acad . sci . usa 85 : 6861 , 1988 ). the nucleotide sequence of the gvp gene cluster of h . halobium is disclosed in halladay ( j . bact . 175 : 684 , 1993 ). a partial sequence is disclosed in jones et al . ( gene 102 : 117 , 1991 ). fig6 includes a sequence of the gvp gene cluster of h . halobium . h . halobium can be transformed using the edta - polyethylene glycol procedure of cline et al . ( j . bateriol . 169 : 1341 , 1987 ). wild type ( wt ) and peptide - inserted gas vesicles ( gv ) were prepared as follows . halobacterium halobium sd109 ( pfl2 ) ( wt gv ) and sd109 ( pfl2c :: k1δ ) ( modified gv ; includes the peptide essgtf insert into gvpc of halobacterium halobium at between the v and e of the sequence eadadveaeae ) ( seq id no : 3 ) were grown to confluency on peptone - salt plates supplemented with 10 μm b mevinoloin . gas vesicles were isolated by centrifugally accelerated floatation ( simon et al ., supra ). the yield of gas vesicles was approximately 10 mg / l of plates ( plate surface area / liter was approximately 1134 cm 2 ). a portion of the wt and peptide inserted gv were used to prepare trinitrophenol ( tnp )- modified wt and peptide inserted gv as follows . modification used was performed according to the modification procedure described by little et al . ( methods in immunology and immunochemistry , vol . 1 , pp . 128 - 133 , 1967 ). briefly , approximately 10 mg of each type of gv was incubated with 2 , 4 , 6 trinitrobenzene sulfonic acid over night at room temperature in the dark . the gv were then purified by dialysis against pbs ( 150 mm nacl ; 10 mm phosphate , ph 7 . 5 ). groups of 8 week old mice ( 4 per group ) were injected intraperitoneally ( approximately 0 . 5 mg / gv per animal ) with wt , mutant , wt - tnp , or mutant - tnp gas vesicles . a group of mice were injected with pbs as a control . serum was collected 2 weeks and 4 weeks after the primary immunization . the mice were then boosted with an additional 0 . 5 mg of gv . serum was collected again 10 days after the secondary immunization . the injections did not have a significant effect on weight gain . no lesions were observed at the site of injection . immune response was measured by elisa using either bovine serum albumin conjugated to tnp ( bsa - tnp ) or the seven amino acid peptide present in mutant gv as antigen . anti - mouse igg horseradish peroxidase or anti - mouse igm horseradish peroxidase . the results of this analysis are presented in fig1 - 3 . fig1 depicts the results of experiments in which wt - tnp gv were used to immunize mice and bsa - tnp was used as an antigen for elisa . fig1 panels a and b present the results for the 2 week primary igm response and the 2 week primary igg response respectively while panels c and d present the secondary igm and igg response ( filled circles : 1 mg wt - tnp gv igm ; filled triangles : 0 . 1 mg wt - tnp gv igm ; filled diamonds : 1 mg wt gv igm ; open circles : 1 mg wt - tnp gv igg ; open triangles : 0 . 1 mg wt - tnp gv igg ; open triangles : 0 . 1 mg wt - tnp gv igg ; open diamonds : 1 mg wt gv igg ; open squares : buffer igg ). fig2 depicts the results of experiments in which mutant - tnp gv were used to immunize mice and bsa - tnp was used as an antigen for elisa . fig2 panels a and b present the results for the 4 week primary igm response and the 4 week primary igg response respectively while panels c and d present the secondary igm and igg response ( filled circles : mutant - tnp gv igm ; filled squares : buffer igm ; open circles : mutant - tnp gv ; open squares : buffer ). fig3 depicts the results of experiments in mutant - tnp gv were used to immunize mice and the 7 amino acid peptide ( essgtfe ) ( seq id no : 1 ) present in mutant gv was used as an antigen for elisa . fig3 panels a and b present the results for secondary igm and secondary igg response ( filled circles : mutant - tnp gv igm ; filled squares : buffer igm ; open circles : mutant - tnp gv igg ; open squares : buffer igg ). these results demonstrate that gv can effectively present tnp and peptide haptens in the absence of added adjuvant . these experiments also demonstrate that both igg and igm responses can be elicited . the igg response increased after the secondary immunization while the igm response peaked prior to the boost . fig5 panel a , fig5 panel b , fig6 panel a , and fig6 panel b present the results of elisa used to demonstrate the immune response elicited by the gas vesicles lasts for months . these results demonstrate that gas vesicles having a peptide inserted into a gas vesicle structural protein can elicit a long - lived immune response . accordingly , such gas vesicles can be used as a vaccine . the recombinant gas vesicles of the invention may be used to immunize patients using standard methods . generally they are mixed with a pharmaceutically acceptable carrier and administered by injection . animal models , e . g ., the murine model described herein , can be used to test the immune response elicited by a selected recombinant gas vesicle . animal models can also be used by those skilled in the art to estimate the dosage required to provide protection against a given pathogen . in general , methods and dosages for recombinant vaccines used by those skilled in the art are applicable to the vaccines of the present invention . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 3 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 7 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : peptide ( xi ) sequence description : seq id no : 1 : gluserserglythrpheglu15 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 8878 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : dna ( xi ) sequence description : seq id no : 2 : gcccggaggctgatcccgatcaggggaatgtcggcgaccgtcacgatcacgtccgcttga60atcacggctccgtcgcgcagtaacacgtcgacgaactcaacgatcgcgtgtgtctcgtct120tttgttggctccattatttaccaatatctggcgcgaacgtgtacggtggccacggccccg180tgaatctgatctctacaccctcgtgttcgacgatcgtatccaatcgatcaccgagagcgg240tctcgtcgtcctcgtccgcgagaacggcgaaccgcacgatctgttctttctcgatggacg300agtgttcgtcctgtagcggcgtattcgtgtcctgttcggtcaggtcgttcacgaccgggg360taatggcctctttcagttgatctgctagttccgtccggcgctctcgtttcagctcttgga420gtcgctgatcggactgtttctcgaggaggaactttttccctgcgcccgattgttgctggc480gctgtcgtagttctcggagccggtcgtctcggtctgcgatggtctcctcgaacggtgcgg540aatcccacaacagattgattcgatactcccacactcccgcgaacgacgctaattcgtcgc600ggaagccctcgtagtggtcttctaaccaccgttcgatactcgcatcaccgccctcgagga660ccgtgtcgaatcgcatcggcagcggcgtaccgaacgcgtcgctcgccgcgtcgacgacct720gctggtgcgtgaccagccatcgcttcacctgttcgaggtcttccgtctcgtagaccgtct780cacagtcatggacgacggcgcccacgccatcggcctcgacgacgtagacagggttgtcgt840cgaccccggtcgtggacagggtcgccgattccgacgacgtggtatcgaccacgcagtata900gatagcggccgttgctgaccgtccgttcctcgttcgctgtggtctgctcttcttccgggc960tgggccggtggtcagtcatacgtcatcacgctgggattccggcgagccgtgacctgacgg1020tgtctcgtgctcggatagctgttcgatggcgtcgcggatcacgtgatcgaggtcctccct1080aaactcggagacctcggcgttgatatcctcttgctgtttcagtcgctcgagctcgtcttc1140gagggcctgtaattgtcgccccaatcgttcgatttcgtcctctgagagcgacccggattc1200catccgacgcaccgcttcttgttcgagggcctcgaccagcaattcgacgacagttacgac1260cagcgccgtgagcccgccttgcaaatcgtccgcgtcgtcgtcgagtgctagttccatctc1320atttggtctcctccgctgacgtggatgccgtcggcgtcgaatcgtccgacagtgggttcg1380tcgactcggtctccgattgggtttccgacgccgggtcggactggtccggtgagatattcg1440cggcggactcgacgcgctccatatccgtccccgttgggaactcgagcccgtattcggccg1500ctgtctcgaacgaagcaatcgcggcccgtaactcgataccgaggagttccgtgtccccga1560cgctgactgcgatatccgcgttgacgacgactcctttgtctaggagcatctccagcatct1620cggcgaggtcgccctgcgagcgcgtcggtttggggtcactcatcgttcacctcgtcctca1680gtgggactcccggacgcgctctcatccgacggggcggatgcctccgagtttccaccggct1740gttttctggtgaagccgttggccgtacaatcgctctcgagccgtcacatccgagtacttc1800ggagtcttcgggacggtcgagtgggagttgcgtaccgcgttctccgcgttcgacttctga1860ggcggcatcgtcgagtgagccgctggattcttgaccgtctccccgtcagtatcgtcgccg1920tcggaatcgtcacgccggggttccgactgtttccggttgcgggtccgacgccgggcgagt1980ttttcgcgctgccgaagcagattgcgccgggctttatcgcggttgatctgcgcctttact2040cgtgcctgtcgtgctttctgcttgtgtttttgctgttgtttgtcgctcatgtggattcac2100ctccatcggtgtccgatgttcgtgctagccgaatttcgagaacctgatttctgagagtca2160tatcggtgatcgccacgtccggccggtcgagtacgactcgctcgaccacgtcgtcgtcga2220cgcgtagcgtgagtgcctgctcgtcggtatcgagtgcgacgtcgacgtcgtcgtccgtca2280cgcccggcaaatctgcgaccacgacgagttcgtcgccgctcgttcctccacgagtctcga2340cgtgaatcgaatcctccgtcgtcctttgctgaccggatcgctgttcggagcgggaccgat2400tggacgatggttcctcgtcgtaggacgacccgtccgctcgtcccagcccgatggaaacgt2460cgtagtcgtaatcaattcgggcgtttccccggtcgatacggcctgactcgtgtcggtgac2520cgccctcctcttcgatgtcggcgagcacctcgacgagcgtgtgcaattggtcgagcagcc2580cgctgagctgggaagactggtcgtcggacgcgtcgtcgttttcgtcgggtaccattattt2640cttgacctccatgcggtcacgcatctgttcttggacctgctcggccatctccagttgcga2700ttcgagtgcttgcttgcgctgctggtactcctcgtcggatcgttcaccaacttcgtacag2760gagttggttctccttgatgtcgtctcgaatcgatttggtgtcgtacatctcgtcgagagc2820catcgtctggaggatatccagcaaggagaaaaacgggctcacgaagagatcgtctatgat2880gaacatgcattatcggcctccttgttgctgttccgcgccgatgtgaatgtccacgaaatt2940gtacggcggccacggccccgtgtactgaatcgtcagttcgtcgtattccgcttcgacatc3000gtcgatggcggagtcgaaagcatcgcgtttctcgaagtcgacgaggtacgacttattgat3060gatcaggcggtctgtgaagagatcgttctcggtctcgttgatactcagatctgctagttg3120atccgtgacgttttcctggatttcttctcgagggactgtatcgtcgccaggaccgagtat3180cttcacgccaagttcgacggttccctcgatgtcattcagcgtactgcgcaatgcacgtcg3240cgccccgcgcaatacaccctttagcgtgcgcgcacttttgaacgccatcccgaagctcat3300cgggacgactgtgcgttcttcttcgtgcttcaatacctcctggagcacgttgttatgagc3360ttccacgtcctcatcggtgcgctcggggtcggtcgtatcaatgtcagagacgacagcgga3420gagtgtcttgtaatcgaccgtatagacctgttccgctccggcaacgccttcgacatctaa3480ttcgagatcttcctgttcgatgataccgtatgtgtataggttctcagtcattggtctctc3540ttccttgggattgtgattgacgcgccttgcaatcggtcataaccgccttgagtacgagcg3600aaaacagcagcaactgatcaaccatgtggtctattcgggtgaacgctccttcaggatcgg3660agaggcgatacactttgcgcttgctcaatttctgtacctcaagtacaccttcgactgcaa3720ggtcatttaaatgcgggtatactgtacccggactcaggtctgccccaaacagccgccgga3780gatcctggagcagttcttttccacaggcaccgtctcgcacagtaatcagaagaaggagaa3840tctcgtcgatatgttcggtgacgatggcatcactgatcgtgtgaagctggtcattatcaa3900gccacccgtccatcgtagcgaccgcgtcatcagtcagcggcgtgtccgtgtagcgttgcg3960ttgccccctcatcaggcggctggtctgcgtgatctgacgcaccgtcggattcgatcactg4020attcgagatctgtgactgcgaacgagatcgcggcgttagcatcgatgtctgcggtgagtt4080cctccagcaagtcgtccattgttagaccatctccgtgagcgtgattttggggatcgactc4140tgactggctgatgccgattccgagcaggggcgtcaacgggttttcgccatacaggatgat4200ggcgtcaccggaccgttccagccggaagtgcatatcggcaacccgatccgctcgcgtgcg4260gagttcagtaccttgcttggtgatgagcagtgtcaggtcgttgtggagagcgacgtaatt4320tgcaaagtcacctagccgggtctcaaatgcctcctgcgccgtgtccatgctgatcacgtg4380caacaacggatcttcactttcttctcgcacctgttcaacgtaggccatgtatggctcgta4440cgcgagttgcccgccctctatcggtgactcaaagtcctcatcaatcggatgcggctggtc4500actccccgtaactccatccgtcgaacgtgagccatcgtccgcaccatcagtctcatgcgt4560cgccgtcggtgcatcgtccggcggcgttgtcgttgccatctcagaaaatgactcagtgct4620gtccggttggtcgtaccgatccgcactgtcagaggggccggcgtatgtttcgaagacgtg4680gcagtaggtatcgaagacctgtgaggagagcacagtattgagatcgttgtggagtaagcc4740agggctgccctcccggggcgggacaaccgcaacccccatctcctgagagaggaagttgcg4800aatcgtcgggagcgtcaacacgctccacgcgtcacgagacagatcgggcccgaggtcgag4860atgaacgacgctgccgcggttgtagccacccgagaggatacggtcaagatcacggatgcc4920agtcgagaatttcgccttcgaatttgccaggggatcccacgtgccattcccggttcctgt4980ttggatggttagtaattcgaccggcgtgatcacctggaactggccgtcggcaagcgtaaa5040gggctgtaagcggttgccgattcgaacgccccgaagcttatccaagcggagatcccgacg5100cgttcggccacggtcatcctccttaacctggagggtgacgaccccatcgacgatgtattc5160aagcgatgagggcgccgctgtttctgtcactaacatcagacgaatgttctcttcgcgggc5220aagaacggccagttgattcgtcacagtcttgatgtcaggggggtcatcgtggcgaacagc5280caaatactcgtagatgagttcccagctatcgaatgcgattgtgagttgcgtggtcgcggc5340gttgatctcttggatccattcgaggagcgaatccagatcgagtttctcgaatggcacgtc5400tacgtccagtgggagttcgaatgggtcttggaagaggtcaagaatcgcggttgtgtcgag5460tgaggagtgatcggcgaagtacatctcgtgaaccgtctcctgatcaacacgtgtggacac5520gtagaggacatcactgtctcggtccaacacatcgaggccgcggatcgtgaacaaggtctt5580acccgtgcctggtgcaccgttaatgaggagcgtttccccggcgtcacccatgaaaaactg5640gctgagctcgcgggggaataacacgattccggtgtagtctgtgggcgggtgagctagatt5700gggtgaactcattacttctctccagtcgatggcggtagagcactcccgactagtaggtga5760ggctttcttcgcttcacgactgtctaagaagctttacactctccgtacttagaagtacga5820ctcattacaggagacataacgactggtgaaaccatacacatccttatgtgatgcccgagt5880atagttagagatgggttaatcccagatcaccaatggcgcaaccagattcttcaggcttgg5940cagaagtccttgatcgtgtactagacaaaggtgtcgttgtggacgtgtgggctcgtgtgt6000cgcttgtcggcatcgaaatcctgaccgtcgaggcgcgggtcgtcgccgcctcggtggaca6060ccttcctccactacgcagaagaaatcgccaagatcgaacaagccgaacttaccgccggcg6120ccgaggcggcacccgaggcctgacgcacaggcctcccttcggccggcgtaagggaggtga6180atcgcttgcaaaccatactattaacaccttctcgggtacacactaatcccatgagtgtca6240cagacaaacgcgacgagatgagtactgcccgcgataagttcgcagaatcacagcaggagt6300tcgaatcatacgctgacgagtttgcagccgatatcacggcaaagcaagacgatgtcagcg6360accttgtcgatgcgatcaccgacttccaggcggagatgaccaacacgacggatgcatttc6420acacatatggtgacgagttcgccgctgaggttgaccacctccgtgccgatattgacgccc6480agcgggacgtgatccgtgagatgcaggatgcgttcgaggcatatgctgacatcttcgcta6540cagatatcgcagacaaacaagatatcggcaatcttctggctgcgattgaggcgctccgaa6600cagagatgaactcaacccacggggcattcgaagcatatgcggacgacttcgcagccgatg6660tcgctgcgctccgtgatatatctgatctggttgcagcaatcgacgacttccaagaggaat6720tcatcgccgtgcaggacgcatttgacaactacgctggtgacttcgatgcggagatcgacc6780agctccacgctgccatcgctgaccagcacgacagcttcgacgctaccgcggacgccttcg6840cagagtaccgagatgagttctatcgcatagaggtggaagcactgcttgaggcgatcaacg6900acttccagcaggacatcggtgacttccgagcggagtttgaaacgactgaggacgcgttcg6960ttgccttcgcccgtgacttctatggccacgagatcacggccgaggaaggcgccgccgaag7020cggaagccgaacccgtcgaggctgacgcggacgtcgaagcggaagcagaagtctctccag7080acgaagctggcggagaatccgccggtaccgaggaagaagagacagagccggccgaggtgg7140aaacagcggctccagaagtagaggggagtcctgcggacacggcagacgaagcggaagata7200cggaagcagaggaggagacagaggaagaggcaccggaagacatggtgcagtgccgggtgt7260gcggcgaatactatcaggccatcacggagccccatctccagacccatgatatgacgattc7320aggagtaccgcgacgagtacggtgaggatgtcccccttcggccggatgataaaacatgac7380gaacgagtcccgtaaacgcaaggtacgagggtcgcagatccgctcctcacgcggcgacaa7440gaaacaggggcgatcacagagccgtgatgataaggagatcgagcgtctcgagaggcagaa7500cgacgctcgtggccaggagtcgtctacccacgtcgacgaggggttcgttcccgaggaaca7560gtccttcatcgagaccgaatcggtcaatcgagtcgagtcgcggatggaacggtggctcga7620tgtcggacgtccggttcacctgatcgggccgaccggctgtgggaaaacgtcgctggcgat7680gcacgtcgcgcgcgagcgcgatcgcccggtcgtctggatcaacggcgacgccgaactcac7740gaccagcgatctcgtcggcgaatacgcggaaaaagagcgcatctcggagcacgatcaatt7800catccacaacgtcgttaagagcaaggacatcatccgtgatcgatgggtggacaaccccct7860gacgctcgccgtacaagagggggcaacgctggtctacaacgagttctcccgcaccaagcc7920cgtcgcaaacaacgtgctgttgtcggtcttcgaggaaggggtgctcgaactgccggggaa7980acgcggcaaatctcggtatgtagatgtgcatcctgagttccgaaccatcctgacctcgaa8040ctccgtcgagtacgctggcgtccacgagccgcaagacgccctgctcgaccgcctcatcgg8100gatctacatggatttctacgatctcgacacggagatcgagatcgttcgggcgcacgtcga8160caagtcggccgacacaaacgtcgaggacatcgtgcgggttctgcgtgaactccgcgagcg8220gctcgatatcaccgtgggtacacgggccgcgattatggccaacgaaggcgctaccaccgt8280cgacaccgtcgaccaggccgtcctgaccgatatctgtaccgacgtgctggcatcgaaggt8340cgcccagcggagcgacgttcgcgggctgcgcgaagaaatagaatccgcgatcgacgacat8400ggaagtcgccctttcttaagatccggggtctctacatagaagcatggcagatccagcaaa8460cgatcgatctgaacgcgaggaaggcggcgaggacgacgaaacaccgccagcgtccgacgg8520gaacccctcgccgtcggccaattcattcactctctccaacgcgcagacgcgcgcacgaga8580ggcggcacaggacctgttggaacaccagttcgagggatgatcaaagccgagtcgaacgac8640gaaggctggcggaccgtcgtcgaagtcgtcgaacggaacgccgtacccgatacacaagac8700atcatcggtcgctacgagatcacgcttgacgggacgggggacgtcaccggctacgagctc8760ctagaacgctatcgtcggggcgacatgaaagaggaactgtagcggtgcgtcaaatgcacg8820agcaatagatatggcccatcgactgaccgtagcgaacgagaaaggcggcgtggggaag8878 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 11 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : peptide ( xi ) sequence description : seq id no : 3 : glualaaspalaaspvalglualaglualaglu1510__________________________________________________________________________

US-75944496-A

a personalized blister pack for the automated packaging of an individually defined product composition , particularly drugs , of a defined person , particularly a patient , for a defined time period comprises a plurality of receiving compartments , each closed by a film , for the products of the product composition , wherein the receiving compartments are each associated with a defined usage time within the defined time period and disposed in matrix form , comprising a number of lines for usage days and columns for usage times during the day , and a memory device for storing the usage data of the products of the product composition of the defined person for the defined time period , comprising a device for generating a usage reminder signal as a reminder of a defined product usage time based on the stored usage data . the blister pack enables a fast , safe and inexpensive supply of the needs of the person for a defined time period , such as one week , and by means of the memory device , which may comprise a reminder function , supports the planned use of the products .

fig1 shows an embodiment of a personalized blister pack 20 according to the invention . this is in the form of a so - called weekly blister , to supply a person or patient with drugs and similar products such as vitamin preparations , food supplements , etc . for the period of one week . obviously , the invention is not restricted to a particular period . for each day of the week , on the blister pack 20 , which as a whole is in matrix form , a row of ( in the shown example ) four receiving compartments 22 , which can be separated by a perforation 24 , is provided , and each contain the products to be used for “ early ”, “ noon ”, “ evening ” or “ night ”, or for “ at breakfast ”, “ at lunch ”, “ at evening meal ” and “ before going to bed ”. depending on the field of usage , a different number of receiving compartments 22 can be provided , e . g . three receiving compartments for each meal , corresponding to before , during or after the meal . the 28 — in the embodiment shown in fig1 — receiving compartments 22 in total are mass - produced inexpensively from a preferably transparent thermoplastic material by deep - drawing , and each have sufficient space for multiple tablets , capsules , dragees etc . all receiving compartments 22 can be sealed by a common foil 25 , e . g . a thin aluminium foil , and provided with symbols for the removal time ( morning , noon , evening , night ). by tearing open the thin foil , the patient can conveniently remove the products to be taken at the appropriate time of day . because of the perforation 24 of both the plastic board which forms the receiving compartments 22 and the foil 25 , daily strips for convenient carrying can be separated from the blister pack 20 . the personalized blister pack 20 can be provided with an identifier 29 which is associated with the relevant patient , and is in the form of a bar code , for instance . however , other types of personal identifier are also possible . to protect the blister pack , and if appropriate for printing prescription information , the blister pack , as described in wo 2005 / 102862 , can have a hinged lid ( not shown in fig1 ). as shown in fig1 , the blister pack 20 is also provided with a memory device 50 , in which the usage data of the products in the receiving compartments , and of other products such as food supplements , ointments etc ., are stored . the memory device 50 can be in the form of a memory which can be written once only , for a single use for the period of use of the blister pack ( e . g . one week ), or a memory which can be written many times , and which after the week expires is returned to the pharmacy for further use , or updated by remote data transmission for the next week . the memory device 50 can be removably attached to the blister pack 20 by adhesives , a velcro ® fastener , a holding strap or similar , so that the patient can easily remove it from the blister pack , without damaging the blister foil 25 . the memory device can have a carrying device such as the shown holding strap 60 , so that the patient can , for instance , hang the memory device around his or her neck , or carry it with himself or herself otherwise . the essential elements of an embodiment of the memory device 50 according to the invention are now explained with reference to the block diagram of fig2 . the memory device has a memory element 52 , which as mentioned above can be a memory which can be written once or one which can be written many times . for instance , an eprom or flash memory element can be used , as can other technologies such as are known from chip cards . additionally , the memory device 50 has an interface unit 54 , which makes it possible to write the product usage data to the memory . the interface 54 can also be designed for updating the data stored in the memory element 52 , e . g . by infrared , bluetooth , wireless lan or a mobile communication network . the memory device 50 also includes a timer 56 and an output unit 58 , to implement a reminder function for the patient . on the basis of the patient &# 39 ; s usage data , which are stored in the memory element 52 , and which contain the period for taking the relevant drugs ( morning , noon , evening , night ), in relation to the relevant meals ( before , during or after the meal ) if appropriate , the timing device 56 supplies a signal to the output device 58 , which then outputs a warning signal . in the shown example , the output device 58 is a miniaturized loudspeaker , which outputs a beep tone , or better a synthesized speech signal with precise usage instructions such as “ take the red tablet before lunch ” or “ take the heart medicine with the evening meal ”. the volume can be adjusted by means of a controller ( not shown ). alternatively , of course , a visual output device which outputs the usage instructions on a small display can be used . however , the most convenient reminder function for the patient ought to be achievable using speech synthesis . in the memory device , in addition to the usage data , personal identification data associated with the patient are stored . they can be output via the output device 58 to the user / patient for checking . in the memory device 50 , patient - related data concerning further therapeutic and / or diagnostic actions such as measuring blood pressure or similar can also be stored . the memory device 50 , like , for instance , a sim card of a mobile telephone , can be in an inexpensive , space - saving and weight - saving form . for power supply , a power supply unit ( not shown in fig2 ) such as a small battery or a capacitor can be provided . however , the memory element 50 can also be in the form of a passive element corresponding to an rfid chip , and receive radio frequency signals via the interface unit 54 , which is provided with a radio frequency aerial , and use them also for power supply . for safe handling , the memory device is also provided with a waterproof , washable , shockproof and inexpensive case , e . g . of plastic . preferably , the additional option of suppressing the ( possibly disturbing ) reminder signal for a specified period of , for instance , 10 minutes by pressing a button or similar can be provided . such a function is known for alarm clocks , for instance . the suppressed signal can then be output later , displaced in time , to remind the patient subsequently of the product usage which may have been missed . also , to check the correct drug usage according to prescription ( compliance ), an acknowledgment button ( not shown ), by which the patient acknowledges the drug usage according to prescription , can be provided . alternatively , for this purpose , a sensor device , which for each of the receiving compartments 22 detects the tearing of the corresponding foil section , and thus deduces the drug usage according to prescription , can be provided . below , with reference to fig3 and 4 , an embodiment of the method according to the invention for automated packaging of an individually defined product combination for numerous patients in individual packaging units is explained . from numerous patients 100 , in a first method step s 1 , first the individual prescription data , i . e . the drugs and other products ( vitamin preparations , food supplements , ointments etc .) which are prescribed for the patient to use are captured , preferably in the pharmacy which looks after the patient in each case , and in the following method step s 2 are stored in a database 80 . the database 80 , as sketched in fig3 , can be a decentralized database which is maintained in the pharmacy , or a central database . a packaging machine or loading machine 90 , which is equipped to supply a large number ( perhaps several hundred thousand ) patients , is supplied with drugs in large quantities by manufacturers . for personalized , patient - specific packaging of the drugs and / or other products which are prescribed for a patient in the blister packs described above for a defined period , in method step s 3 the patient &# 39 ; s usage data are read out of the database 80 , and in the subsequent method step s 4 an individual blister pack 20 , in which the drugs which are prescribed for this patient for the period are packaged , is assigned to each patient . on the basis of the read usage data , in the further method step s 5 these usage data are also stored on a memory device 50 which is associated with the patient , and then the memory device is attached to the packaging unit 20 in step s 6 . obviously , method steps s 5 and s 6 can be executed in the reverse time sequence . in the further method step s 7 , the personal identification data stored in the memory device are checked to agree with the identifier 29 which is attached to the packaging unit . it is thus possible to verify the correctness of the association of the packaging unit 20 with the usage data stored in the memory device 50 , so that the products and usage data assigned to the patient are always supplied to him or her . the blister packs ( or weekly blisters ) which are thus produced quickly , reliably and inexpensively are delivered to the appropriate pharmacies , which then make the weekly blisters , which are provided with storage elements , available to the appropriate patients . the memory device 50 can also contain usage data of products which are not supplied with the blister , e . g . ointments , medicinal teas , spa treatments or similar . according to one variant of the invention , as mentioned above , it can also be provided that the usage data on the memory device are updated , preferably by wireless means , e . g . by a special mobile communication signal or a bluetooth or infrared interface which is provided in the pharmacy . fig5 shows a block diagram of the memory unit 50 according to a second embodiment of the personalized blister pack 20 according to the invention . in addition to the elements shown in fig2 , the memory unit 50 of the second embodiment has a gps unit 55 , to detect the location of the memory device and thus of the user / patient . the patient &# 39 ; s location can be passed on via the wireless interface 54 by mobile communications or similar , e . g . to a hospital or care facility , so that the targeted care for , in particular , older patients can be improved . additionally , the memory element 50 , according to a second embodiment , has an emergency call button 57 for making an emergency call via the wireless interface 54 , in which case , by operating the emergency call button 57 , an access unlocking system , which , for instance , is installed on the entrance door in the user &# 39 ; s home , can also be activated via a transponder or similar , to make access easier for emergency services . finally , in the case of the embodiment shown in fig5 , a display 53 for displaying patient data , reminder data or similar is shown . the invention thus makes it possible to supply a large number of patients , quickly , reliably and inexpensively , with the individually prescribed product or drug combination . the convenient handling of the blister pack and the supplied memory device with reminder function support appropriate medication of the patient , so that the patient is capable of looking after himself or herself for longer , and is not directed to in - patient care .

US-30678107-A

disclosed is a computer support device comprising a base , a rectangular support plate attached to the base in a manner that permits rotation of the support plate around a vertical axis in the center of the base , and a support construct that is moveably attached to the top surface of said support plate , wherein said construct is capable of being vertically elevated relative thereto .

the laptop computer support device 10 of this invention is shown in its entirety in fig1 . it comprises several parts which interact together . as seen in fig1 , the first part ( not seen in fig1 ) is a circular base plate 12 . the base plate 12 is preferably made of molded plastic , but can also be made of metal or wood . the base plate 12 has a hole 14 in the middle having a diameter sufficient for a screw or bolt to be inserted through it . in the preferred embodiment the diameter of the hole 14 is about ⅜ of an inch . the top surface 16 of the base plate 12 has a raised circular flange 18 on it . it is concentric to the hole 14 . the purpose of the flange 18 will be described below . the preferred diameter of the base plate 12 is about 8 inches , and the circular flange 18 is preferably located about one and one quarter inches from the outer edge of the base plate 12 . the flange 18 projects about ⅛ inch vertically for the surface 16 of the base plate 12 . fig2 shows the bottom surface 20 of the base plate 12 . it has a series of concentric strengthening ribs 22 molded into it , and a number of intersecting ribs 24 which radiate out from the center of the plate 12 . there is a small concentric rib 26 molded into the plate 12 at the center surrounding the hole 14 . the concentric rib 26 defines a circular space 28 with a flange 30 wide enough to receive a washer ( not shown ). the bottom surface 20 of the base plate 12 also has a plurality of non skid pads 32 situated at various locations close to the edge of the plate 12 . the non skid pads 32 are situated in recesses 34 molded into the bottom surface 20 of the plate 12 . desirably , the non skid pads 32 are located close to the edge of the bottom surface 20 of the base plate 12 , and are positioned so that they provide uniform support on a flat surface to the base plate 12 . as shown in fig2 , there are four non skid pads 32 , one located at each of the apexes of a imaginary rectangle toward the outer ends of the ribs 24 which intersect with the small concentric rib 26 surrounding the hole 14 in the plate 12 . the non skid pads 32 can be made of felt , velcro , or similar material . the number of non skid pads is variable . as shown , the base plate is circular in configuration , but the shape is substantially immaterial . that is , it could be square or rectangular , or some other shape . what is important is that it have a hole 14 at or near the center thereof , and an elevated circular flange 18 on the top surface 16 . positioned above , and overlying the base plate 12 is a support plate 36 . the support plate 36 , fig3 , 4 , 5 , and 6 , is generally rectangular in configuration . it has an elevated ledge 38 projecting upward at the lower end , to provide a stop for a laptop computer that may be positioned on it . that is , a laptop computer would be stopped from sliding off of the device 10 and support plate 36 by the ledge 38 . as shown in fig1 , the ledge 38 extends across the entire width of the base . in an alternative embodiment , as shown in fig1 , the ledge has a gap 40 in the middle , so as to provide access to wires , connections , and the like that some laptop computers have in the front thereof . if desired , a non slip material 42 such as rubber can be applied to the face 44 of the ledge 38 to prevent sliding of a laptop computer that may be resting against it . as seen in fig3 and 4 , in particular , the support plate 36 has a number of slots in it . one set of slots 46 is located at the end opposite the ledge 38 . each slot 46 has a pair of ears 48 projecting upward from the sides thereof , and a round axle 50 spanning the space between the ears 48 . below each of the slots 46 is a rectangular recessed area 52 molded into the face 44 of the support plate 36 . a second pair of slots 54 is located at an intermediate point on the support plate 36 about ⅔ of the distance from the bottom edge . as best seen in fig9 , each of the slots 54 has a cowl 56 projecting upward from the outer edge thereof , and a set of teeth 58 projecting upward adjacent the inner edge thereof . the teeth 58 are molded onto the top surface or face 44 of the support plate 36 , and provide a ratchet mechanism , as will be described below . the number of teeth 58 can be variable , but preferably , there are 9 spaced apart teeth on each side of the support plate 36 , and the teeth are about ⅛ inches in height . the space between the teeth 58 defines a recess 60 or groove into which an axle is situated , as described below . the top surface 62 of the support plate 36 has a circular elevated section 64 substantially in the middle thereof , intermediate the two rows of teeth 58 . the elevated section 64 has a diameter slightly larger than the diameter of the outer edge of the flange 18 on the top surface of the base plate 12 . as seen in fig6 , the bottom side 66 of the support plate 36 has spacers 68 molded into the four corners thereof , and has a circular indentation 70 that corresponds in diameter to the elevated ring 64 on the surface 62 thereof . the slots 46 and 54 described above with reference to the top surface of the support plate 36 are also shown . a plurality of open faced cups 72 are molded into the bottom surface 66 of the support plate 36 , situated around the periphery of the circular indentation 70 . each of the cups 72 holds a ball bearing 74 which facilitates rotational movement of the support plate 36 on the base plate 12 , as described below . a downwardly projecting screw receiving post 76 is located at the center of the indentation 70 . the diameter of the post is slightly smaller than the diameter of the hole 14 . fig5 shows the base plate 12 mounted to the bottom of the support plate 36 . the annular flange 18 on the top surface 16 of the base plate 12 fits into the indentation 70 in the bottom of the support plate 36 . when properly situated , the post 76 projects through the hole 14 , but is sufficiently loose so that rotation of the support plate 36 with respect to the base plate 12 can be achieved . before the base plate 12 is fastened to the support plate 36 , the ball bearings 74 are placed in the cups 72 . a portion of the ball bearings 74 projects beyond the edge of the cups 72 so as to provide a movable surface against which the base plate 12 rests . the base plate 12 is affixed to the support plate 36 by a screw 78 inserted through the hole 14 and screwed into the post 76 . the screw 78 is restrained from passing through the hole 14 by a washer 80 under the head thereof which is larger than the diameter of the hole 14 and rests against the flange 30 in the recess 28 . the ball bearings 74 in the cups 72 come into contact with the upper surface 16 of the base plate 12 . the support plate 36 is thus rotationally moveable around the axis of the post 76 and screw 78 while the base plate 12 stays stationary . the diameter of the circular flange 18 of the base plate 12 is lightly smaller than the diameter of the indentation 70 in the bottom of the support plate 36 , thus when the screw 78 is tightened , the flange 18 fits within the peripheral confines of the indentation 70 , thereby restricting movement of the support plate 36 , other than rotational movement . a moveable support construct 86 is affixed to the top surface of the support plate 36 . as seen in fig7 , 8 9 , and 10 a and 10 b , the construct 86 comprises an irregularly shaped essentially flat molded piece 88 having a generally straight rounded upper edge 90 , and two parallel legs 92 separated by an arcuate shaped cutout 94 . the rounded upper edge 90 of the molded piece 88 has axle like extensions 96 on each side , and smaller slotted axles 98 extending therefrom . each leg 92 has a slot 100 at the foot thereof , and an axle 102 at the very bottom thereof which extends outwardly . the axles 102 are of a size that they fit into the grooves 60 between the teeth 58 , as best seen in fig9 . an arm 104 attaches to the axles 98 of each side of the molded piece 88 . each arm 104 has an open mouth 106 at one end , and a head 108 with circular configuration defining a circular opening 110 at the other end . when assembled , the open mouth of the arm 104 fits over the axle 50 in the support plate 36 , and engages it , while the head 108 fits over the axle 98 on the molded piece . thus is obtained a moveable support construct , that is rotatable about the horizontal axis of the molded piece 88 extending through axles 98 and the axis of axles 50 of the support plate 36 . the axles 102 on the legs 92 of the molded piece 88 , fit into the groves 60 formed between the teeth 58 . thus a type of ratchet mechanism is achieved . depending on the degree of elevation desired , the support construct 86 can be lowered or raised vertically by repositioning the axles 102 at the bottom of legs 92 in the grooves 60 formed between the teeth 58 . the legs 92 are held in place by the ends of the axles 102 extending into the space formed under the cowl 56 . when fully extended , the construct 86 lays essentially flat against the support plate 36 , thus enabling the device 10 to be placed in a briefcase or laptop carrier , and easily transported . a laptop computer or other device placed on the device of the invention can be moved in a rotational direction , or one end elevated in a vertical direction , or both , as desired . the degree of elevation is controlled by the moveable support construct 86 , which can be raised or lowered vertically by repositioning the axles 102 in the grooves 60 between the teeth 58 , as shown in fig9 . thus the angle of a laptop keyboard resting on the device 10 can be easily adjusted by rotating the support plate 36 on the base plate 12 , or raising the rounded upper edge of the support construct 86 to the desired height , or both . an added advantage is that the device of the invention enables air to circulate freely around and underneath a computer , thus preventing excessive heat buildup , and thereby increasing battery life . while this invention has been described with reference to a preferred embodiment , it should be understood by those skilled in the art that various changes and modification may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . therefore , it is intended that the invention not be limited to the particular embodiment disclose as the best mode contemplated for carrying out the invention , but that the invention will include all embodiments falling within the scope of the appended claims .

US-97555907-A

a concentrator for airflow hair dryers having a comb or similar attachment mounted within the air outlet and selectively positionable in multiple positions to precede the airflow , follow the airflow , or to divide the airflow discharging from the concentrator outlet .

as shown in the drawings , the preferred form of concentrator accessory is adapted for use with an electrically - operated , hand - held dryer having a rectangular heated - air discharge . hair dryers of this type are well known and are available in various types and qualities . it is to be understood that the new concentrator of the present invention may be adapted for use with a variety of hand - held hair dryers , whether intended for professional salons or for home use . the preferred form of concentrator accessory comprises a housing body 1 having a rectangular inlet 2 for receiving heated air from the dryer . the longitudinal edges 3 and 4 of the inlet 2 are provided with suitable series of mounting lips 5 and 6 , respectively , for snap - locking the edges in sealing engagement on the housing of the hair dryer . the end walls 7 and 8 each have curved edges for mating with and closing against the exterior or other suitable portion of the hair dryer housing . the concentrator housing 1 preferably is molded in one piece and generally tapers inwardly toward a terminal discharge outlet 9 in a reduced body portion 10 which is joined with the main body portions at the end walls and by transverse portions of reinforcing ribs 11 . the ribs 11 define a plurality of intermediate outlet apertures 12 , of smaller size , intermediate the inlet 2 and outlet 9 on each side of the housing between the adjacent edges 13 and 14 , respectively , of the main body portion 1 and the reduced portion 10 . internally of the housing , the end walls 7 and 8 each carry a pivot socket 15 and 15 &# 39 ;, respectively . the pivot sockets are aligned with each other , preferably substantially upon the longitudinal centerline of the housing body 1 . the sockets 15 and 15 &# 39 ; are similar and only one will be described in detail , for simplicity , the components of the socket 15 &# 39 ; being identified by the same numerals , primed , as those of socket 15 . the pivot socket 15 is formed of three parallel socket members 17 , 18 and 19 molded on the endwall 7 and spaced from each other transversely of the housing to accept a rounded pivot 20 of a hair - engaging and manipulating attachment such as the comb 21 shown in the drawings . the resilient outer socket members 17 and 19 preferably have arcuate or semi - circular recesses 22 and 23 , respectively , which are aligned opposite each other to provide a semi - circular surface portion for receiving the pivot 20 . the upper portions of the socket members 17 and 19 are separated from their respective end walls , during molding , so that they are free to spring away from each other sufficiently to accept and release the full diameter of the pivot 20 , between their respective ends 24 and 25 , as it is pressed toward and out of the semi - circular recesses 22 and 23 . the semi - circular recesses preferably are curved on a common radius generally equal to , or slightly greater than the radius of the pivot 20 , thereby allowing the ends 24 and 25 to snap back to their original position to retain the pivot resiliently trapped therebetween . the upper surface of the fixed intermediate socket member 18 preferably carries a curved recess 18a formed on the same radius as the recesses 22 and 23 to provide a three - point , arcuate bearing of the pivot socket 15 on the pivot 20 . intermediate the pivot socket 15 and the terminal discharge outlet 9 , the endwall 7 of the reduced body portion 9 is provided with a thickened portion 16 with three elongated , v - shaped , parallel detents 25 , 26 , and 27 for receiving a boss 28 on the comb 21 . the detent 26 is positioned on a line passing through the axis of the pivot socket 15 and transversely bisecting the terminal discharge outlet 9 , as is the fixed socket member 18 . therefore , when an attachment such as the comb 21 is mounted in the concentrator with its pivots 20 and 20 &# 39 ; in the pivot sockets 15 and 15 &# 39 ; and its bosses 28 and 28 &# 39 ; entered in the detents 26 and 26 &# 39 ;, the body and teeth of the comb bisect the reduced body portion 10 and the terminal discharge outlet 9 on its longitudinal center line , as shown in dotted lines in fig3 and 4 . the detents 25 and 27 each are positioned away from the longitudinal center line and closer to their respective , adjacent longitudinal edges of the terminal discharge outlet 9 . the comb , therefore , when mounted in the pivot sockets 15 and 15 &# 39 ; and with its bosses 28 , 28 &# 39 ; in the detents 27 and 27 &# 39 ;, is securely mounted with its teeth 29 against or closely adjacent to the longitudinal edge 31 , as shown in fig4 . if , on the other hand , the detents 28 and 28 &# 39 ; were relocated into the detents 25 and 25 &# 39 ;, the teeth 29 would then be mounted against or closely adjacent the longitudinal edge 30 . it is preferable to form the bosses 28 , 28 &# 39 ; with an apex or , at least , with lateral surface 33 and 34 at an angle to facilitate rotation of the comb or other attachment to disengage the bosses 28 , 28 &# 39 ; from one of the detents for rotational repositioning of the attachment to another position and securement by another of the detents . such bosses may take generally pyramidal or conical form , for example in addition to the wedge - shape shown . this is particularly important where hair - engaging attachments of lesser strength are to be used , as in the case of brushes or thin - tined rakes or lifters . it is to be understood that , although the preferred concentrator incorporates three detents for the positioning of a grooming accessory , the actual number of detents is not critical to the invention . accordingly , a different number of detents , or differing transverse positioning thereof , may be employed to afford intermediate positions of an attachment and differing divisions of the heated - air flow through the terminal discharge outlet . it is important to the present invention that the concentrator be formed from a material which is both tough and light in weight and , particularly , is capable of being molded to form a unitary structure . one such material , for example , would be a polycarbonate such as that currently marketed as number 141 - r , under the trademark &# 34 ; lexan &# 34 ;, by the general electric company . this material is equally suitable for forming the comb or the concentrator - engaging portion of the grooming attachments . the preferred form of concentrator is quite readily molded with its housing , pivot sockets and detents forming a single molded unit . since the socket members 17 , 18 and 19 and the detents 25 , 26 and 27 are all substantially parallel to each other , they are quite easily incorporated as a molded , integral part of the housing . this not only simplifies the mold requirements , but also facilitates removal of the units from the mold . in use , the selected comb or other grooming attachment is installed in the concentrator 1 and the unit is then mounted on the hair dryer for which it was designed , as represented schematically in fig7 . with hair that has just been washed , the concentrator of the present invention permits the selection of a relatively coarse , de - tangling comb and , more importantly , the mounting of the comb against one of the edge 30 or 31 to position the comb teeth 29 following the heated - air flow . with the comb teeth following the heated air flow , the hair is exposed to the drying effect ahead of the comb , and is less swollen by moisture at the time it is engaged by the teeth . this reduces the high coefficient of friction typical of wet hair and reduces the high coefficient of friction typical of wet hair and greatly facilitates the detangling of the hair as well as its drying . the selection of the side toward which the comb is angled will depend , of course , on which hand is to be used for the grooming and drying step . it is usual , when a person is grooming or drying their own hair , to change hands for different sides of the head or for a differing direction of grooming . accordingly , if the comb is initially positioned adjacent the longitudinal edge 31 , for right - hand use , it is desirable that it be repositioned adjacent the longitudinal edge 30 for use in the left hand . the switching of the comb attachment from one position to another is readily accomplished as the unit is changed from one hand to the other . the combing attachment is simply grasped and rotated toward the desired position , thereby disengaging the tapered bosses 28 and 28 &# 39 ; from the detents they formerly occupied . when the desired position has been reached , by further rotation of the comb , bosses 28 and 28 &# 39 ; are then reseated in the porper detents and hold the comb in that position . when the hair has been sufficiently dried that it is capable of being formed and styled , it is most effective to have the heated air impinge following a fine comb in its direction of travel . this heats the hair while it is under the tension imposed by the comb and considerably enhances the forming effect of the comb . to this purpose , the concentrator of the present invention is capable of receiving and mounting a finer comb than that used for initial drying and de - tangling . the pivots 20 and 20 &# 39 ; of the first comb are than snapped out of the resilient arms 17 - 19 and 17 &# 39 ;- 19 &# 39 ; of the pivot sockets 15 and 15 &# 39 ;, and the newly selected , finer tooth comb is installed in the concentrator . in use for styling and forming , the fine comb is rotated and positioned so that its teeth are adjacent whichever of the longitudinal edges 30 or 31 will form the leading edge of the terminal outlet 9 . the heated - air flow thus meets the hair while it is under the tensions imposed by the manipulating effect of the comb teeth , so that the hair is heated under tension . again , when it is desired to change hands or to change the direction of the grooming strokes , the concentrator of the present invention provides for the quick rotation of the comb and its mounting in the newly selected position adjacent the other longitudinal edge . the new concentrator is also of distinct advantage when it is desired to touch up or reform the hair between shampoos and apart from only a drying operation . the combination of heat under tension and the selectively variable relationship between the heated air flow and the teeth of the grooming attachment provides a reforming capability which is particularly advantageous . since the concentrator of the present invention supplies the heated air immediately adjacent the grooming device , the hair is subject to optimum temperature control as it is engaged and worked by the grooming unit , and is quite easily dried or reformed and styled . whenever the bulk of the hair may happen to temporarily block the terminal outlet 9 , the intermediate outlet apertures 12 provide means of escape for the airflow to avoid overheating of the hair dryer elements , which would otherwise result in damge to the dryer unit or tripping of a safety element . therefore , it is apparent that the concentrator of the present invention has unique capabilities and advantages not heretofore available in a unit capable of use with one hand . moreover , the present invention provides a close association of the heated - air flow with the comb , or other hair engaging attachment , and a versatility in that close association which exceeds the potential of prior , two - handed techniques . furthermore , the present invention has achieved these capabilites and advantages in a concentrator which easily is molded with its housing , attachment - mount and attachment - positioning elements formed in a single molded unit . various changes may be made in the details of the invention , as described , without sacrificing the advantages thereof or departing from the scope of the appended claims .

US-57208175-A

soluble and stable liquid compositions containing a plant growth regulator selected from the group consisting of cytokinin and a gibberellin , an acid solubilizer such as citric acid , tartaric acid or glycolic acid and a solvent ; as well as methods for making and using the composition are disclosed . the compositions improve solubility , handling , stability , safety , as well as activity improvements such as improved plant growth , yield , fruit thinning or sizing and quality . the compositions are soluble and stable by adding an ethoxylated alkyl alcohol wherein the growth regulator is 6 - benzyladenine or forchlorfenuron and the ethoxylated alcohol surfactant is c 12 - 15 alkyl alcohol in propylene glycol . the compositions may also contain a cytokinin such as 6 - benzyladenine or forchlorfenuron that is increased in solubility and activity and by synergistically combined with ga 3 or ga 4 a 7 as well as in storage stability by adding an antioxidant . the compositions are formulated in a ready - to - mix formulation .

we have now surprisingly discovered that highly concentrated , soluble and stable liquid formulations of plant growth regulators are improved if organic acid solubilizers such as citric acid , tartaric acid or glycolic acid are added to the composition and dilution solubility is improved if an ethoxylated alkyl alcohol surfactant is added to the composition . the composition having improved dilution solubility preferably comprises 6 - ba or cppu as the plant growth regulator and propylene glycol as the solvent and the ethoxylated c 12 - 15 alcohol as the surfactant . the acid solubilizer prevents crystallization of the active ingredient at ambient or cold storage temperature thereby resulting in a more concentrated liquid formulation . the soluble liquid formulation is still safe , stable and effective . the phrase “ plant growth regulator ” as used herein connotes a product which serves to modify the growth and the development of a treated plant to agricultural maturity without killing the plant . such modification may result from the effect of the material on the physiological processes of the plant , or from the effect of said material on the morphology of the plant . these modifications may also result from any combination or sequence of physiological or morphological factors . the plant growth regulator may be a gibberellin , an auxin , an organic acid , a cytokinin , an ethylene biosynthesis inhibitor , or a combination thereof . suitable ethylene biosynthesis inhibitors include aminoethoxyvinylglycine ; suitable auxins include indole - 3 - acetic acid and indole butyric acid ; suitable organic acids include a - naphthyl acetic acid and suitable cytokinins include 6 - benzyladenine or 6 - benzylaminopurine ( 6 - ba ), forchlorfenuron ( cppu ), thidiazuron ( tdz ) and 6 - furfurylaminopurine ( kinetin ). in the formulation of the present invention , a surfactant may be used as a wetting , solubilizing and penetrating agent for certain plant growth regulators . suitable surfactants include non - ionic surfactants , anionic surfactants and amphoteric surfactants . non - ionic surfactants include ethoxylated alkyl alcohols such as tomadols ®, ethoxylated vegetable oils such as agnique sbo ® ( soybean ), cso ( castor ) and rso ( rapeseed ), ethoxylated sorbitan esters such as emsorb ®, tween ®, and t - maze ®; sorbitan fatty acid esters such as span ® and alkamul ®; sucrose and glucose esters and derivatives thereof such as mazon ®, rheozan ® and glucopon ®; ethoxylated alcohols such as trycol ®, brij ®, armix ®, tergitol ® and plurafac ®; ethoxylated alkylphenols such as igepal ®, macol ® and triton ®; ethoxylated fatty amines such as trymeen ® and ethomeen ®; ethoxylated fatty acids such as emerest ®, alkamul ® and trydet ®; ethoxylated fatty esters such as alkamul ® and atlas g ®; fatty acids such as atlas g - 1556 ®; glycerol esters such as mazol gmo ®; glycol esters such as glycol seg ®; lanolin - based derivatives such as amerchol cab ®; methyl esters such as oleocal me ®; monoglycerides and derivatives such as ethosperse g - 26 ®; propoxylated and ethoxylated fatty acids such as antarox aa - 60 ®; block copolymers of ethylene oxide and propylene oxide such as pluronic ® or surfonic ®; silicone - based surfactants such as silwet ®, breakthru ® and mixtures of organosilicon surfactant with non - ionic or ionic surfactants ; polysaccharides , copolymers of acrylamide and acrylic acid ; and acetylenic diol derivatives such as surfynol 104 ® or tristyrylphenols such as soprophor ® among others . a presently preferred nonionic surfactant family is the ethoxylated alkyl alcohols of c9 to c15 chains ( tomadol 25 - 7 , 1 - 7 or 91 - 60 ). non - ionic surfactants such as natural ethoxylated alcohols ( brij ®) and vegetable oils ( agnique ®) are presently also preferred . suitable anionic surfactants include phosphate esters such as emphos ® and rhodafac ®; dialkyl sulfosuccinates such as monawet ®, n - acyl ed3a chelating surfactant ( hampshire ) and n - acyl sarcosines ( hamposyl ) among others . the tradenames used above of surfactants often are common to a class or series of surfactants . therefore , where a tradename is mentioned , any surfactant in the family including that tradename will be suitable . other components of the formulation may include additional surface active agents , cosolvent , dyes , u . v . ( ultra - violet ) protectants , antioxidants , antifoams or other components which facilitate product handling and application . it is also contemplated that the ready - to - mix compositions of this invention may be used in other active ingredients , such as herbicides , fungicides , insecticides , nematicides , biochemical pesticides , plant produced pesticides ( botanicals ) or plant nutrients . a presently preferred composition contains technical grade active ingredient gibberellin . a preferred technical grade active ingredient gibberellin is ga 3 , since it is the most widely used plant growth regulator for agriculture , although other gibberellins , including but not limited to ga 4 , or ga 7 , ga 4 a 7 , and combinations of ga3 or ga4a7 with 6 - ba or cppu . a presently preferred composition includes from about 1 . 5 to about 3 . 0 weight percent 6 - benzyladenine , from about 1 . 5 to about 3 . 0 weight percent anhydrous citric acid , from about 3 . 5 to about 5 . 5 weight percent ethoxylated c 12 - 15 alcohols , from about 0 . 05 to about 0 . 20 weight percent propyl gallate and from about 91 . 00 to about 93 . 00 weight percent propylene glycol . a presently preferred composition includes from about 0 . 5 to about 2 . 0 weight percent cppu , from about 0 . 5 to about 2 . 0 weight percent anhydrous citric acid , from about 1 . 0 to 3 . 0 weight percent ethoxylated c 12 - 15 alcohols and from about 93 . 0 to 98 . 0 weight percent propylene glycol . gibberellins are known plant growth regulators . for example , u . s . pat . no . 4 , 242 , 120 discloses a non - spray combination of a gibberellin with a low molecular weight carbohydrate such as saccharide , glucose , fructose or maltose to stimulate fructification ; and u . s . pat . no . 5 , 163 , 993 discloses a combination of gibberellin and a surfactant for thinning grape clusters . the formulations described above may be used to regulate plant growth of fruit - producing plants , vegetable - producing plants , row crops , vegetable crops , grasses or trees . the benefits of the use of the formulation vary , according to the type of fruit treated . for example , in grapes , treatment with the formulation can lead to cluster elongation , thinning and larger grapes . in oranges , lemons , limes and tangerines , the formulation can lead to a delay the aging of the rind and reduce disorders such as rind staining , water spotting , sticky or tacky surface , puffy rind or rupture under pressure . in cherries , the formulation may advantageously be used to produce larger , brighter colored and / or firmer fruit . the formulation is preferably diluted in water and sprayed on the plant or tree to be treated . the spraying may be by conventional ground or aerial application equipment . spray volumes are variable depending upon the orchard or crop , growth stage and climatic conditions . the range may be 5 gallons to 300 gallons / acre or higher . a presently preferred range is between 100 to 250 gallons per acre by pressurized spray application equipment . to prepare a formulation for application , a tank is half - filled with water , followed by spray addition of adjuvant , and then addition of plant growth regulator , followed by addition of more water and mixing for at least 15 minutes prior to actual spraying . alternatively , the formulation may be directly applied to the soil ( in which the plant will be grown or is growing ) with or without granular fertilizers for the improved growth and maintenance of crops . moreover , the formulation may be applied to seeds to achieve the same effect . the seed may be rice or paddy , alfalfa , cotton , sorghum , soybeans , corn or other vegetables , ornamental or turf and pasture grass seed , among others . the concentration of the plant growth regulator will vary depending upon the type of fruit is to be treated , the peculiarities of the locale , and the desired result . in general , the composition may be applied at a field rate of from about 0 . 01 to about 1 . 0 lb per acre ; preferably at a rate of from about 0 . 02 to about 0 . 5 lbs per acre and most preferably at a rate of from about 0 . 02 to about 0 . 2 lb / acre . for example , the field spray rates for apples using 6 - ba can be about 38 - 75 g / 100 gallon per acre and for grapes using cppu can be about 4 - 8 g / 250 gallon per acre . a single application may be enough , though depending upon the particular fruit and desired results , multiple applications may be made . as used herein the term “ plant ” includes fruit - producing plants , vegetable - producing plants , row crops , vegetable crops , grasses and trees . the fruit may be grapes , cherries , lemons , limes , oranges , grapefruit , strawberries , pineapples , stone fruits , apples , pears , peaches , blueberries , pistachio or tangerines . the row crop may be cotton , soybeans , corn , sugar cane or rice , among others . the vegetable crops may be lettuce , artichokes , celery or peppers among others . the grasses may be bahaigrass ( paspalum notatum flugge ), bentgrass ( agrostis l . ), bermudagrass ( cynodon dactylon l . ), carpetgrass ( axonopus affinis chase ), kentucky bluegrass ( poe pratensis l . ), canada blugrass ( poe compressa l . ), buffalograss ( buchloe dactyloides ( nutt .) englem . ), fescue grasses ( festuca ), annual rye grass ( lolium l . multiflorum lam . ), perennial rye grass ( lolium perenne l . ), saint augustinegrass ( stenotaphrum secundatum kuntze ), japanese lawngrass ( zoysia japinica steud . ), centipedegrass ( eremochloa ophiuroides ( munro ) hacck , other turf grasses for residential or commercial establishments , among others . the invention will be understood more clearly from the following non - limiting representative examples . of course , the present invention is not limited to the particular embodiments and modes of operation described herein and it is possible to imagine a number of variations in the details without departing from the scope of this invention . the examples below are presented to describe preferred embodiments and utilities of the invention and are not meant to limit the invention unless otherwise stated in the claims appended hereto . in 500 liter batch size ( 523 kg by weight ), 480 . 9 kg of propylene glycol solvent is transferred through a heat exchanger to a mixing tank and the solvent is heated to 40 ° c .- 45 ° c . while in the mixing tank , 10 . 1 kg of 6 - ba tech powder ( 98 . 5 % active ingredient ), 10 . 5 kg of citric acid powder and 0 . 5 kg of propyl gallate powder ( tenox pg ®) are added . the mixture is agitated until all of the powders are completely dissolved . 21 kg of ethoxylated c 12 - 15 alcohol surfactant ( tomadol 25 - 7 ®) is then added . everything is mixed for additional 10 - 20 minutes to complete the formulation . example 2 demonstrates increased solvent solubility of 6 - ba ( n - 6 - benzyladenine ) by adding soluble organic acids in propylene glycol , and improved water dilution stability of 6 - ba and cppu ( forchlorfenuron or n -( 2 - chloro - 4 - pyridinyl )- n - phenylurea ) in formulations with low irritating ( skin and eyes ) surfactants ( alkyl alcohol ethoxylates or / and dioctyl sodium sulfosuccinate ) and citric acid solubilizer . soluble , stable , safe and ready - to - mix formulations were achieved with 6 - ba or cppu and acid / surfactant combinations as shown in table 1 below . table 1 shows the solvent solubility of 6 - benzyl adenine ( 6 - ba ) and cppu ( forchlorfenuron or n -( 2 - choloro - 4 - pyridinyl )- n - phenylurea ) at 20 degrees c . 100 g of solvent are used . the solvent is either propylene glycol , propylene carbonate or propylene glycol - n - propyl ether . only 1 . 5 g of 6 - ba remains soluble in propylene glycol alone . 2 . 4 g 6 - ba remains soluble if 2 g of citric acid is added to propylene glycol . 2 . 5 g of 6 - ba remains soluble if 2 g of tartaric acid is added to propylene glycol . cppu remains soluble at 7 g , 6 g and 10 g in propylene glycol , propylene carbonate and propylene glycol - n - propyl ether , respectively . thus , 6 - ba solubility is increased by adding citric acid or tartaric acid in propylene glycol . formulations designated vbc - 30001 and abg - 3207 contain 6 - ba and forchlorfenuron , respectively , and citric acid , c 12 - 15 alkyl alcohol ethoxylate , propyl gallate and propylene glycol . the weight percent of each component is shown . storage stability for both formulations ( 65 - 022 - vb lot for vbc - 30001 and 51 - 004 - vb lot for abg - 3207 ) is high after 12 months at 25 degree c . or 25 - 40 degree c . tropical conditions . the dilution stability data for both formulations shows that in 342 ppm hard water at about 23 degrees c ., 450 ppm of 6 - ba 200 ppm of cppu remain soluble after 24 hr standing . low skin , eye , sensitization or inhalation toxicity are shown for abg - 3207 ( category iv ) and vbc - 30001 ( mild skin & amp ; eye irritation , category iii ). both formulations employ epa list 3 or 4 inerts . no flammable ipa nor toxic thfa solvent is used in these studies . table 1 also shows a preferred formulation of plant growth regulator compositions of the present invention . formulation designated vbc - 30001 contains 1 . 93 weight percent of benzyladenine technical ( 98 . 5 % active ingredient ), 2 . 00 weight percent of citric acid ( solubilizer ), 4 . 00 weight percent ethoxylated alcohols ( surfactant adjuvant ), 0 . 10 weight percent propyl gallate ( antioxidant ) and 91 . 97 weight percent propylene glycol ( solvent ). a presently preferred composition includes from about 1 . 5 to about 3 . 0 weight percent 6 - benzyladenine , from about 1 . 5 to about 3 . 0 weight percent anhydrous citric acid , from about 3 . 5 to about 5 . 5 weight percent ethoxylated alcohols , from about 0 . 05 to about 0 . 20 weight percent propyl gallate and from about 91 . 00 to about 93 . 00 weight percent propylene glycol . formulation designated abg - 3207 contains 0 . 84 weight percent cppu technical ( 96 . 9 % active ingredient ), 0 . 5 weight percent anhydrous citric acid , 1 . 0 weight percent ethoxylated alcohols , and 97 . 66 weight percent propylene glycol . table 2 shows the activity improvement of 100 ppm or 150 ppm 6 - ba sprays . both formulations improved apple thinning and sizing without , sevin ® ( carbaryl ) insecticides as shown in 2000 field trials . in a similar study , better grape sizing using formulation abg - 3207 than other formulations ( cppu technical / ipa ) is found . fig1 shows c14 radiolabelled 6 - ba uptake from compositions of the present invention ( formulation vbc - 30001 is designated as “ b ”) in apple leaves , was superior to other compositions designated “ a ” and “ c ”. equal amounts of composition a , b or c ( containing radiolabelled 6 - ba ) were individually applied to apple leaves and the amount uptake was determined from sections of the leaves such as from discs and strips cut from the leaves after a 24 hour period of absorption . a control was also compared to compositions a , b and c . the leaves were rinsed with water and the amount of radiolabelled 6 - ba not absorbed in the leaves were determined and quantified ( left bar designated “ rinses ”). the amount of radiolabelled 6 - ba absorbed in the leaves determined from the discs and strips cut from the leaves were determined and quantified ( right bar designated “ non - rinse ”). six trials were taken for each compositions and the control and averaged ( except one trial was dropped from “ c ” and three trials were dropped from “ b ”). fig1 shows that the 6 - ba of the composition of the present invention , “ b ”, was absorbed ( non - rinse ) at a significant higher level compared to that of compositions “ a ” and “ c ”. the amount of 6 - ba of the composition of the present invention that was not absorbed ( rinses ) was significantly lower than that of the other compositions . it is believed that solubilization of the plant growth regulator , such as 6 - ba and cppu , with the organic acid , such as citric acid in conjunction with a surfactant in use dilutions will generate small particle size ( microparticles or nanoparticles ) for improving uptake or penetration . small particle size of high dissolution rate is important for activity of water insoluble active ingredients or drugs . table 3 below shows potential ready - to - mix plant growth formulations which including at least a plant growth regulator , an acid , a surfactant and an antioxidant . formulation vbc - 30009 contains 1 . 9 % 6 - ba , 2 . 0 % ga4a7 and 0 . 45 % cppu . formulation yw - 16 - 7 contains 4 . 5 % ga 3 and 0 . 42 % cppu . formulation yw - 16 - 9 contains 2 . 1 % ga 3 and 1 . 9 % 6 - ba . formulations yw - 26 - 1 and yw - 26 - 5 contain 2 . 1 % cppu . formulation yw - 16 - 4 contains 9 % ga 3 . additional adjuvants are shown . these formulations show the synergistic effect of combining 6 - ba and cppu with ga 3 and ga 4 a 7 as well as the composition comprises an ethoxylated alkyl alcohol surfactant , organic acid and an antioxidant adjuvants in propylene glycol solvent . table 4 below shows stability improvement of formulations containing ga 4 and ga 7 with ethoxyquin or propyl gallate antioxidant in ga4a7 or ga4a7 / 6 - ba or / and cppu liquid formulations . components for the formulations are shown . storage stability data shows most formulations containing antioxidant have excellent storage stability . _significant stability improvement of ga4 and ga7 were achieved by adding 0 . 05 - 0 . 1 % propyl gallate or 0 . 5 % ethoxyquin antioxidant in a % ga4a7 and 6 - ba / cppu plus 2 % ga4a7 liquid formulations . the present invention is illustrated by way of the foregoing description and examples . the foregoing description is intended as a non - limiting illustration , since many variations will become apparent to those skilled in the art in view thereof . it is intended that all such variations within the scope and spirit of the appended claims be embraced thereby . changes can be made in the composition , operation and arrangement of the method of the present invention described herein without departing from the concept and scope of the invention as defined in the following claims :

US-56594309-A

an expandable spinal fusion device is provided . the expandable device comprises a first part slidingly coupled to a second part . an removable expandable member extends between the first part and the second part and is coupled to a rotating operator such that rotating the operator causes the first part and the second part to move away from each other and distract vertebral bodies . a spacer or clip is used to lock the first part in relation to the second part to allow bone growth the fuse the vertebral bodies .

the present invention will now be described with reference to the figures . referring first to fig1 , an axial view of spinal segments 100 a and 100 b is shown . spinal segment includes inferior vertebral body 102 , superior vertebral body ( not specifically shown , but substantially identical to inferior vertebral body 102 ), and intervertebral disc space 104 . intervertebral disc space 104 is typically occupied by an intervertebral disc comprising a disc annulus and disc nucleus . to fuse inferior vertebral body 102 and the superior vertebral body , the intervertebral disc may be fully or partially removed , but is shown as fully removed for convenience . occupying intervertebral disc space 104 is at least one expandable spinal fusion device 106 . depending on the surgical procedure , such as an anterior or posterior approach , and the discs begin fused , one or more devices 106 may be used by the surgeon . as shown in segment 100 a , a single device 106 is used . spinal segment 100 b uses two devices 106 . referring now to fig2 a and 2b , an expandable fusion device 200 is shown in more detail . device 200 includes a first part 202 and a second part 204 . first part 202 includes a first vertebral body interface surface 206 . first vertebral body interface surface 206 may include surface texturing 208 , such as the saw tooth projections shown or alternatively , striations , other shaped protrusions , or the like . first part 202 has a second surface 210 opposite first vertebral body interface surface 206 . extending opposite optional surface texturing 208 from second surface 210 are a plurality of dual walls 212 . as shown , two sets of dual walls 212 form two channels 214 . dual walls 212 and second surface 216 form a partially enclosed space 218 . second part 204 comprises a third vertebral body interface surface 220 . second vertebral body interface surface 220 may comprise optional surface texturing 208 . second part 204 also comprises a fourth surface 222 opposite third vertebral body interface surface 220 . extending from fourth surface 222 exist a plurality of single walls 224 . single walls 224 are aligned to slidably engage channels 214 . note , while two dual walls 212 forming two channels are shown on first part 202 and two single walls 224 to align with channels 214 are shown in second part 204 , dual walls 212 and single walls 224 may be alternatively arranged on second part and first part respectively . alternatively , first part may have two dual walls 212 forming one channel 214 and one single wall 224 while second part may have two dual walls 212 forming one channel 214 and one single wall 224 such that the single walls align with the channels . residing in space 218 is a removable , expandable member 226 . expandable member 226 operates in any conventional manner , similar to , for example , a car jack . because the operation of expandable member is well known in the art , it will not be further explained herein . extending from expandable member 226 is an operating arm 228 . operating arm 228 is connected at a proximate end to expandable member 226 and at a distal end to a rotating operator 230 , which is shown as a dial , but could be other rotating devices . rotating operator 230 has an indicating window 232 and indicia 234 in indicating window 232 to provide information to the surgeon as will be explained further below . as shown in fig2 a and 2b , device 200 is in the collapsed or compact state 236 . correspondingly , indicia 234 indicates “ 0 ” or the like to show no expansion or full collapsed state . referring now to fig3 , spinal segment 100 a is shown in a lateral view . device 200 is implanted in intervertebral disc space 302 initially in the collapsed state 236 with operating arm 228 extending from the disc space 302 to terminate in a position where rotating operator 230 is accessible by a surgeon . referring now to fig4 a and 4b , device 200 is shown in an expanded state 400 . to obtain expanded state 400 , rotating operator 230 is rotated , for example in a clockwise direction as shown by arrow 402 . device 200 may be expandable to a plurality of positions over a spectrum . as device 200 expands to various positions , indicia 234 will indicate the corresponding expansion state in indicating window 232 . for example , indicia 234 indicates a position “ 5 ” in fig4 a and 4b . position 5 would correspond to a desired distraction by the surgeon . as rotating operator 230 is rotated , single walls 224 slidably move in channels 214 as shown by arrows 410 such that channels 214 and single walls 224 provide a traveling guide . as single walls 224 moves in channels 214 , gaps 404 form between a bottom edge 606 of dual walls 212 and fourth surface 222 . referring to fig5 , device 200 in an expanded state 400 is shown in intervertebral disc space 302 . device 200 provides distraction between superior and inferior vertebral discs . referring to fig6 , a spacer 600 is shown . spacer 600 has a plurality of spacer walls 602 separated by a distance 604 , which generally corresponds to a thickness t of single wall 224 . spacer walls 602 have a width w of sufficient size such that a bottom edge 606 of dual walls 212 can rest a leading edge 608 of spacer walls 602 . spacer walls extend all or part of the length of single wall 224 . a spacer wall connector 610 traverses one end of spacer 600 connecting the spacer walls 602 . spacer 600 forms a frictional fitting with single wall 224 . spacer walls 602 may be parallel as shown , converge , or diverge to facilitate use as a matter of design choice . single wall 224 and spacer walls 602 may have texturing 612 to facilitate the frictional fitting between spacer 600 and single wall 224 . spacer 600 is sized to fit into gap 404 , which corresponds to the expansion state selected by the surgeon . thus , expansion state corresponding to indicia “ 1 ” would have a corresponding spacer 600 as would expansion corresponding to indicia “ 2 ”, “ 3 ”, “ 4 ”, or the like . thus , spacer 600 has indicia 610 corresponding to indicia 234 . implanting spacer 600 locks device 200 in the expansion selected by the surgeon . in this case , as shown in fig4 a and 4b , spacer 600 corresponding to expansion state 5 as shown by indicia 234 is selected . referring to fig7 , device 200 with spacer 600 is shown . once spacers 600 are placed , the surgeon may operate rotating operator 230 back to the collapsed stated , position “ 0 ”. once in the collapsed position , expandable member 226 may be removed from space 218 . space 218 may be packed with material 700 , such as bone chips or the like , to facilitate bone growth between superior and inferior vertebral discs . moreover , as shown in phantom in fig7 , dual walls 212 and single walls 224 may have channels 702 , such as , divots , in growth channels , or the like , to further facilitate bone growth and fusion . alternatively to removing expandable member , material 700 may be packed about expandable member 226 and operating arm 228 may be detachable and removable from expandable member 226 . first part and second part may be constructed from , for example , a number of biocompatible materials , such as , for example , milled bone , peek material , titanium , resorbable material , shaped memory alloys , or the like . first part and second part need not be constructed from the same material . while the invention has been particularly shown and described with reference to embodiments thereof , it will be understood by those skilled in the art that various other changes in the form and details may be made without departing from the spirit and scope of the invention .

US-45603806-A

a skiboard system is provided . the system includes a skiboard and left and right loose heel binding secured to the skiboard . the skiboard has a longitudinal axis , a central portion and an upward curving front shovel area . the central portion includes side edges and a central waist . the side edges have concave curvatures of radius and extend between front and rear ends of the central portion so that the concave curvatures of the side edges form the central waist . the central portion further includes a longitudinal camber , which elevates the waist . the upward curving front shovel area has a front tip and is formed by the front end of the central portion . the left and right loose heel bindings are secured to the central portion substantially parallel to each other on opposite sides of the waist at an acute angle less than 35 degrees from the longitudinal axis . furthermore , the bindings are angled to the right of the longitudinal axis when the left binding is in front of the waist and the bindings are angled to the left of the longitudinal axis when said right binding is secured in front of the waist .

the first embodiment of the invention is a single skiboard ( fig1 and 2 ) that employs standard nordic norm telemark bindings ( left binding illustrated in fig1 by combination of a binding toe piece 108l and a heel cable 110l , and right binding by combination of a binding toe piece 108r and a heel cable 110r ) or other loose - heel nordic - style bindings , with binding toe pieces 108l and 108r set at acute angles to the axis of the ski one in front of the other . in this description the first embodiment of the skiboard is generally designated by reference numeral 100 . this embodiment is intended primarily for use in lift - served ski areas . the second embodiment of the invention ( fig1 and 12 ), is generally designated by the reference numeral 200 . it is a skiboard of like dimensions to skiboard embodiment 100 , and also uses multiple arrangements of nordic bindings . the primary difference from skiboard embodiment 100 is that embodiment 200 can , when desired , be separated into longitudinal halves 233l and 233r for use as independent skis ( fig1 and 14 ). it is intended primarily for back - country use , where the user may want to be able to move his legs independently to glide over flat areas and up hills but retain the option of linking halves 233l and 233r into a single embodiment 200 ( fig1 and 12 ) for control on steep descents . both skiboard embodiments 100 and 200 use standard nordic norm or other nordic - style bindings , such as those in fig1 , 23 and 24 , designed for use with telemark boots ( not shown ). both skiboard embodiments 100 and 200 may be constructed using a variety of standard ski construction methods well - known in the industry . because they do not lock down the rider &# 39 ; s heels , we believe standard nordic norm or telemark bindings , such as those illustrated in fig1 , 23 and 24 , will only function well on a skiboard falling within the specific parameters set in this description . on a wider skiboard , the loose - heel aspect of nordic bindings would cause control problems , and a narrower board would be too unstable . referring to fig1 and 11 , in skiboard embodiments 100 and 200 the maximum width of a front shovel area 104 and a rear shovel area 116 is 6 to 9 inches . a waist 112 , or narrowest portion , on skiboard embodiment 100 and 200 falls 0 to 12 centimeters behind their longitudinal midpoints . the sidecut radius on skiboard embodiments 100 and 200 , designated by r in fig1 may vary from an arc describing a section of a circle with a radius of 3 meters to an arc describing a circle with a radius of 20 meters . the lengths of skiboard embodiments 100 and 200 may range from 150 to 200 centimeters . referring to fig3 the maximum unweighted arch or camber 109 of skiboard embodiments 100 and 200 , which is measured off a horizontal plane on which a skiboard rests ( not shown ), ranges from 1 to 6 centimeters . referring to fig1 on both skiboard embodiments 100 and 200 a front shovel area 104 begins to rise 7 to 11 centimeter back toward waist 112 from an imaginary vertical line ( not shown ) that intersects a front tip 102 when either embodiment 100 or 200 is placed on a horizontal plane . front tip 102 rises to a point 2 to 6 centimeters above that plane . again referring to fig1 a rear shovel area 116 begins to rise 6 to 9 centimeters back toward waist 112 from an imaginary vertical line ( not shown ) that intersects a rear tip 114 when either skiboard embodiments 100 or 200 is placed on a horizontal plane . rear tip 114 rises to a point 1 . 5 to 5 centimeters above that plane . referring to fig4 the thicknesses of skiboard embodiments 100 and 200 reach a maximum of 1 to 2 . 5 centimeters at waist 112 and , progressing toward tip 102 , the thickness tapers progressively to between 0 . 5 and 1 . 5 centimeters at point 122 , where front shovel area 104 ( fig1 ) begins to rise . from that point to tip 102 , the thickness tapers progressively to between 0 . 25 and 1 centimeter . a similar taper occurs from waist 112 to rear tip 114 . additional thickness in the rear of waist 114 -- up to 30 percent more than that allowed in front of waist 114 -- is desirable for skiboards that will be used at high speeds . overall thickness will affect stiffness , with softer skiboards more desirable for mogul skiing and stiffer skiboards preferable for speed . referring to fig1 , each of the two standard nordic norm or telemark binding toe pieces 108r and 108l to be used on skiboard embodiment 200 are mounted permanently by rivets or fasteners 111 to base plates 228r and 228l . binding base plates 228r and 228l may be made of 0 . 25 to 0 . 5 centimeter rolled steel or aluminum in 4 - to 8 - centimeter widths , or other materials of dimensions that provide similar strength . referring to fig1 , binding base plates 228r and 228l serve to help connect skiboard halve 233r and 233l when they are combined for use as single skiboard 200 ( also shown in fig1 and 12 ). referring to fig2 , a preferred embodiment of binding assembly 246l includes toe piece 108l bound to binding base plate 238l by three rivets or fasteners 111 , with heel cable 110l attached to binding toe piece 108l . near the rear of binding base plate 228l is a longitudinal slot 238l that is 1 to 10 centimeters in length and 0 . 25 to 1 centimeter in width . in front of binding toe piece 108l , binding base plate 238l has a latitudinal slot that measures 1 centimeter to 5 centimeters in length and 0 . 25 to 1 centimeter in width . in one preferred embodiment ( fig2 ), longitudinal slot 238l is penetrated by a threaded bolt 230l with an elongated or square head which serves as a heel pad for the riders boot ( not shown ). the elongated head of bolt 230l also allows the user to hand tighten it as a connector to any of several combinations of threaded t - nuts or other receivers 234a - h ( fig2 ) installed in the surface of skiboard embodiment 200 . there are many potential methods for connecting binding assemblies 246r and 246l in a variety of positions to the surface of skiboard embodiment 200 . in the preferred embodiment illustrated in fig1 , latitudinal slot 236r ( fig1 ) is penetrated by a threaded wing nut 232r . wing - nut 232r may be hand - tightened by the user to connect the front of binding assembly 246r ( fig2 ) to several combinations of threaded t - nuts or receivers 234a - h installed in the surface of the board ( fig2 ). referring to fig1 and 11 , in preferred versions of skiboard embodiments 100 and 200 the binding toe pieces 108r and 108l are mounted at acute , nearly parallel angles ranging from 1 to 35 degrees off either side of the axis of the skiboard . the objective is to locate binding toe pieces 108r and 108l and the heels of the rider ( not shown ) as close as possible to the opposing edges of skiboards 100 and 200 without either of the binding toe pieces or the heels of the rider overlapping any edge more than 2 centimeters . referring to fig1 in skiboard embodiments 100 and 200 the binding toe pieces 108r and 108l should be mounted so the narrowest portion of the skiboard , waist 112 , falls between the heel of the front ski boot ( not shown ) and whichever binding toe piece is placed in the rear . when locked in binding toe piece 108l or 108r , the heel of the front boot ( not shown ) should fall 0 to 12 centimeters in front of an imaginary line drawn perpendicular to the axis of skiboard embodiments 100 or 200 at waist 112 . when locked in binding toe piece 108r or 108l , the toe of the rear boot should lie 0 to 12 centimeters to the rear of waist 112 . this binding arrangement allows a rider ( not shown ) to pressure waist 112 and thus arc either skiboard embodiment 100 or 200 properly in turns . referring to fig6 on skiboard embodiment 100 threaded inserts or threaded t - nuts ( represented in fig1 at 240 ) are installed in a wood core ( represented in fig1 at 242 ) two five - hole patterns . the insert installation patterns shown in fig6 allow typical three - hole nordic norm bindings to be quickly and securely attached with machine screws , bolts or other connectors ( not shown ) in either a right - foot - forward ( fig7 ) or left - foot - forward ( fig9 ) arrangement , depending on individual preferences . referring to fig7 and 9 , the front and rear insert patterns each have one of five threaded inserts , 122c and 124c , that can be used as one of the three anchor points required to attach the standard nordic norm toe piece in either the right - foot - forward ( fig7 ) or left - foot - forward ( fig9 ) fashion . this common hole eliminates the need to drill a structure - weakening sixth hole ( not shown ). referring to fig7 the combination of inserts used for a right - foot - forward nordic norm binding toe piece arrangement is 122a , 122d and 122c for front binding toe piece 108r attachment and 124a , 124d and 124c for rear binding toe piece 108l attachment . referring to fig9 the combination of inserts used for a left - foot - forward nordic norm binding toe piece arrangement is 122b , 122c and 122e for the front binding toe piece 108l attachment and 124d , 124c and 124e for the rear binding toe piece 108r attachment . referring to fig1 , on one preferred embodiment of skiboard 200 binding assembly 246r is mounted for use on an independent ski , longitudinal half 233r , as follows : the front of binding assembly 246r is locked down by a 1 centimeter diameter hardened machine screw , wing - nut bolt or fastener 232r , which penetrates slot 236r and threads into t - nut 234d installed in the core ( 242 at fig1 ) of longitudinal half 233r . the rear of binding assembly 246r is locked down similarly by machine screw or threaded wing - nut bolt 230r , which penetrates slot 238r and threads into t - nut 234h installed in the core of longitudinal half 233r . referring to fig2 , left binding assembly 246l is attached to longitudinal half 233l in identical fashion but using t - nut locations 234c and 234g . referring to fig1 , when longitudinal halves 233r and 233l are connected for use as single skiboard 200 by a left - foot - forward rider , binding assembly 246l ( also shown as a group of elements in fig2 ) is mounted in the proper position by locking connector 232l down onto receiver 234b and by locking connector 230l down onto receiver 234e . binding assembly 246r ( shown as a group of elements in fig2 ) is mounted in the proper position by locking connector 232r down onto receiver 234d and by locking connector 230r down onto receiver 234g . the right - foot - forward binding arrangement is accomplished in similar fashion , with binding assembly 246r being mounted in the forward position onto receivers 234a and 234d and binding assembly 246l being mounted onto receivers 234e and 234h . the binding lock - down system described above for skiboard embodiment 200 may employ several variations . one preferred embodiment ( fig1 ) employs a plurality of posts 245 that protrude from the surface of the board and which fit through binding base plate slots 236r and l and 238r and l to position them where needed . in that embodiment , a threaded wing nut 248 and a threaded nut with an elongated head ( as represented in 230l , fig2 ) would be used to lock down binding assemblies 246r and 246l . on skiboard embodiment 200 ( fig1 ), each of toe pieces , 108r and 108l , and their respective base plates , 228r and 228l , are connected permanently by three rivets or fasteners 111 and are moveable as binding assemblies 246 and 246l ( detailed in fig1 and 22 ). base plates 228r and 228l must be of suitably strong material such as 0 . 5 centimeter by 4 centimeter plates of aluminum or stainless steel , because they are placed under stress when used as devices for connecting longitudinal halves 233r and 233l , as shown in fig 11 . referring again to fig1 , skiboard embodiment 200 is joined by binding assemblies 246r and 246l and a plurality of other connectors or latches 226a - d ( also shown in fig2 ) mounted on the surfaces of skiboard embodiment 200 . a variety of latches may be used , one prefer embodiment ( fig2 ) employing a stainless steel over - center draw latch . referring to fig2 and 21 , the latch body 252 is installed on the surface of longitudinal half 233l and keeper 256 is installed on the opposing surface of longitudinal half 233r . latch arm 254 is extended to engage keeper 256 and then drawn down by depressing lever 250 , thereby eliminating the intervening gap 258 . the latches used should have a draw strength of at least 50 pounds to withstand the stresses of using the skiboard . skiboard embodiments 100 and 200 are may be constructed by virtually any of the methods common to the ski and snowboard manufacturing industry . a preferred embodiment involves a vertically laminated hardwood core sandwiched between layers of epoxy - soaked triaxial fiberglass fabric . the topsheet may be chemically treated polyamide material and the base material of extruded or sintered polyethlene with chemically etched surfaces to help adhesion of inks or epoxy . standard steel ski edges should wrap all exposed edges of the base material . all requisite hardware may be fabricated easily by those skilled in the art or purchased from existing source of supply . the invention skiboard introduces a new winter sport . in its basic form , the skiboard is a device that allows the user in a lift - served ski area to carve hard , fast turns with the power of a snowboard and the speed of traditional downhill skis . in its divisible embodiment , it allows the user to penetrate remote back - country regions on independent cross - country style skis , which can be joined , using the same bindings , into a skiboard for control on steep downhill runs . while the description above contains many specificities , these should not be construed as limitations on the scope of the invention , but rather as an exemplification of one preferred embodiment thereof . for example , the invention skiboard may use any loose - heel binding devices , such as 75 millimeter , three - pin telemark bindings with or without heel straps or cables , 75 - millimeter cross - country ski bindings , step - in bindings that allow the heel of the boot to rise , nnn bc type telemark bindings , or strap devices designed to hold down the toe and instep of the rider while leaving the heel unfixed . the non - visible embodiment of the subject skiboard may also be employed for back country use by fixing one foot in the front binding toe piece and the other on an auxiliary snow shoe . also , a wide variety of latches or connectors may be used to bind together the longitudinal halves , or skis , of the divisible embodiment of the skiboard . in addition to the over - center draw latches discussed in the description of invention section of this patent application and illustrated in the accompanying drawings , flexible rubber draw latches , bolt - action latches , a wide variety of slam - action or other latches , or straps may be used , in a variety of positions and numbers . the devices used to connect the binding assemblies to the skiboard embodiments may include , in addition to those discussed above and shown in the accompanying drawings , any type of compact fastener or flat latching device designed to hold down the binding or binding assembly . examples include quarter - turn fasteners , captive screws and cam locks . accordingly , the scope of the invention should be determined not by the embodiments illustrated but by the appended claims and their legal equivalents .

US-83124497-A

a lens surrounded by a protective chamber is focused by utilizing a magnetic field to adjust the position of the lens within the chamber . by using a magnetic field to adjust the lens position , it is not necessary to pass a mechanical device through the surface of the chamber , thereby allowing the chamber to be completely sealed to prevent contaminants from contacting the lens .

referring to the figure , endoscope coupler 10 includes a front housing 12 and a rear housing 14 . the apparatus may be a medical device such as an endoscope coupler for coupling an endoscope to another device ( e . g . a video monitor ). front housing 12 includes a spring operated variable split ring clamp that can attach to endoscopes of various diameters . light 17 from an endoscope 19 enters a sealed nonmagnetic cylindrical tube 16 through a front window 18 , passes through focusing lenses 20 and exits tube 16 through a rear window 22 and into a video head assembly 23 for viewing on a monitor . lenses 20 are mounted in a support structure 24 that includes a generally cylindrical permeable steel , ferromagnetic support 26 and a pair of nonmagnetic tubes 27 , 29 . ferromagnetic support 26 includes radial projections 28 , 30 , 32 and 34 , each of which is in sliding contact with the inner surface of tube 16 to allow ferromagnetic support 26 to slide freely ( arrow 31 ) within tube 16 thereby moving lenses 20 toward and away from front window 18 and the source of the light for focusing . projections 28 and 34 are thicker than projections 30 , 32 to provide stable supporting surfaces for support structure 24 within tube 16 . windows 18 , 22 are sealed to tube 16 either by adhesives or by a solder or braze connection . tube 16 is fixed at opposite ends to housing 12 , 14 either by adhesives or by mechanical means such as an interference press fit , threads or a solder or braze connection . a ring shaped permanent magnet 36 surrounds tube 16 and has retaining permeable steel flux conducting washers 38 , 40 adjacent to its north ( n ) and south ( s ) poles , respectively . the inner diameter of magnet 36 is slightly larger than the outer diameter of tube 16 so that magnet 36 may slide freely along tube 16 . the length of magnet 36 together with the two retaining washers 38 , 40 matches the distance spanned by the two projections 30 , 32 . magnet 36 and washers 38 , 40 are supported by a support structure 42 which receives a screw 44 in its radially outermost surface . the support structure may be attached to magnet 36 by adhesives , threads , interference press or a retaining ring . the head of screw 44 fits within a helical groove 46 formed in a cylindrical focusing sleeve 48 . focusing sleeve 48 is mounted within and may be rotated by rotating a cylindrical focusing ring 50 attached to sleeve 48 by adhesives or threads . an anti - rotation or stabilizing rod 52 is secured at one end to magnet support 42 by a press fit and at its other end is received in a hole 54 formed in housing 14 . endoscope coupler 10 also includes a wave spring 56 , floating washers 58 , 60 and 62 , support 64 and nut 66 . the washers are made of a dimensionally stable material with low coefficient of friction , such as bronze or a polyamide - imide plastic . in operation , light representing an image that passes through tube 16 is focused onto an imaging sensor ( not shown ) in head assembly 23 by lenses 20 , the focus being adjustable by moving lenses 20 toward and away from the imaging sensor . to achieve the adjustment , focusing ring 50 is rotated to thereby rotate focusing sleeve 48 . the head of screw 44 will move within helical groove 46 as focusing sleeve 48 is rotated and will therefore move either toward front housing 12 or toward rear housing 14 , depending on the direction of rotation of focusing ring 50 . the movement of screw 44 will cause magnet support 42 , magnet 36 , and washers 38 , 40 to move outside of tube 16 . stabalization rod 52 stabilizes magnet 36 and prevents magnet 36 from rotating with focusing sleeve 48 . since support 26 is ferromagnetic , a flux path is established between the north and south poles of magnet 36 via washers 38 , 40 , projections 30 , 32 , and the tubular part of support 34 . as a result , as magnet 36 moves , lens support 24 and lenses 20 will also move , thereby adjusting the focus of the image passing through tube 16 . the washers function as bearings for the entire assembly . this prevents &# 34 ; cocking &# 34 ; or binding and prevents abrasive contact between the magnet assembly and tube 16 . wave spring 56 functions to prevent &# 34 ; end - play &# 34 ; ( i . e ., axial movement ). the primary sliding surfaces are the surfaces of washers 58 and 60 . because focus is achieved without the need to extend any mechanical components through the surface of sealed tube 16 , no debris or steam can enter the tubes in which the lenses are housed . conventional focusing devices use a direct mechanical connection between the lenses and some external adjustment such as the above described focusing ring . it is therefore necessary to have apertures in the chamber that contains the lenses to admit the mechanical components of the adjustment mechanism . although the apertures are typically sealed as well as possible , dirt , disinfecting solutions and water vapor are still sometimes able to penetrate into the chamber causing the lenses to become dirty or fogged , degrading performance of the device , and necessitating a difficult and time consuming cleaning of the lenses which is typically done by the manufacturer , making the device unavailable to the physician . in the present invention , the lenses will remain dirt and fog free throughout the surgical procedure . furthermore , when the device is cleaned and sterilized between surgical operations such as by autoclaving , the steam will not be able to penetrate into the chamber thereby preventing the lenses from fogging . other embodiments are within the following claims . for example , instead of using a single lens assembly and moving the lens axially to achieve the desired focus , multiple lenses can be selectively moved into the path of the light passing through the chamber , with each lens providing a different predetermined focus .

US-51411990-A

disclosed is a novel method for the preparation of an organo - polysiloxane - grafted polysaccharide compound which is particularly useful as an additive ingredient in various types of cosmetic and toiletry preparations . the method utilizes a reaction between epoxy groups of a diorganopolysiloxane , e . g ., dimethylpolysiloxane , terminated at a single molecular chain end with a 2 - ethyl group and carboxyl groups in a carboxyl group - containing polysaccharide compound such as hydroxypropyl methyl cellulose phthalate and hydroxypropyl methyl cellulose acetate succinate dissolved in an organic solvent . the reaction proceeds efficiently without addition of any catalytic compounds almost quantitatively under moderate reaction conditions .

as is described above , the inventive method comprises a reaction between a carboxyl group - containing polysaccharide compound and an epoxy - terminated organopolysiloxane compound in an organic solvent and , quite unexpectedly , the reaction therebetween proceeds almost quantitatively at a moderate rate even in the absence of any catalytic compound so that , when the starting reaction mixture is prepared by using the epoxy - terminated organopolysiloxane in an amount not exceeding equimolar to the carboxyl groups in the carboxyl group - containing polysaccharide compound , the resultant reaction product contains no or little amount of the unreacted orgariopolysiloxane compound enabling use of the reaction product by omitting or greatly simplifying the expensive purification procedure necessitated in the prior art methods for the removal of the unreacted organopolysiloxane compound and catalytic compound . when the reaction is conducted with an excess molar amount of the carboxyl groups in the polysaccharide compound over equimolar to the epoxy groups in the organopolysiloxane compound , the reaction product can contain a substantial amount of the carboxyl groups unreacted so as to exhibit the advantages by the carboxyl groups and the organopolysiloxane grafts in combination . step ( a ) of the inventive method is for the preparation of a solution as a reaction mixture containing the carboxyl group - containing polysaccharide compound and the epoxy - terminated organopolysiloxane compound jointly dissolved in an organic solvent . accordingly , the carboxyl group - containing polysaccharide compound must be soluble in at least one organic solvent which also dissolves the epoxy - terminated organopolysiloxane compound . several classes of semi - synthetic polysaccharide derivatives are known to meet these requirements including hydroxypropyl methyl cellulose phtihalate , hydroxypropyl methyl cellulose acetate succinate , carboxymethyl ethyl cellulose , pullulan acetate phthalate and the like and they can be selected depending on the particular properties desired of the product , though not particularly limitative thereto . among the above named carboxyl group - containing polysaccharide compounds , it is advantageous , if the purpose of the product can be met with , to use a hydroxypropyl methyl cellulose phthalate or hydroxypropyl methyl cellulose acetate succinate as the reactant to be grafted because of the good commercial availability and inexpensiveness of these cellulose derivatives commercialized as an enterosoluble coating agent on solid medicaments . the epoxy - terminated organopolysiloxane compound as the other reactant in the inventive method is represented by the above given general formula ( i ). in the formula , each r is , independently from the others , a monovalent hydrocarbon group having 1 to 10 carbon atoms exemplified by alkyl groups such as methyl , ethyl , propyl and butyl groups , cycloalkyl groups such as cyclopentyl and cyclohexyl groups , aryl groups such as phenyl and tolyl groups , aralkyl groups such as benzyl and phenethyl groups and alkenyl groups such as vinyl and allyl groups . these monovalent hydrocarbon groups can optionally be partially or fully substituted by halogen atoms or , in particular , fluorine atoms as in chloromethyl and 3 , 3 , 3 - trifluoropropyl groups . it is advantageous in most cases that all or at least 90 mole % of the groups denoted by r are methyl groups , the balance , if any , being phenyl and / or vinyl groups . the group denoted by ep at one of the molecular chain ends of the organopolysiloxane in the general formula ( i ) is a 2 -( 3 , 4 - epoxycyclohexyl ) ethyl group . the subscript n in the general formula ( i ) is a positive integer of 3 to 200 . when n is smaller than 3 , the grafted polysaccharide compound can hardly exhibit the advantageous properties as a silicone - grafted product while , when n is too large , the reactivity of the terminal epoxy groups with the carboxyl groups is unduly decreased not to give a practically feasible reaction rate . the epoxy - terminated organopolysiloxane compound described above as a reactant in the inventive method is obtained by the hydrosilation reaction between an organopolysiloxane terminated at one molecular chain end with a silicon - bonded hydrogen atom as represented by the general formula in which r and n each have the same meaning as defined before , and 1 - vinyl - 3 , 4 - epoxycyclohexane in the presence of a platinum catalyst . the reaction mixture in the inventive method is prepared by dissolving the above described carboxyl group - containing polysaccharide compound and the epoxy - terminated organopolysiloxane compound in an organic solvent which , naturally , must have a dissolving power to both of the two reactants in combination . suitable organic solvents can be selected from ketone solvents such as acetone and cyclohexanone , ether solvents such as dioxane and ester solvents such as ethyleneglycol monobutyl ether acetate , which can be used either singly or as a mixture of two kinds or more according to need . as is mentioned before , it is usually advantageous that the two reactants are dissolved in the organic solvent in such a proportion that the amount of the epoxy - terminated organopolysiloxane does not exceed equimolar to the carboxyl groups in the carboxyl group - containing polysaccharide compound . the concentration of the reaction mixture relative to the carboxyl group - containing polysaccharide compound should preferably be in the range from 50 to 500 g / liter though not particularly limitative thereto . the amount or concentration of the epoxy - terminated organopolysiloxane compound naturally depends on the desired degree of grafting modification of the polysaccharide compound . in step ( b ) of the inventive method , the solution of the reactants as a reaction mixture prepared in the above described manner is heated under agitation at a temperature in the range from 60 to 200 ° c . under reflux or , if necessary , under pressurization in an atmosphere of an inert gas so that the reaction between the carboxyl groups of the polysaccharide compound and the epoxy groups of the organopolysiloxane compound proceeds . the reaction is usually complete to quantitatively give the organopolysiloxane - grafted polysaccharide compound by heating the reaction mixture for several hours or for at least one hour , though dependent on the reaction temperature and other factors affecting the reaction rate . the organopolysiloxane - grafted polysaccharide compound as the product of the inventive method can be isolated from the reaction mixture after completion of the reaction as precipitates by the addition of another organic solvent having poor dissolving power to the grafted polysaccharide compound such as n - hexane followed by drying . it is , however , sometimes the case that , by virtue of the very low content of unreacted matters and absence of any catalytic compounds in the reaction mixture , the reaction mixture in the form of a solution of the product is used as such or merely after replacement of the solvent with another solvent suitable for the intended application . as is mentioned before , the most promising application of the organopolysiloxane - grafted polysaccharide compound is as an additive ingredient in a hair - care or skin - care toiletry preparation . since the degree of grafting modification of the polysaccharide compound is controllable to leave a specified amount of unreacted carboxyl groups in the starting polysaccharide compound , a hair - care treatment composition compounded with the organopolysiloxane - grafted polysaccharide compound prepared by the inventive method can be imparted with the advantages inherent in both of the organopolysiloxane and the carboxyl group - containing polysaccharide compound . for example , the hair treated with the hair - care treatment preparation is imparted with combing smoothness and non - sticky touch feeling as an inherence of an organopolysiloxane component and with good removability after treatment by using a conventional detergent or cleansing composition as an inherence of the other component . besides , the hair - care treatment preparation imparts improvements relative to water repellency , lubricity , glossiness and film formation to the hair treated therewith . needless to say , toiletry preparations compounded with the product of the inventive method are free from the problems relative to safety against human health . the organopolysiloxane - grafted polysaccharide compound obtained by the inventive method , referred to as the inventive product hereinafter , can be compounded with other base ingredients of toiletry preparations either as such or in the form of a solution in an appropriate organic solvent . most of the base ingredients of conventional toiletry preparations have compatibility with the inventive product including waxes , oiling agents , powder materials , metal soaps , gelation agents , tar dyes , surface active agents , polyhydric alcohols , polymeric compounds , water , organic solvents , antiseptic agents , ultraviolet absorbers , antioxidants and others . the toiletry preparations include a variety of preparation forms such as hair - care treatment compositions , cosmetic base preparations , makeup cosmetic compositions and others depending on the particular object of the toiletry and cosmetic preparations . the compounding amount of the inventive product in a cosmetic or toiletry preparation may widely differ depending on the form of the preparations and the particular intention of the formulation but is in the range of , usually , from 1 to 50 % by weight or , in most cases , from 3 to 30 % by weight . when the compounding amount thereof is too small , the desired effects of improvements cannot be fully obtained as a matter of course while , when the amount thereof is too large , an undue increase results in the viscosity or consistency of the toiletry preparation to cause difficulties in the compounding works and in the use of the toiletry preparations . in the following , the method of the present invention is described in more detail by way of examples , which , however , never limit the scope of the invention in any way . into a glass flask equipped with a stirrer , thermometer and reflux condenser were introduced a hydroxypropyl methyl cellulose phthalate containing 33 . 4 % by weight of carboxybenzoyl groups ( a product by shin - etsu chemical co ., hp - 55 ) in an amount of 75 g corresponding to 168 . 2 mmoles of the carboxyl groups and an epoxy - modified dimethylpolysiloxane , of which the epoxy equivalent was 2270 g / mole , expressed by the formula in which me is a methyl group and ep is a 2 -( 3 , 4 - epoxycyclohexyl ) ethyl group , in an amount of 25 g corresponding to 11 . 0 mmoles of the epoxy groups together with 400 g of cyclohexanone under agitation to give a uniform solution , which was heated and agitated at 150 ° c . for 5 hours under a stream of nitrogem gas to obtain a light yellow , slightly cloudy liquid . after cooling to 30 ° c ., this liquid was admixed under agitation with 1000 ml of n - hexane to precipitate the polymeric material which was collected by filtration and dried at 100 ° c . for 3 hours under reduced pressure to give 92 g of a light yellow powder , referred to as the product - 1 hereinafter . this powder product was subjected to infrared absorption spectrophotometric analysis to detect , besides the characteristic absorption bands assignable to the chemical bonds in the hydroxypropyl methyl cellulose phthalate , several absorption bands due to the dimethylpolysiloxane moiety having wave numbers including 1262 cm - 1 assignable to si -- me , 1071 and 1123 cm - 1 assignable to si -- o -- si and 801 cm - 1 assignable to me 2 -- si -- o . further , the product - 1 was subjected to quantitative determination of the carboxybenzoyl groups according to the assay procedure specified in japanese pharmacopoeia for hydroxypropyl methyl cellulose phthalate to find a value of 23 . 5 % indicating that the reaction of the carboxyl groups and the epoxy groups in the respective reactants was substantially quantitative . the procedure for the preparation of another dimethylpolysiloxane - grafted polysaccharide compound , referred to as the product - 2 hereinafter , was substantially the same as in example 1 excepting for the replacement of the hydroxypropyl methyl cellulose phthalate with a hydroxypropyl methyl cellulose acetate succinate , of which the content of the succinoyl groups was 15 . 6 % ( a product by shin - etsu chemical co ., as - lg ) in the same amount corresponding to a content of the carboxyl groups of 115 . 6 mmoles to obtain 93 g of a light yellow powder product . this powder product was subjected to infrared absorption spectrophotometric analysis to detect , besides the characteristic absorption bands assignable to the chemical bonds in the hydroxypropyl methyl cellulose acetate succinate , several absorption bands due to the dimethylpolysiloxane moiety having wave numbers including 1238 cm - 1 assignable to si -- me , 1057 and 1122 cm - 1 assignable to si -- o -- si and 803 cm - 1 assignable to me 2 -- si -- o . further , this product - 2 was subjected to quantitative determination of the succinoyl groups to find a value of 10 . 8 % indicating that the reaction of the carboxyl groups and the epoxy groups in the respective reactants was substantially quantitative . two mousse compositions for hair treatment were prepared according to the following formulation given in % by weight from the ingredients including the product - 1 or product - 2 prepared in example 1 and example 2 , respectively . ______________________________________ ( 1 ) product - 1 or - 2 5 . 0 % ( 2 ) liquid paraffin 5 . 0 % ( 3 ) polyoxyethylene hydrogenated castor oil 1 . 0 % ( 4 ) perfume q . s . ( 5 ) deionized water ( balance to 100 %) ( 6 ) ethanol 15 . 0 % ( 7 ) liquefied petroleum gas 8 . 0 % ______________________________________ a further mousse composition was prepared in the same formulation as above for comparative purpose excepting for the replacement of the product - 1 or product - 2 with the same amount of the ungrafted hydroxypropyl methyl cellulose phthalate ( hp - 55 , see example 1 ). these three mousse compositions were subjected to comparative organoleptic evaluation tests of hair treatment to obtain results that the mousse compositions formulated with the product - 1 and - 2 were apparently superior to the comparative composition in the testing items of absence of stickiness on the treated hail , lubricity of the hair and combing smoothness and were about equivalent to the comparative composition in respect of hair setting and removability by cleansing leading to an overall conclusion that the composition compounded with the inventive product were generally more acceptable than the comparative composition .

US-32579799-A

an injector cap including a sleeve and a blocking means , wherein the sleeve is mounted slidably on a portion of an injection device , e . g ., on an ampoule support , is forced by a pre - tensioning means into a first position in which it covers a cannula carried by the injection device , and can be slid against the pre - tensioning means into a second position in which the cannula emerges from the end of the sleeve , and wherein the blocking means non - detachably blocks the sleeve against sliding when it has been returned from the second position to the first position .

the design of an injector cap in accordance with the invention and attaching it to an ampoule support will now be illustrated first , with reference to fig1 . in the figures , the ampoule support is indicated by the reference numeral 5 . a cannula support 3 is placed at its front facing end , said cannula support in turn keeping the cannula 6 protruding towards the front both at its facing side and centrally . the cannula support 3 comprises a locking protrusion 9 , running in a circle , at the front end of its circular cylindrical section , said locking protrusion forming a heel at its end facing the ampoule support 5 , and tapering towards the other side . the components described above are those which are fixed in their positions . the cut - away sliding sleeve 1 is shown in fig1 and 2 , mounted slidably and like a cap . as with the components described herein below , this sleeve 1 is one of the movable components of the injector cap . in the initial state shown in fig1 and 2 , the injector is ready to administer an injection . to this end , the sliding sleeve 1 is situated in a first position in which its facing side exhibits its greatest distance from the ampoule support 5 . in this state , the cannula 6 is completely hidden within the sliding sleeve 1 . the sliding sleeve 1 is held in the position in which it is shown in fig1 and 2 by a spring 4 between the facing end of the cannula support 3 and inner attachment ( not shown ) at the facing end of the sliding sleeve 1 . a circular opening 7 is provided on the front facing wall of the sliding sleeve 1 , to provide the cannula 6 with a way of emerging . a locking ring , indicated at 11 , is mounted slidably in a guide on the inside of the sliding sleeve 1 . in the initial state shown in fig1 and 2 , the locking ring 11 comprises inner locking clips 8 , arranged circumferentially and forwards and converging inwards , as well , as two spacer clips 2 likewise extending forwards and further outwards . the locking ring 11 abuts the stopper 12 of the sliding sleeve 1 via its spacer clips 2 , i . e ., via its front facing edge . the stopper 12 forms the front end of the guide for the locking ring 11 , said guide being worked out of the inside of the sliding sleeve 1 over a particular length . in this area , the sliding sleeve 1 also comprises two opposing stays 10 , exposed from the surrounding material , which at their free end form a heel protruding obliquely inwards . the stays 10 can be elastically deformed in the radial direction . proceeding from the state shown in fig1 and 2 , it can be shown by way of the representations in fig3 and 4 how the injector cap in accordance with the present invention functions . if a dose of medicine is to be administered by means of the injector , then said injector is placed on the skin of a patient at the front facing side of the sliding sleeve 1 . the ampoule support 5 is then slid forwards , such that the sliding sleeve 1 slides backwards relative to the ampoule support 5 and against the force of the spring 4 , until the cannula support 3 abuts the inner attachment at its front facing end , said attachment surrounding the opening 7 and being enclosed by the spring 4 . this state is shown in fig3 . activating the device as described above does not affect the position of the locking ring 11 comprising the clips 8 and clips 2 relative to the sliding sleeve 1 , i . e ., the spacer clips 2 are still pressing against the stopper 12 . what does change , however , is the position of the locking ring 11 relative to the cannula support 3 ; the cannula support 3 is slid , together with the ampoule support 5 , forwards into the locking ring 11 , through the locking clips 8 . as they pass through the locking protrusion 9 , this first pushes the locking clips 8 outwards , somewhat elastically , and they then latch in behind the locking protrusion 9 , fixing the locking ring 11 with respect to the cannula support 3 . in this state , the cannula 6 has traveled far out of the opening 7 , and the injection can be administered . after the injection has been administered , the spring 4 causes the sliding sleeve 1 to be slid back away from the cannula support 3 , as depicted in fig4 . since , as shown in fig3 and already mentioned above , the locking ring 11 is then fixed behind the locking protrusion 9 on the cannula support 3 by the locking clips 8 , it also remains fixed when the sliding sleeve 1 is brought forward again , i . e ., the sliding sleeve 1 moves forward again without slaving the locking ring 11 . as the sliding sleeve 1 thus moves forward , the stays 10 then slide along the outer circumference of the spacer clips 2 and are briefly , elastically pressed outwards as the rear heel passes over the spacer clips 2 , before they latch back inwards beyond the front end of the spacer clips 2 with their rear facing end . after this latching back , the stays 10 are in the position shown in fig4 , i . e ., they abut the front area of the spacer clips 2 with their facing side . this locks or prevents the sliding sleeve 1 from sliding back again relative to the cannula support 3 or the ampoule support 5 . in the state depicted in fig4 , once the medicine dose has been administered once , the sliding sleeve 1 is therefore blocked against sliding further and again completely covers the cannula 6 against the environment . in this way , using the injector again is positively prevented . the possibility of injury or infection from the needle is likewise prevented . the locking and / or blocking means of an injector cap in accordance with the invention are all substantially situated in the interior of the cap or have their functional parts facing the interior , such that repeated use — which in accordance with health care standards and regulations is not supposed to happen — can only be achieved by extensively manipulating it , which would probably lead to the injector or injector cap being destroyed . in the foregoing description embodiments of the invention have been presented for the purpose of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . obvious modifications or variations are possible in light of the above teachings . the embodiment was chosen and described to provide the best illustration of the principals of the invention and its practical application , and to enable one of ordinary skill in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . all such modifications and variations are within the scope of the invention as determined by the appended claims when interpreted in accordance with the breadth they are fairly , legally , and equitably entitled .

US-201113102560-A

a selectively lockable introducer assembly is disclosed that comprises an introducer cannula and a needle guide . the introducer cannula is defined by a proximal end and a distal end and includes a lumen extending therebetween . the needle guide is defined by a body portion that includes at least one channel extending therethrough . the introducer cannula is configured to be selectively receivable within the at least one channel and the introducer cannula may be selectively lockable with respect to the needle guide such that the introducer cannula is selectively prevented from moving laterally with respect to the needle guide .

referring now to the discussion that follows and also to the drawings , illustrative approaches to the disclosed systems and methods are shown in detail . although the drawings represent some possible approaches , the drawings are not necessarily to scale and certain features may be exaggerated , removed , or partially sectioned to better illustrate and explain the present invention . further , the descriptions set forth herein are not intended to be exhaustive or otherwise limit or restrict the claims to the precise forms and configurations shown in the drawings and disclosed in the following detailed description . according to various exemplary illustrations described herein , a needle guide is provided that includes a body portion . the body portion is configurable between an uncompressed position and a compressed position . the body portion further includes at least one channel extending therethrough . at least one slot extends outwardly from the channel . the slot permits at least a portion of the body portion to compress inwardly between the uncompressed position and the compressed position . the channel includes a first diameter and a second diameter , the first diameter defined by the uncompressed position and the second diameter defined by the uncompressed position . the first diameter is greater than the second diameter . turning now to the drawings and in particular to fig1 , an exemplary compression plate 20 is shown , including a plurality of grid - like openings 22 . in the illustration of fig1 , the compression plate 20 is used with a needle guide 30 . prior to the start of a biopsy procedure , the compression plate 20 is pressed against a body area of interest . in a breast biopsy procedure , for example , the compression plate is pressed against the breast , thereby compressing the breast . an introducer 32 with a stylet is inserted into one of the openings 40 of the needle guide 30 where the lesion to be biopsied may be found . the needle guide 30 includes a series of slots 64 that allow for the needle guide 30 to compress inwardly such that the introducer 32 is unable to move inwardly and outwardly from the opening 40 when locked , as discussed in greater detail below . fig2 a is an illustration of the needle guide 30 and the introducer 32 in a first , uncompressed position . the needle guide 30 includes a body portion 44 , an outer periphery 46 , and a proximate face 60 . the needle guide also includes at least one channel 62 extending therethrough . although fig2 a - 2b illustrate the needle guide 30 including nine channels 62 , it should be noted that any number of channels 62 may be used . the series of slots 64 are located along the proximate face 60 of the needle guide 30 . the slots 64 extend outwardly from each of the channels 62 , and towards either of the outer periphery 46 or an adjacent channel 62 , depending on the placement of the slots 64 . that is , if the slot 64 is located adjacent the outer periphery 46 , then the slot 64 extends from the channel 62 to the outer periphery 46 . if the slot 64 is adjacent to another channel 62 , then the slot 64 extends from one of the channels 62 towards another channel 62 . in the illustration as shown , the slots 64 are each located along a middle section m of each of the channels 62 , however the slots 64 may be located along any point of the channels 62 . as illustrated in fig2 a , the slots 64 extend along a length l of the body portion 44 . the length l is parallel with an axis a - a of the needle guide 30 . the slots 64 permit at least a portion of the body portion 44 to compress inwardly between the uncompressed position and a compressed position , which is discussed in greater detail below . in the embodiment shown , each of the channels 62 include two generally opposing slots 64 , with one of the slots 64 located along an upper portion 54 of the channel 62 and the other slot 64 located along a bottom portion 56 of the channel 62 . although fig2 a illustrates the channels 62 having two generally opposing slots 64 along the upper portion 54 and the bottom portion 56 , the slots 64 may also be located at other positions , such as , for example , along opposing sides 58 of the channel 62 as well . in the uncompressed position , the needle guide 30 is loosely engaged with the introducer 32 . more specifically , when the needle guide 30 is in the uncompressed position , an inner surface 66 of the channel 62 is unable to closely engage with an outer diameter od of the introducer 32 . as seen in fig2 a , the channel 62 includes a first unlocked diameter d 1 . the unlocked diameter d 1 is greater than the outer diameter od of the introducer 32 . thus , when in the uncompressed position , the introducer 32 is able to freely move in a direction d towards the needle guide 30 as well as in a direction r that is away from the needle guide 30 . however , as the needle guide 30 is inserted into one of the openings 22 of the compression plate 20 , a compressive force f is exerted along the outer periphery 46 of the needle guide 30 . that is , when the compressive force f is exerted along the outer periphery 46 , the needle guide 30 is urged inwardly from the first uncompressed position ( fig2 a ) into the second compressed position ( fig2 b ). because the needle guide 30 can be selectively compressed inwardly by the compressive force f when in the uncompressed position , the needle guide 30 is unlocked . fig2 b illustrates the needle guide 30 in the compressed position , after the compressive force f has been applied . for clarity , the compression plate 20 has been omitted . the body portion 44 of the needle guide 30 is urged inwardly by the compressive force f when placed inside the opening 22 of the compression plate 20 ( not shown in fig2 b ). in the compressed position , the slots 64 are urged together . in one embodiment , the slots 64 are urged together such that the slots 64 close and the needle guide 30 is unable to compress further inwardly . the needle guide 30 is also unable to expand outwardly because the outer periphery 46 is restrained by the opening 22 of the compression plate 20 . thus , the needle guide 30 is effectively locked in the compressed position . when the needle guide 30 is in the compressed position , as in fig2 b , the channel 62 is defined by a second diameter d 2 . the second diameter d 2 is less than the first diameter d 1 . moreover , the second diameter d 2 is about equal to or slightly less then the outer diameter od of the introducer 32 . therefore , when in the compressed position , the outer diameter od of the introducer 32 is closely engaged with the inner surface 66 of the channel 62 . thus , when in the compressed position , the introducer 32 is unable to move inwardly in the direction d and outwardly in the direction r from the channel 62 . in the illustrations as shown in fig2 a - 2b , the body portion 44 includes an optional support member 68 . the support member 68 is connected to the body portion 44 at a proximate end 70 of the body portion 44 . the support member 68 includes the proximate face 60 . in one illustration as seen in fig2 c , the support member 68 includes a width w ′ that is greater than a width w of the opening 22 of the compression plate 20 . thus , when inserted into the compression plate 20 , the needle guide 30 is seated such that a back surface 80 of the support member 68 is flush with the opening 22 . the back surface 80 of the support member 68 retains the needle guide 30 within the opening 22 of the compression plate 20 such that the needle guide 30 is unable to advance further into the opening 22 , and in the direction d . including the support member 68 may also provide a grip that the user can easily hold on to when a user removes the needle guide 30 from the opening 22 . when the introducer 32 is slid into the channel 62 the needle guide 30 is in the uncompressed position . then , once the introducer 32 is positioned to the desired depth , the needle guide 30 is placed within one of the openings 22 of the compression plate 20 . as seen in fig2 a - 2b , the introducer 32 may also include a series of graduated markings 90 that indicate the depth of the introducer 32 within a breast . when placed within the opening 22 , the needle guide 30 compresses from the uncompressed position ( fig2 a ) to the compressed position ( fig2 b ). this is because the compressive force f urges the needle guide 30 to move inwardly from the uncompressed position to the compressed position . as discussed in greater detail below , the needle guide 30 may also include a snapping movement between the compressed and uncompressed configuration , therefore providing a tactile feedback to a user . the tactile feedback allows the user to know when the needle guide 30 is in the locked versus the unlocked position . in one example of the needle guide 30 , the slot 64 snaps between the uncompressed position and the compressed position . more specifically , the slot 64 only has two positions , a first open position as seen in fig2 a , and a second closed position as seen in fig2 b . thus , when the needle guide 30 is pushed into the opening 22 of the compression plate 20 , the slots 64 will snap shut with an abrupt movement . a sharp sound may also be used to indicate to a user that the needle guide 30 is in the locked position within the compression plate 20 . fig3 a - 3b are alternative embodiments of a needle guide 130 where the proximate face 160 includes a flange 172 located along at least a portion of the outer periphery 146 . the flange 172 extends outwardly from the proximate face 160 , in the direction r . the flange 172 provides a grip such that when the needle guide 130 is placed within the opening 22 of the compression plate 20 , a user will have a surface along the needle guide 130 that is easy to grasp . as best seen in fig3 b , the flange 172 protrudes from the opening 22 of the compression plate 20 . a back surface 174 of the flange 172 is in contact with the compression plate 20 , and the outer periphery 176 of the flange 172 is slightly larger than the opening 22 . therefore , when inserted within the opening 22 , the needle guide 30 is unable to travel past the back surface 174 , and the needle guide 30 is unable to advance further into the opening 22 in the direction d . the flange 172 provides a handle that a user may hold on to when the needle guide 130 is removed from the opening 22 of the compression plate 20 . in yet another alterative illustration of a needle guide 230 , as seen in fig4 a - 4b , a pair of outwardly extending arms 270 are included that extend from opposing sides of the outer periphery 246 . a pivot member p is mounted to a portion of each arm 270 . when the arms 270 are pushed by an inwards force f ′ towards the needle guide 230 and in the direction d , the pivot member p contacts a portion of the compression plate 20 and needle guide 230 is urged into the uncompressed configuration and unlocks . that is , as seen in fig4 b , when the inward force f ′ is exerted upon the arms 270 , the pivot member p cooperates with arms 270 such that needle guide 230 is pushed outwardly and away from the opening 22 of the compression plate 20 and in the direction r . thus , the arms 270 and pivot member p facilitate removal of the needle guide 230 from the opening 22 of the compression plate 20 by a user . yet another alternative illustration of a needle guide 330 is shown in fig5 a . the needle guide 330 includes a moveable ring 370 that encircles the outer periphery 346 . the ring 370 is moveable along a length l ′ that is measured from the back surface 380 of the support member 368 towards a distal end 358 of the body portion 344 of the needle guide 330 . in the illustration as shown , the ring 370 is placed behind the support member 368 . the support member 368 retains the ring 370 along the outer periphery 346 of the needle guide 330 . the ring 370 urges the needle guide 330 into the compressed configuration . more specifically , when the moveable ring 370 is advanced to the proximate face 360 of the needle guide 330 , the slots 364 are urged together , thereby compressing the needle guide 330 into the compressed and locked configuration . fig5 b illustrates a needle guide 330 inserted into an opening 22 of the compression plate 20 . the needle guide 330 is tapered inwardly , and includes a distal end outer periphery dp and a proximate end outer periphery pp . the distal end outer periphery dp is less than the proximate end outer periphery pp . the moveable ring 370 includes an inner diameter 392 that is smaller than the proximate end outer periphery pp but greater than the distal end outer periphery dp . the needle guide 330 is urged inwardly and into the compressed position when the ring 370 is advanced towards the proximate face 360 of the needle guide 330 in the direction r . that is , the inner diameter 392 of the ring 370 compresses the needle guide 330 inwardly , and urges the slots 364 together . when the ring 370 is retracted away from the proximate face 360 , and pushed in the direction d , the needle guide 330 will unlock into the uncompressed position . fig6 - 9 illustrate an arrangement of a selectively lockable introducer assembly 400 that cooperates with a needle guide 402 to maintain a desired position for introducer assembly 400 . introducer assembly 400 , best seen in fig6 and 7 , includes a generally hollow introducer cannula 404 defined by a proximal end 406 and a distal end 408 . an introducer hub 410 may be secured to proximal end 406 of introducer cannula 404 . introducer hub 410 includes an opening therethrough that is in communication with an inner lumen 411 extending through introducer cannula 404 and may also include a haemostatic valve ( not shown ). positioned on an outer portion of introducer cannula 404 is a plurality of retaining members 412 . retaining members 412 extend upwardly from an outer surface of introducer cannula 404 . in one arrangement , retaining members 412 are positioned along a substantial portion of the length of introducer cannula 404 . in another arrangement , retaining members 412 are also positioned so as to be spaced at equi - distance intervals . in another arrangement , two sets of retaining members 412 are positioned on introducer cannula 404 , with the sets being positioned 180 ° apart from one another , as seen in fig7 . retaining members 412 will be explained in further detail below . referring now to fig8 , needle guide 402 will be described . needle guide 402 includes a body portion defined by an outer periphery 414 and at least one channel 416 extending therethrough . although fig8 illustrates the needle guide 402 including nine channels 416 , it should be noted that any number of channels 416 may be used . disposed within each channel 416 is at least one retaining tang 418 positioned on an internal surface 420 of each channel 416 . retaining tangs 418 are positioned so as to extend inwardly into each channel 416 , and away from inside surface 420 of each channel 416 . in one arrangement , a plurality of retaining tangs 418 extend along the length of inside surface 420 of each channel 416 . in another arrangement , there are at least a pair of retaining tangs 418 , with each retaining tang 418 being positioned 180 ° apart from one another , as shown in fig8 . in one arrangement , retaining tangs 418 are formed so as to have a complimentary shape to retaining members 412 , to be explained below . turning now of fig9 a - 9b , the interaction between introducer cannula 404 and needle guide 402 will now be explained . once a site of interest for performing a biopsy or treatment has been determined , and needle guide 402 has been appropriately positioned with a compression plate 20 ( see fig1 ), introducer cannula 404 is inserted into a desired channel 416 . in one exemplary arrangement , to permit introducer cannula 404 to enter needle guide 402 , introducer cannula 404 is appropriately rotated such that retaining members 412 are positioned approximately 90 ° from retaining tangs 418 . in this configuration , introducer cannula 404 may freely slide within channel 416 to a desired depth . to assist with ascertaining the appropriate depth , the outer surface of introducer cannula 404 may be provided with markings or other indicia to indicate depth . after a desired depth for insertion of introducer cannula 404 has been reached , introducer cannula 404 may be selectively locked into position by rotating introducer cannula 404 within channel 416 by approximately 90 .° once rotated , retaining members 412 engage with retaining tangs 418 in a complementary manner . more specifically , retaining members 412 are rotated so as to place a retaining tang 418 between adjacent retaining members 412 . once so engaged , introducer cannula 404 is locked into position with needle guide 402 in the x , y , and z axes . such locking action prevents accidental dislodgement of introducer cannula 404 during a surgical or therapeutic procedure , including accidental sliding of introducer cannula 404 along the z axis . thus , a stable pathway to a site of interest is maintained . once a procedure is complete , introducer cannula 404 may be disengaged from needle guide 402 by simply rotating introducer cannula 404 sufficiently such that retaining members 412 become disengaged with retaining tangs 418 and introducer cannula 404 may be slid out of needle guide 402 . referring to fig1 - 12 , another arrangement of a selectively lockable introducer assembly 500 is shown . similar to the arrangement shown in fig6 - 9 , introducer assembly 500 cooperates with a needle guide 502 to maintain a desired position for introducer assembly 500 . introducer assembly 500 , best seen in fig1 , includes a generally hollow introducer cannula 504 defined by a proximal end 506 and a distal end 508 . an introducer hub 510 may be secured to the proximal end 506 of introducer cannula 504 . introducer hub 510 includes an opening therethrough that is in communication with an inner lumen extending through introducer cannula 504 . introducer hub 510 may also include a haemostatic valve ( not shown ) to minimize blood flow . positioned on an outer portion of introducer cannula 504 is at least one central groove 512 . in one arrangement , a central groove 512 extends along a substantial portion of the length of introducer cannula 504 . extending away from central groove 512 is a plurality of spaced apart engagement grooves 514 that extend radially along the outer surface of introducer cannula 504 . in one arrangement , engagement grooves 514 are spaced apart at equi - distance intervals and are arranged in pairs disposed on either side of central groove 512 , as shown in fig1 . in another arrangement , a second central groove may be formed on the outside surface of introducer cannula 504 , approximately 180 ° from the first central groove 512 . like the first central groove 512 , the second central groove also includes a plurality of engagement grooves . engagement grooves 514 will be explained in further detail below . referring now to fig1 , needle guide 502 will be described . needle guide 502 includes a body portion defined by an outer periphery 516 and at least one channel 518 extending therethrough . although fig1 illustrates the needle guide 502 as having nine channels 518 , it should be noted that any number of channels 518 may be used . disposed within each channel 518 is at least one retaining tang 520 positioned on an internal surface 522 of each channel 518 . retaining tangs 520 are positioned so as to extend inwardly into each channel 518 , and away from inside surface 522 of each channel 518 . in one arrangement , a plurality of retaining tangs 520 may be provided that extend along the length of inside surface 522 of each channel 518 . in another arrangement , there are at least a pair of retaining tangs 520 , with each retaining tang being positioned 180 ° apart from one another , as shown in fig1 . turning now to fig1 , the interaction between introducer cannula 504 and needle guide 502 will now be explained . once a site of interest for performing a biopsy or treatment has been determined , and needle guide 502 has been appropriately positioned within compression plate 20 , introducer cannula 504 is inserted into a desired channel 518 . to permit introducer cannula 504 to enter needle guide 502 , introducer cannula 504 is rotated such that central groove 512 is aligned with retaining tang 520 . retaining tang 520 is appropriately sized to enter central groove 512 such that introducer cannula 504 may freely slide within channel 518 to a desired depth . to assist with ascertaining the appropriate depth , the outer surface of introducer cannula 504 may be provided with markings or indicia to indicate the depth . after a desired depth of introducer cannula 504 has been reached , introducer cannula 504 may be locked into position by slightly rotating introducer cannula 504 . the rotation of introducer cannula 504 causes an engagement groove 514 to slide over retaining tang 520 ( shown in phantom in fig1 ). once retaining tang 520 has been captured in engagement groove 514 , introducer cannula 504 is locked into position within needle guide 502 such that introducer cannula is effectively prohibited from being displaced during a surgical or other therapeutic procedure . once a procedure is complete , introducer cannula 504 may be easily disengaged from needle guide 502 . for example , introducer cannula 504 is rotated in such a manner so as to place retaining tang 520 in central groove 512 . once in central groove 512 , introducer cannula 504 may be slid out of needle guide 502 . referring to fig1 - 15 , another arrangement of a selectively lockable introducer assembly 600 is shown . introducer assembly 600 cooperates with a needle guide 602 to maintain a desired position , in the x , y , and z axes , for introducer assembly 600 . introducer assembly 600 , best seen in fig1 , includes a generally hollow introducer cannula 604 defined by a proximal end 606 and a distal end 608 . an introducer hub 610 may be secured to proximal end 606 of introducer cannula 604 . introducer hub 610 includes an opening therethrough that is in communication with an inner lumen extending through introducer cannula 604 , and may also include a haemostatic valve ( not shown ) to control blood flow from the body . outer surface of introducer cannula 604 is threaded 612 along at least a portion of its length . in one arrangement , outer surface of introducer cannula 604 is threaded along a substantial portion of introducer cannula 604 . in one arrangement , spaced along threads 612 at predetermined intervals are depth indicators 614 , such as indicia or markings . use of depth indicators 614 will be explained in further detail below . referring now to fig1 , needle guide 602 will be described . needle guide 602 includes a body portion defined by an outer periphery 616 and at least one channel 618 extending therethrough . although fig1 illustrates the needle guide 602 including nine channels 618 , it should be noted that any number of channels 618 may be used . each channel 618 is threaded 620 ( see fig1 ) so as to cooperate with threads 612 of introducer cannula 604 ( to be explained below ). referring now of fig1 , the interaction between introducer cannula 604 and needle guide 602 will now be explained . once a site of interest for performing a biopsy or treatment has been determined , and needle guide 602 has been appropriately positioned within compression plate 20 , introducer cannula 604 is directed into a desired channel 618 . introducer cannula 604 is then rotated in a first direction into the desired channel 618 , such that threads 612 of introducer cannula 604 engage with threads 620 of channel 618 . after a desired depth of introducer cannula 604 has been reached , which may be visually indicated by depth indicators 614 , rotation of introducer cannula 604 is stopped . however , due to the interaction of threads 612 and 620 , introducer cannula 604 is effectively prevented from being displaced during a surgical or other therapeutic procedure . once a procedure is complete , introducer cannula 604 may be easily disengaged from needle guide 602 simply by rotating introducer cannula 604 in a second direction so as to disengage threads 612 and 620 from one another until introducer cannula 604 is free of needle guide 502 . while the present disclosure has been particularly shown and described with reference to the foregoing preferred embodiments , it should be understood by those skilled in the art that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure without departing from the spirit and scope of the disclosure as defined in the following claims . it is intended that the following claims define the scope of the disclosure embodiments within the scope of these claims and their equivalents be covered thereby . this description of the disclosure should be understood to include all novel and non - obvious combinations of elements described herein , and claims may be presented in this or a later application to any novel and non - obvious combination of these elements . the foregoing embodiment is illustrative , and no single feature or element is essential to all possible combinations that may be claimed in this or a later application .

US-12565508-A

a method for providing anesthesia to a subject having a wound , such as a laceration , a surgical incision , an ulcer , an abrasion or a burn , said method comprising the step of applying topically to the wound a composition comprising : at least one local anesthetic agent ; a hydrophilic or hydroalcoholic gelling agent ; an antiseptic agent ; a vasoconstrictor ; and a detectable marker such as a food dye , wherein when the composition is topically applied to the wound of the subject the presence of the anesthetic agent on the subject is indicated by the detectable marker . the method has been developed primarily for anaesthetizing open wounds of animals , particularly those caused by husbandry procedures .

the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventor of carrying out his invention . various modifications , however , will remain readily apparent to those skilled in the art , since the general principles of the present invention have been defined herein specifically to provide a means for anaesthetizing open wounds . this invention has been developed primarily for anaesthetizing open wounds of animals , particularly those caused by husbandry procedures , and will therefore be described in this context . it is to be appreciated , however , that the invention may have general use in anaesthetizing open wounds ( including lacerations , surgical incisions , abrasions , ulcers and burns ) of animals and humans alike . this example describes the preparation of a topical anesthetic composition in the form of a spray - on gel . the composition has the following formulation : the composition is prepared by combining the above ingredients to achieve the required color and consistency as required . the composition is then placed within a suitable spray - on applicator . the composition is viscous and , when applied , is in the form of a “ sticky ” gel . sorbitol functions as a thickener and a humectant and keeps the gel “ sticky ” after application . sodium metabisulfite prevents oxidation of the adrenalin . cetrimide is an antiseptic as well as a surfactant and humectant . hydroxy cellulose functions as a thickener . the hydroxy cellulose and sorbitol are primarily responsible for the gelatinous nature of the composition . although typically the composition will comprise about 5 mg / ml hydroxy cellulose in combination with about 100 mg / ml non - crystallizing liquid sorbitol ( 70 %), the composition can comprise anywhere from about 1 to 20 g per liter of at least one type of gum or cellulosic preparation . typically , the composition will comprise a polyhydric alcohol in combination with a cellulosic preparation . if desired , the composition can further comprise an anti - inflammatory agent ( e . g . isoflupredone acetate ), and / or an insecticide / insect repellent such as diazinon , cyromazine or spinosad ( at about 1 mg / ml ), and / or a skin penetrating enhancer , and / or a bittering agent . this example describes the preparation of another topical anesthetic composition in the form of a spray - on gel and potentially having a longer duration of action than the composition of example 1 . the composition has the following formulation : the composition is prepared by combining the above ingredients to achieve the required color and consistency as required . the composition is then placed within a suitable spray - on applicator . again , the composition is in the form of a “ sticky ” gel . if desired , the composition can further comprise an anti - inflammatory agent , and / or an insecticide / insect repellent , and / or a skin penetrating enhancer , and / or a bittering agent . this example describes the preparation of another topical anesthetic composition in the form of a spray - on crème . the composition has the following formulation : the composition is prepared by combining the above ingredients to achieve the required color and consistency as required . the composition is then placed within a suitable spray - on applicator . the composition is in the form of a “ sticky ” crème . if desired , the composition can further comprise an anti - inflammatory agent , and / or an insecticide / insect repellent , and / or a skin penetrating enhancer , and / or a bittering agent . this example describes the preparation of another topical anesthetic composition in the form of a spray - on gel having a gum base . the composition has the following formulation : the composition is prepared by combining the above ingredients to achieve the required color and consistency as required . the composition is then placed within a suitable spray - on applicator . the composition is in the form of a “ sticky ” gel . if desired , the composition can further comprise an anti - inflammatory agent , and / or an insecticide / insect repellent , and / or a skin penetrating enhancer , and / or a bittering agent . this example describes the preparation of another topical anesthetic composition in the form of a spray - on gel having a polyacrylic acid base . the composition has the following formulation : the composition is prepared by combining the above ingredients to achieve the required color and consistency as required . the composition is then placed within a suitable spray - on applicator . the composition is in the form of a “ sticky ” gel . if desired , the composition can further comprise an anti - inflammatory agent , and / or an insecticide / insect repellent , and / or a skin penetrating enhancer , and / or a bittering agent . formulation of a topical anesthetic gel having an insecticide and a skin penetrating enhancer this example describes the preparation of another topical anesthetic composition in the form of a spray - on gel having an insecticide ( spinosad ) as well as a skin penetrating enhancer ( propylene glycol ). the composition has the following formulation : the composition is prepared by combining the above ingredients to achieve the required color and consistency as required . the composition is then placed within a suitable spray - on applicator . the composition is in the form of a “ sticky ” gel . if desired , the composition can further comprise an anti - inflammatory agent and / or a bittering agent . this example describes the use of the composition of example 1 or example 2 in mulesing . it is to be appreciated that the compositions as described in the other examples could equally be used in a mulesing procedure . if necessary , the breech area of the sheep is crutched of wool . mulesing is then performed . this involves removing strips of skin from either side of the perineum and from the dorsal surface of the tail . the tail may be docked at the same time . the composition is then immediately applied to the surgical wound as a colored gel by a metered dose spray - on pump pack or trigger spray bottle . about 5 - 15 mls of the composition is applied , depending on the size of the wound and the animal . the lignocaine / bupivacaine / adrenaline combination in a sustained release gel base provides rapid as well as prolonged pain relief for a period of at least 8 hours . the dye indicates the area of the sheep that has been anaesthetized . the antiseptic cetrimide helps minimize contamination of the wound with bacteria . the insecticide , if present , can repel insects such as blowflies and prevent flystrike . the gel remains as a “ sticky ” coat on the wound protecting it and maximizing extended delivery of the active ingredients to the wound . moreover , preliminary experiments on lambs undergoing mulesing indicate that the fact that the gel coats the wound ( i . e . nerve endings ), numbing of pain occurs after about 4 hours independently of the anesthetic agent / s ; this therefore contributes to and enhances the anesthetic effect of the formulation . if the composition contains an insecticide ( e . g . the composition as described in example 6 ), then it can be further applied onto the woolen skin surrounding the wound / cut skin edges for a distance of about 2 - 10 cm . this example describes the use of the composition of any one of examples 1 - 6 , but preferably example 6 , for animal castration . the animal should be held firmly and securely in a cradle or restraint designed for routine surgical castration . an incision is made in the scrotal sac and the testes and chordal tissue exposed as per routine surgical castration . the composition is then sprayed onto the chordal tissue so as to fully coat it , particularly at the site of intended incision and along the length of chordal tissue that will remain and retract into the scrotal sac after the testes are excised . depending on the size of the animal , approximately 0 . 5 - 2 mls of spray - on composition is used . the testes are then excised by cutting through the chordal tissue at the level where the composition has been applied , using routine surgical castration technique . the empty scrotal sac and edges of the skin incision are then sprayed with an additional dose of the composition so as to fill the sac and coat the cut skin edges . depending on the size of the animal , approximately 1 - 4 mls of spray - on composition is used . use of a topical anesthetic composition for shearing cuts , skin lacerations and superficial burns this example describes the use of the composition of any one of examples 1 - 6 for shearing cuts , skin lacerations and superficial burns . where a significant skin laceration or superficial ( 1st or second degree ) burn occurs , such as during shearing or branding , the composition may be sprayed directly onto the wound so as to coat the wound and cover the cut skin edges . the spray is applied by metered dose . the volume applied will vary depending on the size of the wound and animal . for instance , a total dose of 50 mg / kg of lignocaine should not be exceeded for sheep . this example describes the use of the composition of any one of examples 1 - 6 for dehorning . where dehorning of animals is carried out leaving a raw , bleeding bed of tissue , the composition may be applied directly to the raw tissue bed immediately following dehorning either by metered spray , or by metered squeeze application of the composition in a thick gel , creme or paste so as to cover the entire exposed tissue bed and remain in contact with it . estimated volumes required are 1 - 3 mls per dehorned tissue bed depending on the size of the wound . the total dose applied should not exceed safety limits of mg / kg lignocaine ( topically applied ) for the animal species involved . this example describes the use of a topical anesthetic composition containing an insecticide , such as the composition described in example 6 , for treating wounds resulting from flystrike . flystrike wounds are very painful for sheep . current practices involve cutting away all wool in the flystruck area and then spraying or applying an insecticide to kill the maggots and eggs . pain is not addressed . a combination agent of a maggot killing insecticide plus an anesthetic agent , such as the composition described in example 6 , may be applied to kill maggots and relieve pain and aid in wound healing . the method entails cutting wool away from an affected area and scraping maggots off as per routine flystrike management . the composition is sprayed by metered dose to cover the affected area . the volume applied will vary depending on the size of the wound and animal . for instance , a total dose of 50 mg / kg of lignocaine should not be exceeded for sheep . in cases of large flystrike wounds where it is anticipated that an excessive volume of the composition is required to cover the wound ( e . g . & gt ; 1 ml / kg / sheep ), a lower concentration composition should be used containing , for example , 1 or 2 % lignocaine with insecticide . this example describes various compositions for use in chemical mulesing or branding . each composition for use in chemical mulesing or branding includes a wounding agent , such as a cationic quaternary ammonium compound , in combination with one or more anesthetic agents as described in the above examples . this mixture is then admixed with , say , the composition of example 1 or 2 . this mixture is then admixed with , say , the composition of example 1 or 2 . this mixture is then admixed with , say , the composition of example 1 or 2 . each chemical mulesing / branding composition is prepared by combining the above ingredients to achieve the required color and consistency as required . the composition is then applied against the skin with a squeeze - on applicator which is combed through the wool or fur over the intended wound area . the composition is viscous and , when applied , is in the form of a “ sticky ” base . the ammonium compound , where applied , creates a wound , and shortly thereafter the wound is anaesthetized as described in example 7 . if desired , the composition can further comprise an insecticide / insect repellent such as cyromazine or spinosad ( at about 1 mg / ml ) and / or a skin penetrating enhancer . advantages of the present invention as exemplified include that the composition can be used to reduce or minimize pain in a large variety of animal husbandry procedures in which anesthetic agents are not currently used by virtue of being too impractical , dangerous , complex or costly . some of the exemplified anesthetic compositions can also be used on human wounds for effective pain relief . advantages to the animal : any reduction in pain is likely to be of significant advantage to the animal . there is minimal risk of toxicity to the animal using this approach . the composition can be conveniently and safely applied to animals without the added pain and risk of injury associated with invasive methods of anesthetic delivery , and without increasing animal stress due to prolonged handling times . preliminary studies in lambs have demonstrated a significant reduction in pain related behavior and a marked improvement in feeding and prevention of weight loss in treated lambs undergoing surgical mulesing . advantages to the handler : the composition provides a simple , practical and convenient method for reducing pain that their animals may experience . this is of advantage to the handler for moral and ethical reasons and because reducing animal pain can result in improved growth , handling and health outcomes for animals . the composition has advantages over invasive methods of anesthetic delivery because it can be quickly and easily administered to a large numbers of animals , even in remote locations with minimal additional cost and / or animal handling times . simplicity of application , low risk of toxicity and ready visualization of the adequate wound covering is advantageous to the handler as successful application of the anesthetic can be readily achieved and monitored without risk of needle stick injury , without compromising animal breathing , mobility and / or recovery , and without the need for a veterinarian to administer the composition . other advantages of the present invention may be found in the applicants &# 39 ; co - pending pct application entitled “ a topical analgesic composition ”, the entire contents of which are hereby incorporated by way of reference . throughout this specification , unless in the context of usage an alternative interpretation is required , the term “ comprise ” ( and variants thereof such as “ comprising ” and “ comprised ”) denotes the inclusion of a stated integer or integers but does not exclude the presence of another integer or other integers . any reference to publications cited in this specification is not an admission that the disclosures constitute common general knowledge in australia or in other countries . it will be appreciated by one of skill in the art that many changes can be made to the composition and uses exemplified above without departing from the broad ambit and scope of the invention . the following claims are thus to be understood to include what is specifically illustrated and described above , what is conceptually equivalent , what can be obviously substituted and also what essentially incorporates the essential idea of the invention . those skilled in the art will appreciate that various adaptations and modifications of the just - described preferred embodiment can be configured without departing from the scope of the invention . the illustrated embodiment has been set forth only for the purposes of example and that should not be taken as limiting the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than as specifically described herein .

US-85617107-A

an organic cotton electronic cigarette includes a liquid storage component and an atomization device . the atomization device includes a hollow spiral tubular electric heater coil and a liquid guiding member passing through the electric heater coil . the liquid guiding member is made from organic cotton free of glass fiber material . the atomization device further includes a smoke guiding tube passing through the liquid storage component for supporting the same and working as a smoke path . the smoke guiding tube includes an external casing and an internal casing one of which is inserted into another one so as to hold the liquid guiding member between the two . the two ends of liquid guiding member extend out of the smoke guiding tube and are tightly pressed against an inner wall of the liquid storage component . this kind of electronic cigarette is safe to human body and has stable internal construction .

it is noted that , in case no interference is resulted in , the embodiments and features contained therein may be combined with each other . the present invention is described in greater detail in conjunction with the accompanying drawings and embodiments . as shown in fig1 - 7 , the present invention provides an organic cotton electronic cigarette 100 . the electronic cigarette 100 is an integral electronic cigarette , and includes a cylindrical outer sleeve 1 in which a liquid storage component 37 for storage of cigar liquid , an atomization device 2 for changing cigar liquid contained in the liquid storage component 37 into smoke , and a power supply device 8 for offering power to the atomization device 2 . the two ends of the outer sleeve 1 are provided with a nozzle case 41 and a base cover 42 respectively used as the closure of the outer sleeve 1 . both of the nozzle case 41 and base cover 42 are provided with an intake hole . the electronic cigarette 100 further includes a smoke guiding tube acting as a path for conducting smoke generated by atomization of cigar liquid out of the outer sleeve 1 . the smoke guiding tube may be constructed of non - glass fiber material such as silica gel , plastic , ceramic or metal material . in this embodiment , the smoke guiding tube is composed of an internal casing 241 and a main guiding tube 35 which will be described hereinafter . as shown in fig2 and 3 , the atomization device 2 includes an atomizer 21 , an atomizer base 24 for supporting the atomizer 21 , an atomizer control circuit board 22 , and a circuit board holding base 23 for receiving and holding the atomizer control circuit board 22 . a miniature pneumatic switch is disposed on the atomizer control circuit board 22 for controlling start of the circuit in order that the atomizer 21 will operate . the atomizer 21 is intended for converting cigar liquid into smoke , and includes an electric heater coil 211 , a liquid guiding member 212 for absorbing cigar liquid and supporting the electric heater coil 211 , and an electric wire 213 . the electric heater coil 211 is enwound on the liquid guiding member 212 . the liquid guiding member 212 is able to absorb and store cigar liquid . the liquid guiding member 212 is made of non - glass fiber and may be made of material capable of absorbing and storing liquid for example cotton material including pure cotton , paper , chemical fiber or twine . or , the member 212 may be made of from combination of two or more of above material . in this embodiment , the liquid guiding member 212 is placed and held into the smoke guiding tube . the two ends of the electric heater coil 211 are respectively coupled with a corresponding electric wire 213 . the electric wire 213 passes across the atomization base 24 and then is electrically connected with the positive and negative electrodes of the power supply device 8 . as shown in fig4 and 5 , the atomization base 24 includes an atomization base body 240 engaged with the inner wall of the outer sleeve 1 , and a tubular internal casing 241 axially outwardly extended from the base body 240 . an axially extended first atomization base through hole 242 is defined in the middle portion of the atomization base body 240 . an axially extended second atomization base through hole 243 communicating with the first atomization base hole 242 is defined in the internal casing 241 . one end of the internal casing 241 far away from the atomization base body 240 is provided with a first the holding 244 . the first holding groove 244 is an opened groove radially passing through the side wall of the internal casing 24 and having a notch formed in an end portion of the internal casing 24 for transversely securing the liquid guiding member 212 and in addition for helping the liquid guiding member 212 be extended out of the internal casing 241 so that the member 212 will contact the liquid storage component 37 for absorbing cigar liquid . two wire guiding holes 245 axially extended for passing through the electric heater coil 211 are provided on the atomization base body 240 at a location adjacent an outer side of the internal casing 241 . an expansion ring 246 to be pressed against and engage the absorption sleeve 1 is disposed on the outer wall of the atomization base body 240 . the atomization base 24 is pressed against and held on the inner wall of the outer sleeve 1 by its outer side wall . it is made of plastic or metal for ensuring strength and no glass fiber floccules will be generated . as shown in fig6 and 7 , the main guiding tube 35 includes a supporting tube 351 and an external casing 352 which communicate with each other . the supporting tube 351 and external casing 352 are integrally formed or constructed separately . both of the supporting tube 351 and external casing 352 are provided with a through hole , and these through holes communicate each other thus forming a venting hole 353 of the main guiding tube 35 . the external casing 352 is provided with a second holding groove 354 engaged with the first holding groove 244 of the internal casing 241 . the second holding groove 354 is an opened groove radially outwardly extended through the side wall of the external casing 352 and having a notch defined in an end portion of the external casing 352 . the liquid guiding member 212 held in the first holding groove 244 passes through the second holding groove 354 and is pressed against the liquid storage component 37 so as to absorb cigar liquid to be atomized by the electric heater coil 211 . as shown in fig2 and 3 , the liquid storage component 37 is intended for absorbing and storing cigar liquid to be further atomized by the atomizer 2 . the liquid storage component 37 has the ability of absorbing and storing cigar liquid , and may be made from material with the ability of absorbing and storing liquid for example cotton material . the liquid storage component is of a hollow cylindrical construction , is sleeved on the outside of the main guiding tube 35 , and is pressed against and supported by the outer wall of the main guiding tube 35 . the two ends of the liquid storage component 37 are inserted into a circular cavity of the atomization base 24 and that of the nozzle case 41 respectively . the side wall of the liquid storage component 37 is pressed against the liquid guiding member 212 . cigar liquid soaks from the liquid storage component 37 into the liquid guiding member 212 , is absorbed , and evaporated by the electric heater coil 211 to generate smoke . as shown in fig2 and 3 , the electronic cigarette 100 further includes a permeating component 38 capable of absorbing and storing cigar liquid , and may be constructed of non glass fiber material with the ability of absorbing and storing liquid for example organic cotton material . the organic cotton material may be pure cotton , hard paper , chemical fiber containing mainly organic material , or twine . the permeating component 38 may be made from any one of above material . or , it may be made from the combination of any two or more of the above material . the permeating component 38 is located between the liquid storage component 37 and the main guiding tube 35 . the outer wall and inner wall of the permeating component 38 are pressed against the inner wall of the liquid storage component 37 and outer wall of the external casing 352 of the main guiding tube 35 respectively . the permeating component 38 is sleeved on the outside of the smoke guiding tube or , it may be enwound on the outer side of the smoke guiding tube such that the inner wall of the permeating component 38 is pressed against the two ends of the liquid guiding member 212 in order that the liquid guiding member 212 absorbs the cigar liquid soaking from the liquid storage component 37 into the permeating component 38 . the liquid absorption ability of the permeating component 38 may be slightly great than the liquid storage component 37 so that the cigar liquid will soak and be transported to the liquid guiding member 212 from the liquid storage component 37 more rapidly . as shown in fig3 , in present embodiment , the nozzle case 41 , atomization base 24 , main guiding tube 35 , liquid storage component 37 , and part of the side wall of the outer sleeve 1 of the electronic cigarette collectively define a space for storage of cigar liquid which functions as a cigar liquid cup of a traditional electronic cigarette . here , the atomization base 24 and nozzle case 41 face and are distant from each other and are held on the inner wall of the outer sleeve 1 to define space range of the cigar liquid cup 3 for storage of cigar liquid . the main guiding tube 35 is located between the atomization base 24 and a nozzle case 41 . the liquid storage component 37 is disposed between the main guiding tube 35 and outer sleeve 1 . as shown in fig2 and 3 , the electronic cigarette 100 further includes a liquid isolating base 39 for preventing leakage of cigar liquid . the liquid isolating base 39 is disposed on the inner wall of the outer sleeve 1 , and in addition , it is disposed between the atomization base 24 and power supply device 8 for preventing leakage of cigar liquid from the atomization base 24 into the power supply device 8 . a wire guiding hole ( not shown ) is defined in the bottom wall of the liquid isolating base 39 . in assembling , the liquid guiding member 212 with an electric heater coil 211 installed and enwound thereon is transversely mounted in the first holding groove 244 of the internal casing 241 of the atomization base 24 . after that , the internal casing 241 of the atomization base 24 is inserted into the external casing 352 of the main guiding tube 35 ensuring that the liquid guiding member 212 is supported into the first holding groove 244 of the internal casing 241 and two ends thereof extend out of the second holding groove 354 of the main guiding tube 35 and are pressed against the permeating component 38 . the two ends of the electric heater coil 211 are connected to the electric wires 213 . each of the electric wires 213 passes through the wire guiding hole 245 of the atomization base 24 and the wire guiding hole of the liquid isolating base 39 and then are connected to the atomizer control circuit board 22 . the interface between the electric wires 213 and corresponding guiding holes is sealed . though various embodiments of the invention have been illustrated above , a person of ordinary skill in the art will understand that , variations and improvements made upon the illustrative embodiments fall within the scope of the invention , and the scope of the invention is only limited by the accompanying claims and their equivalents .

US-201313994710-A

a medical probe device including a catheter having a stylet guide housing with one or more stylet ports in a side wall thereof and guide means for directing a flexible stylet outward through the stylet port and through intervening tissue to a target tissue . the catheter assembly includes a stylet guide lumen communicating with the stylet port and a stylet positioned in said stylet guide lumen for longitudinal movement from the port through intervening tissue to a target tissue . the stylet can be an electrical conductor enclosed within a non - conductive layer , the electrical conductor being a radio frequency electrode . in normal action , the stylet and its surrounding sleeve are deployed out from the stylet port in the catheter into the desired target tissue . a sharpened tip on the stylet electrode facilitates the penetration of the intervening tissue , such as a urethra . if , however , the stylet is deployed into a dense or fibrous area of tissue or into an area of scar tissue in the urethra , the sharpened tip of the stylet might not immediately penetrate the urethra wall until sufficient pressure is applied to the stylet . by heating the stylet prior to extension of the stylet from the stylet port in the catheter , the passage of the stylet through the intervening tissue is facilitated . once the stylet is in position in the target tissue , the normal operation of the stylet in emitting electromagnetic current for tissue ablation is commenced .

the device of this invention provides a precise controlled positioning of a treatment stylet in a tissue targeted for treatment , destruction or sampling from a catheter positioned in the vicinity of the target tissue . the term &# 34 ; stylet &# 34 ; as used herein is defined to include both solid and hollow probes which are desired to be passed from a catheter port through normal tissue to targeted tissues . the stylet is shaped to facilitate easy passage through tissue . it can be a solid wire , thin rod , or other solid shape or it can be a thin hollow tube or other shape having a longitudinal lumen for introducing fluids to or removing materials from a site . the stylet can also be a thin hollow tube or other hollow shape , the hollow lumen thereof containing a reinforcing or functional rod or tube such as a laser fiber optic . the stylet preferably has a sharpened end to reduce resistance and trauma when it is pushed through tissue to a target site . the stylet can be designed to provide a variety of medically desired treatments of a selected tissue . as a radio frequency electrode or microwave antenna , it can be used to ablate or destroy targeted tissues . as a hollow tube , it can be used to deliver a treatment fluid such as a liquid to targeted tissues . the liquid can be a simple solution or a suspension of solids , for example , colloidal particles , in a liquid . since the stylet is very thin , it can be directed from the catheter through intervening normal tissue with a minimum of trauma to the normal tissue . the device and method of this invention provide a more precise , controlled medical treatment which is suitable for destroying cells of medically targeted tissues throughout the body , both within and external to body organs . the device and method are particularly useful for treating benign prostate hyperplasia ( bph ), and the device and its use are hereinafter described with respect to bph , for purposes of simplifying the description thereof . it will be readily apparent to a person skilled in the art that the device and method can be used to destroy body tissues in any body cavities or tissue locations that are accessible by percutaneous or endoscopic catheters , and is not limited to the prostate . application of the device and method in all of these organs and tissues are intended to be included within the scope of this invention . bph is a condition which arises from the replication and growth of cells in the prostate and the decrease of cell death rate , forming glandular and stromal nodules which expand the prostate and constrict the opening of the prostatic urethra . glandular nodules are primarily concentrated within the transition zone , and stromal nodules within the periurethral region . traditional treatments of this condition have included surgical removal of the entire prostate gland , digital removal of the adenoma , as well as transurethral resection of the urethral canal and prostate to remove tissue and widen the passageway . one significant and serious complication associated with these procedures is iatrogenic sterility . more recently , laser treatment has been employed to remove tissue , limiting bleeding and loss of body fluids . balloons have also been expanded within the urethra to enlarge its diameter , with and without heat , but have been found to have significant limitations . microwave therapy has been utilized with some success by positioning a microwave antenna within the prostatic urethra and generating heat in the tissue surrounding the urethra with an electromagnetic field . coolants are sometimes applied within the catheter shaft to reduce the temperature of the urethral wall . this necessitates complicated mechanisms to provide both cooling of the immediately adjacent tissues while generating heat in the more distant prostatic tissue . this technique is similar to microwave hyperthermia . similarly , radio frequency tissue ablation with electrodes positioned within the urethra exposes the urethral wall to destructive temperatures . to avoid this , low temperature settings required to protect the urethra must be so low that the treatment time required to produce any useful effect is unduly extended , e . g . up to three hours of energy application . one embodiment of the device of this invention uses the urethra to access the prostate and positions rf electrode stylets directly into the tissues to be destroyed . the portion of the stylet conductor extending from the urethra and into targeted tissues is usually enclosed within a longitudinally adjustable sleeve shield which prevents exposure of the tissue adjacent to the sleeve to the rf current . the sleeve movement is also used to control the amount of energy per unit surface area which is delivered by controlling the amount of electrode exposed . however , in this invention where there is anticipated a more dense intervening tissue obstruction or there is viewed a distending of the intervening tissue without penetration of the intervening tissue by a sharpened stylet , the insulating sleeve can be retracted prior to penetration through the intervening tissue , such as a urethra . then the exposed electrode can by applied with a short duration of rf current sufficient to cause heating of the electrode and destruction of the tissue as the stylet electrode is introduced into the intervening tissue . other aspects of the invention will become apparent from the drawings and accompanying descriptions of the device and method of this invention . it will be readily apparent to a person skilled in the art that this procedure can be used in many areas of the body for percutaneous approaches and approaches through body orifices . fig1 is an isometric view of an rf ablation catheter embodiment of this invention with a fiber optic viewing accessory . the flexible catheter 2 , attached to handle 4 , has a terminal stylet guide 6 with two stylets 8 . the handle has stylet sleeve tabs 10 and 11 and electrode tabs 12 and 13 as will be described in greater detail hereinafter . the handle 4 is also connected to a optical viewing assembly 14 and rf power connector 16 , transponder connector 18 and thermocouple connectors 20 . the portions of the catheter 2 leading from the handle 4 to the stylet guide tip 6 can optionally have a graduated stiffness . for example , the catheter can be designed to be more stiff near the handle and more flexible near the tip , or any other stiffness profiles . the catheter can be constructed of an inner slotted stainless steel tube with outer flexible sleeve such as is described in copending application ser . no . 790 , 648 filed aug . 11 , 1991 ( corresponding to published australian patent application ser . no . 9210858 ), the entire contents of which are incorporated herein by reference . it can also be made of coiled or braided wire to which an outer sleeve is bonded . the fiber optic viewing assembly in this embodiment includes a lens focusing assembly 22 , a lens viewing assembly support connector 24 assembly attached to a male quick disconnect connector 26 by flexible tubing 28 . fig2 is a cross - sectional view of a catheter of fig1 showing details of the stylet guide housing . the stylet guide housing 6 has a curved passageway 28 through which the stylet 8 is extended into the tissue to be treated . further details of these components are described in copending applications ser . no . 08 / 01 2 , 370 filed feb . 2 , 1993 , and application ser . no . 08 / 062 , 647 filed may 13 , 1993 . fig3 is a side view of the stylet and lumen assembly of this invention . the key components of the stylet of this embodiment are an insulating sleeve 30 and an electrode 32 extending therethrough . the electrode 32 has a sharpened tip , in this embodiment a broadened spear tip . the proximal end of the electrode and sleeve are connected by respective sleeve connector 334 and electrode connector 336 to handle sleeve and electrode slides described in greater detail hereinafter with respect to fig1 and 13 . an electrode support tube 36 extends from the electrode connector 336 to the area 38 of the sleeve connector 334 to transmit compressive pressure without collapsing the electrode 32 . an insulating sleeve support tube 40 made of shrink tubing extends from the sleeve connector 334 to the beginning or proximal end 42 of the outer tubing 44 . tubing 44 joins the support tubing to the control tube 46 . the control tube 46 supporting both the electrode and insulating sleeve extends to the junction 48 ( see fig4 ) of the electrode lumen passageway 50 and the electrode 32 . in this manner , support is provided over the length of the stylet extending from the handle to the trilumen tip , preventing collapse or loss of linearity of the highly flexible electrode when it is pushed through the stylet guide housing . fig4 is a cross - sectional side view of the of the junction of the stylet and control tube assembly taken along the central axis of the tubing , and fig5 is a cross - sectional view of the junction of the stylet and control tube assembly taken along the line b -- b of fig4 . at the junction 48 , the electrode 32 extends through the upper electrode lumen wall 62 and enters the electrode lumen 50 . the outer tubing 52 encloses and supports both the distal ends of the control tubing 46 and trilumen sleeve tube 54 . referring to fig5 the space 56 between the control tube 46 and the trilumen 56 can be filled with adhesive to secure them together . the trilumen includes an electrode lumen 50 , a temperature sensor lumen 58 and a fluid supply lumen 60 for supply of optional fluids such as antibiotics or anesthetics to the area of treatment . fig6 is a cross - sectional view of a trilumen stylet of this invention taken along the line a -- a in fig3 . the trilumen sleeve 30 is an insulating sleeve for the electrode 32 and includes the additional temperature sensor lumen 58 and liquid supply lumen 60 . the inner surface of the electrode lumina can be spaced from the outer surface of the electrode by a distance &# 34 ; h &# 34 ; which can be , for example , from about 1 to 3 mm to define an additional liquid supply conduit with an approximate annular cross - section . fig7 is a cross - sectional side view of the trilumen stylet tip shown in fig6 taken along the line c -- c . the terminal end of the temperature sensor lumen 58 is sealed to protect the electrical components . thermocouple 64 is placed at the distal end of the sleeve 30 to monitor the temperature of the tissue surrounding the electrode 32 and is preferably less than about 1 mm from the exposed electrode . thermocouple 66 is placed at least 3 mm and preferably from about 3 to 6 mm from the tip of sleeve 30 to monitor the temperature of the duct wall ( such as the urethra ) through which the stylet is extended . this is provided to insure the duct wall temperature does not reach destructive levels when the rf treatment of tissue surrounding the extended electrode is underway . fig8 is a plane view of the annular groove embodiment of the current density focusing electrode of this invention . in this embodiment , the electrode is ground to a single current focusing sharp tip 68 without secondary corner or other sharp edges which could also focus or crowd current . additional current focusing can be provided along the electrode surface by the annular grooves 70 and 72 . the temperature of the tissue surrounding the electrode initially increase in initial zones 74 , 76 and 78 . the elevated temperature zone then extends to two intermediate zones 80 and 82 , as the zones from the grooves merge . thereafter all of the elevated temperature zones merge to form the single oval zone lesion 84 . use of these current focusing grooves 70 and 72 produces a more symmetrical lesion . fig9 is a plane view of the spiral groove embodiment of the current density focusing electrode of this invention . in this embodiment , the electrode is also ground to a single current focusing sharp tip 86 without secondary sharp corners or edges which could also focus or crowd current . additional current focusing can be provided along the electrode surface by at least one spiral or helical groove 88 . the temperature of the tissue surrounding the electrode initially increase in the initial tip zone 90 and a spiral zone 92 . the elevated temperature zone then extends to two intermediate zones 94 and 96 , as the spiral zone 92 merges to form a single zone 96 . thereafter , all of the elevated temperature zones merge to form the single oval zone lesion 98 . use of the spiral focusing groove 88 provides a more symmetrical lesion . fig1 is an exploded view of the rf ablation catheter assembly shown in fig1 . the upper handle plate 276 has two central slots 278 and 280 through which the electrode control slides 10 are attached to respective left electrode slide block 282 and right electrode slide block 284 . sleeve control slides 12 are attached through outer slots 286 and 288 to respective left sleeve slide block 290 and right sleeve slide block 292 . fiber optic receptor housing 30 is mounted on the proximal surface of the upper handle plate 276 . the electrical receptor 294 is received in respective cavities 296 and 298 in the upper handle plate 276 and lower handle plate 300 attached thereto . the lower handle plate 300 has a central cavity 302 which accommodates the electrode and sleeve slide blocks and associated elements . microswitch activator blocks 304 ( only left sleeve block shown ) are connected to the sleeve slide blocks 290 and 292 . they are positioned to actuate the microswitches 306 when the respective sleeve block ( and sleeve attached thereto ) have been advanced . the microswitches 306 hold the respective rf power circuits open until the respective sleeves are advanced to a position beyond the urethra wall and into the prostate to prevent direct exposure of the urethra to the energized rf electrodes . extension of the sleeve 5 mm beyond the guide is usually sufficient to protect the urethra . the tension - torque tube assembly 308 is mounted in the distal end of the housing in the receptor 310 . fig1 is an isometric view of the adjuster block and tension tube assembly 308 of the rf ablation catheter shown in fig1 . the torque tube 312 extends from the torque coupler 314 through the twist control knob 316 to the stylet guide 6 . bending flexure of the torque tube 312 during use lengthens the path from the handle to the guide tip 6 . to prevent a resulting retraction of the stylet sleeve and electrode components when the torque tube 312 is flexed , a tension tube 318 having a fixed length and diameter smaller than the inner diameter of the torque tube 312 is provided . the distal end of the tension tube 318 is securely attached to the stylet guide 6 , and the proximal end 320 is secured to the adjuster block 322 , for example , by an adhesive . the axial position of the adjuster block 322 can be adjusted to insure the stylets are initially positioned just inside the outlet ports in the stylet guide 6 . torque coupler 31 4 is mounted on the coupler block 324 . twist control knob stop pin 326 extends into a groove ( not shown ) and limits rotation of the control knob 316 . fig1 is a detailed view &# 34 ; a &# 34 ; of the distal end tension tube connections of the tension tube shown in fig1 . the tension tube 318 is securely connected to the proximal end 328 of the stylet guide 6 , for example by a length of shrink tubing 330 . fig1 is an exploded view of the sleeve and electrode slide block assembly of the embodiment shown in fig1 . the right sleeve slide block 292 has a projection 332 which extends inward under the right electrode slide block 284 . right sleeve connector 334 is mounted to the inner end of the projection 332 , secured to the end of the proximal end of the sleeve 336 . right electrode connector 338 is attached to an inner surface of the electrode slide block 284 and is secured to the proximal end of electrode 340 . the right sleeve and electrode slide blocks 292 and 284 are slidingly attached to the right friction adjustment rail 342 by screws ( not shown ) through slots 344 and 346 , the screws being adjustable to provide sufficient friction between the blocks and the rail 342 to provide secure control over the stylet movement . the left sleeve slide block 290 and left electrode slide block 282 are mirror replicas of the right blocks and are similarly mounted on the left friction rail 344 . the left sleeve and electrodes are not shown . when the operating surgeon desires to deploy the electrodes 8 in fig1 into the target tissue and the surgeon detects an obstruction in the advancement of the stylet electrode and its surrounding insulating sleeve , he or she can decide to first withdraw or retract the insulating sleeve by use of the associated slider block handle . the rf current can then be increased momentarily to the stylet electrode to heat it to a point that makes the contiguous tissue more plastic and pliable . then the stylet can be deployed into the intervening tissue , such as a urethra . the heated stylet will pass through the urethra wall as the intervening tissue is warmed and becomes more pliable . then , when the stylet is fully deployed into the target tissue , the applied rf current can be immediately reduced to a level to cause ablation of the target tissue . the desired effect is to raise the temperature of the affected tissue to 45 ° c . or more to cause internal lesions which will eventually be absorbed by the body and reduce the prostatic pressure on the urethra . safeguards could be designed into the system to assure that the high initial rf current only lasts long enough to allow the dense or fibrous intervening tissue to be softened by the stylet electrode only long enough to permit the deployment of the stylet electrode into the target tissue . once the stylet electrodes are positioned in the target tissue , the ablating action as set forth above and in previous applications can proceed . thus , when the electrodes 8 in fig1 are supplied with rf current via connector 16 , the electrical circuit from the stylet electrodes to a grounding plate is closed . the current density flows through the stylet electrode into the intervening tissue at deployment , and through the target tissue after stylet deployment . during the normal tissue ablation procedure , the current supplied passes through target tissues to be treated , creating lesions having the appropriate shape as seen in fig8 and 9 . when two stylets are utilized , two overlapping lesions are created . although preferred embodiments of the subject invention have been described in some detail , it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended claims .

US-18051294-A

the device is an exercise equipment hand grip that can be removeably installed on a piece of exercise equipment . the hand grip permits the user to maintains an open grip of the hand . the hand grip can be a soft visco - elastic , urethane , close cell foam , rubber or similar material . the hand grip has a generally cylindrical shape where one end of the cylinder has a larger circumference than the other end . the device thereby has a cone like shape with the narrow end held at the thumb side of the palm and the larger diameter end fits at the side of the palm . the holder includes a lengthwise opening that allows the holder to be placed over the bar grips of numerous exercise equipment and devices such as handles on weight machines , bar bells , dumb bells and ez curl bars .

the above general description and the following detailed description are merely illustrative of the subject invention and additional modes , advantages and particulars of this invention will be readily suggested to those skilled in the art without departing from the spirit and scope of the invention . the device subject of this disclosure relates to a hand grip that can be installed on exercise equipment such as dumbbells , weight bars , ez curl bars or exercise machine handles . one advantage of the device ( hereinafter “ hand grips ”) is that the hand grips increase the circumference of the device to be grasped and held by the user &# 39 ; s hand . this opens the user &# 39 ; s grip when exercising . the increased circumference achieved from installation of the hand grips is advantageous . the increased circumference spreads the grip of the hand to a more open position . this causes the user to use more force to hold the exercise device without any change in the weight of the device . exercising with the devices achieves greater finger , hand , and forearm strength with increased muscularity . the purpose of opening the hand grip is to fatigue the muscles in the fingers , hands , and forearms more quickly and more thoroughly than when compared to gripping a standard exercise bar ( typically 1 inch diameter or 28 to 30 mm ). the use of the hand grips will force the muscles in the fingers , hand and forearms to grow stronger and larger to adapt to the increased force required to grip the bar or handle . the hand grip subject of the invention forces the grip , forearm and biceps to work harder with no increase in the number exercise sets being performed , increase in weights or the time spent working out . another advantage of the hand grips is that they can be made of soft , pliable material such as a visco - elastic , urethane or close cell foam . the hand grips may provide a cushioned surface for the user &# 39 ; s hand . the hand grip material is able to yield and form around the palm and fingers when squeezed while exercising . this creates a more secure grip as the user has an increased surface area to grip with his / her hand . the rubber like material of the hand grip yields as the user squeezes ( grips ) to hold onto the bar or handle . this forms a no slip bond with the handle and the bar . the hand grip both opens the grip of the hand and is squeezable . the annulus and lengthwise split of the hand grip permits the device to fit over varying sized equipment . for example , the hand grip can be used with a 1 inch to 1¼ inch diameter bar . for example , the hand grip facilitates a reverse curl grip with dumbbells . starting with the dumbbells in a reverse curl grip , slowly reverse curl the dumbbells up and rotate the dumbbells 180 degrees to the finish at the top of the curl . on the negative portion of the repetition repeat the same motion down . the positive and negative portions of the repetition are to be done slowly and in complete control . this maneuver or exercise feels very awkward without the hand grip subject of the invention . the increased gripping area and resulting control makes this a great exercise . the hand grip will be beneficial to persons involved in sports that require excellent hand and finger strength . examples include rock climbing , martial arts , baseball , football , basketball , bodybuilding , tennis and golf . another group that would benefit would be persons involved in highly demanding activities such as those serving in the united states armed forces , police officers , firemen , and emergency medical personnel . in one embodiment , the hand grips may be manufactured using a plastic injection molding machine . the material used in manufacturing the hand grips may be a soft rubber like material . in a preferred embodiment , the hand grip includes 1 to 1⅛ inch outside diameter ( od ) hole or annulus in the center . the annulus extends longitudinally from the small end to the wide end of the hand grip . the hand grip also has a split or opening on one side that allows the hand grip to be spread apart to fit over a standard 1 ″ od exercise barbell , dumbbell handle , or exercise machine handle . it will be appreciated that the hand grip may be removed from the equipment when the user is finished and the hand grip placed on other equipment . the removal of the hand grip enhances sanitation of exercise equipment . the hand grips are designed to be wider at one end , for example 2 inches in an outer diameter ( first end ) than the other end , for example 2½ inches at a second end . this forms a conical shape . fig1 illustrates an end view of the first end of the hand grip comprising an outer component 112 of a soft , pliable material such as a visco - elastic , urethane or close cell foam . also illustrated is an inner annulus 117 . the diameter of the annulus may remain relatively constant for the length of the device . see fig2 . the length of the hand grip may be 4½ inches . other lengths are within the scope of the invention . fig2 illustrates a cross - sectional view of the device shown in fig1 . the outer diameter of the hand grip 110 expands from the first end 111 to the second end 112 . fig2 also illustrates the cross - sectional view of the device as shown from the second end ( fig3 ). in one example , the outer diameter of the first end is 2 inches and expands to 2½ inches at the second end . note that in this example , the diameter of the annulus 117 remains constant at 1⅛ inches . also illustrated in fig2 is the split or slit 115 that extends through the length and thickness of the hand grip 110 to the annulus 117 . as explained elsewhere , this allows the device to be open longitudinally to be placed over a piece of exercise equipment such as a handle on a weight machine or a weight bar . the hand grip is held in the grip of the user &# 39 ; s hand . the wider hand grip end ( second end ) is held at the bottom of the user &# 39 ; s palm , with the narrower end ( first end ) held against the thumb end of the palm . this design allows the bar or handle to be held more squarely or securely in the palm of the hand . this includes better balance and set straight . this is a more ergonomically correct position in the palm of the hand . the design also forces the fingers to be spread more open when contrasted with holding a bar or handle not using the grips . fig1 illustrates a top view ( first end ) of the hand grip showing a 2 inch outside diameter and the inner annulus 117 having a 1⅛ inch diameter . fig2 illustrates a cross sectional view of the hand holder 110 and the annulus 117 . also illustrated is the tapered shape of the device as it extends from a first end to the wider second end . also illustrated is the side slit 115 used to open the conical shaped handle for placement on an exercise bar . fig3 illustrates the second end of the hand grip wherein the outside diameter is illustrated 2½ inches . the inner annulus 117 retains the same approximate 1 inch to 1⅛ inch diameter . fig4 illustrates the placement of the hand grips 110 on dumbbells 201 . the hand grips are placed on the connecting bar 200 . the bars have an approximate equal outer diameter than other exercise equipment . note that the split 115 extending the length of the hand grip may be used to fit the hand grip on the bar . fig5 illustrates placement of the hand grips 110 on a bar bell 203 . the grips are place at the hand hold position of the user . fig6 illustrates the placement of the hand grips 110 on an ez curl bar 204 . fig7 illustrates the hand holder 110 placed on a handle 207 of an exercise machine pulling device 205 . also illustrated is the rope of the pulling device . fig8 illustrates as side view of the hand grip 110 , including the narrow first end 111 and the wider second end 113 including the side slit 115 for inserting the holder on the exercise equipment 200 . this specification is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the manner of carrying out the invention . it is to be understood that the forms of the invention herein shown and described are to be taken as the presently preferred embodiments . as already stated , various changes may be made in the shape , size and arrangement of components or adjustments made in the steps of the method without departing from the scope of this invention . for example , equivalent elements may be substituted for those illustrated and described herein and certain features of the invention may be utilized independently of the use of other features , all as would be apparent to one skilled in the art after having the benefit of this description of the invention . further modifications and alternative embodiments of this invention will be apparent to those skilled in the art in view of this specification .

US-89199007-A

a tissue collecting and staging apparatus is operable with a minimally invasive percutaneous tissue removal system to collect a mass of tissue bits and provide an ordered , or staged , version of the bulk tissue prior to removal . the apparatus includes a chamber under vacuum and at least one tube having a first end extending into the chamber for receiving tissue bits therein . a tissue collection container is slidably disposed over the first tube end and extends along a portion of the tube within the chamber . as tissue bits are dispensed from the tube into the tissue collection container , the vacuum draws the container away from the first tube end to maintain vacuum within the tube . the resulting collected tissue mass is a staged reconstruction of the bulk tissue prior to removal to facilitate analysis of the tissue by a pathologist .

for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . in accordance with the present invention , an apparatus for collecting and staging tissue is shown in fig1 - 4 . such an apparatus has application , for example , in a system for percutaneous removal of tissue , such as the system shown in fig5 . the apparatus receives tissue bits provided by a tissue cutting tool , or morcellator , and provides an ordered , or staged , version of the removed tissue . in other words , tissue is collected by the apparatus of the present invention in the order in which it was excised by the tissue morcellator so that the resulting collected tissue mass replicates the tissue as it existed prior to removal . this feature greatly enhances post operative pathological examination of percutaneously removed tissue . according to a preferred embodiment of a tissue collecting and staging apparatus 10 of the present invention , as illustrated in fig1 and 2 , a housing 12 is provided which includes a lid 16 . the lid 16 and housing 12 are designed to be sealingly engaged during operation of the apparatus 10 , and together define a chamber 14 therein . lid 16 has a port 18 therethrough which is connected via tube 20 to a source of vacuum ( not shown ). although the lid 16 provides a convenient location for port 18 , the present invention contemplates locating port 18 and tube 20 at any other convenient location through the housing 12 . moreover , although the port 18 and tube 20 may be sealingly engaged as shown in fig1 and 2 , these two elements may be combined into a port / tube of unitary construction . the housing 12 further includes a port 26 therethrough connected to a tissue receiving tube 22 . as with the vacuum port 18 , port 26 may be disposed at any convenient location through the housing 12 or lid 16 . moreover , the tube 22 and port 26 combination may be of unitary construction . a portion of tube 22 extends into the chamber 14 and terminates at a tissue dispensing end 24 . the tube 22 has a channel 23 for receiving and transporting tissue bits to be collected by the apparatus 10 . although the cross - section of the channel 23 is circular in a preferred embodiment , the invention contemplates channel 23 cross - sections having a variety of shapes including , for example , oval , d - shaped , square , or star - shaped to name a few . the importance of channel 23 lies in its ability to transport tissue past the end 24 of tube 22 and not in a particular geometric shape . disposed over the end 24 of the tube 22 and extending along a portion of tube 22 within the chamber 14 is a tissue collection container 28 . container 28 is attached at its open end to a sealing ring 30 which is slidably disposed about the outer surface of the tube 22 . a flange 32 is included on outer surface of the tube 22 adjacent the tube end 24 and provides a stop for the sealing ring 30 ( and tissue collection container 28 ) moving in the direction of arrow 34 . although many types of materials may be used for the tissue collection container 28 , a flexible nylon mesh bag is used in a preferred embodiment . in other contemplated embodiments , the container 28 may be rigid or flexible , slotted , and / or perforated , and constructed of metallic , synthetic , cloth , biological , dissolving or other types of materials , all depending on the requirements and preference of a particular user . in one embodiment , an important requirement in the structure and construction of container 28 is that it must allow vacuum from tube 20 to be created within the channel 23 of tube 22 . this requirement is preferably accomplished with a flexible nylon mesh bag having apertures of a predetermined size disposed therethrough . the apertures 25 are small enough to retain tissue bits 36 therein , yet large enough ho permit vacuum from tube 20 to be created within the channel 23 of tube 22 . apertures 25 meeting these two requirements further allows fluid 38 accompanying the tissue bits to flow through the apertures 25 and into the chamber 14 . a variety of structures and materials may similarly be used for the sealing ring 30 ; an important requirement being that the ring 30 be freely slidable along the exterior surface of the tube 22 in a manner to be described hereinafter . in a preferred embodiment , sealing ring 30 is made of rubber or a flexible polymer such as nylon , plastic , or the like , although the present invention contemplates other materials for sealing ring 30 having elastic qualities . the flange 32 extends radially away from the outer surface of the tube 22 sufficiently to stop the sealing ring 30 , sliding in the direction of arrow 34 , from sliding off the end 24 of the tube 22 . however , since it is contemplated that a new tissue collection container 28 will be used for each tissue collection procedure , the flange 32 must be sized to permit the sealing ring 30 ( and tissue collection container 28 ) to be loaded onto , and removed from , tube 22 . the use of such a flange 32 requires the sealing ring 30 to have an elastic quality that permits it to be temporarily deformed while loading a new tissue collection container 28 onto the tissue receiving tube 22 . the sealing ring must then constrict to allow a sealing , yet sliding , relationship with the outer surface of the tube 22 . in an alternate embodiment ( not shown ), the flange mechanism is provided on a threaded or pressure fitting tube extension which has an outer diameter larger than that of tube 22 . in this case , the sealing ring 30 need not be flexible enough to stretch over the flange mechanism since the sealing ring 30 / tissue collection container 28 may be loaded and unloaded onto tube 22 while the tube extension is disengaged from the tube 22 . in such an embodiment , the sealing ring 30 need not be flexible and may be of metallic , rigid plastic or polymer , wood or other rigid material construction . the operation of a tissue collection and staging apparatus 10 will now be explained with reference to fig1 and 2 . with the cover 16 of the housing 12 removed , a tissue collection container 28 is loaded onto the portion of the tube 22 extending into the chamber 14 as shown in fig1 . with the lid 16 hermetically sealed to the housing 12 , vacuum from a vacuum source ( not shown ) is created within tube 20 . since the chamber 14 is vacuum - tight , the vacuum within tube 20 will be created within the chamber 14 and within the channel 23 of tube 24 . tissue bits entering the channel 23 of tube 22 under the force of the vacuum created therein will begin filling the bottom portion 29 of the tissue collection container 28 in the order in which they entered channel 23 . as the tissue bits 36 begin to form a mass within the bottom portion 29 of the tissue collection container 28 , the vacuum created within chamber 14 begins to slide the tissue collection container 28 and sealing ring 30 in the direction of arrow 34 as shown in fig2 . this sliding action causes the mass of tissue bits 36 contained in the bottom portion 29 of the tissue collection container 28 to slide away from the tube opening 24 , thereby allowing the vacuum created within tube 20 to be maintained within channel 23 through open apertures 25 of the container 28 . as more tissue bits 36 flow into the tissue collection container 28 , the container 28 and seal ring 30 continue to move in the direction of arrow 34 so that new apertures 25 become available between the end 24 of tube 22 and the mass of tissue bits 36 so that a continuous vacuum can be maintained within channel 23 . when the sealing ring 30 eventually slides into contact with flange 32 , the movement of the container 28 in the direction of arrow 34 will cease and the tissue bits 36 entering the container 28 will eventually clog the remaining apertures 25 between the end 24 of the tube 22 and the mass of tissue bits 36 contained within the container 28 . when the container 28 has been completely filled with tissue bits 36 , most or all of the apertures 25 in the vicinity of the end 24 of the tube 22 will be clogged with tissue bits , thereby causing the vacuum created within channel 23 of tube 22 to cease . the housing 12 and / or lid 16 may be made transparent to provide the apparatus 10 operator with a visual indication that the container 28 is full , or known vacuum sensing means may be used to signal such a condition to the operator . due to the manner in which the tissue bits 36 entered the container 28 as just described , the resulting mass of tissue bits 36 constitutes a staged version of the original tissue mass . in other words , the resulting filled container 28 contains an ordered mass of tissue bits 36 . the size of the tissue collection container 28 may be varied to correspond to the approximate size of the tissue mass being collected . in this way , tissue masses can be ordered , or staged , for subsequent pathological examination . referring now to fig3 and 4 , an alternate embodiment of a tissue collecting and staging apparatus 110 is shown . in operation , tissue collecting and staging apparatus 110 cooperates with tissue collection container 28 in a manner identically to that described in the previous embodiment . identical numbers are therefore shown in fig3 and 4 which correspond to identical structural components of fig1 and 2 . referring to fig3 the tissue collecting and staging apparatus 110 includes a container 112 , a tissue collection member 116 , and a cover 117 . the member 116 and cover 117 are rotatable relative to each other in the directions of the double - headed arrow 124 . in one embodiment , member 116 is rotatable while the container 112 and cover 117 remain stationary . in an alternative embodiment , the cover 117 is rotatable in the directions of arrow 124 while the member 116 and container 112 remain stationary . in either case , an electrical motor 140 is connected to a power source ( not shown ) via electrical conductors 144a and 144b , and includes a drive gear 142 operatively engaged with one of the member 116 and cover 117 to provide the respective rotation . cover 117 includes a vacuum port 118a which is connectable to vacuum tube 20 and a tissue collection port 120 for connection to a tissue collection tube 22 . in either case , the respective port and tube may be of unitary construction . referring to fig4 member 116 has a vacuum pork 118b disposed therethrough . as shown in fig3 vacuum ports 118a and 118b are axially aligned so that when member 116 and cover 117 are juxtaposed in operable relationship , vacuum created within tube 20 is transferred to chamber 114 . tube 20 may terminate coextensive with port 118b or , alternatively , may extend substantially into the chamber 114 . a series of tissue collection ports 126 are radially disposed about the vacuum port 118b of member 116 . extending downwardly into the chamber 114 from each of the tissue collection ports 126 is a tube 122 having a tissue dispensing end 124 and a flange 132 adjacent end 124 . each of the tubes 122 are structurally identical to the tube 22 described with respect to the previous embodiment . in the operation of one embodiment , the electric motor 140 causes member 116 to be rotated relative to the cover 117 in either of the directions shown by arrow 124 until the tissue collection port 120 of cover 117 is axially aligned with one of the tissue collection ports 126 of the member 116 . fig3 and 4 show the tissue collection port 120 being axially aligned with the tissue collection port 126a . with the tissue collection ports 120 and 126a so aligned , tissue bits 36 are collected and staged within a tissue collection container 28 as previously described . when a tissue collection container 28 is full , or contains a desired amount of tissue bits , the motor 140 is actuated so that tissue collection port 120 of cover 117 becomes aligned with another tissue collection port 126 , wherein a new tissue collection container 28 can be filled with tissue bits 36 . in this way , a surgeon can collect numerous tissue samples without having to stop the procedure to provide a new tissue collection container 28 . although the tissue collecting and staging apparatus 110 is shown in fig3 and 4 as having ten tubes 122 ( corresponding to ten tissue collection containers 28 ), the present invention contemplates using as few as two tubes 122 and as many as practicable with the vacuum source being used . in other words , the upper limit on the number of tubes 122 that can be included within the tissue collecting and staging apparatus 110 is determined by the ability of the vacuum source to create a sufficient vacuum within the chamber 114 and within the tubes 122 to permit the collection and staging of tissue bits 36 within the tissue collection containers 28 . referring now to fig5 a typical tissue removal system 200 to be used with the tissue collection and staging apparatus 10 or 110 of the present invention is shown . a tissue cutting tool , or morcellator , 202 includes a cannula 204 and a cutting end 206 which is adapted to be percutaneously introduced at the site of the tissue removal . such a tissue cutting tool 202 is percutaneously insertable into a variety of body locations to effectuate the removal of tumors , cysts , degenerated tissue , and the like . the tissue cutting tool 202 includes an irrigation line 212 and an aspiration line 214 extending therefrom . the two lines are used to provide irrigation fluid and aspiration vacuum at the cutting end 206 of the disposable tissue cutting tool 202 . irrigation line 212 is connected to a source of irrigation fluid 208 . such an irrigation fluid source 208 would typically include a balanced sterile saline solution ( bss ), which is fed into the disposable tissue cutter 202 to pass to the cutting end 206 . in an alternate embodiment , the irrigation fluid source can be replaced by an insuflation gas source when necessary to inflate and maintain the working site . the system 200 further includes a tissue collecting and staging apparatus 10 or 110 , corresponding to one of the two embodiments of the invention disclosed herein . fig5 shows the embodiment 10 of fig1 and 2 connected to the system 200 . the tissue receiving tube 22 of the apparatus 10 is connected to the aspiration line 214 . vacuum tube 20 of tissue collecting and staging apparatus 10 is connected to a vacuum source 216 via a vacuum line 218 . the operation of the interrelated components of the system 200 is controlled by a control unit 250 . control unit 250 supplies electrical signals to the tissue morcellator 202 via the signal line 252 . similarly , the control unit 250 supplies electrical signals to the vacuum source 215 via the signal line 256 and to the irrigation fluid source 208 via signal line 258 . the various parameters of the system 200 components , such as cutter speed , fluid pressure , and vacuum level may be set by actuating control knobs 260 , 262 , and 264 . moreover , the actuation of the various system components may be controlled via a series of foot switches 260a , 262a , and 264a . for example , the operation of the tissue morcellator 202 may be actuated by depressing foot switch 260a , and the vacuum source 216 and fluid source 208 may be actuated by depressing foot switches 262a and 264a , respectively . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .

US-38377795-A

the present invention contemplates a fluid applicator useful for applying a fluid in a uniform and discrete manner to a remote surface wherein said applicator has a fibrous pad which is saturated and retains the fluid until applied to a surface , a valve or throttle means to control the amount of fluid in the fibrous pad and a telescoping handle element which can be extended to provide an elongate handle for reaching remote areas and to expose a cylindrical fluid vessel having a flexible wall which is compressed to extrude fluid therefrom and into the fibrous pad .

referring initially to fig1 and 2 , the apparatus of the present invention includes a cylindrical vessel 10 having ends 12 and 14 , with a threaded section 16 located at end 12 . threaded section 16 engages with a screw on cap 20 which includes threaded section 22 . a neck assembly 30 is threaded onto threaded section 22 and has plug 24 located to close an orifice 26 in threaded section 22 when neck assembly 30 is in its lower position . in particular , as seen in fig2 neck assembly 30 may be rotated so that plug 24 is removed from orifice 26 to allow passage of fluid into passageway 32 located in neck assembly 30 . likewise , neck assembly 30 may be rotated in the opposite direction so that plug 24 seats in orifice 26 to prohibit passage of fluid from the interior 18 of vessel 10 into passageway 32 located in neck assembly 30 . it will be understood that in an alternative embodiment plug 24 may be a &# 34 ; pop up &# 34 ; valve , wherein threaded section 22 is eliminated and neck assembly 30 is slidably engaged with screw on cap 20 and has first and second positions , wherein the first position causes plug 24 to be seated in orifice 26 and in the second position plug 24 is removed from orifice 26 to allow fluid to pass therethrough . it will be further understood that various other valves or fluid flow regulating means may be employed in alternative embodiments of the present invention . located at the end of neck assembly 30 , most distant from threaded section 22 of cap 20 , is a socket 40 sized to rotatably engage with a barrel 42 . barrel 42 has a fibrous pad assembly 44 attached thereto . socket 40 has barrel 42 engaged therewith , barrel 42 having passage 50 through its center to fluidly connect passage 32 in neck assembly 30 with fluid passage 60 in pad assembly 44 . it will be understood that in an alternate embodiment barrel 42 can be a ball to allow greater freedom of movement of the neck assembly . passage 50 is generally of conical shape to assure that passages 32 and 60 remain fluidly connected regardless of the angular disposition of pad assembly 44 . pad assembly 44 is connected to barrel 42 by a stem 46 and the rotational movement of pad assembly 44 is limited by stem 46 &# 39 ; s engagement with walls 62 and 64 located in neck 30 proximate to socket 40 . it will be understood that pad assembly 44 comprises a fibrous material 80 mounted on a rigid support platform 82 , wherein fibrous material 80 is sufficiently porous to permit saturation thereof by a fluid , but prohibits dripping or oozing of the fluid therefrom . fibrous material 80 is made from a material suitable to allow the deposit of any fluid located therein onto a surface upon contact with the surface . tubular sleeve 100 mounted on the exterior surface of tubular vessel 10 , having an internal diameter sufficiently greater than the outer diameter of tubular vessel 10 to permit the sleeve to slide thereon . it will be further understood that tubular vessel 10 is of substantially circular cross section and tapered such that its outer diameter at end 14 may be larger than its outer diameter at end 12 ; and similarly tubular sleeve 100 is of substantially circular cross section and tapered such that its inner diameter at end 114 is larger than its inner diameter at end 112 . it will be further understood that the internal diameter of the end 112 of tubular sleeve 100 is smaller than the outer diameter of end 14 of tubular vessel 10 so that tubular sleeve 100 is prohibited from being removed from tubular vessel 10 at end 14 , and becomes securely frictionally engaged with tubular vessel 10 at a predetermined position when removal is attempted . the frictional engagement of end 14 of tubular vessel 10 and end 112 of tubular sleeve 100 serves to secure the tubular sleeve 100 and the tubular vessel 10 in an extended position , as shown in fig4 . with the tubular sleeve 100 and the tubular vessel 10 in said extended position , the tubular sleeve 100 functions as an extendable handle whereby a user can apply fluid to remote locations . as seen in fig1 and 2 , cap 20 is of sufficient diameter so as to prohibit passage of end 112 of tubular sleeve 100 to a point beyond cap 20 , thus limiting the movement of tubular sleeve 100 between its first position , as shown in fig1 and the second position ( as shown in fig4 ). referring now to fig3 an alternative embodiment of the present invention is shown wherein tubular vessel 200 has first and second ends 202 and 204 , respectively , and has a valve assembly 210 engaged at its first end 202 . valve assembly 210 has an orifice ( not shown ) which permits application of the contents of tubular vessel 200 directly onto a surface from valve assembly 210 . this alternative embodiment also contemplates a tubular sleeve 220 slidably mounted about the elongate axis of tubular vessel 200 , which can be located in two positions as described above . referring now to fig4 the preferred embodiment of the present invention is shown having tubular sleeve 100 in its fully extended position with tubular vessel 10 &# 39 ; s flexible wall 110 exposed to permit the vessel to be squeezed to cause fluid to pass into fibrous pad assembly 44 . it will be understood that wall 110 is significantly flexible and elastic to allow the volume of the vessel to be decreased by the application of an external force to the wall , and is biased to return to a position of substantially circular cross section when the force is removed . it will be further understood that tubular sleeve 100 is of sufficient strength to prohibit deformation of flexible wall 110 when the sleeve is in its first position covering the wall . this aspect of the present invention serves to prohibit discharge of the fluid contents of tubular vessel 10 unless tubular sleeve 100 is in its second position . the fluid contents of tubular vessel 10 is applied to the surface in the form of smear 300 . referring now to fig5 in an alternative embodiment tubular sleeve 100 is shown in its second position and has elongate cutout 400 . cutout 400 facilitates the user &# 39 ; s grip on tubular sleeve 100 , and may be employed with a second elongate cutout located at the opposite side of the tubular sleeve ( not shown ). most importantly , when tubular sleeve 100 is in its first position cutout 400 allows the user to deform flexible wall 110 to extrude the contents of tubular vessel 10 . the presence of cutout 400 in tubular sleeve 100 is preferred when it is necessary or desirable to extrude the contents of vessel 10 when the sleeve is in its first position as shown in fig1 and 2 . in operation , the user extends tubular sleeve 100 to expose flexible wall 110 of the tubular vessel 10 , and rotates the neck assembly 30 so that the valve is in its open position to allow fluid to pass from the tubular vessel through the neck assembly and saturate fibrous material 80 . the user deforms tubular vessel 10 by hand to cause the internal volume thereof to decrease and extrude a fluid contained therein through passageway 32 located in neck assembly 30 . sufficient force is applied by the user to assure that fluid passes through passage 50 in barrel 42 and fluid passage 60 in fibrous pad assembly 44 to reach fibrous material 80 . when the user is satisfied that fibrous material 80 is saturated with fluid , the user then grips tubular sleeve 100 and can apply the fluid in a predetermined amount in a uniform manner to a remote surface , such as the human back . it will be understood that there is no need for the user to continue to deform the cylindrical vessel to facilitate application of the fluid , but that the fibrous material 80 is of sufficient volume to permit an adequate application thereof to the desired surface . it will be understood that the present invention provides the advantage of permitting the user to apply the fluid with one hand , eliminating the previously necessary step of pumping the apparatus to apply fluid therefrom . although preferred and alternative embodiments of the invention have been described in the foregoing detailed description and illustrated in the accompanying drawings it will be understood that the invention is not limited to the embodiments disclosed , but is capable of numerous rearrangements , modifications , and substitution of parts and elements without departing from the spirit of the invention . the present invention is therefore intended to encompass such rearrangements , modifications and substitution of parts and elements as fall within the scope of the invention .

US-90434786-A

the poultry stunner described herein comprises a poultry conveyor and an electrolyte bath below the conveyor and means for applying an electric potential between the conveyor and the bath so as to stun birds on the conveyor as their heads are passed through the bath . the electrolyte bath is continuously aerated and a drainage rack at the end of the basin recovers electrolyte that would otherwise be lost .

a poultry stunner embodying the invention , as shown in fig1 - 3 , comprises an overhead conveyor 10 ( fig2 ) and a lower frame 14 supported by vertically adjustable legs 16 to accommodate birds of various sizes . the frame defines a main electrolyte basin 20 extending generally along the line of the conveyor 10 and below the same so that the heads of birds suspended from the conveyor will engage the electrolyte . the main basin 20 is in fluid communication with adjacent fluid chambers 22 , 24 , 26 which are described further below . at the entrance to the basin , there is a guide plate 30 at the inlet thereof . the guide plate extends downward away from the basin so that the heads of approaching birds are gradually lifted by the guide plate and then fall into the electrolyte once they have cleared it . a perforated aeration tube 32 extends the length of the basin substantially below the surface of the electrolyte and generally in the same plane as the overhead conveyor . the aeration tube is provided at intervals ( preferably every two inches ) with a series of aeration holes 34 of about 1 / 8 inch diameter . above the aeration tube 32 , but just below the surface the electrolyte , a horizontal , perforated screen of baffle 36 is attached within the basin 20 . the purpose of the screen is two - fold : ( 1 ) to break up the air stream emitted from the aeration tube and ( 2 ) to prevent aspiration of water by the birds , by limiting the depth to which their heads may protrude into the water . at the outlet end of the stunner the screen terminates and is succeeded by a plurality of general cylindrical tubes or bars 40 ( see detail , fig3 ) extending generally in the direction of the conveyor and parallel to one another . these bars are inter - connected with spaces between them to form a grate 42 through which electrolyte can drain from the birds &# 39 ; heads and return to the basin 20 . the grate 42 is supported within the frame of 14 by means of feet 44 , and it can be easily removed from the frame for cleaning . the tubes 40 of the grate have leading portions 46 angled upward with respect to the horizontal so as to shorten the vertical distance between the stunner and the conveyor to insure maximum capture , particularly with respect to smaller birds within the population ; the tubes &# 39 ; length is sufficient to permit thorough drainage of electrolyte from the stunned birds . the length of the path over which the birds are out of contact with the electrolyte prevents water from being plowed or pushed out of the container by the larger birds within the population as occurred in previous devices . fig4 shows in detail the auxillary chambers 22 , 24 , 26 , which are designated a salt chamber , an inlet chamber and the float chamber respectively . the salt chamber receives a block of salt ( nacl ) which is slowly soluble in water . the salt chamber 22 is open at one lower side 48 to the main basin 20 so that its salt concentration is in equilibrium with the other chambers . although our apparatus greatly reduces electrolyte consumption , there is naturally some evaporation and some water is removed from the basin by the birds &# 39 ; heads . to replenish the lost liquid , the inlet chamber 24 has a water inlet 50 so disposed in or preferably slightly above the chamber to admit fresh water from a supply line 52 . the inlet includes a float - controlled valve 54 that stabilizes electrolyte level . the controlling float 56 is isolated from electrolyte in the inlet chamber 24 ( because the turblence caused by the inlet water would adversely affect float operation ); the float chamber 26 communicates only with the stunner bath via an opening at 58 and is therefore quiescent . referring once again to fig1 and 3 , one can see in addition to structure previously described a bar 60 extending above the electrolyte level and parallel to the conveyor 10 . this is a &# 34 ; rump bar &# 34 ; to prevent the birds from avoiding electrolyte by pulling up toward their feet . also shown are plural rubber fingers 62 that extend towards the birds &# 39 ; breasts to prevent lateral movement of the birds while avoiding tissue injury . the electrical circuitry for impressing the voltage between the conveyor and the electrolyte is shown in fig5 . this circuit includes sixty - cycle standard line source 70 acting as the input to a variable voltage supply 72 which in turn is connected to frequency converter 74 . the output of the frequency converter is impressed across the electrodes , viz ., conveyor 10 and basin 20 . the frequency converter is commercially available from georator , manassas , va . under model no . 30 , 003 . we prefer a stunning frequency of about 400 cycles per second at a voltage of 18 volts output , as we have found that the higher frequency produces a much less violent stun than does a sixty - cycle current and lasts longer . in addition , this permits the stunning voltage to be reduced , thereby reducing or eliminating the incidence of hemorraging that may result from higher voltages . in use , a series of birds are carried over the stunner by the conveyor 10 . as the birds &# 39 ; heads engage the guide plate 30 and then fall into the electrolyte , they are stunned by the voltage existing between the conveyor ( which is in electrical communication with their feet ) and the electrolyte . the electrolyte is continuously aerated by air supplied under pressure ( for example 90 psi ) to the aeration tube 32 ; and the aeration helps to insure good head contact with the birds by locally increasing the water level near the center of the bath . the stunned birds are carried through the basin by the conveyor and then across the drain rack 42 , which lifts the heads of the birds from the water , allowing electrolyte to flow back to the basin 20 , so that when the birds then leave the stunner they carry only a very small amount of electrolyte . the stunner normally operates continuously for two work shifts and during this time substantially uniform electrolyte salinity has been observed , owing primarily to the low rate of electrolyte loss and to the selection of block salt for its slow dissolving rate . not only is the salinity level much more stable than with previously known devices , but also the salt savings are significant . we estimate that the cost of a stunner will be returned early during its useful life on salt savings alone . we have further observed improved yields from the combination of good electrolyte contact , stable salinity , high frequency and relatively low voltage , in that there is substantially less incidence of internal hemorraging and consequent product loss . inasmuch as the invention is subject to many variations modifications and changes in detail , it is intended that the foregoing should be regarded as illustrative only of the invention described in the following claims .

US-723987-A

composition of biocompatible microparticles of alginic acid for the controlled release of active ingredients by intravenous administration . the invention relates to a biocompatible composition which comprises microparticles of alginic acid or its salts and an active ingredient . more particularly , the invention relates to microparticles for the encapsulation of an active ingredient to be administered intravenously to a patient who needs it . these microparticles are of a combination of size sufficient to increase the half - life or survival of the active ingredient in blood , with a low uptake in the liver and a fast cell clearance when administered intravenously .

alginic acid and its salts ( ammonium alginate , calcium alginate , potassium alginate , sodium alginate and propylene glycol alginate ) are among the polymers most used and studied in the encapsulation of active ingredients due to their physicochemical and biochemical properties . they are polysaccharides of natural origin , commercially produced from algae or bacteria . alginates are alginic acid salts , a linear polysaccharide made up of two monomer units , β -( 1 - 4 )- d - mannuronic ( m ) acid and α -( 1 - 4 )- l - guluronic ( g ) acid . these are grouped in blocks forming a wide variety of sequences , the most common being g , m and mg . in the presence of multivalent cations like calcium ( ca ++ ), strong bonds are made between contiguous g blocks forming an extended network of alginates . calcium ions are situated as bridges between the groups with a negative charge of guluronic acid . in some formulations they are often accompanied by other polysaccharides such as chitosan . chitosan is a linear polysaccharide composed of randomly distributed chains of β -( 1 - 4 ) d - glucosamine ( deacetylated units ) and n - acetyl - d - glucosamine ( acetylated unit ). in some alginate formulations albumin can be used as the substance of charge , preferably sterile and pyrogen - free human albumin , which can also act as a protector of the active ingredient in the process of manufacture or as a stabiliser during the long - term conservation of the product . the active ingredient which release in plasma is intended to be modified can be a complex and labile active ingredient . more specifically , the active ingredient features exhibits biological activity . this biological activity can be developed through enzymatic activity , transport , molecular interaction or binding with a ligand . in both cases , it would be a question of active ingredients labile or sensitive to energetic conditions of manufacture in temperature , pressure and / or nonpolar environments amongst others , since small structural changes can lead to an irreversible loss of biological activity . as examples of active ingredients with biological activity , human peptide hormones such as melatonin , serotonin , thyroxin , epinephrine , norepinephrine , dopamine , adrenocorticotropic hormone , angiotensinogen and angiotensin , vasopressin , atriopeptin , calcitonin , erythropoietin , follicle stimulating hormone , glucagon , human chorionic gonadotropin , human placental lactogen , growth hormone , inhibin , insulin , insulin - type growth factor ( or somatomedin ), luteinising hormone , melanocyte - stimulating hormone , oxytocin , prolactin , thrombopoietin , neuropeptide y , histamine , together with their derivatives can be mentioned . other examples can be biologically active proteins such as albumin , alpha 1 - antitrypsin , alpha - acid glycoprotein , alpha - 2 - macroglobulin , antithrombin , haptoglobin , ceruloplasmin , lipoproteins , transferrin , plasminogen , fibrinogen , complementary proteins , clotting factors , and immunoglobulins , amongst others . the fact that these active ingredients are biologically active makes them especially vulnerable to a possible loss of functionality as a result of minor structural damage . this structural damage can be associated with temperature , pressure , polarity of the medium , osmolality , presence of oxygen , agitation , etc . in this connection , clotting factor viii stands out amongst these active ingredients because of its extreme lability . due to its structural complexity , it is very difficult to adequately stabilise the biological activity of fviii , especially in its purified form . for example , parti r et al ( haemophilia 2000 ; 6 : 513 - 522 ) explain how even in its lyophilised form , the biological activity of fviii begins to be compromised at temperatures of above 40 ° c . this instability is most evident when fviii is in solution , where even at 25 ° c . signs of instability are observed . in the case of factor ix and of factor viia sensitivity to external factors such as temperature is also known . in this regard it must be noted that the manufacturing process applied allows therapeutic preparations with biological activity of fviii to be obtained . this means that the method is applicable to active ingredients exhibiting biological activities which are difficult to stabilise , and , therefore , that the present invention is applicable to ingredients which are as labile as fviii . by extension , the present invention is applicable to ingredients that are more stable than fviii . as a result , clotting factors are a clear example of an active ingredient which can benefit from the application of the formulation as described in the present invention . in the present invention the active ingredient included in the polymer microsphere can thus be a peptide , a protein or a hormone exhibiting biological activity . preferably , the active ingredient is a clotting factor and more preferably , the active ingredient is the viii factor , the von willebrand factor , the complex formed by the viii factor and the von willebrand factor , the ix factor or the viia factor . these ingredients can be of human , animal , recombinant or transgenic origin . in the latter cases , the synthesised molecule can be a reproduction of the natural molecule or be deliberately modified . microencapsulation is a process of coating molecules , solid particles or liquid globules , with materials of a different nature , in order to create particles of micrometric size . the products resulting from this technological process are named microparticles , microcapsules or microspheres . the chosen technique for the manufacture of microparticles described in the present invention is spray drying , as described in erdinc b . i . [ erdinc b . i . ( 2007 ) micro / nanoencapsulation of proteins within alginate / chitosan matrix by spray drying , degree thesis , queen &# 39 ; s university , kingston , canada ]. this manufacturing technique features a single stage and microparticles are obtained as the final product . the manufacturing process of a biocompatible composition for intravenous administration which includes microparticles of alginic acid or its salts for the controlled release of an active ingredient of the present invention is characterized by the stages of : spraying , in which the solution / suspension / emulsion containing the active ingredient and the polymer is pumped through a nozzle and is dispersed in the form of drops , drying in the drying chamber , where the hot air assists the evaporation of the solvent from the drops , and collection of the encapsulated product this procedure being performed at a temperature of between 140 and 180 ° c . with a supply flow rate between 35 and 40 m 3 / h , an injection flow rate between 3 . 5 and 5 ml / min and a pressure between 4 and 6 psi . under these conditions it is possible to obtain particles with a size of less than or equal to 5 μm , preferably between 1 and 4 . 5 μm and maintain the activity of the active ingredient . in addition , the average size of the particles can be improved in an optional process of homogenisation of the emulsion before the spray stage . this additional homogenisation process is carried out by means of pressure , for example between 1500 and 2000 psi . the encapsulation of active ingredients by means of spray drying is a continuous process in which a solution or emulsion is dehydrated , recovering a solid formed by microparticles at the end of the process . to this end , the fluid containing the active ingredient is driven mechanically at a predetermined injection flow rate towards a nozzle or rotating disk in which it is sprayed in millions of very small drops . the size of the drops is determined in large measure by the pressure of the gas that causes the spray of the fluid . this process takes place in a closed chamber where a stream of controlled gas , which is usually air , circulates continuously at a predetermined speed of intake and at a controlled temperature . as a result of the spraying , the fluid greatly increases its contact surface area with the air , so that when faced with the current of drying air there is a rapid evaporation of the fluid solvent , usually water . this rapid evaporation causes the internal cooling of each small drop due to the heat needed for the change in state . in this way it is possible to carry out fast drying whilst minimising the thermal shock to the active ingredient . upon completion of the process , the product is collected in solid form . the microparticles obtained are distinguished by determining their particle average size , their z potential and biological activity . the size of particle is determined with a beckman coulter ls13320 device by a diffraction laser . as it is a question of intravenous administration , it is necessary for the particle size to be less than or equal to 5 μm , preferably between 1 and 4 . 5 μm , because higher particle sizes could cause the formation of thrombi . the z potential , which is determined with a malvern zetasizer device , is one of the fundamental parameters controlling the interaction of the particles in suspension . it is determined by the nature of the particle surface and the dispersion medium . in this case the optimal values are those above − 30 mv since this ensures repulsion between particles and absence of aggregates . it has been shown that microparticles with z potentials close to 0 , preferably between − 30 mv and 0 , have low liver uptake and cell clearance levels . ( szycher , michael , high performance biomaterials : a comprehensive guide to medical and pharmaceutical applications , published by crc press , 1991 isb 0877627754 , 9780877627753 , 812 pages ). the pharmaceutical forms of modified or controlled release are those designed in such a way as to change the speed and / or the place of release of the active substance or substances in relation to the pharmaceutical form of conventional release , administered in the same way . in the present invention it has been observed how the encapsulation of active ingredients exhibiting biological activity , such as proteins , and more specifically , clotting factors , allows a controlled release in an in vitro release model . factor viii is notable for its extreme sensitivity to external factors given its structural complexity . in fact , even freezing fviii in human plasma itself , its natural matrix , causes a partial loss of biological activity ( bravo , m . i . et al , pharmeuropa scientific notes , 2006 - 1 pp . 1 - 5 ). so when the microparticles containing human fviii described in the present invention are placed in a continuous flow cell in a similar environment to human plasma , a delay has been observed , compared with the unencapsulated product , in the release of fviii in the medium . similarly , intravenous administration of fviii - containing microparticles of the present invention in rabbits , results in consistent and significant extension of the half - life of fviii in plasma , as compared to the conventional product . furthermore , no adverse effects were observed in animals that might indicate a toxic effect associated with the formulation described . the in vivo pharmacokinetics data are very significant because they prove without doubt that the effect of opsonisation and accelerated uptake for the mps has been dealt with properly for the formulation of the invention . the present invention can be used in the treatment of various pathologies that require the intravenous administration of complex ingredients , which can include for example , bleeding disorders and clotting disturbances , hormonal disorders , etc . in these cases , a significant extension of half - life would be achieved , which for example in the case of fviii , could include reducing the number of administrations for maintaining a primary prophylaxis regime , for example , weekly administration . a possible drawback associated with the use of hydrophilic polymers may be the partial dissolution of the microparticle during the period of time between suspension of the product in an aqueous vehicle of administration , for example , water for non - pyrogenic and sterile injection and the time of the intravenous infusion . this type of disadvantage can be overcome for example with the use of partially apolar biocompatible solutions , such as ethanol , propylene glycol , polyethylene glycol , dimethylsulphoxide , n - methyl - 2 - pyrrolidone , glycofurol , isopropylidene - glycerol , glycerol formal or acetone ( mottu f et al . journal of pharmaceutical science & amp ; technology 2000 vol . 54 , no . 6 , 456 - 469 ), amongst others , as vehicles of resuspension and administration of the microparticles described in the present invention . the invention can be produced , for example , in the form of a dehydrated or freeze - dried product packed in a vacuum or inert atmosphere , allowing long - term stability in varying temperature conditions , for example , between 2 ° c . and 40 ° c . the product thus preserved can be administered intravenously after reconstitution with a solvent which can be water for injection , or a saline solution , or a mixture or an aqueous saline solution with a variable content , for example between 0 . 5 % and 50 % of biocompatible solvents such as for example ethanol , propylene glycol , polyethylene glycol , dimethylsulphoxide , n - methyl - 2 - pyrrolidone , glycofurol , isopropylidene - glycerol , glycerol formal or acetone , amongst others . the present invention describes the production of hydrophilic microparticles of alginate with a combination of a size suitable for intravenous infusion and physicochemical features suitable for preventing their rapid phagocytosis , allowing an extension of the half - life of complex active ingredients . alginate is biocompatible and is eliminated via urine , and has no association with any known effect of toxicity . due to its features , the present invention is compatible with the administration of proteins and complex active ingredients . this invention can overcome all the disadvantages that have made a controlled administration intravenous system impractical , thus decreasing the number of administrations necessary for treatment with unchanged active ingredients for intravenous use . in this regard it should be noted that the present invention does require any modification of an active ingredient , in the amino acid sequence , glycosylations or introduction of synthetic derivatives . fig1 shows a comparative graph of the results of the in vitro release tests of batch 9 and batch 1 . fig2 shows the pharmacokinetics of human fviii : c in rabbit plasma after the administration of unencapsulated fviii and after the application of the composition . fig3 shows the pharmacokinetics of human vwf : ag in rabbit plasma after the administration of unencapsulated fviii and after the application of the composition . the spray drying process has been used for the production of alginate microparticles as described in erdinc b . i . [ erdinc b . i . ( 2007 ) micro / nanoencapsulation of proteins within alginate / chitosan matrix by spray drying , degree thesis , queen &# 39 ; s university , kingston , canada ]. basically , microparticles were prepared by producing an emulsion with the polymer and the active ingredient chosen . a büchi mini spray dryer b - 290 device was used for spraying the samples under the following conditions : spray temperature : 140 ° c .- 180 ° c ., intake rate : 35 - 40 m 3 / h , injection flow rate : 3 . 5 - 5 ml / min and pressure 4 - 6 psi . tables 1 , 2 and 3 describe the materials used in the manufacture of microparticles and their features , including size , z potential and yield . the manufacturing process and the conditions used were as described in example 1 . the fviii activity / fviii antigen ratio gives an idea of the proportion of active protein in a given sample . in this way , if we compare the activity / antigen ratio in the initial sample with that obtained in the encapsulated sample , we can calculate the proportion of active ingredient which remains functional after microencapsulation . in the example , we found that the activity yields during the process of encapsulation , expressed as a percentage compared to the initial activity yield , are 57 . 6 %, 33 . 9 % and 35 . 7 % for batches 1 , 2 and 3 respectively . in the case of proteins of recombinant origin , the activity yields determined during the process of encapsulation were of 25 % and of 71 % for batches 7 and 8 respectively . in all batches , the size of particle was determined with the beckman coulter ls13320 device through a diffraction laser and the z potential was measured with the malvern zetasizer device . the biological activity of fviii was determined by deficient plasma clotting assay or by evaluating the generation of fxa by chromogenesis . in the case of fviia and fix , the biological activity was determined by evaluating the clotting time ( partial activated thromboplastin time ) of plasmas without fvii and fix , respectively . the protein concentration was determined by the immunological detection method of enzyme - linked immunosorbent assay ( elisa ) using specific antibodies against fviii : ag , fix : ag or fvii : ag respectively . the activity / antigen ratios , indicative of the proportion of active protein in a given sample were calculated by obtaining the quotient between the activity and antigen units for the specific active ingredient in the sample . the calculation of the activity / antigen yield is carried out by estimating the percentage of variation between the activity / antigen ratios of the starting sample and of the final encapsulated product . as can be seen in all cases , the average particle size is less than or equal to 5 μm and the z potential is negative . also the results of activity / ag yield indicate that the biological activity during the process is being maintained . the various tables show that the controlled release system is suitable for different active ingredients . a controlled release test with a continuous flow cell is performed in a sotax ce1 device in closed circuit in order to evaluate the release of active ingredient . the test was conducted at a temperature of 37 ° c . with a flow rate of 7 - 25 ml / min using as a dissolving medium an imidazole ph 7 . 3 buffer containing 1 % human albumin . a representative sample was extracted for analysis at different times ( 5 minutes , 10 minutes , 15 minutes , 30 minutes , 60 minutes , 120 minutes , 180 minutes and 240 minutes ). the volume of extracted sample was replaced with the same volume of fresh medium in order to correct the loss of volume . the biological activity of fviii was determined by a deficient plasma clotting assay or by evaluating the generation of fxa by chromogenesis . in the case of fviia and fix , the biological activity was determined by evaluating the clotting time ( partial activated thromboplastin time ) of plasma without fvii and fix , respectively . the protein concentration was determined by the immunological detection method of enzyme - linked immunosorbent assay ( elisa ) using specific antibodies against fviii : ag , fix : ag or fvii : ag respectively . we can see that the composition of the microparticle applied to the active ingredient modifies the release kinetics of the product compared to unencapsulated product . in order to evaluate the effect of the composition on the release of active ingredient in vivo , a pharmacokinetics test was carried out on rabbits . for this , a dose of 50 iu / kg of human fviii from batch 9 ( not encapsulated ) was administered intravenously to three female new zealand white rabbits . similarly , a dose of 50 iu / kg of encapsulated fviii from batch 1 as manufactured as described in example 1 and described according to example 2 was administered intravenously to a further three female new zealand white rabbits . at various times , plasma samples were obtained which were analysed to detect the presence of human fviii : c , as described in table 6 . the detection of human fviii was performed by chromogenesis after selective immunological capture of the human fviii molecules . this allows the activity of infused human fviii to be distinguished from that of rabbit fviii . we can see from the results that the composition delays the release of the active ingredient in plasma . in addition , these results demonstrate that there is no cell mechanism ( liver , spleen , or macrophages ) which rapidly removes the microparticles from the circulation , in spite of their size . the analysis of this data using appropriate software for this purpose ( winnonlin 5 . 2 ) allowed us to calculate the pharmacokinetic constants detailed in table 7 . both in the case of the batch 9 preparation ( unencapsulated fviii ) and in the preparation of batch 1 ( encapsulated fviii ), the fviii was of plasma origin with a significant content of von willebrand factor ( vwf ). this means that the encapsulation of the vwf occurs at the same time as the encapsulation of fviii . for this , their behaviour can be studied independently . for this we proceeded to independently analyse the vwf pharmacokinetics , by assessing the presence of the human vwf antigen ( vwf : ag ) in the rabbit plasma . the results are shown in table 8 . we can see from the results that the composition delays the release of the active ingredient in plasma . in addition , these results demonstrate that there is no cell mechanism ( liver , spleen , or macrophages ) which rapidly removes the microparticles from the circulation , in spite of their size . the analysis of this data using appropriate software for this purpose ( winnonlin 5 . 2 ) allowed us to calculate the pharmacokinetic constants detailed in table 9 . while the invention has been described for examples of preferred embodiments , these should not be considered limitative of the invention which will be defined by the broader interpretation of the following claims .

US-63420309-A

a swimming goggle has improved to snugly fit around a user &# 39 ; s eyes for comfort wearing . an air channel is adopted to remove an ocular pain due to a pressure in an inner space where the user &# 39 ; s eyes are placed when the swimming goggles are worn . the swimming goggle comprises a pair of glasses disposed at a predetermined distance in front of the user &# 39 ; s eyes , a set of looped cushions surrounding the glasses for directly contacting around the user &# 39 ; s eyes , and a vent hole interconnecting an outer surface with an inner surface of the glasses or penetrating the looped cushions .

description will now be made in detail to certain embodiments of the present invention with reference to the accompanying drawings . well - known functions and constructions are not described in detail since they would obscure the invention in unnecessary detail . terms described herein are determined in consideration of functions in this invention , and definition of the terms may vary according to a producer &# 39 ; s intention or custom . also , the definition of the terms is determined based on the contents throughout the specifications . swimming goggles having enhanced wearing comfort according to a first embodiment of the present invention will be described with reference to fig1 and 2 . fig1 is a sectional view showing the main elements of the swimming goggles according to the first embodiment , and fig2 is a view showing the swimming goggles according to the first embodiment in use . hereinafter , the swimming goggles having enhanced wearing comfort will be referred to simply as ‘ swimming goggles ’ without particular explanation . as shown in fig1 , the swimming goggles 100 include a vent hole 112 formed at a lower portion of a lens part 110 and interconnecting an inner surface 114 and an outer surface 116 of the lens part 110 . a cushion part 120 is formed to fit the swimming goggles 100 on a user &# 39 ; s facial skin curve and protect the user from impacts . the cushion part 120 can be made of silicon or foamed synthetic resin . although the vent hole 112 is formed at a lower part of the lens part 110 according to the drawings , the present invention is not limited so . as long as not interfering with the user &# 39 ; s visual field , the vent hole 112 can be disposed at any positions such as an upper portion and a side portion . although the vent hole 112 is formed at the lens part 110 in this embodiment , the present invention is not limited so . the vent hole 112 may be formed through the cushion part 120 of the swimming goggles 100 . the vent hole 112 of the cushion part 120 can be disposed on any position of the cushion part 120 . more specifically , the vent hole 112 may be formed at only the lens part 110 , only the cushion part 120 , or both the lens part 110 and the cushion part 120 . as necessitated , one or more vent holes 112 can be formed in predetermined arrangement . according to an exemplary embodiment of the present invention , diameter of the vent hole 112 is not greater than 3 mm . as generally known , a water drop is equal to or greater than 1 mm in diameter . especially , a water drop splashed in a swimming pool is usually larger than a sprayed water drop , that is , not less than 3 mm in diameter . therefore , diameter of the vent hole 112 can be set equal to or less than 3 mm . considering that certain water drops have diameter not greater than 1 mm , the vent hole 112 preferably has diameter not greater than 1 mm in order to prevent water infiltration more effectively . accordingly , the vent hole 112 according to the embodiment of the present invention has smaller diameter than a water drop , so as not to allow a water drop to pass therethrough while allowing steam particulates having diameter of several to tens of micrometers . therefore , while water cannot infiltrate from the outside to an inner space between the user &# 39 ; s eye and the lens part 110 , air and steam particulates of the inner space can pass freely through the vent hole 112 . even when water surges in through the vent hole 112 , infiltration of the water can be prevented by the air in the swimming goggles 100 . this is the same principle in that water does not infiltrate an opening of a bottle which is put into water upside down . when wearing the swimming goggles 100 according to the first embodiment of the present invention , as shown in fig2 , ocular pain by pressure difference can be overcome since the air can freely pass between the inner space and the outside through the vent hole 112 . swimming goggles according to a second embodiment of the present invention will now be described with reference to fig3 . fig3 is a sectional view showing main elements of the swimming goggles according to the second embodiment . referring to fig3 , swimming goggles 200 according to the second embodiment of the present invention is structured substantially in the same manner as the swimming goggles 100 of the first embodiment , except that a vent hole 212 of the swimming goggles 200 has a zigzag form . when the vent hole 212 is in the zigzag form , as shown in the second embodiment , water infiltration can be more effectively prevented while the air can still smoothly pass . as well as in the first embodiment , although the vent hole 212 is disposed at a lower portion of a lens part 210 in the second embodiment , the vent hole 212 can be disposed on any other positions such as upper and side portions of the lens part 210 . it will be sure understood that the vent hole 212 can be disposed on any position of a cushion part 220 . hereinafter , swimming goggles according to a third embodiment of the present invention will be described with reference to fig4 . fig4 is a front view of swimming goggles 300 according to the third embodiment of the present invention . as shown in fig4 , the swimming goggles 300 of the third embodiment have an inner vent hole 312 , an extension hole 313 , and an outer vent hole 314 . except this , the third embodiment has substantially the same structure as the first embodiment . the inner vent hole 312 is disposed on an upper inner surface of a lens part 310 . however , position of the inner vent hole 312 is not limited to the upper portion of the lens part 310 , but can be a side portion or a lower portion . the extension hole 313 is formed along an inside of the periphery of the lens part 310 , being extended from the inner vent hole 312 . the outer vent hole 314 can be disposed on any position of an outer side of the lens part 310 . however , in order to effectively prevent infiltration of water , the outer vent hole 314 is preferred to be disposed at the lower portion . according to the above configuration , the swimming goggles 300 according to the third embodiment of the present invention are capable of preventing infiltration of water almost completely . the vent holes 312 , 313 and 314 in the third embodiment can also be formed at a cushion part . hereinafter , a fourth embodiment of the present invention will be described with reference to fig5 and 6 . fig5 is a front sectional view of swimming goggles according to the fourth embodiment , with a first valve closed . fig6 is a front sectional view of swimming goggles according to the fourth embodiment , with a second valve closed . as shown in the drawings , in swimming goggles 400 according to the fourth embodiment of the present invention , vent holes are divided into first and second outer holes 412 and 419 , first and second extension holes 413 and 418 , first and second inner holes 415 and 416 , and first and second valves 414 and 417 . the first outer hole 412 is formed on an upper outer surface of a lens part 410 . the first extension hole 413 is formed along an inside of the periphery of the lens part 410 , being extended from the first outer hole 412 up to the middle of the lens part 410 . the inner hole 415 is formed on an inner surface of the lens part 410 , being extended from the first extension hole 412 . the first valve 414 is connected between the first extension hole 413 and the first inner hole 412 . additionally , the first valve 414 can open toward the first inner hole 415 . the second outer hole 419 is formed on a lower outer surface of the lens part 410 . the second extension hole 418 is formed along an inside of the periphery of the lens part 410 , being extended from the second outer hole 419 . the second inner hole 416 is formed on an inner surface of the lens part 410 , being extended from the second extension hole 418 . the second valve 417 is connected between the second extension hole 418 and the second inner hole 416 , and capable of opening toward the second inner hole 416 . the operation of the vent hole according to the fourth embodiment of the present invention will now be described . as the user enters water wearing the swimming goggles 400 , the water surges to the second outer hole 419 and accordingly , the second valve 417 is opened . the first valve 414 is closed simultaneously . as a result , constant pressure can be maintained in an inner space of the swimming goggles 400 , as shown in fig5 . when the user exits from the water wearing the swimming goggles 400 , the water surges to the first outer hole 412 and the first valve 414 is opened . simultaneously , the second valve 417 is closed . as a result , constant pressure can be maintained in the inner space of the swimming goggles 400 . this state is shown in fig6 . as described above , inner pressure of the swimming goggles 400 can be constantly maintained by the first and the second valve 414 and 417 being selectively opened and closed , thereby improving the wearing comfort . the vent holes in the embodiments of the present invention may have approximately 1 mm diameter . diameter of a valve mounting part may be approximately 3 mm for smooth mounting of the valve . however , the present invention is not limited to the embodiments . therefore , for example , both the vent holes and the valve mounting parts can be equal to or less than 3 mm in diameter . furthermore , for more complete prevention of water infiltration , both the vent holes and the valve mounting parts may be equal to or less than 1 mm in diameter for more complete prevention of water infiltration . swimming goggles according to a fifth embodiment of the present invention will be described hereinafter , with reference to fig7 . fig7 is a sectional view showing main elements of swimming goggles 500 according to the fifth embodiment of the present invention . referring to fig7 , in comparison with the swimming goggles 100 of the first embodiment , the swimming goggles 500 of the fifth embodiment further comprise a concave part 522 formed on a cushion part 520 along the middle of a surface of the cushion part 520 , directly contacting with the user &# 39 ; s face . the other structures of the fifth embodiment are substantially the same as in the first embodiment . the above - structured cushion part 520 of the swimming goggles 500 according to the fifth embodiment can enhance the wearing comfort since the concave part 522 is transformed and closely contacted with the user &# 39 ; s face when the user wears the swimming goggles 500 . while the invention has been shown and described with reference to certain embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims .

US-31043906-A

a medical staple formed from a nitinol wire , the staple having two elongated arms which extend upwardly and outwardly from a central loop in two opposing generally semicircular courses forming an arc extending upwardly and outwardly and an end second comprising a sharpened endpoint , the endpoint being the arms bendable under resistance , is disclosed . in some embodiments the arms extend upwardly on a parallel course and then outwardly . the material is preferably an alloy with hyperelastic characteristics . the staples are placed in a flexible endoscope and a lumen catheter within the endoscope , using a hook or forceps in the lumen catheter having a distal end in the lumen of the catheter and the staple distal to the forceps in folded configuration with the arms folded inward in the lumen catheter , positioning the distal end of the lumen catheter at a location in the patient &# 39 ; s gastrointestinal tract where stapling is desired , moving the forceps distally so as to force the staple forward out of the lumen catheter and cause the end points to pierce the patient &# 39 ; s inner wall of the gastrointestinal tract .

referring first to fig1 a and 1 b , an example of a staple 10 of the invention is shown wherein a first 1 and a second 2 wing are joined perpendicularly at respective ends of joining member 3 . in the illustrated embodiment , the staple 10 is molded in one piece from nitinol , commercially available nickel - titanium alloy . distance a in fig1 a varies between 4 mm and 30 mm but preferably 6 mm to 20 mm , and more preferably 10 mm to 16 mm . preferably , the distance from the bottom of the loop to the endpoints is about 2 . 0 mm or more to avoid the endpoints piercing back into the lumen . distance b can vary between 1 mm and 5 mm depending on the organ in which the staple is used ( the stomach is much thicker than the esophagus or small and large bowel ) but preferably is about 3 mm . distance d in fig1 b can vary between 2 mm and 10 mm depending on the organ in which the staple is used ( the stomach is much thicker than the esophagus or small and large bowel ). distance c in fig1 b can vary between 0 . 5 mm to 4 mm , more preferably about 2 . 0 mm . importantly , distance e which determines the distance between the base of the central loop 3 and the sharpened tip of wing 4 can vary between − 2 mm and 10 mm ( depending on distance d ), having a negative value when the tip 4 is below the base of the central loop 3 ( fig1 c ). referring to fig2 , an example of a staple 10 of the invention is shown wherein a first wing 1 and a second wing 2 are parallel at a portion adjacent to central loop joining member 3 . each of the wings 1 and 2 extend from the parallel direction in two opposing courses forming an arc 5 extending upwardly and outwardly and two ends 4 comprising sharpened endpoints , the endpoint being in this example a distance d , of 1 . 0 mm above the top part of the central loop , but can be varied , depending on the size of the staple . distance a , the width of the staple , is 15 mm in this example , and distance f , the length of the parallel segment between the bottom of the loop 3 and the beginning of the arc 5 , is 3 . 0 mm in this embodiment . staple 10 is preferably molded in one piece from nickel - titanium alloy such as nitinol , a brand of commercially available nickel - titanium alloy . referring now to fig3 , 4 and 5 , several variations of the staples are illustrated . in fig3 both wings 1 , 2 of the staples 10 are roughly perpendicular to the parallel elements 1 a and 2 a . in fig4 the ends have an s shape and in fig5 the ends are facing backwards towards the central loop . referring now to fig6 a and 6 b , the staple 10 is pulled ( fig6 a ) with a grasping forceps 6 with a little tooth 12 and inserted in a flexible catheter 7 which is slightly wider than the diameter of the joining member , allowing both wings to bend inside the flexible catheter 7 as in fig6 b . the flexible catheter 7 acts as a sheath for the forceps 6 and staple 10 assembly . the flexible catheter 7 is preferably made in a pebax thermoplastic elastomer flexible tube . a short tube 8 can be welded , glued or otherwise attached at the end of the pebax flexible tube to avoid excessive friction of the endpoints 4 of the staples 10 when loading into the catheter 7 and particularly when expelling of the staple 10 in tissue is desired . the flexible pebax catheter 7 with the forceps 6 and the staple 10 are passed in the working channel of a standard endoscope . in order to place the staple 10 in tissue or through a medical device such as a gard , the rounded tip 9 of the catheter 7 is placed against the device or tissue that has to be stapled ( fig1 ) and the staple 10 is pushed out with the forceps 6 . referring to fig7 a and 7 b , a variation of the catheter is presented where the rounded end as in fig6 a is alternatively a sharpened needle 11 . rather than a tooth 12 , a small hook 14 is used to grab the staple 10 by its central loop 3 . in order to control the depth of penetration and to avoid causing lesions of organs beyond the wall of the esophagus or hernia such as the aorta or vena cava , a stopper 13 can be placed at a predetermined distance from the tip of the needle 11 , for example between about 3 mm and 20 mm , and preferably about 4 mm to 6 mm . such stopper can be used to hit the inner wall of the gard and avoid deep penetration . alternatively , a mark ( not shown ) on the needle 11 can inform the surgeon of the depth of penetration but will not control it . an echoendoscope eus ( not shown ) could also be used for that purpose , however few endoscopists use eus echoendoscope on a regular basis . a stopper or echoendoscope are not necessary when a round end catheter 9 ( fig6 a ) is used and the staple 10 with sharp endpoints 4 is used to staple the device and penetrate tissue , which is an advantage of the embodiment of fig6 a and 6 b . referring now to fig8 a , a staple 10 is shown being grabbed by central loop 3 and being pulled in the direction of the arrow into the round ended flexible catheter 7 with the forceps 6 . in fig8 b , the catheter 7 is shown loaded with the staple 10 being held by forceps 6 . fig8 c illustrates firing out the staple of the round end of catheter 7 in tissue 15 . referring now to fig9 a , a different embodiment of forceps 6 has a hook 16 that pulls the staple 10 in the flexible catheter 7 . fig9 b illustrates a staple 10 having been loaded in a catheter 7 with forceps 6 having hook 16 . referring now to fig1 gard 100 anti - gerd valve is shown in place and the flexible catheter 7 with round end 9 have been passed through the flexible endoscope 16 through an overtube 17 . the round tip 9 of the catheter 7 has been placed in a niche of the ring 80 and the staple 10 is positioned in the wall of the hernia 90 . several staples 10 will be placed around the perimeter of the ring 80 . in this embodiment the central loop 3 acts to prevent staple 10 from going all the way through ring 80 . in this way , without tying complicated knots or using any pledgets or other devices to attach the free piece of thread , a reversible staple can be placed through the inner wall of the gastrointestinal tract and hold any device in place that needs to be held either for a long period of time such as the gard that is placed for years , or shorter periods of time such as pressure , ph monitoring devices or other pressure devices that can be placed for a few weeks . when used with absorbable staples the monitoring devices will fall in the lumen of the esophagus , stomach or bowel once he staples and joining segment dissolve and will be expelled naturally . when used with the reversible staples , each staple 10 can be recovered by flexible endoscopy by pulling on the central loop 3 . referring to fig1 a lateral viewing endoscope 160 ( or a standard straight viewing endoscope ) is placed through an overtube 17 , and balloon 300 is blown to offer a certain amount of counter - pressure . the staple 10 is placed in the ring 80 of the gard 100 for reversible stapling using the balloon 300 to maintain the forceps 6 toward the ring 80 . referring to fig1 a an enlargement shows staple 10 in the muscular layer of the gastro - intestinal wall 15 . removal of the staple illustrated in fig1 b which shows a direction arrow toward the inside of esophagus 15 with staple 10 being pulled by central loop 3 . referring to fig1 , staples 10 are placed in pairs at the cardia region of the stomach 60 , creating a pleat 70 to block mild reflux . the endoscope 160 , overtube 17 , and needle 7 catheter with forceps 6 are also shown . the overtube or the inner part of the guardus overtube sold by us endoscopy can act as a counterpressure device where the balloon cannot be used because the stomach organ is large . referring to fig1 staples 10 attach an obesity ob 200 device using the same technique as described in placement of the gard in fig1 . ob tubes 200 are preferably those disclosed in my u . s . pat . no . 5 , 861 , 036 which is hereby incorporated by reference and are usually longer than 10 cm for treatment of obesity , using the ring disclosed in u . s . patent publication 20030009239 of jan . 9 , 2003 , also incorporated by reference , preferably with the ring 80 having a zig - zag shaped nitinol spring 81 . referring to fig1 , a vertical reservoir 82 is made along the lesser curvature with a series of removable staples placed in pairs 10 a and 10 b and linked together to staple the posterior wall of the stomach 61 to the anterior wall 62 as shown in fig1 . this operation , made endoscopically with a straight viewing endoscope , allows a reversible reservoir to be made to treat obesity . fig1 shows detail of the linking of the two staples 10 a and 10 b of a pair . the staples 10 a and 10 b can be linked by a ring 20 or sutured together by two threads as illustrated in fig1 which shows a horizontal endoscopic reversible stapling of the stomach for obesity . a small reservoir is made in “ a ”. an anterior reversible staple 10 a is placed on the anterior wall 62 with a double thread 30 to the mouth , a second reversible staple 10 b is placed on the posterior wall 61 of the cardia of the stomach 30 with a thread 30 and a small tube 40 is slid from the mouth on both threads and crimped in place 50 as illustrated in fig1 , fig2 and fig2 . both threads are cut as in fig2 . this procedure is repeated along the width of the cardia leaving a small passage for food . this procedure creates a reservoir a similar to the reservoir currently created by the prior art laparoscopic band , but endoscopically and reversibly according to the invention . the process of linking two staples can also be used to repair tears in a stomach or esophagus . such tears can be accidental or can be intentional . a relatively new technique involves intentionally perforating the stomach in order to do operations endoscopically but outside of the stomach . a problem faced in the use of this new technique is how to close the perforations which were intentionally made . the use of two staples 10 and 10 a ( fig1 ) with thread connecting them , one on either side of the tear , can be used to repair such tears . referring to fig2 , an obesity tube 200 is introduced in the stomach 60 , stapled 10 to the hiatus hernia 90 . this tube 200 creates a small reservoir as in fig1 but is longer and easier to staple in place than creating a reservoir as in the operation described in fig1 with a series of pairs of staples . referring to fig2 a , an internal by - pass tube 200 is introduced in the stomach and stapled 10 to the lower esophagus or hiatus hernia 90 , allowing food to pass directly into the stomach 60 . fig2 b illustrates total gastric bypasses according to the invention . fig2 c illustrates total gastric bypass and partial duodenum 83 bypass with bypass tube 200 and stapled 10 to lower esophagus 84 . fig2 d illustrates a total gastric 60 bypass and total duodenum 70 bypass tube 200 . the tube 200 can be semipermeable to allow fluids to pass but stops food particles to enter the stomach 60 , duodenum 83 , and proximal jejunum 75 , causing a calibrated malabsorption . the length of the tube 200 is calibrated according to the excess weight loss , creating a “ pseudo ” short bowel syndrome . fig2 e illustrates a total gastric 60 bypass with total duodenum 83 bypass and partial intestinal ( jejunal 75 ) bypass . fig2 f illustrates a total gastric 60 bypass , total duodenum 83 bypass , partial intestinal ( jejunal 75 ) bypass with a stimulator in the form of a gastrointestinal pacemaker 500 and the leads 600 . the tube can let gastric and duodenal water secretions penetrate in the tube 200 but not to leave it , thereby decreasing the length of small bowel used for absorption of food and causing weight loss . the tube leaves space 65 between the wall of the duodenum 83 and the external wall so that bile secretion and pancreatic secretions as well as gastric secretions can flow freely . a stimulator 500 can be used to pace the stomach 60 , duodenum 83 and small bowel to allow peristaltic contractions ( not shown ) transmitted to the inner tube for progression of the bolus of food in the tube . contractions induced to the gastrointestinal tract by the pace setter stimulator 500 increase the pressure in the bypass tube 200 . referring to fig2 a staple 10 is placed in the wall of the colon 400 using the same technique as described in fig1 using a colonoscope or sigmoidoscope . the staple 10 holds a manometric probe 450 that transmits pressure readings telemetrically to a sensor 480 held outside the body to treat irritable bowel syndrome ( ibs ). referring to fig2 , an embodiment of staple 10 having a tilt tag 18 attached with surgical thread 30 to central ring 3 and secured at tilt tag hook 50 is illustrated . using the tilt tag 18 helps prevent implantation of the staple 10 too deeply in either gard ring 80 ( fig3 ) or tissue 60 ( fig1 ). fig2 illustrates an embodiment of tilt tag 18 using a knot 11 of thread 30 rather than the hook 50 of fig2 . fig2 illustrates thread 30 engaged to hook 50 of tilt tag 18 . fig2 illustrates a gard valve 100 having thick ring 80 with holes 19 placed in esophagus 84 . the ring 80 has a thin net 85 , with silicone covering holes 19 . fig2 illustrates an example of a staple 10 with tilt tag 18 being inserted through a hole 19 in a gard ring 80 with a flexible tube 7 having a stopper 13 . fig3 is an embodiment of a staple 10 being inserted through a hole 19 in a gard ring 80 with a flexible tube , forceps 6 , outer sheath 17 , tag 18 , and thin net 85 system . fig3 shows a flexible catheter 7 having a needle 91 formed from a metal tube cut at a slant 92 with edges sharpened , a forceps 6 with a tooth 93 in the central lumen of the needle , a stopper 13 to limit the depth to which the needle 91 may be inserted , a staple 10 with tilt tag 18 joined by surgical thread 30 illustrated distal to the tip of the needle prior to being grabbed by the teeth or tooth 93 of the forceps 6 . fig3 is the catheter - needle - forceps system illustrated in fig3 , illustrating the staple 10 being pulled into the needle 91 by action of the forceps 6 tooth 93 grabbing the central loop 3 of the staple 10 and pulling in a proximal direction , with the tilt tag 18 located in the lumen of the outer sheath 86 but outside of the needle 91 . fig3 is a top view of the catheter - needle forceps system of fig3 , illustrating a lateral slit 94 in the sharpened needle 91 which receives the surgical thread 30 connecting the tilt tag 18 and staple 10 when the staple 10 is pulled into the needle 91 and the tilt tag 18 is placed in the lumen of the catheter 86 outside of the needle 91 . fig3 illustrates a staple - loop - thread - tilt tag system with the staple wings 1 , 2 inserted through a hole 19 in the gard ring 80 and through the net 85 of the gard , with the central loop 3 of the staple within the hole 19 and through the net 85 of the gard , and the tilt tag 18 loosely connected with thread 30 to the central loop 3 and disposed on the inside of an esophagus . the thread 30 passed in the ring or hook 50 of at the ends of the tilt - tag 18 tightens the tilt - tag 18 against the loop 3 of the staple . fig3 is a similar view to fig3 , illustrating the thread 30 passed in the ring or hook 50 at the ends of the tilt tag 18 and the tilt tag 18 tightened against the central loop 3 of the staple . fig3 illustrates a pair of staples 10 , 10 a inserted in two tissue walls 15 , 15 a of a stomach with tilt tags 18 , 18 a facing each other and thread 30 from the first staple - tag system being used to join the second staple - tag system of the pair . fig3 illustrates the pair of staples of fig3 wherein the thread 30 has cross - hooked the opposing tilt tags 18 , 18 a and has tightened the tilt tags 18 , 18 a toward each other so as to draw the two opposing tissue walls 15 , 15 a toward each to form a gastric stapling . while the invention has been described in detail and several embodiments have been illustrated , other embodiments , alternatives , and modifications should become apparent to those skilled in the art without departing from the spirit and scope of the invention .

US-75126007-A

a retaining device for retaining a shower caddy or other item on a shower arm or other elongated member includes a clip structure for partially surrounding the shower arm or elongated member and having retaining arms extending therefrom and a plastic sleeve structure having receptacles for receiving the retaining arms to hold the sleeve structure on the clip structure , and a shower - arm engaging portion or elongated member engaging portion for engaging the shower arm or elongated member to render the shower caddy or other item immobile on the shower arm or elongated member .

fig1 - 5 show a shower caddy 1 hung on a shower arm s . shower arm s protrudes from a wall w and has a showerhead h mounted on its free end . shower caddy 1 has a support portion 3 which is in the form of an inverted u having a pair of opposed loop arms 7 with a relatively large internal diameter d as shown in fig6 . depending from support portion 3 are a pair of transition arms 5 which are integral with each of loop arms 7 of support portion 3 . transition arms 5 are integral with a pair of opposed parallel straight arms 9 of shower caddy 1 . arms 9 support one or more baskets or trays 11 . in shower caddy 1 as shown , extending at about 90 ° from the portion of straight arms 9 at the opposite portion thereof from support portion 3 are a pair of straight members 13 having end portions 15 which are bent towards support portion 3 to form a pair of arms from which items can be hung . a pair of suction cups 17 are disposed beneath the lowest of shelves 11 for retaining shower caddy 1 against wall w beneath shower arm s the inverted u of support portion 3 is symmetrical about an axis y as shown in fig2 . a clip structure 19 , also in the form of an inverted u , is attached to support portion 3 between loop arms 7 of support portion 3 and positioned to share axis y with support portion 3 . clip structure 19 is shown more clearly in fig6 - 11 . clip structure 19 is composed of a curved portion 21 from which extend opposed parallel arms 23 which are parallel with straight arms 9 of shower caddy 1 . curved portion 21 has an inside diameter d as shown in fig7 . bent at about 90 ° from the end of parallel arms 23 opposite curved portion 21 are a pair of opposed retaining arms 25 . retaining arms need not be at 90 ° from parallel arms 23 and can be transverse thereto . curved portion 21 and parallel arms 23 fall generally in a plane , and retaining arms 25 are perpendicular to that plane . curved portion 21 , parallel arms 23 and retaining arms 25 are preferably made from a uniform cylindrical wire having the same diameter throughout , which is preferably smaller than the wire of which support portion 3 is composed so as to make clip structure 19 less noticeable when in use . furthermore , since clip structure 19 has a relatively small inside diameter , it can be bent inwardly to reduce its diameter d or bent outwardly to increase its diameter d . as explained below , clip structure 19 can be slipped over a shower arm s , and clip structure 19 can be manually squeezed to reduce inner diameter d or moved apart to increase diameter d so as to enable clip structure 19 to tightly engage shower arms having various outer diameters . attached to clip structure 19 is a sleeve structure 27 . sleeve structure 27 is preferably made from pvc , polyurethane or similar plastic and is a unitary , one - piece member comprised of a generally curved portion composed of inner layers 31 and opposing outer layers 33 . inner layers 31 and outer layers 33 form a pair of opposing receptacles in the form of parallel hollow tubes 35 which can be separated from each other by a distance to enable each of them to receive or slip onto one of the retaining arms 25 of clip structure 19 . inner layers 31 and outer layers 33 are respectively separated from each other so that they can each receive one of the retaining arms 25 in a sliding engagement . inner layers 31 are formed to protrude towards each other near the respective tubes 35 at opposing protrusions 37 . opposing protrusions 37 combine with an inner surface 39 of sleeve structure 27 to expand the portion of sleeve structure 27 which engages the outer surface of a shower arm s to enhance the holding power of clip structure 19 and sleeve structure 27 on shower arm s . as noted earlier , opposing parallel arms 23 of clip structure 19 can be bent towards each other to increase the holding force of clip structure 19 and sleeve structure 27 on shower arm s . one of the features of clip structure 19 and sleeve structure 27 which is not found in the prior art is the ability of sleeve structure 27 to remain on clip structure 19 by virtue of the gripping of retainer arms 25 by the surfaces of sleeve structure 27 forming tubes 35 which engage retaining arms 25 . the latter holding force is very effective and remains in effect to keep sleeve structure 27 on clip structure 19 from as soon as sleeve structure 27 is installed on clip structure 19 , regardless of the handling procedures which ensue during the completion of the manufacturing process for shower caddy 1 , the packing and shipping of shower caddy 1 , and regardless of the amount of times that shower caddy 1 is placed upon and removed from shower arms s . the inventor has found that for a clip structure made from wire having an outer diameter of 0 . 23 inch that the length between the outside surface of parallel arm 23 and the free end of retaining arm 25 of clip structure 19 , as shown by the distance 1 in fig1 is 0 . 77 inch , the total height from the top of curved portion 21 of clip structure 19 to the outer dimension of outer wall 33 of sleeve structure 27 shown by the letter h in fig9 is 1 . 35 inches , and the distance between the outer surfaces of sleeve structure 27 shown by the letter h in fig8 is 1 . 23 inches . referring to sleeve structure 27 , the entire sleeve structure is made of opposing layers 31 and 33 as noted above . the total thickness of these layers when they are contacted , as shown for example where curved surface 39 is located , is preferred to be 0 . 217 inch . of course , all of the foregoing dimensions could be modified depending on the components of shower caddy 1 and the respective clip structure and sleeve structure used . there are various ways in which clip structure 19 could be affixed to support portion 3 of shower caddy 1 . in its preferred form , a portion 41 shown in fig7 on a plane about which clip structure 19 is symmetrical at the center of curved portion 21 can be mig welded in a manner well known in the art . although the preferred embodiment of the invention has been described above , it should be understood that the present invention is broader than the preferred embodiment . the invention generally relates to a retaining device for retaining a shower caddy on a shower arm which extends from a wall . the retaining device comprises a clip structure and a sleeve structure . the clip structure includes a shower arm engaging structure configured to engage part of the shower arm and retaining structure extending in a direction transverse to the wall when the shower caddy is hung on a shower arm for cooperating with the sleeve structure . the sleeve structure has a receptacle for receiving the retaining structure to prevent the inadvertent removal of the sleeve structure from the clip structure . the receptacle could be a tubular member , as discussed with respect to the preferred embodiment , but could also be sleeve structure to the clip structure which would prevent the inadvertent removal of the sleeve structure from the clip structure . also as noted above , the invention is not limited to shower caddies for attachment to shower arms . it could be used for items such as those used in kitchens , bathrooms , houses in general and numerous commercial environments where an item is to be firmly attached to an elongated member . the elongated member could be cylindrical , but also could have polygonal cross sections , irregular cross sections etc . although the elongated member could extend horizontally from a support , this is not a requirement . the invention has been described in detail , with particular emphasis on the preferred embodiment thereof , but variations and modifications within the spirit and scope of the invention may occur to those skilled in the art to which the invention pertains .

US-201113328606-A

the invention comprises peptidyl analogs that possess agonist or antagonist ghrelin activity , along with therapeutic and non - therapeutic uses thereof .

the present invention features ghrelin analogs active at the ghs receptor . human ghrelin is a 28 amino acid modified peptide where a serine hydroxyl group is esterified by n - octanoic acid ( kojima et al ., nature 1999 , 402 , 656 - 660 , and kojima , abstract at the third international symposium on growth hormone secretagogues , keystone , colo ., usa 2000 , feb . 17 - 19 ). certain amino acids present in compounds of the invention can be and are represented herein as follows : abu is α - aminobutyric acid , aic is 2 - aminoindane - 2 - carboxylic acid , acc is 1 - amino - 1 - cyclo ( c 3 - c 9 ) alkyl carboxylic acid , a3c is 1 - amino - 1 - cyclopropanecarboxylic acid , a4c is 1 - amino - 1 - cyclobutanecarboxylic acid , a5c is 1 - amino - 1 - cyclopentanecarboxylic acid , a6c is 1 - amino - 1 - cyclohexanecarboxylic acid , act is 4 - amino - 4 - carboxytetrahydropyran , which has the structure : with the exception of the n - terminal amino acid , all abbreviations ( e . g ., ala ) of amino acids in this disclosure stand for the structure of — nh — c ( r )( r ′)— co —, wherein r and r ′ each is , independently , hydrogen or the side chain of an amino acid ( e . g ., r ═ ch 3 and r ′═ h for ala ), or r and r ′ may be joined to form a ring system . for the n - terminal amino acid , the abbreviation stands for the structure of ( r 2 r 3 )— n — c ( r )( r ′)— co —, wherein r 2 and r 3 are as defined in formula ( i ). a peptide of this invention is also denoted herein by another format , e . g ., ( aib 2 ) hghrelin ( 1 - 28 )- nh 2 ( seq id no : 325 ), with the substituted amino acid ( s ) from the natural sequence placed between the first set of parentheses ( e . g ., aib 2 for ser 2 in hghrelin ). the numbers between the second set of parentheses refer to the number of amino acids present in the peptide ( e . g ., hghrelin ( 1 - 18 ) ( seq id no : 435 ), refers to amino acids 1 through 18 of the peptide sequence for human ghrelin ). the designation “ nh 2 ” in e . g ., ( aib 2 ) hghrelin ( 1 - 28 )- nh 2 ( seq id no : 325 ), indicates that the c - terminus of the peptide is amidated . ( aib 2 ) hghrelin ( 1 - 28 ) ( seq id no : 325 ), or alternatively ( aib 2 ) hghrelin ( 1 - 28 )- oh ( seq id no : 325 ), indicates that the c - terminus is the free acid . “ alkyl ” refers to a hydrocarbon group containing one or more carbon atoms , where multiple carbon atoms if present are joined by single bonds . the alkyl hydrocarbon group may be straight - chain or contain one or more branches or cyclic groups . “ substituted alkyl ” refers to an alkyl wherein one or more hydrogen atoms of the hydrocarbon group are replaced with one or more substituents selected from the group consisting of halogen , ( i . e ., fluorine , chlorine , bromine , and iodine ), — oh , — cn , — sh , — nh 2 , — nhch 3 , — no 2 , — c 1 - 2 alkyl substituted with 1 to 6 halogens , — cf 3 , — och 3 , — ocf 3 , and —( ch 2 ) 0 - 4 — cooh . in different embodiments 1 , 2 , 3 or 4 substituents are present . the presence of —( ch 2 ) 0 - 4 — cooh results in the production of an alkyl acid . examples of alkyl acids containing , or consisting of , —( ch 2 ) 0 - 4 — cooh include 2 - norbornane acetic acid , tert - butyric acid and 3 - cyclopentyl propionic acid . “ heteroalkyl ” refers to an alkyl wherein one of more of the carbon atoms in the hydrocarbon group are replaced with one or more of the following groups : amino , amido , — o —, or carbonyl . in different embodiments 1 or 2 heteroatoms are present . “ substituted heteroalkyl ” refers to a heteroalkyl wherein one or more hydrogen atoms of the hydrocarbon group are replaced with one or more substituents selected from the group consisting of halogen , ( i . e ., fluorine , chlorine , bromine , and iodine ), — oh , — cn , — sh , — nh 2 , — nhch 3 , — no 2 , — c 1 - 2 alkyl substituted with 1 to 6 halogens , — cf 3 , — och 3 , — ocf 3 , and —( ch 2 ) 0 - 4 — cooh . in different embodiments 1 , 2 , 3 or 4 substituents are present . “ alkenyl ” refers to a hydrocarbon group made up of two or more carbons where one or more carbon - carbon double bonds are present . the alkenyl hydrocarbon group may be straight - chain or contain one or more branches or cyclic groups . “ substituted alkenyl ” refers to an alkenyl wherein one or more hydrogens are replaced with one or more substituents selected from the group consisting of halogen ( i . e ., fluorine , chlorine , bromine , and iodine ), — oh , — cn , — sh , — nh 2 , — nhch 3 , — no 2 , — c 1 - 2 alkyl substituted with 1 to 6 halogens , — cf 3 , — och 3 , — ocf 3 , and —( ch 2 ) 0 - 4 — cooh . in different embodiments 1 , 2 , 3 or 4 substituents are present . “ aryl ” refers to an optionally substituted aromatic group with at least one ring having a conjugated pi - electron system , containing up to two conjugated or fused ring systems . aryl includes carbocyclic aryl , heterocyclic aryl and biaryl groups . preferably , the aryl is a 5 or 6 membered ring . preferred atoms for a heterocyclic aryl are one or more sulfur , oxygen , and / or nitrogen . examples of aryl include phenyl , 1 - naphthyl , 2 - naphthyl , indole , quinoline , 2 - imidazole , and 9 - anthracene . aryl substituents are selected from the group consisting of — c 1 - 4 alkyl , — c 1 - 4 alkoxy , halogen ( i . e ., fluorine , chlorine , bromine , and iodine ), — oh , — cn , — sh , — nh 2 , — no 2 , — c 1 - 2 alkyl substituted with 1 to 5 halogens , — cf 3 , — ocf 3 , and —( ch 2 ) 0 - 4 — cooh . in different embodiments the aryl contains 0 , 1 , 2 , 3 , or 4 substituents . the present invention includes diastereomers as well as their racemic and resolved enantiomerically pure forms . ghrelin analogs can contain d - amino acids , l - amino acids or a combination thereof . preferably , amino acids present in a ghrelin analog are the l - enantiomers . preferred derivatives of analogs of the invention comprise d - amino acids , n - alkyl - amino acids , β - amino acids , and / or one or more labeled amino acids ( including a labeled version of a d - amino acid , a n - alkyl - amino acids , or β - amino acid ). a labeled derivative indicates the alteration of an amino acid or amino acid derivative with a detectable label . examples of detectable labels include luminescent , enzymatic , and radioactive labels . both the type of label and the position of the label can effect analog activity . labels should be selected and positioned so as not to substantially alter the activity of the ghrelin analog at the ghs receptor . the effect of a particular label and position on ghrelin activity can be determined using assays measuring ghrelin activity and / or binding . a protecting group covalently joined to the c - terminal carboxy group reduces the reactivity of the carboxy terminus under in vivo conditions . the carboxy terminus protecting group is preferably attached to the α - carbonyl group of the last amino acid . preferred carboxy terminus protecting groups include amide , methylamide , and ethylamide . examples are provided below to further illustrate different features of the present invention . the examples also illustrate useful methodology for practicing the invention . these examples do not limit the claimed invention . the compounds of the invention can be produced using the techniques disclosed in the examples herein as well as techniques that are well known in the art . for example , a polypeptide region of a ghrelin analog can be chemically or biochemically synthesized and modified . examples of techniques for biochemical synthesis involving the introduction of a nucleic acid into a cell and expression of nucleic acids are provided in ausubel , current protocols in molecular biology , john wiley , 1987 - 1998 , and sambrook et al ., in molecular cloning , a laboratory manual , 2 nd edition , cold spring harbor laboratory press , 1989 . techniques for chemical synthesis of polypeptides are also well known in the art ( see e . g ., vincent in peptide and protein drug delivery , new york , n . y ., dekker , 1990 ). for example , the peptides of this invention can be prepared by standard solid phase peptide synthesis ( see , e . g ., stewart , j . m ., et al ., solid phase synthesis ( pierce chemical co ., 2d ed . 1984 )). the substituents r 2 and r 3 of the above generic formula may be attached to the free amine of the n - terminal amino acid by standard methods known in the art . for example , alkyl groups , e . g ., ( c 1 - c 30 ) alkyl , may be attached using reductive alkylation . hydroxyalkyl groups , e . g ., ( c 1 - c 30 ) hydroxyalkyl , may also be attached using reductive alkylation wherein the free hydroxy group is protected with a t - butyl ester . acyl groups , e . g ., coe 1 , may be attached by coupling the free acid , e . g ., e 1 cooh , to the free amine of the n - terminal amino acid by mixing the completed resin with 3 molar equivalents of both the free acid and diisopropylcarbodiimide in methylene chloride for one hour . if the free acid contains a free hydroxy group , e . g ., p - hydroxyphenylpropionic acid , then the coupling should be performed with an additional 3 molar equivalents of hobt . when r 1 is nh — x 2 — ch 2 — conh 2 , ( i . e ., z 0 ═ conh 2 ), the synthesis of the peptide starts with bochn — x 2 — ch 2 — cooh , which is coupled to the mbha resin . if r 1 is nh — x 2 — ch 2 — cooh ( i . e ., z 0 ═ cooh ), the synthesis of the peptide starts with boc - hn — x 2 — ch 2 — cooh , which is coupled to pam resin . for this particular step , 4 molar equivalents of boc - hn — x 2 — cooh , hbtu and hobt and 10 molar equivalents of diea are used . the coupling time is about 8 hours . the protected amino acid 1 -( n - tert - butoxycarbonyl - amino )- 1 - cyclohexane - carboxylic acid ( boc - a6c - oh ) was synthesized as follows : 19 . 1 g ( 0 . 133 mol ) of 1 - amino - 1 - cyclohexanecarboxylic acid ( acros organics , fisher scientific , pittsburgh , pa .) was dissolved in 200 ml of dioxane and 100 ml of water . to it was added 67 ml of 2n naoh . the solution was cooled in an ice - water bath and 32 . 0 g ( 0 . 147 mol ) of di - tert - butyl - dicarbonate was added to this solution . the reaction mixture was stirred overnight at room temperature . dioxane was then removed under reduced pressure and 200 ml of ethyl acetate was added to the remaining aqueous solution . the mixture was cooled in an ice - water bath . the ph of the aqueous layer was adjusted to about 3 by adding 4n hcl . the organic layer was separated . the aqueous layer was extracted with ethyl acetate ( 1 × 100 ml ). the two organic layers were combined and washed with water ( 2 × 150 ml ), dried over anhydrous mgso 4 , filtered , and concentrated to dryness under reduced pressure . the residue was recrystallized in ethyl acetate / hexanes and 9 . 2 g of the pure product was obtained , 29 % yield . boc - a5c - oh was synthesized in an analogous manner to that of boc - a6c - oh . other protected acc amino acids can be prepared in an analogous manner by a person of ordinary skill in the art as enabled by the teachings herein . in the synthesis of a ghrelin analogue of this invention containing a5c , a6c and / or aib , the coupling time is 2 hours for these residues and the residue immediately following them . the titled peptide was synthesized on an applied biosystems ( foster city , calif .) model 433a peptide synthesizer . 4 -( 2 ′, 4 ′- dimethoxyphenyl - fmoc - aminomethyl )- phenoxyacetamido - norleucyl - mbha resin ( rink amide mbha resin , novabiochem , san diego , calif .) was used with a substitution of 0 . 72 mmol / g . the fmoc amino acids ( anaspec , san jose , calif .) were used with the following side chain protection : fmoc - arg ( pbf )- oh , fmoc - pro - oh , fmoc - gln - oh , fmoc - leu - oh , fmoc - lys ( boc )- oh , fmoc - ala - oh , fmoc - ser ( tbu )- oh , fmoc - glu ( otbu )- oh , fmoc - val - oh , fmoc - his ( trt )- oh , fmoc - phe - oh , and fmoc - asp ( otbu )- oh . boc - gly - oh ( midwest bio - tech , fishers , ind .) was used in position 1 . n - α - fmoc - l - glutamic acid γ - 4 -{ n -( 1 -( 4 , 4 - dimethyl - 2 , 6 - dioxocyclohexylidene )- 3 - methylbutyl )- amino } benzyl ester ( fmoc - glu ( odmab )- oh ) ( chem - inpex international , wood dale , ill .) was used in position 3 . the synthesis was carried out on a 0 . 25 mmol scale . the fmoc groups were removed by treatment with 20 % piperidine in n - methylpyrrolidone ( nmp ) for 30 min . in each coupling step , the fmoc amino acid ( 1 mmol ) was first pre - activated with hbtu ( 0 . 9 mmol ) and hobt ( 0 . 9 mmol ) in dmf and then added to the resin . the abi 433a peptide synthesizer was programmed to perform the following reaction cycle : ( 1 ) washing with nmp , ( 2 ) removing fmoc protecting group with 20 % piperidine in nmp for 30 min , ( 3 ) washing with nmp , ( 4 ) coupling with pre - activated fmoc amino acid for 1 h . at the end of assembly of the peptide chain on the applied biosystems ( abi ) 433a peptide synthesizer , the resin was transferred into a reaction vessel on a shaker for manual synthesis . the dmab protecting group in the side chain of the glu residue was removed with a solution of 2 % hydrazine in dmf for 2 h . after washing with dmf , the resin was treated with 2 . 5 mmol of tetramethylfluoroforamidinium hexafluorophosphate ( tffh ) ( perseptive biosystems , warrington , uk ) in dichloromethane ( dcm ) for 25 min to convert the free carboxylic acid functional group in the side chain of the glu residue to its acid fluoride . to the mixture were added 5 . 0 mmol of hexanol , 2 . 5 mmol of o -( 7 - azabenzotriazol - 1 - yl )- 1 , 1 , 3 , 3 - tetramethyluronium hexafluorophosphate ( hoat )( anaspec , san jose , calif . ), 5 . 0 mmol of diisopropylethyl amine ( diea )( aldrich , milwaukee , wis .) and catalytic amount of 4 -( dimethylamino ) pyridine ( dmap )( aldrich , milwaukee , wis .). the mixture was shaken at room temperature for 2 h . the resin was washed with dmf and dcm and treated overnight with 2 . 5 mmol of n , n - diisopropylcarbodiimide ( dic )( chem - impex international , wood dale , ill . ), 2 . 5 mmol of 1 - hexanol , 2 . 5 mmol of hobt , and 0 . 025 mmol of dmap . after washing and drying , the peptide was cleaved off from the resin by using a mixture of tfa ( 9 . 5 ml ), h 2 o ( 0 . 85 ml ) and triisopropylsilane ( tis ) ( 0 . 85 ml ) for 2 h . the resin was filtered off and the filtrate was poured into 70 ml of ether . the precipitate formed was filtered off and washed thoroughly with ether . this crude product was dissolved into 5 % acetic acid and purified on a reverse - phase preparative hplc using a column ( 4 × 43 cm ) of c 18 dynamax - 100a 0 ( varian , walnut creek , calif .). the column was eluted with a linear gradient from 75 % a and 25 % b to 55 % a and 45 % b in an hour where a was 0 . 1 % tfa in water and b was 0 . 1 % tfa in acetonitrile . the fractions were checked by an analytical hplc . those containing pure product were combined and lyophilized to dryness . the purity of the compound was 92 . 8 %. yield was 8 . 6 %. electro - spray ionization mass spectrometry ( esi ms ) analysis gave a molecular weight for the product of 3369 . 4 ( in agreement with the calculated molecular weight of 3369 . 9 ). the titled peptide was synthesized according to the procedure described in example 1 for the synthesis of ( glu 3 ( o - hexyl )) hghrelin ( 1 - 28 )- nh 2 ( seq id no : 324 ), except as follows : fmoc - ser - oh was used at position 3 , fmoc - aib - oh was used at position 2 and boc - gly - oh was used at position 1 . after the peptide chain was assembled , the peptide - resin was treated with 25 % piperidine in dmf for 3 × 2 h . the resin was washed with dmf and treated with octanoic acid ( 2 . 5 mmol , 10 fold excess ), hbtu ( 2 . 2 mmol ), hobt ( 2 . 2 mmol ) and diea ( 7 . 5 mmol ) in dmf for 2 h . the resin was washed with dmf and then treated with octanoic acid ( 2 . 5 mmol ), dic ( 2 . 5 mmol ), hobt ( 2 . 5 mmol ) and dmap ( 0 . 025 mmol ) in dmf for 2 h . the final cleavage and purification procedures were the same as those in example 1 . the product was found to be homogenous by analytical hplc , with a purity of 99 % in 18 . 5 % yield . electro - spray ionization mass spectrometry ( esi ms ) analysis gave a molecular weight for the product of 3367 . 6 ( in agreement with the calculated molecular weight of 3367 . 0 ). the titled peptide was synthesized on an applied biosystems ( foster city , calif .) model 430a peptide synthesizer which was modified to do accelerated boc - chemistry solid phase peptide synthesis . see schnolzer , et al ., int . j . peptide protein res ., 40 : 180 ( 1992 ). 4 - methylbenzhydrylamine ( mbha ) resin ( peninsula , belmont , calif . ), with a substitution of 0 . 91 mmol / g was used . boc amino acids ( midwest bio - tech , fishers , ind . ; novabiochem ., san diego , calif .) were used with the following side chain protection : boc - ala - oh , boc - arg ( tos )- oh , boc - his ( dnp )- oh , boc - val - oh , boc - leu - oh , boc - gly - oh , boc - gln - oh , boc - lys ( 2clz )- oh , boc - ser ( bzl )- oh , boc - phe - oh , boc - glu ( ochex )- oh and boc - pro - oh . fmoc - glu ( otbu )- oh ( novabiochem ., san diego , calif .) was used for the residue at position 3 in the sequence . the synthesis was carried out on a 0 . 25 mmol scale . the boc groups were removed by treatment with 100 % tfa for 2 × 1 min . boc amino acids ( 2 . 5 mmol ) were pre - activated with hbtu ( 2 . 0 mmol ) and diea ( 1 . 0 ml ) in 4 ml of dmf and were coupled without prior neutralization of the peptide - resin tfa salt . coupling times were 5 min . at the end of the assembly of the first 25 residues on the abi 430a peptide synthesizer and before the coupling of fmoc - glu ( otbu )- oh , the protected peptide - resin was transferred into a reaction vessel on a shaker for manual synthesis . after removing the boc protecting group by using 100 % tfa for 2 × 1 min and washing with dmf , the resin was mixed with fmoc - glu ( otbu )- oh ( 2 . 5 mmol ) which was pre - activated with hbtu ( 2 . 0 mmol ), hobt ( 2 . 0 mmol ) and diea ( 1 . 0 ml ) in 4 ml of dmf . the mixture was shaken for 2 h . this coupling step was repeated . after washing with dmf , the resin was treated with a tfa solution containing 5 % water and 5 % tis for 2 h to remove the tbu protecting group in the side chain of the glu residue . the resin was neutralized with 10 % diea in dmf and washed with dmf and dcm . the resin was then treated with hexylamine ( 2 . 0 mmol ), dic ( 2 . 0 mmol ), hobt ( 2 . 0 mmol ) in 5 ml of dcm for 2 × 2 h . the resin was washed with dmf and treated with 25 % piperidine in dmf for 30 min to remove the fmoc protecting group . after washing with dmf and dcm , the resin was transferred into the reaction vessel on the abi 430a peptide synthesizer for the assembly of the rest two residues . at the end of the assembly of the whole peptide chain , the resin was treated with a solution of 20 % mercaptoethanol / 10 % diea in dmf for 2 × 30 min to remove the dnp group on the his side chain . the n - terminal boc group was then removed by treatment with 100 % tfa for 2 × 2 min . the peptide - resin was washed with dmf and dcm and dried under reduced pressure . the final cleavage was done by stirring the peptide - resin in 10 ml of hf containing 1 ml of anisole and dithiothreitol ( 50 mg ) at 0 ° c . for 75 min . hf was removed by a flow of nitrogen . the residue was washed with ether ( 6 × 10 ml ) and extracted with 4n hoac ( 6 × 10 ml ). this crude product was purified on a reverse - phase preparative hplc using a column ( 4 × 43 cm ) of c 18 dynamax - 100a 0 ( varian , walnut creek , calif .). the column was eluted with a linear gradient from 75 % a and 25 % b to 55 % a and 45 % b at flow rate of 10 ml / min in an hour where a was 0 . 1 % tfa in water and b was 0 . 1 % tfa in acetonitrile . fractions were collected and checked on an analytical hplc . those containing pure product were combined and lyophilized to dryness . 31 . 8 mg of a white solid were obtained . purity was 89 % based on analytical hplc analysis . electro - spray ionization mass spectrometry ( esi ms ) analysis gave the molecular weight at 3368 . 4 ( in agreement with the calculated molecular weight of 3368 . 9 ). ( i ) the titled peptide was synthesized according to the procedure described in example 3 for the synthesis of ( glu 3 ( nh - hexyl )) hghrelin ( 1 - 28 )- nh 2 ( seq id no : 326 ) with the following modifications : after the assembly of the first 25 residues using boc chemistry , the last 3 residues were assembled by employing fmoc chemistry . the following 3 fmoc amino acids were used : n - α - fmoc - s -( p - methoxytrityl )- l - cysteine ( fmoc - cys ( mmt )- oh ), fmoc - ser ( bzl )- oh and fmoc - gly - oh , which were purchased from novabiochem ( san diego , calif .). the fmoc amino acid ( 1 mmol ) was first pre - activated with hbtu ( 0 . 9 mmol ) and hobt ( 0 . 9 mmol ) in dmf before it was coupled to the peptide - resin . the synthesis cycle for the fmoc amino acids included : ( 1 ) washing with nmp , ( 2 ) removing fmoc protecting group with 20 % piperidine in nmp for 30 min , ( 3 ) washing with nmp , and ( 4 ) coupling with pre - activated fmoc amino acid for 1 h . ( ii ) at the end of the assembly of the entire peptide chain , the protected peptide - resin was treated with a solution of 20 % mercaptoethanol and 10 % diea in dmf for 2 × 30 min to remove the dnp group on the side - chain of the his residue . the mmt protecting group in the side - chain of the cys residue was then removed by using a solution of 1 % tfa and 5 % tis in dcm for 30 minutes and the peptide - resin was washed with dmf . ( iii ) 1 -( 2 - pyridyldithio ) decane was prepared by stirring 2 , 2 ′- dipyridyl disulfide ( 1 . 06 g , 4 . 8 mmol ), 1 - decanethiol ( 0 . 83 ml , 4 mmol ) and triethylamine ( 2 ml ) in propanol and acetonitrile ( 1 / 9 , v / v ) at room temperature for about 3 hours ( see carlsson et al ., biochem . j ., 1978 , 173 , 723 - 737 ). purification of the crude 1 -( 2 - pyridyldithio ) decane was performed using flash chromatography , eluting with a mixed solvent system of dcm / meoh ( 10 : 0 . 4 ). ( iv ) the peptide - resin from step ( ii ) was treated with the 1 -( 2 - pyridyldithio ) decane from step ( iii ) and diea ( 3 eq ., 0 . 75 mmol ) overnight in a mixed solvent system of dmf / 1 - propanol ( 7 : 3 ). the resin was then washed with dmf and the n - terminal fmoc protecting group was removed by treatment with 25 % piperidine in dmf for 30 min . the peptide - resin was then washed with dmf and dcm and dried under reduced pressure . ( v ) final cleavage was performed by stirring the peptide - resin in 10 ml of hf containing 1 ml anisole at about 0 ° c . for about 70 min . the purification procedure was the same as that described in example 3 . the target product ( yield 10 . 2 %) was found by analytical hplc to have a purity of 99 . 9 %. electro - spray ionization mass spectrometry ( esi - ms ) analysis gave the molecular weight at 3432 . 1 ( in agreement with the calculated molecular weight of 3432 . 1 ). other peptides of the invention can be prepared by a person of ordinary skill in the art using synthetic procedures analogous to those disclosed generally hereinabove and / or to those disclosed specifically in the foregoing examples , as were the compounds depicted in table 1 . the activity of the compounds of the invention at the ghs receptor can be and were determined using techniques such as those described in the examples provided below . in different embodiments a ghrelin analog has at least about 50 %, at least about 60 %, at least about 70 %, at least about 80 %, or at least about 90 %, functional activity relative to ghrelin as determined using one or more of the functional activity assays described below ; and / or has an ic 50 greater than about 1 , 000 nm , greater than about 100 nm , or greater than about 50 nm , using the receptor binding assay described below . with respect to ic 50 , greater refers to potency and thus indicates a lesser amount is needed to achieve binding inhibition . assays measuring the ability of a compound to bind a ghs receptor employ a ghs receptor , a fragment of the receptor comprising a ghrelin binding site , a polypeptide comprising such a fragment , or a derivative of the polypeptide . preferably , the assay uses the ghs receptor or a fragment thereof . a polypeptide comprising a ghs receptor fragment that binds ghrelin can also contain one or more polypeptide regions not found in a ghs receptor . a derivative of such a polypeptide comprises a ghs receptor fragment that binds ghrelin along with one or more non - peptide components . the ghs receptor amino acid sequence involved in ghrelin binding can be readily identified using labeled ghrelin or ghrelin analogs and different receptor fragments . different strategies can be employed to select fragments to be tested to narrow down the binding region . examples of such strategies include testing consecutive fragments about 15 amino acids in length starting at the n - terminus , and testing longer length fragments . if longer length fragments are tested , a fragment binding ghrelin can be subdivided to further locate the ghrelin binding region . fragments used for binding studies can be generated using recombinant nucleic acid techniques . binding assays can be performed using individual compounds or preparations containing different numbers of compounds . a preparation containing different numbers of compounds having the ability to bind to the ghs receptor can be divided into smaller groups of compounds that can be tested to identify the compound ( s ) binding to the ghs receptor . in an embodiment of the present invention , a test preparation containing at least 10 compounds is used in a binding assay . binding assays can be performed using recombinantly produced ghs receptor polypeptides present in different environments . such environments include , for example , cell extracts and purified cell extracts containing the ghs receptor polypeptide expressed from recombinant nucleic acid or naturally occurring nucleic acid ; and also include , for example , the use of a purified ghs receptor polypeptide produced by recombinant means or from naturally occurring nucleic acid which is introduced into a different environment . screening for ghs receptor active compounds is facilitated using a recombinantly expressed receptor . using a recombinantly expressed ghs receptor offers several advantages such as the ability to express the receptor in a defined cell system so that a response to a compound at the ghs receptor can more readily be differentiated from responses at other receptors . for example , the ghs receptor can be expressed in a cell line such as hek 293 , cos 7 , and cho not normally expressing the receptor by an expression vector , wherein the same cell line without the expression vector can act as a control . screening for compounds reducing ghs receptor activity is facilitated through the use of a ghrelin analog in the assay . the use of a ghrelin analog in a screening assay provides for ghs receptor activity . the effect of test compounds on such activity can be measured to identify , for example , allosteric modulators and antagonists . ghs receptor activity can be measured using different techniques such as detecting a change in the intracellular conformation of the ghs receptor , in the g - protein coupled activities , and / or in the intracellular messengers . preferably , ghs receptor activity is measured using techniques such as those measuring intracellular ca 2 + examples of techniques well known in the art that can be employed to measure ca 2 + include the use of dyes such as fura - 2 and the use of ca 2 + - bioluminescent sensitive reporter proteins such as aequorin . an example of a cell line employing aequorin to measure g - protein activity is hek293 / aeq17 ( button et al ., cell calcium , 1993 . 14 , 663 - 671 , and feighner et al ., science , 1999 , 284 , 2184 - 2188 ). chimeric receptors containing a ghrelin binding region functionally coupled to a different g - protein can also be used to measure ghs receptor activity . a chimeric ghs receptor contains an n - terminal extracellular domain ; a transmembrane domain made up of transmembrane regions , extracellular loop regions , and intracellular loop regions ; and an intracellular carboxy terminus techniques for producing chimeric receptors and measuring g - protein coupled responses are provided in , for example , international application number wo 97 / 05252 , and u . s . pat . no . 5 , 264 , 565 , both of which are hereby incorporated by reference herein . ghrelin analogs can be used to stimulate ghs receptor activity . such stimulation can be used , for example , to study the effect of ghs receptor modulation , to study the effect of growth hormone secretion , to look for or study ghrelin antagonists , or to achieve a beneficial effect in a subject . beneficial effects that can be achieved include one or more of the following : treating a growth hormone deficient state , increasing muscle mass , increasing bone density , treating sexual dysfunction in males or females , facilitating a weight gain , facilitating maintenance of weight , facilitating maintenance of physical functioning , facilitating recovery of physical function , and / or facilitating appetite increase . increasing weight or appetite can be useful for maintaining weight or producing a weight or appetite gain in an under weight subject , or in a patient having a disease or undergoing treatment that affects weight or appetite . in addition , for example , farm animals such as pigs , cows and chickens can be treated to gain weight . underweight subjects include those having a body weight about 10 % or less , 20 % or less , or 30 % or less , than the lower end of a “ normal ” weight range or body mass index (“ bmi ”). “ normal ” weight ranges are well known in the art and take into account factors such as a patient age , height , and body type . bmi measures your height / weight ratio . it is determined by calculating weight in kilograms divided by the square of height in meters . the bmi “ normal ” range is 19 - 22 . a . preparation of cho - k1 cells expressing the human recombinant ghs receptor the cdna for human growth hormone secretagogue receptor ( hghs - r1a , or ghrelin receptor ) was cloned by polymerase chain reaction ( pcr ) using human brain rna as a template ( clontech , palo alto , calif . ), gene specific primers flanking the full - length coding sequence of hghs - r , ( s : 5 ′- a t g t g g a a c g c g a c g c c c a g c g a a g a g - 3 ′( seq id no : 433 ) and as : 5 ′- t c a t g t a t t a a t a c t a g a t t c t g t c c a - 3 ′) ( seq id no : 434 ), and advantage 2 pcr kit ( clontech ). the pcr product was cloned into the pcr2 . 1 vector using original ta cloning kit ( invitrogen , carlsbad , calif .). the full length human ghs - r was subcloned into the mammalian expression vector pcdna 3 . 1 ( invitrogen ). the plasmid was transfected into the chinese hamster ovary cell line , cho - k1 ( american type culture collection , rockville , md . ), by calcium phosphate method ( wigler , m et al ., cell 11 , 223 , 1977 ). single cell clones stably expressing the hghs - r were obtained by selecting transfected cells grown in cloning rings in rpmi 1640 media supplemented with 10 % fetal bovine serum and 1 mm sodium pyruvate containing 0 . 8 mg / ml g418 ( gibco , grand island , n . y .). membranes for radioligand binding studies can be and were prepared by homogenization of the foregoing cho - k1 cells expressing the human recombinant ghs receptor in 20 ml of ice - cold 50 mm tris - hcl with a brinkman polytron ( westbury , n . y .) ( setting 6 , 15 sec ). the homogenates were washed twice by centrifugation ( 39 , 000 g / 10 min ), and the final pellets were resuspended in 50 mm tris - hcl , containing 2 . 5 mm mgcl 2 , and 0 . 1 % bsa . for assay , aliquots ( 0 . 4 ml ) were incubated with 0 . 05 nm ( 125 i ) ghrelin (˜ 2000 ci / mmol , perkin elmer life sciences , boston , mass . ), with and without 0 . 05 ml of unlabeled competing test peptides . after a 60 min incubation ( 4 ° c . ), the bound ( 125 i ) ghrelin was separated from the free by rapid filtration through gf / c filters ( brandel , gaithersburg , md . ), which had been previously soaked in 0 . 5 % polyethyleneimine / 0 . 1 % bsa . the filters were then washed three times with 5 - ml aliquots of ice - cold 50 mm tris - hcl and 0 . 1 % bovine serum albumin , and the bound radioactivity trapped on the filters was counted by gamma spectrometry ( wallac lkb , gaithersburg , md .). specific binding was defined as the total ( 125 i ) ghrelin bound minus that bound in the presence of 1000 nm ghrelin ( bachem , torrence , calif .). a . in vitro gsh receptor mediated intracellular ica 2 + mobilization the foregoing cho - k1 cells expressing the human gsh receptor were harvested by incubating in a 0 . 3 % edta / phosphate buffered saline solution ( 25 ° c . ), and washed twice by centrifugation . the washed cells were resuspended in hank &# 39 ; s — buffered saline solution ( hbss ) for loading of the fluorescent ca 2 + indicator fura - 2am . cell suspensions of approximately 10 6 cells / ml were incubated with 2 μm fura - 2am for 30 min at about 25 ° c . unloaded fura - 2am was removed by centrifugation twice in hbbs , and the final suspensions were transferred to a spectrofluorometer ( hitachi f - 2000 ) equipped with a magnetic stirring mechanism and a temperature - regulated cuvette holder . after equilibration to 37 ° c ., the ghrelin analogs were added for measurement of intracellular ca 2 + mobilization . the excitation and emission wavelengths were 340 and 510 nm , respectively . as is well known in the art , compounds may be tested for their ability to stimulate or suppress release of growth hormone ( gh ) in vivo ( see , e . g ., deghenghi , r ., et al ., life sciences , 1994 , 54 , 1321 - 1328 ; international application no . wo 02 / 08250 ). thus , for example , in order to ascertain a compound &# 39 ; s ability to stimulate gh release in vivo the compound may be injected subcutaneously in 10 - day old rats at a dose of , e . g ., 300 mg / kg . the circulating gh may be determined at , e . g ., 15 minutes after injection and compared to gh levels in rats injected with a solvent control . similarly , compounds may be tested for their ability to antagonize ghrelin - induced gh secretion in vivo . thus a compound may be injected subcutaneously in 10 - day old rats at a dose of , e . g ., 300 mg / kg , along with ghrelin . again the circulating gh may be determined at , e . g ., 15 minutes after injection and compared to gh levels in rats injected with ghrelin alone . ghrelin analogs can be formulated and administered to a subject using the guidance provided herein along with techniques well known in the art . the preferred route of administration ensures that an effective amount of compound reaches the target . guidelines for pharmaceutical administration in general are provided in , for example , remington : the science and practice of pharmacy 20 th edition , ed . gennaro , lippincott , williams & amp ; wilkins publishing , 2000 , and modem pharmaceutics 2 nd edition , eds . banker and rhodes , marcel dekker , inc ., 1990 , both of which are hereby incorporated by reference herein . ghrelin analogs can be prepared as acidic or basic salts . pharmaceutically acceptable salts ( in the form of water - or oil - soluble or dispersible products ) include conventional non - toxic salts or the quaternary ammonium salts that are formed , e . g ., from inorganic or organic acids or bases . examples of such salts include acid addition salts such as acetate , adipate , alginate , aspartate , benzoate , benzenesulfonate , bisulfate , butyrate , citrate , camphorate , camphorsulfonate , cyclopentanepropionate , digluconate , dodecylsulfate , ethanesulfonate , fumarate , glucoheptanoate , glycerophosphate , hemisulfate , heptanoate , hexanoate , hydrochloride , hydrobromide , hydroiodide , 2 - hydroxyethanesulfonate , lactate , maleate , methanesulfonate , 2 - naphthalenesulfonate , nicotinate , oxalate , pamoate , pectinate , persulfate , 3 - phenylpropionate , picrate , pivalate , propionate , succinate , tartrate , thiocyanate , tosylate , and undecanoate ; and base salts such as ammonium salts , alkali metal salts such as sodium and potassium salts , alkaline earth metal salts such as calcium and magnesium salts , salts with organic bases such as dicyclohexylamine salts , n - methyl - d - glucamine , and salts with amino acids such as arginine and lysine . ghrelin analogs can be administered using different routes including oral , nasal , by injection , transdermal , and transmucosally . active ingredients to be administered orally as a suspension can be prepared according to techniques well known in the art of pharmaceutical formulation and may contain microcrystalline cellulose for imparting bulk , alginic acid or sodium alginate as a suspending agent , methylcellulose as a viscosity enhancer , and sweeteners / flavoring agents . as immediate release tablets , these compositions may contain microcrystalline cellulose , dicalcium phosphate , starch , magnesium stearate and lactose and / or other excipients , binders , extenders , disintegrants , diluents and lubricants . administered by nasal aerosol or inhalation formulations may be prepared , for example , as solutions in saline , employing benzyl alcohol or other suitable preservatives , absorption promoters to enhance bioavailability , employing fluorocarbons , and / or employing other solubilizing or dispersing agents . ghrelin analogs may also be administered in intravenous ( both bolus and infusion ), intraperitoneal , subcutaneous , topical with or without occlusion , or intramuscular form . when administered by injection , the injectable solution or suspension may be formulated using suitable non - toxic , parenterally - acceptable diluents or solvents , such as ringer &# 39 ; s solution or isotonic sodium chloride solution , or suitable dispersing or wetting and suspending agents , such as sterile , bland , fixed oils , including synthetic mono - or diglycerides , and fatty acids , including oleic acid . suitable dosing regimens are preferably determined taking into account factors well known in the art including type of subject being dosed ; age , weight , sex and medical condition of the subject ; the route of administration ; the renal and hepatic function of the subject ; the desired effect ; and the particular compound employed . optimal precision in achieving concentrations of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug &# 39 ; s availability to target sites . this involves a consideration of the distribution , equilibrium , and elimination of a drug . the daily dose for a subject is expected to be between 0 . 01 and 1 , 000 mg per subject per day . ghrelin analogs can be provided in a kit . such a kit typically contains an active compound in dosage forms for administration . a dosage form contains a sufficient amount of active compound such that a desirable effect can be obtained when administered to a subject during regular intervals , such as 1 to 6 times a day , during the course of 1 or more days . preferably , a kit contains instructions indicating the use of the dosage form to achieve a desirable affect and the amount of dosage form to be taken over a specified time period . the invention has been described in an illustrative manner , and it is to be understood that the terminology which has been used is intended to be in the nature of words of description rather than of limitation . obviously , many modifications and variations of the present invention are possible in light of the above teachings . it is , therefore , to be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described . the patent and scientific literature referred to herein represents knowledge that is available to those with skill in the art . all patents , patent publications and other publications cited herein are hereby incorporated by reference in their entirety . it is to be understood that while the invention has been described in conjunction with the detailed description thereof , that the foregoing description is intended to illustrate and not limit the scope of the invention , which is defined by the scope of the appended claims . other aspects , advantages , and modifications are within the claims .

US-201414157770-A

the present invention relates to avirulent salmonella gallinarum variants by inactivating virulence gene clusters of salmonella gallinarum , a main pathogen of avian salmonellosis , and various uses thereof notably in the production of salmonella - specific lytic bacteriophages , pharmaceutical compositions and feed additives .

in order to accomplish the above objects , an aspect of the present invention provides the avirulent salmonella gallinarum variants which are remarkably decreased in pathogenicity . the salmonella gallinarum variants are rendered avirulent by inactivating at least one of the virulence gene clusters salmonella pathogenicity island - 1 , salmonella pathogenicity island - 2 , spvrabcd , and faehi . as used herein , the term “ virulence gene clusters of salmonella ” refers to the four gene clusters involved in the virulence of salmonella gallinarum , including the salmonella pathogenicity island - 1 ( hereinafter referred to as “ spi - 1 ”) operon coding for the structural proteins and toxic effector proteins of type iii secretion system , the salmonella pathogenicity island - 2 ( hereinafter referred to as “ spi - 2 ”) operon coding for the structural proteins and toxic effector proteins of type iii secretion system , the spvrabcd operon coding for pathogenically active proteins on avian salmonella - specific virulent plasmids , and the faehi operon coding for fimbriae . so long as it functionally works in salmonella gallinarum , any gene cluster may be used . the term “ gene cluster ,” as used herein , refers to a population of adjacent genes on a chromosome or a plasmid that are commonly responsible for the same products . the genes in one cluster are under the regulation of common regulatory genes . the inactivation of genes in bacteria can be achieved using various methods . for example , single or multiple nucleotides of an active site within a gene may be modified to decrease the activity of the protein expressed . alternatively , an antibiotic - resistant gene or other gene ( s ) may be inserted into the gene of interest to prevent the expression of intact proteins . the most reliable method is to delete the entire sequence of a gene from the genome ( russell c b et al ., j . bacteriol . ( 1989 ); 171 : 2609 - 2613 , hamilton c m et al ., j . bacteriol . ( 1989 ); 171 : 4617 - 4622 , link a j et al ., j . bacteriol . ( 1997 ); 179 : 6228 - 6237 ). in the present invention , entire sequences of the genes of interest are deleted to effectively promise the inactivation of the genes . for this , the one - step deletion method using lamda red recombinase , known as a method of deleting gene clusters , developed by datsenk k a et al ., may be employed ( datsenko k a et al ., pnas , ( 2000 ); 97 ( 12 ): 6640 - 6645 ). with regard to the information of virulence genes to be deleted , nucleotide sequences of spi - 1 and spi - 2 were obtained referring to the virulence gene sequences within the salmonella gallinarum chromosome ( salmonella enterica subsp . enterica serovar gallinarum str . 287 / 91 , nc 011274 ), disclosed by the ncbi . for the faehi operon sequence , reference was made to the sequence of the salmonella gallinarum virulence plasmid gene ( salmonella gallinarum virulence plasmid minor fimbrial subunit genes , af005899 ). for the spvrabcd operon , the sequence of the same name gene of salmonella typhimurium lt2 , which has highly homology with salmonella gallinarum , was consulted because its sequence is not disclosed in the ncbi . the sequencing of the spvrabcd operon of salmonella gallinarum was also performed with reference to the sequence of the corresponding gene of salmonella typhimurium . examples of the salmonella virulence genes clusters include the spi - 1 gene cluster ( seq id no : 1 ), the spi - 2 ( seq id no : 2 ), the spvrabcd operon ( seq id no : 3 ), and the faehi operon ( seq id no : 4 ) of salmonella gallinarum 287 / 91 . to prepare strains that had definitely been rendered avirulent , all of the plural virulence gene clusters were deleted . to inactivate many gene clusters in one strain , the gene clusters may have been deleted sequentially . in the present invention , a salmonella gallinarum strain in which only the spi - 2 gene cluster is inactivated ( sg3 - d2 ), a salmonella gallinarum strain in which both spi - 1 and spi - 2 gene clusters are integrally inactivated ( sg3 - d1d2 ) and a salmonella gallinarum strain in which all of the four virulence gene clusters ( spi - 1 , spi - 2 , spvrabcd , faehi ) are integrally inactivated ( sg3 - d4 ). sg3 - d2 is deposited under accession no . kccm 11009p , sg3 - d1d2 under accession no . kccm 11010p , and sg3 - d4 under accession no . kccm 11011p . studies on the independent deletion of individual genes of the gene clusters have been reported ( hapfelmeier s et al ., j immunol , ( 2005 ); 174 ( 3 ): 1675 - 1685 , brumme s et al ., vet microbiol , ( 2007 ); 124 ( 3 - 4 ): 274 - 285 , desin t s et al ., infect immun , july ( 2009 ); 2866 - 2875 ), but avirulent salmonella strains developed by integrally inactivating two or more entire gene clusters had not been disclosed prior to the study of the present inventors . the salmonella gallinarum strain was named salmonella gallinarum sg2293 - d2 when only the spi - 2 gene cluster is inactivated , and sg2293 - d1d2 when both spi - 1 and spi - 2 were integrally inactivated . further , it was named sg2293 - d4 upon the inactivation of all of spi - 1 , spi - 2 , spvrabcd , and faehi . to ascertain the avirulence thereof , the strains prepared by inactivating virulence gene clusters according to the present invention were assayed for the efficiency of invasion into avian epithelial cells and for disease outbreak and mortality (%) upon infection into poultry . preferably , the salmonella gallinarum strains in which the virulence gene clusters had been inactivated by transformation were allowed to invade avian epithelial cells so that invasion efficiency could be measured . also , the strains were injected into brown egg layers to measure mortality . in accordance with another aspect thereof , the present invention provides an avirulent salmonella strain for use in producing salmonella - specific lytic bacteriophages and a method for producing phages using the same . φcj1 ( us 20100135962 ), a salmonella - specific phage , was used to examine the bacteriophage productivity of the avirulent salmonella gallinarum variants . the phage shows a specific bactericidal activity against salmonella gallinarum and salmonella pullorum , belongs to the morphotype group of the family siphoviridae b1 , characterized by isometric capsid and long non - contractile tail , and has a total genome size of 61 kb and major structural proteins with a size of 38 kda and 49 kda . the method for producing a bacteriophage in accordance with the present invention comprises culturing the avirulent salmonella gallinarum variants in a medium , inoculating a bacteriophage into the medium , and recovering the bacteriophage . in this regard , the phage may be produced briefly using a plate or on a mass scale using broth . in the case of production using a plate , a bacteriophage is inoculated at a suitable ratio into bacteria when the bacteria enter a log phase , mixed with top agar , and poured onto a plate . when phage plaques appear , the top agar fractions are collected and centrifuged , followed by filtering the supernatant to afford a phage stock . for mass production as a broth , a mixture of phages and bacteria is prepared in the same manner as in plate production , and incubated for 5 hours in fresh broth , instead of in top agar . in accordance with a further aspect thereof , the present invention provides a pharmaceutical composition for the prevention of fowl typhoid , comprising the avirulent salmonella strain as an active ingredient and optionally a pharmaceutically acceptable vehicle , and preferably a vaccine for the prevention of fowl typhoid , formulated with the avirulent salmonella strain and optionally a pharmaceutically acceptable vehicle . the term “ pharmaceutically acceptable vehicle ,” as used herein , refers to a carrier or diluent which does not deteriorate the biological activity and property of the active ingredient and which does not irritate the subject . preparations intended for oral administration may take the form of tablets , troches , lozenges , aqueous or oily suspensions , powders , granules , emulsions , hard or soft capsules , syrups , elixirs , etc . in regards to the oral forms such as tablets and capsules , the active ingredient may be formulated in combination with a binder such as lactose , saccharose , sorbitol , mannitol , starch , amylpectin , conjugate such as cellulose or gelatin , an excipient such as dicalcium phosphate , a disintegrant such as corn starch or sweet potato starch , or a lubricant such as magnesium stearate , calcium stearate , sodium stearylfumarate or polyethylene glycol wax . as for capsules , they may further comprise a liquid carrier such as fatty oil . the composition of the present invention may be formulated into preparations for non - oral administration , such as subcutaneous injections , intravenous injections , or intradermal injections . for this , the composition of the present invention may be mixed with a stabilizer or buffer in water to give a solution or a suspension which is then formulated into unit doses such as ampules or vials . as used herein , the term “ vaccine ” refers to a biological preparation that improves immunity to a particular disease by inducing the formation of an antibody upon injection into the body , a preparation containing an antigen , e . g ., killed or attenuated forms of a disease - causing microorganism . vaccines may be prepared from killed pathogens . there are also live vaccines , but with the virulence thereof attenuated . the salmonella gallinarum variants of the present invention have the same antigenic proteins as those of the wild - type , but are greatly decreased in virulence compared to the wild - type , so that they can be used as live vaccines prophylactic of fowl typhoid . in accordance with still another aspect thereof , the present invention provides a feedstuff containing the avirulent salmonella gallinarum , and preferably a feed additive containing the avirulent salmonella gallinarum . when applied to poultry , the feed additive of the present invention serves as a live vaccine that prevents fowl typhoid . the feedstuff of the present invention may be prepared by mixing feedstuff with the salmonella gallinarum variant as it is or in the form of a feed additive . in the feedstuff , the salmonella gallinarum variant may be in a liquid or dry state . the dry state can be accomplished by various drying methods including , but not limited thereto , pneumatic drying , spontaneous drying , spray drying and freeze drying . in addition to the salmonella gallinarum variant of the present invention , the feedstuff of the present invention may further comprise a typical additive useful for improving the preservation of the feedstuff . the feedstuff comprising the salmonella gallinarum variant of the present invention may be vegetable matter such as a cereal , nut , a by - product of food processing , millet , fiber , pharmaceutical by - product , a vegetable oil , starch , oil seed meals and cereal remnants , or animal matter such as proteins , minerals , fats , mineral oils , unicellular proteins , animal planktons and leftover food etc . examples of the feed additive comprising the salmonella gallinarum variant of the present invention include , but are not limited to , various agents for preventing quality deterioration and improving utility , such as binders , emulsifiers , preservatives , amino acids , vitamins , enzymes , probiotics , flavoring agents , non - protein nitrogen compounds , silicates , buffer , colorants , extracts , oligosaccharides , etc . also , a mixing agent may be within the scope of the feed additive . in accordance with still a further aspect thereof , the present invention provides a method for treating the salmonella gallinarum infectious disease fowl typhoid using the pharmaceutical composition . the composition of the present invention may be administered to animals in the form of a pharmaceutical preparation to animals , or in the form of being mixed with feedstuff or water . preferably , it is mixed in the form of a feed additive with feedstuff before administration . so long as it allows the composition of the present invention to reach tissues or cells of interest , any administration route , such as non - oral , intraartery , intradermal , transdermal , intramuscular , intraperitoneal , intravenous , subcutaneous , oral or intranasal route , may be taken . the treating method of the present invention comprises administering the composition of the present invention in a pharmaceutically effective amount . it will be apparent to those skilled in the art that the suitable total daily dose may be determined by an attending physician within the scope of medical judgment . the specific therapeutically effective dose level for any particular patient may vary depending on a variety of factors , including the kind and degree of desired reaction , the specific composition , including the use of any other agents according to the intended use , the patient &# 39 ; s age , weight , general health , gender , and diet , the time of administration , the route of administration , and rate of the excretion of the composition ; the duration of the treatment ; other drugs used in combination or coincidentally with the specific composition ; and like factors well known in the medical arts . typically , the composition may be administered at a daily dose of from 10 4 to 10 8 cfu once or in a divided dosage manner . hereinafter , the present invention will be described in more retail with reference to examples . however , these examples are for illustrative purposes only , and the invention is not intended to be limited by these examples . screening of target genes to be inactivated through comparison of salmonella gallinarum virulence genes the first step of preparing avirulent avian salmonella strains was the screening of target virulence genes to be inactivated . salmonella pathogenicity island - 1 ( spi - 1 ), and salmonella pathogenicity island - 2 ( spi - 2 ), both of which are type three secretion system gene clusters essential for the delivery of the pathogenicity of salmonella , and spvrabcd and faehi , both of which are genes on virulence plasmids , were determined as target genes , and the data base of the ncbi was searched for the nucleotide sequences of the target genes ( salmonella enterica subsp . enterica serovar gallinarum str . 287 / 91 , nc 011274 ). because the nucleotide sequence of spvrabcd of salmonella gallinarum had not yet been disclosed , primers were synthesized with reference to the nucleotide sequence of the same name gene of salmonella typhimurium ( salmonella typhimurium lt2 plasmid pslt , nc 003277 ), which has high nucleotide sequence homology with salmonella gallinarum . as for the faehi operon , the information of its nucleotide sequence was obtained from salmonella gallinarum virulence plasmid minor fimbrial subunit genes ( af005899 ). preparation of avirulent variants by inactivation of virulence genes of salmonella gallinarum and by integration of the inactivated sites to delete ttss - related virulence genes of the wild - type salmonella gallinarum ( sgsc no . 2293 ) as determined in example 1 , the one - step deletion method using lamda red recombinase , developed by datsenko k a et al ., ( datsenko k a et al , pnas , ( 2000 ); 97 ( 12 ): 6640 - 6645 ), was employed . a chloramphenicol resistant gene of pkd3 was used as an antibiotic marker for identifying insertion into a target site of chromosome . using a pair of the primers spi - 1 - p1 ( seq id no : 5 ) and spi - 1 - p2 ( seq id no : 6 ) of table 1 , which correspond to 50 bp of 5 ′ flanking region of the avra and 50 bp of 3 ′ flanking region of the invh gene , wherein spi - 1 comprising from avra to invh is target for deletion , and a part of the chloramphenicol resistant gene of pkd3 , respectively , a polymerase chain reaction ( hereinafter referred to as “ pcr ”) was performed [ sambrook et al , molecular cloning , a laboratory manual ( 1989 ), cold spring harbor laboratories ], with pkd3 as a template . the obtained pcr product was gene fragment about 1100 bp long . in this regard , a pcr hl premix kit ( bioneer ) was used and 30 cycles of denaturation at 94 ° c . for 30 sec , annealing at 55 ° c . for 30 sec and elongation at 72 ° c . for 1 min was conducted . the pcr product was separated in 0 . 8 % agarose gel by electrophoresis and eluted at a desired band size . according to the method of datsenko k a et al ., the 1100 bp - long gene fragment was introduced into pkd46 - transformed , competent wild - type salmonella gallinarum , which was then spread over lb plates containing chloramphenicol ( 30 mg / l ). as for the resulting transformant , its gene was examined by pcr using a pair of the primers spi - 1 - p3 ( seq id no : 7 ) and spi - 1 - p4 ( seq id no : 8 ), which correspond to regions about 1 kb distant from both ends of the deletion target gene , respectively . the pcr product thus obtained was 3100 bp long , indicating that the spi - 1 gene cluster was inactivated . the resulting strain was cultured at 37 ° c ., a condition of removing the pkd46 vector , to select a strain that could not grow on an lb plate containing ampicillin ( 100 mg / l ). subsequently , the antibiotic marker inserted into the inactivated gene cluster was removed by transformation with pcp20 . the removal of the antibiotic marker was identified by pcr using the primers spi - 1 - p3 & amp ; spi - 1 - p4 . the resulting pcr product was 2000 bp long , also indicating the inactivation . afterwards , the strain which was now free of the antibiotic marker was cultured at 42 ° c . ( a condition of removing pcp20 ) to select a strain that could not grow on an lb plate containing ampicillin . the spi - 1 gene cluster - inactivated strain thus obtained was named sg3 - d1 ( salmonella gallinarum sg2293 :: δspi - 1 ). spi - 2 , spv , and fae gene clusters were also inactivated in the same manner as in the spi - 1 gene cluster . the resulting gene cluster - inactivated strains were named sg3 - d2 ( salmonella gallinarum sg2293 :: δspi - 2 , accession no . kccm 11009p ), sg3 - ds ( salmonella gallinarum sg2293 :: δspv ), and sg3 - df ( salmonella gallinarum sg2293 :: δfae ), respectively . primers used for deleting genes and for identifying gene deletion are summarized in table 2 , below . to integrally inactivate the gene clusters in one strain , the sg3 - d1 strain was sequentially subjected to the inactivation of spi - 2 , spvrabcd , and faehi gene clusters , using a method similar to that of example 2 - 1 . to begin with , pcr was performed using the primers spi - 2 - p1 ( seq id no : 9 ) and spi - 2 - p2 ( seq id no : 10 ) for the purpose of inactivating the spi - 2 cluster gene , with pkd4 serving as a template , resulting a 1600 bp gene fragment . this pcr product was introduced into the sg3 - d1 strain in which pkd46 vector remained ( example 1 - 2 ), followed by spreading the bacteria over an lb plate containing kanamycin ( 50 mg / l ). as for the resulting transformant , its gene was examined by pcr using a pair of the primers spi - 2 - p3 ( seq id no : 11 ) and spi - 2 - p4 ( seq id no : 12 ), which correspond to both flanking regions of the deletion target gene . the pcr product thus obtained was 3600 bp long , indicating that the spi - 2 gene cluster was inactivated . the resulting strain was cultured at 37 ° c ., a condition of removing the pkd46 vector , to select a strain that could not grow on an lb plate containing ampicillin ( 100 mg / l ). subsequently , the antibiotic marker inserted into the inactivated gene cluster was removed by transformation with pcp20 . the removal of the antibiotic marker was identified by pcr using the primers spi - 1 - p3 & amp ; spi - 1 - p4 in case of spi - 1 and the primers spi - 2 - p3 & amp ; spi - 2 - p4 in case of spi - 2 . the resulting pcr product was 2000 bp long , also indicating that the inactivation had taken place . afterwards , the strain free of the antibiotic marker was cultured at 42 ° c . ( a condition of removing pcp20 ) to select a strain that could not grow on an lb plate containing ampicillin . the spi - 1 and spi - 2 gene cluster - inactivated strain thus obtained was named sg3 - d1d2 ( salmonella gallinarum sg 2293 :: δspi - 1δspi - 2 , accession no . kccm 11010p ). in sg - d1d2 strain , spvrabcd and faehi gene clusters were further inactivated . to this end , the spvrabcd gene cluster ( the kanamycin - resistant gene of pkd4 was used as an antibiotic marker ) was inactivated in the same manner as in the inactivation of spi - 1 in example 1 - 2 , while the inactivation of the faehi gene cluster ( the chloramphenicol - resistant gene of pkd3 was used as an antibiotic marker ) was conducted in the same manner as in the inactivation of spi - 2 in the spi - 1 - inactivated strain . as for the resulting transformants , their genes were examined by pcr using the primer set spv - p3 ( seq id no : 15 ) and spv - p4 ( seq id no : 16 ) for spvrabcd deletion , and the primer set fae - p3 ( seq id no : 19 ) and fae - p4 ( seq id no : 20 ) for faehi deletion , which correspond to regions about 1 kb distant from both ends of the respective deletion target genes . the pcr products thus obtained were 3600 bp , 3100 bp long respectively , indicating that the spvrabcd and faehi gene clusters were inactivated . the resulting strain was cultured at 37 ° c ., a condition of removing the pkd46 vector , to select a strain that could not grow on an lb plate containing ampicillin ( 100 mg / l ). the salmonella gallinarum strain in which all of the four gene clusters spi - 1 , spi - 2 , spvrabcd and faehi were integrally inactivated was named sg3 - d4 ( salmonella gallinarum sg2293 :: δspi - 1δspi - 2δspvrabcdδfaehi ) and deposited under accession no . kccm 11011p . nowhere has the genetic information on spvrabcd of salmonella gallinarum ( sgsc no . 2293 ) been disclosed yet . its nucleotide sequence was analyzed in the present invention . for this , primers were synthesized as summarized in table 3 , below . assay of virulence gene - inactivated salmonella gallinarum sg2 - d4 for avirulence by measurement of invasion efficiency into avian epithelial cell salmonella gallinarum and salmonella pullorum , which are unique salmonella species due to the lack of a motile flagella , are specifically infected to avian cells and can invade other animal cells but at very low efficiency . in this example , an in vitro cell invasion assay was conducted ( henderson s c et al , infect immun , ( 1999 ); 67 ( 7 ): 3580 - 3586 ) on the avian epithelial cell line bat ( budgerigar abdominal tumor ), provided from md . lee , georgia university . the avirulent salmonella gallinarum variants sg3 - d1d2 and sg3 - d4 , developed by the above - described gene deletion method , were expected to invade the host cell with very low efficiency by reduced level of ttss - related protein . a recent research review on the infection mechanisms of pathogenic microorganisms has it that even when only a specific gene of spi - 1 is deleted , the salmonella strain shows a decrease in invasion efficiency into epithelial cells ( lostroh c p et al , microbes infect , ( 2001 ); 3 ( 14 - 15 ): 1281 - 1291 ). in the present invention , ttss - related gene deletion was proven to lead to a decrease in virulence by measuring the efficiency of the invasion of the avian salmonella variants into the avian epithelial cell line bat . invasion efficiency into avian epithelial cells was measured on 24 - well plates in triplicate , and mean values of three measurements were given . the bat cell line was cultured at 37 ° c . in dmem supplemented with 10 % fetal bovine serum , 1 mm glutamine , 100 iu / ml penicillin and 100 μg / ml streptomycin under the condition of 5 % co 2 . the bat cell line was seeded at a density of 2 . 5 × 10 5 cells / well into 24 - well plates and incubated at 37 ° c . for 1 ˜ 2 days in a 5 % co 2 incubator to form monolayers of cells . after distribution of the cell and incubation for one day , the culture medium was changed out with antibiotic - free dmem . for comparison of invasion efficiency , wild - type salmonella gallinarum sg3 ( sgsc #: 2293 ), the virulence gene - inactivated salmonella gallinarum variants sg3 - d1 , sg3 - d2 , sg3 - d1d2 and sg3 - d4 , and sg9r , which is a commercially available live vaccine , were employed , with the non - pathogenic e . coli mg1655 serving as a control . after being primarily seed cultured , all of test bacteria were vigorously incubated for 4 ˜ 5 hours in a main lb medium , and the cultures were diluted to od 600 = 1 . 0 . to 200 μl of the animal cells incubated in the antibiotic - free medium , 200 μl of each of the culture dilutions was added so that the bacteria were aliquoted at a concentration of 2 . 0 × 10 8 cfu / ml per well . the plates were incubated at 37 ° c . for one hour in a 5 % co 2 atmosphere to allow the bacteria to penetrate into the epithelial cells . thereafter , the medium was aspirated off and the plates were washed with 1 × pbs to remove remaining microorganisms . then , the epithelial cells were incubated at 37 ° c . for 2 hours in the presence of 50 μg / ml gentamycin in a 5 % co 2 incubator to clear the microorganisms remaining outside the cells . the antibiotic was removed by washing with 1 × pbs . to examine the microorganisms which succeeded in penetrating into the epithelial cells , the animal cells were lyzed for 15 ˜ 30 min in 500 μl of 0 . 1 % triton x - 100 . the cell lysates were spread over lb plates and incubated overnight at 37 ° c . so that the microorganisms that had grown could be counted . to calculate the invasion efficiency , 200 μl of the microorganism culture with od 600 = 1 . 0 was also incubated . invasion efficiency (%)= count of microorganisms invaded to cell / count of microorganisms within culture medium ( od 600 = 1 . 0 )× 100 the bat cell invasion efficiencies of the four transformed salmonella gallinarum variants prepared by the inactivation of virulence gene clusters were calculated . of them , the variant in which only the spi - 1 gene cluster , responsible for cell invasion mechanism , was inactivated , was decreased in invasion efficiency by 84 % compared to the wild - type . the sg3 - d1d2 variant with the deletion of both spi - 1 and spi - 2 and the sg3 - d4 variant with the deletion of all the four gene clusters were found to decrease in cell invasion efficiency by approximately 89 % and 91 %, respectively , compared to the wild - type salmonella gallinarum ( sg3 ). the variants of the present invention were also remarkably reduced in invasion ability , in comparison to that of the commercially available live vaccine nobilis sg9r . these data demonstrated that the inactivation of ttss - related gene clusters decreases the virulence of salmonella gallinarum ( see table 4 and fig2 ). the avirulence of salmonella gallinarum variant sg3 - d4 was confirmed in vitro test which shows extremely low in invasion efficiency into avian epithelial cells , as was reconfirmed in animal tests and the results are given in example 4 . assay of salmonella gallinarum sg3 - d4 for avirulence by measuring mortality of chickens the research institute of veterinary science , seoul national university , was entrusted with this assay . one - week - old brown egg layers ( hy - line chicken ) were employed in this assay , and they were divided into many groups of 10 which were separated in respective chicken houses before infection with pathogens . no vaccine programs were used on the experimental animals after they hatched . five avian salmonella strains including the wild - type salmonella gallinarum sg3 ( sgsc #: 2293 ), the virulent gene cluster - inactivated salmonella gallinarum sg3 - d2 and sg3 - d4 ( identified to decrease in virulence by in vitro invasion assay ), the commercially available live vaccine nobilis sg9r , and the non - pathogenic e . coli mg1655 were employed in the in vivo assay . after being primarily seed cultured , the five strains were vigorously incubated for 4 ˜ 5 hours to od 600 = 1 . 0 in a main lb medium , and the concentration of each of the cell cultures was adjusted to 1 . 0 × 10 8 cfu / ml . the bacteria was subcutaneously injected at an adjusted dose into the chickens which were the monitored for two weeks for mortality . subsequently , the chickens which were alive were autopsied to examine lesions and to isolate bacteria . for the two weeks after artificial infection of the pathogens ( 1 . 0 × 10 8 cfu / ml ), the chickens infected with salmonella gallinarum ( sg3 ) were observed and showed typical external syndromes such as low motility , blue diarrhea and low uptake of feedstuff , and looked to be dying . the mortality was not high , but an autopsy disclosed lesions in almost all the chickens . in contrast , the chicken group infected with the salmonella gallinarum variant ( sg3 - d4 ) the avirulence of which was proven by in vitro invasion assay were observed to actively move and not die although some of them had diarrhea during the two weeks . also , they were found to have almost no lesions in the autopsy . therefore , the salmonella gallinarum variant of the present invention was again proven to have greatly decreased virulence . the chicken groups infected with the sg3 - d2 variant in which the gene responsible for primary invasion into host cells remains intact while the spi - 2 gene involved in systemic infection and survival over phagocytosis is inactivated , or with the sg3 - ds variant in which the spv gene known to participate in pathogenicity is inactivated , were observed to have low or no mortality (%). thus , even the inactivation of single gene clusters had a great influence on the reduction of pathogenicity ( see table 5 ). according to autopsy findings , the liver and spleen were swollen and weakened , with the significant frequency of greenish brown or bluish green liver lesions , in the chicken group infected with the wild - type salmonella gallinarum ( sg3 ). like the commercially available live vaccine nobilis sg9r or the non - pathogenic e . coli mg1655 , however , the virulent gene cluster - inactivated variants of the present invention ( sg3 - d1d2 and sg3 - d4 ) were found to produce almost no lesions , and were demonstrated to be harmless to chickens . comparison of the productivity of φcj1 bacteriophage specific to salmonella gallinarum variants ultimately , the development of avirulent salmonella stains is to apply to the production of salmonella - specific lytic bacteriophages . the salmonella variants prepared in example 2 were proven to have greatly attenuated virulence in examples 3 and 4 . finally , φcj1 ( korean patent application no . 10 - 2008 - 121500 / us20100135962 ), which specifically infects avian salmonella , was used to examine a difference in bacteriophage productivity between the wild - type and the avirulent salmonella gallinarum variants . the avian - specific bacteriophage φcj1 was cultured on a mass scale , with the wild - type salmonella gallinarum strain ( sg3 ) or the variant serving as a host cell . for this , each bacterial strain was cultured to an od 600 of 0 . 5 ( 2 . 5 × 10 10 colony forming units ( cfu )) in 50 ml of lb broth in a flask with agitation . φcj1 was inoculated at 1 . 25 × 10 9 pfu ( plaque forming unit ) to form an moi ( multiplicity of infection ) of 0 . 05 , and allowed to stand for 20 min at 37 ° c ., followed by additional incubation at 37 ° c . for 4 hours . chloroform was added in an amount of 2 % of the final volume and shakes for 20 min . after passage of the supernatant through a 0 . 2 μm filter , the titer of φcj1 was counted . φcj1 was produced at a titer of 6 × 10 11 pfu / ml from the wild - type strain ( sg3 ) and at a titer of 8 × 10 10 pfu / ml from the avirulent salmonella gallinarum variant ( sg3 - d4 ). these data demonstrated that the avirulent variants prepared by inactivating virulence gene clusters have no problems with infection with bacteriophages and can be used as host cells for producing bacteriophages ( see table 6 ). in addition , φcj2 ( us 20100158870 ) and φcj3 ( us 20100166709 ), which were both developed by the same applicant , were produced using the variant as a host cell . the host cell was found to allow the production of φcj2 at a titer of approximately 2 × 10 10 pfu / ml and φcj3 at a titer of approximately 5 × 10 9 pfu / ml . like φcj1 , φcj2 and φcj3 were produced from the variant of the present invention , without significant difference from the wild - type . as described hitherto , the avirulent salmonella gallinarum variants , prepared by inactivating virulence genes , according to the present invention are useful as host cells for effectively producing salmonella - specific lytic bacteriophages on an industrial scale with the advantage of cost saving . the avirulent salmonella gallinarum variants simplify the purification process taken to remove toxicity after bacteriophage production , thus greatly reducing the production cost and solving the safety problem of the products . in addition , the variants can be used as live vaccines that guarantee higher immunological effects and safety than do conventional vaccines . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims .

US-201113274854-A

a wavefront sensing system for determining the wave aberration of an eye comprises a fixation target configured to keep the eye focus at its far accommodation point by illuminating the fixation target with a light source at a location optically conjugate to the cornea of the eye , an illumination light source configured to produce a compact light source at the retina of the eye , and a wavefront sensor configured to measure the outgoing wavefront originated from the compact light source at the retina . the compact light source at the retina of the eye in the wavefront sensing system is obtained by illuminating the cornea of the eye with a fixed divergent beam that is optimized for a normal population without the need of a refractive correction for the focus error and astigmatism . the outgoing wavefront originated from the compact light source at the retina is refracted by a cylindrical lens before being measured if the wavefront sensor is a hartmann - shack sensor . the wavefront sensing system can include a non - contact opto - sensor configured to detect the left and the right eye automatically during a wavefront measurement .

fig1 illustrates a schematic diagram of a wavefront - sensing system 100 in accordance with the present invention . a fixation system 110 is provided to stabilize the tested eye for accommodation control ( i . e . the control of the eye &# 39 ; s focus position ). a collimated light source 120 is converted to a small divergent beam of light by a negative spherical lens 121 . the divergent beam is reflected off a beam splitter ( bs 2 ) and generates a compact light source ( s ) at the retina of the eye . the compact light beam illuminates the eye &# 39 ; s retina and is diffusely reflected by the retina . the illumination light beam for the compact light source at the retina is referred as the probing light beam or the illumination light beam . the reflected light propagates to the eye &# 39 ; s cornea and forms a distorted wavefront at the cornea plane . the distorted wavefront is reflected off a beam splitter bs 1 and then relayed by an optical relay system 130 to a hartmann - shack wavefront sensor 140 . the optical relay system 130 consists of lenses ( l 1 ) and ( l 2 ). a cylindrical lens 141 introduces a fixed cylindrical wave to the wavefront from the eye before it enters hartmann - shack wavefront sensor 140 . the hartmann - shack wavefront sensor 140 includes a lenslet array 142 and an image sensor . the lenslet array 142 converts the distorted wavefront to an array of focus spots on the image sensor . an image analysis module 150 detects the focus spots and calculates the slopes of the wavefront . a wavefront estimator 160 reconstructs the wavefront using the slopes of the wavefront . a vision diagnosis module 170 determines the eye &# 39 ; s optical quality and optical defects , which can provide the basis for a vision correction diagnosis . fig2 a shows a schematic diagram of a conventional fixation system 200 using incoherent light and an uncontrolled pupil size . a target object 203 is illuminated by an incoherent light source 201 through a diffuser 202 . a lens 204 is placed next to the target object 203 . the distance between the target object 203 and the lens 204 is adjustable . at the beginning of a measurement , the lens 204 is located at a distance relative to the target object 203 such that the target object 203 is out of focus to the eye . the lens 204 is then moved toward the object to bring the target object 203 in focus to the retina of the eye ( 206 ) through the optics of the eye ( 205 ). in order to make the tested eye accommodate at its far point , the lens can be moved away from the target object 203 at the final stage of the measurement to bring the target object 203 out of focus again to the eye . the last defocusing movement is often referred to as fogging . fig2 b shows an improved fixation system 210 compatible with a wavefront - sensing system 100 in accordance with the present invention . a small pinhole aperture 213 is set optically conjugate to the cornea plane 216 . the pinhole aperture 213 is illuminated by a light emitting diode ( led ) 211 through a diffuser 212 providing a spatially coherent light source . the target object 214 is illuminated by the spatially coherent light from the pinhole aperture 213 . the target object 214 is then imaged on the retina 217 of the eye through lens 215 and the lens optics 216 of the eye . the target object 214 is set at a fixed position throughout the measurement . there is no moving part in the wavefront measurement . for the normal population , the target object 214 is set at + 6 d ( diopters ) for the emmotropic eyes . the target object 214 contains broad spatial frequencies up to 60 cycles / deg like a siemens section star . the conventional fixation system 200 uses an incoherent light source and the entire pupil of the eye for all spatial frequency . in contrast , the improved fixation system 210 uses a coherent light source and coherent imaging system , in which different effective pupil sizes are used for different spatial frequencies . the distribution of the illumination light near the eye &# 39 ; s cornea is the fourier spectra of the fixation target . the low frequency components of the fixation target are distributed at the center of the pupil whereas the high frequency components are away from the pupil center . therefore , the high spatial frequencies use a large effective pupil size and are more sensitive to focus error . low spatial frequencies use a smaller effective pupil size . the use of a smaller effective pupil size yields also a large depth of focus . the improved fixation target system 210 includes the following advantageous features . first , the fixation target is out of focus for the tested eyes from the near point to the far point because the fixation target is in focus only for hyperopic eyes at + 6 d . this is important for the tested eye to try to accommodate at its far point for the best image quality available . second , the wave aberration of the eye is measured at its far focus point because the tested eye has the best image quality when the eye accommodated at its far point . third , a significant portion of the fixation target is always visible because of small effective pupil for low spatial frequencies and long depth of focus . visible fixation target prevents measuring eye &# 39 ; s wave aberration at a random different focus state . finally , the improved fixation target system 210 contains no moving part , which allows for instant wavefront measurement and leads to a low cost system . wavefront sensor for the eye requires a compact light source at the retina . fig3 a shows a retinal point - spread function with a small amount of focus error . the distribution of the point image is center symmetric . fig3 b shows the normalized profiles of the point - spread functions for different amounts of focus errors . when the focus error is within a ¼ wave , the point spread function appears to be diffraction - limited containing a strong central peak and much weaker side - peaks . as wavefront error is increased , the central peak decreases whereas the side peaks increase . the central peak becomes lower than the side peak when the focus error is greater than a ¾ wavelength . the retinal point - spread function is compact with a strong central peak and much weaker side peaks within ½ wave focus error as seen in fig3 b . therefore , the threshold for the acceptable wavefront errors is chosen to be less than ½ wave . by relaxing the threshold for the wavefront error from ¼ wavelength for diffraction - limited imaging to ½ wavelength for a compact distribution , a given probing light beam can be used to measure eyes having twice the focus range for a fixed aperture . fig4 a shows the characteristics of a probing light beam on the retina in accordance with the present invention . a divergent beam 400 of − 3 d rather than a collimated beam is used to illuminate the corneal plane . the divergent beam 400 is kept fixed during the measurement . the beam is uniform and approximately 0 . 6 mm in diameter at the corneal plane . the probing light beam is designed to be located at the center of the normal population with naked - eye refractive error ranging from − 12 d to + 6 d . fig4 b shows the simulated point spread functions of the probing beam 400 illustrated in fig4 a . the wavefront error within the illumination beam is one half wavelength for an eye with a spherical correction of + 6 d and − 12 d , and one quarter wavelength for an eye with a spherical correction of 0 d and − 6 d . compact light sources can be formed at the retina of the eye having spherical refractive errors of + 6 d , 0 d , − 6 d and − 12 d . the wavefront sensor for the eye measures aberrations of the eye by sensing the outgoing wavefront originated from a compact light source at the retina . fig5 a shows wavefront measurements with a lenslet array 510 in a conventional wavefront sensing system . the distorted wavefront 505 is focused by the lenslet array 510 on the image plane 515 . the focus spots 520 are formed by the lenslet array 510 , which are distributed in an approximate square pattern as the lenslet array . an image sensor 525 is positioned at the image plane to capture the image of the focus spots . since low - cost image sensors 525 are typically of a rectangular shape with an aspect ratio of 3 to 4 , the focus spots 520 may be distributed outside of the image sensor 525 along the short axis of the image sensor 525 , as shown in fig5 b . as shown in fig1 and fig5 c , a positive cylindrical lens 141 is placed in front of the wavefront sensor in accordance with the present invention . the cylinder lens 141 reduces the length of the image along the short axis of the image sensor 545 , but does not change the spot pattern in the long axis . the cylindrical lens 141 can be placed at an optically conjugate position relative to the lenslet array 510 . the cylindrical lens 141 thus produces a rectangular distribution of focus spots 540 to better match a rectangular image sensor 545 , as shown in fig5 d . the use of the rectangular - shaped video image sensor 545 can significantly reduce the cost for wavefront sensing of eye . proper selection of the cylindrical lens is important in using a rectangular image sensor . first , the power of the cylinder lens should be properly chosen so that the astigmatism induced by the cylindrical lens within each lenslet is less than ¼ to ⅛ wavelength . the astigmatism in each lenslet is given by where φ a is the cylindrical power of the cylindrical lens in diopters and d is aperture size of each lenslet . second , the reduction of wavefront sensor image along the short axis is represented by where x is radius of eye &# 39 ; s pupil , f the focal length of the lenslet , and f a is the focal length of the cylindrical lens . if x = 3 . 5 mm , f = 40 mm , f a = 165 mm , the reduction along the short axis is 1 . 5 mm . for a ⅔ inch camera , the long axis and short axis are 6 . 6 mm by 8 . 8 mm , respectively . a reduction of 1 . 5 mm in the short axis increase the chip size effectively to 8 . 1 mm from 8 . 8 mm , which is significant for using inexpensive ccd chips . fig6 a illustrates a schematic diagram of a non - contact od / os sensor for left and right eye of a patient . an optical sensor 601 consists of a led light source 602 and a photo - detector 603 . the optical sensor 601 is mounted together with the movable wave sensing system , which can be moved between a left - eye measurement position and a right - eye measurement position . a reflective object 604 is mounted on a stationary base on the right eye side . the optical sensor 601 needs to have proper range of sensing distance ( sd ) to handle the variation in the vertical distance between the eyes and the chin . during a wavefront measurement , a patient &# 39 ; s head is usually supported by a chin - rest and head - rest so that the tested eye is fixed in the air . the exact corneal location of the tested eye can be different from eye to eye . in order to measure the wavefront at the corneal plane , the wavefront sensor system together with the optical sensor 601 must be moved towards or away from the tested eye . since the reflective object is fixed on the stationary base , the optical sensor 601 is required to function in a sensing distance ( sd ) between 5 mm to 30 mm . when the optical sensor 601 is at the right - eye measurement position , the light from the led light source 602 is reflected off the reflective target 604 and sensed by the photo detector 603 . the optical sensor 601 outputs a logic “ 0 ” as shown in fig6 b . when the optical sensor 601 is moved to the left - eye measurement position , no light signal is detected by the photo detector 603 . the photo sensor outputs a logic “ 1 ”. the eye position information is recorded to specify the wavefront sensing data collected from each eye to prevent mismatch of wavefront sensing data from the two eyes . in another embodiment , the probing light beam is designed to be moved within the eye &# 39 ; s pupil to avoid potential anomalous locations in the optics of the tested eye . patients may have abnormal aberrations that may create anomalous distributions for the probing light . if a narrow probing light beam enters the eye at locations with strong irregularity , it can cause problem in forming a compact probing light at the retina of the tested eye . in order to ensure to always obtain an acceptable wavefront measurement , a narrow probing beam can be moved within the pupil to a number of locations in the pupil . only acceptable wavefront measurements are selected and averaged as the final wavefront measurement . fig7 shows the configurations of the movement of the probing light beam relative to the eye &# 39 ; s pupil , including : a position - adjustable small beam 701 , a translating and vertically scanning small beam across eye &# 39 ; s pupil 702 , a rotating small beam over the eye &# 39 ; s cornea 703 , a slit beam 704 , rotating slit beam 705 , a translating and laterally scanning slit beam 706 , and an alternating small beams 707 . many optical designs could be used to achieve these proposed configurations of probing beam . fig8 a shows the configuration 702 that scans a narrow probing light beam across the pupil in one direction . light from a point light source 801 is imaged through a lens 802 and filtered by an aperture 803 to a cone - shaped narrow light beam . the narrow light beam is imaged on to a galvo - scanner 804 that is at the focal plane of a positive lens 805 . as the galvo - scanner 804 rotates around its axis , it raster - scans the reflected narrow beam across the cornea of the patient &# 39 ; s eye , as shown in the insertion 702 . fig8 b shows the arrangement for rotating a narrow probing light beam across the pupil . light from a point light source 811 is expanded by the lens 812 . a screen 813 with a small aperture is placed between the eye and the expanded beam . rotating the screen 813 and the aperture creates a circularly moving light beam within the pupil of the eye , as shown in the insertion 703 . a number of embodiments have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . for example , advantageous results still could be achieved if steps of the disclosed techniques were performed in a different order and / or if components in the disclosed systems were combined in a different manner and / or replaced or supplemented by other components . accordingly , other embodiments are within the scope of the following claims .

US-29361105-A

a sifting apparatus and container for storing and dispensing material , such as cosmetic powder are described . two sifters are arranged so their holes are not aligned , and a resilient material is placed between the sifters to create a gap that allows powder to pass out from a storage cavity to a surface accessible by the user . in a second configuration , at least one of the sifters is displaced toward the other sifter to reduce or eliminate the gap , thus reducing or preventing the flow of material through the sifters .

containers having displacement sifter mechanisms will now be described with reference to the figures . the sifter mechanism may have one or more sifters , each sifter having one or more holes . the holes in the sifter may be uniform or varied both in size , topography , shape , and so forth . while the disclosure is described in the context of sifters for powdered cosmetics products , the displacement sifter mechanisms may be useful for other powdered or powder - like products , such as baby powder , foot powder , medicinal powders , and the like . they may also be useful for handling liquids and other non - powdered material . fig1 shows an exploded view of a container 100 having a displacement sifter mechanism according to one exemplary implementation . in this configuration , the displacement sifter mechanism may be referred to as a compression sifter as a compression member may be placed between two sifter portions . in a displacement sifter 102 , a gap between portions of the first sifter 104 and a second sifter 106 provides a pathway for material to pass between the storage cavity 108 in a base 110 and the dispensing surface 112 . when the sifters are displaced toward one another , this gap is reduced , which obstructs the pathway and thus prevents material from being passed by the sifters . the displacement may be provided by pressure from a cover 114 engaging a bottom portion 116 comprising the base 110 , the first sifter 104 , and the second sifter 106 , through engagement with a lever or cam , by rotating a threaded member , or through any other suitable displacement mechanism . the container 100 may be provided with a first sifter 104 engaged with the base 110 in such a fashion as to leave a storage cavity 108 . the first sifter 104 may be integral to the base or may be secured or fixed to the base 110 by friction , glue , threaded engagement , ribs or other contoured features , or other suitable means . the first sifter 104 may have one or more holes 118 for sifting loose material , such as facial powder , makeup , or the like , stored within the storage cavity 108 . the first sifter 104 may also have one or more protrusions 120 extending toward and aligned with holes 122 in the second sifter 106 . here the protrusions 120 are shown shaped as truncated cones ; however they may be in any suitable shape including cones , cylinders , pyramids , hemispheres , cubes , and so forth . the second sifter 106 , which is engaged with the first sifter 104 , may have a circumferential rim 124 and an upper surface 112 for dispensing and / or retrieving material via the holes 122 . although not shown , the second sifter 106 may also have protrusions aligned with the holes 118 in the first sifter 104 a cover 114 may be removably affixed to any portion of the bottom portion 116 . the base 110 may be filled with material in several ways . for example , the storage cavity 108 in base 110 may be filled with material , then the first sifter 104 and remaining components are assembled . fig2 shows an elevational view of the container 100 of fig1 in its closed position wherein the cover 114 and base 110 are proximate and engaged . as shown in fig1 - 5 , the cover 114 is secured to the base 110 using threads ; however the cover 114 may be secured to the base 110 , or to a potion of the bottom portion 136 , using a rib , groove , hinge , clasp , latch , or other suitable means . fig3 shows a top plan view of the cover 114 of the container of fig1 . other shapes for the container are also possible . for example , the container 100 , or any portion thereof , may be round , elliptical , triangular , cubical , conical , spherical , or other shape suitable for mounting the sifters and providing a storage cavity . fig4 shows a cross - sectional view of the container of fig1 in the “ closed ” position . the second sifter 106 may be secured to the first sifter 104 by friction or other suitable means . additionally or alternatively , one or more ribs , or tabs 402 on the first sifter 104 may be configured to engage with one or more grooves 404 in the second sifter 106 . groove 404 may be a generally circular groove along the outer circumference of second sifter 106 . as shown in fig4 , the holes 122 in the second sifter 106 are aligned with protrusions 120 which extend from the first sifter 104 towards the second sifter 106 . the pressure from the cover 114 in a closed position upon the circumferential rim 124 or other portion of the second sifter 106 compresses a resilient material 406 forcing the second sifter 106 towards the first sifter 104 , and causes the protrusions 120 to occlude holes 122 and thus prevent material from passing from the storage cavity 108 onto the upper surface 112 of the second sifter 106 . additionally or alternatively , the holes 122 from the first sifter 104 may be misaligned with the holes 118 in the second sifter 106 so that the sifter components themselves provide the occlusion . upon displacement of the sifters 106 and 104 , such as by affixing the cover 114 , the first and second sifters 106 and 104 would come into contact with , or closer proximity to , each other and prevent material from traveling through the sifter holes 122 and / or 118 and / or gap 408 . the resilient material 406 may be a co - molded thermoplastic elastomer ( tpe ) or other suitable material and may be molded , extruded , and / or formed according to other conventional methods . when embodied as a generally circumferential ring , the resilient member 406 may also deform and seal a gap 408 between the first sifter 104 and the second sifter 106 . the resilient material 406 may be formed on the side of the second sifter 106 facing the first sifter 104 . the resilient material 406 may alternatively be provided on the first sifter 104 on the side facing the second sifter 106 , or as a separate component entirely . the displacement caused by the displacement mechanism , such as cover 114 , may elastically alter , compress , and / or deform the resilient material 406 . when the displacement mechanism is disengaged , the resilient material , may recover , decompress , and / or elastically return to a less compressed , altered and / or deformed state as described with reference to fig5 . the resilient material may have in whole or part elastic or semi - elastic properties . the cover 114 may have a sealing layer 410 engaged with or integral to the cover 114 for pressing or touching the second sifter 106 to further prevent the unintentional spillage of powder or other material from container 100 . alternatively , there may be a sealing layer affixed to the circumferential rim 124 . the sealing layer 410 may be waxed paperboard , teflon , tpe , or other suitable material . a supporting member 412 may extend from the first sifter 104 to the base 110 . base 110 , first sifter 104 , second sifter 106 , and cover 114 may be constructed of polypropylene , metal , plastic , wood , or other suitable material and may be molded or formed according to conventional methods . fig5 shows a cross - sectional view of the container of fig1 , taken along line 3 - 3 in fig3 , in the open position with cover 114 removed . the cover 114 no longer presses second sifter 104 ; thus , the resilient material 406 recovers , decompresses , and / or elastically returns to a less compressed , altered and / or deformed state to separate the first sifter 104 and the second sifter 106 , creating or expanding gap 408 between them . material may thus flow freely from the storage cavity 108 via the holes 118 in the first sifter 104 and the holes 122 in the second sifter 106 to the upper surface 112 of the second sifter 106 . like the configuration shown in fig1 , fig6 shows another exemplary implementation in an exploded view of a container 600 with a base 602 , first sifter 604 , second sifter 606 , and cover 608 . this implementation differs from that shown in fig1 in that the protrusions 610 on the first sifter 604 are larger to accommodate the larger holes 612 in the second sifter 606 . additionally , the first sifter 604 in this embodiment has support arms 614 for the protrusions 610 extending radially from the center to the rim , providing larger holes 616 in the first sifter 604 . the protrusions 610 may obscure the holes 612 , with or without extending beyond the surface 618 of the second sifter 606 to prevent material from passing between the storage cavity 620 and the surface 618 of the second sifter 606 . additionally or alternatively , material may be prevented from passing between the storage cavity and the surface 618 of the second sifter 606 by misaligning the holes 612 in the second sifter 606 with the holes 616 in the first sifter 604 . fig7 shows an elevational view of the container of fig6 , when in the closed position . fig8 shows a top plan view of the container of fig6 . fig9 shows a cross - sectional view of the container of fig6 , taken along line 4 - 4 in fig8 , when in the closed position . fig1 shows a cross - sectional view of the container of fig6 , taken along line 4 - 4 in fig8 , when in the open position . additionally , the implementation shown in fig6 - 10 also illustrates how the upper surface 618 of the second sifter , such as second sifter 606 , may be concave . this upper surface 618 may assist in directing powder or other material into the one or more holes 612 and , thus , into the storage cavity 620 . this concave or sloped surface 618 may reduce the amount of powder or other material above the second sifter 606 when the container 600 is held in an upright position , such as when a user is preparing to close the container 600 . additionally or alternatively , the concavity of the upper surface 618 may aid in collecting the material for an application , such as for engaging the material with a brush or other applicator . reducing the amount of powder above the second sifter 606 may reduce the amount of powder that may be spilled while the container 600 is closed or when the container 600 is initially opened . fig1 a , 11 b , and 12 depict alternate configurations in which the base 1102 of the container 1104 has an opening 1106 . in these configurations , a bottom container 1108 or cap 1206 may be designed to engage or be fixed to base 1102 through a press fit , friction fit , threaded engagement , friction , glue , or other securing method or means . as shown in fig1 a , and 11 b , base 1102 has an integral first sifter 1110 . according to the implementation shown in fig1 a and 11b , the bottom container 1108 may have side walls and an open top and may be filled with material 1112 to be dispensed . in this implementation , the cartridge may be prefilled before the cartridge is engaged with the base . fig1 b shows the bottom cartridge 1108 as engaged with container 1102 . bottom container 1108 may be secured or fixed to the base 1102 by friction , glue , threaded engagement , ribs or other contoured features , or other suitable means . fig1 shows a variation of the container shown in fig1 a and 11b , in which the first sifter 1202 and bottom portion 1204 are integral , but instead of cartridge 1108 , the bottom portion is provided with a bottom cap 1206 . this configuration allows a user to load powder into the bottom portion 1204 of the container 1208 by a process of inverting the container 1208 , with the bottom cap 1206 removed , filling the bottom portion 1204 with material , and affixing cap 1206 to enclose the material within container 1208 . the bottom cap 1206 may be engaged with the bottom portion 1204 by press fit , friction fit , threaded engagement , friction , glue , or other securing method or means . ribs may assist in maintaining the engagement of bottom cap 1206 with bottom portion 1204 . these variations of the cartridge , 1108 , cap 1206 , and / or the integral bottom portion 1102 and sifter 1110 may also be implemented in the implementations shown and described with reference to fig1 through 10 . fig1 depicts variations of cross - sections that the resilient material 406 may have including a substantially u - shaped cross section 1302 a , solid circular cross section 1302 b , a solid square cross section 1302 c , a hollow circular cross section 1302 d , a combination square and generally sinusoidal or zigzagged cross section 1302 e , a sinusoidal or zigzagged cross section 1302 f , a substantially h - shaped cross section 1302 g , a helical or spring shape 1302 h , a chevron cross section 1302 i , a wave spring 1302 j , or other suitable shape . it should be noted that the resilient material may be continuous as a generally ring shaped member placed between the first and second sifters , or the resilient material may have one or more discrete components that operate to create and / or maintain a gap between the first and second sifters , such as sifters 106 and 104 , when the displacement mechanism , such as cover 114 , is removed or disengaged . fig1 shows another exemplary implementation of a compression sifter . like the configuration shown in fig6 , fig1 shows another exemplary implementation in an exploded view of a container 1400 with a base 1402 , first sifter 1404 , second sifter 1406 , and cover 1408 . this implementation differs from that shown in fig6 in that the resilient material 1410 is shown as a separate piece , and non - central holes 1412 of the second sifter 1406 are sealed by sealing ring 1414 when in the closed position . in another implementation not depicted , resilient material 1410 and sealing ring 1414 may be a single piece , or may be co - molded onto first sifter 1404 . fig1 shows a cross - sectional view of the container of fig1 , when in the closed position , where the sealing ring 1414 is obscuring the non - central holes 1412 of the second sifter 1406 . fig1 shows a cross - sectional view of the container of fig1 , when in the open position . the displacement mechanism , in this case , cover 1408 is disengaged . the resilient material 1410 , may therefore recover , decompress , and / or elastically return to a less compressed , altered and / or deformed state as shown and described with reference to fig1 . this action creates a gap 1602 to permit passage of material from the base 1402 to the second sifter 1406 . like the configuration shown in fig1 , fig1 shows another exemplary implementation in an exploded view of a container 1700 with a base 1402 , first sifter 1404 , second sifter 1406 , and cover 1408 . this configuration may utilize resilient material 1410 . element 1410 may be entirely of resilient material , or a resilient elastomeric material may be overmolded onto a non - resilient piece to provide for a lesser amount of compression . this implementation differs from that shown in fig1 in that the first sifter 1404 has threads 1702 which engage with matching threads 1704 on the second sifter 1406 . rotation of the cap 1408 engages cogs 1706 on the second sifter 1406 causing the second sifter to rotate , and , in turn , causing the resilient material 1410 , if provided , to be compressed . this action engages holes 1412 with the seal 1414 and central protrusion 1416 ( if any ) on the first sifter 1404 . the pitch of threads 1702 and corresponding threads 1704 may be different then the pitch of the threads on the base 1402 and the corresponding threads in the cap 1408 to facilitate operation . more particularly , the pitch of threads 1702 and corresponding threads 1704 may be steeper than the pitch of the threads on the base 1402 and the corresponding threads in the cap 1408 . fig1 shows a cross - sectional view of the container of fig1 , when in the closed position , where the sealing ring 1414 is obscuring the non - central holes 1412 of the second sifter 1406 . fig1 shows a cross - sectional view of the container of fig1 , when in the open position . the displacement mechanism , in this case , cover 1408 is disengaged . the resilient material 1410 , may therefore recover , decompress , and / or elastically return to a less compressed , altered and / or deformed state as shown and described with reference to fig1 . this action creates a gap 1902 to permit passage of material from the base 1402 to the second sifter 1406 . of course , the gap could also be created by the rotation of the second sifter in relation to the first sifter . like the configuration shown in fig1 , fig2 shows another exemplary implementation in an exploded view of a container 2000 with a base 1402 , first sifter 1404 , second sifter 1406 , and cover 1408 . this implementation differs from that shown in fig1 in that elements 1410 and 1414 may not be resilient and springs 2002 or other suitable members are used to maintain a gap between first sifter 1404 and second sifter 1406 . fig2 shows a cross - sectional view of the container of fig2 , when in the closed position , where the sealing ring 1414 is obscuring the non - central holes 1412 of the second sifter 1406 and the springs 2002 are compressed . fig2 shows a cross - sectional view of the container of fig2 , when in the open position . the displacement mechanism , in this case , cover 1408 is disengaged . the springs 2002 , may therefore recover , decompress , and / or elastically return to a less compressed , altered and / or deformed state as shown and described with reference to fig2 . this action creates a gap 2202 to permit passage of material from the base 1402 to the second sifter 1406 . although details of specific implementations and embodiments are described above , such details are intended to satisfy statutory disclosure obligations rather than to limit the scope of the following claims . thus , the claims are not limited to the specific features described above .

US-2206208-A

the present invention is directed to an exercise and training device for runners and provides a means to train them to stay in the most efficient position for optimum muscle use and to improve speed and lateral quickness . the device comprises an upper thigh strap , a foot stirrup and a length of resilient elastic material adjustably secured therebetween and adjusted to maintain the user &# 39 ; s knee at a 90 ° angle during running .

fig1 illustrates a preferred embodiment of the present invention on a user &# 39 ; s leg . the device comprises an adjustable thigh strap 1 a foot stirrup assembly 2 and an elastic resistance member 3 . foot stirrup assembly 2 comprises an arch strap 4 which encircles the user &# 39 ; s foot 5 at the instep or arch and heel straps 6 extending rearward from arch strap 4 . thigh strap 1 , arch strap 4 and heel straps 6 are preferably made from non - elastic woven strap or webbing that is flexible but of sufficient strength to resist the tension of elastic resistance member 3 . alternatively , thigh strap 1 may include an elasticized portion to allow a certain amount of flexibility in the strap 1 as the thigh muscles flex during use . resistance member 3 may be made from any resilient elastic material providing the desired strength and resistance to stretching so as to work to maintain the user &# 39 ; s legs bent while running . such materials include elastic straps or webbing , rubber tubing , rubber straps , “ bungee ” cords , or the like . thigh strap 1 and arch strap 4 are adjustable in length to accommodate different sizes of users and have a releasable fastening means 8 , preferably a hook and loop fastener such as velcro ®, to releasably hold their ends together . thigh strap 1 and arch strap 4 may be simple lengths of strap material that are wrapped around the thigh or foot and secured by the fastening means 8 and may have a cushioning layer 21 on one side for comfort against the skin . fig6 illustrates a preferred means of adjustably fastening the thigh strap 1 and arch strap 4 wherein a buckle 7 is secured at one end of the appropriate strap by stitching 9 or other suitable non - releasable fastening means , while the other end wraps around the appropriate body part , passes through the other side of buckle 7 and is folded back over itself to secure with the releasable fastener 8 . of course other means for providing similar adjustable fastening means may be employed without departing from the scope of the present invention . in addition to arch strap 4 , the foot stirrup assembly includes at least one heel strap 6 secured to arch strap 4 and extending rearward therefrom . preferably , heel strap 6 and arch strap 4 are secured by stitching although other non - releasable fastening means may be used . heel strap 6 is attached to arch strap 4 so as to extend therefrom on either side of the user &# 39 ; s heel and at an angle of from about 30 ° to about 60 ° relative to the longitudinal axis of the user &# 39 ; s foot . in this manner , when the device is in place on the user and properly adjusted to hold the knee bent at a bout a 90 ° angle , the heel strap 6 and the elastic resistance member 3 will be substantially in line behind the leg along the hypotenuse of a triangle formed thereby in combination with the upper and lower leg . fig3 illustrates separate heel straps 6 on either side of the user &# 39 ; s foot , with each strap having means to receive the free ends 10 of elastic resistance member 3 . such means may simply be holes 11 in the ends of heel straps 6 , which holes are preferably reinforced with grommets 12 . in such a structure the ends 10 of resistance member 3 may be passed through the holes 11 and knotted 13 to prevent them from passing back through . alternatively , ends 10 of elastic resistance member 3 may be provided with clips , such as swivel clips 14 , which may be used to releasably clip elastic resistance member 3 to heel straps 6 through the holes 11 and grommets 12 as shown in fig7 . in this manner , elastic resistance member 3 may be easily changed in the event of breakage or the desire to use a stronger or weaker resistance member 3 . other means for securing resistance member 3 to heel straps 6 may be used without departing from the scope of the present invention . although the length of resistance member 3 may be changed by changing the position of knots 13 , it is preferred that a simpler adjustment means be provided . in the principal embodiment of the device illustrated in fig1 , resistance member 3 comprises a length of elastic tubing that is secured to each of the heel straps as shown in fig3 , and passes through an adjustable loop 15 on thigh strap 1 . adjustable loop 15 comprises a strap 16 secured to thigh strap 1 by stitching or other non - releasable fastening means and having a longer portion extending downward from the lower edge of thigh strap 1 and a shorter portion extending from the upper edge of thigh strap 1 . shorter portion is provided with a releasable buckle or grip clip type fastener 17 through which the longer portion of strap 16 passes and is adjustable to make loop 15 larger or smaller . with resistance member 3 passing through loop 15 as shown in fig2 , adjusting the size of loop 15 by lengthening or shortening strap 16 in fastener 17 will have the effect of lengthening or shortening the effective length of resistance member 3 between thigh strap 1 and stirrup assembly 2 , thus permitting the device to be adjusted for different users . in an alternative embodiment shown in fig4 and 5 , heel strap 6 is in the form of a loop 18 of the strap material secured at each end to opposite sides of arch strap 4 and extending beyond the user &# 39 ; s heel . non - releasably secured to the back of loop 18 is a releasable buckle fastener 19 through which the end 10 of resistance member 3 passes and is held in an adjustable manner . thigh strap 1 is provided with a similar releasable buckle fastener 19 that is non - releasably secured to thigh strap 1 and through which the other end 10 of resistance member 3 passes and is held in an adjustable manner . in this embodiment , the effective length of resistance member 3 is adjustable directly through the buckles 19 and may be released for replacement simply by removing the ends 10 from the buckles 19 . instead of buckles 19 of the type shown in fig4 and 5 , releasable grip clamps or other releasable fastening means that will securely hold the ends 10 of the resistance member 3 during use of the device may be employed without departing from the scope of the present invention . in use , a runner is provided with one device for each leg . the arch strap 4 is wrapped about the foot 5 at the instep or arch with the heel strap 6 extending rearward and the releasable fastening means 8 is secured to prevent slippage of the strap 4 . the thigh strap 1 is wrapped about the upper thigh 20 , preferably at a point just below the lower curve of the buttocks , and the releasable fastening means 8 is secured to prevent slippage of the strap 1 downward but not so tight as to impede circulation within the leg . thigh strap 1 is positioned on the runner &# 39 ; s thigh 20 so that loop 15 or buckle 19 is at the back of the thigh 20 above the heel . in this manner , resistance member 3 will span the distance between thigh strap 1 and heel strap 6 behind the leg without rubbing against the leg as shown in fig1 . with thigh strap 1 and stirrup assembly 2 properly positioned and fastened , the length of resistance member 3 is adjusted through either loop 15 or buckles 19 so that the runner &# 39 ; s leg assumes a 90 ° angle through the knee . in this position , the runner is forced to assume a crouch like that of a sprinter with the heels off the ground and the runner &# 39 ; s weight on the toes and balls of the feet . preferably , the resistance provided by the elastic resistance member 3 is sufficient to maintain this position against normal extension of the leg during running but not so great as to positively prevent such extension . with the device properly positioned and adjusted , the runner is effectively prevented from using the strength through the hips to extend his legs and must solely focus on the quadriceps , hip - flexors and hamstrings that will generate the muscular force to maintain the crouch position without the device . with the device in position , as long as the runner maintains his correct crouch , there will be no feeling of tension or resistance from the resistance member 3 , which will tell the runner that his legs are at the correct angle . any attempt to extend the legs during use will result in tension being applied through the resistance member 3 thus providing the runner with immediate knowledge that he is not in the correct position . the device thus trains the runner to remember the feeling of the proper technique and correct position required for efficient use of the leg muscles so there is no wasted movement and force is generated out of every turn and push from the lower body . when conducting running drills with the device , it is important that such drills be of short duration , i . e ., no more than thirty yards at a time to avoid muscle fatigue . rest time between drills is spent sitting on the ground so that , even with the knees bent , the legs are not under tension and the muscles can rest . with high resistance , the device is intended for teaching correct form and position rather than conditioning . however , with different strength resistance members 3 installed , the device has utility in conditioning and strengthening of the leg muscles through the use of different drills such as a quick leg extension in which the user quickly extends the leg against the resistance of the resistance member 3 to a position as far as possible toward straight and then immediately relaxes . this has the effect of improving the speed of leg motion . in further drills , the device has utility in working on the endurance of the quadriceps and hip flexors by a static hold drill in which the user remains in a stationary squat with the heels off the ground while maintaining pressure on the leg muscles , not the knee joints , until the muscles begin to feel as though they will fail to support this position . the user then makes a controlled drop to the ground to rest and , when control of the muscles is regained , repeats the exercise . an additional drill is a squat jump . with the device in position , the user performs a jump from the squat position bringing his knees up to his chest with the heels against the buttocks , then dropping the knees to land on his toes . this exercise works on the same form as is used during running . the muscles are used to control landing in the squat position and prevent all of the landing pressure from falling on the knees . while the invention has been described with respect to certain specific embodiments , it will be appreciated that many modifications and changes may be made by those skilled in the art without departing from the spirit of the invention . it is intended , therefore , that all such modifications and changes are within the true spirit and scope of the invention as recited in the following claims .

US-94296604-A

an intraocular surgical tool for infusing fluid into an eye of a patient . the tool is provided with a housing having a longitudinal bore opening into an aperture . a flow diffuser is positioned over the aperture to diffuse and slow the flow of fluid through the aperture . the flow diffuser may be a cone positioned over the aperture or a permeable cap fitted over the aperture . by diffusing and slowing the flow of fluid , the risk of damage to the interior of the eye is decreased and more fluid is maintained near the tip of the bore after being expelled from the aperture .

with reference to the drawings , shown in fig1 is a prior art surgical tool ( 10 ) having a longitudinal bore forming a fluid transfer housing ( 12 ) secured to a vitrectomy cutter ( 13 ). the housing ( 12 ) is provided with a proximal end ( 14 ) and a distal end ( 16 ). the tool ( 10 ) is coupled to a fluid supply ( 18 ) such as an air compressor , a syringe filled with saline solution , or any other fluid supply known in the art . the distal end ( 16 ) of the housing ( 12 ) is provided with an opening ( 20 ) on the side to allow the distal end ( 16 ) of the housing ( 12 ) to act as a diffuser to allow fluid ( 22 ), such as air , to pass out of the opening ( 20 ) rather than the distal end ( 16 ) of the housing ( 12 ). as shown in fig1 when it is desired to add fluid ( 22 ) to the vitreous cavity ( 24 ) of an eye ( 26 ), the surgical tool ( 10 ) is inserted through a sclerotomy incision ( 28 ) provided in the eye ( 26 ). the surgical tool ( 10 ) is inserted as deeply as required , and fluid ( 22 ) is then transferred from the fluid supply ( 18 ) through the housing ( 12 ) out of the opening ( 20 ) and into the vitreous cavity ( 24 ), using a control box ( not shown ), such as those known in the art , a syringe plunger ( not shown ), or similar fluid moving means . as shown in fig2 a , 2 b and 2 c , the housing ( 12 ) is provided with a single aperture ( 20 ). as can be seen in fig1 fluid ( 22 ) leaves the housing ( 12 ) through this single aperture ( 20 ). this single aperture ( 20 ) causes the fluid ( 22 ) moving out of the housing ( 12 ) to leave the housing ( 12 ) at a relatively high pressure , force and mass flux . if , as shown in fig1 the aperture ( 20 ) is positioned close to a sensitive portion of the eye ( 26 ), such as the retina ( 30 ), the pressure , force and mass flux exerted by the fluid , might injure the retina ( 30 ), or other delicate structures of the eye . the present invention is designed to overcome these drawbacks associated with the prior art . shown in fig3 is an improved surgical tool ( 34 ), having a shaft ( 36 ). the shaft ( 36 ) is provided with a proximal end ( 38 ) and a distal end ( 40 ). as shown in fig4 a , soldered to the distal end ( 40 ) of the shaft ( 36 ) are three brackets ( 42 ). soldered to the brackets ( 42 ) is a flow diffuser ( 44 ). the brackets ( 42 ) and flow diverter ( 44 ) are preferably constructed of solid surgical steel or similarly suitable material . as shown in fig4 a - c , the flow diffuser ( 44 ) is provided with a lower pyramidal portion ( 46 ) and an upper pyramidal portion ( 48 ). as shown in fig4 a and 4 c , the lower pyramidal portion ( 46 ) is provided with three faces ( 50 ), ( 52 ) and ( 54 ), secured to one another at three corners , ( 56 ), ( 58 ) and ( 60 ). the brackets ( 42 ) are secured to the lower pyramidal portion ( 46 ) at the three corners ( 56 ), ( 58 ) and ( 60 ). the upper pyramidal portion ( 48 ) is also provided with three faces ( 62 ), ( 64 ) and ( 66 ) to allow for ease of insertion of the improved surgical tool ( 34 ) ( fig3 and 4 b ). as shown in fig3 the proximal end ( 38 ) of the shaft ( 36 ) is coupled to a fluid supply ( 68 ) such as an air compressor , a saline filled syringe , or other suitable fluid supply known in the art . to operate the improved surgical tool ( 34 ) of the present invention , the distal end ( 40 ) of the improved surgical tool ( 34 ) is inserted into the vitreous cavity ( 24 ) though a sclerotomy incision ( 70 ). the distal end ( 40 ) of the improved surgical tool ( 34 ) is inserted into the vitreous cavity ( 24 ) to the desired position . secured around the shaft ( 36 ) is a flange ( 71 ). the improved surgical tool ( 34 ) is temporarily fixated through the sclera by suturing the flange ( 71 ) to the external sclera as is known in the art of vitrectomy surgery . pressure within the fluid supply ( 68 ) moves fluid ( 72 ) from the fluid supply ( 68 ) through the shaft ( 36 ) and out the distal end ( 40 ) of the improved surgical tool ( 34 ). the flow of fluid ( 72 ) from the fluid supply ( 68 ) to the distal end ( 40 ) may be controlled by a valve ( 74 ) such as those known in the art . as can be seen in fig3 as the fluid ( 72 ) exits the distal end ( 40 ) of the improved surgical tool ( 34 ), the flow diverter ( 44 ) diffuses the fluid ( 72 ) radially from the shaft ( 36 ). by diffusing the fluid ( 72 ) over a wide area , pressure , force and mass flux resulting from the infusion of fluid ( 72 ) into the vitreous cavity ( 24 ) are reduced and potential damage to the retina ( 30 ) and other sensitive areas of the eye ( 26 ) are also reduced . additionally , by diffusing the fluid ( 72 ) slowly over a larger area , more fluid ( 72 ) remains in the area of the distal end ( 40 ) of the improved surgical tool ( 34 ). shown in fig5 is an alternative surgical tool ( 76 ) having a distal end ( 78 ). as shown in fig6 a - b , the distal end ( 78 ) of the surgical tool ( 76 ) is provided with a rounded tip ( 80 ). a portion of the housing ( 82 ) is positioned over one large aperture to form two smaller apertures ( 84 ) on either side of the housing ( 82 ). alternatively , as shown in fig7 a - b , the alternative surgical tool ( 76 ) may be provided with a pointed tip ( 86 ) to aid in insertion of a surgical tool ( 76 ) into the vitreous cavity ( 24 ) of the eye ( 26 ). as shown in fig5 the alternative surgical tool ( 76 ) is provided with a fluid supply ( 88 ), such as that described above , to supply fluid ( 89 ) through the distal end ( 78 ) of the alternative surgical tool ( 76 ). by providing a pair of apertures ( 84 ), the pressure generated by the fluid ( 89 ) entering the vitreous cavity ( 24 ) of the eye ( 26 ) is cut in half , thereby reducing the potential for damage to the retina ( 30 ) and other portions of the eye ( 26 ). shown in fig8 is a second alternative surgical tool ( 90 ) provided with a distal end ( 92 ). as shown in fig9 a - b , the distal end ( 92 ) of the second alternative surgical tool ( 90 ) is provided with a rounded , perforated cap ( 94 ) constructed of thin surgical steel or similarly suitable material . the perforated cap ( 94 ) is preferably provided with a plurality of apertures ( 96 ) to evenly diffuse fluid ( 98 ) flowing out of the distal end ( 92 ) of the second alternative surgical tool ( 90 ). the perforated cap ( 94 ) may either be soldered or welded to a shaft ( 100 ) of the second alternative surgical tool ( 90 ), or may be an integral part of the shaft ( 100 ). as shown in fig8 by diffusing the fluid ( 98 ) over the entire surface of the perforated cap ( 94 ), the force of the fluid ( 98 ) exiting the second alternative surgical tool ( 90 ) is greatly reduced , thereby reducing the potential for damage to the retina ( 30 ) of the eye ( 26 ). alternatively , as shown in fig1 , the second alternative surgical tool ( 90 ) may be provided with a perforated conical cap ( 102 ) to aid in insertion of the tool ( 90 ) into the vitreous cavity ( 24 ) of the eye ( 26 ). ( fig8 and 10 ). although the invention has been described with respect to a preferred embodiment thereof , it is to be understood that it is not to be so limited , since changes and modifications can be made therein which are within the full intended scope of this invention as defined by the appended claims . for example , it is anticipated that various gauges of housings may be used and that the device may be made in the form of a larger laproscopic tool for surgical uses in other parts of the body . it is additionally anticipated that various fluids may be infused into and removed from the body with the surgical tool of the present invention .

US-9879998-A

a hand and wrist restorer and method of use having a cuff which is capable of grasping a portion of the outer skin of a limb and securing the fascia tissue thereunder together with a support which allows a user to provide a distal force upon the limb while rotating or moving the distal portion of the limb whereby a stretch of the fascia tissue occurs .

the preferred embodiment of the present art hand and wrist restorer apparatus 10 as seen in fig1 , 2 , and 10 - 13 comprises a cuff 12 and one or more ( preferably two ) winged supports 32 attached with said cuff 12 , said cuff 12 having a proximal 15 and distal portion 17 . preferably said winged supports 32 extend at least partially laterally from said cuff 12 and have an at least partially arcuate shape 34 . the cuff 12 has an at least partially cylindrical form , i . e . having a passage 19 shaped to closely fit with the forearm or wrist of a user , and is preferably manufactured of a rigid material such as a molded or formed plastic but may be manufactured from a plurality of materials including but not limited to metals and alloys thereof , woods , ceramics , or composites . for enablement purposes only , the cuff 12 is approximately four inches in outside diameter , three inches in inside diameter , and four inches in length . the first alternative embodiment as seen in fig3 - 9 shares the essence of the cuff 12 of the preferred embodiment with a partial conical form 36 utilized in lieu of the winged supports 32 . the second alternative embodiment as seen in fig1 - 15 and third alternative embodiment as seen in fig1 - 17 utilizes a pneumatic or hydraulic bladder 24 within the cuff 12 . said bladder 24 is shown with a mechanical bulb for pressurization but may further comprise an electrical or electronic pumping mechanism without departing from the spirit and scope of the present art . the embodiments with said bladder 24 may include said hinged portion 14 or may forego use of said hinged portion 14 and form said cuff 12 as a single or closed element through which a user &# 39 ; s limb is placed . for the preferred embodiment , the cuff 12 has a hinged portion 14 , an inner liner 16 or lining , and a buckle or retainer 26 to maintain the cuff 12 in a closed form . the hinged portion 14 preferably is substantially parallel with the axis of the cylindrical form and allows the cylindrical form to open into two halves 28 for placement of the patients limb or forearm 40 . the hinged portion 14 may comprise a traditional barrel hinge form or a plurality of other forms including but not limited to continuous or piano hinges , butt hinges , strap hinges , or a continuously molded living hinge . the inner liner 16 or lining is preferably of a tacky rubberized material that allows a substantial grip with the limb in wet or dry conditions and forms a central passage 19 or bore for limb placement . this includes materials of a natural or synthetic rubber material , vulcanized rubber , polyurethane open or closed cell foam , or a plurality of natural or synthetic materials which provide a slight cushioning and frictional grip with the limb . preferably the inner liner 16 or lining is mechanically or adhesively attached with the inside circumference of the cuff 12 and is separated at the opening between the two halves 28 substantially opposite the hinged portion 14 . for the preferred embodiment , the inner liner represents a single molded piece 18 with a lengthwise slit 20 or openings which may open and close with the two halves 28 of the cuff 12 . said inner liner 16 preferably has one or more extensions or protrusions 22 which mate with recesses or holes 30 within the cuff 12 for retention purposes . further alternative embodiments utilize a pneumatic or hydraulic bladder 24 in place of said inner liner 16 , with or without the hinged portion 14 . the pneumatic or hydraulic bladder 24 functions and operates similar to a blood pressure cuff . the pressure placed via said cuff 12 around the forearm 40 or wrist 42 areas provides a firm grip upon the skin and fascia when placed within the central passage 19 . a pump valve and release valve are provided to pressurize and vent said bladder 24 respectively . preferably said valves are located upon the winged support 32 or the conical form 36 but may be located at a plurality of user accessible locations . said bladder 24 may take a plurality of forms including , but not limited to , integrally mounted bladders mounted within a recess within said cuff 12 , separately inserted bladders which are removable , and / or bladders which simply fit and are attached within the central passage 19 of said cuff 12 . the buckle or retainer 26 is mounted with one of the halves 28 of the cylinder or cuff 12 and is retained by the other half 28 via a retainer 26 when the two halves 28 are closed to form the somewhat cylindrical shape . the buckle or retainer 26 holds the cylindrical form of the cuff 12 onto the limb with the required force during use of the apparatus 10 . the buckle or retainer 26 may take a plurality of forms including but not limited to traditional buckles having a frame , prong , and bar , clasps , or hook and loop fasteners ( i . e . velcro ®). for the preferred embodiment , the retainer 26 comprises a ridge member 29 and a hook or edge portion 31 , substantially from the proximal portion 15 to the distal portion 17 . the two members / portions 29 , 31 mate or disconnect via a flexing of the retainer 26 body during closing and opening . that is , the hook or edge portion 31 fits over and latches with the ridge member 29 . for the preferred embodiment a retainer pin 27 , also substantially from the proximal portion 15 to the distal portion 17 , is utilized to further secure the retainer 26 when the cuff 12 is in a closed position . for the preferred embodiment , said winged supports 32 have a shape which allows a patient to support the apparatus upon his or her thighs during use . that is , the user must be able to exert a forward or distal force and a lateral or rotational movement with a portion of the limb extending from the apparatus 10 and upon which the apparatus 10 is mounted . this requires that the apparatus 10 be supported when utilized . the winged supports 32 may also be utilized with a counter top , wall , floor or other surface in order to provide said support . for enablement purposes only , the preferred embodiment has winged supports 32 which are approximately one inch in width and six inches in length with a thickness of approximately ½ inch . provided the winged supports 32 are capable of providing the aforesaid support , said supports 32 may take a plurality of forms including but not limited to flat , curved , arcuate , or block forms . an alternative embodiment attaches a strap and / or handle with the cuff 12 and allows a user to hold the strap or handle with a single hand while imparting the distal or lateral forces to a particular limb portion . the handle or strap may be secured to the cuff 12 or to the winged supports 32 or to a combination of both . a further alternative embodiment utilizes a distal cone , conical , semi - conical , partial conical , or frustum shaped form 36 in place of said winged supports 32 . the alternative conical form 36 attaches with the cuff 12 and allows a patient or user to easily apply the forward force onto a surface such as a counter top , wall , or floor . the alternative conical form 36 is attached with the cuff 12 whereby the cuff 12 may be opened and closed as with other embodiments . in operation , the patient or user first places a portion of a limb requiring treatment ( usually the forearm 40 or possibly the wrist 42 area ) into the open cuff 12 and closes the cuff 12 . ( i . e . places the limb through the central passage 19 ) the cuff 12 is compressed tightly around the limb and the buckle or retainer 26 is secured with the retainers 26 on the cuff 12 or the pneumatic or hydraulic bladder 24 is inflated or pressurized . this assures a firm grasp of the limb and the underlying fascia , scar , and muscle tissue . the patient or user then places the winged supports 32 onto the thighs , against a surface , or in the case of the partially conical form 36 ( also known as a support ) against a surface such as a table , wall , counter top , or floor and applies a distal force . if the strap and / or handle is utilized , the user will hold the handle or strap with a hand prior to therapy . for use with the arm , therapy thereafter begins with the user preferably forming a fist - like form with the hand 44 ( i . e . distal portion of the user &# 39 ; s limb ) on the arm upon which the apparatus 10 is mounted in order to maximize the fascia stretch , especially at the back of the hand 44 and knuckle areas . the patient or user then rotates the wrist 42 ( either clockwise or counterclockwise ). the patient or user holds the first at a particular location which feels the most stretch until the stretch feeling dissipates . typically the holding time is on the order of two minutes but may be longer or shorter depending upon the user preference and severity of the injury or ailment . upon release , the hand 44 will have a red like appearance and a tingling feel which is a normal condition . when the apparatus 10 is removed , the patient or user will have a looser feeling or more nimble hand 44 , wrist 42 , and fingers 46 . the fascia and scar tissue fibers will be stretched and not constrict the muscle movement as was experienced prior to operation of the apparatus . although contemplated and described for use with an arm or forearm 40 , the art of the present invention may also be utilized with the legs . that is , the user can mount the cuff 12 around the lower leg , thereby grasping the fascia tissue , and thereafter rotate the foot to obtain the aforesaid benefits for the lower leg . although described for enablement purposes , the lengths , widths , and other dimensional attributes may depart significantly from those specified . the shape , size , location , component numbers and mounting methods utilized for the components described may take a plurality of forms as recognized within pertinent arts without departing from the scope and spirit of the present invention . having described the invention in detail , those skilled in the art will appreciate that modifications may be made to the invention and its method of use without departing from the spirit herein identified . therefore , it is not intended that the scope of the invention be limited to the specific embodiments illustrated and described . rather , it is intended that the scope of this invention be determined by the appended claims and their equivalents . no claim is made to any part of the human body ; any reference thereto within the appended claims is provided for method of use purposes only or to more fully describe the present art apparatus and method of use .

US-201113012646-A

a facemask incorporating breathing equipment for use with a flying helmet comprises a rigid outer shell in which a flexible face - piece is housed whose periphery makes an airtight seal with the pilot &# 39 ; s face . the face - piece includes an inhalatory valve and an expiratory vane and the rigid shell is attached to the helmet by a harness which keeps the shell at a fixed distance from the helmet . inflatable means are provided between the shell which are inflated to press the periphery of the face - piece towards the pilot &# 39 ; s face when the pressure of breathable gas supplied to the interior of the mask and to said inflatable means increases above that required for normal breathing . alternatively , the face - piece can include extendable means in the form of a re - entrant section or bellows section which extends in a direction towards the pilot &# 39 ; s face when the pressure of the breathable gas supplied to the interior of the face - piece increases above that required for normal breathing .

referring to the drawings , fig1 shows a pilot ( 1 ) wearing a rigid protective helmet ( 2 ). a flexible breathing face - piece ( 3 ), usually made of natural or synthetic rubber , surrounds the pilot &# 39 ; s nose and mouth and is mounted in a rigid plastic shell ( 4 ) attached to the helmet ( 2 ) by means of harness arrangement ( 5 ) having fitting ( 6 ) at one end to releasably attach it to fitting part ( 7 ) mounted on the helmet . the badness ( 5 ) includes adjustable means ( not shown ) so that its length can be readily altered to ensure that the face - piece ( 3 ) rests comfortably on the pilot &# 39 ; s face with its edge lip ( 12 ) making a proper seal with the area of the pilot &# 39 ; s face surrounding his nose and mouth . an avionics system ( 13 ) such as an armament sight is mounted on arm ( 16 ) attached to the helmet ( 2 ) to protrude forwardly therefrom into the line of vision as illustrated . a transparent viewing screen ( 14 ) is mounted on the shell ( 4 ) in front of the pilot &# 39 ; s eyes to display images projected from avionics ( 13 ). breathable gas such as oxygen is supplied to the interior of the face - piece ( 3 ) from a supply ( 11 ) via an oxygen regulator ( not shown ) connected thereto by means of a hose ( 8 ). an expiratory valve ( not shown ) is also provided in the face - piece ( 3 ). as can be seen more clearly in fig2 the wall of the face - piece ( 3 ) includes extendable means ( 20 ) which are housed within the rigid shell ( 4 ). the purpose of the extendable means ( 20 ) is to enable the edge seal ( 12 ) to move in a direction generally parallel to the wall of the rigid shell ( 4 ) when the pressure of the breathable gas supplied to the interior of the face - piece ( 3 ) is increased as a result of the regulator ( not shown ) being activated when the aircraft makes a turn . when the pressure supplied to the interior of the face - piece ( 3 ) increases , its wall expands to cope with the increased pressure . as the wall cannot move radially outwardly because it is contained within the rigid shell ( 4 ), it can only move in a direction generally towards the pilot &# 39 ; s face in the direction of the arrows and thereby improves its seal therewith . the operation of the arrangement in fig1 and 2 follows : in normal flight where no g - forces are exerted on the aircraft , breathable gas is supplied from the pressurised supply ( 11 ) via inlet hose ( 8 ) to the interior of the face - piece ( 3 ) fitted over the pilot &# 39 ; s nose and mouth . as soon as the pilot makes a turn , this will generate g - forces which cause the regulator ( not shown ) to increase the pressure of the gas supplied from the source ( 11 ) to the interior of face - piece ( 3 ) and it is inflated . as the rigid shell ( 4 ) cannot move relative to the helmet ( 2 ) because its position in relation thereto is controlled by the harness ( 5 ) which is of fixed length , inflation of the face - piece ( 3 ) extends the extendable means ( 20 ) and the edge seal ( 12 ) is pushed towards the helmet ( 2 ) as indicated by the arrows in fig2 . this movement effectively increases the pressure f the edge seal ( 12 ) of the face - piece ( 3 ) on the pilot &# 39 ; s face . reductions in the gas supply pressure cause the face - piece ( 3 ) to deflate accordingly and thus to reduce the pressure of the edge seal ( 12 ) on the pilot &# 39 ; s face . it will be appreciated that during flight , the aeroplane will be making many turns and the g - forces generated will therefore vary considerably . the regulator ( not shown ) which controls the gas supply from the source ( 11 ) in combination with the inflation and deflation of the face - piece ( 3 ) therefore ensures that the edge seal ( 12 ) is kept in contact with the pilot &# 39 ; s face at the required pressure at all times . since it is the face - piece ( 3 ) which is moving relative to the pilot &# 39 ; s face to increase or decrease its seal therewith , the helmet ( 2 ) remains stationary at all times so the avionics sight ( 13 ) can be attached to it and will work perfectly satisfactory regardless of the g - forces to which the pilot or the aircraft is being subjected . fig3 a - 3d illustrate several different types of flexible face - piece ( 3 ) which incorporate alternative forms of extendable means . in each of these embodiments the breathable gas is supplied directly to the interior of the face - piece ( 3 ) at a constantly changing pressure as a result of which the extendable means reconfigure and extend / expand or contract . in the arrangement shown in fig3 a , the wall of the face - piece ( 3 ) includes a re - entrant section ( 21 ) which opens up or extends on pressurisation of the interior of the face - piece ( 3 ) to reconfigure into the profile ( 21a ) whereby the edge region ( 12 ) shown in dotted line moves in the direction of the arrows into the position shown in full line . the face - piece ( 3 ) shown in fig3 b is similar to that shown in fig3 a except that the re - entrant sections ( 22 ) include a generally circular portion in cross - section and reconfigure on inflation of the interior of the face - piece ( 3 ) into the profile ( 22a ) whereby the edge region ( 12 ) shown in dotted line moves in the direction of the arrows into the position shown in full line . fig3 c shows yet another configuration of face - piece ( 3 ) incorporating a bellows section ( 23 ) which extends into configuration ( 23a ) and causes the edge region ( 12 ) to move towards the pilot &# 39 ; s face . in the arrangement shown in fig3 d , the facemask ( 3 ) is housed within the rigid shell ( 4 ) as has already been described . the face - piece ( 3 ) is manufactured with a convoluted rolling section ( 24 ) situated behind and adjacent the edge seal ( 12 ) and accommodated in an enlarged section ( 25 ) of the rigid shell ( 4 ). as can be seen from the drawings , the thickness of the wall of the face - piece ( 3 ) in the region of the convoluted rolling section ( 24 ) is thinner than the remainder of the face - piece ( 3 ) thereby allowing it to be rolled back on itself into the s - shaped configuration illustrated . in its normal state , the face - piece ( 3 ) is contained within the shell enlargement ( 25 ). however , when the pressure of the gas supply to the interior of the facemask ( 3 ) is increased , the convoluted rolling section ( 24 ) tends to unroll and the edge seal ( 33 ) is moved in the direction of the arrows thereby increasing the force applied by the edge seal ( 12 ) to the pilot &# 39 ; s face thus preventing leakage . in some circumstances it may be advisable to provide an inflatable bladder ( 30 ) between the rigid outer shell ( 4 ) and the front region of the face - piece ( 3 ) as shown in fig3 f to assist in the dynamic movement of the face - piece ( 3 ) in response to changes in pressure of the breathable gas supply to the interior thereof . the bladder ( 30 ) is preferably inflated by means of a branch supply duct ( not shown ) from the main gas supply to the interior of the face - piece ( 3 ). it can however be inflated by a separate gas supply . the facemask ( 3 ) shown in fig3 e differs from those shown in fig3 a - 3d in that it incorporates a chamber ( 26 ) which is supplied via an inlet ( 28 ) from a separate gas supply ( not shown ) to that supplied to the interior of the face - piece ( 3 ). the gas supply to the chamber ( 26 ) has to be at a pressure higher than that supplied to the interior of the face - piece ( 3 ) otherwise it will not be inflated and assume the illustrated configuration ( 26a ) in which the edge seal ( 14 ) is moved in the direction of the arrows towards the pilot &# 39 ; s face . it will be seen from the foregoing description that the invention provides a simple dynamic system which adjusts the pressure of the face - piece ( 3 ) on the pilot &# 39 ; s face automatically in response to the regulator controlled breathable gas supply pressure . as it is the face - piece ( 3 ) which moves rather than the helmet ( 2 ) or the shell ( 4 ), avionic systems can be mounted on the helmet . referring now to fig4 this shows a facemask of the invention incorporated into an nbc respirator having a protective hood ( 30 ). in this arrangement , the whole of the front portion of the hood ( 30 ) is moulded from a rigid plastics material and includes within it a transparent viewing window ( 31 ). the hoed ( 30 ) is preferably made of rubber and attached to the edges of the front piece ( 4 ) to enclose the wearer &# 39 ; s head and extend over the wearer &# 39 ; s neck . as with the fig1 embodiment , the rigid front portion ( 4 ) is attached to the helmet ( 2 ) by means of the harness ( 5 ). in the embodiment illustrated in fig4 however , an optional second harness ( 32 ) is connected to the rigid front portion ( 4 ) adjacent the wearer &# 39 ; s temples and is releasably secured to the helmet ( 2 ) by means of a fitting ( 33 ). it will be seen therefore that as both harnesses ( 7 , 33 ) are made of an inextendable webbing material , the rigid front portion ( 4 ) of the hood ( 30 ) cannot move in a direction away from the helmet ( 2 ). a dynamically movable face - piece ( 3 ) is mounted in the rigid front piece ( 4 ) which can be of any type such as those already described with reference to fig1 - 3 . the face - piece ( 3 ) illustrated is the same as that shown in fig2 and includes re - entrant section ( 20 ) but this is for illustrative purposes only . breathable gas is fed to the interior of the face - piece ( 3 ) through inlet hose ( 8 ) connected to the gas source and regulator ( not shown ). it will be appreciated that with the arrangement shown in fig4 the window ( 31 ) can be kept at a fixed distance from the pilot &# 39 ; s eyes at all times during flight as it is the face - piece ( 3 ) which moves relative to the wearer &# 39 ; s face rather than the front piece ( 4 ) or the helmet ( 2 ) to cope with increases or decreases in the pressure of the breathable gas supplied to the interior of the face - piece . as a result , the viewing window ( 31 ) can be used as a screen onto which images can be projected from the avionics ( 13 ) mounted on the helmet ( 2 ) on arm ( 16 ). as harnesses ( 5 , 32 ) include adjustment means ( not shown ) the position of the window ( 31 ) relative to the pilot &# 39 ; s eyes can be adjusted pre - flight to suit the pilot &# 39 ; s particular viewing requirements . once set however , no further adjustments need to be made in - flight . similarly , the position of the avionic part ( 13 ) relative to the window ( 31 ) can be set pre - flight which is another critical distance which must not change during flight if the pilot is to be able to read the data projected onto the window ( 31 ). fig5 shows a facemask of the invention incorporated into a full - face helmet ( 35 ) having a visor ( 36 ) which can be either fixed or pivotable upwardly out of the wearer &# 39 ; s line of vision . a rigid plastics shell ( 4 ) is attached to the interior of the front portion ( 38 ) of the helmet ( 35 ) by mounting arms ( 37 ) although it could be attached in some other way so as to be immovable relative to the front portion of the helmet . dynamically movable face - piece ( 3 ) is mounted in the rigid shell ( 4 ) which can be of any type such as those already described with reference to figures 1 - 3 . the face - piece ( 3 ) illustrated is the same as that shown in fig2 and includes re - entrant section ( 20 ) but this is for illustrative purposes only . breathable gas is fed to the interior of the face - piece ( 3 ) through an inlet hose connected to the gas source and regulator . none of these components are shown in fig5 for ease of illustration . the helmet and facemask shown in fig5 operate in the same way as has already been described with reference to the embodiments shown in fig1 - 4 . it will be appreciated however that the rigid shell is fixed relative to the wearer &# 39 ; s face due to it being mounted on the front portion ( 38 ) of the helmet which itself is a fixed distance relative to the wearer &# 39 ; s face . thus , in use , the face - piece ( 3 ) moves relative to the shell ( 4 ) while the visor ( 36 ) is maintained at a fixed distance relative to the wearer &# 39 ; s eyes . the mounting means ( 37 ) can incorporate adjustment means ( not shown ) to move the shell ( 4 ) towards or away from the wearer &# 39 ; s face to ensure that it makes a proper fit therewith and accommodates differences in the wearer &# 39 ; s facial features . because the visor ( 36 ) never moves relative to the wearer &# 39 ; s eyes during pressure breathing , the illustrated helmet is ideal for use with helmet mounted or other avionics systems .

US-33161195-A

microcapsule for injection into the bloodstream of a patient before a magnetic resonance acquisition pertaining to the bloodstream , include a magnetic resonance marking substance inside the microcapsule and an outer membrane that is impermeable to the marking substance . the microcapsule is overall biodegradable .

fig1 shows as a first exemplary embodiment a microcapsule 1 according to the invention ( that can also be designated as a marked corpuscle ), an erythrocyte ghost 2 developed from a red blood cell . the microcapsule 1 comprises the natural corpuscle membrane 3 and a magnetic resonance marking substance 4 arranged inside that exists in a high concentration in the microcapsule 1 and for which the membrane 3 is impermeable . nevertheless , a good biodegradability is ensured since the erythrocyte ghost 2 is based on a natural red blood cell . the corpuscles that are used can originate from the patient to be examined , or also from a blood bank . in the present case , the surface markers associated with the blood group ( schematically indicated at 5 ) are destroyed , which means that the immunogenicity of the microcapsules 2 is reduced . this can be achieved if denaturing substances ( for example aldehydes or ethanol ) are added during the preparation . in order to produce such erythrocyte ghost 2 , erythrocytes ( red blood cells ) are initially washed in order to then be lysed with a hypotonic solution . the membrane 3 is reestablished in an isotonic solution in which the marking substance 4 is also contained , such that the marking substance 4 is incorporated into the erythrocyte ghost that is created . the erythrocyte ghost can then be washed again . multiple possibilities can be taken into consideration for a marking substance 3 , for example a fluorine compound ( in particular a perfluorocarbon ) as explained above , or compounds ( for example hydroxyethyl starch ) of high molecular weight marked with isotopes ( for example 13 - c ) exhibiting a net spin , from the series of marking substances possessing isotopes with particular resonance frequencies ; however , a marking substance 4 generating a negative contrast can also be used , for example iron oxide particles or a gadolinium chelate . these marking substances can also be used in the second exemplary embodiment of a microcapsule according to the invention that is shown in fig2 . this is a liposome 7 which has formed from lipid molecules that comprise a hydrophilic portion 8 and a hydrophobic portion 9 . the hydrophilic portion 8 points outward or inward and thus shields the hydrophobic portions from the fluid . the hydrophobic ( and this lipophilic ) remainder in this case forms the membrane 3 . a marking substance 4 is thereby in turn arranged in an internal space 10 . the liposome 7 is spherical and presently exhibits a diameter of 10 μm , thus is approximately as large as a red blood cell , such that here it can be discussed as an artificial corpuscle . the microcapsules 1 , 6 described in fig1 or , respectively , fig2 can advantageously be used in order to be able to localize a hemorrhage in the gastrointestinal tract of a patient . for example , this can proceed as shown in fig3 . microcapsules ( thus marked , natural or artificial corpuscles ) are thereby prepared in step 11 . a predetermined number of these microcapsules is intravenously injected into a patient in step 12 . the predetermined number can thereby be , for example , 10 8 - 10 10 microcapsules , which corresponds approximately to the amount of erythrocytes in 0 . 1 - 10 ml of blood . one or more microcapsule image data sets are then acquired in step 13 using an acquisition technique showing the marking substance , in particular after the microcapsules have passed the gastrointestinal tract into the arteries there . if a hemorrhage exists , the microcapsules ( and thus the marking substance ) consequently accumulate in the intestine so that a clear image signal indicating the hemorrhage with high spatial resolution is created since the acquisition technique is matched to the marking substance . while a suitable image signal might already occur after the first passage of the microcapsules in the gastrointestinal tract given acute , strong bleeds , given less strong bleeds a certain time ( for example a few minutes ) can be waited under sufficient microcapsules have accumulated in the intestine . if the marking substance comprises specific isotopes with a resonance frequency ( for example fluorine ), this resonance frequency is excited . for example , magnetic resonance antennas are known for this that can be adjusted to different resonant frequencies ( for example also to that of fluorine ) so that such exposures can be produced . in this context it is reasonable in principle to also generate an anatomy image data set via the typical proton imaging so that the anatomy can be correlated with the locations that can be determined via the microcapsule image data set . this anatomy image data set should be acquired promptly , in particular if the patient has not yet moved in comparison to the acquisition of the microcapsule image data set . in particular , it is possible to generate a fusion image data set via fusion of the microcapsule image data set and the anatomy image data set , which fusion image data set then contains the anatomical information and the blood - related information . if a marking substance is used that causes a negative contrast ( for example iron oxide nanoparticles ), an aqueous solution ( for example water with methyl cellulose ) is orally administered to the patient before the examination , whereupon a t2 *- weighted sequence is used as an acquisition technique . the intestine itself thereby shows up with very high signal , such that the signal cancellation by the iron oxide is very well recognizable in the event that a crossover of the marked microcapsules into the intestine occurs ( thus a hemorrhage is present ). if multiple microcapsule image data sets are acquired , it is thereby also possible to compare these , for example to form subtraction image data sets . this is particularly advantageous if a reference microcapsule image data set was generated ( for example shortly before the injection of the microcapsules ) in which no signal ( or also no non - signal ) caused by the microcapsules exists . the background that is possibly present can be eliminated in this way . for example , it can be provided that such a reference microcapsule image data set is acquired immediately before the administration of the microcapsules ; the injection of the microcapsules then occurs , an additional microcapsule image data set is acquired after approximately 25 more seconds , and a third microcapsule image data set is acquired after five minutes so that the temporal development can also be observed . the acquired image data are evaluated in step 14 . for example , for this it can be provided that an image data set ( for example a microcapsule image data set itself , a subtraction image data set or a fusion image data set ) is possibly displayed in parallel with the display of an anatomy image data set on the display device , such that a physician can assess the presence of hemorrhages . naturally , an automatic evaluation is also possible in principle . it may be necessary — for example due to the intestinal movement — to conduct a movement correction in the comparison of different image data sets . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of their contribution to the art .

US-71730310-A

an electronic control system has the ability to programmably assign or map various input functions to different output functions . this allows for a much greater degree of customization of the control system for an individual user and allows inputs to be matched to different outputs to suit the individual users needs more optimally .

referring now to the drawings , there is illustrated in fig1 a diagrammatic representation of an electronic control system 10 for a personal mobility vehicle , such as power wheelchairs , scooters , and the like . the electronic control system 10 includes various modules , such as hand control modules 12 , motor control modules 14 , power seat control modules 16 , light control modules 18 , environmental control modules 20 , specialty input control modules 22 , and input devices 24 , such as pneumatic input devices and groupings of switches designed for access by users with limited body control . the modules are connected together by electrical cables 26 that carry command signals from module to module within the electronic control system 10 and / or carry electronic power to the various parts of the electrical system of the vehicle . the electronic control system 10 is adapted to be custom - configured by a healthcare professional for a specific user to match the user &# 39 ; s physical and cognitive skills , and may not contain all the aforementioned modules , but only those modules needed by that specific user . for example , if the intended user is a spinal chord injury paraplegic with normal arm and hand function and normal cognitive skills , the electronic control system 10 might include only a hand control module 12 , which may include a joystick and various switches , and a motor control module 14 to accept input signals from the hand control module 12 , accept power from a battery pack 30 , and output power to drive motors 28 . these two modules 12 , 14 may be connected by electrical cables 26 that carry command signals from the hand control module 12 to the motor control module 14 and carry electronic power to the various parts of the electrical system of the vehicle . the hand control module 12 could be physically positioned on the vehicle armrest , near the user &# 39 ; s hand , and the motor control module 14 could be positioned underneath the seat ( not shown ) near the battery pack 30 and the drive motors 28 that drive the drive wheels 31 . the electronic control system 10 may include a programmable digital micro - controller or processor 36 and a memory 38 with imbedded software to programmably control the operation of the vehicle . various modules of the electronic control system 10 may communicate with each other over a digital communications bus 40 . the system communications bus 40 may also provide power to the various modules . when the vehicle is initially set up for a given user , a programming module 42 may be connected to the electronic control system 10 to allow a technician to configure the software appropriately for that user , or to monitor the electronic control system 10 in use . programming may include telling the electronic control system 10 what modules are connected ( unless the electronic control system 10 is able to automatically detect the modules ) and setting various parameters , such as the maximum speed or acceleration rate that would be appropriate for the specific user . the various modules included in the electronic control system 10 are described in detail hereinbelow . input devices may be in the form of switched inputs or analog inputs . switched inputs are on / off switches physically arranged in design to allow access by a disabled person with limited body function . arrangements of one or more switches can be used to control movements of the vehicle and accessory functions , and can be placed on trays , on headrests , or other places ( none of which are shown ) reachable by disabled people . switch closures by the user are interpreted into control commands by the electronic control system 10 based on the programming of the software and the operation of the input module . for example , a switch closure enables operation of the drive motors 28 , another switch may control light functions . analog inputs are proportional devices that are specially designed to allow access by disabled people . a commonly used example of an analog input device is a joystick ( not shown ). when the user pushes on the joystick in a certain direction , the vehicle will move in that direction and the more the joystick is displaced , the faster the vehicle will move . another example of an analog device is a proportional device , such as a head switch ( not shown ), which controls the speed of the vehicle based on the degree to which the switch is depressed by the user &# 39 ; s head . input modules , such as the hand control module 12 , may be used to accept signals from input devices , such as the input device 24 , and send corresponding commands to the system communications bus 40 . some input modules , have built - in input devices , notably hand control modules 12 that have built in joysticks and switches . visual feedback or display modules 32 may be used to provide visual feedback to the user about the electronic control system 10 . display modules 32 may include text and / or iconic displays , such as liquid crystal displays , light emitting diodes , or similar lights , for showing the user what input device is active and the control mode of the control system . display modules 32 may also allow the user to see what parameters are currently governing the electronic control system 10 and the state - of - charge of the battery . display modules 32 may be stand - alone modules or modules that are built into input devices , such as the input device 24 , or hand control modules , such as the hand control modules 12 . motor control modules 14 may be provided for controlling the drive wheels 31 through the drive motors 28 and act as the hub of the electronic control system 10 as a whole . motor control modules 14 may be housed in a separate enclosure with input and output connectors . electronic cables 26 may be provided for connecting the motor control module 14 to the battery pack 30 , the drive motors 28 , the digital communications bus 40 , and possibly other devices in the electronic control system 10 , such as , speed encoders ( not shown ) on the drive motors 28 . the motor control module 14 may interpret system commands from input devices into output commands to the drive motors 28 , power seat control module 16 , light control modules 18 , environmental control modules 20 , and other parts of the electronic control system 10 . power seat control modules 16 may be used to control the position of the power seat system 34 on the vehicle , if present , so that the position of the vehicle occupant may be adjusted . power seat systems 34 may use electric actuators to control the seat tilt , the backrest recline , the seat height , and the legrest angles , if the vehicle is equipped with these capabilities . the power seat control module 16 translates the user input signals into commands to the power seat system 34 . light control modules 18 control lights 46 ( i . e ., headlights , turn indicators , and hazard lights ) on the vehicle , if such lights are present . input signals from the user are translated into light control commands by the light control module 18 . environmental control modules 20 may be used to allow the user to control devices or accessories 44 external to the vehicle , for example , computers or room lights , via the input device of the electronic control system 10 . the environmental control module 20 translates user inputs to control commands to operate the external device . the programming module 42 may be provided to custom - configure the control software for a specific vehicle user to match the user &# 39 ; s individual needs and capabilities . many control system parameters may be set using the programming module 42 , such as the maximum speed and acceleration rate . an example of a hand control module 12 according to one embodiment of the invention is illustrated in fig2 . the hand control module 12 includes various input devices and a display module 32 . the input devices include various switched inputs 48 and an analog input 50 . the switched inputs 48 include a plurality of switches and an analog input 50 is in the form of a joystick . the display module 32 also includes an iconic display for showing the user what input device 48 , 50 is active and the control mode of the electronic control system 10 . in the illustrated hand control module 12 , there are seven switches , although any suitable number of switches may be provided . the switches may communicate with the micro - controller or processor 36 through the communications bus 40 . the microprocessor 36 programmably controls the operation of the vehicle according to the software imbedded in the memory 38 . the switched inputs 48 may carry indicia to aid the user in determining the operation associated with the switched inputs 48 . for example , one switch may carry indicia that is standard for indicating power or “ on / off ”. other switches can carry indicia that are standards for indicating various vehicle light functions , such as headlights , turn indicators , and hazard lights . another switch may carry indicia for indicating a horn . yet another switch carries the abbreviated indicia , “ m ”, for “ mode ”. these are only examples of indicia that the various switched inputs 48 may carry . the display module 32 may include iconic displays , such as a visual graphic representing the vehicle , or a portion thereof , and a visual indicator for indicating drive and auxiliary control modes . with the switched inputs 48 described above , the operation of the vehicle lights can be controlled simply by depressing a switch . for example , upon depressing the power switch , operation of the vehicle is enabled or disabled . by depressing any one of the light switches , operation of the lights is controlled . similarly , by depressing the horn switch , the horn is actuated . the aforementioned functions are all performed by the microprocessor 36 in accordance with the software embedded in the memory 38 . that is say to , upon depressing a switched input 48 , a signal is communicated to the microprocessor 36 through the communications bus 40 . the microprocessor 36 performs a function associated with that signal as dictated by the software . this holds true for the mode switch as well . however , the mode switch controls the operating mode of the vehicle . for example , when the power switch is depressed to enable operation of the vehicle , the vehicle initially enters drive mode , wherein the analog input 50 controls the operation of the drive motors 28 via the motor control module 14 . upon depressing the mode switch , the user can use the analog input 50 to navigate through the visual graphic of the vehicle to control other operations of the vehicle . the visual graphic can include indicators , which represent these operations . for example , indicators in the form of lights can represent power seat functions , such as tilt , recline , lift , and legrest functions , all of which are controlled by the power seat control module 16 . the user can navigate to a desired light by moving the analog input 50 ( i . e ., the joystick ) left and right , and can perform any function represented by the light by moving the analog input 50 forward and rearward . for instance , by navigating to the lights illustrated in fig3 a , and moving the analog input 50 forward and rearward , the vehicle seat can be tilted forward and rearward , respectively . by navigating to the light illustrated in fig3 b , and moving the analog input 50 forward and rearward , the vehicle seat back can be reclined forward and rearward . the vehicle seat can be raised and lower by navigating to the light illustrated in fig3 c and moving the analog input 50 forward and rearward . legrests can similarly be adjusted by navigating to the lights in fig3 d and 3e . a standing function can be performed by navigating to the lights in fig3 f . drive modes and auxiliary modes can be selected by navigating through the visual indicator , such as the pie graph shown . the visual indicator can be divided into a desired number of segments , each representing a drive or auxiliary control mode . various drive modes can represent various drive profiles and auxiliary control modes can represent various accessory functions . users who rely on the personal mobility vehicle for mobility and accessory functions may be physically and / or cognitively disabled . the user &# 39 ; s abilities and needs can depend on the user &# 39 ; s diagnosis , age , medical history , and many other factors . hence , the user may be highly capable cognitively but highly disabled physically , or highly disabled both physically and cognitively . the electronic control system 10 according to the present invention has inputs that can be programmably mapped to outputs according to the needs of the user for convenient operation of the vehicle and the accessory functions . the electronic control system 10 is capable of reducing the number of sequences of input commands required to operate the vehicle and the accessory functions . vehicle operations and accessory functions that are most often accessed by the user can be quickly selected . consequently , users with limited physical ability can easily operate the vehicle and accessory functions with less fatigue than encountered by conventional control systems . the present invention allows different input devices , such as but not limited to the switched inputs described above , to be programmably assigned to control various vehicle operations , such as operations of the power seat system 34 , and accessory functions , such as computers or room lights . for example , switched inputs that are not frequently used , such as vehicle headlights , turn indicators , or hazard lights , can be programmably assigned to perform other vehicle operations or accessory functions . this avoids the need for the user to depress a mode switch and navigate through a display module 32 to enter , for example , the power seating mode . to this end , cognitive ability to enter the power seating mode is reduced because the user is no longer required to navigate through the visual graphic or indicator on the hand control module 12 . with the electronic control system 10 of the present invention , the user , through the depression of a single switch , without need for visual feedback , can enter the power seating mode , or another vehicle operation mode , or perform an accessory function , that would otherwise require navigation through a display module 32 . in accordance with the present invention , the software embedded in the memory 38 comprises one or more programs , procedures , and / or routines associated with the operation of an electronic control system 10 . a set of instructions directs the operation of the electronic control system 10 to perform each operation and accessory function that the vehicle is capable of performing . the software can be configured so that instructions can be associated with desired input devices ( e . g ., switched inputs ) so that the microprocessor 36 can map the input devices to control a desired control module , such as the power seat control module 16 or the environmental control module 20 . these modules 16 , 20 , in turn , control the operation of the vehicle seat ( not shown ) or accessories . this mapping can be accomplished in any known matter wherein a software profile is created for a particular user . the term “ profile ” in this context is understood to mean custom configure for the particular user . the software can be in any suitable software , and may include one or more objects , lookup tables , databases , and / or linked lists for performing the vehicle operations and accessory functions . the software may set up and initialize an array that could hold all instructions or data necessary to control the operation of the vehicle and accessory functions . in accordance with the present invention , the microprocessor 36 can be programmed to access objects , jump to subroutines , or jump to locations in the table , database , or linked list associated with particular outputs upon selection of particular switched inputs . in this way , the electronic control system 10 can be customized so that operations and functions that the user desires , or most often uses , may be performed by depressing a switch that may otherwise be associated with outputs that perform operations or functions that the user may seldom use . accordingly , the power seat control module 16 and / or the environmental control module 20 can be controlled by depressing a single switch . it should be appreciated that the inputs can be mapped to outputs in any suitable manner . for example , the switch inputs 48 are user interface objects . the outputs are targets ( e . g ., control modules ) to which the switch inputs 48 can send action messages . the action messages can represent operations ( e . g ., “ tiltup ”, “ tiltdn ”, etc .) or control functions ( e . g ., “ on ”, “ off ”, “ volup ”, “ voldn ”, etc .). the input could send an action message to the target once if momentarily selected , or continuously as long as the button is depressed . the microprocessor 36 can be programmed so that a signal from a certain input could send a desired action message to a desired target . that is to say , the action message could be programmably assigned or otherwise associated with a desired input and the target to which the action message is to be sent could be customized for the user . inputs and outputs could be set up in a look up table with records including , for example , record identification fields , title fields , function - type fields , and detail fields . each record identification field could include a record number . each title field could provide titles for an operation or function associated with a corresponding record . each function - type field could indicate the type of function associated with a corresponding record . the detail fields could indicate other record numbers and control modules affected by the operations and functions , pins thereof , and signals applied thereto , and values for parameters . parameters may be variable settings that the vehicle software uses to affect the way the vehicle drives and operates . an array may include variables , such as action and value variables . the action variable could specify the action mode and / or control function that would be activated upon depressing a switch . when the user depresses the switch , control could be passed to a command parser . the command parser could compare the value held in the action variable to a list of possible actions . upon finding a match , the command parser could send control to the appropriate output ( e . g ., control module ) in the program , which would complete the referenced action ( i . e ., enter the selected control mode and perform the associated operation or function ). the value variable could hold a value , if desired . as an example , if the action variable controls a drive profile ( e . g ., the maximum speed ) of the vehicle , the value variable could hold the desired setting for that speed . in this way , the user could easily set the maximum speed to , for example , 70 percent . the value variable could also be a relative setting . for example , if the value variable is + 10 , the maximum speed could be incremented by 10 percent . the software could control the operation of each switch . for example , the microprocessor could be programmed to interpret a switch depression as a momentary , pulse , on / off , or toggle operation . a momentary switch operation could relay an output as long as the switch is depressed . a pulse switch operation could relay an output for a specific period of time when the switch is depressed . an on / off switch operation could open or close each time the switch is depressed . a toggle switch operation could change the current state of the output ( i . e ., if the output is on , the output will be turned off ). a method for mapping inputs to the outputs is shown in fig4 . according to this method , a personal mobility vehicle is provided having inputs , outputs , and a programmable micro - controller or processor for performing vehicle operations or control functions of the outputs in response to signals from the inputs , as shown in function step 60 . in function step 62 , a desired input is selected . after the desired input is selected , an operation or control function is assigned to the input , as shown in function step 64 . then , an output is associated with the operation or control function , as shown in function step 66 . it should be appreciated that function steps 62 – 66 can be performed in any order and need not be performed in the order described above . in addition , it should be appreciated that any or all of the function steps 62 – 66 could be combined as opposed to being performed separately . it should be understood that an input to be mapped may be selected in any suitable manner . for example , an input may be selected by entering a programming mode , as shown in function step 68 , and then depressing the desired input , as shown in function step 70 . alternatively , the input may be selected from a list of inputs , as shown in optional function step 72 , or by manually entering an input , for example , into a field through the use of a terminal , as shown in optional function step 74 . once the input is selected , the input may be saved , as shown in optional function step 76 . other input may be selected in a similar manner . operation or control functions may be assigned to the input in any suitable manner . for example , operations or control functions may be selected from a list of operations or control functions , as shown in function step 78 , or be manually entered , for example , into a field through a terminal , as shown in alternative functional step 80 . operations or control functions may include , for example , action messages ( e . g ., tiltup , tiltdn , fwd , back , on , off , volup , voldn , etc .) and parameter values . once operations or control functions are assigned to desired inputs , the operations or control functions may be saved , as shown in optional function step 82 . the output may be associated with a desired input in any suitable manner . for example , outputs may be selected from a list of outputs , as shown in function step 84 , or be manually entered , for example , into a field through a terminal , as shown in alternative functional step 86 . outputs may include , for example , motor control modules , power seat control modules , or accessory control modules , which in turn control drive motors , power seat system actuators , or accessories ( e . g ., television , room lights , doors ). once the output is associated with a desired input , the output may be saved , as shown in optional function step 88 . the foregoing method can be performed in any suitable manner . for example , the method may be performed using a program editor . the program editor can include any suitable program or software application . the application may be integral with the vehicle . alternatively , the application can be stored in an external device , such as the programming module 42 described above . the programming module 42 can be removably connected or linked to the vehicle in any suitable manner , such as through a physical connector or a wireless connection , and may be in the form of a handheld pendant or palm , or a personal computer . the program editor may be in the form of a user - friendly windows application . an example of an application window for mapping inputs to outputs is shown in fig5 . the window may contain step - by - step instructions for selecting an input and assigning operations or control functions to the input . inputs may be selected by for example , selecting a “ input editor ” button , and then manually entering inputs into fields , for example , via a terminal or selecting inputs from a list of inputs ( e . g ., switch 1 , switch 2 , etc .). the latter can be accomplished with a terminal or a mouse , wherein an input is selected from a list by clicking on an input in a list , or by dragging and dropping an input from a list into a field or other designated location . as yet another alternative , an arrangement or array of inputs may be provided in the window , as shown , and an input may be selected by clicking on the input with a mouse or other peripheral device . once an input is selected , an operation or control function may be assigned to the input . this may be accomplished , for example , by manually entering operations or control functions into fields , for example , via a terminal . alternatively , operations or control functions could be selected from a list ( e . g ., tiltup , tiltdn , fwd , back , on , off , volup , voldn , param , etc .). this could be accomplished , for example , by clicking an operation or control function that is to be assigned to the selected input . alternatively , operations and control functions may be selected from a list by dragging and dropping an operation or control function from the list into a field or other designated location . once operations or control functions are assigned to the input , the operations or control functions may be saved simply by clicking a button in the window , such as “ save function ”. inputs that have not been assigned an operation or control function can be emphasized , pronounced , or highlighted in some manner , such as by allowing those inputs to appear in red font so that those inputs can be easily identified . now , output may be associated with the operation or control function . this may be accomplished in any suitable manner . for example , similar to the selection of an input or an operation or control function , an output may be selected by manually entering the output into a field , for example , via a terminal . alternatively , an output could be selected from a list ( e . g ., motor control module , power seat control module , environmental control module , etc .). this could be accomplished , for example , by clicking an output that is to be associated with the operation or control function . alternatively , outputs may be selected from a list of outputs by dragging and dropping an output from the list into a field or other designated location . it should be appreciated that the selection of operations and control functions and the selection of output may be accomplished through a single selection , and then save accordingly by clicking on a button , such as a “ finished ” button . the inputs may be changed at any time . this can be accomplished with the program editor simply by selecting the “ edit input ” button in the program editor and following the instructions . it should be understood that the invention is not intended to be limited to the application shown and described above and that other applications may be suitable for carrying out the invention . for example , outputs having pre - associated functions that may be selected from a list . it should also be understood that a program editor application may be integral with the personal mobility vehicle , as opposed to being removably linked to the personal mobility vehicle . the operation of such a program editor may be viewed on the vehicle display module 32 and controlled via the hand control module 12 . for example , the hand control module 12 may be provided with a “ program ” button that can be selected to map inputs to outputs . upon selecting this button , an input may be depressed . subsequently , the user may be prompted to select an operation or control function to be performed by the input and an output to which the input is to be mapped . alternatively , a user may navigate to a desired operation or control function and then select the “ program ” button and a desired input to map that input to the desired operation or control function . it should further be understood that the menu structure need not be created by an application but rather may be created by someone skilled in writing and editing menu structure software or algorithms . the principle and mode of operation of this invention have been explained and illustrated in its preferred embodiment . however , it must be understood that this invention may be practiced otherwise than as specifically explained and illustrated without departing from its spirit or scope .

US-69147703-A

an electronic fire suppression method that transmits a frequency wave pattern of electromagnetic wave having particular frequencies , powers and durations configured to separate and isolate components of combustion so as to suppress and extinguish the fire . a device for implementing this method of fire suppression includes a power supply and an electromagnetic wave transmitter . the electromagnetic wave transmitter is capable of transmitting frequency wave patterns having the defined frequencies , powers and durations . the device may also include one or more frequency receivers , analyzers , and controllers for detecting , analyzing , and targeting operating frequencies of a fire .

in the following detailed description , the inventive electronic fire extinguisher present invention is generally referred to by reference numeral 10 in fig1 - 9 . the primary components of the electronic fire extinguisher 10 are the power supply 12 , and the frequency wave transmitter 14 . referring now to the invention in more detail , the inventive electronic fire extinguisher 10 suppresses combustion and / or fires by emitting oscillating electromagnetic waves with fire - suppression dependent frequency , amplitude , modulation , bandwidth , and harmonics in a specific pattern . these specific patterns promote fire suppression by separating , isolating , and excluding components of combustion , e . g ., specific atom ( s ), element ( s ), molecule ( s ), compound ( s ), etc ., to be temporarily moved away from one another , thereby disrupting the interactions between these components necessary for combustion to continue , thereby removing the ability of the combustion or fire to sustain itself . it is important to note that the electromagnetic waves discussed herein are distinguished from waves that are mechanical in nature . such mechanical waves ( e . g ., sound , surf , etc .) typically require some sort of medium ( e . g ., air , water , etc .) in which to travel and cause some form is displacement within the medium . in contrast , electromagnetic waves require no medium in which to travel . the following detailed description is directed to the use of electromagnetic waves as the source of fire suppression . as used herein , the term “ combustion components ” is intended to refer to those atoms , elements , molecules , compounds , etc ., that are considered necessary to combustion . it is commonly accepted that a fire requires three things : fuel , heat , and air . this is a very simplistic view of the components , particularly where air is considered primarily for the oxygen it contains . in fact , air contains many more components that participate in combustion , including , but not limited to , oxygen , carbon , nitrogen , and hydrogen , as well as molecules that have components made up of the same common elements . most of these components of air promote combustion in some manner . while the frequency wave patterns disrupt interactions between these combustion components , the continued frequency wave patterns also prevent these combustion components from moving back together so as to re - kindle the fire as long as the oscillating frequencies are being emitted into the fire . once the fire is extinguished , the frequency wave patterns can be stopped because the fire has no ignition source to reignite . after the frequency wave pattern is ceased , all of the components are allowed to re - occupy whatever space is available without concern about further combustion . the oscillating frequencies and their harmonics emitted by this invention are capable of separating nearly all of the components that are commonly found in the atmosphere , including oxygen , carbon , nitrogen , and hydrogen , as well as molecules that have components made up of the same elements . these are some of the basic components necessary for combustion and separation of one or more of these components inhibits combustion . there are a great many frequency wave patterns that can be used for combustion / fire suppression , as long as the correct associated attributes of frequency , power and duration are configured for the specific pattern . the large number of available frequency wave patterns is possible because the following mechanisms can trigger each other multiple times . these mechanisms are : the frequency wave pattern makes up a repulsion beam that certain particles , ions , atoms , elements , molecules , and compounds cannot cross ; the frequency wave patterns prevent the interaction of particular types of particles , ions , atoms , elements , molecules , and compounds that are necessary to sustain combustion / fire ; the frequency wave patterns initiate harmonic resonance frequencies that cause certain particles , ions , atoms , elements , molecules , and compounds in the fire to disperse or erupt out of the combustion / fire ; the frequency wave patterns interact with “ operating frequencies ” of combustion / fire , thereby disrupting and changing the “ operating frequencies ” of the combustion / fire ; the frequency wave patterns cause the combustion / fire to reach its natural harmonic frequency where particles , ions , atoms , elements , molecules , and compounds in the combustion / fire oscillate until they are unable to interact and continue the process of combustion . a frequency wave pattern may consist of a single electromagnetic wave or multiple electromagnetic waves . the overall range of frequencies for all frequency wave patterns is between 2 . 500 hertz ( hz ) and 128 . 000 gigahertz ( ghz ). as discussed above , the electronic fire extinguisher does not rely upon sound waves , acoustic waves , or other waves that require a medium or generate physical movement of that medium . some prior art device rely upon such sound or acoustic waves passing through air in an attempt “ blow - out ” a fire . as discussed herein , the electronic fire extinguisher relies upon oscillations of the electromagnetic waves to interact with the combustion components and prevent interaction of the same . the overall range of power for electromagnetic waves is 0 . 1 watts ( w ) to 4 . 00 w . the overall range of duration of electromagnetic waves is generally between 0 . 1 seconds and 10 seconds , except for the final electromagnetic wave in a frequency wave pattern which is effectively continuous until the combustion / fire is extinguished . general guidelines for frequency wave pattern requirements include that the starting electromagnetic wave in a pattern has a duration of between 0 . 1 seconds and 10 seconds , unless the pattern consist of a single electromagnetic wave , in which case the single electromagnetic wave will be maintained until the fire is extinguished . in addition , higher frequencies in a frequency wave pattern require that a particular electromagnetic wave be maintained for a longer duration versus an electromagnetic wave having a lower frequency in the context of operability for fire suppression . in addition , the power output for any particular electromagnetic wave needs to be between 0 . 01 w and 4 . 0 w for distances of up to 1 , 000 feet from the frequency wave transmitter . frequency and power have an inverse relationship , e . g ., lower frequencies require more power than higher frequencies , as far as operability for fire suppression is concerned . a larger power output may be needed for distances greater than 1 , 000 feet . when utilizing proper frequency , power , and duration characteristics , there is effectively no minimum or maximum distance from a fire at which the present invention will operate . with sufficiently large transmission frequency wattages , the present invention can operate at distances of up the five miles or more . such would be beneficial for devices mounted on aircraft or other similar mobile vehicles for use with forest fires . however , a person of ordinary skill in the art will appreciate that as distance from a fire increases , the possibility of obstruction of interference with the frequency wave pattern increases . preferably , the frequencies of electromagnetic waves in a frequency wave pattern are either in ascending or descending order . it has been observed that a progression of frequencies in a frequency wave pattern is more likely to produce the desired harmonic oscillation of combustion components versus patterns that contain both increases and decreases in frequency progression . some particularly preferred frequency wave patterns for fire suppression are as follows : the present invention is used by aiming a device 10 configured to emit the inventive frequency wave patterns directly at a point in a fire . as the frequency wave patterns emitted by the device affect the components of the fire , the fire will begin to degrade until the point at which it is extinguished . at this point , the device is then aimed at another section of the fire until that section is extinguished . this process is continued until the entire fire is extinguished . for larger fires ( i . e . forest fires ) the device may be attached to a vehicle ( i . e . aircraft , plane , helicopter , boat , car , truck , etc .) and is controlled by wired or wireless remote inside the vehicle . the process of use is similar . as shown in fig1 , the most basic embodiment of the electronic fire extinguisher 10 consists of a power supply stage 12 and a frequency transmitter stage 14 . the power supply stage 12 is electrically connected to the frequency transmitter stage 14 so as to be able to receive , use , or transfer the necessary voltage and current to or from the frequency transmitter stage 14 . the power supply stage 12 can also receive , use , or transfer data , communication , and control information to the frequency transmitter stage 14 . the power supply stage 12 may have a wide range of input voltages . in one embodiment , the power supply stage 12 preferably has a voltage input ranging from 3 volts alternating current ( vac ) to 1000 vac with a current rating from 100 milliamp hours ( mah ) to 1000 amp hours ( ah ). such alternating current input voltage preferably has a frequency of 50 hertz or 60 hertz . alternatively , the power supply stage 12 can have an input ranging from 3 volts direct current ( vdc ) to 1000 vdc with a current rating from 100 mah to 1000 ah . the voltage and current output of the power supply stage 12 can range from 3 vac to 1000 vac with a current output of 100 ma to 1 ka ( depending on input voltage and current ) or / and 3 vdc to 1000 vdc with a current output of 100 ma to 1 ka ( also depending on input voltage and current ). the power supply stage 12 can include but is not limited to the following types of input / output hardware connections for interfacing with other devices : alternating current types : b , bs , c , d , e , f , h , j , k , l , i , n , m , or direct current types : anderson , aispss , amp , barrel , cigar lighter socket / plug , clipsal , concentric barrel , deans , din , duac , eiaj , inverter tabs / lugs , iso 4165 , jsbp , jst rcy , kycon , magsafe , mc4 , mini din , molex , molex microfit , molex sabre , molex sr , power pack , sr , tip , self , xlr , or usb . the direct current battery types that can be used with the power supply stage 12 include but are not limited to alkaline , nickel cadmium ( nicd ), nickel metal hydride ( nimh ), nizn , lithium , lithium ion , lead acid , wet / flooded type , calcium - calcium , vrla ( agm , gel ), deep cycle , cobalt dioxide , ncm , nca , and fepo . the power supply stage 12 can include but is not limited to a wide variety of electronic components necessary to implement this stage , such as resistors , capacitors , diodes , zener diodes , transistors ( all family &# 39 ; s and types ), integrated circuits ( i . e . cmos , ttl , logic , all family types , etc . ), led &# 39 ; s , voltage regulators , crystals , microprocessors , memory ic &# 39 ; s ( i . e . ram , rom dram , drom , sdram , etc . ), zener diodes , etc . and an assortment of other various electronic components as needed . a person of ordinary skill in the art will appreciate the components necessary to build a necessary power supply . the frequency transmitter stage 14 can output frequencies , harmonics and their related oscillations ranging from 1 hertz to 128 gigahertz with power levels ranging from 0 . 1 w to 1 mw depending on the input voltage and current source . the output ranges of frequency and power ( particularly power ) of the frequency transmitter stage 14 are greater than the preferred ranges stated elsewhere . the preferred ranges stated elsewhere are intended as optimal ranges for the described distances and fires . power outputs much greater than those preferred ranges would be necessary for fires at greater distances , e . g ., greater than one thousand feet . for example , fires at ranges of up to five miles may be suppressed using power outputs in the range of about 50 , 000 w . as described more fully below , specific frequency and power ranges , along with corresponding durations , have particular benefit to the present invention . the output frequencies , harmonics , and their related oscillations can have a root mean square ( rms ) value that ranges from 1 volt to 1 kv depending on input voltages and current source . as mentioned above , the frequency transmitter stage 14 is electronically connected to the power supply stage 12 so as to receive , use , or transfer the necessary power to or from the power supply stage 12 . the frequency transmitter stage 14 can also receive , use , or transfer data , communication , and control information to or from the power supply stage 12 . the frequency transmitter stage 14 can include a wide variety of electronic components necessary to implement this stage , as understood by a person of ordinary skill in the art , such as resistors , capacitors , diodes , zener diodes , transistors ( all family &# 39 ; s and types ), integrated circuits ( i . e . cmos , ttl , logic , all family types , etc . ), led &# 39 ; s , voltage regulators , crystals , microprocessors , memory ic &# 39 ; s ( i . e . ram , rom dram , drom , sdram , etc . ), zener diodes , etc . and an assortment of other various electronic components as needed . the electronic fire extinguisher 10 preferably contains an on / off mechanism 16 , either electrical or mechanical in nature , for either switching off the power supply stage 12 or stopping the frequency transmitter stage 14 from emitting the electromagnetic waves . this mechanism 16 can be a slide switch , a push switch , a touch switch , a voice or sound activated switch , or any other kind of switch that selectively allows power to pass through . while fig1 shows the mechanism 16 in the connection between the power supply stage 12 and the frequency transmitter stage 14 , the mechanism 16 can be electrically connected to either stage 12 , 14 , or the connection in between . as shown in fig2 , a second preferred embodiment of the electronic fire extinguisher 10 consists of the same power supply stage 12 , frequency transmitter stage 14 , and on / off mechanism 16 ( not shown in fig2 ) along with a display driver stage 18 . the power supply stage 12 , frequency transmitter stage 14 , and on / off mechanism 16 are as described above . the display driver stage 18 is preferably electrically connected to the other stages 12 , 14 . fig2 shows the display driver stage 18 between the power supply stage 12 and the frequency transmitter stage 14 , but the parts may be assembled in any order . as with the other stages , the display driver stage 18 can use , receive , or transfer power , data , communication and control information to or from the power supply stage 12 and / or the frequency transmitter stage 14 . the display driver stage 18 is preferably configured to interact with the other stages 12 , 14 , so it preferably has similar ranges of input voltages and output signals . the power supply stage 12 , frequency transmitter stage 14 , and / or display driver stage 18 can allow power , data , communication , and control information to be to input to or output from the electronic fire extinguisher 10 . in the case of output , the power , data , communication , and control information may be exported to an external device ( not shown ) so as to allow the present invention to supply the necessary and voltage and current to power the connected external device . the stages 12 , 14 , 18 may include interfacing with all common communication protocols , including but not limited to : address resolution protocol ( arp ), dynamic host configuration protocol ( dhcp ), domain name system ), file transfer protocol ftp ), hypertext transfer protocol ( http ), hypertext transfer protocol secure ( https ), internet control message protocol ( icmp ), internet group message protocol ( icmp ), internet group management protocol ( igmp ), internet message access protocol version 4 ( imap4 ), network time protocol ( ntp ), post office protocol version 3 ( pop3 ), real - time transport protocol ( rtp )— voice over internet protocol ( voip ), session initiation protocol ( sip )— voice over internet protocol ( voip ), simple mail transfer protocol ( stmp ), simple network management protocol version 2 or 3 ( snmp2 / 3 ), secure shell , ( ssh ), transmission control protocol / internet protocol ( tcp / ip ), telnet , trivial file transfer protocol ( tftp ), transport layer security ( tls ), datagram protocol ( udp ) and wifi protocols 802 . 11 - 1997 , 802 . 11a ( ofdm waveform ), 802 . 11a , 802 . 11b , 802 . 11c , 802 . 11g , 802 . 11 - 2007 , 802 . 11n , 802 . 11 - 2012 , 802 . 11ac , 802 . 11ad , 802 . 11af , 802 . 11ah , 802 . 11ai , 802 . 11aj , 802 . 11aq , 802 . 11ax , and 802 . 11ay . the display driver stage 18 can implement a visual display of information through a variety of different visual displays including but not limited to liquid crystal displays ( lcd &# 39 ; s ), light emitting displays ( led &# 39 ; s ), fluorescent , and plasma displays with any colors of text and any colors of images and any colors of backgrounds . the purpose of the display driver stage 18 is to provide a user with a visual account of the performance , transmissions , current status and currently performing actions or processes of the electronic fire extinguisher 10 . the display driver stage 18 may show electronic frequencies and / or frequency patterns being transmitted by the device 10 . the display driver stage 18 may include a wide variety of electronic components necessary to implement the functions of a visual display , including but not limited to resistors , capacitors , diodes , integrated circuits ( i . e . cmos , ttl , logic , all family types , etc . ), led &# 39 ; s , voltage regulators , crystals , microprocessors , memory ic &# 39 ; s ( i . e . ram , rom dram , drom , sdram ) etc . and an assortment of other various components as needed , as well as a variety of different visual displays including but not limited to liquid crystal displays ( lcd &# 39 ; s ), light emitting displays ( led &# 39 ; s ), fluorescent , and plasma displays . as shown in fig3 , a third preferred embodiment of the electronic fire extinguisher 10 consists of the same power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 ( not shown ), and display driver stage 18 , along with an input / output stage 20 . the power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 , and display driver stage 18 are as described above . the input / output stage 20 is preferably electrically connected to the other stages 12 , 14 , 18 . fig3 shows the input / output stage 20 between the power supply stage 12 and the display driver stage 18 , but the parts may be assembled in any order . as with the other stages , the input / output stage 20 can use , receive , or transfer power , data , communication and control information to or from the power supply stage 12 , the frequency transmitter stage 14 , and / or the display driver stage 18 . the input / output stage 20 is preferably configured to interact with the other stages 12 , 14 , 18 , so it preferably has similar ranges of input voltages and output signals . the input / output stage 20 facilitates the input or output of power , data , communication , and control information from the power supply stage 12 , frequency transmitter stage 14 , and / or display driver stage 18 in the electronic fire extinguisher 10 . in the case of output , the power , data , communication , and control information may be exported to an external device ( not shown ) so as to allow the present invention to supply the necessary and voltage and current to power the connected external device . as with the other stages , the input / output stage 20 may include but is not limited to the following types of input / output hardware connections : input / output jacks / plugs / ports for interfacing with other devices , alternating current types b , bs , c , d , e , f , h , j , k , l , i , n , m and direct current types anderson , aispss , amp , barrel , cigar lighter socket / plug , clipsal , concentric barrel , deans , din , duac , eiaj , inverter tabs / lugs , iso 4165 , jsbp , jst rcy , kycon , magsafe , mc4 , mini din , molex , molex microfit , molex sabre , molex sr , power pack , sr , tip , self , xlr , usb . the input / output stage 20 can allow power , data , communication , and control information to be to input to or output from the electronic fire extinguisher 10 as described above . the input / output stage 20 can utilize common communication protocols including but not limited to : address resolution protocol ( arp ), dynamic host configuration protocol ( dhcp ), domain name system , file transfer protocol ftp ), hypertext transfer protocol ( http ), hypertext transfer protocol secure ( https ), internet control message protocol ( icmp ), internet group message protocol ( icmp ), internet group management protocol ( igmp ), internet message access protocol version 4 ( imap4 ), network time protocol ( ntp ), post office protocol version 3 ( pop3 ), real - time transport protocol ( rtp )— voice over internet protocol ( voip ), session initiation protocol ( sip )— voice over internet protocol ( voip ), simple mail transfer protocol ( stmp ), simple network management protocol version 2 or 3 ( snmp2 / 3 ), secure shell , ( ssh ), transmission control protocol / internet protocol ( tcp / ip ), telnet , trivial file transfer protocol ( tftp ), transport layer security ( tls ), datagram protocol ( udp ) and wifi protocols 802 . 11 - 1997 , 802 . 11a ( ofdm waveform ), 802 . 11a , 802 . 11b , 802 . 11c , 802 . 11g , 802 . 11 - 2007 , 802 . 11n , 802 . 11 - 2012 , 802 . 11ac , 802 . 11ad , 802 . 11af , 802 . 11ah , 802 . 11ai , 802 . 11aj , 802 . 11aq , 802 . 11ax , and 802 . 1lay . the input / output stage 20 can include a variety of electronic components necessary to implement the electronic fire extinguisher 10 including the same components as described above . as shown in fig4 , a fourth preferred embodiment of the electronic fire extinguisher 10 consists of the same power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 ( not shown ), display driver stage 18 , an input / output stage 20 , as well as , a receiver stage 22 . the power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 , display driver stage 18 , and input / output stage 20 are as described above . the receiver stage 20 is preferably electrically connected to the other stages 12 , 14 , 18 , 20 . fig4 shows the receiver stage 22 between the frequency transmitter stage 14 and the display driver stage 18 , but the parts may be assembled in any order . as with the other stages , the receiver stage 22 can use , receive , or transfer power , data , communication and control information to or from the power supply stage 12 , the frequency transmitter stage 14 , and / or the display driver stage 18 . the receiver stage 22 is preferably configured to interact with the other stages 12 , 14 , 18 , 20 , so it preferably has similar ranges of input voltages and output signals . the receiver stage 22 is configured to receive signals or frequencies generated by the fire to be analyzed by the present invention . receiving frequencies in the receiver stage 22 will aid the electronic fire extinguisher 10 in determining what frequencies and / or patterns will have to be generated to disrupt the fire &# 39 ; s ability to sustain itself . as shown in fig5 , a fifth preferred embodiment of the electronic fire extinguisher 10 consists of the same power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 ( not shown ), display driver stage 18 , input / output stage 20 , and receiver stage 22 , as well as , a receiving frequency analyzer stage 24 . the power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 , display driver stage 18 , input / output stage 20 , and receiver stage 22 are as described above . the receiving frequency analyzer stage 24 is preferably electrically connected to the other stages 12 , 14 , 18 , 20 , 22 . fig5 shows the receiving frequency analyzer stage 24 between the frequency transmitter stage 14 and the receiver stage 22 ( or in parallel the power supply stage 12 ), but the parts may be assembled in any order . as with the other stages , the receiving frequency analyzer stage 24 can use , receive , or transfer power , data , communication and control information to or from the power supply stage 12 , the frequency transmitter stage 14 , the display driver stage 18 , the input / output stage 20 , and / or the receiver stage 22 . the receiving frequency analyzer stage 24 is preferably configured to interact with the other stages 12 , 14 , 18 , 20 , 22 , so it preferably has similar ranges of input voltages and output signals . the receiving frequency analyzer stage 24 works in conjunction with the receiver stage 22 to receive signals or frequencies generated by the fire to be analyzed as described above . the receiving frequency analyzer stage 24 can analyze the signals and frequencies received by the receiver stage 22 to determine the optimal transmitting frequencies to prevent the fire from sustaining itself . this analyzing process can involve but is not limited to the use of : software ; software subroutines ; quantum mechanics ; nuclear physics ; molecular chemistry ; atomic , elemental , and molecular movement detectors ( hardware and software ); atmospheric vital statistic determiners ( hardware and software ); and additional sensors and detectors as needed . as shown in fig6 , a sixth preferred embodiment of the electronic fire extinguisher 10 consists of the same power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 ( not shown ), display driver stage 18 , input / output stage 20 , receiver stage 22 , and receiving frequency analyzer stage 24 , as well as , a controller stage 26 . the power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 , display driver stage 18 , input / output stage 20 , receiver stage 22 , and receiving frequency analyzer stage 24 are as described above . the controller stage 26 is preferably electrically connected to the other stages 12 , 14 , 18 , 20 , 22 , 24 . fig6 shows the controller stage 26 between the display driver stage 18 and the receiving frequency analyzer stage 24 ( or in parallel the power supply stage 12 ), but the parts may be assembled in any order . as with the other stages , the controller stage 26 can use , receive , or transfer power , data , communication and control information to or from the power supply stage 12 , the frequency transmitter stage 14 , the display driver stage 18 , the input / output stage 20 , the receiver stage 22 , and / or the receiving frequency analyzer stage 24 . the controller stage 26 is preferably configured to interact with the other stages 12 , 14 , 18 , 20 , 22 , 24 , so it preferably has similar ranges of input voltages and output signals . the controller stage 26 operates to electronically regulate , condition , or modify the transmission of frequencies , as well as , to control any of the other stages of the electronic fire extinguisher 10 . this controller stage 26 may work in conjunction with the receiving frequency analyzer stage 24 and utilize : software ; software subroutines ; quantum mechanics ; nuclear physics ; molecular chemistry ; atomic , elemental , and molecular movement detectors ( hardware and software ); atmospheric vital statistic determiners ( hardware and software ); and additional sensors and detectors as needed . as shown in fig7 , a seventh preferred embodiment of the electronic fire extinguisher 10 consists of the same power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 ( not shown ), display driver stage 18 , input / output stage 20 , receiver stage 22 , receiving frequency analyzer stage 24 , and controller stage 26 , as well as , a second receiving frequency analyzer stage 28 . the power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 , display driver stage 18 , input / output stage 20 , receiver stage 22 , receiving frequency analyzer stage 24 , and controller stage 26 are as described above . the second receiving frequency analyzer stage 28 is preferably electrically connected to the other stages 12 , 14 , 18 , 20 , 22 , 24 , 26 . fig7 shows the second receiving frequency analyzer stage 28 between the input / output stage 20 and the controller stage 26 ( or in parallel the power supply stage 12 ), but the parts may be assembled in any order . as with the other stages , the second receiving frequency analyzer stage 28 can use , receive , or transfer power , data , communication and control information to or from the power supply stage 12 , the frequency transmitter stage 14 , the display driver stage 18 , the input / output stage 20 , the receiver stage 22 , the receiving frequency analyzer stage 24 , and / or the controller stage 26 . the second receiving frequency analyzer stage 28 is preferably configured to interact with the other stages 12 , 14 , 18 , 20 , 22 , 24 , 26 , so it preferably has similar ranges of input voltages and output signals . the second receiving frequency analyzer stage 28 preferably cooperates with the receiver stage 22 , the receiving frequency analyzer stage 24 , and the controller stage 26 to more effectively electronically regulate , condition , or modify the transmission of frequencies to a fire . the second receiving frequency analyzer stage 28 allows the electronic fire extinguisher 10 to fine tune its emitted frequency wave patterns by determining the cause and effect relationship ( the dx difference on the fire ) of the different frequencies being transmitted into the fire thereby allowing the electronic fire extinguisher 10 to optimize the transmitting frequencies to obtain a faster and more efficient fire extinguishing process . this second receiving frequency analyzer stage 28 may work in conjunction with the receiving frequency analyzer stage 24 and utilize : software ; software subroutines ; quantum mechanics ; nuclear physics ; molecular chemistry ; atomic , elemental , and molecular movement detectors ( hardware and software ); atmospheric vital statistic determiners ( hardware and software ); and additional sensors and detectors as needed . as shown in fig8 , an eighth preferred embodiment of the electronic fire extinguisher 10 consists of the same power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 ( not shown ), display driver stage 18 , input / output stage 20 , receiver stage 22 , receiving frequency analyzer stage 24 , controller stage 26 , and second receiving frequency analyzer stage 28 , as well as , a second receiver stage 30 . the power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 , display driver stage 18 , input / output stage 20 , receiver stage 22 , receiving frequency analyzer stage 24 , controller stage 26 , and second receiving frequency analyzer stage 28 are as described above . the second receiver stage 30 is preferably electrically connected to the other stages 12 , 14 , 18 , 20 , 22 , 24 , 26 , 28 . fig8 shows the second receiver stage 30 between the input / output stage 20 and the controller stage 26 ( or in parallel the power supply stage 12 ), but the parts may be assembled in any order . as with the other stages , the second receiver stage 30 can use , receive , or transfer power , data , communication and control information to or from the power supply stage 12 , the frequency transmitter stage 14 , the display driver stage 18 , the input / output stage 20 , the receiver stage 22 , the receiving frequency analyzer stage 24 , the controller stage 26 , and / or the second receiving frequency analyzer stage 28 . the second receiver stage 30 is preferably configured to interact with the other stages 12 , 14 , 18 , 20 , 22 , 24 , 26 , 28 , so it preferably has similar ranges of input voltages and output signals . the second receiver stage 30 preferably cooperates with the second receiving frequency analyzer stage 28 and the controller stage 26 so as to work on analyzing a portion of the fire other than the one that is presenting being subjected to electronic frequency waves . the second receiver stage 30 is configured to receive frequencies from the next section of the fire before the electronic fire extinguisher 10 has completed the transmitting and extinguishing process of the section of the fire it is currently working on . in this way , the electronic fire extinguisher can have already determined the proper and most efficient transmitting frequencies to extinguish the fire even faster and more efficiently . the second receiving frequency analyzer stage 28 can then analyze the cause and effects of a particular transmission pattern ahead of time for a quicker fire extinguishing process and completion . such stage 30 can use of software , software subroutines , fractal and integral calculus , quantum mechanics ; nuclear physics ; molecular chemistry ; atomic , elemental , and molecular movement detectors ( hardware and software ); atmospheric vital statistic determiners ( hardware and software ); and additional sensors and detectors as needed . as shown in fig9 , a ninth preferred embodiment of the electronic fire extinguisher 10 consists of the same power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 ( not shown ), display driver stage 18 , input / output stage 20 , receiver stage 22 , receiving frequency analyzer stage 24 , controller stage 26 , second receiving frequency analyzer stage 28 , and second receiver stage 30 , as well as , a second controller stage 32 . the power supply stage 12 , frequency transmitter stage 14 , on / off mechanism 16 , display driver stage 18 , input / output stage 20 , receiver stage 22 , receiving frequency analyzer stage 24 , controller stage 26 , second receiving frequency analyzer stage 28 , and second receiver stage 30 are as described above . the second controller stage 32 is preferably electrically connected to the other stages 12 , 14 , 18 , 20 , 22 , 24 , 26 , 28 , 30 . fig9 shows the second controller stage 32 between the frequency transmitter stage 14 and the second receiving frequency analyzer stage 28 , but the parts may be assembled in any order . as with the other stages , the second receiver controller stage 32 can use , receive , or transfer power , data , communication and control information to or from the power supply stage 12 , the frequency transmitter stage 14 , the display driver stage 18 , the input / output stage 20 , the receiver stage 22 , the receiving frequency analyzer stage 24 , the controller stage 26 , the second receiving frequency analyzer stage 28 , and / or the second receiver stage 30 . the second controller stage 32 is preferably configured to interact with the other stages 12 , 14 , 18 , 20 , 22 , 24 , 26 , 28 , 30 , so it preferably has similar ranges of input voltages and output signals . the second controller stage 32 preferably cooperates with the second receiving frequency analyzer stage 28 to regulate , condition , or modify the transmission of frequency pattern , to control any of the stages in the present invention . the second controller stage 32 can include , but is not limited to the use of : software ; software subroutines ; quantum mechanics ; nuclear physics ; molecular chemistry ; atomic , elemental , and molecular movement detectors ( hardware and software ); atmosphere vital statistic determiners ( hardware and software ); and additional sensors and detectors as needed , as well as , the ability to control the individual stages and processes that can be controlled by other stages . the details of how the various stages in the electronic fire extinguisher 10 are constructed and connected are not critical to the present invention , so long as power is supplied and electronic frequencies are emitted consistent with the frequencies and patterns described herein . a person of ordinary skill in the electronic arts will understand how to construct devices / stages capable of meeting the stated requirements . such a person will understand and appreciate the existence of variations , combinations , and equivalents of the specific embodiments , methods , and examples herein . the invention should therefore not be limited by the above described embodiment , method , and examples , but by all embodiments and methods within the scope and spirit of the invention . accordingly , the invention is not to be limited , except as by the appended claims .

US-201715415757-A

according to the invention , there is provided a hybrid maize plant , designated as 3860 , produced by crossing two pioneer hi - bred international , inc . proprietary inbred maize lines . this invention relates to the hybrid seed 3860 , the hybrid plant produced from the seed , and variants , mutants , and trivial modifications of hybrid 3860 .

pioneer brand hybrid 3860 is a single cross , yellow endosperm , dent maize hybrid with excellent yield for the 90 crm zone . hybrid 3860 is high yielding relative to other hybrids of similar maturity , over a range of yield levels . hybrid 3860 is high yielding in low populations as well as high populations , which is unusual for hybrids in its maturity zone . the ability to yield when planted at lower populations is a major help to farmers where normal growing conditions might include a cold spring that reduces the hybrid stand . hybrid 3860 has the potential to compensate by increasing the yield on remaining plants . lower populations tend also to be planted by farmers where rainfall limits corn yields . hybrid 3860 &# 39 ; s ability to yield in low population conditions , as well as its superior drought tolerance , especially adapt 3860 to dryland farming . hybrid 3860 demonstrates excellent staygreen and fast drydown . hybrid 3860 demonstrates above average early growth . hybrid 3860 is also characterized by its above average silage yield and digestibility . hybrid 3860 is surprising not only in its ability to yield well under low population conditions , but it demonstrates an unexpected , consistent drought tolerance . hybrid 3860 yields well in dryland conditions where rainfall limits the amount of seed most hybrids produce . hybrid 3860 is also unique in its excellent field appearance , showing off its large , thick ear size in the fall . this hybrid has the following characteristics based on the data collected primarily at johnston , iowa . table 1______________________________________variety description informationhybrid = pioneer brand 3860______________________________________type : dent region best adapted : northa . minnesota relative maturity rating ( harvest moisture ): 92 gdu &# 39 ; s to physiological maturity ( black layer ): 2140 gdu &# 39 ; s to 50 % silk : 1130b . plant characteristics : plant height ( to tassel tip ): 263 cm length of top ear internode : 19 cm number of ears per stalk : slight two - ear tendency ear height ( to base of top ear ): 111 cm number of tillers : none cytoplasm type : normalc . leaf : color : ( b14 ) dark green * angle from stalk : & lt ; 30 degrees marginal waves ( oh7l ) many number of leaves ( mature plants ): 18 sheath pubescence : ( w22 ) light longitudinal creases : ( oh56a ) few length ( ear node leaf ): 93 cm width ( widest point , ear node leaf ): 10 cmd . tassel : number of lateral branches : 7 branch angle from central spike : & gt ; 45 degrees pollen shed : ( kv21 ) heavy peduncle length ( top leaf to basal branches ): 21 cm anther color : red * glume color : green * e . ear ( husked ear data except when stated otherwise ): length : 19 cm weight : 203 gm mid - point diameter : 46 mm silk color : salmon * husk extension ( harvest stage ): medium ( barely covering ear ) husk leaf : long (& gt ; 15 cm ) taper of ear : average position of shank ( dry husks ): upright kernel rows : straight , distinct number = 16 husk color ( fresh ): light green * husk color ( dry ): buff * shank length : 22 cm shank ( no . of internodes ): 9f . kernel ( dried ): size ( from ear mid - point ) length : 13 mm width : 9 mm thick : 55 mm shape grade (% rounds ): 9 pericarp color : colorless * aleurone color : homozygous yellow * endosperm color : yellow * endosperm type : normal starch gm wt / 100 seeds ( unsized ): 34 gmg . cob : diameter at mid - point : 25 mm strength : strong color : red * h . diseases : n . leaf blight ( e . turcicum ): susceptible eye spot ( k . zeae ): intermediate goss &# 39 ; s wilt ( c . nebraskense ): resistant fusarium ear mold ( f . moniliforme ): susceptible gibberella ear rot ( g . zeae ): intermediatethe above descriptions are based on a scale of 1 - 9 , 1 being highlysusceptible , 9 being highly resistant . s ( susceptible ): would generally represent a score of 1 - 3 . i ( intermediate ): would generally represent a score of 4 - 5 . r ( resistant ): would generally represent a score of 6 - 7 . h ( highly resistant ): would generally represent a score of 8 - 9 . highly resistant does not imply the inbred is immune . i . variety most closely resembling : character hybridmaturity poineer brand 3845usage poineer brand 3845______________________________________ * in interpreting the foregoing color designations , reference may be had t the munsell glossy book of color , a standard color reference . data for items b , c , d , e , f , and g is based primarily on a maximum of two reps from johnston , iowa grown in 1994 . comparisons of characteristics for pioneer brand hybrid 3860 were made against pioneer brand hybrids 3905 , 3845 , 3795 , 3787 and 3790 . table 2a compares pioneer hybrid 3860 and pioneer hybrid 3905 . the results show hybrid 3860 is significantly higher yielding and taller than hybrid 3905 . table 2b compares pioneer hybrid 3860 and pioneer hybrid 3845 . the results show hybrid 3860 is significantly higher yielding than hybrid 3845 . table 2c compares pioneer hybrid 3860 and pioneer hybrid 3795 . the results show hybrid 3860 is significantly higher yielding than hybrid 3795 . table 2d compares pioneer hybrid 3860 and pioneer hybrid 3787 . the results show hybrid 3860 is significantly higher yielding than hybrid 3787 . in addition , hybrid 3860 has taller plants and higher ear placement than hybrid 3787 . table 2e compares pioneer hybrid 3860 and pioneer hybrid 3790 . the results show hybrid 3860 is significantly higher yielding than hybrid 3790 . in addition , hybrid 3860 has taller plants and higher ear placement than hybrid 3790 . table 2a__________________________________________________________________________paired comparison reportvariety # 1 = 3860variety # 2 = 3905 bu bu tst sdg est til gdu gdu var acr acr mst wt vgr cnt ler shd slk # abs % mn abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 145 . 0 107 25 . 5 51 . 7 5 . 8 58 . 2 2 . 4 108 . 9 109 . 8 2 135 . 1 101 22 . 9 54 . 2 5 . 9 61 . 9 0 . 9 108 . 0 107 . 4 locs 87 87 89 54 74 79 2 41 27 reps 144 144 146 76 117 126 4 64 44 diff 9 . 9 6 2 . 6 2 . 5 0 . 1 3 . 7 1 . 5 0 . 9 2 . 5 prob . 000 # . 000 # . 000 # . 000 # . 612 . 000 # . 221 . 007 # . 000 # __________________________________________________________________________ plt ear rt sta stk brt grn ear drp var ht ht ldg grn ldg stk app mld ear # abs abs abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 102 . 9 47 . 2 90 . 7 5 . 6 91 . 5 99 . 6 5 . 6 7 . 8 99 . 8 2 99 . 5 45 . 6 94 . 8 5 . 3 93 . 8 99 . 8 5 . 9 7 . 8 99 . 8 locs 48 46 27 28 77 11 19 2 53 reps 69 66 49 35 112 12 20 4 66 diff 3 . 4 1 . 6 4 . 1 0 . 4 2 . 3 0 . 2 0 . 4 0 . 0 0 . 0 prob . 000 # . 061 * . 062 * . 341 . 009 # . 341 . 148 1 . 00 . 674__________________________________________________________________________ nlf gos hd fus gib eye ecb ecb var blt wlt smt ers ers spt dpe 2sc # abs abs abs abs abs abs abs abs__________________________________________________________________________ total sum 1 3 . 0 6 . 0 95 . 9 3 . 5 5 . 0 4 . 3 99 . 3 8 . 0 2 6 . 1 6 . 0 94 . 9 2 . 5 5 . 4 5 . 5 99 . 7 8 . 0 locs 3 2 5 2 8 2 3 1 reps 7 4 10 3 15 3 4 1 diff 3 . 1 0 . 0 1 . 0 1 . 0 0 . 4 1 . 3 0 . 4 0 . 0 prob . 055 * . 000 # . 771 . 000 # . 351 . 126 . 697__________________________________________________________________________ * = 10 % sig + = 5 % sig # = 1 % sig table 2b__________________________________________________________________________paired comparison reportvariety # 1 = 3860variety # 2 = 3845 bu bu tst sdg est gdu gdu plt var acr acr mst wt vgr cnt shd slk ht # abs % mn abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 144 . 0 106 27 . 1 51 . 2 5 . 6 62 . 6 109 . 8 110 . 2 100 . 6 2 134 . 9 99 26 . 6 52 . 1 6 . 4 65 . 9 112 . 0 112 . 7 107 . 2 locs 95 95 96 56 78 74 45 30 62 reps 157 157 158 90 104 111 69 45 91 diff 9 . 1 7 0 . 5 0 . 9 0 . 8 3 . 3 2 . 2 2 . 5 6 . 7 prob . 000 # . 000 # . 058 * . 008 # . 000 # . 000 # . 000 # . 000 # . 000 # __________________________________________________________________________ ear rt sta stk brt grn ear drp nlf var ht ldg grn ldg stk app mld ear blt # abs abs abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 46 . 5 93 . 2 5 . 8 90 . 8 99 . 6 5 . 0 7 . 8 99 . 9 3 . 0 2 45 . 4 95 . 9 5 . 8 92 . 6 99 . 8 5 . 1 8 . 0 99 . 9 6 . 6 locs 62 42 33 78 10 24 2 49 3 reps 92 76 41 129 11 30 4 73 7 diff 1 . 1 2 . 7 0 . 0 1 . 8 0 . 2 0 . 0 0 . 3 0 . 1 3 . 6 prob . 091 * . 064 * . 000 # . 070 * . 343 . 853 . 500 . 601 . 064 * __________________________________________________________________________ gos hd fus gib eye ecb ecb ecb ecb var wlt smt ers ers spt dpe 1lf 2sc 2it # abs abs abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 6 . 0 95 . 9 3 . 5 5 . 0 4 . 3 99 . 5 4 . 0 6 . 3 4 . 0 2 7 . 3 99 . 0 5 . 0 5 . 3 6 . 5 99 . 2 4 . 2 6 . 0 3 . 4 locs 2 5 2 8 2 4 3 3 1 reps 4 10 3 15 3 7 8 7 3 diff 1 . 3 3 . 0 1 . 5 0 . 3 2 . 3 0 . 3 0 . 2 0 . 3 0 . 6 prob . 126 . 218 . 500 . 577 . 070 * . 798 . 184 . 828__________________________________________________________________________ * = 10 % sig + = 5 % sig # = 1 % sig table 2c__________________________________________________________________________paired comparison reportvariety # 1 = 3860variety # 2 = 3795 bu bu tst sdg est gdu gdu var acr acr mst wt vgr cnt shd slk # abs % mn abs abs abs abs abs abs__________________________________________________________________________total sum 1 132 . 1 109 28 . 9 49 . 7 5 . 9 66 . 6 108 . 7 108 . 7 2 121 . 8 100 28 . 4 51 . 2 5 . 4 69 . 3 107 . 7 108 . 5 locs 41 41 42 29 33 41 22 9 reps 59 59 60 40 48 59 37 17 diff 10 . 4 9 0 . 6 1 . 5 0 . 5 2 . 6 0 . 9 0 . 2 prob . 000 # . 000 # . 146 . 000 # . 051 * . 002 # . 099 * . 796__________________________________________________________________________ plt ear rt sta stk grn ear var ht ht ldg grn ldg app mld # abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 102 . 5 44 . 8 95 . 4 6 . 6 89 . 7 5 . 6 8 . 0 2 102 . 9 43 . 8 99 . 4 6 . 3 92 . 5 5 . 6 8 . 0 locs 25 23 12 13 42 14 1 reps 37 34 18 20 60 18 2 diff 0 . 4 1 . 1 3 . 9 0 . 3 2 . 8 0 . 0 0 . 0 prob . 654 . 213 . 383 . 303 . 070 * . 883__________________________________________________________________________ drp nlf gos hd fus gib ecb var ear blt wlt smt ers ers dpe # abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 99 . 9 4 . 0 6 . 0 94 . 0 4 . 0 4 . 5 99 . 3 2 99 . 6 7 . 0 6 . 0 98 . 6 4 . 5 4 . 8 99 . 3 locs 14 2 1 3 1 4 3 reps 16 3 2 6 2 8 4 diff 0 . 3 3 . 0 0 . 0 4 . 6 0 . 5 0 . 3 0 . 0 prob . 461 . 205 . 090 * . 664 . 000 # __________________________________________________________________________ * = 10 % sig + = 5 % sig # = 1 % sig table 2d__________________________________________________________________________paired comparison reportvariety # 1 = 3860variety # 2 = 3787 bu bu tst sdg est gdu gdu var acr acr mst wt vgr cnt shd slk # abs % mn abs abs abs abs abs abs__________________________________________________________________________total sum 1 115 . 7 105 27 . 0 50 . 4 6 . 1 60 . 5 108 . 1 107 . 5 2 110 . 0 99 28 . 0 51 . 8 5 . 8 63 . 5 108 . 8 107 . 9 locs 40 40 41 37 27 33 16 7 reps 90 90 91 66 33 54 25 13 diff 5 . 7 6 1 . 0 1 . 4 0 . 4 2 . 9 0 . 7 0 . 4 prob . 021 + . 015 + . 015 + . 000 # . 152 . 014 + . 166 . 649__________________________________________________________________________ plt ear rt sta stk brt grn ear var ht ht ldg grn ldg stk app mld # abs abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 98 . 9 41 . 2 92 . 6 4 . 0 88 . 1 99 . 5 5 . 6 8 . 0 2 97 . 4 37 . 8 95 . 0 5 . 8 93 . 3 99 . 2 5 . 6 6 . 0 locs 23 23 6 5 33 4 17 1 reps 37 37 21 5 61 5 28 2 diff 1 . 5 3 . 4 2 . 4 1 . 8 5 . 1 0 . 3 0 . 0 2 . 0 prob . 032 + . 000 # . 184 . 009 # . 005 # . 391 . 926__________________________________________________________________________ drp nlf gos hd fus gib ecb var ear blt wlt smt ers ers dpe # abs abs abs abs abs abs abs__________________________________________________________________________ total sum 1 99 . 9 3 . 0 6 . 0 94 . 0 4 . 0 4 . 5 99 . 3 2 100 . 0 7 . 0 2 . 0 100 . 0 2 . 5 3 . 5 100 . 0 locs 23 1 1 3 1 4 3 reps 39 2 2 6 2 8 4 diff 0 . 1 4 . 0 4 . 0 6 . 0 1 . 5 1 . 0 0 . 7 prob . 329 . 069 * . 116 . 423__________________________________________________________________________ * = 10 % sig + = 5 % sig # = 1 % sig table 2e__________________________________________________________________________paired comparison reportvariety # 1 = 3860variety # 2 = 3790 bu bu tst sdg est gdu gdu var acr acr mst wt vgr cnt shd slk # abs % mn abs abs abs abs abs abs__________________________________________________________________________total sum 1 138 . 5 108 26 . 5 51 . 5 5 . 8 61 . 5 111 . 7 110 . 5 2 124 . 5 98 27 . 4 53 . 8 5 . 9 64 . 2 112 . 9 112 . 0 locs 45 45 47 32 39 45 23 15 reps 61 61 63 44 53 63 48 32 diff 14 . 0 10 0 . 9 2 . 3 0 . 1 2 . 7 1 . 2 1 . 5 prob . 000 # . 000 # . 002 # . 000 # . 621 . 001 # . 012 + . 038 + __________________________________________________________________________ plt ear rt sta stk brt grn ear var ht ht ldg grn ldg stk app mld # abs abs abs abs abs abs abs abs__________________________________________________________________________total sum 1 102 . 6 45 . 5 95 . 2 5 . 7 88 . 0 99 . 5 5 . 6 8 . 0 2 99 . 0 43 . 9 93 . 7 6 . 7 92 . 6 100 . 0 5 . 5 5 . 0 locs 27 26 17 23 42 9 7 1 reps 39 37 22 32 58 10 8 2 diff 3 . 6 1 . 6 1 . 5 1 . 0 4 . 6 0 . 5 0 . 1 3 . 0 prob . 002 # . 087 * . 377 . 004 # . 010 + . 169 . 884__________________________________________________________________________ drp nlf gos hd fus gib ecb var ear blt wlt smt ers ers dpe # abs abs abs abs abs abs abs__________________________________________________________________________ total sum 1 99 . 8 4 . 0 6 . 0 94 . 0 4 . 0 4 . 5 99 . 3 2 99 . 9 7 . 0 6 . 0 97 . 1 4 . 5 4 . 5 99 . 7 locs 23 2 1 3 1 4 3 reps 24 3 2 6 2 8 4 diff 0 . 1 3 . 0 0 . 0 3 . 2 0 . 5 0 . 0 0 . 4 prob . 589 . 000 # . 366 . 000 # . 697__________________________________________________________________________ * = 10 % sig + = 5 % sig # = 1 % sig comparison data was collected from strip tests that were grown by farmers . each hybrid was grown in strips of 4 , 6 , 8 , 12 , etc . rows in fields depending on the size of the planter used . the data was collected from strip tests that had the hybrids in the same area and weighed . the moisture percentage was determined and bushels per acre was adjusted to 15 . 5 percent moisture . the number of comparisons represent the number of locations or replications for the two hybrids that were grown in the same field in close proximity and compared . comparison strip testing was done between pioneer brand hybrid 3860 and pioneer brand hybrids 3905 , 3845 , 3795 , 3787 , and 3790 . the comparisons come from all the hybrid &# 39 ; s adapted growing areas in the united states . these results are presented in table 3 . hybrid 3860 has a weighted average 2 . 1 bushel per acre yield advantage over the other hybrids . in addition , hybrid 3860 has a weighted average income advantage of $ 2 . 91 per acre over the other hybrids . table 3__________________________________________________________________________pioneer hybrid 3860 vs . pioneer hybrids 3905 , 3845 , 3795 , 3787 and 3790from 1994 strip tests income / pop stand roots testbrand product yield moist acre k / acre (%) (%) wt__________________________________________________________________________pioneer 3860 153 . 9 21 . 9 310 . 41 25 . 3 92 97 54 . 1pioneer 3905 149 . 1 20 . 3 305 . 47 26 . 2 96 97 56 . 7advantage 4 . 8 - 1 . 6 4 . 94 - 0 . 9 - 4 0 - 2 . 6 # comparisons 306 306 306 220 188 161 298percent wins 67 8 60 32 18 12 3prob . of diff . 99 99 99 99 99 60 99pioneer 3860 153 . 9 20 . 7 314 . 53 24 . 3 88 94 53 . 8pioneer 3845 156 . 0 20 . 3 320 . 25 25 . 5 88 97 55 . 9advantage - 2 . 1 - 0 . 4 - 5 . 72 - 1 . 2 0 - 3 - 2 . 1 # comparisons 252 252 252 163 137 113 248percent wins 44 31 40 26 41 8 4prob . of diff . 99 99 99 99 42 98 99pioneer 3860 153 . 7 23 . 8 304 . 85 26 . 2 94 99 55 . 3pioneer 3795 150 . 4 23 . 9 297 . 69 27 . 1 97 99 57 . 2advantage 3 . 3 0 . 1 7 . 16 - 0 . 9 - 3 0 - 1 . 9 # comparisons 97 97 97 79 75 57 96percent wins 69 54 71 25 16 7 7prob . of diff . 99 68 99 99 99 72 99pioneer 3860 152 . 4 21 . 6 308 . 85 25 . 4 87 96 54 . 5pioneer 3787 153 . 1 22 . 5 307 . 17 26 . 9 95 96 56 . 2advantage - 0 . 7 0 . 9 1 . 68 &# 39 ; 1 . 5 - 8 0 - 1 . 7 # comparisons 113 113 113 85 77 64 113percent wins 46 74 55 18 11 12 4prob . of diff . 50 99 60 99 99 0 99pioneer 3860 149 . 5 22 . 0 300 . 80 25 . 3 92 99 55 . 3pioneer 3790 144 . 3 22 . 7 288 . 39 26 . 0 94 99 58 . 2advantage 5 . 2 0 . 7 12 . 41 - 0 . 7 - 2 0 - 2 . 9 # comparisons 135 135 135 101 89 65 131percent wins 74 71 80 33 25 7 3prob . of diff . 99 99 99 99 99 26 99pioneer 3860 153 . 0 21 . 8 309 . 33 25 . 2 91 97 54 . 4weighted avg 150 . 9 21 . 3 306 . 42 26 . 2 94 98 56 . 7advantage 2 . 1 - 0 . 5 2 . 91 - 1 . 0 - 3 - 1 - 2 . 3 # comparisons 903 903 903 648 566 460 886percent wins 59 37 58 28 23 10 4prob . of diff . 99 99 99 99 99 97 99__________________________________________________________________________ note : the probability values in table 3 are useful in analyzing if there is a real difference in the genetic potential of the products involved . high values are desirable , with 95 % considered significant for real differences . characteristics of pioneer hybrid 3860 are compared to pioneer hybrids 3905 , 3845 , 3795 , 3787 and 3790 in table 4 . the values given for most of the traits are on a 1 - 9 basis . in these cases 9 would be outstanding , while 1 would be poor for the given characteristics . these values are based on performance of a given hybrid relative to other pioneer commercial , precommercial and competitive hybrids that are grown in research and strip test trials . these performance based values are determined utilizing several factors such as research data , experience the trained corn researchers had in the field , and sales experience with the hybrids in strip tests and the field . these values reflect the hybrid &# 39 ; s relative performance to other hybrids for the characteristics listed . table 4 shows 3860 yields very well for its maturity and is well adapted to both high and low density populations . table 4__________________________________________________________________________hybrid patent comparisons - characteristicspioneer hybrid 3860 vs . pioneer hybrids 3905 , 3845 , 3795 , 3787 and 3790 silk phy gdu gdu h / l / variety crm crm crm silk phy yld pop pop d / d s / l r / l__________________________________________________________________________3860 92 91 91 1130 2140 9 8 9 7 4 43905 87 88 88 1090 2060 9 9 8 6 7 63845 91 94 94 1160 2170 8 8 8 8 5 63795 92 91 89 1130 2080 7 8 7 5 6 43787 95 92 92 1140 2170 7 7 6 6 6 53790 95 93 93 1150 2190 7 7 6 6 6 5__________________________________________________________________________ sta tst plt ear brtvariety grn d / t wt g / a e / g ht ht d / e stk pro p / y__________________________________________________________________________3860 7 7 3 5 6 6 7 6 5 4 83905 7 7 6 5 6 5 7 6 6 5 93845 7 5 5 5 9 8 7 4 7 5 83795 4 6 7 6 5 5 7 5 2 4 63787 5 6 6 6 5 4 3 6 5 5 73790 5 5 8 8 7 4 5 6 2 5 7__________________________________________________________________________ this invention includes hybrid maize seed of 3860 and the hybrid maize plant produced therefrom . the foregoing was set forth by way of example and is not intended to limit the scope of the invention . as used herein , the term plant includes plant cells , plant protoplasts , plant cell tissue cultures from which maize plants can be regenerated , plant calli , plant clumps , and plant cells that are intact in plants , or parts of plants , such as embryos , pollen , ovules , flowers , kernels , ears , cobs , leaves , seeds , husks , stalks , roots , root tips , anthers , silk and the like . duncan , williams , zehr , and widholm , planta , ( 1985 ) 165 : 322 - 332 reflects that 97 % of the plants cultured which produced callus were capable of plant regeneration . subsequent experiments with both inbreds and hybrids produced 91 % regenerable callus which produced plants . in a further study in 1988 , songstad , duncan & amp ; widholm in plant cell reports ( 1988 ), 7 : 262 - 265 reports several media additions which enhance regenerability of callus of two inbred lines . other published reports also indicated that &# 34 ; nontraditional &# 34 ; tissues are capable of producing somatic embryogenesis and plant regeneration . k . p . rao , et al ., maize genetics cooperation newsletter , 60 : 64 - 65 ( 1986 ), refers to somatic embryogenesis from glume callus cultures and b . v . conger , et al ., plant cell reports , 6 : 345 - 347 ( 1987 ) indicates somatic embryogenesis from the tissue cultures of maize leaf segments . thus , it is clear from the literature that the state of the art is such that these methods of obtaining plants are , and were , &# 34 ; conventional &# 34 ; in the sense that they are routinely used and have a very high rate of success . tissue culture of maize is described in european patent application , publication 160 , 390 , incorporated herein by reference . maize tissue culture procedures are also described in green and rhodes , &# 34 ; plant regeneration in tissue culture of maize &# 34 ;, maize for biological research ( plant molecular biology association , charlottesville , va . 1982 , at 367 - 372 ) and in duncan , et al ., &# 34 ; the production of callus capable of plant regeneration from immature embryos of numerous zea mays genotypes ,&# 34 ; 165 planta 322 - 332 ( 1985 ). thus , another aspect of this invention is to provide cells which upon growth and differentiation produce maize plants having the genotype of 3860 . maize is used as human food , livestock feed , and as raw material in industry . the food uses of maize , in addition to human consumption of maize kernels , include both products of dry - and wet - milling industries . maize , including both grain and non - grain portions of the plant , is also used extensively as livestock feed , primarily for beef cattle , dairy cattle , hogs , and poultry . industrial uses of maize include production of ethanol , maize starch in the wet - milling industry and maize flour in the dry - milling industry . the industrial applications of maize starch and flour are based on functional properties , such as viscosity , film formation , adhesive properties , and ability to suspend particles . the maize starch and flour have application in the paper and textile industries . other industrial uses include applications in adhesives , building materials , foundry binders , laundry starches , explosives , oil - well muds , and other mining applications . plant parts other than the grain of maize are also used in industry . stalks and husks are made into paper and wallboard and cobs are used for fuel and to make charcoal . the seed of the hybrid maize plant and various parts of the hybrid maize plant can be utilized for human food , livestock feed , and as a raw material in industry . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding , it will be obvious that certain changes and modifications may be practiced within the scope of the invention , as limited only by the scope of the appended claims . applicants have made a deposit of at least 2500 seeds of hybrid corn line 3860 with the american type culture collection ( atcc ), rockville , md . 20852 usa , atcc deposit no . 97524 . the seeds deposited with the atcc on apr . 29 , 1996 were taken from the same deposit maintained by pioneer hi - bred international , inc ., 700 capital square , 400 locust street , des moines , iowa 50309 - 2340 since prior to the filing date of this application . this deposit of the hybrid corn line 3860 will be maintained in the atcc depository , which is a public depository , for a period of 30 years , or 5 years after the most recent request , or for the effective life of the patent , whichever is longer , and will be replaced if it becomes nonviable during that period . additionally , applicant has satisfied all the requirements of 37 c . f . r . §§ 1 . 801 - 1 . 809 , including providing an indication of the viability of the sample . applicant imposes no restrictions on the availability of the deposited material from the atcc ; however , applicant has no authority to waive any restrictions imposed by law on the transfer of biological material or its transportation in commerce . applicant does not waive any infringement of its rights granted under this patent .

US-40089795-A

a mechanized dildo , including a motor driven coaxial plurality of longitudinally spaced drive cams , and corresponding sets of passive cams that operate within an elastic phallic sleeve to locally cyclically expand a girth of the sleeve . optional vibratory elements are positioned proximate a distal extremity of the sleeve , and in a laterally extending arm that is formed for clitoral stimulation . a battery powered control handle provides multiple operating modes and speeds .

the present invention is directed to a mechanized dildo that is particularly effective in stimulating female genitalia . with reference to fig1 - 4 of the drawings , a mechanized dildo 10 includes a motorized cam assembly or mechanism 12 , a control module 14 , and a phallic sleeve 16 that encloses the cam mechanism . the cam mechanism 12 includes a main motor 18 that is operatively connected to a drive shaft 20 through a reduction gear train 22 . a plurality of drive cams 24 ( and individually designated 24 a , 24 b , and 24 c ) are rigidly supported on the shaft 20 for rotation therewith , each drive cam engaging a set 26 of passive cams 27 that are circumferentially equally spaced around the drive shaft , the passive cam sets being designated 26 a , 26 b , and 26 c ( numbered a , b , c in the direction of the shaft ), the cams of each set being individually designated 27 a , 27 b , and 27 c ( numbered a , b , c around the shaft ). the passive cams 27 are guided for generally radial motion by a plurality of guide rods 28 that engage corresponding slots 29 that are formed in the passive cams 27 . a support member 30 holds a proximal end of each rod 28 in fixed relation to the motor 18 , and a dome member 32 locates a distal end of each rod for holding the rods in parallel relation to the drive shaft 20 . the phallic sleeve 16 contacts each of the passive cams 27 , biasingly holding each cam 27 in sliding engagement with its associated drive cam 24 . the phallic sleeve 16 is preferably made of an elastic material . each of the drive cams 24 has outwardly projecting and equally circumferentially spaced lobes 34 corresponding to the number of passive cams 27 of the corresponding set 26 . accordingly , and since the passive cams 27 of each set are also equally spaced , rotation of the drive shaft 20 produces synchronous radial reciprocation of the passive cams 27 of each particular set , correspondingly producing outward local elastic radial expansion and contraction of the sleeve 16 proximate each of the passive cams of that set , thereby increasing and decreasing a local girth of the sleeve 16 in a region thereof associated with the set 26 of passive cams 27 . the elastic tension within the phallic sleeve moves the passive cams inwardly as the respective lobes rotate beyond maximum passive cam displacement . preferably the phallic sleeve has a nominal diameter of from approximately 1 . 2 inches ( 30 mm ) to approximately 2 . 0 inches ( 50 mm ), and a nominal length of from approximately 5 inches ( 127 mm ) to approximately 9 inches ( 228 mm ), and the girth expansion can be from approximately 0 . 12 inch ( 3 . 1 mm ) up to approximately 0 . 79 inch ( 20 mm ), which corresponds to an increase in diameter of from approximately 0 . 04 inch ( 1 mm ) to approximately 0 . 39 inch ( 10 mm ). of course , other dimensions are possible , depending on user preference . in the exemplary embodiment shown in fig1 - 4 , the drive cams 24 a , 24 b , and 24 c are “ in - phase ” on the drive shaft 20 and the passive cams of each set 26 a , 26 b , and 26 c are also “ in - phase ” relative to the other sets ; thus the expansion and contraction of the respective local girths is also both in unison and in phase , the sleeve 16 expanding from a relatively relaxed condition shown by solid lines to an expanded condition shown by broken lines as indicated , for example , at 38 in fig2 . as also shown in fig1 and 2 , the dildo 10 has an arm member 40 that is formed as a lateral extension of the phallic sleeve 16 in a shape and dimension preferably facilitating contact with the clitoris of a user of the dildo , a first vibrator 42 being locatingly supported within an arm cavity 43 of the arm member 40 . as further shown in fig2 , a second vibrator 44 is locatingly supported within a head cavity 45 proximate a distal end of the phallic sleeve 16 . each of the vibrators 42 and 44 preferably includes a two - piece housing 46 enclosing a vibrator motor 47 that rotates an eccentric weight member 48 in a conventional manner and as further described below . the control module 14 includes a control housing 50 that serves as a handle of the dildo 10 and which also encloses a battery pack 52 ( which is retained by a removable cap 53 ) and a circuit board 54 , there being appropriate wiring or other conductors ( not shown ) between the battery pack 52 , the circuit board 54 , the main motor 18 , and the vibrator motors 47 . in the configuration shown in fig1 - 4 , the control module has a power switch actuator 56 , a mode switch actuator 57 , and a speed switch actuator 58 , each actuator protruding the housing 50 for operation by a user and having an associated switch ( not shown ) on the circuit board 54 . the circuit board 54 has a power indicator 60 and a plurality of intensity indicators 62 that project through the housing for facilitating operation by the user . the mode switch actuator 57 sequentially selects a plurality of vibration and throbbing ( reciprocating girth expansion ) combinations , by selectively activating the main motor 18 and / or the vibrator motors 47 in accordance with methods known to those skilled in the art . the speed switch actuator sequentially selects different speeds of both vibration and throbbing , also in accordance with methods known to those skilled in the art . regarding the throbbing , or reciprocating girth expansion , a preferred range of throbbing rates is between approximately 50 to approximately 180 times per minute . preferred vibration rates are from approximately 20 per second to approximately 120 per second . suitable materials for the drive shaft 20 and the guide rods 28 include hardened steel ; suitable materials for the support member 30 , the dome member 32 , the vibrator housings 46 , the control housing 50 , and the switch actuators 56 , 57 , and 58 include abs . suitable materials for the drive cams 24 and the passive cams 27 include pom and other substantially rigid plastics ; suitable materials for the battery module include polypropylene ; and suitable materials for the phallic sleeve include elastic plastic materials such as tpe . a suitable battery complement is four type aaa alkaline batteries . with further reference to fig5 - 10 , an alternative configuration of the mechanical dildo , designated 10 ′, includes counterparts of the cam mechanism , designated 12 ′, the control module , designated 14 ′, the phallic sleeve , designated 16 ′, the main motor 18 , and the gear train 22 . there are four of the drive cams , designated 24 ′ ( and individually 24 a ′, 24 b ′, 24 c ′, and 24 d ′), and correspondingly four sets of four equally spaced passive cams , designated 26 ′ ( individually 26 a ′, 26 b ′, 26 c ′, and 26 d ′), the cams of each set being designated 27 ′. a drive shaft 20 ′ and a plurality of guide rods 28 ′ are lengthened counterparts of the drive shaft 20 and guide rods 28 of the configuration of fig1 - 4 , for accommodating the extra drive cam 24 d ′ and passive cam set 26 d ′. a support member 30 ′, and dome member 32 ′ are counterparts of the above - described support member 30 and dome member 32 , configured for supporting additional guide rods associated with the extra passive cam 27 ′ of each set 26 ′. as further shown in fig6 - 10 , each of the drive cams 24 ′ has four equally spaced drive cam lobes , designated 34 ′, such that the passive cams 27 ′ of each set 26 ′ move in unison with the other passive cams of that set . alternating pairs of the drive cams 24 ′ are 45 degrees out of phase on the drive shaft 20 ′. more particularly , the drive cams 24 a ′ and 24 c ′ are in - phase with each other and 45 degrees out of phase with the drive cams 24 b ′ and 24 d ′. also in the same manner , alternating sets of the passive cams 27 ′ are out of phase with each other . accordingly , all of the passive cams 27 ′ move in unison in response to rotation of the drive shaft 20 ′; however , the local girth expansions that result are staggered at 45 degrees between regions of the sleeve 16 ′ associated with adjacent sets 26 ′ of the passive cams 27 ′. it will be understood that aligned mounting of the drive cams 24 ′ in combination with the staggered arrangement of the passive cams 27 ′ will produce alternating expansion and contraction of the phallic sleeve 16 ′ proximate adjacent pairs of passive cam sets 26 ′. for example , during simultaneous expansion proximate the passive cam sets 26 ′ a and 26 ′ c there is corresponding contraction of the sleeve proximate the other passive cam sets 26 ′ b and 26 ′ d . continued rotation of the drive shaft 20 ′ produces expansion proximate the passive cam sets 26 ′ b and 26 ′ d and corresponding contraction proximate the cam sets 26 ′ a and 26 ′ c . conversely , the staggered configuration of drive cams 24 ′ shown in fig8 , in combination with an aligned configuration of passive cams ( corresponding to the arrangement shown in fig4 ) also produces simultaneous expansion and contraction proximate alternating sets of the passive cams , but with the local expansions being axially aligned as in the configuration of fig1 - 4 . in configurations having one or the other of the of the drive cams and the passive cam sets out of phase , the rotation of the drive shaft 20 ′ causes the girth of the dildo to expand and contract in different lengthwise portions corresponding to the out - of - phase cam sets along the length of the dildo . although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . for example , any number of drive cams and passive cam sets , and any number of passive cams per set are contemplated within the scope of the present invention . also , the number of lobes on each cam can be different than the number of passive cams operated thereby , although a multiple or submultiple of that number is preferred , the equal numbers ( three and four ) described above being most preferred . further , the drive cams can be supported other than rigidly on the drive shaft , such as with back - lash , or with an elastic connection . moreover , a single cam member can form plural drive cams . therefore , the spirit and scope of the appended claims should not necessarily be limited to the description of the preferred versions contained herein .

US-97179708-A

a system for shipping and displaying small articles , the system having three parts consisting of rectangular display box with an open top ; a metal rack to carry the goods thereon , which fits within the display box ; and a shipping carton , which has an open bottom designed to slip over the top of the display box when the rack is in the box . when the goods are shipped hanging on the metal rack , the only step required for display at the retail end is removal of the shipping carton from the display box and placement of the display box , with the goods hanging from the display rack within the box , on the retail sales floor .

turning to fig1 a and 1b , two alternate preferred embodiments of the present invention , are illustrated , namely mainly free - standing , typically metal display racks ( 10a ) and ( 10b ) capable of displaying goods thereon . fig2 illustrates a display box ( 12 ), typically made of cardboard and open at the top , dimensioned to receive the display rack therein , typically so that the articles contained on the display rack are visible above or from the front of display box ( 12 ). fig3 illustrates the third component of applicant &# 39 ; s system , namely a shipping carton ( 14 ) typically open at the bottom and designed to slide down over the top of the display box 12 having metal racks ( 10a or 10b ) located therein and loaded with articles . after shipping carton ( 14 ) is slid over display box ( 12 ), tape or other means it utilized to secure the bottom of the display box to the sides of the shipping carton . turning back to fig1 a and 1b , it is seen how the display racks ( 10a ) and ( 10b ) are comprised of arms ( 16a ), ( 16b ) and ( 16c ), which arms are supported by support members ( 18 ), which support members are vertically mounted to base ( 20 ). the entire display rack referenced ( 10a ) can be made from a single piece of 1 / 4 to 3 / 8 &# 34 ; metal rod bent to the illustrated shape . display racks ( 10a ) and ( 10b ) are typically made of steel rod approximately 1 / 4 inch in diameter , bent in the configuration illustrated . arms ( 16a ), ( 16b ) and ( 16c ) are typically tilted up slightly ( 1 - 2 &# 34 ;) from the horizontal , that is , from the plane of base ( 20 ), this helps the arm stand straight out as it is loaded with goods and flexes downward under their weight . the display rack ( 10a ) has a single arm ( 16a ) whereas display rack ( 10b ) has a pair of arms ( 16b ) and ( 16c ) spaced apart and above base ( 20 ). the function of the arms , typically attached at a proximal end by supports ( 18 ) and free at a removed end , is to receive thereon , typically in a hanging fashion , the articles to be displayed ( see fig3 ). frequently such articles are themselves mounted to a cardboard tag or label which , in turn , has a hole near the top so as to be suspended from the arms . the arms may be longer than the length of the bases ( dimension a ). the function of supports ( 18 ) is just that -- to support the arms . the supports are , in turn , mounted on a base ( 20 ). with reference now to fig1 a , 1b , 2 and 3 , it is seen that dimensions a , d and g represent the length of the display rack , display box , and shipping carton , respectively . dimensions b , e and h represent the corresponding widths ; and dimensions c , f and i represent the corresponding heights . typically , length a and width b are slightly smaller than the corresponding length d and width e of display box ( 12 ) so the display box fits snugly with its base up against the inner walls of the display box as the base rests against a floor ( 22 ) of the display box . display box ( 12 ) is seen to have the floor ( 22 ), a pair of upstanding side walls ( 24a ) and ( 24b ), a rear wall ( 26 ), and a front wall ( 28 ). reference numeral ( 30 ) represents the open top of the display box . shipping carton ( 14 ) is , like display box ( 12 ), typically rectangular and includes an bottom ( 32 ), a pair of side walls ( 34a ) and ( 34b ), a rear wall ( 36 ), and a front wall ( 38 ). shipping carton ( 14 ) has a closed top represented by top wall ( 40 ). it may also be appreciated how , with reference to fig3 dimensions d and e of the display box are slightly smaller than corresponding dimensions g and h on the shipping carton so that the shipping carton may be lowered over the display box , such that walls ( 24a ), ( 24b ), ( 26 ) and ( 28 ) are snug and flush against the inner surfaces of walls ( 34a ) and ( 34b ) and ( 36 ) and ( 38 ), respectively . moreover , sliding shipping carton ( 14 ) over the display box so that the lower edges of side walls ( 34a ) and ( 34b ) are flush with the lower edges of side walls ( 24a ) and ( 24b ), with the inner surfaces of the shipping carton flush with the outer surfaces of the walls of the display box , will create a closed unit with bottom ( 22 ) complete obscuring open bottom ( 32 ) and closed top ( 40 ), completely covering open top wall ( 30 ). it is to be noted that the height of side walls ( 24a ) and ( 24b ) may be cut down so that dimension f is less than dimension i , so that the height of arms ( 16a ), ( 16b ) or ( 16c ) above their respective bases ( 20 ), when the display rack is inserted into the display box may stand above the top of the side walls ( 24a ) and ( 24b ) and above the top of rear wall ( 26 ) as illustrated in fig3 . this is simply to allow , when shipping carton ( 14 ) is removed from the display box and the articles placed , while still in the display box , on the retail sales outlet shelf , easier viewing by the consumer of the goods . in an alternate preferred embodiment , dimension f is just slightly less than dimension i and is slightly greater than the height of the arms above the base of the display racks so that , when the shipping carton is placed over the display carton with the bottom edges of walls ( 24a ), ( 24b ), ( 26 ) and ( 28 ), laying just adjacent the bottom edges of walls ( 34a ), ( 34b ), ( 36 ) and ( 38 ), the corresponding top walls are also adjacent . fig2 and 3 also illustrate additional features of applicant &# 39 ; s display box ( 12 ). more specifically , that the forward portion of side walls ( 24a ) and ( 24b ) can be canted as seen at sections ( 40a ) and ( 40b ) of fig3 . this also helps facilitate the view of the consumer when the articles are in the display box on the shelf of the retail outlets . it is further appreciated with reference to fig2 and 3 that front wall ( 28 ) is cut down so that its height j is substantially less than the height of side walls ( 24a ) and ( 24b ) illustrated as dimension f in fig2 . this allows , again , for ease of viewing of the merchandise or goods being hung from arms ( 16a ), ( 16b ) or ( 16c ). further , front wall ( 28 ) is typically rectangular and may be dimensioned to receive labels or tags thereon to advertise for the goods and merchandise enclosed on the display rack . these labels are frequently placed on at the manufacturer , again to allow for greater convenience to the clerk at the retail end . display racks , such as the single arm rack illustrated in fig1 a , typically come in lengths about 16 inches to 20 inches and widths about 6 , 8 and 12 inches . display racks , such as the embodiment illustrated in fig1 b with two arms , namely ( 16b ) and ( 16c ), typically come in lengths between 16 inches to 20 inches and widths between 20 inches and 26 inches . goods that have been effectively and conveniently shipped according to the system of applicant &# 39 ; s present invention include : leather hammer holders , gloves , belts , and tool holders . the articles to be shipped are typically mounted on the rack first , the loaded rack placed into the display box , and then the shipping carton is slid over the outside of the display box and secured , by tape ( 41 ) or otherwise , to the display box . the unit is then shipped to the retailer , where the retail clerk cuts the tape and slides the shipping carton off and has a display box full of goods to be displayed ready to place out on the shelves . terms such as &# 34 ; left ,&# 34 ; &# 34 ; right ,&# 34 ; &# 34 ; up ,&# 34 ; &# 34 ; down ,&# 34 ; &# 34 ; bottom ,&# 34 ; &# 34 ; top ,&# 34 ; &# 34 ; front ,&# 34 ; &# 34 ; back ,&# 34 ; &# 34 ; in ,&# 34 ; &# 34 ; out ,&# 34 ; and like are applicable to the embodiments shown and described in conjunction with the drawings . these terms are merely for purposes of description and do not necessarily apply to the position or manner in which the invention may be constructed for use . although the invention has been described in connection with the preferred embodiment , it is not intended to limit the invention &# 39 ; s particular form set forth , but on the contrary , it is intended to cover such alternatives , modifications , and equivalences that may be included in the spirit and scope of the invention as defined by the appended claims .

US-66834096-A

the present invention relates to novel formulations of taxoids for oral administration . more particularly , this invention discloses and claims various semi - solid formulations for the oral administration of taxoids .

r 1 is h , ( c 2 - c 4 ) acyl , ( c 1 - c 3 ) alkyl ; r 2 is oh , alkoxy or r 2 and r 3 taken together are methylene ; r 3 is ch 3 or r 2 and r 3 taken together are methylene ; r 4 is ococh 3 or ocooch 3 ; r is phenyl , ( c 3 - c 4 ) alkoxy or ( c 3 - c 4 ) alkenyloxy , preferably phenyl or tert - butoxy ; and r ′ is aryl , preferably phenyl , optionally substituted or ( c 2 - c 4 ) alkyl or ( c 2 - c 4 ) alkenyl . a more preferred taxoid is chosen among compounds of formula ( ia ) to ( if ): the semi - solid formulation of the invention is particularly suitable for taxoids of formula ( ib ) or ( ic ). a convenient semi - solid formulation according to the invention may contain up to 200 mg taxoid per g of polymeric material , more preferably between 50 and 200 mg taxoid per g of polymeric material . suitable taxoid content may be adapted to the need of a patient , for example taxoid concentration within the polymeric material of e . g . 5 mg / g , 10 mg / g , 20 mg / g , 30 mg / g , 40 mg / g , 50 mg / g , 60 mg / g , 70 mg / g , 80 mg / g , 90 mg / g , 100 mg / g , 150 mg / g or 200 mg / g . the semi - solid formulations of the invention may optionally further contain at least one additional additive chosen from stabilizing agents , preservatives , agents which make it possible to adjust the viscosity , or agents that can modify the organoleptic properties . in another aspect the invention concerns a process for preparing a formulation as defined above , wherein there is prepared , where appropriate , the mixture of principal excipients , after heating , for melting the semisolid excipients , and then , if necessary , mixing with the additional additives , and then with the taxoid while stirring in order to obtain a homogeneous mixture . the strategy has been to obtain a formulation able to enhance taxoid solubilization in aqueous medium by using amphiphilic - and lipid - based formulations able to form a colloidal system ( fine emulsion or micellar solution ) in vivo . amphiphilic polymers ( micelle or emulsion formation ) phospholipids ( lipidic vesicles formation ) smes ( self - microemulsifying systems ): oil + surfactant + co - surfactant ( microemulsion formation ) after a first selection of proper excipients ( in terms of safety and developability ), the solubility of taxoids in the excipient was the first screening step for the choice of the excipient and the selection of the prototypes . then , the prototypes ( liquid or semi - solid ) were manufactured , and characterized in terms of in vitro behavior in simulated gi media and chemical stability . finally , the physical properties and stability of the semi - solid prototypes have been investigated . different categories of excipients described in the literature as components of amphiphilic and lipid - based formulations have been tested for the solubility of taxoids : 1 . oils ( medium - chain triglycerides , fatty acids , . . . ) 2 . amphiphilic surfactants with hydrophilic character ( hlb & gt ; 10 ) ( peo sorbitan fatty acids , castor oil ethoxylates , fatty acid ethoxylates .) 3 . amphiphilic surfactants with lipophilic character ( hlb & lt ; 10 ) ( glycerides of fatty acids : glyceryl oleate / linoleate , oleoyl macrogol glycerides ; derivatives of propylene glycol : pg caprylate / linoleate ,) 4 . phospholipids ( lecithins ) 5 . hydrophilic solvents ( peg 400 , . . . ) all the selected excipients are described as safe for oral administration , and they are developable ( alone or as mixture ) as pharmaceutical dosage form ( soft or hard capsule ). the chemical composition of the selected excipients in liquid form at room temperature , as well as the solubility of taxoid of formula ib , are reported in table 1 below . the following table 2 reports the chemical composition of the selected excipients in semi - solid form at room temperature , as well as the solubility of a taxoid of formula ib . excipients had been previously melted up to 70 ° c . for drug dissolution . for the smes category ( 3 - components system ), a first screening of the excipients as oil , surfactant ( hlb & gt ; 10 ) and co - surfactant ( hlb & lt ; 10 ), combined together at different ratios without the presence of the active , was necessary for identifying the formulations able to form a microemulsion ( droplet size & lt ; 30 nm ) after infinite dilution with water . with this screening the following smes were identified : cremophor el / maisine / miglyol 812n at 50 mg / g cremophor el / lauroglycol 90 / miglyol 812n at 50 mg / g cremophor el / capryol 90 / miglyol 812n at 50 mg / g cremophor el / peceol / miglyol 812n at 50 mg / g cremophor el / imwitor 988 / miglyol 812n at 50 mg / g the ratio between the excipients in the retained formulations was as follows : ratio surfactant to co - surfactant 3 : 1 and with oil concentration of 20 %. it is understood that the dosage may vary according to the degree or the nature of the condition to be treated . thus , the quantity of active product in a composition according to the invention will be determined such that a suitable dosage can be prescribed . as a result , the quantity of taxoids varies as a function of its solubility in the mixture and also as a function of the appropriate dosage for the treatment of patients . preferably , care should be taken not to load more than 10 % w / w of taxoid drug so as to avoid microemulsion destabilization to occur . in humans , it is understood that , to choose the most appropriate daily dosage , there should be taken into account the weight of the patient , his general state of health , his age and all factors which may influence the efficacy of the treatment . preferably , the compositions are prepared such that a unit dose contains from 0 . 1 to 50 mg of active product . in the alternative , where a second active ingredient is introduced , the compositions may comprise 0 . 2 to 50 mg . however , this quantity may optionally be lower and may vary from 0 . 2 to 10 mg . when the composition further comprises certain additional additives , the latter may be stabilizing agents , preservatives , agents which make it possible to adjust the viscosity , or agents that can modify , for example , the organoleptic properties . the stabilizing agents may be , for example , antioxidants chosen in particular from α - tocopherol , ascorbyl palmitate , bht ( butyl hydroxytoluene ), bha ( butyl hydroxyanisole ), propyl gallate or malic acid for example . the preservatives may , by way of example , be chosen from sodium metabisulfite , propylene glycol , ethanol or glycerin . among the agents capable of adjusting the viscosity , there may be mentioned , for example , lecithins , phospholipids , propylene glycol alginate , sodium alginate or glycerin . the agents capable of modifying the organoleptic properties of the composition are , by way of example , malic acid , fumaric acid , glycerin , vanillin or menthol . when such additives are used , the latter may constitute from 0 . 001 % to 5 % by weight of the total composition . according to the invention , the pharmaceutical composition may be obtained by mixing , where appropriate , the principal excipients ( after heating for melting the semisolid excipients ), and then , if necessary , mixing with the additional additives , followed by the addition of the taxoid and maintaining stirred in order to obtain a homogeneous mixture . the compositions according to the invention may be provided in the semi pasty state . they are particularly suitable for presentation in the form of hard gelatin capsules or soft gelatin capsules , or in the form of an oral solution . the compositions according to the invention are particularly advantageous because of their good stability , both physically and chemically , and the enhancement of the bioavailability which they offer upon oral administration of taxoids . the following examples , given without limitation , illustrate formulations according to the present invention . taxoid of formula ib miglyol 812n ( condea vista company , cranford , n . j ., usa ) labrasol ( gattefossé , saint priest , f ) gelucire 44 / 14 ( gattefossé , saint priest , f ) vitamin e tpgs ( eastman chemical , anglesey , uk ) cremophor el ( basf ag , ludwigshafen , de ) capryol 90 ( gattefossé , saint priest , f ) lauroglycol 90 ( gattefossé , saint priest , f ) peceol ( gattefossé , saint priest , f ) maisine 35 - 1 ( gattefossé , saint priest , f ) imwitor 988 ( condea vista company , cranford , n . j ., usa ) phosal 75sa ( nattermann , cologne , de ) phospholipon 90h ( nattermann , cologne , de ) ps80 vg df ( seppic , paris , france ) the weighed drug was dispersed in the melted excipient , and then maintained under mechanical stirring at 50 - 60 ° c . until dissolution . the mass was poured into a hard gelatin capsule ( size 0 ) and kept refrigerated overnight . the gelatin shell was then removed to avoid compatibility issues at this step . the chemical stability of the different formulations is a key parameter . prototypes were stored in bulk ( glass vial ) for up to 3 months at + 5 ° c . (± 3 ° c . ), 25 ° c . (± 2 ° c .) and 30 ° c . (± 2 ° c .) under 60 % (± 5 %) relative humidity ( rh ) and 40 ° c . (± 2 ° c .) under 75 % (± 5 %) rh . the stability was evaluated by mean of the potency determined by hplc , as well as evaluation of relative substances . the prototypes analysed for drug dosage and stability studies are shown in the table below . all the formulations are stable for 3 months at 40 ° c . under 75 % rh , except the smes formulations . indeed , the smes are stable for 1 month at 25 ° c ., whereas at 40 ° c . an impurity of taxoid of formula ib ( hydrolysis ) appears ( 1 . 15 - 3 . 88 % at t 1 month , depending on the nature of the co - surfactant ). the 3 months analysis of the sample allowed to evaluate if this impurity increase was critical : after 3 months , an increase of taxoid of formula ib impurity content was noticed . the smes is stable at 5 ° c . during 7 months . [ heading - 0112 ] in vitro behavior in simulated gi media ( gi = gastro intestinal tract ) gastric medium usp , ph 1 . 2 fasted intestinal medium , ph 6 . 8 ( ref . dressman et al ., pharm . res ., 1998 ) fed intestinal medium , ph 5 ( ref . dressman et al ., pharm . res ., 1998 ) in a first step of experiments , the formulations ( 100 mg drug / g formulation , 500 mg formulation in a hard gelatin capsule ) were diluted 1 : 500 in the gastric medium ( 1 capsule / 250 ml ), and then incubated 2 hours at 37 ° c . under stirring ( 50 rpm ) in a usp standard dissolution apparatus . the same experiment has been carried out in gastric medium with 2 capsules loaded with less concentrated formulations ( 50 mg drug / g formulation ), in order to study the effect of the drug / excipient and excipient / medium ratio on the release profile . in a second step of experiments , a first incubation of 1 hour in gastric medium was followed by 2 hours incubation in fasted intestinal or fed intestinal medium , in order to simulate the gastric emptying process . samples were taken after 5 - 15 - 30 - 60 min and 2 h . the drug concentration was determined by hplc after centrifugation ( 6000 rpm , 10 min ). homogeneity of the medium was evaluated by sampling bottom , medium and top of the vessel . drug release profiles in gastric medium of formulations at 100 mg / g are shown in the fig1 . compared to the ps80 formulation ( evaluated as reference ), only the formulation composed of vitamin e tpgs allowed improvement of the in vitro solubilization of taxoid of formula ib ( 80 % of drug solubilized ) by 2 hours . concerning the profiles obtained with the other formulations data from phosal and gelucire are not very representative , since these formulations led to the formation of a very heterogeneous mixture after incubation . for gélucire 44 / 14 , the disintegration of the semi - slid matrix occurred only partially , not allowing the dispersion in the simulated gastric medium . the labrasol formulation led to the formation of a very homogeneous emulsion with the medium , despite the low amount of drug recovered after centrifugation ( see release profile ), suggesting that for a coarse emulsion the centrifugation ( determining the collapse of the emulsion ) could sub - estimate its in vitro performance . the experiment with phospholipon 90h was stopped ( no data collection ) since the powder floating did not allow the formation of a homogeneous suspension . the comparison of the drug release profiles of semi - solid formulations ( gelucire , vitamin e tpgs and peg 4000 ) at 50 et 100 mg / g ( fig2 ; the profiles related to vitamin e tpgs and gelucire at 100 mg / g are the same already reported in fig1 ) shows that vitamin e tpgs exhibited the highest solubilization properties , with a release of 80 % for the 100 mg / g dosage and up to 100 % for the 50 mg / g dosage . the gelucire formulation at 50 mg / g allowed the solubilization of about 80 % of drug , contrarily to the 100 mg / g dosage , as described previously . finally , the hydrophilic peg 4000 confirmed , as expected , the inability to solubilize a hydrophobic drug in an aqueous medium . [ heading - 0128 ] particle size analysis after incubation in gastric medium ( usp ) the aim of this part of the study was to evaluate , by particle size measurement , the colloidal stability and the self - emulsifying properties of the emulsion / microemulsion / micellar solution of taxoid of formula ib formulations after incubation in the gastric medium . the formulations ( concentration 100 mg drug / g formulation , 100 mg formulation ) were diluted 1 : 500 in the gastric medium ( 50 ml ), then incubated 2 hours at 37 ° c . under mechanical stirring ( 300 rpm ). the sample was diluted immediately with water for size measurement or filtered onto 2 μm if necessary . the filtration allowed to retain oil droplets & gt ; 2 μm , as well as drug crystals & gt ; 2 μm , in order to allow the particle size measurement by qels ( quasi - elastic light scattering ) ( nanosizer n4 +, beckmann - coulter ). as shown in the fig3 and 4 , a particle size & lt ; 50 nm was obtained only in the case of the formulations with active concentration of 50 mg / g : the 5 microemulsions ( nevertheless their composition ), gelucire ( after 2 μm filtration ) and vitamin e tpgs . the results suggest using the formulations able to form small and monodisperse droplets in gastric medium in order to have a better performance in vivo . further experiments in simulated intestinal media should be performed in order to evaluate the effect of biliary salts on the size and colloidal stability of the formulations . 3 . 3 preliminary conclusions on the evaluation of taxoid of formula ib formulations all the results concerning the in vitro behavior in simulated gi fluids of the formulations for oral administration of taxoid of formula ib , as well as the chemical stability in accelerated conditions , are summarized in the tables below . gelucire leads to a heterogeneous emulsion with the gi media , so it was discarded at this concentration . thus , at 100 mg / g , only vitamin e tpgs formulation exhibited a promising behavior ( in terms of release profile and droplet size ). the analyses are carried out on a siemens - bruker d5000 matic diffractometer , using the parafocusing bragg - brentano ( θ - 2θ )- type geometry . if enough of the product is available , the powder is deposited on a concave aluminum sample holder . otherwise a thin layer of the product is deposited on a single - crystalline silicon wafer , cut out according to the ( 510 ) crystallographic orientation that impedes any bragg reflection ( by ensuring the systematic extinction of the corresponding diffraction band ). a cobalt anticathode tube ( 40 kv / 30 ma ) gives an iron - filtered incident beam . two radiations are emitted : cokα 1 ( λ = 1 . 7890 å ) and cokα 2 ( λ = 1 . 7929 å . a 50 m multicanal braun linear detector completes the setup . it has a 10 °- wide detection window in angle 2θ . diagrams were recorded in the following conditions : a 1 . 5 to 50 . 0 degree scan in angle 20 , 10 to 30 seconds &# 39 ; counting time per degree in 2θ according to the amount of powder to be analyzed , and ambient conditions of pressure , temperature and % relative humidity . taxoid of formula ib semi - solid formulations for this part of the study were manufactured and characterized by t . borovac ( dea report & lt ;& lt ; conception et caractérisation des matrices semi - solides associées à un principe actif peu hydrosoluble et destiné à la voie orale & gt ;& gt ;, crs meeting , jul . 19 , 2003 . in the semi - solid formulations , drug substance physical state ( solubilized or dispersed ) and physical form ( if dispersed ) were characterized using xrpd . this technique detection limit was evaluated using a range of physical mixtures ( of vitamin e - tpgs or gelucire and drug substance ): this limit is 2 . 5 % or 25 mg / g with both excipients . storage conditions ( temperature , pressure , time ) can change or induce recrystallization of drug substance in a solubilized semi - solid formulation or polymorphism in a dispersed one . two semi - solid formulations ( a 60 mg / g vitamine - tpgs one and a 80 mg / g gelucire one ) were evaluated after one month at 30 ° c ./ 60 % rh or at 40 ° c ./ 75 % rh . both formulations were mostly solubilized after manufacturing and no recrystallization was observed after one month . we can anticipate that both 50 mg / g formulations are physically stable for at least one month .

US-89416304-A

a single serving filter pod encapsulated brewing press and thermal drinking receptacle allowing a user to brew coffee or tea within the device using premeasured sealed filter pods .

fig1 shows the operation of the single cup beverage pod press . for the purpose of this illustration , the outer brew chamber 6 is transparent to allow viewing of the inner brew chamber 3 . fig1 a shows the outer brew chamber 6 filled with liquid 101 of an appropriate temperature for brewing the beverage , such as hot water . the outer brew chamber 6 is a generally cylindrical shape with an open top and a closed bottom , having a bottom and a side wall . a release valve 7 may be located in the bottom portion of the outer brew chamber 6 . the beverage pod , such as a coffee pod shown herein , located within the pod retainer 5 at the lower end of the brew chamber 3 is pressed downward by the operator . fig1 b shows the inner brew chamber 3 in an intermediate position as the water 101 perfuses through the coffee pod . as the inner brew chamber 3 is forced down below the liquid surface 103 , it fills with brewed coffee 105 . o - ring seals 4 prevent the water 101 from exiting the outer brew chamber 6 . fig1 c shows the completed brew cycle , with the inner brew chamber 3 fully down within the outer brew chamber 6 . the area between the vertical walls of the inner brew chamber 3 and vertical walls of the outer brew chamber 6 remains relatively free of liquid , providing additional insulation to the container . a lid 1 provides additional thermal insulation and / or spill resistance . the lid 1 may have one or more apertures for liquid and air to ingress and egress from the inner brew chamber 3 . a lid gasket 2 seals against the upper portion of the outer brew chamber 6 such that when the unit is assembled , the lid gasket maintains an airtight seal against the outer brew chamber creating a thermal travel container . when the inner chamber 3 is down in the lowest most position within the outer chamber 6 , the beverage pod within the pod retainer 5 is seated near the bottom of the brew chamber , minimizing circulation , or continued brewing of the beverage 105 . fig1 d shows a side view of the single cup pod press and beverage container showing the lid 1 and outer brew chamber 6 with release valve 7 . the release valve 7 enables the inner brew chamber 3 to be more easily pulled from the outer brew chamber 6 by allowing air to pass through the outer brew chamber , reducing the vacuum . fig1 e shows a section view of the invention in fig1 d taken on section line 1 e - 1 e . the inner brew chamber 3 fits within the outer brew chamber 6 . seals 4 are disposed upon the outer wall of the inner brew chamber 3 and seal against the inner wall surface of the outer brew chamber 6 . seals 4 prevent egress of water between the walls the inner and outer brew chambers 3 , 6 . lid 1 is shown secured to the inner brew chamber with threaded connection 21 . lid gasket 2 seal against the lid 1 and outer brew chamber 6 . ideally lid gasket 2 provides an air tight sealed cavity adding to the thermal insulating properties of the invention to maintain the beverage &# 39 ; s temperature . the pod 15 is placed between the brew screen 10 and pod retainer 5 . a seal 13 tightly presses against the pod flange preventing water from bypassing the pod &# 39 ; s contents ensuring an even consistent brew . fig2 a shows the inner brew chamber 3 , lid 1 , and pod retainer 5 , in a disassembled state 201 . in the present invention , the pod retainer 5 is retained to the inner brew chamber 3 by a plurality of retainer lock pins 8 . a lid gasket 2 is shown attached to the lid 1 . fig2 b shows the inner brew chamber 3 , lid 1 and pod retainer 5 assembled . fig3 a and 3b shows an alternative embodiment to the inner brew chamber . instead of a long inner brew chamber 3 , a short inner brew chamber or “ brew piston ” 16 is attached to the lid 1 by a rod or brew shaft 12 . in this alternative embodiment , the pressing on the lid 1 transfers the downward force to the lower brew piston 16 lowering the inner brew assembly into the outer brew chamber 6 forcing the water through the pod . fig3 a shows the lid 1 , brew rod 12 , brew piston 16 and pod retainer 5 in a disassembled state 203 , while fig3 b shows the same components in an assembled state . fig4 a shows a bottom view of the pod retainer showing a plurality of apertures 35 through which water can pass allowing brewing of the pod beverage . fig4 b shows a side perspective view showing the retainer gasket 13 . the retainer gasket 13 seals against the pod flange , pod retainer 5 and lower portion of the inner brew chamber 3 or brew piston 16 , preventing water from bypassing the contents of the pod . a plurality of retainer locks 14 engage the retainer lock pins 8 to secure the pod retainer 5 to the brew piston 16 or inner brew chamber 3 . fig4 c shows a top view of the pod retainer . fig5 a shows a side view of the inner brew chamber 3 inverted and in an unassembled state 205 . a brew screen 10 retains the pod and prevents the pod 15 from entering the inner brew chamber . the brew chamber gaskets 4 are retained by the inner brew chamber 3 by seating in retaining grooves 24 which may be present to assist in securing the brew chamber gaskets . fig5 b shows a side perspective view of the inner brew chamber 3 , brew screen 10 , and pod 15 . fig6 a shows a side view of a standard coffee pod 15 and its circumferential flange 121 . the pod contains the product desired to be brewed between two layers of porous material . this portion containing the brew product is referred to as the pod belly 125 . the pod flange 123 surrounds the pod belly 125 and provides an area where the top layer 127 is attached to the bottom layer 129 . fig6 b shows a bottom view of the same coffee pod 15 . the pod 15 generally is comprised of an upper sheet and a lower sheet of porous media joined at a circumferential flange and containing ground coffee , tea leaves or the like for brewing . fig7 a shows a perspective view of the outer brew chamber 6 . fig7 b shows the outer brew chamber 6 assembled with the inner brew chamber 3 , lid 1 and pod retainer 5 . a release valve 7 positioned in the lower portion of the outer brew chamber 6 allows air to ingress into the outer brew chamber 6 when the inner brew chamber 3 is removed from the outer brew chamber 6 . fig8 shows a bottom view of a first embodiment of the brew screen 10 . the brew screen possesses large apertures 40 and small apertures 41 . the smaller apertures 41 restrict fluid flow forcing most of the liquid through the large apertures 40 and adjacent pod contents , thus resulting in a milder brewed beverage . alternatively , the apertures may be the same size or more or less numerous to produce the desired brew strength . fig9 shows an alternative second embodiment of the brew screen . fig9 a shows a strength adjustment disk 11 having a radial pattern of apertures 40 , 41 . fig9 b shows the outer brew screen 30 with a corresponding plurality of apertures 40 , 41 . fig1 a shows the strength adjustment disk 11 and outer brew screen 30 in an unassembled state 209 . the strength adjustment brew screen 11 may be retained by the outer brew screen 30 by a retainer groove 31 . fig1 b shows the strength adjustment disk 11 and outer brew screen 30 assembled as a brew screen unit 10 . it should be understood that while a retainer groove 31 is shown as retaining the brew strength adjustment disk , the disk may be retained by a central pivot such as a rivet , crimp or divot . fig1 a shows a top view of the brew screen 10 with the strength adjustment disk 11 and outer brew screen 30 aligned for full brew strength . rotating the strength adjustment disk 11 as shown in fig1 b allows the large apertures to be either completely or partially covered , or aligned with the small apertures in the outer portion of the brew screen 10 while providing ample area for liquid to flow through the center portion of the pod . the strength adjustment disk 11 allows the user to select a achieve a desired brew strength by varying the flow rate of the liquid across different areas of the brew pod . for instance , a brew strength adjustment disk 11 set to allow flow across the entire pod surface would result in a stronger brew , while closing the apertures closer to the circumference would force a larger portion of the liquid through the center of the disk , resulting in a weaker brew . fig1 is a cross section of the brew screen showing the large apertures 40 and small apertures 41 aligned for full brew strength . the inner brew screen 11 is retained by the strength adjustment disk retainer groove 31 .

US-201313775101-A

a wearable , conductive textile patch is provided that may include any of a number of features for monitoring body analytes and / or delivering fluids to a body . in one embodiment of the invention , a single , patch - mounted system monitors glucose levels of a diabetic person and provides appropriate doses of insulin in response to the glucose measurements . a hand - held user interface can be provided for wirelessly controlling the system and / or receiving information from it . conductive pathways can be formed in the fabric of the patch . components that can be integrated into the flexible patch include a power source , controller , transmitter , antenna , temperature and other sensors , fluid pump , infusion set , electrical pathways , switches , controls , electrodes , connectors , resistors and other circuit elements . such components can be embedded , interwoven or coated on to the flexible patch instead of or in addition to surface mounting . methods associated with use of the flexible patch system are also covered .

the following description focuses on one variation of the present invention . the variation of the invention is to be taken as a non - limiting example . it is to be understood that the invention is not limited to particular variation ( s ) set forth and may , of course , vary . changes may be made to the invention described and equivalents may be substituted ( both presently known and future - developed ) without departing from the true spirit and scope of the invention . in addition , modifications may be made to adapt a particular situation , material , composition of matter , process , process act ( s ) or step ( s ) to the objective ( s ), spirit or scope of the present invention . fig1 shows a top view of an exemplary embodiment of a combined fluid delivery and analyte monitoring system 10 constructed according to some aspects of the present invention , while fig2 shows an elevational end view of system 10 mounted on the skin of patient p . flexible fabric patch 12 forms the base of system 10 . flexible patch 12 may be provided with an adhesive on a bottom surface to secure patch 12 to the skin of the patient during use . various components may be attached to or integrated into flexible patch 12 , such as power source 14 , controller and transmitter module 16 , antenna 18 , temperature sensor 20 , fluid pump 22 and infusion set 24 . electrical pathways 26 may be integrated into flexible patch 12 for interconnecting components of system 10 . flexible patch 12 may be provided with a thicker area 28 , generally towards its center , to afford sufficient support for mounting components . in one embodiment , central area 28 is about 1 mm thick . a peripheral area 30 of flexible patch 12 may be made thinner to promote attachment and adhesion to the skin , particularly as the skin moves and flexes . power source 14 may be one or more solar cells , disposable or rechargeable batteries or device , an electrochemical device generating power from an analyte of the patient , and / or other power source suitable for satisfying the power requirements of the components located on flexible patch 12 . such power sources may be directly integrated into flexible patch 12 , or removably inserted into a holder attached to patch 12 . power source 14 may itself be flexible by constructing a battery from one or more layers of paper or fabric . such a paper or fabric battery can convert chemical energy directly into electricity by oxidizing metal on one side of the layer and allowing an oxide to be reduced on the other side when the battery is connected . the metal may be zinc , aluminum , nickel or other metals , the oxide can be manganese oxide , or other oxides , and the paper or fabric layer can contain an electrolyte . such flexible batteries are currently being developed by companies such as enfucell ltd . of espoo , finland ( www . enfucell . com ). flexible patch 12 itself may comprise one or more layers that can be used to form a flexible battery . such an arrangement can reduce the need for electrical connectors for the battery , thereby contributing to making the overall system 10 smaller , softer , more conforming to the user and more comfortable to wear . circuitry for controller and transmitter 16 may be directly integrated into flexible patch 12 . alternatively , controller and transmitter 16 can be constructed using traditional electronic component assembly techniques then physically and electronically attached to patch 12 . such attachment of module 16 can be permanent or removable . permanent attachment can be achieved by soldering electrical leads of module 16 to electrical leads on patch 12 . removable attachment of module 16 can be achieved with a traditional electrical connector or with a snap type fitting 32 having electrical pathways interconnecting module 16 to patch 12 . module 16 is preferably powered by power source 14 , but may include its own power source in addition to or instead of power source 14 . antenna 18 preferably is at least somewhat flexible to provide enhanced fit and comfort of patch 12 . antenna 18 can be a separate element physically and electrically coupled with patch 12 , but preferably is formed by a conductive layer or layers of patch 12 . antenna 18 is electrically connected to controller and transmitter module 16 to transmit radio frequency ( rf ) signals such as analyte readings therefrom to an external device , such as a handheld user interface . if module 16 is configured to receive information as well , antenna 18 can be arranged to both transmit and receive rf signals . an infrared ( ir ) transmitter or transceiver ( not shown ) can be utilized in addition to or instead of antenna 18 to wirelessly communicate information between system 10 and an external device . a transducer coil and / or cable connector ( not shown ) can also be provided for external communications , such as to a computer for running diagnostics , or uploading or downloading information . flexible patch 12 may be provided with one or more sensor sites 34 for receiving transcutaneous analyte sensors . multiple sensors can be used simultaneously to provide redundant analyte readings . alternatively , one sensor may be inserted at a time . after each sensor is used for a predetermined period , such as three , five or seven days each , it can be removed and a fresh sensor can be inserted at an unused sensor site . preferably , once all of the sensor sites 34 of a particular patch 12 have been used , patch 12 is removed from the skin and a new patch 12 is applied to a different location on the user &# 39 ; s skin . alternatively , a portion of patch 12 can be reused with a new adhesive portion . transcutaneous analyte sensors can be inserted into the user &# 39 ; s skin using an automatic introducer or inserter device , such as those described in u . s . patent application ser . no . 10 / 703 , 214 , published jul . 8 , 2004 under publication number 20040133164 , incorporated herein by reference in its entirety . an inserted sensor can be electrically connected to controller and transmitter module 16 directly , with external conductors or through internal electrical pathways within flexible patch 12 . the sensors may include adhesive mounts , or some type of mounting feature such as one or more snaps , hooks , clamps , pins , clips or other means molded onto or attached to the patch to secure the sensor to flexible patch 12 or to the user &# 39 ; s skin during use . monitoring and delivery system 10 can also include a temperature sensor 20 for sensing ambient temperature , skin surface temperature or sub - dermal temperature . ideally , sub - dermal temperature is measured to more accurately calibrate the readings taken by the analyte sensors , since such readings are typically temperature sensitive . however , sub - dermal temperature measurement can be impractical , since this typically necessitates another puncture to the user &# 39 ; s skin . placing a temperature sensor below the surface of the skin can cause discomfort and increased chance of infection . accordingly , temperature sensor 20 can be mounted to or integrated with the bottom surface of flexible patch 12 to measure the local surface temperature of the skin . from this temperature reading , the higher sub - dermal temperature may be estimated for the depth of penetration associated with sensor 20 . in one embodiment , temperature sensor 20 may be connected to controller and transmitter module 16 with internal electrical pathways within flexible patch 12 . a fluid pump 22 , such as for delivering insulin or other medicine , can also be located on flexible patch 12 . in this exemplary embodiment , fluid pump 22 includes a removable fluid reservoir 36 . reservoir 36 may be a disposable or refillable vial that is replaced by another vial when depleted . reservoir 36 may be flexible so that it collapses like a balloon when it contents is emptied , or it may include a flexible diaphragm portion . alternatively , reservoir 36 may be a rigid cylinder with a plunger 38 that forces fluid out when advanced into the reservoir 36 . actuator 40 may be a stepper motor , a shape - memory alloy actuator or other suitable mechanism for advancing plunger 38 or otherwise moving fluid out of reservoir 36 . a shape - memory alloy actuator is preferred because of its small size , simplicity and reliability . it &# 39 ; s low cost of manufacture also allows pump 22 to be disposable with patch 22 if desired . details of such a shape - memory alloy driven pump are provided in u . s . patent application ser . no . 10 / 683 , 659 , published jun . 17 , 2004 under publication no . 20040115067a1 , incorporated herein by reference in its entirety . reservoir 36 need not be removable from pump 22 and / or patch 12 , particularly if patch 12 is designed to be disposed of after the fluid is depleted . pump 22 preferably is powered by power source 14 , but may have its own power source . internal conductive pathways 26 can be used to connect pump 22 with power source 14 and / or controller and transmitter module 16 . pump 22 may be removably or fixedly attached to patch 12 . pump 22 or a pump mounting base may be attached to patch 12 by sandwiching a portion of the patch material between the pump or base and a plate or washer ( s ) on the opposite side . alternatively , pump 22 or a mounting base may be attached to patch 12 with an adhesive , fasteners or other suitable means . in operation , pump 22 can receive control signals from controller and transmitter module 16 , causing actuator 40 to push fluid from reservoir 36 into tubing 42 of infusion set 24 , through cannula 44 and into the patient . infusion set 24 may include an adhesive mount 46 for securing the distal end of infusion set 24 to patch 12 or directly to the patient &# 39 ; s skin . the proximal end of infusion set 24 may be removably connected to an output port 48 of pump 22 . multiple sites 50 may be provided in the thin region 30 of patch 12 for alternately placing infusion sets 24 . an automatic inserter or introducer may be used to insert cannula 44 of infusion set 24 into the patient . preferably , a single puncture device can be used to insert cannulas 44 and the transcutaneous analyte sensors described above . after a predetermined period of use , typically 3 days , infusion set 24 can be removed by lifting adhesive mount 46 , removing cannula 44 from the patient and disconnecting tubing 42 from pump output port 48 . a fresh infusion set 24 may then be placed in another one of the sites 50 and connected to pump 22 . it may be advantageous to separate infusion set insertion sites 50 as far as possible from sensor insertion sites 34 as shown so that the local effect of the infusion of insulin or other fluid does not interfere with glucose monitoring or other analyte measurement . in one embodiment , infusion sites 50 are spaced about 1 inch apart . in arranging system 10 components on flexible patch 12 , the longitudinal axis of components such as controller and transmitter module 16 , antenna 18 and pump 22 may be aligned with each other . this allows the overall system to be highly flexible in at least one direction . since these components may be fairly long and rigid , the exemplary system 10 shown in fig1 is more flexible along the y - axis shown than along the x - axis . with such an arrangement , patch 12 can more compliantly conform to curves of a patient &# 39 ; s body when the y - axis is aligned with the direction of the sharpest curve at the application site of patch 12 . an example of such an alignment is shown in fig3 , where patch 12 is attached to an upper arm of a patient p . as shown , the more compliant y - axis of flexible patch 12 is arranged horizontally to traverse the curve of the arm , while the less compliant x - axis is arranged vertically along the straighter , longitudinal axis of the arm . system 10 may be adhered to other suitable locations of the body , such as the torso , thigh or calf . in this exemplary embodiment , system 10 is about 4 inches long along the x - axis , about 3 inches long along the y - axis and has a maximum thickness of about 0 . 75 inches at pump 22 . flexible patch 12 itself can be constructed of polyester , nylon , polyurethane , lycra ® or other synthetic or natural fibers . preferably , patch 12 has elastomeric properties that come from properties of the fibers themselves , or from how the fibers are combined to form patch 12 . patch 12 can be woven , non - woven , knitted , spun or constructed of a textured film , preferably to form an electro - active fabric . conductive aspects of the textile can come from fine metal wires , either in the yarn used to make the fabric of patch 12 or woven into the fabric alongside ordinary textile fibers . alternatively , the electrical properties of patch 12 can come from inherently conductive polymers or nanocomposites deposited as coatings on the fabric &# 39 ; s fibers . as discussed above , various components of system 10 can woven directly into the fabric of patch 12 , including but not limited to complex electronic pathways , circuits , controls , electrodes , temperature and other sensors , traces , connectors , resistors , antenna , batteries , switches and other components . switches and other controls can be incorporated into flexible patch 12 by using a multilayered fabric . for example , three electro - active layers can be used . two outer conductive layers can surround an inner resistive layer that separates the conductive layers until the layers are momentarily pressed together . using fabrics as discussed above , flexible patch 12 can be soft , stretchable and breathable to provide patient comfort during use . existing fabrics can provide a high moisture vapor transmission rate ( mvtr ). such fabrics can be rolled , crumpled and folded without damaging functionality . patch 12 may also be constructed or coated to be flame resistant , waterproof or water - resistant if desired . further information on suitable fabrics , general construction and component integration methods for flexible patch 12 may be obtained from companies currently developing “ smart fabrics ” or “ conductive textiles , such as textronics ( www . textronics . com ), konarka ( www . konarka . com ), nanosonic ( www . nanosonic . com ), eleksen ( www . eleksen . com ) and eeonyx ( www . eeonyx . com ). for instance , eeonyx has a proprietary process for coating textiles with inherently conductive polymers based on doped polypyrrole . the company polymerizes the materials in situ — or on the surface of the fabric itself — so the coating material fills interstices in the surface and forms a physical bond with the fibers . see also “ fabrics get smart ”, by joseph ogando , design news , may 15 , 2006 ( www . designnews . com / article / ca6330247 . html ), incorporated herein by reference in its entirety . as for additional details pertinent to the present invention , materials and manufacturing techniques may be employed as within the level of those with skill in the relevant art . the same may hold true with respect to method - based aspects of the invention in terms of additional acts commonly or logically employed . also , it is contemplated that any optional feature of the inventive variations described may be set forth and claimed independently , or in combination with any one or more of the features described herein . likewise , reference to a singular item , includes the possibility that there are plural of the same items present . more specifically , as used herein and in the appended claims , the singular forms “ a ,” “ and ,” “ said ,” and “ the ” include plural referents unless the context clearly dictates otherwise . it is further noted that the claims may be drafted to exclude any optional element . as such , this statement is intended to serve as antecedent basis for use of such exclusive terminology as “ solely ,” “ only ” and the like in connection with the recitation of claim elements , or use of a “ negative ” limitation . unless defined otherwise herein , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . the breadth of the present invention is not to be limited by the subject specification , but rather only by the plain meaning of the claim terms employed .

US-201213436820-A

a lightweight , non - bulky personal cooling device consists of a first length of flexible tubing adapted to fit around the wearer &# 39 ; s torso or another of the wearer &# 39 ; s body parts , which tubing contains at least two perforations and desirably a series thereof that are situated to facilitate air cooling of the torso or other body part and connect at both ends to a t or y - shaped connector having an additional inlet to which is connected a second length of flexible tubing which is unperforated and is in turn connected to a hand operatable air aspirator member whereby air is drawn in through the second flexible tubing and through the t or y connector to the first flexible tubing from which air exits to the skin of the wearer and cools it . the preferred air aspirator is a sphygmanometer which can be carried in a pocket , or in a pouch attached to the wearer .

the personal cooling tube device of this invention was particularly inspired by intimate knowledge of the special needs of law enforcement officers relative to cooling , under circumstances where they are required to wear heavy ballistics vests in hot weather . these vests , in general , are often made from multiple layers , in the order of up to 13 layers of the plastic kevlar ®, an excellent insulator especially when multilayered , that is particularly uncomfortable to wear in any warm environment . the use , of the device of this invention however , is in no sense limited to law enforcement personnel or even to personnel that are required wear ballistic vests . many other people who wear protective clothing , especially under very warm ambient conditions , can benefit from the device of this invention . members of the armed forces , firefighters , players of various sports , especially professionals who train and often play under extremely warm weather conditions , construction workers , amusement park personnel and their patrons , and anyone else who must work under extremely warm conditions or who must wear protective heavy clothing in warm weather can benefit from wearing this simple , efficient , lightweight , non - obstructive device . the longer tube , sometimes referred to as the “ upper tube ” and the shorter tube , sometimes called “ the lower tube ” are both preferably made from clear vinyl tubing material , but any type of flexible plastic tubing , such as polypropylene , nylon , silicone - based plastic , high density polyethylene , or even latex could be used . it has been found that almost any flexible tubing of a diametric size such that it is not uncomfortable to wear on the human skin is acceptable . of course , care should be taken , for example , with latex or any other material which is known to cause allergenic skin reactions in some persons . it has been found that a particularly useful plastic tubing that is readily available has an outer diameter of approximately ¼ inch and an inner diameter of about ⅛ inch , but the size of the tubing is not critical and it is only necessary that the tubing be able to supply air to the skin through the perforations in the “ longer ” tube and that the “ shorter ” tube carry air to the “ longer ” tube and , further that no tubing be so heavy or thick as to be uncomfortable for the wearer . as already noted the longer tube which is intended to provide the cooling effect should have at least two perforations or holes , so as to cool both sides ( front and back ) of the wearer , but any number of holes may be made to ensure proper ventilation to the body or body part that the wearer wishes to cool . these holes may be drilled into the tubing or they may be made by any other acceptable mechanical means . the holes may be round , square , or of any other convenient shape . in some instances it may be desirable , for most efficient cooling , to establish a series of holes of different sizes at intervals along the portion of the tube that contacts the human body . the “ t ” or “ y ” shaped connector is a commonly available plastic item which is used in this devise to connect the continuous unperforated plastic piping that connects to the air aspirator ( the “ shorter ” or “ upper ” tube ) to the longer or “ lower ”) perforated tube . because this longer tube is connected to the “ t ” or “ y ” at both of its ends , air can flow through the perforations in the tube in both directions around the wearer &# 39 ; s body or the body part to be cooled . because the amount of air conveyed to the body is not excessive , no need exists for any type of special exhaust means ; the gentle circulation set up by the device in combination with the natural tendency of air to exhaust through pores in clothing and other small openings around armholes , neck and the like , is enough to exhaust air that has warmed and permit the entry of cooler air as long as the device is being operated . in place of the “ t ” or “ y ” shaped connector , other types of connectors having the same function could be substituted . in particular an “ x ” connector , of a type commonly available , can be readily made suitable by blocking one of its inlets . alternatively , its four inlets can be rendered useful by attaching each of the two left free when the so - called “ upper ” or “ longer ” tube is attached thereto to a shorter ( or “ lower ”) tube each free end of which is itself attached to a separate air aspirator , thereby enabling additional air to be pumped to the wearer &# 39 ; s body . while the “ shorter ” or “ lower ” tube is typically 8 to 12 inches in length while the “ longer ” or “ upper ” is most often between about 4 and about 6 feet long , at least when the device is intended that either or both tubes may be of any length that is convenient for the size of person who is to wear the device or for the body part specifically desired to be cooled . in particular , adaptations of the device sized for cooling , e . g ., an arm , a leg or the human neck may require that the tube appended to the air aspirator be longer that the one intended to cool the body part by delivering air to it . similarly , a device adapted to cool a leg may have a shorter perforated tube and a longer unperforated tube in order to allow the wearer easily to access the air aspirator with one hand . any number of variations for particular purposes will readily occur to people in various specialized occupations who might benefit from being able to cool a particular part of the human body with the simple , non - obstructive lightweight device of this invention , and all such modifications and variations are intended to be comprehended herein . the air aspirator particularly preferred to be used in the device of this invention is a common rubber bulb aspirator known as a sphygmanometer , of the type used with blood pressure measuring apparatus . it is approximately 3 . 25 inches long and about 1 . 5 inches wide at its widest point . such a device is easily fitted into a pocket or into a small cloth pouch that can be fastened to the device wearer &# 39 ; s belt . another convenient way of attaching the aspirator to the wearer involves making a small buttonhole or other opening that is otherwise stabilized with binding material or by hemstitching or by any other technique used to create a stable opening in fabric , in the wearer &# 39 ; s outer shirt . the tube attaching the air aspirator to the “ t ” or “ y ” connector can then be threaded — through this opening thus leaving the wearer able to reach the squeezable rubber bulb of the aspirator readily whenever air cooling is desired , but locating the aspirator in an unobtrusive place where it is unlikely to disturb the wearer or be disturbed under normal conditions . as will readily be recognized , many other forms of air aspirator could be used , including bicycle tire pumps , various types of air pumps and air compressors including miniature and electronic air compressors , mini - pumps , etc . the sphygmanometer type of aspirator is preferred for its light weight and consequent ready portability and for its ease of hand operation . in the testing of the device of this invention by a human subject who wears a ballistic vest daily , it was noticed that at times , especially when the skin is perspiring profusely , the first length of tubing may stick to the skin , causing at least some of multiple perforations through which air flows to the skin in the tubing at back or front , or both , to become blocked or clogged , so that air cooling stops in the region where this occurs . to alleviate this problem at both back and front of a torso cooling device , it was found effective to seat in at least one of a plurality of perforations at both the wearer &# 39 ; s back and front a small “ t ” or “ y ” shaped connector having an inner diameter in its twin branched inlets not more than about ½ that of the inner diameter of the flexible tubing . this small connector can easily be positioned against the skin so that it primarily acts as a spacer of the skin from the adjacent portions of the first length of tubing . the effect is to break any moisture seal caused by adherence of one or more perforations situated in adjoining portions of the tubing to the skin surface , facilitate evaporation of moisture blocking these perforations of the tubing and thereby enable perforations in the tubing to resume rapid delivery of cooling air to the skin . this modification of the device involving the inclusion of tiny “ t ” or “ y ” “ spacers ” at required intervals along the periphery of the first length of tubing , is particularly useful in cooling devices of this invention that are to be used by persons who tend to perspire heavily and whose protective clothing is particularly heavy . many people , however , will find the unmodified device as earlier described adequate to their personal cooling needs . it is preferred to provide the device of this invention , when not in use on a human wearer &# 39 ; s body with a lightweight pouch - type carrying case made of nylon or other lightweight fabric of the type in which law enforcement officers typically carry pepper spray . this type of case can readily be secured to a belt by placing its flap over the top of the officer &# 39 ; s belt and snapping the flap to the part of the case that is behind and partially below the officer &# 39 ; s belt . any bag , pouch or case similarly capable of being fastened to a belt could be used for this purpose . it is to be understood that while this pouch enhances the convenience of the device of the invention for many wearers and provides a place within which the device can be stored when not needed , it is not an essential and has nothing directly to do with the functioning of the device . as noted earlier , however , it can conveniently hold the air aspirator portion of the device when the device itself is being used to cool the portions of the body covered by a ballistic vest . moreover , since the pouch is soft and flexible , the wearer of the pouch containing the aspirator can activate the aspirator by simply squeezing the pouch . in the appended drawings , fig1 shows an assembled device of this invention wherein a denotes the air aspirating sphygmanometer , b is the so - called “ lower ” or shorter tube , c denotes a “ t ” connector d is the longer or “ upper ” tube designed to encircle the upper torso and cool the skin beneath a ballistic vest or similarly constructed heavy vest . fig2 illustrates how the device of fig1 is typically positioned on the skin of a law enforcement officer prior to his donning the ballistic vest . in fig2 , the “ shorter ” or “ lower ” tube is seen attached to third inlet of a t shaped connector and is so positioned that when the officer dons his outer his outer shirt , the tube appended to the air aspirator can be momentarily disconnected , threaded through a small well - stabilized buttonhole opening created in the shirt itself and then reconnected to the t connector , leaving the air aspirator bulb outside both the shirt and the ballistic vest beneath the shirt . the air aspirator is thus conveniently at hand to be squeezed and thus pull in admit air and supply it to the skin whenever the wearer wishes to initiate cooling . fig3 depicts the use of a “ t ” or “ y ” connector seated in a perforation of the flexible tubing with both of its inlets left open so that when the connector is abutted against the wearer &# 39 ; s skin it acts as a spacer of the skin from adjoining perforations in portions of the tubing and thus facilitates evaporation of moisture that may block such perforations . in this embodiment , the open inlets of the “ t ” or “ y ” connector function as lateral outlets for some of the air flowing through the flexible tubing to the skin , thus dissipating moisture seals between the tubing and the skin . as has been earlier noted herein , the device of this invention can be modified and varied in numerous ways without departing from the scope of this invention . it is accordingly intended that such scope be limited only insofar as the appended claims may require .

US-18290205-A

a fingernail cleaning apparatus , comprising : a chamber into which fingernails of a user are placed ; a compressor , for generating a jet of abrasive powder ; and a first nozzle , for directing the abrasive powder jet onto a front side of the fingernails when placed in the chamber ; thereby allowing cleaning the front side of the fingernails and / or roughening the front side of the fingernails by the abrasive powder as a preceding step for applying nail polish .

the present invention will be understood from the following detailed description of preferred embodiments (“ best mode ”), which are meant to be descriptive and not limiting . for the sake of brevity , some well - known features , methods , systems , procedures , components , circuits , and so on , are not described in detail . the term “ abrasive powder ” refers herein to small particles of a material , often a mineral , such as alumina , used to shape or finish a workpiece through rubbing . the workpiece for the present invention is the fingernail . the term “ abrasive blasting ” or “ sand blasting ” refers herein to the operation of forcibly propelling a stream of an abrasive powder against a surface under high pressure to smooth a rough surface , roughen a smooth surface , shape a surface , or remove surface contaminants . a pressurized fluid , typically air , commonly is used to propel the abrasive material . fig1 is a cross - section view of a fingernail cleaning apparatus , according to one embodiment of the present invention . a fingernail cleaning apparatus 10 according to the present invention cleans the fingernails 44 by abrasive blasting . a compressor 22 blows a jet 42 of abrasive powder 40 from a nozzle 30 towards a fingernail 44 . compressor 22 may blow abrasive powder 40 either by pressure blast equipment or by suction ( siphon ) blast equipment using the venturi principle ( both described in http :/ en . wikipedia . org / wiki / abrasive_blasting ). the abrasive powder 40 , after rubbing fingernails 44 by jet 42 , may fall down through perforations disposed below fingernails 44 , for being re - used by a closed course , as depicted by the arrows . the act of blowing a jet 42 of abrasive powder 40 onto fingernails 44 is a “ clean ” process , as the abrasive powder 40 does not scatter , as the process is conducted within a closed chamber 60 . the opening of the chamber , through which the hand 26 is inserted , is closed by hand 26 and a springy cover 32 pressing it . fig2 is a top view of the fingernail cleaning apparatus of fig1 . fingernail cleaning apparatus 10 includes a guiding structure for limiting the available locations of nozzle 30 , for ensuring that nozzle 30 blows abrasive powder jet 42 on the fingernails 44 only . according to one embodiment , the guiding structure includes a track 18 , for guiding nozzle 30 , such that nozzle 30 is limited to being moved therealong only . track 18 includes subsidiary tracks , namely 18 a , 18 e , and others , each for allowing nozzle 30 to be located against one finger ; and a main sub - track 58 , for guiding nozzle 30 from one subsidiary ( 18 a , 18 e ) to another . the guiding may be manual or motorized . according to one embodiment , compressor 22 is enabled only upon locating nozzle 30 at the end of a subsidiary track ( 18 a , 18 e ). fig3 is a front perspective cross - section view of the fingernail cleaning apparatus of fig1 . in order to ensure that track 18 indeed guides nozzle 30 to the fingernails 44 only , the guiding structure further limits fingernails 44 to pre - determined locations , by a stationary rigid template 38 , into which the user inserts the hand 26 thereof . fingers template 38 includes subsidiary templates , namely 38 a , 38 e and others , each for inserting one finger therewithin , such that the fingernail 44 protrudes out . template 38 is shaped like a glove having short finger covers . fig4 is a top perspective cross - section view of the fingernail cleaning apparatus of fig1 . track 18 is shaped and disposed against fingers template 38 , for providing correspondence therebetween , in that each fingernail 44 is disposed under an end of a subsidiary track ( 18 a , 18 e ). fig5 depicts the fingernail cleaning apparatus of fig1 , including also a liquid dispenser . fingernail cleaning apparatus 10 may further include a lacquer dispenser or any other liquid dispenser , for accurately dispensing lacquer 52 or any other liquid on the fingernails . whereas compressor 22 is connected to nozzle 30 through a pipe 16 , a liquid dispenser 50 , which may constitute a second compressor 50 or a manual pump , may dispense , through a second pipe 56 , nail lacquer 52 or any other liquid or nail polish to nozzle 30 . nozzle 30 , moving within track 18 , may accurately dispense liquid 52 onto the fingernails . according to another embodiment , a handle 12 of nozzle 30 may be removed from track 18 , for inserting a second nozzle 54 thereinto . in the figures and / or description herein , the following reference numerals ( reference signs list ) have been mentioned : numeral 10 denotes a fingernail cleaning apparatus according to one embodiment of the present invention ; numeral 12 denotes a handle of the nozzle ; numeral 14 denotes a switch for turning on the compressor ; numeral 16 denotes a pipe ; numeral 18 denotes a track ; numerals 18 a and 18 e denote subsidiary tracks , each corresponding to one finger ; numeral 20 denotes a leg , for supporting the funnel - shaped chamber ; the chamber is shaped so for collecting the abrasive powder falling through perforations to the bottom of the chamber , below the hand of the user , for re - use ; numeral 22 denotes a compressor for blowing an abrasive powder ; numeral 26 denotes a hand of the user ; numeral 30 denotes a nozzle , for blowing the abrasive powder jet ; numeral 32 denotes a supporting element for the hand , which may also function as a side cover for preventing exit of the abrasive powder ; numeral 38 denotes a glove having short sleeves for the fingers , for exposing the fingernails and for protecting the other regions of the hand ; according to one embodiment , the glove is rigid and stationary , for limiting each fingernail to a limited location , for ensuring the accurate location of the abrasive blasting and of the lacquer / polish dispensing ; numeral denotes an abrasive powder , such as sand , alumina or other ; numeral 42 denotes a jet of the abrasive powder ; numeral 44 denotes a fingernail ; numeral 48 denotes a switch for turning on the liquid dispenser ; numeral 50 denotes a liquid dispenser ; numeral 52 denotes a nail polish or other liquid ; numeral 54 denotes another nozzle ; numeral 56 denotes another pipe ; numeral 58 denotes a main sub - track of the track , for guiding the nozzle ; and numeral 60 denotes a chamber . the foregoing description and illustrations of the embodiments of the invention has been presented for the purposes of illustration . it is not intended to be exhaustive or to limit the invention to the above description in any form . any term that has been defined above and used in the claims , should to be interpreted according to this definition . the reference numbers in the claims are not a part of the claims , but rather used for facilitating the reading thereof these reference numbers should not be interpreted as limiting the claims in any form .

US-201414488465-A

a ball game platform and a method to play a ball game on said platform are disclosed . the ball game platform comprising a rectangular surface divided into two sections with boundary lines and a middle line , and a duel pole set on one end of the middle line . the method of playing a ball game for two teams of players to play on one section of the platform comprising providing a soft ball being bounceable ; setting a set of rules for the game , judging the score according to the rule , breaking tie score by using duel pole and declaring a winner . the rules for the game do not allow the player to touch the ball by hands except in the services and duels . the rules may include the rules of starting the gaming , serving the ball , shooting , and exchanging of field , as well as rules of violations .

referring more particularly to the drawings , the numeral 10 generally designates the game field or platform of the present invention which may be of any suitable material ; for example , the platform can be made by wood panels , concrete , or compact soil . it should be a hard , plane , rectangular horizontal surface having enough resilience to bounce the ball when playing the game . a preferred embodiment of the field / platform 10 is of 7 . 10 m ( 279 . 53 inches ) long by 4 . 10 m ( 161 . 42 inches ) wide . the playing area is delineated by boundary line 13 with the width of 5 cm , and divided into two sections 11 and 12 by a middle line 14 with the width of 5 cm . the boundary line and middle line can be made by different materials from the field . they may also simply be painted lines with any desired color . according to one of the embodiment , a duel pole 20 is attached to one of the ends of the middle line . as shown in fig2 a and 2b , the duel pole comprises a supporting pole 21 , attached with 3 vertical panels 22 , 23 , and 24 , which are evenly spaced along the length of the pole . each of the vertical panels has a hole , indicated as 25 , 26 or 27 , in the middle of the panels . in particular , the pole is in a rectangular shape of 10 cm × 7 . 5 cm × 120 cm ( 3 . 94 × 2 . 95 × 47 . 24 inches ), the vertical panels are of 20 cm × 20 cm × 5 cm ( 7 . 88 × 7 . 88 × 1 . 97 inches ), and the holes have a diameter of 10 cm ( 3 . 94 inches ). 1 ) pressurized balls have a core pressurized with air or nitrogen . these balls may lose their pressure , and hence playing properties , over time . 2 ) non - pressurized balls are made from a thicker rubber core , and the pressure within the core is equal to the ambient pressure . these balls tend to hold their playing characteristics for a longer period of time , as it is only the cloth that deteriorates . the ball of the game may have a diameter of about 5 cm ( 1 . 97 inches ) and a weight of about 55 grams ( 1 . 94 oz ). the ball must be capable of bouncing . the game will be played by two teams with one to three players in each team . there will be only one player at one side to compete with another player at the other side at a given time . for games with the team having 3 - players , there will be two ( 2 ) waiters . one of them may enter once the player of his side leaves the field . in fig2 a and 2b , it is shown , in plan view , of the duel pole of a preferred embodiment , where the supporting pole has a rectangular cross section and it is made of wood . the vertical panels are of rectangular wood blocks . the purpose of the duel pole is to break the tied score , which will be disclosed hereinafter . the game can be played by two teams competing with each other . the number of the player on each team should be the same . before starting the game , both teams must agree on which section they want to use . the game is played under a set of rules that will be described hereinafter , and is started with a bouncing ball on the middle line . the player receiving the ball will keep the ball bouncing with his body parts except his hand ( s ) and delivering the ball to the other section until one of the following occur : to start the game , an umpire bounces the ball on the middle line of the field . while the ball is still bouncing , the players of the two teams compete to get the ball to his / her control . the players are not permitted to step into their opponent &# 39 ; s section of the field , however , their body parts can reach over the middle line to get the ball in the air of the other section . the above rule of starting of the game is also used when the game extends to the second section . at all times , the ball should be bouncing instead of rolling or stopping on the ground . the players can not touch the ball with their hands except in only two situations , where the player serves the ball and makes a duel shot . without using hands , the ball may be kept by a player at his / her side by patting the ball with the sole of his foot against the surface of his section of the field in order to keep the ball bouncing . after starting , the player with controlling of the ball should return the ball to the other section of the field . the two players then volley , back and forth until there is a score , a change of service or time expires . the players volley by hitting the ball using any body part , except hands of the player . the return ball can be to any place on the other player &# 39 ; s section of the field , including the boundary lines . a player can not go to the other side to hit or claim the ball . serving the ball is made by hand and head of the server . to serve , the serving player throws the ball by hand and hits the ball using his / her head . the ball should bounce from the head and volley into the adversary &# 39 ; s section of the field . after the ball &# 39 ; s first bounce on the player &# 39 ; s section , if the player failed to gain the control of the ball before the ball goes out - of - bounds and lands , it is considered a boundary violation . it is a technical foul when a player touches the ball with his hand ( s ) except in the service of the ball . he shall lose his service by this violation . it is also a technical foul if a player lets his ball stop bouncing after he takes control of the ball . the technical foul will cost the service of the player committing the foul . the player with the technical foul must turn the ball over to the player at the other side for serving . it is a technical violation if a player fails to get control of the ball after its first bounce . when the player returns or serves the ball , if the ball goes out - of - bounds without a first landing either in the other section of the field or on the boundary lines of it , it is considered a foul shot . a player with foul shot loses his service to the other player . a player can control the ball by patting the ball with the sole of his foot against the field . however , if the ball is kept by the player for more than 1 ( one ) minute without returning to the other side of the field , it is considered a time violation . the player loses the service and turns the ball over to the other team for serving when : after change of service , the game is resumed by serving from the team gaining the right of service . there are several ways to time the game , one must be agreed on before starting the game . usually , there are two ( 2 ) sessions for one game play , with thirty ( 30 ) minutes for each session . players are required to change sections after the first session , which is called the half time . in a 3 - player team game , a team &# 39 ; s player can be replaced once by another player in his team . two extensions with 3 minutes each may follow if there is a tie . for the extension in a 3 - player team game , each player plays one ( 1 ) minute and turns the ball to the next player of the team . by the end of the two sessions , the player or the team which scores the most wins the game . one - point scoring applies to the shot by head ( head - shot ), where the ball is sent out to the adversary &# 39 ; s field by bouncing from his head . if the ball lands on the other section of the field and bounces out - of - bounds and the player of the other side fails to return the ball onto the field , or the player fails to gain his control of the ball after the first bounce on his section of the field , one point will be awarded to the head shooter . for a head - shot , if the ball is sent to the other section of the field and lands directly onto any of the boundary lines ( 5 cm ( 1 . 97 inches ) lines ) of the other section , two points will be awarded to the shooter . two points will be awarded even if the other player returns the ball back to the field after the ball &# 39 ; s bouncing on the boundary lines . three - point scoring is for the shots by foot ( foot - shot ), where the player sends the ball to the other section of the field by upper portion of his foot . if a player shoots the ball by his foot and the ball lands on the other section of the field and bounces out - of - bounds and the player of the other side fails to return the ball onto the field , or the player fails to gain control of the ball after the first bounce on his section of the field , one point will be awarded to the foot shooter . for a foot - shot , if the ball is sent to the other section of the field and lands on the boundary line ( 5 cm ( 1 . 97 inches ) lines ) of the section , four points will be awarded to the shooter . the duel pole is used to determine which team wins if the score is tied by the end of the second sessions . a player from each team will be elected for the duel . the ball is placed at one corner of the boundary lines at the side of duel pole . the duel is conducted according to the following scoring scheme : 1 ) foot shot : one point is scored if the player shoots the ball through the hole of the lower panel using his foot . 2 ) hand shot : one point is scored if the player takes the ball by hand and throws it through the hole of the middle panel using his hand . 3 ) head shot : one point is scored if the player shoots the ball through the hole of the upper panel by bouncing the ball from his head . there are two sessions for the duel with 3 minutes for each session and in a multiplayer game , the player may take turn for the shooting . the duel may be repeated until a team wins . obviously , many modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced other than as specifically described .

US-74264607-A

this game apparatus includes a playing surface having end sections mounted at right angles to each other , thus forming a corner with a center section positioned between the end sections , a backboard mounted along the outer edges of the playing surface , panels mounted along the inside edges of the playing surface and a net extending from the corner to the backboard . the rules of the game require that the ball come in contact with the playing surface , backboard and panels in a specified order both while serving and during play . the game apparatus fits easily into a corner of a room and the game requires utilization of very little space around the game apparatus .

as shown in fig1 and 3 , the game apparatus includes a horizontal planar playing surface 10 , a vertical backboard 12 , a net 14 , and vertical transparent panels 16 . for the purpose of illustration , paddles 18 and a ball 20 are also shown . as shown in fig2 the playing surface is preferably supported by folding metal legs 22 and collapsible metal legs 24 , although fixed legs or other supports may be used . the playing surface 10 has two end sections 26 , and one middle section 28 . the end sections 26 are each rectangular in shape and preferably of the same size . they are connected at right angles to each other to form an inner common corner 30 . the co - planar middle section 28 can be pentagonal , rectangular or square in shape and is positioned in the space between the end sections 26 . the sections are connected in such a way that they are collapsible for easy assembling and storage . the means of connecting the sections comprise 40 inch brass piano hinges or any other means which render the sections collapsible . the vertical backboard 12 has two side portions 32 and one center portion 34 . as shown in fig1 the side backboard portions 32 are mounted along part of the outer edge of the end playing sections 26 and part of the outer edge of the middle playing section 28 . the center backboard portion 34 is positioned between the side backboard portions 32 and is mounted across the middle playing section 28 directly across from the inner corner 30 . as shown in fig1 the side backboard portions 32 of the backboard 12 are preferably 30 inches high at the intersection 36 between the side backboard portions 32 and the center backboard portion 34 , have a top edge 38 extending horizontally for a length of approximately 231 / 2 inches in a straight line then extending outwardly and vertically for approximately 22 inches and then extending vertically in a straight line for another 12 inches so that the bottom edge 40 of the end backboard portions measures approximately 36 inches . preferably the top edge 42 and the bottom edge 44 of the center backboard portion are each approximately 471 / 2 inches long and the center backboard portion 34 has a height of approximately 30 inches at the point of intersection 36 with the side backboard portions 32 . the playing surface 10 and the backboard 12 are preferably constructed of three - quarter inch plywood but may also be constructed of material which will create an adequate planar playing surface for playing table tennis . the transparent panels 16 are made of a transparent sheeting material , preferably plexiglass . they are mounted along the inner edges 46 of the end playing sections 26 and are joined at the inner corner 30 of the playing surface 10 . the panels 16 preferably have a bottom edge 48 of approximately 24 inches extending from the inner corner 30 along the inner edges 46 of the end playing sections 26 . the top edges 50 of the panels are preferably 30 inches high at the inner corner 30 where they intersect and have top edges 50 extending horizontally for approximately 12 inches in a straight line and then extending vertically and outwardly for approximately 22 inches and then extending in a vertical straight line for approximately 12 inches . the panels 16 are mounted to the playing surface 10 with plexiglas hinges 52 measuring one inch by three - quarter inch but may also be mounted with any means which allow the panels 16 to be easily removed and stored . the backboard portions are connected preferably with 29 inch brass piano hinges but may also be connected with any means which allow them to be collapsible and easily removed from the table . the backboard 12 is mounted with hinges 54 as shown in fig3 or with any means which allows the backboard 12 to be collapsible and easily removed from the playing surface 10 . a net 14 extends across the middle section 28 of the playing surface 10 from the inner corner 30 to the center 54 of the center backboard portion 34 . the net 14 is preferably 6 inches times 383 / 4 inches and is secured to the table through brackets 56 , as shown in fig2 or any other means which allow the net to be easily assembled and removed . as shown in fig1 the rules of the game require that , with a paddle 18 , a server hits the ball 20 on his end playing section , then the ball must cross the net 14 , hit the center backboard portion 34 then hit the end playing section 26 of the opposing player . if the ball hits the side backboard section 32 on the server &# 39 ; s side first as shown in fig4 the player loses his serve . the ball on the serve may hit any portion of the back wall , provided it has not made contact with either panel 16 or backboard section 32 . if the ball hits the side backboard section 32 on the server &# 39 ; s side before it crosses the net 14 as shown in fig6 the player loses his serve . to get the ball over the net 14 before it hits either the panel 16 , or the side backboard section 32 requires great dexterity and therefore the game is exciting and competitive . during play , the ball may hit as many walls as possible but must hit the center backboard section 34 before hitting the opponent &# 39 ; s main playing court . the ball may bounce only once on the main playing court each time it crosses the net 14 . after the serve and play has started , the ball must hit the center backboard section 34 or the player loses his volley . if the ball goes off the end without touching the playing surface but hits the player &# 39 ; s paddle 18 , the ball 20 remains in play . the ball may be played in mid - air over the playing surface and does not have to hit the playing surface at any time as long as it hits the center backboard section 34 during each volley . if the server wins the volley , he receives one point and continues to serve . if the opponent wins the volley he receives no points but becomes the server . when one player has reached eight points , the players change sides and play continues with the same server with the players remaining at those positions until the game is over . the game is over when one player reaches fifteen points with a two - point advantage . the panels 16 create a barrier to prevent the ball 20 from leaving the court during the course of play , thus allowing the players to remain in the open end 56 of the end playing sections 26 . therefore , it is not necessary to have a large area in which to play since the player does not have to maneuver around the entire table in order to control the ball 20 . when four players play , two at each end playing section 26 , the panels 16 are removed in order to give the players more room to maneuver and to add a more competitive aspect to the game . in a doubles game , the players do not alternate hits but alternate serves . otherwise , the same rules apply as in a singles game . while the game described and the form of apparatus for carrying this game into effect constitute preferred embodiments of this invention , it is to be understood that the invention is not limited to this precise game and form of apparatus , and that changes may be made in either without departing from the scope of the invention which is defined in the appended claims .

US-7183787-A

a nut harvester and separator , particularly for nuts such as pecans , almonds and walnuts , includes a wheeled frame drawn by a tractor over nut and trash windrows on the nut - orchard ground . power - driven pick - up and lifting reels within a longitudinal plenum on the frame advance the picked - up material well into the plenum . a power - driven suction fan is open to the top of the plenum and draws atmospheric air into the plenum partially through a powered chain conveyor largely defining the bottom wall of the plenum . atmospheric air is also drawn into the plenum through side inlets in an initial free fall zone of separation providing separation and removal of a large fraction of the light debris which is lifted through the suction fan and discharged to the atmosphere . heavy , less aerodynamically responsive nuts are left behind to lodge on the conveyor along with the remaining fraction of light debris to form a blanket . the blanket restricts upward flow of air through the rearwardly moving conveyor until the leading edge of the blanket approaches the rearwardly converging downstream , or back , wall of the plenum where the venturi effect of the wall helps to induce a vigorous updraft in the vicinity of the wall capable of disrupting the leading edge of the blanket where final separation of the debris takes place and the isolated nuts are discharged into a towed cart or other container .

the nut harvester and separator pursuant to the invention 5 is especially useful in picking up and separating a mixture of nuts and accompanying debris which have been by previous operations , deposited on the ground . the nuts and trash usually have been gathered together in relatively long , sometimes rather wide and high windrows between the tree rows . the nut harvester may be self - propelled ; but in most instances it is advanced between the tree rows and over the ground by a standard tractor . as an example in the present instance , a windrow 6 of combined debris , trash and nuts lies on the ground 7 between tree rows and is traversed by a tractor 8 having not only a hitch 9 , but a power take - off 11 . the harvester itself includes a main frame 12 supported at the front by ground - engaging , preferably pneumatic , wheels 13 and similar rear ground - engaging wheels 14 ; and is afforded a hitch 15 to receive the hitch of the tractor . furthermore , the harvester may be arranged for steering and maneuvering in general , but that is not disclosed herein , for it is not part of the present invention . the harvester main frame 12 is effective to support a number of space - enclosing side plates 16 and 17 and top plates 18 , 19 and 20 extending over a large part of the structure in a longitudinal or fore and aft direction . the top plate 18 is hinged at its after end by hinge 21 to afford access to the interior ; and top plate 20 is hinged at its forward end by hinge 22 for purposes subsequently to be described in more detail . the side plates 16 and 17 and the top plates 18 , 19 and 20 define , in part , an elongated tunnel - like plenum 23 , with the bottom portion of the plate 20 serving as an after end wall to the plenum . the plenum 23 begins at the forward end in a gathering or pick - up means 24 that is largely defined by side walls 25 , by a planar top wall 26 and curved top wall 27 . the forward portions of the side walls 25 and the top wall 26 diverge somewhat so that as the machine advances , the entire width of the windrow 6 can be gathered in and directed toward the center of advance of the machine . depending from the forward end of the transverse top wall 26 is a number of strips 28 of flexible material , such as rubber , that yield to displacement by the materials encountered but tend to assist in forming a good converging inlet for the machine itself . immediately behind the inlet and well within the forward portion of the plenum 23 is a primary pick - up reel 29 , or drum . this is mounted on the frame 12 by a transverse shaft 30 suitably supported in journals and extending about horizontally . the primary pick - up reel 29 is positioned to extend for the full width of the machine with its lowermost reaches approaching very close to or contacting the ground . preferably , the reel 29 is made up not only of appropriate spiders ( not shown ) mounted on the shaft 30 , but also has transversely extending paddles 31 , or bats , or encounter material on the ground 7 and to displace it as the machine advances along the windrow 6 . cooperating with the primary reel 29 is a secondary reel 32 mounted on a transverse shaft 33 having its axis parallel to that of the shaft 30 and arranged so that the bottom of the secondary pick - up reel 32 approaches or is in contact with the surface of the ground 7 . preferably , the secondary pick - up reel 32 although inclusive of bats 34 , or paddles , is of about half the diameter of the primary reel 29 and has half the number of bats . the reels 29 and 32 are arranged to rotate counter to each other with their lower portions approaching each other near the ground and they are mechanically interconnected so that the various paddles 31 and 34 intersperse and cooperate to elevate and forcefully propel the nuts and trash in an upward and rearward direction , as shown in fig3 for example . also spanning the forward portion of the plenum 23 on a shaft 35 parallel to the shafts 30 and 33 is a tertiary , or lifting reel 36 having paddles 37 , or bats , arranged to rotate in the same direction as the secondary reel 32 and to assist the secondary reel 32 in flinging the material into a free fall arc , or into a buoyant or suspended condition while traversing the chamber below the top wall 18 of the plenum 23 . the tertiary reel 36 , in cooperation with the secondary reel 32 also assists in thrashing apart wads of material bound together by long grass and wet leaves and in dislodging sticks and the like which might otherwise block the flow of material . on the machine and to the rear of the reels 29 , 32 and 36 the opposite side plates 17 and the top plates 19 and 20 are configured to enclose and define a central zone 38 of the tunnel - like plenum 23 . this middle portion of the plenum 23 is about the maximum width of the machine and also is substantially of greater height so that it encloses a large volume . the side plates 17 and the top plates 19 and 20 defining the enlarged portion of the plenum 23 extend a substantial distance toward the rear of the frame 12 . also serving to act with the top and side plates to define a large portion of the bottom of the plenum 23 is a link belt conveyor 39 . this is made up of chain sections 40 with cross bars 41 . at its forward end the conveyor 39 is trained around sprockets 42 on a sprocket shaft 43 . at its after upper end it is trained around sprockets 44 on a sprocket shaft 45 journaled on the frame upper portion 12 . intermediate sprockets 46 and 47 are also provided . the conveyor 39 can be of various sizes and meshes , depending upon the particular commodity to be handled . in all cases , the path and function of the chain are substantially the same . the chain conveyor 39 assists in defining the lower portion of the plenum and extends through the plenum to emerge from the plenum into the atmosphere beneath the trailing tip 48 or trailing edge , of the curved top plate 20 . the top plate 20 is a continuation of the top plate 19 and is connected thereto for swinging movement about a horizontal axis by means of a hinge 22 as previously indicated . the hinged rear plate 20 is especially contoured initially to continue the curved shape of the top plate 19 , but then to reverse curvature and converge very smoothly at the trailing tip 48 in almost a horizontal direction toward the adjacent upper run of the conveyor 39 . usually , the rear tip 48 of the plate 20 runs on or very close to the upper run of the conveyor 39 . the hinged plate 20 can yield somewhat to allow nuts to ride under the trailing edge 48 of the plate 20 and to be carried along the upper , or higher , portion of the conveyor 39 to discharge over the upper , or after , end thereof into a nut cart 50 , usually drawn by the harvester . particularly in accordance with the invention , and because much of the separation of the nuts from the trash is accomplished by gravity and by air currents , there is provided on the frame 12 a suction fan 49 . this conveniently is a fan having blades 51 mounted on a cross shaft 52 extending the width of the machine and parallel to the shafts 30 , 33 and 35 . the suction fan 49 has an outlet directly to the atmosphere through a guiding duct 53 , and has an inlet 54 opening into a transverse , partial tube 56 that extends substantially the entire width of the plenum 23 . the suction tube 56 has a transversely extending opening 57 in the upper portion thereof spanning substantially the full width of the machine . thus , separated trash , such as leaves , twigs , dirt and the like , are removed from the plenum 23 by vacuum - induced air flow entering the tube 56 through the opening 57 , thence into the fan scroll through the inlet 54 and emerging into the atmosphere after traversing the duct 53 . since some present - day harvester equipment is self - powered , there may be provided a source of power on the frame 12 itself ; but usually that is not so and the power take - off 11 of the tractor 8 shown herein is utilized . in setting up the equipment , the harvester - separator 5 and the tractor are brought into alignment in the general direction 58 they are to proceed or advance . the frame 12 is connected through the hitch 15 to the tractor hitch 9 , and the power takeoff 11 of the tractor is connected through a drive shaft 59 to a gear box 61 on the frame 12 . drive from the gear box can be arranged in various different ways . in this instance , a power pulley 62 on one side has the proper rotational speed and diameter to be connected by suitable belts to pulleys 63 on the suction fan shaft 52 . from the gear box 61 another shaft 64 is connected through drive connectors 65 to the various shafts such as 30 , 33 and 35 of the primary , secondary and tertiary pick - up reels . when the tractor 8 begins to advance , the windrow 6 of nuts and debris of trash on the ground gradually come under the advancing forward portion of the plenum and are engaged by the various pick - up reels 29 , 32 and 36 . these first lift and then forcefully discharged the various materials in a generally upward and rearward direction , being assisted by the sub - atmospheric pressure within the tunnel due to operation of the suction fan 49 . in other words , as the machine advances and material is lifted into the air by the primary and secondary reels and begins to float along , the third or tertiary reel assists in propelling it upwardly and rearwardly and keeping it buoyant in the air in the initial , or primary separation zone 66 , or region , located between an opposed pair of openings 67 in side plates 16 , the openings 67 being covered by screens 68 . atmospheric air is sucked in through the screened openings 67 in a direction approximately transverse to , or across the rearward flow of buoyant nuts , and accompanying leaves and other trash propelled into the primary separation zone 66 by the reels . it is important to note that the screened openings 67 are not subject to being blocked off or restricted by the suspended material , since air passageways therein ensure a constant air inflow through the openings . the vigorous turbulence created by the collision between the two transverse air currents is particularly effective in separating and removing the more aerodynamically responsive leaves and other trash . during the time the material is in this region of buoyancy , or suspension , or free fall , all of the surfaces are exposed to the swirling air currents and a very large fraction of the trash is separated out in the primary separation zone 66 and is immediately sucked into the fan and discharged . when the lifting effect subsides , or slackens , as the nuts and remaining trash move rearwardly out of the initial separation zone 66 , gravity tends to make the remaining picked - up material descend onto the subjacent , forward lower end 71 of the conveyor belt 39 . as a result , a layer 72 , or blanket , or bed , of nuts plus trash and debris is deposited beginning on the lower forward end 71 of the top run of the conveyor . the blanket is quite impervious to the flow of air , thereby restricting upward air flow from the outside through that portion of the conveyor covered by the blanket 72 . as the blanket 72 is carried toward the after end of the plenum and approaches the bottom portion of the top plate 20 , the vacuum build - up in the plenum reaches a high level , creating a vigorous updraft in the vicinity of the end wall formed by the top plate 20 , the location of this secondary , terminal zone of separation being generally indicated by the reference numeral 74 . the strong updraft disrupts the leading edge of the blanket as the blanket approaches the bottom portion of the after end wall 20 and elevates the mixture of nuts and residual trash , allowing the more aerodynamically responsive trash to be sucked up into the tube 56 and discharged through the duct 53 while the nuts fall back onto the conveyor belt 39 . the separation effect is enhanced by the presence of a blocking plate 76 located below the conveyor belt in the vicinity of the trailing edge 48 , or tip , of the hinged plate 20 . a quiescent zone 77 is created by the plate 76 , the isolated nuts dropping down and lodging on the conveyor belt as the nuts are carried beyond the leading edge of the blocking plate 76 . the nuts , free of trash , move upwardly and rearwardly beneath the hinged plate 20 . the trailing edge 48 of the hinged plate 20 normally runs very close to the upper part of the conveyor chain but can yield as necessary when encountered by twigs and limbs too heavy to be removed by the vacuum induced updraft . this arrangement maintains the opening between the trailing edge 48 of the swinging plate 20 and the conveyor quite small so that not a great deal of atmospheric air is induced to flow in at this point . sometimes , in the event a larger opening is needed , there is afforded a chain adjuster 79 which can be manually set on an upright stop 81 on the frame . this allows some change of input air at this point and can be used to assist in regulating the extent of the vacuum within the plenum , especially when necessary to change the force or shape of the updraft in the secondary , or terminal , zone of separation 74 . additional control is afforded by a hinged baffle 83 which serves to regulate the amount of opening at the throat 84 between the initial zone of separation 66 from the enlarged central zone 38 of the plenum where the suction fan and attendant conduits effect removal of the trash separated in both the initial zone 66 and terminal zone 74 . as the machine advances along the windrow over the ground , it continually picks up the nuts available and the debris that inevitably come therewith , effectuates an appropriate separation of the debris , dirt and nuts as they proceed through the tunnel of the machine , then discharges the debris and dirt to one side for return to the floor of the orchard , and separates the nuts and discharges them over the rear end of the machine into an appropriate nut cart for eventual recovery . fig4 illustrates a modified form of nut separator in which the tertiary or lifting reel 36 of the fig1 - 3 form of machine is replaced by an endless conveyor belt 86 having flights 87 . the belt 86 , at its upper end , is trained around sprocketed shaft 88 suitably connected to a power source to move the upper run of the belt in a rearward direction . the upper run of the belt is loaded with a thick bed 89 of mixed trash and nuts picked up from a windrow of such material on the ground 7 . pick - up means similar to that disclosed in the fig1 - 3 harvester and separator can be utilized to elevate and deliver the mixtue of nuts and debris onto the upper run of the endless conveyor 86 . as the upper run of the conveyor reaches the end of its run and starts to recurve around the sprocketed shaft 88 the bed of material 89 is released into a free fall state into the throat 84 defined on the upper boundary by the bottom portion of the suction tube 56 and on the lower boundary by the adjacent portion of the foraminous conveyor 39 . the velocity imparted by the belt 86 to the nuts and debris as they separate from the belt launches them in free flight in a generally rearward direction while gravity tends to head them downwardly , as shown in fig4 . during free fall , the nuts , and especially the more aerodynamically responsive trash , are subjected to a strong upflow of air through the gap 91 between the lower , or forward , turn of the chain conveyor 39 and an airflow guide plate 92 below the bottom run of the endless belt 86 . a strong upflow of air also occurs through the foraminous conveyor 39 , as shown by the arrows 93 indicating the direction of the upward and rearward air currents transverse to the downward and rearward descent , in free fall , of the mixed trash and nuts . while in free fall state the light trash is especially vulnerable to aerodynamic forces , such as that imposed by the transverse air currents indicated by the arrows 93 . thus , a very large fraction of the debris is immediately stripped away from the nuts and residual debris and carried through the opening 57 , thence into the suction tube 56 and suction fan , into the guide duct and into the atmosphere . the remaining trash and nuts are deflected somewhat from their normal flight path by the transverse air currents . nevertheless , the residual material descends onto a landing zone 94 on the conveyor 39 and there builds a layer 72 , or blanket , or bed , of leaves , twigs , dirt and nuts which is relatively impervious to the passage of fan - induced upflowing air . it is significant to note that owing to its forward position relative to the landing zone 94 , the gap 91 is not susceptible to being blocked or choked off by the layer 72 . consequently , even under very heavy trash conditions , trash separating airfow will continue through the primary separation zone 66 . owing to this relatively high resistance to airflow , the blanket remains substantially free of disruption during its migration from the area of deposit , or landing zone 94 to a location near the hinged back plate 20 , where the secondary , or terminal , zone of separation 74 is located . the relatively impervious blanket 72 serves also to reduce the area at the bottom of the plenum 23 through which air is free to flow . thus , the vacuum induced in the plenum 23 by the single suction fan is maintained at a sufficiently high level to maintain a very brisk , or even vigorous , air flow in both the initial and the terminal regions of separation and removal . this characteristic of the bed 72 also affords a desirable self - regulating capability to the overall system . in other words , in the event that an especially thick ( i . e . high trash to nut ratio ) layer lands on the landing zone 94 , even less than usual air can permeate the blanket 72 . as a consequence , the vacuum induced by the fan increases within the plenum and more air than usual is &# 34 ; sucked up &# 34 ; through the two separation zones , resulting in enhanced separation while the particularly heavy trash is present on the conveyor . the reverse automatically occurs when the trash turns to lighter material . as previously noted , adjustment of the chain 79 is a manual way of regulating upflow . thus , when more than the ordinary amount of heavy trash is encountered , or particularly when the trash is damp or wet , manually lowering the trailing edge 48 of the hinged back plate 20 ( by increasing the effective length of the chain 79 ) reduces the cross - sectional area of the air inlet for the plenum . such an inlet restriction increases the vacuum within the plenum , and imposes more vigorous uplifting forces upon the trash . as before , the secondary zone of separation 74 is located somewhat upstream from the lower portion of the back wall 20 , the upflow through the conveyor belt being as generally indicated by the reference numeral 96 . upflow is enhanced by the venturi effect of the bell - shaped back wall 20 . here , again , the flow is transverse to the movement of the blanket 72 of mixed nuts and residual trash . while transverse upflow through the bottom of the plenum is not as effective as transverse flow through a freely falling curtain , the primary separation zone is capable of removing such a large fraction of debris that the task remaining for the secondary separation zone is relatively undemanding and the final separation efficiently removes the remaining trash . as before , a blocking plate 76 is often found helpful in creating a zone of quiescence 77 adding to the efficiency of nut isolation at the site of last - chance separation , particularly when increased by the venturi - like effect of the wall 20 .

US-79380185-A

an apparatus for use in respiratory therapy procedures in the field of medicine . the apparatus of the invention converts liquid medication into an aerosol mist comprising sub - micron size particles and provides for delivery of this mist with such high efficiency that up to 40 % of the original dose of medication placed in the nebulizer will be deposited in the patient &# 39 ; s lungs .

referring to the drawings and particularly to fig1 and 2 , the aerosol inhalation apparatus of one form of the invention can be seen to comprise a sectionalized main housing 12 to which is attached an inflatable bag 14 , a bacteria filter 16 , and nebulizer means , shown here as a small volume nebulizer ( svn ) 18 . as best seen in fig2 and 3 , the upper half 18a of nebulizer 18 is enclosed within a first chamber 20 of the main housing 12 and the lower half 18b is disposed externally for ease of accessibility . a first end 12a of the main housing is provided with a standard size breathing port 22 for ready patient interfacing with the aerosol system via a conduit , or breathing tube 23 . in a manner presently to be described , the various sections of chambers of the main housing are interconnected by appropriately baffled fluid flow passageways which are constructed and arranged in a manner to maximize the amount of aerosolized medication that is accessed by the patient . turning particularly to fig2 the nebulizing means , or nebulizer 18 of the apparatus is mounted partially within first chamber 20 and functions to nebulize a selected fluid medication to produce a fine particle - laden spray having a precise range of sizes of medicament particles contained therewithin . nebulizer 18 is of a standard construction well known to those skilled in the art , and as indicated in fig6 and 7 , nebulizer 18 includes an upper cylindrical collar 24 and a lower liquid reservoir portion 26 . carried by a wall 28 of housing 12 , which is disposed directly above nebulizer 18 , is access means for accessing nebulizer 18 to supply medication fluid to reservoir portion 26 thereof . in the embodiment of the invention shown in the drawings , the accessing means comprises a self - sealing , penetrable septum 30 which , as shown in fig3 and 6 , is sealably mounted within an aperture 32 provided in top wall 28 of housing 12 . for certain applications , septum 32 can also comprise a split septum adapted to receive a blunt cannula . septum 30 is preferably constructed of soft rubber or other suitable elastomer material which is readily penetrable by a blunt cannula or by the needle &# 34 ; n &# 34 ; of a hypodermic syringe ( fig6 ). nebulizer 18 also includes a gas inlet means here comprising a gas inlet port 36 , which is interconnected with a source of gas under pressure such as a tank &# 34 ; t &# 34 ; ( fig6 ). the nebulizer gas inlet means functions to permit the controlled introduction into the nebulizer of a selected gas under pressure in a manner to cause nebulizing of the fluid disposed within reservoir 26 of the nebulizer . this particulate containing fluid is generally designated in fig6 by the letter &# 34 ; f &# 34 ; and may comprise any of a large number of medications , or mixtures thereof , depending upon the end use to be made of the apparatus . in operating the nebulizer , the source of gas &# 34 ; t &# 34 ;, such as oxygen or compressed air , is interconnected , with inlet 36 by a suitable conduit &# 34 ; c &# 34 ; ( see fig6 ). the gas is preferably supplied to the nebulizer at a flow rate of about ten liters per minute . as best seen in fig6 and 7 , the gas flowing through the inlet port in the direction of the arrow 37 passes through a very small nebulizer orifice 40 provided in a specially configured member 41 . this causes the fluid &# 34 ; f &# 34 ; to be drawn from reservoir 26 through orifice 40 in the direction of the arrow 43 . due to the basic design of the nebulizer and in accordance with the bernoulli effect , the liquid drawn from the reservoir will be predictably converted into a fine mist containing a mixture of particles of varying sizes . after flowing through orifice 40 , the fine particulate laden mist will be forced around a flow control member 44 and then upwardly through the nebulizer unit and into collar 24 in the direction of the arrows 45 . flow control member 44 , which surrounds the outlet side of orifice 40 in the manner shown in fig6 functions to increase turbulence within the nebulizer and to properly direct fluid flow toward collar 24 . this novel construction reduces the size of the particles reaching the outlet port of the device and , along with settling means , the character of which will presently be described , limits the size of the particles that ultimately reach the patient . as best seen in fig1 and 2 , a reservoir means , shown here in the form of an inflatable bag 14 having a capacity of about two liters , is , secured by a ring clamp 48 to a cylindrically shaped port 50 which is integrally formed with bottom assembly 12b of housing 12 . port 50 communicates with a second chamber 54 which is formed in housing 12 adjacent first chamber 20 . housing 12 is also provided with a third chamber 56 which is in communiction with an outlet port 56a to which there is connected a filtering means for impeding fluid flow through the outlet port and for filtering particles from the spray flowing into chamber 56 as a result of exhalation by the patient through the breathing tube or conduit 23 . in the embodiment of the invention here shown , the filtering means comprises a filtering assembly 60 of the character best seen in fig2 . assembly 60 includes a filtering element 62 , which is retained within a housing 64 , having neck portion 64a , and functions to filter particulates from the fluid flowing from chamber 56 through outlet port 56a , through filtering element 62 and outwardly of port 66 to atmosphere . neck 64a is closely receivable over a cylindrical skirt 67 which forms a part of housing 12 . filtering element 62 is of a character well known to those skilled in the art and is commercially available from sources such as intertech of lincolnshire , ill . for so long as compressed air or oxygen is supplied to the nebulizer through inlet 36 and for so long as liquid remains within the nebulizer reservoir , a constant supply of medication containing mist will be supplied to first chamber 20 . on average , a patient breathes approximately 10 to 12 times per minute and the adult tidal volume is in the order of 600 to 700 cc . under normal patient dynamics , an inhalation breath will average approximately one second , and there is a retention time of on the order of one second , followed by an exhalation time of about three seconds . using conventional small volume nebulizer ( svn ) configurations , the patient is accessing aerosolized medication only during the inhalation period of perhaps one second . if the nebulizer is operating at 10 liters / min ., during the one second inhalation period the patient will have received only 10 , 000cc / 60 sec .= 167cc of aerosolized medication with the remainder of the patient &# 39 ; s tidal volume breath being composed essentially of room air . during patient retention and exhalation , the nebulizer output is being vented either through a filter or directly to the atmosphere . accordingly , normal patient breathing dynamics severely limits the efficiency of conventional nebulizer circuits . the novel apparatus of the present invention uniquely overcomes the drawbacks of prior art inhalation devices by substantially minimizing the loss of aerosolized medication during the exhalation phase of patient breathing . as indicated in fig2 during optimum system operations , nebulizer 18 is continually supplying a fine mist of aerosolized medication to first chamber 20 at a rate of approximately 167ccd per second . at the start of the treatment cycle , this mist is inhaled into the patient &# 39 ; s lungs through a passageway 70a formed in a wall 70 , which separates chambers 20 and 56 , and via chamber 56 and conduit 23 . as shown in fig2 first chamber 20 is in communication at all times with second chamber 54 and with third chamber 56 with flow being unobstructed by check valves . during the following three second exhalation period , the expired air pushes a portion of the medication laden mist being generated from chamber 20 into chamber 54 and then into inflatable bag 14 , with any excess expired air flowing to atmosphere through filter assembly 60 . uniquely , during the patient &# 39 ; s next breath , medication laden mist is inhaled by the patient both from chamber 20 and from inflatable bag 14 in a volume sufficient to fully satisfy the patient &# 39 ; s tidal volume requirements . this medication laden mist from chambers 20 and 54 , goes into and is distributed through out the patient &# 39 ; s lung area . during each subsequent breath , the process is repeated . absent chambers 54 and inflatable bag 14 , which is connected thereto , exhalation by the patient would cause a substantial portion of the medication laden mist being generated to be lost via filter 62 to atmosphere . in addition to making more medication available to the patient and minimizing medication loss to atmosphere , chambers 20 and 56 also uniquely comprise settling means which function to remove large particles of medicaments from the particulate laden mist by means of sedimentation . in this connection , novel baffling means , of a character presently to be described , promote the effective entrapment of large particles with the result being that the particles actually being accessed by the patient are very small , as for example on the order of 0 . 3 microns mmad . these particles are sufficiently small so that they desirably reach the extremities of the lung area through which medication is transported to the blood . the previously mentioned baffling means of the invention comprise a first baffle means , or wall 72 , which separates first and second chambers 20 and 54 as well as a wall 70 , which separates first and third chambers 20 and 56 . the settling means also comprises a settling chamber 20a which comprises a portion of first chamber 20 ( fig2 ). in operation , wall 72 functions to impede the flow of large particles toward second chamber 54 causing them to fall by force of gravity into settling chamber 20a . similarly , wall 70 functions to impede the flow of large particles toward third chamber 56 , once again causing the large particles traveling toward chamber 56 to fall by force of gravity into chamber 20a . to vividly demonstrate the high levels of efficiency of the apparatus of the present invention , measurements have been made through use in the nebulizer chamber of radioactive labeled tc 99 m dtpa . by sensing emissions from the radioactive particles that are actually deposited in the patients lungs , it has been shown that , if run to dryness , up to 40 % of the fluid medication placed in the nebulizer reservoir will be deposited in the patient &# 39 ; s lungs . turning now to fig8 a filter assembly 80 of alternate construction to filter assembly 60 is there shown . assembly 80 is receivable over skirt 67d of housing 12 and includes a filtering element 82 of different construction from that in element 62 . more particularly , element 82 comprises a generally disk - shaped , relatively dense , porous mass adapted to capture particulate matter contained in the fluid flowing through outlet port 56a . once again element 82 is of a character well known in the art and is readily commercially available . referring now to fig9 and 11 an alternate form of inhalation apparatus of the present invention is there illustrated . this alternate form is similar in many respects to that shown in fig2 and like numerals have been used to identify like components . a major difference between this latest form of the invention and that of fig2 is the addition of novel valve means here provided in the form of a one way valve assembly 86 of novel construction which is disposed proximate passageway 71a . another difference is the replacement of filter assembly 60 with a sealing cap 88 the function of which will presently be discribed . as best seen in fig1 and 11 , valve assembly 86 comprises a base wall 90 having central opening 92 therethrough . affixed to wall 90 at a single pivot point 93 is a generally circular substantially flexible flapper valve member 94 . valve member 94 can be constructed of a number of materials including plastic and various yieldably deformable elastomeric materials . pivot point 93 is defined by a fastener such as rivet 96 which passes through member 94 at a location proximate its outer periphery and then through base wall 90 in the manner shown in fig9 . with this unique construction , fluid passing through passageway 70 in the direction of the arrow 97 will flow through aperture 92 and will cause valve member 94 to open in a novel pivoting motion about pivot point 93 . conversely , fluid flowing in an opposite direction will cause valve member 94 to securely close and move into sealing engagement with a portion 90a of wall 90 that circumscribes opening 92 thereby blocking fluid flow through passageway 70a . when the apparatus is in use , patient inhalation will cause the valve to open to permit the aerosolized medication to flow from chamber 20 into chamber 56 and then into the patient &# 39 ; s lungs . during the time of patient breath hold and exhalation , the one - way valve will close causing mist produced during this period of time to be retained within chambers 20 and 54 , and within the inflatable bag 14 . this accumulation will fully satisfy the patient &# 39 ; s next breath tidal volume requirements . once again , this novel construction permits maximum effective use to be made of the particulate laden mist being generated by the nebulizer . in those situations where no harm results from exhalation of the particulate laden mist directly into the atmosphere , the filter means can be removed and replaced with the less expensive cap 88 which fits securely over cylindrical portion 67 . cap 88 is provided with a small , centrally disposed aperture 88a which permits flow to atmosphere and at the same time provides sufficient impedance to such flow as to insure proper closing of valve member 94 upon patient exhalation . having now described the invention in detail in accordance with the requirements of the patent statutes , those skilled in this art will have no difficulty in making changes and modifications in the individual parts or their relative assembly in order to meet specific requirements or conditions . such changes and modifications may be made without departing from the scope and spirit of the invention , as set forth in the following claims .

US-16715793-A

the present invention is a collapsible stool with a plurality of legs that can be stored either freestanding or hung , and that has a single handle that is used to carry , initiate expansion or collapse of , or used to guide the stool when sitting . further , the stool has a novel mechanism that allows a smooth transition from collapse to expansion and expansion to collapse using a single handle . this same mechanism allows the stool to stand upright in a stable position in both the expanded and collapsed configurations .

the preferred embodiment of the invention consists of a seat 101 , with a handle 41 at its forward end , that is fastened to a seat beam assembly 103 , which is connected to a support beam assembly 105 by a hinge that pivots about a seat hinge pin 27 . the seat beam assembly 103 contains a storage guide 43 that stabilizes the stool as it rests on a partition , door , or other rigid structure in the collapsed position . a plurality of legs 15 , made from hollow aluminum square tubes , are each attached to the lugs of a slider fitting 13 through hinges pivoting about a plurality of leg hinge pins 25 and a lower link hinge pin 35 . the legs 15 extend radially and each fasten to a caster fitting 17 with two rivets 45 . each caster fitting 17 attaches a caster 21 with double - wheels to one of the legs 15 by screwing the shank of the caster 21 into a threaded hole . a plurality of tension links 23 connect to each of the caster fittings 17 at hinges connected by a plurality of outer link hinge pins 33 . each of the tension links 23 connect to a single tension fitting 19 by hinging about a plurality of inboard link hinge pins 31 installed into each pair of lugs as part of the tension fitting 19 . the tension fitting 19 slides over and is riveted to a support tube 39 that is part of the support assembly 105 . the slider fitting 13 contains a center hole large enough to accept a pressed - in bearing of fiber - reinforced plastic with an inner diameter slightly larger than the support tube 39 as to allow vertical movement along the tube . the upmost vertical movement of the slider fitting 13 is restricted by a tube stop 37 welded to the support tube 39 . downward movement of the slider fitting 13 is restricted by the tension fitting 19 or by other restrictions in the system such as caster 21 to caster 21 contact , when collapsed . a main link 11 connects the slider fitting 13 to the seat beam assembly 103 by hinges that pivot about a lower link hinge pin 35 and an upper link hinge pin 29 , respectively . the present invention uses sintered bronze plain bearings to support all large hinge pins in the slider fitting 13 , main link 11 and seat beam assembly 103 . teflon coated plain bearings are used to support smaller hinge pins connecting the tension links 23 . small pins are retained by applying retaining compound to and pressing them into interference - sized holes in the caster fittings 17 and the tension fitting 19 . the preferred embodiment of the present invention uses a seat 101 made of fiber - reinforced plastic , or composite , that contains the handle 41 integral to its structure . the support tube assembly 105 is preferably made of steel with surface treatment or stainless steel . each of the pins are preferably made from steel or stainless steel . all other parts are preferably made from aluminum . the leg hinge pins 25 are held in place by applying retaining compound and pressing each into the inside of a metal tube 49 , preferably made of aluminum , swaged into a through - hole in each of the legs 15 . ( refer to fig1 ) a set of plain bearings 45 , preferably made of sintered - bronze , are used as rotational surfaces for each pin , while flat washers 47 are used to bear lateral thrust loads . the upper link hinge pin 29 is coated with retaining compound and pressed through an under - sized tube 51 that retains the pin . the seat hinge pin 27 has retaining compound applied to and is pressed into an interference - sized steel tube that rests in holes of , and tack welded into , the support tube 39 perpendicular to its centerline axis . all large pins , preferably , rotate on sinter - bronze bearings . an alternate embodiment of the present invention uses a linear roller bearing pressed into , or otherwise captured by , the slider fitting 13 that rides on the support tube 39 made from hardened steel or steel with hardened surface . each caster 21 may be attached by means threading , or held into the caster fitting 17 by a friction device . another embodiment of the present invention uses legs 15 of a different section shape than the preferred square - shape . tension links 23 could also be made using a different section shape than the i - shape in the preferred embodiment . all parts could be made from an alternate material such as titanium , aluminum , steel , plastic , fiber - reinforced plastic , plastic , or otherwise . also , rotational bearings , plain , spherical , roller , ball - type , may or may not be used between each hinge pin and each lug . hinge pins could be replaced by alternate fasteners such as bolts , rivets or otherwise . still another embodiment of the present invention uses a seat 101 of different shape yet contains a handle 41 , either integral , as used in the present invention , or attached , as to allow collapse and expansion of the stool using a single hand . the storage guide 43 may also be in a different shape , either integral or affixed , yet function in a similar manner , as to stabilize the stool as it sits on a partition , door , or other rigid structure in the collapsed position . while the preferred embodiment uses five legs 15 and associated linkages , other embodiments may have fewer or greater legs . while a greater number of legs will increase tip - over stability for a given leg length and geometry , it comes with added complexity and weight . the present invention uses a reciprocating motion of the slider fitting 13 to synchronize the extension and collapse of all five leg 15 . the relationship of the slider fitting 13 to the tension fitting 19 along the length of the support assembly 105 determines the positions of the legs 15 and tension links 23 . when the legs 15 of the stool are fully extended , the slider fitting 13 rests against the tube stop 37 and the seat 101 is in a horizontal position . the main link 11 connects the seat beam assembly 103 to the slider fitting 37 and synchronizes the rotational motion of the seat 101 to the extension of the leg 15 and supporting structure . to collapse the stool , the handle 41 is raised , simultaneously breaking down the leg support trust structure and raising the seat . as the front of the seat 41 is raised , weight of the stool is still resting on the casters 21 . as the legs 15 are drawn inward , the casters 21 rotate so that they trail radially outward . ( refer to fig1 ) the caster &# 39 ; s pivot axis moves from vertical to somewhere between vertical and horizontal when the leg 15 are fully collapsed . the positions of the casters 21 remain stable from gravity once lifted from the floor . if the stool is place back onto the floor , the casters 21 remain in these positions because of the unique orientation the caster fittings 17 place the casters 21 in . even with the caster pivot axis above the contact points of the wheels to the floor , the casters 21 remain in position , supporting the weight of the stool in the collapsed position . if slight downward pressure is applied to the stool &# 39 ; s handle 41 , the legs 15 of the stool will extend outward , yet the casters 21 will remain in the same radial position and support the weight of the stool as its legs 15 are being extended . only when the legs 15 are almost fully expanded and the tension links 23 are near horizontal , will the casters 21 begin to flip around seamlessly . ( refer to fig1 ) this novel mechanism allows for a smooth transition from collapsed to expanded and expanded to collapsed configurations of the stool . it also allows the stool to be placed on the floor in the collapsed position while supporting its own weight . another embodiment of the present invention may arrange the linkages so that contact points of each caster 21 to the ground , while in the collapsed stool position , are radially outboard from the center &# 39 ; s of the leg hinge pins 25 and 35 . this will allow the stool to unfold as it is placed on the floor without downward pressure on the handle 41 . the stool will then be required to hang by the storage guide 43 when not in use . another embodiment of the present invention combines each leg 15 with a caster fitting 17 to reduce the number of parts . this leg assembly 55 is illustrated in fig1 . this embodiment or a different embodiment combines the seat beam assembly 103 with the seat 101 . this seat structure assembly 57 is illustrated in fig1 . the forgoing is considered as illustrative only to the principal of the invention . further , since numerous changes and modification will occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described above , and accordingly , all suitable modifications and equivalents may be resorted to falling within the scope of the invention .

US-201514792735-A

a carrying harness apparatus for carrying or turning a mattress which can be tightened down on mattresses of varying sizes to provide lateral support for the mattress during carrying and secure handholds at several points about the periphery is disclosed . two belts in the harness apparatus , which lie along opposite sides of the mattress , are adjustable in length to allow the harness to be tightened down and have releasable connectors for easy removal of the harness .

with reference to fig1 and 1a , a mattress carrying harness 10 is comprised of two sections connected at opposite ends by a pair of locking devices 11 . each section has a long strap or belt 12 made of a sturdy , flexible material such as polypropylene or nylon webbing which is sewn or otherwise secured end to end to form a continuous major loop 12a . two short , longitudinally spaced - apart connecting straps or belts 14 , also made of a sturdy , flexible material such as polypropylene or nylon webbing , are sewn or otherwise secured between opposing points on major loop 12a to form two corner loops 12b . when these corner loops are fitted around adjacent corners of a mattress 13 the two segments of major loop 12a between connecting belts 14 form a pair of side belts 12c that rest along or near the edge or side of mattress 13 . securely attached to corner loops 12b roughly opposite the side belts and at opposite ends of each harness section are end belts 15 , which are also made of a sturdy , flexible material such as polypropylene or nylon webbing . in this position , the end belts extend out from the corner loops along opposite edges of mattress 13 . when the mating harness sections are placed on opposite sides of mattress 13 their corresponding end belts extend out toward one another . some overlap is provided in these corresponding end belts so that mattress carrying harness 10 can be used on mattresses of various widths . while tying the corresponding end belts together is one way of securing the harness sections to mattress 13 , the preferred embodiment uses locking devices 11 . the securing means used should provide secure locking , ease in disconnection and ease in adjusting the combined lengths of the end belts to allow the mattress carrying harness to be secured on mattresses of various widths . one locking device which has these advantages is fastex model qr - 1 . the releasable interconnection properties of this locking device are described in great detail in u . s . pat . no . 3 , 167 , 835 issued to bengtsson and are illustrated by fig3 - 6 . with reference to fig3 locking device 11 has a male component 16 and a female component 17 . the male component has an adjustable attachment portion 18 generally flat and rectangular in shape with a generally rectangular central hole 19 extending therethrough and an orthogonal shoulder 20 along one of its edges . extending away from shoulder 20 along opposite sides of portion 18 are a pair of raised ribs 21 . a locking piece 22 , slidably attached to the opposite sides of portion 18 , encircles these raised ribs and has an upper member 23 and a lower member 24 which extend across central hole 19 ( fig7 ). the end of an end belt 15 can be attached to portion 18 by threading it up into hole 19 , from the side opposite shoulder 20 , between the upper member and lower member of locking piece 22 up and back over the top of upper member 23 and then back down through hole 19 to rest on top of itself . female component 17 has a locking socket portion 29 and an attachment portion 30 . attachment portion 30 is a u - shaped piece wnose opposed ends are attached to a back edge 31 of the locking socket portion . a pair of raised ribs 32 extend out from back edge 31 along opposite sides of portion 30 to provide structural support . the end of an end belt 15 can be fixedly attached to portion 30 by looping it around the end of the u - shaped piece and fastening it to itself . thus , the corresponding ends of end belts 15 can be securely locked together by sliding the two components of locking devices 11 together , can be easily disconnected and can be easily adjusted to fit snugly on mattress 13 once the locking devices are in the locked position by pulling on the ends of the two end belts which are threaded through adjustable attachment portions 18 . the locking pieces 22 will allow the end belts to be tightened down and will not loosen up if tension is put on the end belts because the locking piece will slide to the left , as shown in fig4 pressing the lengths of end belt 15 against the back rim of the central hole preventing them from sliding . when the two sections of harness 10 have been tightened down on mattress 13 , the belt and loop segments provide numerous handholds about its periphery which can be securely gripped for turning or carrying the mattress , as shown in fig2 . in addition , the harness extends completely around the mattress so that tension placed at one point on the harness will be widely distributed . the complete support given the mattress will also make it easier to control during turning or carrying . while harness 10 was developed with mattresses in mind , it is also contemplated that it could prove useful in moving other bulky objects , one example of which would be box springs .

US-62142284-A

a shoe insole includes a magnetized insole body formed of a mixture including rubber and magnetic poweder , the body having a first and second generally flat surface , and reinforcing sheets juxtaposed to each of the first and second surfaes . the insole has projections projecting from at least one of the surfaces , the projections being formed integrally with the body , and at least one of the sheets having projecting sheet portions projecting into such projections .

the present invention relates to an inner sole used for inserting into shoes , more specifically , it relates to a shoe insole as a health instrument for promoting health by applying a line of magnetic force and a biasing stimulus to the sole of a foot . conventionally , a shoe insole , as shown in fig6 includes a rubber sheet 22 having a plurality of projections 21 fixed to the plantar arch of a leather insole body 20 . the rubber sheet 22 is formed by laying permanent magnet grains in each projection 21 , and its periphery is inserted into a groove 23 provided in the insole body 20 so as to be fixed integrally . however , in the case of such insole , since the magnetized portion is present only partly in the insole 20 , a line of magnetic force can not be applied entirely throughout the sole , thus it is difficult to obtain an effective magnetic treatment . also , since the rubber sheet 22 is not strong physically , when the bending stress or the like has occurred in use , considerable difficulty was encountered as regards durability such as becoming unusable by cracks and tears produced on the rubber sheet 22 . in order to solve these problems , the inventor has developed a construction of an insole which includes pressing and magnetizing a mixture of rubber and magnetic powder , and laying a reinforcing sheet material within the center of the insole body . according to the construction , the line of magnetic force can be applied entirely throughout the sole , and tears of the insole due to bending stress can be prevented , thus improving the durability thereof . however , in such improvement as mentioned above , though the reinforcing sheet material functions effectively to prevent tears and cracks of the insole , cracks occurring on its surfaces can be hardly prevented and a sufficient physical strength is difficult to obtain . besides , when the projections are projected integrally on the surfaces of the insole , cracks occurring on the base portion of the projection will cause it to come off , consequently the treatment effect by the biasing stimulus will be reduced considerably . it is an object of the present invention to provide a shoe insole which has solved the above problems by devising a method of laying the reinforcing sheet material into the insole body . a shoe insole according to the present invention comprises an insole body which is formed by pressing and magnetizing a mixture of rubber and magnetic powder and which is provided with projections projected integrally thereon . in the shoe insole according to the present invention , two sheets of reinforcing material which are in conformity with the shape of the insole body , are laid within the insole body and each reinforcing sheet material is positioned along the vicinity of its surfaces . according to the present invention , since the insole body is magnetized entirely , a line of magnetic force can be applied to the entire sole of a foot , thus the magnetic treatment effect can be improved . also , since the two sheets of reinforcing material are laid within the insole body , cracks and tears caused by bending stress can be prevented completely , improving the durability of the insole body . moreover , since the two sheets of reinforcing material are positioned along the surfaces of the insole body , the occurrence of cracks thereon can be also prevented , thus the physical strength is improved and falling of the projection caused by the cracks occurring at the base portion of the projection is prevented , so that there is no possibility of reducing the treatment effect by the biasing force . fig1 is a plan view showing a shoe insole according to one embodiment of the present invention , fig2 is a vertical sectional view of a shoe insole taken along the line a -- a of fig1 fig3 is an enlarged sectional view showing the projected portion of an insole body , fig4 is a flow sheet showing a manufacturing process of a shoe insole , fig5 is a perspective view for illustrating one process in a manufacturing process of a shoe insole , and fig1 and 2 show a shoe insole 1 according to one embodiment of the present invention , in which fig1 shows an external view of the embodiment and fig2 shows an internal structure thereof . in the shoe insole 1 shown in the drawing , a group of projections 5a , 5b which include large projections 3a , 3b and small projections 4a , 4b , are formed integrally on both surfaces ( hereinafter , for convenience &# 39 ; sake , the surface is indicated by a and the reverse side is indicated by b of the thin liner body 2 having a shape of the sole of a foot , and a plurality of air holes 6 ( shown by a + in fig1 ) are formed through the entire surface of the insole body 2 . a group of projections 5a , 5b on each surface are selectively used at the user &# 39 ; s option and when the insole 1 is inserted into the shoes , the projections on one side touch the sole of a foot to function for treatment , and those on the other side touch the sole of a shoe to form air paths between the insole body 2 . in order to apply various different biasing stimuli to the human body , the large and small projections 3a and 4a of projection group 5a are formed into the sharp cone - shaped tips , and the large projections 3b and small projections 4b of the other projection group 5b are formed into the flat and round cone - shaped tips . the large projections 3a , 3b among each projection are arranged respectively in a large number at the plantar arch p , four at the finger joints q and one at the heel r , and the small projections 4a , 4b are arranged entirely on the other portions uniformly . the insole body 2 is , as shown in fig3 constructed such that two sheets of flexible reinforcing material 8 , 9 are laid within a rubber magnet plate 7 , whose entire surfaces are formed with a protective coat 10 with a polyurethane coating and the like . the rubber magnet plate 7 mentioned above is formed of a mixture of synthetic rubber such as nbr rubber ( nitrobutadiene rubber ) and a magnetic powder such as ferrite as a main raw material , and n - pole and s - pole are magnetized respectively on the a side and b side , with a flux density of about 400 to 600 gauss at each projection . each sheet of reinforcing material 8 , 9 is shaped to conform with the shape of the insole body 2 and consists of a cotton or nylon fabric . one reinforcing sheet material 8 is positioned along the vicinity of the surface a and the other reinforcing sheet material 9 is positioned along the vicinity of the reverse side b of the insole body 2 , and each one is projected into the thick portion of the projection at each position of the large projections 3a , 3b and the small projections 4a , 4b . fig4 specifically shows a method of manufacturing the aforementioned insole body 2 . the first process 1 is for preparing raw materials of the rubber magnet plate 7 , whereby synthetic rubber such as nbr rubber and a ferrite powder are mixed at the rate of 1 : 15 by weight , and to the mixture there is added with a cross - linking agent , zinc oxide , sulphur , curing agent , softener ( e . g . dop -- dioctyl phthalate ), etc . and kneaded . the following process step 2 is for forming the rubber magnet plate 7 , whereby the raw materials prepared are compressed by a roller and formed into a plate having a uniform thickness , then cut into the prescribed size . in the next process step 3 , as shown in fig5 the two sheets of reinforcing material 8 , 9 are positioned to face each other and the rubber magnet plates 7 , 7 , are clamped and are all pressed together with a hot plate mold for a fixed time while heated . the temperature at this time is , for example , around 135 ° c . and the pressing time is 3 to 4 minutes . in the heating and pressing process step , the projections 5a , 5b are formed on the both surfaces and each reinforcing sheet material 8 , 9 is laid in the vicinity of both surfaces within the rubber magnet plate 7 . besides , at each position of the large projections 3a , 3b and the small projections 4a , 4b , each reinforcing sheet material 8 , 9 enters into the thick portion of the projection and functions effectively to reinforce the projection . in the case of this embodiment , a nylon fiber consisting of polycapramide ( structural formula : [ nh ( ch 2 ) 5 co ] n ) and treated with an adhesion treating agent comprising a mixture of condensation polymer of resorcinol - formaldehyde , copolymer of butadiene - styrene vinyl - pyridine and copolymer of butadiene styrene is used as the reinforcing sheet material 8 , 9 , and when it is heated and pressed together with the rubber magnet plate 7 , the adhesion treating agent is fused to bond the reinforcing sheet material 8 , 9 with the rubber magnet plate 7 rigidly in one body . in the following process step 4 , extracting the formed body and drilling the air holes 6 therein are conducted simultaneously to complete the external shape of the insole body 2 , which is , in the process step 5 , coated with an elastic polyurethane 2 liquid resin coating entirely on both surfaces , thereby forming the protective coat 10 having a superb wear - resistance . in the next process 6 , the entire insole body 2 is treated for magnetization , whereby an n - pole is magnetized on the surface a and an s - pole is magnetized on the reverse side b . in the case of this embodiment , by the magnetization in the process a flux density of 550 gauss is given to the large projections 3a , 3b , 400 gauss at the small projections 4a , 4b and 180 gauss at the other plane portions . in the last process step 7 , other treatments are conducted to complete the product . in the embodiment mentioned hereinbefore , though two sheets of reinforcing material 8 , 9 are laid at the prescribed positions within the rubber magnet plate 7 , it will be appreciated that an additional reinforcing sheet material may be inserted , for example , between the reinforcing sheet materials 8 , 9 when necessary . in using the shoe insole 1 , when it is inserted into a shoe with the reverse side b facing the sole of the shoe , since air paths are formed between the sole of the shoe and the insole 1 by the group of projections 5b , in cooperation with the air holes 6 , evaporation of sweating is accelerated , functioning effectively to prevent stuffiness . when placing a foot on the insole 1 , the group of projections 5a on the surface side a contact the sole of the foot and a strong biasing stimulus is applied entirely on the sole by each of large and small projections 3a , 4a , and at the same time , a line of magnetic force from the rubber magnet plate 7 functions effectively . when an excessive biasing force is applied , the insole 1 can be reversed to select the slighter one by the projection group 5b on the reverse side b . when bending stress occurs on the insole 1 while wearing or taking off shoes or walking , since two sheets of reinforcing material 8 , 9 are laid within the insole body 2 , cracks and tears due to the bending stress may be prevented completely . besides , since the two sheets of reinforcing material 8 , 9 are positioned along the surface side a and reverse side b of the insole body 2 , and in addition , each of the reinforcing sheet material 8 , 9 is bonded rigidly with the rubber magnet plate 7 by the bonding force of an adhesion treating agent , the occurence of cracks occurred on both surfaces of the insole body 2 can be also prevented completely . in particular , the cracks can hardly occur at the base portions of the large projections 3a , 3b and the small projections 4a , 4b , which are prevented from coming off in use , besides , since each reinforcing sheet material 8 , 9 is inserted into the thick portion of each projection , preventive function against the falling of the projections may be greatly accelerated . furthermore , both surfaces of the insole body 2 are coated entirely with the protective coat 10 , so that a high wear - resistance with the physical strength which is sufficiently endurable to ordinary use can be obtained .

US-15036887-A

a method and apparatus for delivering a truncated damped sinusoidal external defibrillation waveform which , when applied through a plurality of electrodes positioned on a patient &# 39 ; s torso will produce a desired response in the patient &# 39 ; s cardiac cell membranes is provided . the external defibrillator is utilized for applying a damped sinusoidal waveform having a first waveform phase and a second waveform phase to a pair of electrodes . the external defibrillator has a first capacitive component , a first inductive component , a first truncating switch , and waveform control circuitry . the waveform control circuitry of the defibrillator controls the first and second truncating switches such that the duration of the second phase waveform delivered by the second charge storage component is greater than the duration of the first phase waveform delivered by the first charge storage component .

the present invention provides a method and apparatus for determining an optimal transchest external defibrillation waveform which , when applied through a plurality of electrodes positioned on a patient &# 39 ; s torso will provide a desired response in the patient &# 39 ; s cardiac cell membrane . the apparatus of the present invention is an automated external defibrillator ( aed ) illustrated in fig1 a and 1b . fig1 a illustrates an aed 10 , including a plastic case 12 with a carrying handle 14 . a lid 16 is provided which covers an electrode compartment 18 . an electrode connector 20 , a speaker 22 and a diagnostic panel ( not shown ) are located on case 12 within electrode compartment 18 . fig1 b illustrates aed 10 having a pair of electrodes 24 connected thereto . electrodes 24 can be pre - connected to connector 20 and stored in compartment 18 . the operation of aed 10 is described briefly below . a rescue mode of aed 10 is initiated when lid 16 is opened to access electrodes 24 . the opening of lid 16 is detected by aed 10 to effectively turn on the device . aed 10 then quickly runs a short test routine . after electrodes 24 have been placed on the patient , aed 10 senses patient specific parameters , such as the impedance of the patient . the patient specific parameters are then utilized in the design of optimal waveforms as will be described below . if a shockable condition is detected through electrodes 24 , a plurality of capacitors inside of aed 10 are charged from an energy source , typically a detachable battery pack . based upon the patient specific parameters sensed , the duration and other characteristics of a discharge waveform are then calculated . the energy stored in aed 10 is then discharged to the patient through electrodes 24 . for a more detailed description of the physical structure of aed 10 or the process involved in sensing , charging , shocking and testing , reference should be made to applicants co - pending application ser . no . 08 / 512 , 441 , filed aug . 8 , 1995 entitled automated external defibrillator with self - test system which is assigned to the assignee of the present invention , the disclosure of which is herein incorporated by reference . in the present invention it is not assumed that both phases of a biphasic waveform are delivered using the same set of capacitors or that both phases of a biphasic waveform are delivered using the capacitor set in the same electrical configuration , although such an embodiment is considered within the spirit and scope of the present invention . transthoracic defibrillation is generally performed by placing electrodes on the apex and anterior positions of the chest wall . with this electrode arrangement , nearly all current passing through the heart is conducted by the lungs and the equipotential surfaces pass through the myocardium normal to the electrode axis . the present invention uses the transthoracic charge burping model to develop design equations that describe the time course of a cell &# 39 ; s membrane potential during a transthoracic biphasic shock pulse . these equations are then used to create equations that describe the design of monophasic and biphasic shock pulses for transchest defibrillation to optimize the design of φ 1 for defibrillating and the design of φ 2 for stabilizing . these optimizing shock pulse design equations are called design rules . according to the present invention , the main series pathway for current is to pass through the chest wall , the lungs , and the heart . additionally , there are two important shunting pathways in parallel with the current pathway through the heart . these shunting pathways must be taken into consideration . the lungs shunt current around the heart through a parallel pathway . the second shunting pathway is provided by the thoracic cage . the resistivity of the thoracic cage and the skeletal muscle structure is low when compared to lungs . the high resistivity of the lungs and the shunting pathways are characterizing elements of external defibrillation that distinguish the art from intracardiac defibrillation and implantable defibrillation technologies . therefore , in the transthoracic defibrillation model of the present invention illustrated in fig4 there are several resistances in addition to those discussed for the charge burping model above . r s represents the resistance of the defibrillation system , including the resistance of the defibrillation electrodes . r cw and r ls represent the resistances of the chest wall and the lungs , respectively , in series with resistance of the heart , r h . r tc and r lp represent the resistances of the thoracic cage and the lungs , respectively , in parallel with the resistance of the heart . the design rules for external defibrillation waveforms are determined in three steps . in the first step , the transchest forcing function is determined . the transchest forcing function is the name that is given to the voltage that is applied across each cardiac cell during an external defibrillation shock . in the second step , the design equations for φ 1 of a shock pulse are determined . the design equations are the equations describing the cell &# 39 ; s response to the φ 1 transchest forcing function , the equation describing the optimal φ 1 pulse duration , and the equation describing the optimal φ 1 capacitor . therefore , step two relates the cell response to the action of a monophasic shock pulse or the first phase of a biphasic shock pulse . this relation is used to determine the optimal design rules and thereby design parameters for the implementation of this phase in an external defibrillator . it will be clear to those in the art that step two is not restricted to capacitor discharge shock pulses and their associated transchest forcing function . another common implementation of an external defibrillator incorporates a damped sine wave for a shock pulse and can be either a monophasic or biphasic waveform . this type of external defibrillator is modeled by the circuit shown in fig5 . in the third step , the design equations for φ 2 of a shock pulse are determined . the design equations are the equations describing the cell &# 39 ; s response to the φ 2 transchest forcing function , the equation describing the optimal φ 2 pulse duration and the equation describing the optimal φ 2 capacitor . these design equations are employed to determine the optimal design rules and thereby design parameters of φ 2 of a biphasic shock pulse with respect to how the cell responds to the shock pulse . an important element of this invention is to provide shock pulse waveforms that are designed from a cardiac cell response model developed from first principles and that correctly determines the effects of the chest and its components on the ability of a shock pulse to defibrillate . the transchest forcing function is determined by solving for the voltage found at node v 3 in fig4 . the transchest forcing function is derived by solving for v 3 using the following three nodal equations : ## equ1 ## equation 1 can be rewritten as ## equ2 ## rewriting equation 2 , we have ## equ3 ## by substituting equation 4b for v 1 into equation 4c , we can solve for v 2 as an expression of v s and v 3 : ## equ4 ## now solving for v 3 as an expression of v s and v m , equation 3 may be rearranged as ## equ5 ## so that ## equ6 ## substituting equation 5 for v 2 into equation 7 , we can solve for v 3 as an expression of v s and v m : ## equ7 ## from equation 8 we define ω m to be : ## equ8 ## from equation 8 we also define ω s to be : ## equ9 ## is the general transchest transfer function as shown in fig4 or fig5 a and 5b . equation 14 incapsulates the transchest elements and their association between the forcing function v s ( which models a defibrillation circuit and the shock pulse ) and the cell membrane voltage v m . therefore , this completes the first step . the variable v s may now be replaced with a more specific description of the defibrillation circuitry that implements a shock pulse . for a first example , a monophasic time - truncated , capacitive - discharge circuit may be represented by v s = v 1 e - t / τ . sbsp . 1 , where v 1 is the leading - edge voltage for the shock pulse and τ 1 = rc 1 , with r determined below . as shown in fig5 a and 5b , a second example would be a monophasic damped sine wave circuit , represented by ## equ10 ## where v 1 is the voltage on the charged capacitor c 1 , τ c1 = rc 1 and τ l1 = l 1 / r . every step illustrated below may be performed with this and other similar transchest forcing functions which represent defibrillator circuitry . to proceed with step two , from fig4 nodal analysis provides an equation for v m : ## equ11 ## rearranging equation 15 , we have ## equ12 ## next , substituting equation 14 as an expression for v 3 into equation 16 , the cell membrane response is now calculated as follows : ## equ13 ## dividing through by c m , and setting τ m = r m c m , then equation 18 becomes ## equ14 ## equation 19 is a general ordinary differential equation ( ode ) that models the effects of any general forcing function v s that represents a phase of a shock pulse waveform applied across the chest . the general ode equation 19 models the effects of a general shock pulse phase v s on the myocardium , determining cardiac cell response to such a shock pulse phase . c 1 equals the capacitance of the first capacitor bank and v s = v 1 e - t / τ . sbsp . 1 ; c 2 equals the capacitance of the second capacitor bank and v s = v 2 e - t / τ . sbsp . 2 ; r = r s + r b , where r s = system impedance ( device and electrodes ); r b = body impedance ( thoracic cage , chest wall , lungs ( series , parallel ), heart ). to determine body impedance , r b , we see that the series combination of r h and r ls yields r h + r ls . ( fig4 ). the parallel combination of r h + r ls and r lp yields : ## equ15 ## the series combination of equation 20 and r cw yields : ## equ16 ## the parallel combination of equation 21 and r tc yields : ## equ17 ## where r b is the impedance of the body for this model . the discharge of a single capacitor is modeled by v s = v 1 e - t / τ . sbsp . 1 for an initial c 1 capacitor voltage of v 1 . placing v s into equation 19 gives : ## equ18 ## where τ m = r m c m represents the time constant of the myocardial cell in the circuit model , and τ 1 , which equals r s c 1 , represents the time constant of φ 1 . such a standard linear ode as equation 23 has the form ## equ19 ## these linear odes have an integration factor that equals e . sup .∫ pdx . the general solution to such equations is : the ode in equation 23 models the effects of each phase of a time - truncated , capacitor - discharged shock pulse waveform . equation 23 is a first - order linear ode , and may be solved using the method of integration factors , to get : ## equ20 ## equation 24 is an expression of cell membrane potential during φ 1 of a shock pulse . to determine the constant of integration k , the initial value of v m1 is assumed to be v m1 ( 0 )= v g (&# 34 ; cell ground &# 34 ;). applying this initial condition to equation 24 , k is found to be ## equ21 ## assuming τ 1 = rc 1 , where r = r s + r b , then the solution to the initial - value problem for φ 1 is : ## equ22 ## equation 26 describes the residual voltage found on a cell at the end of φ 1 . assuming v g = 0 and v 1 = 1 , the solution for cell response to an external shock pulse is ## equ23 ## we may now determine optimal durations for φ 1 according to criteria for desired cell response . one such design role or criterion is that the φ 1 duration is equal to the time required for the external defibrillator shock pulse to bring the cell response to its maximum possible level . to determine this duration , equation 27 is differentiated and the resulting equation 27b is set to zero . equation 27b is then solved for the time t , which represents shock pulse duration required to maximize cardiac cell response . ## equ24 ## solving for t , the optimal duration dφ 1 for a monophasic shock pulse or φ 1 of a biphasic shock pulse is found to be ## equ25 ## where &# 34 ; ln &# 34 ; represents the logarithm to the base e , the natural logarithm . for φ 2 , an analysis almost identical to equations 20 through 27 above is derived . the differences are two - fold . first , a biphasic waveform reverses the flow of current through the myocardium during φ 2 . reversing the flow of current in the circuit model changes the sign on the current . the sign changes on the right hand side of equation 23 . the second difference is the step taken to incorporate an independent φ 2 into the charge burping model . therefore , the φ 2 ode incorporates the c 2 capacitor set and their associated leading - edge voltage , v 2 , for the φ 2 portion of the pulse . then τ 2 represents the φ 2 time constant ; τ 2 = rc 2 , and v s =- v 2 e - t / τ . sbsp . 2 . equation 23 now becomes : ## equ26 ## equation 29 is again a first - order linear ode . in a similar manner , its general solution is determined to be : ## equ27 ## to determine the constant of integration k , the value of v m2 at the end of φ 1 is where d . sub . φ1 is the overall time of discharge for φ 1 and v . sub . φ1 is the voltage left on the cell at the end of φ 1 . applying the initial condition to equation 30 and solving for k : ## equ28 ## the solution to the initial - value problem for φ 2 is ## equ29 ## equation 33 provides a means to calculate the residual membrane potential at the end of φ 2 for the cells that were not stimulated by φ 1 . setting equation 33 equal to zero , we solve for t , thereby determining the duration of φ 2 , denoted dφ 2 , such that v m2 ( dφ 2 )= 0 . by designing φ 2 with a duration dφ 2 , the biphasic shock pulse removes the residual change placed on a cell by φ 1 . we determine dφ 2 to be : ## equ30 ## from the equations above , an optimal monophasic or biphasic defibrillation waveform may be calculated for an external defibrillator . as an example , an external defibrillator may be designed as set forth below . assume a monophasic truncated exponential shock pulse , a 200 μf capacitor , so that τ 1 = r ·( 200 μf ). suppose also that the external defibrillator is designed to apply the maximal cardiac cell response design rule ( equation 27c ) to determine the duration of the discharge . suppose further that the human cardiac cell time constant is estimated to be 3 ± 1 ms . further assume that the external defibrillator energy source comprises five 1000 μf capacitors in series to implement a 200 μf capacitor bank . if each capacitor is charged to 400v , for a total of 2000v for the leading - edge voltage , this represents 400 j of stored energy . the transchest elements are estimated at : 82 % current through the thoracic cage ; 14 % through the chest wall and lungs in parallel ; and 4 % of applied current through the lung in series with the heart . then the membrane resistance coefficient ω m = 5 . 9 , and the system resistance coefficient ω s = 2 . 3 then the table below illustrates the application of the design rule as the overall chest resistance ranges from 25ω to ______________________________________r ( ω ) τ . sub . 1 d ( φ . sub . 1 ) v . sub . final e . sub . delivered______________________________________25 5 . 2 5 . 05 757 34350 10 . 2 6 . 90 1017 29775 15 . 2 8 . 15 1170 263100 20 . 2 9 . 10 1275 238125 25 . 2 9 . 90 1350 216150 30 . 2 10 . 55 1410 201175 35 . 2 11 . 15 1457 186200 40 . 2 11 . 65 1497 176______________________________________ it should be noted and understood that the design of φ 2 is independent from φ 1 . to design φ 2 , the only information necessary from φ 1 is where the cell response was left when φ 1 was truncated . additionally , φ 2 need not use the same or similar circuitry to that used for φ 1 . for example , φ 2 may use a model as illustrated in fig5 b where φ 1 may use the model illustrated in fig5 a or vice versa . from equations 27 , 27c , 33 , and 34 above it is evident that the characteristics of the cell membrane responses are functionally related to the defibrillator time constants τ 1 and τ 2 , and to the time constant of the cell membrane τ m . time constants τ 1 and τ 2 are established by the capacitance of the capacitors c 1 and c 1 and the electrode system resistance r s . it has been determined that efficacious and relatively low energy biphasic external defibrillation pulses can be generated from relatively low capacitance capacitors if the phase - duration ratio ( d . sub . φ2 / d . sub . φ1 ) is optimized to meet certain criteria described below . fig6 a is a graph of experimentally derived intra cardiac defibrillation thresholds ( dfts ) as a function of biphasic defibrillation pulse phase - duration ratios for pulses generated from both 140 μf and 40 μf capacitors . the defibrillation threshold is statistically computed from the experimental data and is the defibrillation pulse energy at a 50 % effective defibrillation dose . it is evident from fig6 a that , with phase - duration ratios greater than one , efficacious biphasic defibrillation pulses having relatively low energy levels can be generated from 40 μf capacitors . in comparison , similar biphasic defibrillation pulses having these phase - duration ratios and generated from 140 μf capacitors required relatively high energy levels to achieve the same efficacy . fig6 b is a graph of experimentally derived intra cardiac defibrillation thresholds as a function of total pulse duration ( i . e ., both phases one and two ) for pulses generated from both the 140 μf and 40 μf capacitors . from this figure it is evident that at the lowest defibrillation thresholds , the durations of biphasic defibrillation waveforms produced by both the 140 μf and 40 μf capacitors are similar . however , the intra cardiac biphasic defibrillation waveforms generated by the 140 μf capacitor with the shorter total durations and small phase duration ratios have higher thresholds . further , the intra cardiac biphasic defibrillation waveforms generated by the 140 μf capacitor with the longer total durations and larger phase duration ratios have the highest defibrillation thresholds . fig7 is a graph of optimal first and second phase pulse component durations ( d . sub . φ1 and d . sub . φ2 ) and the optimal phase - duration ratio ( d . sub . φ2 / d . sub . φ1 ) as a function of both the capacitance of the capacitor used to generate the pulse component and the defibrillator time constant . the capacitance values on the graph are scaled to the pulse component durations and phase - duration ratios on the basis of a 50ω defibrillator - patient resistance . the total duration of the defibrillation pulse is the sum of the first and second phase pulse components . from the information represented in fig6 a , 6b and 7 , it has been determined that for a given pulse generation capacitor such as c 1 and c 2 having relatively small values ( i . e ., less than about 100 μf ) and where τ 1 and τ 2 are less than τ m , preferred biphasic external defibrillation waveforms will have a phase - duration ration ( d . sub . φ2 / d . sub . φ1 ) greater than one . particularly efficacious external defibrillation waveforms meeting these requirements will be provided most preferably from pulse generation capacitors of less than about 60 μf . for the higher resistance patient the pulse generation capacitors may be less than 40 μf . furthermore , particularly efficacious external defibrillation waveforms meeting these requirements will have a phase - duration ratio ( d . sub . φ2 / d . sub . φ1 )≧ 1 . 5 . the table below illustrates capacitor values for a range of resistance values . ______________________________________ r ( ω ) cap ( μf ) ______________________________________ 50 72 60 60 70 50 80 45 90 40 100 36 110 32 120 30 130 28 140 26 150 24______________________________________ each row entry represents the point marked * in fig7 for a fixed resistance value , and as determined from equations 27 , 27c , 33 and 34 . more than 90 % of external defibrillation shocks are applied across a patent load from 60ω to 90ω , and thereby demonstrating that pulse generation capacitors of less than about 60 μf are optimally suited for external defibrillation . although the present invention has been described with reference to preferred embodiments , worked skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the present invention .

US-83271097-A