Datasets:

tharindu

/

patents

like 0

a method of manufacturing a protein - containing food product by means of heat - treating a protein and water - containing carrier material suitable for pumping in a turboreactor which has a cylindrical reaction chamber with a rotor equipped with blades in order to centrifuge the carrier material in the form of a dynamic , turbulent layer against an inner wall of said reaction chamber , heat - treating , drying to aw less than 0 . 6 and granulating the carrier material , advancing the carrier material in the direction of an outlet from the turboreactor , and forming individual food products from the carrier material ; a protein - containing food product made by press molding of a carrier material that has been granulated and dried to an aw value of less than 0 . 6 and that is microbiologically stable , the carrier material being free of gelantized starch .

fig1 shows a schematic diagram of a process according to the invention in the form of a flow chart , indicating the device components used . at the starting point of the manufacturing process , a carrier material 1 suitable for pumping is produced , which consists virtually exclusively of protein , water and optionally fat . the protein portion of the carrier material 1 can consist of meat , fish , other animal protein or also of protein produced by bacteria or micro - organisms . the proportion of water in the carrier material ( total water content , free and bound water ) is less than 70 % as a rule . the carrier material may contain antioxidants in addition . meat as such can be used as a carrier material , i . e . without prior pressing off of fat , which is usual and necessary in other drying methods . by use of meat as such , it is possible to obtain dried meat out of the turboreactor ( described below ), and not just a meat product having a reduced fat content or otherwise changed composition ( apart from water content ). advanced by a pump ( not shown ), the carrier material 1 passes through a metering station ( throughput measuring unit ) 2 into a turboreactor 4 of the type known from u . s . pat . no . 3 , 527 , 606 , for example , the structure and functioning of which is explained below in connection with fig5 . in the turboreactor 4 , the carrier material is centrifuged against the inner wall of the turboreactor and forms a thin , highly dynamic , turbulent fluid layer , whose dwell time in the turboreactor is adjusted to about 3 minutes at about 90 ° c . pasteurisation or essential reduction of germs takes place in the turboreactor at the same time as drying . the heat - treated carrier material has a total water content of about 40 % at the outlet from the turboreactor 4 . in order to explain the turboreactor 4 , reference should first be made to fig5 . the turboreactor essentially consists of a cylindrical , double - walled housing 6 , which forms a heating or cooling jacket 7 . inside the housing 6 a rotor 12 is rotatably mounted on end walls 8 , 10 , said rotor 12 having a plurality of blades 14 which are disposed to project radially from the rotor 12 . the blades end at a radial distance s , e . g . 5 mm , from an inner wall 16 of the housing 6 and are adjusted , taking into account the direction of rotation ( arrow 18 ) of the rotor , such that they generate a conveying effect in a predetermined direction , in the direction of the end wall 10 in the present case . the double casing 7 of the housing 6 can be subdivided in an axial direction ( longitudinal axis 20 ) into a number of chambers separated from one another in order to make different levels of heating or cooling possible from one section to the next . the turboreactor 4 is normally arranged such that its longitudinal axis 20 is horizontal , though it may also be arranged on a slight incline in order to support the flow of material within the turboreactor by the effect of gravity . a product delivery point 22 and a gas delivery point 24 are provided in the ( first ) end wall 8 , while a product removal point 26 and a gas removal point 28 are disposed in the ( second ) end wall 10 . with a length 1 of about 3 m and an internal diameter d of about 35 cm , the turboreactor 4 can be operated at a speed of 750 revolutions per minute , for example . the turboreactor can be fed continuously with a flow of material of , for example , 80 kg / h carrier material , with the temperature of the double casing of the housing being maintained at 125 ° c . in order to achieve a product temperature of about 90 ° c . since the turboreactor is operated at ambient pressure , the product is heated at most during short periods to temperatures near or above 100 ° c ., due to its water content and the cooling effect by evaporation / vaporisation . because of the high speed of rotation , the carrier material is centrifuged against the inner wall 16 in a highly dynamic , turbulent layer with an average thickness h of a few millimetres , e . g . 10 mm , in the course of which there is an intensive transfer of heat in the turbulent layer of material from or to the inner wall 16 . via the gas delivery point 24 , air , an inert gas or a gas triggering a reaction may be delivered , especially in order to remove water vapour from the turboreactor and , in this way , to contribute to drying the carrier material . making reference once again to fig1 , the heat - treated and partially dried carrier material 1 reaches a drying turboreactor 30 downstream which in principle has a structure identical to that of the turboreactor 4 and which the carrier material leaves as a substantially dried meat or protein with a total water content of less than 10 %. the carrier material , which might still be sticky because of its fat content , is cooled in a cooler 32 and now has a granulate or particulate , pourable consistency , in which it is poured into storage containers 34 a , 34 b , 34 c for the appropriate types ( beef , lamb , fish . . . ) and from which it can readily be metered . contrary to extrudated , dried material , the carrier material exiting the turboreactor is therefore not lumpy , but has a pourable , virtually ground consistency which facilitates further processing . the total germ concentration can be reduced by treatment in the turboreactor by a factor of 10 3 , 10 4 and even 10 5 and more , e . g . from 10 8 germs / g at the metering station to 10 3 germs / g after the drying turboreactor , dependent on temperatures and degree of drying . an aw value of 0 . 6 or less stops any growth of microorganisms that are relevant for perishableness , so that the carrier material can be considered microbiologically stable and non - perishable . one or more other storage container ( s ) 34 d contain ( s ) prebiotic substances , which in the present connection should be understood to mean substances that have a favourable effect on the life or growth of the probiotic micro - organisms , e . g . substances that can be absorbed or processed in some other way by the probiotic micro - organisms , so that their numbers increase and / or their vitality is improved , and also further additives such as vegetable fibers . the granulated , pourable carrier material for one or more desired types from one or more of the storage containers 34 a to d is passed via a metering station 40 to a mixer 38 , where it is mixed with other substances , namely first with probiotic micro - organisms which are added in doses via a mixer 42 and a pump 44 . the probiotic micro - organisms may be encapsulated in a suitable matrix and optionally premixed in the mixer 42 with the addition of oil before being added to the mixer 38 . further additives are a binder , which is delivered from a storage container 34 e via a metering station 46 , this preferably being a starch - free binder . fat may be added via a metering station 48 . from other storage containers 34 f , g , h , minerals , vitamins , other trace elements and optionally further probiotic micro - organisms can be added via a metering station 50 . after being gently but thoroughly mixed in the mixer 38 , the carrier material provided with all the desired additives is placed in a storage container 52 , from which it is delivered via a metering station 54 to a mould press 56 which presses the material into a desired final shape , e . g . into small , compact bite - sized food pellets . it may be either a foodstuff for human consumption , or equally an animal feed , e . g . for pets or breeding animals . fish feed may also be manufactured in this way , and in this case an increased fat content is often desired , which can be achieved by adding appropriate quantities . fig2 illustrates a supplement to the schematic diagram of fig1 , where , in addition to the ingredients already referred to , chunky additives are mixed with the carrier material , namely in particular dried vegetables , cereals , vegetable fibers and other granulated additives , these in particular being extruded and expanded additives which are delivered via a metering station 60 and a dry extruder 62 after passing through a cooler 64 to further storage containers 70 a , b , c and d , from which they are added via a metering station 72 to the mixture 38 . the additives may be dyed with a variety of dyes 74 a , b , c , d , so that the finished product has a correspondingly multi - colored appearance . the advantage of mixing in the additives mentioned is that it is possible to adjust the texture and taste and , moreover , if expanded additives are used , the density of the finished food product . fig3 shows a variant of the schematic diagram of fig1 , where the mixture of probiotic micro - organisms , prebiotic substances and oil provided in the mixer 42 is not delivered directly to the carrier material in the mixer 38 , but is co - extruded with the carrier material and is present within the finished food product unmixed , in addition to the carrier material . it goes without saying that mixed forms of the two process variants are conceivable , i . e . part of the prebiotic or probiotic substances can be added to the carrier material in the mixer 38 and another part can be co - extruded . fig4 shows a schematic diagram which corresponds substantially to a combination of fig2 and 3 and in which the optionally dyed and expanded additives are added to the carrier material , which is subsequently co - extruded with at least part of the total amount of prebiotic or probiotic substances to be added . in each of the process variants described in accordance with fig1 to 4 , it is possible , in addition or as an alternative to mixing the prebiotic or probiotic substances with the carrier material ( mixer 38 ), for the latter to be sprayed or coated on in a suitably sprayable or coatable form at an appropriate point in the course of the process , which may be done either already in the mixer 38 or only after shaped or form - pressed food pellets have been manufactured . with regard to the food product of the invention , it may be mentioned in addition that the latter is not restricted to the method of manufacturing by processing the protein - containing carrier material in a turboreactor , but that any suitable protein - containing carrier material being micro - biologically stabilized and dried to a sufficiently low water content or a w level , in particular meat material , could be placed into the storage containers 34 a , b , c as the starting material and further processed accordingly . one major advantage in connection with manufacturing or processing the carrier material in the turboreactor is the higher product quality ( nutritional value , taste , digestibility , natural vitamin content , smell , micro - biological quality , non - perishability ).

US-50859405-A

according to the embodiment of the invention , a communication apparatus including : a first communication module radio communicating based on a first radio access technology ; a second communication module radio communicating based on a second radio access technology ; a first information storing module storing radio access technology information indicating at least one of the first and second radio access technologies to be used in a radio communication of the communication apparatus ; a chip storing module configured to store an information chip that stores company information with respect to a company providing a communication service ; a search module configured to read out the company information from the information chip to perform a radio wave search according to one of the first and second radio access technologies based on the company information ; and a setting module configured to set the radio access technology information in the first information storing module based on the result of the radio wave searching

a communication terminal apparatus according to an embodiment of the present invention will be hereinafter described with reference to the accompanying drawings . in the embodiment , the communication terminal apparatus is a cell phone . as shown in fig1 , the cell phone according to the embodiment is configured in such a manner that a control section 10 which is a cpu , for example , controls individual sections . the control section 10 is equipped with a radio wave search means 18 and an rat setting means 19 . and a communication processing section 20 , a voice interface section 11 , an input control section 12 , a display control section 13 , a usim ( universal subscriber identity module ) 14 , and a memory unit 16 are connected to the control section 10 . the cell phone is equipped with a power section 17 which supplies power to the individual sections after being turned on by a power switch 17 a . the communication processing section 20 is equipped with a first communication means 21 which performs a utms communication and a second communication means 22 which performs a gsm communication . and a umts antenna 23 and a gsm antenna 24 are connected to the communication processing section 20 . a speaker 25 and a microphone 26 are connected to the voice interface section 11 . as such , the voice interface section 11 outputs , to the speaker 25 , a speech signal that is supplied via the control section 10 and thereby produces a voice . on the other hand , the voice interface section 11 converts a voice that is received through the microphone 20 into a speech signal and supplies it to the control section 10 so that it will be transmitted via the communication processing section 20 . a keyboard unit ( including a case that it is embodied using a touch panel ) 27 is connected to the input control section 12 , whereby information including a text can be input . a key manipulation for turning on or off an off - line mode in which no on - line communication is performed can be made through the keyboard unit 27 . a display unit 28 such as an lcd ( liquid crystal display ) is connected to the display control section 13 under the control of the control section 10 , the display control section 13 displays information such as a text on the display unit 28 . the usim 14 is an information chip having a company information storing means which is stored with information of a company used by the subscriber of the cell phone concerned ( i . e ., information of a company of a home network ; it also serves to identify a country ). the cell phone concerned is configured in such a manner that an information chip containing information of a company used by the subscriber can be set therein . while the cell phone concerned is in use , the information chip should be set therein . the memory unit 16 is equipped with a country - by - country radio access technology information storing means 16 a and a set rat storing section 16 b . names of communication companies that provide networks and pieces of radio access technology ( rat ) information are stored in the country - by - country radio access technology information storing means 16 a so as to be correlated with respective countries in the form of a table shown in fig2 , for example . radio access technology ( rat ) information that is set in the cell phone concerned , more specifically , a umts only modes a gsm only node , or a umts / gsm dual mode , is stored in the set rat storing section 16 b . before radio access technology information is set in the set rat storing section 16 b ( set information storing means ), the radio wave search means 18 which is provided in the control section 10 performs a radio wave search according to one of a first radio access technology ( umts ) and a second radio access technology ( gsm ) on the basis of the company information that is stored in the usim 14 . the rat setting means 19 functions as a setting means for setting information of a radio access technology to be used on the basis of a search result of the radio wave search means 18 . the radio wave search means 18 and the rat setting means 19 are implemented by the control section 10 &# 39 ; s running a program that corresponds to a flowchart shown in fig3 and 4 . an rat setting process of the cell phone according to the embodiment will be described below with reference to the flowchart of fig3 and 4 . the control section 10 detects a power - on manipulation made through the power switch 17 and a manipulation of turning off the off - line mode through the keyboard unit 27 when those manipulations are made . furthermore , the control section 10 detects , via the communication processing section 20 and the antennas 23 and 24 , whether a prescribed time has elapsed since reception of radio waves from a communication company was disabled ( i . e ., the cell phone went out of its communication range ). if the control section 10 detects a power - on manipulation made through the power switch 17 , a manipulation of turning off the off - line mode through the keyboard unit 27 , or a fact that the cell phone comes into its communication range from out of the communication range , the process of the flowchart of fig3 and 4 is started . at step s 11 , the control section 10 reads the home network information ( company information ) from the usim 14 and determines a home network ( communication company name ) at step s 12 , the control section 10 determines country information ( country h ) and radio access technology ( rat ) information of country h by referring to the country - by - country radio access technology information storing means 16 a of the memory unit 16 on the basis of the home network information . at step s 13 , the control section 10 judges whether the determined radio access technology ( rat ) information indicates the first radio access technology ( umts ). if the judgment result of step s 13 is “ yes ,” at step s 14 the control section 10 performs a radio wave search according to the first radio access technology ( umts ) via the communication processing section 20 and the antenna 23 . if the judgment result of step s 13 is “ no ,” at step s 15 the control section 10 performs a radio wave search according to the second radio access technology ( gsm ) via the communication processing section 20 and the antenna 24 . in this manner , a radio wave search is performed according to only one radio access technology , whereby the search time and the power consumption are reduced . at step s 16 , it is judged whether mcc information ( country information ) was acquired from information received by the radio wave search of step s 14 or s 15 . if it is judged at step s 16 that no mcc information ( country information ) could be acquired , the control section 10 sets the umts / gsm dual mode in the set rat storing section 16 b at step s 17 and finishes the optimum rat setting process . as a result , in an intermittent receiving operation which is performed every prescribed time , the cell phone operates in the umts / gsm dual mode that is set in the set rat storing section 16 b . in an intermittent receiving operation that is performed after the execution of the optimum rat setting process , a radio wave search is performed according to both radio access technologies , that is , umts and gsm . however , the cell phone is not out of its communication range , the cell phone can perform a communication via a network that is supported by a communication company of the country concerned . on the other hand , if it is judged at step s 16 that mcc information ( country information ) was acquired , it is judged at step s 18 whether the thus - found country coincides with the country ( country h ) where the home network exists that was determined at step s 11 . if it is judged that country found at step s 16 coincides with country h , at step s 19 the control section 10 determines a radio access technology ( rat ) of country h by referring to the country - by - country radio access technology information storing means 16 a . at step s 20 , the control section 10 judges whether the thus - determined radio access technology ( rat ) accommodates both of the first radio access technology ( umts ) and the second radio access technology ( gsm ). if it is judged at step s 20 that the determined radio access technology ( rat ) does not accommodate both of the first radio access technology ( umts ) and the second radio access technology ( gsm ), at step s 21 the control section 10 sets , in the set rat storing section 16 b , the mode of the one radio access technology ( umts mode or gsm mode ) that was determined at step s 19 as being employed in country h . then , the optimum rat setting process is finished . as a result , in an intermittent receiving operation which is performed every prescribed time , the cell phone operates in the umts only mode or the gsm only mode that is set in the set rat storing section 16 b . the cell phone can perform a communication over a network that is supported by a communication company of the country concerned if it is judged at step s 20 that the determined radio access technology ( rat ) accommodates both of the first radio access technology ( umts ) and the second radio access technology ( gsm ), the control section 10 sets the umts / gsm dual mode in the set rat storing section 16 b at step s 22 and finishes the optimum rat setting process . as a result , in an intermittent receiving operation which is performed every prescribed time , the cell phone operates in the umts / gsm dual mode that is set in the set rat storing section 16 b . in an intermittent receiving operation that is performed after the execution of the optimum rat setting process , a radio wave search is performed according to both radio access technologies , that is , umts and gsm , whereby the cell phone can perform a communication over a network that is supported by a communication company of the country concerned . if it is judged at step s 18 that the country found does not coincide with the country ( country h ) where the home network exists , at step s 23 the control section 10 determines a country ( country n ) from the mcc information ( country information ) at step s 24 , the control section 10 determines a radio access technology ( rat ) of country n by referring to the country - by - country radio access technology information storing means 16 a . at step s 25 , the control section 10 judges whether the thus - determined radio access technology ( rat ) accommodates both of the first radio access technology ( umts ) and the second radio access technology ( gsm ). if it is judged at step s 25 that the determined radio access technology ( rat ) does not accommodate both of the first radio access technology ( umts ) and the second radio access technology ( gsm ), at step s 26 the control section 10 sets , in the set rat storing section 16 b , the mode of the only one radio access technology ( umts mode or gsm mode ) that was determined at step s 23 as being employed in country h . then , the optimum rat setting process is finished . as a result , in an intermittent receiving operation which is performed every prescribed time , the cell phone operates in the umts only mode or the gsm only mode that is set in the set rat storing section 16 b . the cell phone can perform a communication over a network that is supported by a communication company of the country concerned . if it is judged at step s 25 that the determined radio access technology ( rat ) accommodates both of the first radio access technology ( umts ) and the second radio access technology ( gsm ), the control section 10 sets the umts / gsm dual mode in the set rat storing section 16 b at step s 22 and finishes the optimum rat setting process . as a result , in an intermittent receiving operation which is performed every prescribed time , the cell phone operates in the umts / gsm dual mode that is set in the set rat storing section 16 b . in an intermittent receiving operation that is performed after the execution of the optimum rat setting process , a radio wave search is performed according to both radio access technologies , that is , umts and gsm , whereby the cell phone can perform a communication over a network that is supported by a communication company of the country concerned . fig5 - 8 show specific optimum rat setting operations . fig5 - 8 employ the same step symbols as used in the flowchart of fig3 and 4 . first , fig5 corresponds to a case that the name of a japanese communication company is stored in the usim 14 as a communication company that operates a home network and an optimum rat is to be set in japan . in this example , japan is found from the home network information that is stored in the usim 14 and it is detected that japan employs umts by referring to the country - by - country radio access technology information storing means 16 a . at step s 14 , a radio wave search is performed according to the first radio access technology ( umts ). at steps s 16 and s 18 , the country name “ japan ” is acquired from mcc information ( country information ) that is acquired by reception of radio waves . based on this country name , the umts only mode is set in the set rat storing section 16 b at steps s 19 - s 21 . as a result , the cell phone can perform a communication in japan . fig6 corresponds to a case that the name of a chinese communication company is stored in the usim 14 as a communication company that operates a home network and an optimum rat is to be set in china . in this example , chine is found from the home network information that is stored in the usim 14 and it is detected that chine employs gsm by referring to the country - by - country radio access technology information storing means 16 a . at step s 15 , a radio wave search is performed according to the second radio access technology ( gsm ) at steps s 16 and s 18 , the country name “ china ” is acquired from mcc information ( country information ) that is acquired by reception of radio waves . based on this country name , the gms only mode is set in the set rat storing section 16 b at steps s 19 - s 21 . as a result , the cell phone can perform a communication in china . fig7 corresponds to a case that the name of a japanese communication company is stored in the usim 14 as a communication company that operates a home network and an optimum rat is to be set in france . in this example , japan is found from the home network information that is stored in the usim 14 and it is detected that japan employs umts by referring to the country - by - country radio access technology information storing means 16 a . at step s 14 , a radio wave search is performed according to the first radio access technology ( umts ) at steps s 16 , s 18 , and s 23 , the country name “ france ” is acquired from mcc information ( country information ) that is acquired by reception of radio waves . based on this country name , it is found at steps s 24 and s 25 that france accommodates both of the first radio access technology ( umts ) and the second radio access technology ( gsm ). the umts / gms dual mode is set in the set rat storing section 16 b at step s 22 . as a result , the cell phone can perform a communication in france according to either of umts and gsm . fig8 corresponds to a case that the name of a chinese communication company is stored in the usim 14 as a communication company that operates a home network and an optimum rat is to be set in japan . in this example , chine is found from the home network information that is stored in the usim 14 and it is detected that chine employs gsm by referring to the country - by - country radio access technology information storing means 16 a . at step s 15 , on the basis of the home network information stored in the usim 14 , a radio wave search is performed according to the second radio access technology ( gsm ). it is judged at steps s 16 that no mcc information ( country information ) could be acquired , because japan employs umts and hence radio waves could not be received properly . therefore , the control section 10 moves from step s 16 to s 17 , where the umts / gms dual mode is set in the set rat storing section 16 b . as a result , the cell phone in which the chinese communication company name is stored as the home network can perform a communication in japan which employs umts . the above embodiment is directed to umts and gsm which are currently used radio access technologies . if another radio access technology is employed in the future , in the optimum rat setting process a radio wave search will be performed using only one of plural radio access technologies . instead of the dual mode ( see fig4 ), a mode is set in which all of the plural radio access technologies are used . this enables a communication . furthermore , the user may be allowed to set whether to execute the optimum rat setting process . this enables proper setting if the user knows an rat to be used . when it is detected that a country concerned employs plural radio access technologies , these candidate radio access technologies may be shown ( e . g ., displayed ) to the user so that the user can select one of those . still further , the user may be allowed to set whether to move to step s 11 shown in fig3 every prescribed cycle irrespective of whether the cell phone is within or out of its communication range , in addition to a case that one of the conditions shown in fig3 is satisfied . as described with reference to the embodiment , there is provided a communication terminal apparatus which makes it unnecessary for a user to make rat setting and can reduce the radio wave search time and the power consumption . in the communication terminal apparatus according to the embodiment , the company information stored in the company information storing means of the information chip that is set in the communication terminal apparatus is read out , a radio wave search is performed according to one of the first and second radio access technologies on the basis of the read - out company information , and information of radio access technology to be used is set on the basis of a result of the radio wave search . therefore , the user is not required to make rat setting . furthermore , a radio wave search can be performed according to one radio access technology , which makes it possible to reduce the radio wave search time and the power consumption . the communication terminal apparatus according to the embodiment further comprises the country - by - country radio access technology information storing means which is stored with pieces of radio access technology information in such a manner that they are correlated with respective countries . a country is determined using country number information that has been acquired through the radio wave search , and information of a radio access technology to be used is set on the basis of the information stored in the country - by - country radio access technology information storing means . therefore , the user is not required to make rat setting and an rat can be set properly . in the communication terminal apparatus according to the embodiment , if the radio wave search means has acquired no country number information through the radio wave search , the setting means sets information to the effect that both of the first and second radio access technologies should be used . therefore , the user is not required to make rat setting and an rat can be set properly .

US-40100409-A

provided herein are couplings useful in the transfer of liquid fuels from a remote storage reservoir to an on - board fuel tank of a motorized vehicle . there is provided a first coupling which is adapted to be in fluid communication with the interior of a vehicle &# 39 ; s fuel tank , and a second coupling which is intended to be in fluid communication with the contents of a remote fuel storage reservoir . the invention also includes a process for charging a fuel reservoir on board of a motorized vehicle from a remote reservoir , wherein the vapor in the fuel reservoir is displaced by an equal volume of fuel delivered from said remote reservoir , and wherein the vapor in said fuel reservoir is simultaneously caused to be transferred to said remote reservoir , thus permitting no escape of the vapor from said fuel reservoir to the surrounding atmosphere . through use of the present invention , spills of fuel are essentially eliminated , and the escape of vapors from the vehicle &# 39 ; s fuel tank are prevented , thus preventing atmospheric hydrocarbon pollution .

a fuel transfer coupling according to the present invention comprises an on - board portion which is in fluid contact with the gasoline tank on a motorized vehicle such as a race car , and a remote portion which is in fluid contact with a source of liquid hydrocarbon fuel that is to be delivered to the gasoline tank of the motorized vehicle . the on - board portion may be referred to as the male adapter and the remote portion of the coupling may be referred to as the female adapter , for convenience . referring to the drawings , and initially to fig1 there is shown the on - board portion of a fuel transfer coupling according to the invention in an exploded view , including all of its various components , which are described forthwith . in fig2 is shown a perspective view of the male adapter base 4 . the male adapter base 4 includes a central bore 34 through which fuel is intended to flow . the central bore 34 has a first end portion which is adapted to be connected to the inlet pipe of a fuel tank , and a second end portion which extends into said adapter base and terminates at a point within the male adapter base . disposed about the central bore 34 is a shrouding enclosure 36 which forms an envelope around the central bore portion 34 for the purpose of allowing the travel of gas or air vapor through the various holes 33 disposed in the planar top surface 40 of the male adapter base , wherein the holes 33 are in fluid contact with the outlet portion 35 of the vapor tube 20 . thus , this assembly is similar to a condenser as used in the chemical arts , which consists of a tube having a water jacket about it , with an inlet and outlet for the cooling water , and a tube disposed therethrough which the vapor to be condensed is caused to pass . in the present instance , the central bore 34 is surrounded by the shrouding enclosure 36 , which has as its “ inlet ”, the various holes 33 , and which has as its “ outlet ”, the vapor tube 20 . there is a planar flange portion 42 having a plurality of holes 44 disposed through it along its periphery for the purpose of fastening the male adapter base to other components of this portion of the coupling . the plane of the flange portion 42 is slightly below the plane of the top surface 40 , and at the point of intersection of these two features there is thus caused to exist an elevation 38 , upon which an o - ring seal may be mounted for sealing the surfaces in the finished assembly . there is a circumferential ledge 37 onto which a flow cone 58 is mounted , as is described later herein . the wall w of the bore above the circumferential ledge 37 is also shown . in fig3 is shown an overhead view of the male adapter base 4 , including the central bore 34 flange 42 , holes 44 , vapor tube 20 , holes 33 , circumferential ledge 37 , and o - ring seal 46 in its location at the elevation at 38 as shown in fig2 . fig4 shows a perspective view of the male adapter cover 2 , having an outer wall 24 , top surface 3 , and flange portion 26 , wherein the flange portion 26 includes a plurality of holes 28 disposed along its periphery for connection to the male adapter base 4 once all of the components have been properly assembled , using conventional fasteners . there is also a beveled edge 30 , which is shown in fig6 as well . fig5 shows a side elevation view of the male adapter cover 2 , including outer wall 24 and flange 26 . fig6 shows a bottom view of the male adapter cover 2 , including its flange 26 , plurality of holes 28 , annular groove 19 which extends about the hole 1 adjacent to the flange 26 and is adapted to receive the o - ring seal 46 in a sealing relationship in the completed assembly . there is also a beveled edge 30 . fig7 shows the internal housing 18 , which is reminiscent of a hollow shell having an open top portion t and an open bottom portion b , and a hollow interior space within the confines of its walls . there is a flat top surface 48 , a sloping shoulder portion 49 which includes an o - ring seal 50 , which o - ring seal 5 is disposed to seal between the sloping shoulder 49 and the beveled edge 30 from fig4 and 6 previously . there is also an o - ring seal 52 disposed along the bottom skirt portion 51 as well , for sealing the skirt portion 51 against the wall portion w of the bore in fig2 . thus , the skirt portion 51 of the internal housing 18 is slidably disposed within a circumferential slot which is defined by the wall w that is adjacent to the circumferential ledge 37 and the wall portion 64 of the flow control cone 6 when the flow control cone is in its position on the circumferential ledge 37 . the skirt portion 51 provides a travel stop against planar top surface 40 . fig8 shows a side elevation view of the internal housing 18 and depicts the locations of the top surface 48 , sloping shoulder 49 , o - ring seal 50 , skirt 51 , and o - ring seal 52 . fig9 shows a perspective view of the flow control cone 6 component . the flow control cone 6 includes a funnel - shaped cone element 58 , which is held rigidly in place in the center of an outer ring 62 ( which has a wall portion 64 ) by means of cone supports 60 which are welded or otherwise attached by known conventional means , such as integral casting , etc ., to the cone and inner portion of the wall portion 64 of the outer ring 62 . there is also a poppet guide bore 54 disposed at the apex of the cone , and a space 59 disposed between the cone 58 and the outer ring 62 . fig1 is a side elevation view of the flow control cone 6 showing the cone 58 , wall portion 64 , and the outer ring 62 . the cone supports 60 are also shown . fig1 shows a bottom view of the flow control cone 6 showing the poppet guide bore 54 , wall portion 64 , outer ring 62 , cone supports 60 , space 59 , and cone 58 . the diameter of the wall portion is slightly less than that of the internal diameter of the bottom portion b of the internal housing 18 shown in fig7 , which enables the skirt portion 51 of the internal housing to reside atop the outer ring 62 of the flow control cone 6 after the flow control cone 6 has been placed in position on the circumferential ledge 37 of fig2 . fig1 shows a perspective view of the top of the flow control cone 6 including the poppet guide bore 54 having an outer wall 56 . there is a flat portion 57 which serves as the seat for the poppet spring 8 ( fig1 ). also shown is cone 58 , cone supports 60 , outer ring 62 , and wall portion 64 . fig1 a shows a perspective view of the upper portion of the poppet 10 which includes a flat top surface 70 , and an o - ring seal 72 disposed on the upper shoulder 80 ( fig1 b ). there is a poppet stem 68 which is preferably of a tri - lobe cross - section as later shown . there is a vent disc 14 disposed in a recess in the face of the flat top surface 70 , which is held in place by retainer ring 16 , which retainer ring 16 is held in position by means of machine screws threaded through the flat top surface . the vent disc 14 in one embodiment includes a hole 15 that passes through the vent disc . the spring 12 mechanically biases the disc 14 onto its seat . according to an alternate form of the invention , the hole 15 may be disposed through the wall of the male adapter cover 2 . fig1 b is a side elevation view of the poppet 10 , showing the upper shoulder 80 of the poppet 10 , lower shoulder 81 of the poppet 10 , o - ring seal 72 , and poppet stem 68 . fig1 shows a perspective view of the underside of the poppet 10 which includes the lower shoulder 81 , flat bottom surface 83 , o - ring seal 72 , vent disc 14 having hole 15 , spring 12 , machine screw bottoms 78 , poppet stem 68 , and stem supports 69 . the spring 12 is disposed between the vent disc 14 and the poppet stem 68 so as to maintain a mechanical bias on the vent disc 14 in a direction towards the flat top surface 70 from fig1 a . fig1 shows a bottom view of the poppet 10 including the stem supports 49 , poppet stem 68 , vent disc 14 , lower shoulder 81 , and flat bottom surface 83 . the circle labeled d1 is of such a diameter as to be just slightly larger than the diameter d2 of the top portion of the cone 58 ( fig1 ) so that the skirt of the poppet 81 lines up with the top portion of the cone 58 to promote a smooth fuel flow . the poppet stem 68 is of such diameter as to form a snug fit which allows in and out motion of the poppet within the poppet guide bore 54 . fig1 shows a side view of the male adapter 700 in its final assembled form , when all of the components shown in fig1 and as previously described herein are contained within the male adapter cover 2 and the male adapter base in their proper design configuration . to assemble the male adapter 700 , one begins by placing the male adapter base 4 on a flat surface . next , the flow cone 6 is placed into position so that the outer ring 62 of the flow cone 6 rests on the circumferential ledge 37 , so that the poppet spring seat 57 is facing upwards , as shown in fig1 . next , the poppet 10 ( including the spring 12 , vent disc 14 , and retaining ring 16 ) is inserted into the internal housing 18 from the bottom b ( fig8 ) so that the o - ring seal 72 contacts the inner wall of the internal housing 18 at a location on the interior of the sloping shoulder 49 , which is a bevel 99 shown in fig7 that extends around the inner circumference of the internal housing so as to completely contact the o - ring seal 72 . next , the poppet spring 8 is placed on the spring seat 57 , and the internal housing 18 ( with poppet 10 inside it ) is then placed into position so that the skirt portion 51 rests atop the outer ring portion 62 of the flow control cone 6 , against the pressure of the poppet spring . finally , the male adapter cover 2 is placed over the internal housing and the fasteners are secured to connect the flanges on the male adapter cover 2 and the male adapter base 4 , to provide the assembled male adapter 700 as shown in fig1 . fig1 shows a top view of the assembled male adapter 700 , showing the respective positions of the vent disc 14 , vent hole 15 , retaining ring 16 , vapor tube 20 , flange 26 , flat top surface 48 of the internal housing 18 , flat top surface 70 of the poppet 10 , top surface 3 of the male adapter cover 2 ( fig4 ), and the important gap 7 between the outer perimeter of the flat top surface 48 of the internal housing 18 and the inner perimeter of the top surface 3 of the male adapter cover 2 . the gap 7 is important , as it is through this gap that air passes during a refueling operation , to allow the escape of headspace air in the fuel tank to compensate for the volume of fuel delivered during the refueling operation . as the flat top surface 70 of the poppet is depressed slightly , at first , against the pressure of the poppet spring 8 , both the poppet 10 and the internal housing 18 move into the assembly as a whole , until the skirt portion 51 has bottomed out against the face 40 of the body 4 . the movement of the internal housing 18 to its bottomed out position opens a space in the gap at 7 between the inner wall of the male adapter 2 and the internal housing 18 by releasing the contact between the o - ring seal 50 and the beveled edge 30 . this slight depressing of the flat top surface 48 of the internal housing 18 causes a fluid connection to exist between the vapor tube 20 and the gap 7 at the top portion of the assembly where the o - ring seal 50 has separated from the beveled edge 30 , through the plurality of holes 33 in the male adapter base 4 . further depressing of the flat top surface 70 of the poppet 10 opens a space s between the outer periphery of the top surface 70 of the poppet 10 and the internal wall of the internal housing 18 , as shown in fig1 , thus enabling a liquid fuel to pass through the inner volume of the internal housing , through the open space 59 in the flow control cone 6 and through the central bore 34 , which is connected to the inlet pipe on the vehicle &# 39 ; s fuel tank . the vapor tube 20 is connected to a hose which is in fluid contact with the headspace gas within the fuel tank . thus , by depressing the flat top surface 70 of the poppet 10 , a fluid communication between the headspace gas in the fuel tank and the gap at 7 is first caused , and secondly a pathway is opened to the fuel tank for fuel to flow in through central bore 34 , from a location at the top of the poppet in the closed condition . this is because the poppet spring 8 biases the poppet upwards ; however , the poppet 10 is located within the internal housing 18 but the head of the poppet has a larger diameter than the diameter of the beveled edge 99 just beneath the top surface 48 of the internal housing 18 in which it is contained , which thus also causes the internal housing 18 to be biased upwards . the internal housing 18 is held in position within the male adapter cover 2 because the diameter of the sloping shoulder 49 of the inner housing 18 is larger than that of the beveled edge 30 in the male adapter cover . this is why the male adapter assembly 700 can only be assembled as taught herein . fig1 shows the underside view of the male adapter assembly 700 when the poppet 10 is not depressed , and fig2 shows the underside view of the assembly 700 while the poppet 10 is depressed , showing the movement of the poppet stem 69 with respect to the outer wall 56 . fig2 is a top perspective view of the male adapter assembly 700 , and fig2 is a bottom view of the male adapter assembly 700 . a fuel transfer coupling according to the present invention comprises a remote portion which is in fluid contact with a source of liquid hydrocarbon fuel that is to be delivered to the gasoline tank of the motorized vehicle . the remote portion may be thought of as a female adapter owing to its being adapted to receive the male portion of the coupling already described herein . the female adapter , in one preferred form of the invention , is preferably disposed at the exit point of a fuel from a portable , remote fuel reservoir . referring to the drawings , and particularly to fig2 there is shown the remote portion of a fuel transfer coupling according to the invention in an exploded view , including all of its various components , which are described forthwith . fig2 shows a side elevation view of a female adapter base 164 according to the invention , including the top portion of the central conduit 166 t , bottom portion of the central conduit 166 b , shrouding enclosure 170 vapor tube 172 , o - ring seal 168 , and raised surface 171 . fig2 shows a perspective view of the upper portion of the female adapter base 164 according to the invention , including the raised surface 171 , shrouding enclosure 170 , outer flange 180 having a plurality of holes 182 disposed thereon , holes 174 , vapor tube 172 , top portion of the central conduit 166 t having a flat top surface 184 , o - ring seal 168 , and a retaining fastener 176 disposed in a boss 177 held centrally within the interior of the central conduit by means of a plurality of fastener boss supports 178 , which are affixed to the inner surface of the wall of the central conduit by conventional means , such as a weld . retaining fastener 176 is shown with its threads visible . fig2 shows a top view of the female adapter base 164 according to the invention , including the central conduit , raised surface 171 , holes 174 , vapor tube 172 , top surface 184 , flange 180 , holes 182 , fastener boss supports 178 and retaining fastener 176 . thus , the female adapter base 164 includes a central conduit 166 through which fuel is intended to flow . disposed about the central conduit is a shrouding enclosure 170 which forms an envelope around the central conduit for the purpose of allowing the travel of gas or air vapor through the various holes 174 disposed in the raised surface 171 of the female adapter base , wherein the holes 174 are in fluid contact with the outlet portion 187 of the vapor tube 172 . thus , this assembly is similar to a condenser as used in the chemical arts , which consists of a tube having a water jacket about it , with an inlet and outlet for the cooling water , and a tube disposed therethrough which the vapor to be condensed is caused to pass . in the present instance , the central conduit is surrounded by the shrouding enclosure 170 , which has as its “ inlet ”, the various holes 174 , and which has as its “ outlet ”, the vapor tube 172 . fig2 shows a perspective view of a female adapter cover 144 according to the present invention , which is shaped in the form of a hollow cylindrical shell , reminiscent of a cylinder sleeve . the female adapter cover includes a smooth bore 196 along its length dimension , except for a raised band 194 at the top , which raised band has a slightly less inner diameter than the smooth bore 196 . there is an o - ring seal 148 which is disposed in an annular slot at the upper end of the female adapter cover , which o - ring provides a seal around the outer surface of the male adapter cover 2 when the male adapter cover is inserted into the female adapter cover 144 . there is a top surface 146 and a flared bottom 150 . fig2 shows a top view of the female adapter cover 144 , including the top surface 146 and the o - ring seal 148 . fig2 shows a bottom view of the female adapter cover 144 , including flared bottom 150 and a plurality of threaded holes 152 disposed circumferentially about the lower flared portion , which holes are adapted to receive a fastener that also passes through the holes 182 in the female adapter base 164 , which are in the same configuration and spacing on both the female adapter cover 144 and female adapter base 164 . the diameter d3 of the inner bore 196 of the female adapter cover 144 is just slightly larger than the diameter of the raised surface 171 , so that the female adapter cover 144 may be securely fit over the female adapter base 164 . fig3 a shows a moveable collar 102 according to the present invention , which is shaped as a hollow cylinder . the moveable collar 102 is intended to be slidably disposed within the smooth bore 196 of the female adapter cover 144 . the moveable collar 102 includes a groove 108 in which is housed an o - ring seal 130 , which o - ring seals the outer surface of the moveable collar 102 within the smooth bore 196 of the female adapter cover 144 . there is a flat top surface 106 , and a plurality of slots 104 which pass through the wall of the moveable collar and may thus be regarded as holes . on the inside wall of the moveable collar 102 , there is a flat recessed surface 112 that is disposed between beveled edge 114 and bevel 110 . surface 113 extends annularly about the inside diameter of the moveable collar 102 , and has itself an inside diameter which is smaller than the inside diameter of the flat recessed surface 112 . the surface 115 extends annularly about the inside diameter of the moveable collar 102 and has its own inside diameter which is less than that of surface 113 . thus , going from surface 113 to surface 112 , there is a bevel 110 . then , going from surface 112 to surface 115 , there is a beveled edge 114 . fig3 b shows a side elevation view of the moveable collar 102 element of the invention , including the slots 104 , flat top surface 106 , and groove 108 . fig3 is a top view of the moveable collar 102 element of the invention , including the flat top surface 106 . fig3 shows a bottom view of the moveable collar 102 element of the invention , including the beveled edge 114 and holes 117 which are drilled from the bottom surface of the moveable collar to the floor portion of each of the slots 104 , so as to enable insertion of springs into the holes 117 . fig3 shows a perspective view of the bottom of the moveable collar 102 , including the slots 104 and groove 108 . there is also shown surface 115 , beveled edge 114 , holes 117 , surface 112 , surface 113 , flat surface 119 , wall 203 , and flat surface 201 . the flat surface 119 accommodates a retaining ring 190 ( fig2 ) having same diameter as said flat surface 119 , to retain in their position springs which have been placed into the holes 117 . the springs are then held in place by a retaining ring fastened to flat surface 119 , either by interference fit , an adhesive substance , or other conventional means . there is also a flat bottom surface 201 . fig3 shows a seal ring 116 element of the invention , which is preferably metallic in construction , as are all of the other elements of the couplings of the present invention . the seal ring includes a hollow interior space 207 . there is a flat top surface 118 which includes an o - ring seal embedded in an annular groove that is present on the flat top surface 118 . there is a beveled surface 132 , which is reminiscent of a valve - seat in an automotive cylinder head , and which beveled surface functions as a seat for the valve center 154 as later described herein . there is a shoulder portion 120 which includes an o - ring seal 122 annularly disposed thereon . there is also a lower shoulder 134 , and a skirt portion 128 , as well as a smooth bore 312 . these elements are shown in fig3 as well , in addition to threaded holes 126 which are drilled into the seal ring 116 at a band portion 124 which circumscribes the seal ring . there are a plurality ( preferably 4 ) of holes 126 spaced around the perimeter of the seal ring 116 which correspond in position to the slots 104 in the moveable collar 102 . the centerlines of the bores of the threaded holes 126 are perpendicular to the centerline of the seal ring 116 itself . there is also a flat portion 192 on the underside of the seal ring which functions as a seat for the spring 186 ( fig2 ). fig3 is a top view of the seal ring 116 , showing the respective positions of the beveled surface 132 , flat top surface 118 , o - ring seal 130 , shoulder 120 , and o - ring 120 . fig3 shows the collar / seal ring assembly 136 . according to the invention , the seal ring 116 is moveably held in place within the moveable collar 102 . this is done by first inserting a spring 140 into each of the holes 117 in the underside of the moveable collar 102 , and then securing them in place by placement of spring retaining ring 190 ( fig2 ) onto the flat surface 119 , such as by using an epoxy resin . this causes the springs to be partly visible in the slots 104 and partially embedded within the hole 117 between the bottom of the moveable collar and the bottom of the slots 104 . a slight forcing of the springs 140 downward enables one to insert a screw 138 ( whose threads match the holes 126 on the outer band of the seal ring 116 into the slot between the top of the spring 140 and the top portion of the oval or elongate slot 104 . when four screws are inserted into the four slots 104 in such fashion , the seal ring 116 may then be placed into the interior of the moveable collar 102 so that the four screws 138 are engaged in the threads in the holes 126 . a more preferred means for assembly is to first assemble o - ring 122 to seal ring 116 . subsequently , the seal ring 116 is fitted inside the moveable collar 102 , and then the screws 138 are inserted through the slots in the moveable collar 102 into threaded holes 126 in 116 . then the springs 140 are inserted into the holes 117 and the retainer 190 is fitted into the groove in the moveable collar 102 . such a construction yields the arrangement shown in fig3 in which the seal ring 116 is held within the moveable collar 102 in such fashion that motion of the seal ring 116 within the moveable collar 102 is permitted in the direction of the centerline , but downward , and against the pressure of the springs 140 applied on each of the screws 138 . such a motion downwards pushes the seal ring 116 downward , releasing the contact between the o - ring 122 and the beveled edge 114 , thus opening up an annular space located at the gap at 142 . upon release of downward pressure on the seal ring 116 , the force of the springs 140 force the seal ring 116 back in an upwards direction , forcing the o - ring 122 to sealably engage the beveled edge 114 . also shown in fig3 is the flat top surface 106 , flat top surface 118 , o - ring seal 130 , beveled surface 132 , and o - ring seal 188 disposed in groove 108 . although the screws 138 are used to secure the seal ring 116 in its position within the moveable collar 102 , any other functionally equivalent equatorially - located protrusions from the seal ring are suitable for use in this regard , including without limitation , pins welded into place . fig3 shows a side view of the collar / seal ring assembly 136 , showing the respective positions of the flat top surface 118 , flat top surface 106 , groove 108 , springs 140 and screws 138 . the bottom of the assembly is denoted as b . fig3 shows an overhead view of the collar / seal ring assembly 136 , showing the respective positions of the flat top surface 118 , o - ring 130 , gap 142 , flat top surface 106 , and beveled surface 132 . fig4 a shows a top view of the valve center 154 of the present invention having a flat top surface 156 . fig4 b shows a perspective view of the underside of valve center 154 of the present invention , showing the stem portion 158 which has a threaded hole 160 at its bottom portion and an o - ring seal 162 disposed annularly about the valve center . fig4 c shows a side perspective view of the valve center element 154 , showing the respective positions of the stem 158 and o - ring seal 162 and flat top surface 156 . fig4 shows a side view of the female adapter 701 in its final assembled form , when all of the components shown in fig2 and as previously described herein are contained within the female adapter cover 144 and the female adapter base 164 in their proper design configuration . to assemble the female adapter 701 , one begins by placing the female adapter base 164 on a flat surface so that the bottom of the central conduit 166 b and vapor tube 172 rest on the flat surface . next , the spring 186 is placed in position around the top portion of the central conduit 166 t and using the flat surface 171 as a seat . next , an o - ring 188 is placed in the groove 108 of the collar / seal ring assembly 136 , and the collar / seal ring assembly is located over the spring . the assembly 136 is pushed against the pressure of the spring 186 so that the top portion of the central conduit 166 t enters the underside of the assembly 136 and pushing is continued until the bottom skirt portion ( b in fig3 ) of the assembly 136 contacts the surface 171 , which simultaneously engages the o - ring 168 in a sealing contact with the smooth bore 312 in fig3 . once the bottom portion b has contacted the surface 171 , the hole 160 in the end of the stem of the valve center is then threaded over the nut ( retaining fastener 176 , fig2 ) securely , so that subsequent releasing of the assembly 136 causes the beveled edge 132 to contact the o - ring 162 on the valve center 154 in a sealing arrangement . the female adapter cover 144 is then slid over the assembly 136 and fastened into position using conventional fasteners threaded through the holes 182 ( fig2 ) and into the threaded holes 52 ( fig2 ). fig4 is a bottom view of the assembled female adapter 701 showing the respective positions of the flange 180 , bolt holes 182 , retaining fastener 176 , fastener boss supports 178 , valve center 154 , central conduit 166 , vapor tube 172 , and the outlet portion 187 of the vapor tube 172 . fig4 is a top view of the assembled female adapter 701 showing the respective positions of its various elements including the top surface 146 , flat top surface 118 , o - ring 130 , flat top 156 , gap 142 , and flat top surface 106 . fig4 shows a perspective view of the inside top portion of the assembled female adapter 701 showing the respective positions of its various elements including the flat top surface 118 , o - ring 130 , flat top 156 , top surface 146 , flat top surface 106 , and gap 142 . fig4 shows a perspective view of the inside top portion of the assembled female adapter 701 in which the surface 118 has been pressed downward , against the force of spring 186 ( fig2 ) showing the respective positions of its various elements including the flat top surface 118 , o - ring 130 , flat top 156 , top surface 146 , flat top surface 106 , gap 142 , and opening o which has been caused to exist by virtue of the collar / seal ring assembly having been depressed against the force of spring 186 ( fig2 ). the construction so described for the female adapter ( or remote portion of a fuel transfer coupling according to the invention ) operates as follows . a force is applied to the surface 118 of the collar / seal ring assembly , against the pressure of the spring 186 . this causes the collar / seal ring assembly 136 to be moved inside the smooth bore 196 of the female adapter cover 144 , to open up an opening o through which a fuel may flow by virtue of the beveled surface 132 having moved away from the o - ring seal 162 of the valve center 154 . the collar / seal ring assembly continues its travel downwards opening up the opening o larger and larger until the bottom portion b of the assembly 136 contacts the raised surface 171 . at this point , further pressure on surface 118 causes the seal ring 116 to continue moving downwards , against the pressure of springs 140 , which opens up the gap 142 by virtue of the o - ring seal 122 no longer being in contact with beveled edge 114 . the opening of the gap 142 opens fluid communication between the outlet portion 187 of the vapor tube 172 and the gap 142 , through the holes 174 and shrouding enclosure 170 . reference is now made back to the male adapter 700 . when the male adapter 700 is engaged inside the female adapter cover and the two are pressed together by an applied force , a series of events heretofore unknown in the art occurs . the o - ring 130 on the female adapter 701 contacts the flat top surface 48 of the internal housing 18 . the applied force causes the internal housing 18 to be pressed into the adapter 700 , thus opening the gap 7 , which provides a fluid communication path between the outlet portion 35 of the vapor tube 20 and the gap 7 . continued applied force causes the assembly 136 to be pushed into the smooth bore 196 of the female adapter cover 144 , thus creating an opening o through which a liquid fuel may flow as was shown in fig4 . continued applied force opens the gap 142 by virtue of the assembly 136 bottoming out on the flat surface 171 , as described above , thus providing a fluid communication path between the outlet portion 187 of the vapor tube 172 and the gap 142 . under such an arrangement , the gap 7 of the male adapter 700 and the gap 142 of the female adapter 701 are in fluid contact , which also means that the outlet portion 35 of the vapor tube 20 and the outlet portion 187 of the vapor tube 172 are now in fluid communication with one another . during the course of the applied force , and more or less simultaneously with the afore said events , the flat top 156 of the valve center 154 pushes on the flat top surface 70 of the poppet 10 thus opening space s as described for fig1 , thus enabling fluid contact between the space s on the adapter 700 and the opening o ( fig4 ) of the adapter 701 . establishment of a fluid connection between the opening of space s and the opening 0 means that there is now a fluid connection between the bottom of the central conduit 166 b and the central bore 34 of the male adapter base 4 . thus , insertion of the outer surface of the male adapter cover 2 of the finished assembly 700 into the bore of the female adapter cover 144 of the finished assembly 701 simultaneously causes a fluid connection to occur between the vapor tubes of each of the coupling counterparts and a fluid connection to occur between the central bore 34 of the male adapter base and the bottom of the central conduit 166 b . according to a preferred form of the invention , the central bore 34 ( fig2 ) of the assembly 700 is connected by conventional means such as a hose to the inlet pipe through which a fuel tank is normally filled , and the outlet portion 35 of the vapor tube 20 is connected by conventional means such as a hose to the headspace above the fuel in a fuel tank , and the assembly 700 is placed in a location at which the orifice through which gasoline is normally added to a vehicle &# 39 ; s gas tank is located . the adapter assembly 701 is fitted to the bottom of a portable fuel reservoir ( or the outlet of a pump ). the outlet portion 187 of the vapor tube 172 is connected by conventional means such as a hose to the headspace above the fuel in the fuel reservoir from where the fuel to be delivered to the vehicle is stored . the central conduit 166 b is connected by conventional means such as a hose to the bottom of the portable reservoir , to be in contact with a liquid fuel . using such provisions , when it is deemed desirable to fill gasoline to the vehicle , insertion of the end of the assembly 700 into the open end of the assembly 701 causes the above - described series of events to occur , thus effectively simultaneously , i . e ., within about less than 1 second , and permits fueling of a vehicle to occur with no loss of vapor to the atmosphere . also , since the volume of fuel delivered from the storage tank to the fuel tank on the vehicle is simultaneously compensated for by an equal exchange of headspace volume as between the two fuel storage vessels , no inhibition of flow is observed . owing also to the nature of the coupling , losses of fuel due to spillage are kept to an absolute minimum , thus reducing fire hazards associated with gasoline spills and effectively eliminating health hazards to persons in the area by virtue of their not breathing volatile materials such as alkyl lead compounds since no spillages occur . these events are depicted in cross - section in fig4 a - 46f . another way of viewing the events associated with the connection sequence may be broken down in the following steps : 1 . o - ring , 148 , engages with adapter cover , 2 . sealing inner portion of coupler and adapter from outside . 2 . o - ring , 130 , of 136 engages with face , 48 , of internal housing , 18 . sealing inner fluid conduit , 34 , from vent cavity , 7 . 3 . assy , 136 , pushes internal housing , 18 , and poppet , 10 , back until face , 51 , contacts face 40 of body , 4 . this opens to vent cavity , 7 . 4 . face , 156 , of poppet , 158 , engages with face , 70 , of poppet , 10 . 5 . poppet , 156 , pushes poppet , 10 , open allowing fluid / fuel to flow from 166 b to cavity 34 . 6 . assy , 136 , is pushed back until face , 201 , of 102 contacts face , 171 , of body , 164 . 7 . housing , 18 , with face , 48 , in contact with o - ring , 130 , pushes inner housing , 116 , back opening vent cavity , 142 ?, to vent port , 172 . 8 . coupler assy . continues forward until face , 146 , of adapter cover , 144 , contacts the heads of screws , 22 , of male adapter . coupler is now fully engaged and all ports are fully open . the occurrences of the above events are described according to one preferred form of the invention . however , it will occur to one of ordinary skill in the art after reading this specification that the events are controlled by the strengths of the various springs 8 , 12 , 186 , and 140 selected . according to a preferred form of the invention , the event which is the last to occur is the opening of the gap 142 in the assembly 136 . the vent disc 14 on the assembly 700 is spring - loaded , as previously described herein . the purpose of this is to enable ambient air to enter the fuel tank after a quantity of fuel has been removed from the fuel tank by the action of the fuel pump . when the fuel pump removes fuel from the fuel tank during its normal operation , a vacuum will be developed within the fuel tank because of the volume of fuel removed . when the coupling of the present invention is utilized , once the vacuum inside the fuel tank reaches a sufficient level that the spring 12 can no longer hold the vent disc 14 in its seated position , the vent disc is drawn away from it seat , and enables ambient air to enter the tank to compensate for the loss of fuel or other cause of vacuum in the tank , such as a sudden temperature decrease . in addition , the vent disc 14 includes a hole 15 in its surface , which acts as a vent to vent out any pressure which may build up in the tank , owing to increases in temperature or other causes . fig4 shows a perspective view of a fuel containment system comprising a fuel reservoir 609 having an inlet pipe 611 and containing a liquid fuel and a headspace 613 , and further comprising the coupling 700 , wherein the vapor tube 20 is in effective fluid contact with the headspace 613 above the fuel in said fuel reservoir by means of a tube 615 , and wherein the first end portion 34 of the central bore portion is in effective fluid contact with the inlet pipe 611 . fig4 shows a perspective view of a fuel containment vessel 617 comprising an outlet 625 and containing a liquid fuel 621 and a headspace 619 , and further comprising the coupling 701 , wherein the vapor tube 172 is in effective fluid contact with the headspace 619 above the fuel 621 in said fuel containment vessel by means of a tubing 623 , and wherein said central conduit portion is in effective fluid contact with said outlet 625 . there is also shown a valve means 627 disposed between said outlet 625 and said central conduit portion . consideration must be given to the fact that although this invention has been described and disclosed in relation to certain preferred embodiments , obvious equivalent modifications and alterations thereof will become apparent to one of ordinary skill in this art upon reading and understanding this specification and the claims appended hereto . the present invention further includes all possible combinations of the features recited in any one of the various claims appended hereto with the features recited in any one or more of each of the remaining claims . accordingly , the presently disclosed invention is intended to cover all such modifications , alterations , and combinations .

US-72727903-A

a process for reducing the amount of unwanted diacrylate produced during the distillation of hydroxyalkyl acrylates or hydroxyalkyl methacrylates .

this invention is directed to a method for reducing formation of di ( meth ) acrylate during the distillation of hydroxyalkyl ( meth ) acrylates from the iron catalyzed reaction of ( meth ) acrylic acids with alkylene oxides by conducting the distillation in the presence of a catalyst deactivating additive preferably by admixing to the reaction mixture before beginning the distillation an effective amount of one or more of a catalyst deactivating additive selected from : a . substituted or unsubstituted c 4 - c 20 alkyl or c 7 - c 20 aralkyl mono -, di -, or tricarboxylic acids , anhydrides of the mono -, di -, or tricarboxylic acids , or mixed anhydrides of the mono -, di , or tricarboxylic acids wherein the substituent is selected from one to four c 1 - c 4 alkoxy such as methoxy , ethoxy , propoxy , or butoxy , c 1 - c 4 alkyl such as methyl , ethyl , propyl , or butyl , halo such as chloro , bromo , fluoro , or aryl such as phenyl , or naphthyl ; examples of these acids are stearic , lauric , octanoic , phenylacetic , adipic , succinic , and the like ; preferred acids are stearic , lauric , phenylacetic and the like ; most preferred are stearic , lauric , and the like acids . examples of anhydrides of the mono , di , or tricarboxylic acids are succinic , and the like ; b . substituted aryl mono -, di -, or tricarboxylic acids , anhydrides of the mono -, di -, or tricarboxylic acids , or mixed anhydrides of the mono -, di -, or tricarboxylic acids wherein the substituent is selected from one to four c 1 - c 4 alkoxy such as methoxy , ethoxy , propoxy , or butoxy , c 1 - c 4 alkyl such as methyl , ethyl , propyl , or butyl , halo such as chloro , bromo , fluoro , or aryl such as phenyl , or naphthyl ; examples of the acids are p - toluic , o - phthalic , and the like ; preferred acids are o - toluic and the like ; examples of the anhydrides are phthalic and the like ; c . substituted or unsubstituted c 3 - c 10 vicinal diols wherein the substituent is selected from one to four c 1 - c 4 alkoxy such as methoxy , ethoxy , propoxy , butoxy , and the like , c 1 - c 4 alkyl such as methyl , ethyl , propyl , butyl , and the like , halo such as chloro , bromo , fluoro , and the like , or aryl such as phenyl , and the like ; examples of these diols include glycerol and the like ; d . substituted or unsubstituted o - substituted phenols wherein the o - substituted substituent is selected from hydroxy , hydroxymethyl , or carboxymethyl , and , when substituted , the substituent is selected from one to four c 1 - c 4 alkoxy such as methoxy , ethoxy , propoxy , butoxy , and the like , c 1 - c 4 alkyl such as methyl , ethyl , propyl , butyl , and the like , halo such as chloro , bromo , fluoro , and the like , or aryl such and phenyl and the like ; examples of these o - substituted phenols include 2 - hydroxyphenylacetic acid , catechol , 3 - methoxycatechol , 2 - hydroxybenzyl alcohol , and the like ; preferred o - substituted phenols are 2 - hydroxyphenylacetic acid , catechol , and the like ; most preferred is catechol and the like ; e . substituted or unsubstituted o - substituted polyaromatic alcohols wherein the substituent is selected from one to four c 1 - c 4 alkoxy such as methoxy , ethoxy , propoxy , butoxy , and the like , c 1 - c 4 alkyl such as methyl , ethyl , propyl , butyl , and the like , halo such as chloro , bromo , fluoro , and the like , or aryl such and phenyl and the like , and wherein the o - substituent is selected from hydroxy , hydroxymethyl , carboxy , or carboxymethyl ; examples of these o - substituted polyaromatic alcohols include 2 , 3 - dihydroxynaphthalene and the like ; f . substituted or unsubstituted diglycolic anhydrides wherein the substituent is selected from one to four c 1 - c 4 alkoxy such as methoxy , ethoxy , propoxy , butoxy , and the like , c 1 - c 4 alkyl such as methyl , ethyl , propyl , butyl , and the like , halo such as chloro , bromo , fluoro , and the like , or aryl such as phenyl and the like ; examples include diglycolic anhydride and the like ; g . poly ( meth ) acrylic acids and the like ; examples include polyacrylic acid and the like . the rationale for the approach used in this invention was to minimize the effectiveness of iron containing process catalysts as di ( meth ) acrylate production catalysts during the processing of crude hydroxyalkyl ( meth ) acrylate . additives can be mixed with crude hydroxyalkyl ( meth ) acrylate at levels up to about five percent by weight with the pure hydroxyalkyl ( meth ) acrylate typically isolated by distillation . effectiveness of the additives varies depending on their particular physicochemical properties , properties of the reactant ( meth ) acrylic acid and epoxide , as well as the product hydroxyalkyl ( meth ) acrylate . two different , but related , modes of deactivation may be at work in this process . certain of the additives , notably the long - chain fatty acids ( stearic and lauric ), produce an insoluble material resembling a tar . this insoluble material sequesters the catalyst in such a way that it can no longer catalyze di ( meth ) acrylate production . removal of the insoluble material by filtration followed by distillation of the mother liquor results in a high recovery of hydroxyalkyl ( meth ) acrylate with significantly reduced di ( meth ) acrylate content . this result also confirms that it is the catalyst that has a major contribution in formation of the di ( meth ) acrylate . with other additives tars are not produced . however , the catalyst is nonetheless deactivated because again , distillation results in a high recovery of hydroxyalkyl ( meth ) acrylate with reduced di ( meth ) acrylate . the following examples and comparative examples illustrate the present invention more specifically . the invention is in no way limited to these specific examples . a model hydroxyalkyl ( meth ) acrylate production system was chosen for purposes of determining the effectiveness of each additive in reducing di ( meth ) acrylate content in distilled product . in this system , undistilled crude hydroxyethyl acrylate produced from the iron catalyzed esterification of acrylic acid and ethylene oxide was treated with varying amounts of each additive and the resulting mixture evaluated . the crude hydroxyethyl acrylate used in these studies contained approximately 3000 ppm of iron . the primary evaluation procedure , referred to as &# 34 ; bottle studies &# 34 ; for the determination of di ( meth ) acrylate formation , involved heating reaction mixtures in closed 2 oz . bottles at 80 ° c . for periods of 3 or 6 hours . this procedure was used to highlight differences in di ( meth ) acrylate formation between untreated reaction crude and reaction crude that was treated with an additive . a secondary evaluation involved laboratory distillation of the reaction crude with and without the additive . the results of these studies are summarized in tables 1 and 2 . examples 1 - 43 were conducted using the bottle study evaluation as follows : the additive was added to the hydroxyethyl acrylate reaction crude containing up to 0 . 5 weight percent di ( meth ) acrylate . the mixture was heated at 80 ° c . for either three or six hours . the di ( meth ) acrylate content of the mixture was then determined by hplc analysis . the di ( meth ) acrylate content of the mixture was compared to that in a sample treated identically except for the absence of the additive . table 1 summarizes the results of these experiments . table 1______________________________________example weightno . additive % conditions . sup . 1 ratio . sup . 2______________________________________ 1 stearic acid 2 . 0 a - 1 0 . 6 - 0 . 7 . sup . 3 2 lauric acid 0 . 2 a - 1 0 . 4 3 lauric acid 2 . 0 a - 1 0 . 2 4 octanoic acid 2 . 0 a - 1 0 . 8 5 - p - toluic acid 2 . 0 b - 1 0 . 5 6 phenylacetic 2 . 0 a - 1 0 . 6 acid 7 adipic acid 2 . 0 a - 1 0 . 5 8 - o - phthalic acid 1 . 0 c - 2 0 . 5 9 - o - phthalic acid 2 . 0 a - 1 0 . 610 succinic acid 0 . 5 b - 1 0 . 811 succinic acid 1 . 0 b - 2 0 . 512 succinic acid 2 . 0 a - 2 / b - 2 0 . 3 - 0 . 713 salicylic acid . sup . 4 0 . 5 a - 2 / b - 2 0 . 7 - 1 . 114 salicylic acid . sup . 4 1 . 0 a - 2 1 . 115 salicylic acid . sup . 4 1 . 5 a - 2 1 . 216 salicylic acid . sup . 4 2 . 0 a - 2 / b - 2 0 . 6 - 1 . 017 salicylic acid . sup . 4 2 . 2 a - 1 0 . 8 - 0 . 918 salicylic acid . sup . 4 5 . 0 b - 2 0 . 619 2 - hydroxy - 1 . 0 a - 1 0 . 8 phenylacetic acid20 phthalic anhy . 2 . 0 b - 1 0 . 621 succinic anhy . 2 . 0 b - 1 0 . 822 succinic anhy . 2 . 5 a - 2 0 . 423 diglycolic 1 . 0 a - 2 0 . 8 anhy . 24 catechol 0 . 5 a - 1 0 . 625 catechol 1 . 0 a - 1 0 . 4 - 0 . 626 catechol 2 . 0 a - 1 / b - 1 0 . 4 - 0 . 627 3 - methoxy - 1 . 0 b - 2 0 . 6 catechol28 2 - hydroxy - 1 . 0 b - 1 0 . 7 benzyl alcohol29 polyacrylic acid 0 . 5 b - 2 0 . 730 polyacrylic acid 2 . 0 b - 2 0 . 631 glycerol 0 . 5 b - 1 0 . 932 glycerol 1 . 0 b - 1 0 . 833 glycerol 2 . 0 a - 2 / b - 1 0 . 6 - 0 . 834 polyethylene 0 . 5 b - 2 1 . 8 glycol ( peg ) mw of 150 . sup . 435 peg 200 . sup . 4 0 . 5 b - 2 0 . 736 peg 200 . sup . 4 2 . 0 a - 1 0 . 937 peg 400 . sup . 4 0 . 5 b - 1 / b - 2 0 . 9 - 1 . 038 peg 600 . sup . 4 0 . 5 b - 2 0 . 839 peg 1000 . sup . 4 0 . 5 b - 2 0 . 740 peg 1000 . sup . 4 1 . 0 a - 1 1 . 241 peg 2000 . sup . 4 2 . 0 a - 1 0 . 942 . sup . 5 lauric acid 1 . 0 a - 1 0 . 743 . sup . 5 catechol 1 . 0 a - 1 0 . 8 - 0 . 9______________________________________ . sup . 1 initial di ( meth ) acrylate concentration : a = less than 0 . 3 weight percent b = 0 . 3 weight percent or more c = unknown initial concentration - 1 = 80 ° c . for 6 hours - 2 = 80 ° c . for 3 hours . sup . 2 ratio of final di ( meth ) acrylate concentration additive vs . no additive . sup . 3 a range indicates results of multiple experiments , not necessarily under identical conditions . sup . 4 comparative example . sup . 5 hydroxyethyl methacrylate crude used in this experiment ; ratio was based on concentrations of ethyleneglycol dimethacrylate examples 44 - 56 were conducted by vacuum distillation of crude reaction mixture under laboratory conditions . the distillation was completed in either 1 - 2 hours or 5 - 6 hours in order to simulate short - term and long - term distillations . the concentration of di ( meth ) acrylate in the distillate from the sample containing additive was then compared to that in a similar sample without additive . the results of these experiments are summarized in table 2 . table 2______________________________________example weight # additive % conditions . sup . 1 ratio . sup . 2______________________________________44 lauric acid 0 . 5 a - 2 1 . 045 lauric acid 2 . 0 a - 1 / a - 2 0 . 03 - 0 . 7 . sup . 346 phthalic acid 0 . 5 a - 2 0 . 747 phthalic acid 2 . 0 a - 2 0 . 348 phenylacetic 2 . 0 a - 2 0 . 6 acid49 salicylic acid . sup . 4 0 . 5 a - 2 0 . 750 - p - toluic acid 0 . 5 a - 2 1 . 151 - p - toluic acid 2 . 0 a - 2 0 . 552 polypropylene 2 . 0 a - 2 1 . 0 glycol53 glycerol 2 . 0 a - 2 1 . 054 succinic acid 2 . 0 b - 2 0 . 355 catechol 1 . 0 a - 2 / b - 2 0 . 2 - 0 . 456 catechol 2 . 0 b - 2 0 . 2______________________________________ . sup . 1 initial di ( meth ) acrylate concentration : a = less than 0 . 3 weight percent b = 0 . 3 weight percent or more - 1 = 1 - 2 hour distillation time - 2 = 5 - 6 hour distillation time . sup . 2 ratio of final di ( meth ) acrylate concentration ( less initial concentration ) additive vs . no additive . sup . 3 a range indicates results of multiple experiments , not necessarily under identical conditions . sup . 4 comparative example a range indicates results of multiple experiments , not necessarily under identical conditions comparative example

US-77318591-A

in a probe scanning method , a probe is scanned in a main scanning direction in an xy plane disposed between the probe and a surface of a sample while scanning the probe in a zigzag pattern . physical quantities acting on the probe and the surface of the sample are measured at peaks of the zigzag pattern during the scanning step . image data corresponding to the physical quantities measured at the different positions in the xy plane is then generated .

the invention will be described with reference to the preferred embodiments shown in accompanying drawings . fig1 shows in detail a scanning method according to the present invention embodied in the claims . specifically , fig1 relates to an embodiment in which a probe moves linearly in one scanning unit while fig2 relates to another embodiment where the probe moves in the space of a sine wave in one scanning unit . further , fig4 shows that data collected by the scanning method of fig1 are mapped as images . fig5 is similar to fig1 in which the collected data are mapped as images . since the scanning methods shown in fig1 and 2 are basically identical , the method of fig1 will be described hereinafter . referring to fig1 the probe is scanned in a main scanning direction in an xy plane while it is relatively staggered or scanned in a zigzag pattern with respect to a sample by + 1 scanning unit in the x and y directions so that physical quantities acting on the probe and the sample are measured . next , the probe is staggered by + 1 scanning unit in the x direction and by − 1 scanning unit in the y direction . this operation is repeated in order to measure physical quantities acting on the probe and the sample . the staggered probe can scan approximately two scan lines in the x direction at the same time , which is approximate to two scanning operations in the raster scan method of fig3 and can improve the actual scanning speed . further , the probe repeatedly moves by + 1 and − 1 scanning units in the y direction , and is substantially unaffected by the uneven surface of the sample . this means that the relative speed of the probe with respect to the sample is approximately equal to that of the raster scan method of fig3 . in the scanning method of fig1 physical quantities between the probe and the sample are measured at positions 1 , 2 , 3 , . . . , 19 , 20 , and 21 . the measured physical quantity data are mapped as image data as shown in fig4 . in fig1 each of the directions from positions 1 - 10 and positions 11 - 20 denotes a main scanning direction of the probe . it is assumed here that r ( 1 ), r ( 2 ), r ( 3 ), . . . , r ( 19 ), r ( 20 ) and r ( 21 ) denote the data obtained at the positions 1 , 2 , 3 , . . . , 19 , 20 , 21 in fig1 and d ( 1 , 1 ), d ( 1 , 2 ), d ( 1 , 3 ), . . . d ( 2 , 4 ), d ( 2 , 5 ), d ( 3 , 1 ), etc . denote the data mapped as the image in fig4 . the data are mapped as the image data by applying the following related formula . d ( 2 , 2 )=( r ( 2 )+ r ( 3 )= r ( 4 ))/ 3 d ( 2 , 3 )−( r ( 4 )+ r ( 5 )+ r ( 6 ))/ 3 the image data at the surface positions in the x and y directions such as the mapping data d ( 2 , 2 ) and d ( 2 , 3 ) which are present between the positions 2 and 4 , 4 and 6 , and so on , and d ( 2 , 1 ) at one end and so on in fig1 are not obtained by actual measurement but are interpolated using physical quantities which are actually measured near the foregoing surface positions . in the foregoing embodiment , the number of picture elements of the mapped data is equal to the number of collected data . it is assumed here that r ( 1 ), r ( 2 ), r ( 3 ), . . . , r ( 19 ), r ( 20 ), r ( 21 ) denote the data obtained at the measurement positions 1 , 2 , 3 , . . . , 19 , 20 , 21 in fig1 and denote the data mapped in the image in fig4 . the data are mapped as the image data by applying the following related formula . d ( 1 , 4 )=( r ( 3 )+ r ( 4 )+ r ( 5 ))/ 3 d ( 1 , 10 )=( r ( 9 )+ r ( 10 ))/ 2 d ( 2 , 3 )=( r ( 2 )+ r ( 3 )+ r ( 4 ))/ 3 d ( 2 , 5 )=( r ( 4 )+ r ( 5 )+ r ( 6 ))/ 3 in this case , all the measured physical quantity data are used as image data . the image data at the surface positions in the x and y directions such as the mapping data d ( 2 , 3 ) and d ( 2 , 5 ) which are present between the positions 2 and 4 , 4 and 6 , and so on , and mapping data d ( 1 , 2 )), d ( 1 , 4 ) which are present between the positions 1 , 3 and 3 and 5 , and so on in fig1 or the mapping data d ( 1 , 10 ), d ( 2 , 1 ) at an end , and so on are not obtained by actual measurement , but are interpolated using physical quantities actually measured near the foregoing surface positions . in another embodiment , the number of picture elements of the mapped data is larger than the number of collected data . in this case , the number of mapping picture elements is four times more than the number of pseudo collected data . according to the invention , the probe is scanned in a main scanning direction while it is relatively staggered or scanned in a zigzag pattern over the uneven surface of the sample at a speed approximately equal to that of the raster scan method shown in fig3 . however , the scanning probe microscope can scan two scan lines at the same time , which is approximate to two scan operations in the raster scan method . this results in an improvement in actual scanning speed . further , since the probe is staggered or scanned in a zigzag pattern across the surface of the sample , it is possible to extensively improve the resolution when the collected data are mapped into picture elements which are more than the number of collected data .

US-75465101-A

a two - piece check valve employing an elastomeric diaphragm retained between two lands of an integral member . the integral member forms a boss on which the diaphragm is seated , and cooperates with the diaphragm to form a chamber surrounding the boss .

in the drawing , the number 10 designates a check valve 10 which is constructed from a cylindrical aluminum housing member 12 and a circular elastomeric diaphragm 14 . the number 15 designates the ambient environment in which the valve 10 is used . as is illustrated , the diaphragm 14 is directly exposed to the ambient environment 15 . the number 17 designates the axis of the cylindrical member 12 , thus defining opposing axial ends 16 , 18 thereof . the member 12 is machined by conventional means to form a relatively large annular recess 20 , coincidentally forming an internal boss 22 which projects toward the axial end 16 . the boss 22 is initially cylindrical , and later becomes annular with the drilling of a hole to form a low - pressure channel 24 . alternatively , the channel 24 may be formed prior to forming the recess 20 . the member 12 . is then machined by conventional means to form a radially - extending annular recess 26 near the axial end 16 , thus forming first and second opposing annular lands 28 , 30 . a hole is drilled to form an inlet port 32 and a high - pressure channel 34 extending from the port to the annular recess 20 . a hole is drilled along the axis of the boss 22 , and joins a hole cross - drilled from a suitable location to form an outlet port 36 and the low - pressure channel 24 . the flexible diaphragm 14 is inserted in the annular recess 26 so that an annular peripheral portion of the diaphragm is captured between the opposing annular lands 28 , 30 . sufficient force is then applied to the first axial end 16 of the member 12 so that it is crimped to retain the diaphragm 14 as indicated . alternatively , the diaphragm 14 may be bonded to either or both of the lands 28 , 30 . the diaphragm 14 and housing member 12 cooperate to form an annular chamber 38 which surrounds the boss 22 . the upper end of the boss 22 provides an annular valve seat 40 which cooperates with the diaphragm 14 to prevent or permit flow from the chamber 38 into the low - pressure channel 24 . the valve seat 40 is slightly higher ( as viewed in the drawing ) than the annular land 30 , thus providing slight mechanical pressure which , in addition to the air pressure in the ambient environment 15 , must be overcome by the pressure in the channels 24 , 34 in order to open the valve 10 . with proper adjustment of the dimensional difference ( determined in the axial direction 17 ) between the land 30 and valve seat 40 both low leakage and a low crackpoint ( i . e . differential pressure required to open valve ) can be achieved . in an exemplary use , the check valve 10 serves as a component of an outflow valve controller in a cabin pressure control system for an aircraft . the ambient environment 15 is at cabin pressure and high - pressure channel 34 is in direct fluid communication with the rate chamber ( designated at 42 ) of the controller . the pressure load on the valve 10 is normally from the rate chamber 42 to the ambient environment 15 . upon occurence of an abnormal condition ( e . g . loss of cabin airflow , intentional depressurization , air transients , subsystem failure ) the cabin pressure becomes lower than the pressure in the rate chamber 42 . the valve then acts to equalize the pressure in the rate chamber 42 and cabin by displacement of the diaphragm 14 away from the valve seat 40 , thus enabling flow from the annular chamber 38 to the low - pressure channel 24 . it should be understood from the foregoing description that the invention provides a unique and advantageous method for manufacturing a diaphragm - type check valve , and a check valve which produces a negligible leakage rate while also providing a low crackpoint . the fact that , for the preferred embodiment of the invention , the diaphragm and integral member are described as circular and cylindrical , respectively , is not intended as limiting since the two members of the valve can have other common shapes without departing from the scope of the invention .

US-19986594-A

a joint between an end of a ceramic roll and a metal ferrule compensates for the differences in the thermal expansion properties of the joined materials . a plurality of thermodeformable bimetal elements are positioned in the space between the roll end and the ferrule to expand when the temperature increases to accommodate the greater thermal expansion of the ferrule relative to the roll and to provide a selected coupling strength in the joint at a given operating temperature . the roll is preferably made from a vitreous , fused silica material and is suitable for supporting glass and metal in sheet , strip or plate form at elevated temperatures .

reference numeral 1 designates a rotatable roll in fig1 and 2 . the roll 1 is made from a refractory ceramic material having a low coefficient of thermal expansion , for example , vitreous or fused silica . only one end of the roll 1 is shown . the roll has a cylindrical body portion , generally with a constant diameter . each end of the roll 1 has a cylindrical end portion of smaller diameter for receiving a ferrule 2 . the ferrule is usually made of a material different from that of the roll , usually a metal such as steel . the coefficient of thermal expansion of the ferrule 2 is consequently much greater than that of the ceramic material of the roll 1 . as a result , the space between the outside diameter of the end portion of the roll 1 and the inside diameter of the ferrule 2 increases greatly as the operating temperature of the joined assembly increases . according to the invention , thermodeformable bimetal elements 4 are provided in this area to accommodate the dimensional increase or &# 34 ; play &# 34 ; which results from the differing thermal expansion properties of metal and ceramic materials . in one preferred embodiment , the bimetal elements 4 are placed in longitudinal grooves 6 formed in each of the ends of the roll 1 . as depicted in fig1 and 2 , three grooves 6 are formed on each roll end into which six bimetal elements 4 are located ( two in each groove ). the bimetal elements 4 are comprised , for example , of strips of intimately bonded nickel and nickel alloy . the thermodeformable bimetal elements at ambient temperature have an initial predeflection camber in the natural direction of deformation which takes place with a temperature rise . this predeflection is designed to assure a spring - type pretensioning at ambient temperature that facilitates a tight roll - ferrule joint and the transmission of a sufficient couple by virtue of the compressive loading provided by the arcuately shaped bimetal elements 4 . as shown in fig1 a , the metal strip of the bimetal element 4 having the higher coefficient of thermal expansion designated 4a is located outside of the cambered part , while the second metal strip designated 4b having a lower coefficient of thermal expansion is located on the inside . when the temperature of the assembly rises , the play due to differential thermal expansion between the roll 1 and the ferrule 2 increases , but at the same time the camber of the bimetal elements 4 increases due to the greater expansion of the metal strip 4a . thus , the increase in play is compensated by the increase in camber of the bimetal elements 4 . as a result , the transferable couple or coupling strength as well as the alignment of the roll and the ferrule can remain essentially constant and the assembly can be used at a higher temperature than the assemblies of the prior art . operating temperatures upwards of 750 ° c . or more are possible with the present invention . by appropriately choosing the number and size of the thermodeformable bimetal elements 4 , it is also possible to control the variation in the transferable couple or loading as a function of the temperature . for example , bimetal elements 4 may be selected to thermally expand in the camber direction a greater amount than the expected increase in play between the roll and ferrule at a given operating temperature . such an increase in camber in effect increases the transferable couple of the joint as the temperature increases . the predeflection camber of the arcuate bimetal elements 4 is preferably between about 0 . 2 and 2 . 5 mm . to facilitate the assembly of the unit , the thermodeformable bimetal elements 4 could be preassembled on the roll or on the ferrule , for example , by thermally destructible adhesion . in addition , the ferrule or ferrules may be pre - heated to thermally expand the ferrule so as to reduce the press - on force required during assembly . according to one preferred assembly variant , the thermodeformable bimetal elements 4 are prepositioned in a cage . it is also possible to cool the bimetal elements lower than ambient temperature to produce an inverse deflection which cancels or minimizes the initial predeflection camber to provide an easier assembly of the roll and ferrule . according to another variation , the thermodeformable bimetal elements 4 are prepositioned and / or prestressed in thermally destructible containers . fig3 and 4 show a further embodiment which functions identically to that discussed with reference to fig1 and 2 . in this embodiment , the end of roll 1 has six grooves 6 instead of three , but each of these grooves has only one thermodeformable bimetal element 4 positioned therein . thus , an element 4 of a given camber direction is placed between two elements 4 of opposite camber . thus , the elements 4 are positioned so that their camber is inversed with respect to an adjacent bimetal element 4 . as explained with reference to fig1 the bimetal strips are dished so that the metal 4a with the greater coefficient of expansion is located on the outside . the same is true in the embodiment of fig3 and 4 . but , as shown on the left in fig3 the concavity of the bimetal element 4 is directed toward the ferrule 2 while , as shown on the right of the same fig3 the concavity of the other half of the elements 4 &# 39 ; is directed toward the roll 1 . the left hand element 4 thus presents a point of contact with the ferrule 2 and two points of contact with the roll 1 while , inversely , the right hand element 4 &# 39 ; presents a single point of contact with the roll 1 and two points of contact with the ferrule 2 . three generatrices of contact of bimetal elements on the ferrule and on the roll are thus defined . for short ferrules , this type of assembly makes it possible to multiply the number of contact generatrices and thus avoid the swivel effect that would occur if the concavity of the deformable elements is always directed toward the ferrule or toward the roll . this embodiment may be used where it is necessary to have a short ferrule which prohibits the use of two bimetal elements 4 in end to end alignment , as shown in fig1 and 2 . fig5 and 6 depict another variant in which the thermodeformable bimetal elements 4 comprise discs or washers in a form analogous to that of the well known belleville - type elastic washer . these discs or washers are placed in cylindrical seats 6 formed in the end portions of the roll 1 . in the embodiment shown in fig5 and 6 , the thermodeformable discs or washers are arranged in series so that their unitary deflections are additive . this permits a greater amplitude of movement of the discs or washers to accommodate a greater play . the joining force applied is that applied by a single disc or washer . fig7 and 8 show a variant of fig5 and 6 in which the discs or washers are arranged in parallel instead of in series . the loading force exerted by each of the thermodeformable elements 4 are additive , but the dimensional amplitude of the deflection is that produced by a single disc or washer . in fig9 and 10 , the thermodeformable elements 4 are placed in series - parallel , which facilitates combining the advantages of the two embodiment variants described above , for example , obtaining a loading and simultaneously a deflection amplitude of the deformable elements greater than those of a single disc or washer . fig1 and 12 show a further embodiment in which the thermodeformable bimetal elements 4 are metal strips arranged circumferentially on a terminal part of smaller diameter of the roll 1 . the strips preferably have a precamber that corresponds to the diameter of the end portion of the roll or which is slightly larger if one wishes to obtain a prestressing at ambient temperature . if it is desirable to obtain a transferred couple that is constant or increasing with the operating temperature of the assembly , the metal 4a having the higher coefficient of thermal expansion would be placed on the outside of the bimetal element 4 . in the contrary case , the metal 4b having the lower coefficient of expansion is placed on the outside . thus , in the case where the metal 4a having the higher coefficient of thermal expansion is on the outside , the arcuate bimetal element 4 increases in camber as the temperature increases to accommodate the increased play between the roll and ferrule . on the other hand , where the metal 4b having the lower coefficient of thermal expansion is positioned on the outside , the arcuate bimetal element 4 decreases in camber as the temperature increases to lower the compressive loading couple in the joint between the roll and the ferrule .

US-6238993-A

electrical connectors incorporate a composite coating of molybdenum disulfide and a metal , preferably tin , for one or both of the contact surfaces of the electrical connector . the coating provides for a low coefficient of friction , low contact resistance , and good electrical conductivity , as well as good mechanical properties . the coating also reduces the insertion force of the electrical connectors , thereby increasing the number of possible terminal pairs and / or reducing terminal bending and breakage for a manually mated connector . the coating can be deposited on copper , tin - plated copper , tin alloy - plated copper or other metallic substrates , using any of several physical vapor deposition methods .

the present invention resides in an electrical connector having contact surfaces of its female and / or male terminals coated with a solid thin film coating consisting essentially of a particular composite material of molybdenum sulfide and a metal . the present invention also resides in related methods for making terminals incorporating this coating . the metal composite hereafter is referred to as “ mos x - metal ”, where “ x ” is the atomic ratio of sulfur to molybdenum and preferably has a value of 1 . 0 ≦ x ≦ 2 . 0 . use of the coating provides for electrical connector terminals having an advantageous combination of low cof , low cr , low cost , and sufficient wear resistance to allow multiple mating and unmating actions . the coating of the present invention can be applied to contact surfaces of either female or male terminals , or both . since mos x - metal is known to decrease electrical conductivity ( and therefore increase cr ), this coating preferably is applied to the contact surface of only one of the two terminal types . the male terminal is commonly manufactured by stamping and folding in such a manner that a coating deposited on one side of the strip substrate ends up on both the top and bottom of the blade of the fabricated male terminal . cost can be decreased by coating only one side of the substrate material and by manufacturing male terminals from this substrate material . the coating most preferably is therefore applied to the contact surface of the male terminal . the coating of the present invention incorporates an atomic or molecular composite of mos x with a metal or mix of metals . these metals are selected from tin , titanium , zirconium , chromium , cobalt , nickel , tungsten , tantalum , niobium , hafnium , and their alloys . in particular , mos x - sn composite coatings within the scope of the present invention are softer and relatively more compliant when compared to some known mos 2 - metal composite coatings . this is of particular mechanical property advantage for electrical connector fabrication , because the bending , folding , and other forming operations in these applications do not cause these coatings to flake or debond , as would occur for harder coatings . moreover , since mos x - sn coatings are softer relative to some known mos 2 - metal composite coatings , they cause less wear of the stamping and forming dies used to prepare electrical terminals . also , the mos .- sn composite coatings of this invention are comparatively more compatible with connectors made from traditional tinplated and tin - alloy ( e . g ., solder ) plated copper alloys , because stable mos x - sn composites can be deposited on tin - plated metals with no or minimal adhesion problems . therefore , mos x - sn composites are most preferred coatings for these applications . the metal content of the mos x - metal composite coating preferably is between 2 weight percent and 20 weight percent , and most preferably between 4 weight percent and 14 weight percent . a metal content of the coating below about 20 weight percent allows the coating to successfully survive static and dynamic loading and linear motion similar to that present during the mating of electrical connectors . a metal content above about 2 weight percent allows for contact resistance suitably low for use in electrical connectors . the thickness of the mos x - metal composite coating preferably is in the range of 0 . 05 μm to 2 . 0 μm , and most preferably in the range of 0 . 1 μm to 1 . 0 μm . thinner coatings are preferable for providing higher electrical conductivity . however , coatings that are too thin cannot survive the wear and tear caused by multiple engagements . in a preferred embodiment of this invention , a thin intermediate metal layer , made of titanium , chromium , or zirconium is situated between the substrate material and the mos x - metal composite coating . this intermediate metal layer is used to ensure adhesion of the mos x - metal composite coating to copper or other metal substrates . such an intermediate metal layer coating also is advantageous for improving the strength and hardness of the mos x - metal composite coating , particularly when the coating is deposited on soft substrate materials , such as tin - plated copper . this intermediate metal layer preferably has a thickness in the range of 0 . 005 μm to 0 . 2 μm . the mos x - metal composite coating of the present invention can be deposited on any electrical terminal substrate material , including copper , copper alloy , tin - plated copper , tin - plated copper alloy , tin alloy - plated copper , tin alloy - plated copper alloy , tin - plated brass , nickel - plated copper , nickel - plated copper alloy , nickel - plated brass , brass , silver , nickel , iron - nickel alloy , silver - nickel alloy , or other suitable electrical terminal substrate material . the substrate should have a shape suitable for manufacturing of connector terminals from the substrate . examples of suitable substrate shapes include thin , long strips , thin sheets , and thin coupons , all of which are within the scope of this invention . substrates in the shape of thin , long strips are most preferred . another preferred aspect of this invention resides in a method for cleaning and coating an electrical terminal substrate material . the cleaning method includes a step of pre - cleaning , comprising several sub - steps . first , the substrate is washed using solvents , such as acetone , isopropanol , ethanol , toluene , chlorinated solvent , or mixtures of these . then , the substrate is cleaned using a dilute solution of detergent or soap in deionized water in an ultrasonic cleaner . after rinsing with deionized water , the substrate material is dried in an air or nitrogen stream . in one aspect of this method , the step of pre - cleaning includes cleaning the dried substrate material using a sprayed snow of carbon dioxide . after the steps of pre - cleaning described above , the substrate is placed in a high vacuum sputter deposition chamber . before the deposition of the coating , the method preferably further includes a step of fine - cleaning of the substrate by bombardment of ar + ions in this deposition chamber . in another preferred aspect of this invention , this deposition chamber is further equipped to provide for continuous motion of the strip substrate relative to the sputter deposition sources . during the deposition , the strip substrate preferably is continuously unwound from a supply reel , and drawn past an ion cleaning station and two sputter deposition stations , to a take - up reel . deposition of the coating can be achieved using any of several known physical vapor deposition ( pvd ) methods . commonly used pvd methods include evaporation and sputtering from a suitable source . the pvd also can be achieved using cathodic arc deposition and ion beam deposition . deposition of the solid thin film by simultaneous sputtering from separate mos 2 and metal targets ; sputtering from a single target composed of mos 2 - metal ; and sputtering from a molybdenum metal or mos 2 target along with a metal sulfide target is within the scope of this invention . the sputter deposition source can be powered by any known technique such as direct current ( dc ), mid - frequency alternating current , alternating current ( ac ), pulsed current , radio frequency ( rf ), and microwave energy . such techniques are known to yield mos x coatings in which x is within the range of about 1 . 0 to about 2 . 0 inclusive . in a preferred method , deposition of the solid thin film of the mos x - metal composite is achieved by using a balanced planar magnetron , powered by either dc or mid - frequency ac ( 20 - 500 khz ) at a power density in the range of preferably 2 w / cm 2 to 12 w / cm 2 . for this deposition , the sputter target attached to the planar magnetron preferably is a rectangular plate made by hot - pressing of a thoroughly blended mixture of mos 2 powder and metal powder . alternatively , a suitable target also can be made by hotpressing a thoroughly blended mixture of mos 2 powder and metal sulfide powder . the most preferred targets include : an mos 2 - sn target , manufactured by hot - pressing of mos 2 powder and tin powder at temperatures generally below the melting point of tin ( 232 ° c . ); and , a molybdenum sulfide - tin sulfide target , manufactured by hot pressing of mos 2 powder and sns or sns 2 powder . the ratio of the powder used as a source of metal to the powder used as a source of molybdenum is adjusted to provide the desired metal content in the deposited coating . such targets can be obtained from pure tech , a subsidiary of williams advanced materials of brewster , n . y . in another embodiment of this invention , the mos x - metal coating also can be deposited using reactive physical deposition methods . in reactive deposition , the sulfur content of the coating is derived from a gaseous source , such as h 2 s or a vapor of elemental sulfur , and the molybdenum and metal content from metallic sputter targets by following the methods taught by a . aubert et al ., in “ preparation and properties of mos x films - grown by d . c . magnetron sputtering ”, surface coatings and technology , vol . 41 , pp . 127 - 134 ( 1990 ) or evaporation sources . the coating chamber discussed above is further equipped to provide a pressure of lower than about 7 . 5 × 10 − 4 millitorr and a refrigerated trap having a surface temperature lower than about 150 kelvin . application of such low pressures and use of a cold trap is crucial for removing residual water vapor , thereby minimizing or completely preventing the reaction between the water vapor and mos x , to obtain coatings having improved cof and cr properties . during the application of the coating , the chamber first is evacuated to an initial pressure of lower than about 7 . 5 × 10 − 4 millitorr and the cold trap is refrigerated to a temperature lower than about 150 kelvin . this ensures minimization of the residual water content of the chamber . after this initial evacuation step , gaseous argon is admitted to the chamber to increase the pressure so that argon plasma is obtained when the power is applied . higher argon pressures are essential for providing stable argon plasma . however , lower argon pressures are favorable for achieving higher energies of sputtered atoms , leading to a higher density coating . in view of these competing concerns , the argon pressure is controlled to preferably be within a range of 0 . 25 millitorr to 7 . 5 millitorr , more preferably 0 . 5 millitorr to 3 . 0 millitorr , and most preferably 0 . 75 millitorr to 1 . 5 millitorr . next , the ion source and sputter deposition sources are activated , and the coating process is initiated . at the ion cleaning station , the substrate is bombarded with ar + ions to achieve the step of fine - cleaning by removing the adsorbed water layer and the metal oxide on the surface of the substrate . these ions preferably are generated by high - voltage glow discharge , more preferably an ion source , and most preferably an anode - layer ion beam source . in one aspect of the method , the substrate then is coated at the first sputter station with a thin intermediate layer of chromium , titanium , or zirconium . the film thickness is varied in the range of 0 . 005 μm to 0 . 2 μm . this coating improves the adhesion between the substrate and the mos x - metal composite coating . finally , the substrate is coated with the mos x - metal composite material in the second sputter station . after all of the substrate has been coated , the ion source and sputter deposition sources are turned off , the sputter chamber is vented to atmospheric pressure , and the coiled , coated substrate is removed . a substrate having a solid thin coating within the scope of the present invention is obtained . the female or male electrical terminals can then be manufactured from this substrate using conventional methods , such as stamping and forming . as taught by spalvins in “ lubrication with sputtered mos 2 films : principles , operation , and limitations ” jmepeg , vol . 1 , pp . 347 - 52 ( 1992 ), the cof decreases with increasing load , decreasing contact area and shear strength . as for electrical connectors , coatings or materials constituting both contact surfaces of female and male connectors also contribute to the friction force . application of solid lubricant to only one of these surfaces can be sufficient to substantially reduce required insertion force . additionally , since application to both surfaces can further decrease the insertion force , such application also is within the scope of this invention . thin film coatings and / or coating configurations that can provide cof of preferably lower than about 0 . 2 , more preferably lower than about 0 . 1 , and most preferably lower than about 0 . 08 , are within the scope of this invention . the cr also is affected by the coating configurations discussed above . thin film coatings and / or coating configurations which can provide cr levels of preferably less than about 20 milliohms , more preferably less than about 10 milliohms , and most preferably less than about 8 milliohms , together with the low cof levels described above , are within the scope of this invention . in this example , a thin strip sheet of c2600 brass ( about 0 . 25 cm thick , about 3 . 2 cm wide , and about 60 cm long ) and a coupon of borosilicate glass ( about 0 . 1 cm thick , about 2 . 0 cm wide , and about 7 . 0 cm long ) were used as substrate materials . both substrates were pre - cleaned with acetone , a dilute solution of detergent , rinsed with deionized water , dried in an air stream , and placed on a moving stage in a sputter coating chamber . the cold trap was activated , and the chamber was evacuated to a pressure below 7 . 5 × 10 − 4 millitorr . after this initial evacuation step , the pressure of the chamber was raised to about 25 millitorr by feeding the chamber with about 99 . 999 volume percent pure argon gas . both substrates then were cleaned for about 10 minutes using a dc glow discharge of about 1 , 200 volts . next , the argon pressure was lowered to about 1 . 5 millitorr . the brass and the borosilicate substrates were moved linearly at a distance of about 5 cm above a titanium target that was about 99 . 995 weight percent pure titanium , having rectangular planar dimensions of about 12 . 5 cm width and about 20 cm length , provided by pure tech . this titanium target was driven by a dc sputtering power supply at a power density of about 0 . 8 w / cm 2 , for about 60 seconds . this resulted in deposition of a titanium intermediate layer on the target . next , the mos x - sn thin film was deposited on the titanium intermediate layer . the sputtering target used for this deposition was manufactured by hot - pressing a mixture of mos 2 powder and tin powder at a temperature below about 232 ° c ., to provide a target with a tin content of about 9 weight percent . this composite target having rectangular planar dimensions of about 12 . 5 cm width and about 20 cm length and was provided by pure tech . during the deposition of the coating , this target was driven by a dc sputtering power supply at a power density of about 2 . 8 w / cm 2 . the deposition was achieved at about 1 . 5 millitorr argon pressure by steadily moving the brass and borosilicate substrates linearly at a distance of about 5 cm above the mos 2 - sn target at a speed of about 3 . 81 cm / minute . this resulted in deposition of a mos x - sn layer on the titanium intermediate layer . the cof and the cr levels of the target then were determined by analyzing the mos x - sn coating deposited on the brass substrate , whereas the coating that had been simultaneously deposited on the borosilicate substrate was used in the determination of the coating thickness . a thickness analysis performed using a stylus profilometer ( dektak , model number 3030st , manufactured by veeco instruments ) determined that a mos x - sn composite coating with a thickness of about 0 . 85 μm was obtained on the borosilicate substrate . the cof of this coating on the brass substrate was measured by a tribometer manufactured by csi instruments of switzerland . measurements were done by using a chromium - steel ball counterpart having a diameter of about 1 . 5 millimeter and by applying about 5 newtons normal load to the ball , and moving the sample relative to the ball in a reciprocating mode for 10 cycles at an average speed of about 10 cm / minute . the cr of the mos x - sn on the brass substrate was measured by applying an astm standard b 667 - 97 entitled “ standard practice for construction and use of a probe for measuring electrical contact resistance ”. this measurement was achieved using a platinum probe at about 10 ma with a normal load of about 5 newtons . using these measuring techniques , the cr of this coating was determined to be about 7 milliohms , and the cof to be about 0 . 09 ± 0 . 02 . in this example , a thin sheet of c19210 copper alloy ( about 0 . 03 cm thick , about 2 cm wide , and about 3 cm long ) manufactured by outokumpu co . of finland was used as a substrate material . this substrate was pre - cleaned as described in example 1 . after this step , this substrate and a coupon borosilicate glass as described in example 1 were placed on a turntable in a sputtering chamber . fine - cleaning was carried out using a glow discharge of argon as described in example 1 . after the glow discharge cleaning , the argon flow was stopped , the chamber was repumped , and an intermediate layer of chromium having a thickness of about 0 . 0078 μm was deposited on the substrate by filament evaporation of chromium ( about 99 . 999 weight percent pure , provided by espi inc . of u . s . a ). the mos x - sn thin film was deposited on the chromium intermediate layer using a mos 2 - sn target as described in example 1 , except that the target used in this example had a disk shape with a diameter of about 2 . 5 cm and a thickness of about 0 . 32 cm . this target was driven by a dc sputtering power supply at a power density of about 3 . 75 w / cm 2 . the sputtering was continued for about 17 minutes at about 1 . 2 millitorr of argon pressure . during sputtering , the substrate was rotated at 15 rpm on a turntable placed about 5 cm beneath the target . the thickness of the mos x - sn coating on the borosilicate glass coupon was determined by using the profilometer as described in example 1 . the coating thickness was found to be about 0 . 2 μm . this coating was analyzed for its cr and cof levels as described in example 1 . this coating yielded a cr value of about 3 . 3 milliohms and the cof value of about 0 . 06 ± 0 . 02 . taken together , examples 1 and 2 indicated that both the cr and the cof levels of the mos x - sn thin film could be decreased by decreasing the coating thickness . in this example , a thin sheet of c19700 copper alloy ( about 0 . 03 cm thick , about 2 cm wide , and about 3 cm long ) manufactured by olin co . of u . s . a . was used as a substrate material . this substrate was pre - cleaned as described in example 1 . after this step , this substrate and a coupon borosilicate glass as described in example 1 were placed on a turntable in a sputtering chamber . fine - cleaning was carried out using a glow discharge of argon as described in example 1 . after the glow discharge cleaning , an intermediate layer of titanium having a thickness of about 0 . 015 μm was deposited on the substrate by sputtering of a titanium target ( about 99 . 9 weight percent pure , about 2 . 5 cm diameter and about 0 . 32 cm thick target , provided by pure tech ). this deposition was performed at about 3 millitorr pressure and the substrate rotation speed of about 15 rpm . two sputtering targets were used to deposit the mos x - ti composite coating , one made of mos 2 and the other made of titanium ( both targets were about 99 . 9 weight percent pure , about 2 . 5 cm in diameter and about 0 . 32 cm thick targets , and provided by pure tech ). the mos 2 target was powered at about 3 . 75 w / cm 2 and the titanium target at about 1 . 00 w / cm 2 simultaneously , as the substrates were rotated at a speed in the range of 12 rpm to 15 rpm on a turntable placed about 5 cm beneath the targets , for about 73 minutes . the titanium content of the film was determined by energy - dispersive x - ray analysis ( using a scanning electron microscope , model number jsm - 6401f manufactured by jeol of japan equipped with an x - ray detector , model number 6925 , manufactured by oxford instruments of england ). this coating was found to have a titanium content of about 10 weight percent . the thickness of the mos x - ti coating on the glass coupon — was determined using the profilometer as described in example 1 . this coating was analyzed for its cr and cof levels as described in example 1 . about 1 . 24 sum thick coating of this composite yielded a cr level of about 8 milliohms and the cof level of about 0 . 12 ± 0 . 02 . this coating was found to have slightly higher cof than the mos x - sn composites of example 1 and example 2 . in general , mos x - ti composites are less desirable for use in applications in which a combination of electrical conductivity and low friction is important . this is because of the pronounced ability of titanium to combine with water and oxygen during the deposition process or from the environment after deposition , leading to oxidized titanium , causing increase of the cof and cr . however , mos x - ti composites or in general , mos x - metal composites can be useful for electrical connectors used in services in which wear resistance is as important as low friction and low contact resistance . in this comparative example , a thin sheet of c19700 copper alloy ( about 0 . 03 cm thick , about 2 cm wide , and about 3 cm long ) manufactured by olin co . was used as a substrate material . this substrate was pre - cleaned as described in example 1 . after this step , this substrate and a coupon borosilicate glass as described in example 1 were placed on a turntable in a sputtering chamber . fine - cleaning was carried out by a glow discharge of argon as described in example 1 . after the glow discharge cleaning , the argon flow was stopped , the chamber was repumped , and an intermediate layer of chromium having a thickness of about 0 . 0078 μm was deposited on the substrate by filament evaporation of chromium ( about 99 . 999 weight percent pure , provided by espi inc .). this deposition was performed at a substrate rotation speed in the range of 12 rpm to 15 rpm . two sputtering targets were used to deposit the mos x - sn composite coating , one made of mos 2 and the other made of tin ( both targets were about 99 . 9 weight percent pure , about 2 . 5 cm diameter and about 0 . 32 cm thick targets , and provided by pure tech ). the mos 2 target was powered at about 3 . 75 w / cm 2 and the tin target at about 1 . 35 w / cm 2 simultaneously , as the substrates rotated in the range of 12 to 15 rpm on a turntable placed about 5 cm beneath the targets , for about 29 minutes . the tin content of the mos x - sn coating was determined using x - ray fluorescence analysis ( using an x - ray fluorescence spectrometer manufactured by rigaku , model number zsx ). this coating was found to have a tin content of about 41 weight percent . the thickness of the mos x - sn coating on the glass coupon was determined using the profilometer as described in example 1 . this coating also was analyzed for its cr and cof levels as described in example 1 . a coating about 0 . 77 μm thick yielded a cr level of about 8 milliohms and a cof in the range of 0 . 5 to 1 . 3 . during the cof test , the coating was found to be ineffective at providing low friction . during the test , the chromium - steel ball either punched through the coating , or it caused considerable loss of coating material . this comparative example demonstrated that mechanically poor coatings are obtained at high tin concentrations . although the invention has been disclosed in detail with reference only to the preferred terminal coatings and methods of preparation , those skilled in the art will appreciate that additional coatings and methods fall within the scope of the invention .

US-42033603-A

a fastening device particularly for sports shoes of the type which includes an upper or a shell that have two flaps or a tongue to be fastened by means of laces and / or of a cable . the device includes a plurality of pulley members which are associated with the upper or shell and guide the laces and / or cable . it is thus possible to quickly and easily fasten the flaps even for example at very low temperatures .

with reference to the above figures , the reference numeral 1 designates a sports shoe which comprises an upper or a shell , designated by the reference numeral 2 , which have two flaps or a tongue , designated by the reference numeral 3 , to be fastened by means of laces or a cable , designated by the reference numeral 4 . the reference numeral 5 designates the fastening device , which comprises multiple pulley members 6 which are constituted by a preferably curved plate 7 which has , at one first end 8 , a first hole 9 for coupling it , for example by a rivet , to the upper or shell 2 , preferably in pairs which are arranged approximately mutually opposite with respect to the pair of flaps or tongue 3 . each pulley member 6 has a second end 10 which is directed towards the longitudinal median axis of the shoe and is essentially c - shaped . a pulley 13 is associated between the wings 11a and 11b of said c - shaped end so that it can rotate freely , for example by means of a pivot 12 . the use of the invention is therefore as follows : once the fastening devices have been associated , preferably in pairs , transversely with respect to the shell or to the upper , the laces and / or the cable are inserted between the wings 11a and 11b of the pulley member 6 , so as to arrange them at the groove of the pulley 13 . in this way , the user can apply optimum traction to the cable or to the laces simply by pulling at the loose ends of said cable or laces by virtue of the fact that the pulley substantially reduces friction , allowing optimum distribution of forces when the laces or cable are pulled . it has thus been observed that the invention has achieved the intended aim and objects , a fastening device having been provided which can be applied to sports shoes and allows to tension laces or cables and thus fasten said shoe in a very quick and simple manner even in the worst weather conditions in which such fastening might occur . release is equally easy , as once the ends of the laces or of the cable have been loosened , a simple pressure of the foot instep on the shell or on the upper allows to loosen the traction elements as they can slide at the pulleys . the arrangement of the pulley members 6 at the shell or upper may of course be the most pertinent according to the specific requirements . thus , for example , fig4 illustrates a sports shoe 101 in which some pulley members 106 are associated with the upper or shell 102 and others are associated with a tongue 114 which is frontally associated with said upper or shell . furthermore , in one or more of said pulley members 106 the second end 110 with which the pulley 113 is associated is directed towards the median longitudinal axis of the tongue 114 , whereas in other pulley members the second end is directed towards the lateral edges 115 of said tongue . accordingly , the shoe 101 has , in a conventional manner , a longitudinal extension extending from a toe portion to a heel portion of the shoe , and a median plane extending in the direction of the longitudinal extension between two lateral portions of the shoe . the pulley members 106 as seen in fig4 are connected to one of the lateral portions of the shoe 101 , and in one or more of such pulley members 106 the second end 110 with the pulley 113 is arranged nearer to the median plane of the shoe than is the first end , connected to the shoe , of the pulley members 106 , while in other of such pulley members 106 the first end connected to the shoe is arranged nearer to the median plane of the shoe than is the second end with the pulley 113 . this opposite arrangement of some pulley members 106 allows to provide a different path for the laces or cable 104 and thus ensures a further improvement in their tensioning , in addition to allowing better distribution of the fastening forces . with reference to fig5 - 7 , the reference numeral 201 designates a sports shoe which comprises an upper or a shell , designated by the reference numeral 202 , which have two flaps or a tongue , designated by the reference numeral 203 , to be fastened by means of laces or a cable , designated by the reference numeral 204 . the reference numeral 205 designates the fastening device , which comprises a plurality of pulley members 206 which are constituted by an essentially c - shaped plate 207 between the wings 208a and 208b of which a pulley 210 is associated so that it can rotate freely for example by means of a first pivot 209 proximate to the free ends of the plate 209 . a sleeve 212 is formed at the base 211 of each plate 207 by bending and is arranged along a first axis 213 which lies approximately at right angles to the axis of the first pivot 209 . the fastening device also comprises a means for coupling to said flaps or upper or shell . the means is constituted by a metal wire 214 which is essentially shaped like a triangle in which the base is rotatably freely associated with said sleeve 212 and the vertex 215 is shaped so as to form an eyelet 216 . said eyelet has in turn a second axis 217 which lies approximately at right angles to the first axis 213 and is approximately parallel to the axis of the first pivot 209 ; a second pivot 218 for coupling to said flaps or upper or shell is associated at the eyelet . the use of the invention is therefore as follows : once the fastening devices have been associated , preferably in pairs , transversely with respect to the shell or to the upper , the laces and / or the cable are inserted between the wings 208a and 208b of each pulley member 206 , so as to arrange them at the groove of the pulley 210 . in this way , the user can apply optimum traction to the cable or to the laces simply by pulling at the loose ends of said cable or laces by virtue of the fact that each device can adapt both to the shape of the shoe and spontaneously center itself with respect to the forces involved ; this is possible by virtue of the oscillation of the plate , 207 with respect to the first axis 213 and of the eyelet 216 with respect to the second axis 217 . it is thus possible to reduce friction substantially , allowing the optimum distribution of forces while tightening the laces or the cable . release is easy too , as once the ends of the laces or cable have been loosened , a simple pressure of the foot instep on the shell or on the upper allows to loosen the traction elements as they can slide at the pulleys . the possibility of arranging the pulley members in the desired point of the shell or of the upper , together with the possibility of each pulley member to orientate itself according to the force applied to the cable or to the laces , also allows to further increase the securing force also according to the shape of the foot , by virtue of the self - adaptation of the orientation of the individual elements along the two axes 213 and 217 . fig8 and 9 illustrate a fastening device 305 having a means for coupling to said flaps or upper or shell , constituted by a base 319 from the sides of which two wings 320a and 320b protrude ; a second pivot 321 is freely associated between said wings and can in turn be arranged within the sleeve 312 of the plate 307 , which can thus oscillate freely . the plate 319 also has a first end 322 which lies partially below the plate 307 and a second end 323 that protrudes beyond the pair of wings 320a and 320b ; a through hole 324 is formed on said plate 319 and has a second axis 317 which lies approximately at right angles to the first axis 313 and is approximately parallel to the axis of the first pivot 309 . the number of pulley members , as well as their specific arrangement , their size or their materials , may of course be the most pertinent according to the specific requirements .

US-53026295-A

a multi - stage power plant . the condenser side of the power plant runs the cold water in series through the stages . the boiler side runs the incoming warm water in parallel among the stages . furthermore , it has a separate channel for using warm ocean water to drive a super heater for the boiled refrigerant vapor . means are disclosed for producing large quantities of desalinated water by having the heat transferred from the warm ocean water to the boiler by evaporating and condensing water . means also are disclosed for producing large quantities of desalinated water by having the heat transferred from the condenser to the cold ocean water by evaporating and condensing water .

fig1 presents the theory of operation of this invention as a three - stage otec power plant . it should be understood that there can be more or fewer stages than three . note that stage 1 , stage 2 , and stage 3 are identified on the left of the figure , and the brackets (“ stage 1 ,” stage 2 ,” and “ stage 3 ”) show where the stages are . that is , everything to the right of each bracket is part of the corresponding stage . pipe 1 is where the cold water is brought into condenser 5 . then after the water is warmed , as it condenses some working fluid in condenser 5 , pipe 2 takes the water from condenser 5 to condenser 6 . pipe 3 takes the water from condenser 6 to condenser 7 . pipe 4 takes the water from condenser 7 and discharges the water into the ocean . pipes 8 take working fluid vapor from turbines 9 to the condensers . turbines 9 are all given the same number , even though the higher turbines have different operating conditions due to the different temperatures of the condensers . the generators all have the label number 10 . after the working fluid is condensed in the condensers , pumps 11 pump the working fluid to the respective boilers 12 . after the working fluid is boiled in the boilers , the working fluid vapor flows through pipes 13 into the counter - flow super heaters 14 , where they are heated to about ( for example ) 27 ° c . ( depending on the temperature of the local ocean surface ). notice that the vapor leaving the boilers has a temperature of ( again , by way of typical example ) about 23 ° c . pipes 15 carry the super heated working fluid to the turbines . after the warm ocean water flows down through the counter - flow super heaters 14 , the water exits the bottom of the super heaters through pipes 16 and flows to the lower part of the boilers 12 ; it then is used to pre - heat the working fluid before it is boiled . alternatively , the warm seawater in pipes 16 could be carried to pre - heaters to heat the liquid working fluid before it flows into the boilers . the warm ocean water flows in through pipe 17 . then it flows into the boilers 12 through pipes 18 . warm water also flows from pipe 17 into the super heaters 14 through pipes 19 . the water flows out the bottoms of the boilers 12 through pipes 20 and then flows into the discharge pipe 21 . in addition to generating power , this invention provides methods to produce fresh water from seawater . the inventive methodology uses water vapor as a heat transfer medium . it is , in effect , like a heat pipe . some heat pipes can conduct heat 20 , 000 times a fast as copper . by having water evaporate from a surface , it removes heat from that surface . then the water vapor flows to a boiler surface and condenses on that surface . that deposits the heat into the surface . in fig2 , warm seawater enters from the right through pipe 101 and has connections to the vertical warm water channels 102 . these channels could be tubes or spaces between flat plates . the warm water channels are vertical , and the warm water flows upward in the channels . part of the warm water exits at the top and flows out the warm water discharge pipe 103 . part of the water flows through water distributers 104 and flows as water films 105 down the outside of the warm water channels 102 in the “ vacuum .” the advantage of this design is that the water film can flow down the outside of tubes or down both sides of flat sheets . as the water flows up through the vertical channels 102 , it transfers heat out through the walls , and this heat keeps the water film on the outside hot , and that causes the water to evaporate . the water vapor 107 then flows to the boiler channels 111 , where it condenses and deposits its heat of condensation . most of the water flowing up in the channels flows out the discharge tube 103 to the right and is discarded . by having only part of the water flow down as a film 105 , less air will escape from the water into the vacuum . when the water film gets to the bottom , it is caught by catch troughs 108 and is discarded to a warm water discharge pipe 103 . this warm water discharge can be used to preheat the liquid refrigerant that comes from the condenser on its way to the boiler ( see fig1 ). similarly , the fresh water that is produced is warm , and it can be used to preheat the liquid refrigerant . these actions can reduce the required amount of warm water . as the water vapor 107 flows down to the boiler , it flows between and condenses on the boiler channels 111 and deposits heat in the liquid refrigerant . the liquid refrigerant enters through pipe 110 and flows up the boiler channels 111 . the refrigerant boils and passes out through pipe 116 . from there , it flows to a super heater or flows to the turbine ( e . g ., as seen in fig1 ). also , as the water vapor 107 flows to the boiler , it carries the dissolved air with it . and as the water vapor flows along the surface of the boiler channels 111 , it tends to carry the air with it . when the air gets pushed to the bottom of the chamber 106 , there is a vacuum pump 114 to remove the air through pipe 115 . it is not necessary to pre - deaerate the water before it flows into the evaporator section . only about 5 % of the water enters the vacuum chamber 106 . most of the air is carried out with the water flowing through the warm water discharge pipe 103 . the geometry near the bottom can be designed so that the air is concentrated to a smaller volume , but this is not shown in the figure . the desalinated water flows out pipe 113 . since it is exiting from a partial vacuum , it must be pumped out , unless the vacuum chamber is sufficiently high so that gravity will remove it . it is a good idea to have a thin coat of hydrophilic material on the surfaces , so that the water film tends to spread out all across the surfaces . in fig2 , the water vapor can flow directly down from the evaporator into the boiler , where it condenses on the surface of the boiler and discharges its condensation energy into the boiler . the condensed water flows down and is collected as fresh water . we can have a single unit like fig2 that can feed warm water vapor to all the boilers in the separate stages . or , we can have separate units like fig2 for each stage . we can not only produce fresh water from seawater on the boiler side of the otec plant , as shown in fig2 , but we can also produce fresh water from seawater on the cold water side of the otec plant . its design is shown in fig3 . if it is desirable to produce fresh water on both the boiler side and the condenser sit , it would be necessary to have a separate system like fig3 for each condenser stage of the plant . for this design , a similar system is used to condense the refrigerant vapor that exhausts from the turbines . that refrigerant condenser is placed above the cooler ( water condenser section ) within the vacuum chamber 206 . the refrigerant vapor enters the condenser section through pipe 210 and flows down the inside of the condenser channels 202 . there is a source of cold water entering through pipe 201 . the water flows up through channels 211 and out through pipe 209 . part of the water flows out pipe 203 , which can supply cold water to the next stage or can discharge the cold water . the rest of the water flows up through pipe 220 and then flows through water distributors 204 , that supplies films 205 of cold water running down the outside of the condenser channels 202 . as the refrigerant vapor condenses inside the channels , it releases heat . that heat is absorbed by the water film 205 running down the outside and produces water vapor 207 . the water vapor flows down to the water condenser section , where it condenses on the outsides of cold water channels 211 that contain flowing cold water from deep sea . the condensed water ( films 212 ) runs down and is collected as fresh water through pipe 213 . the water caught in the catch troughs 208 and the fresh water is cold , so it can be directed to the next stage to provide cooling . that will increase the efficiency . again there will be air in the water vapor . it is swept downward with the flow of the vapor and the downward water flow of the water film on the cold water channels . a vacuum pump 214 removes the air and pumps it out pipe 215 . to calculate how much water is desalinated on the cold water side , we can use the equation h c = p ( 1 − e )/ e , but it is simpler just to use the temperature change through the stages . i have written a computer program called otecnew . exe that calculates the efficiency and power . for the three - stage model , rather than use a 6 degree temperature change , i used a 5 . 7 degree change . looking at fig3 , we can see that the heat is transferred by water vapor . for each cubic meter of water that flows through , the amount of heat flow is 5 . 7 calories per gram for one million grams or 5 . 7 million calories . at those temperatures , the latent heat of vaporization ( and condensation ) is about 585 calories per gram so that 9 , 744 grams are evaporated ( and condensed ) per second . that is 2 . 578 gallons per second per cubic meter of water . we multiply that by the number of cubic meters per second ( 49 . 31 ) and get 127 . 1 gallons per second . that is 10 , 981 , 860 gallons per day for one stage . for the three stages , it is 32 . 94 million gallons per day for the 100 mw plant . these calculations were done for the situation in which we multiplied the efficiencies by 0 . 7 to allow for mechanical and heat exchanger losses . for the warm water side , h w = p / e . it should be remembered that the principle concern regards the amount of cold water that must be pumped up from 1 , 000 meters down . for the first stage , p = 1 , 002 , 670 watts per cubic meter of cold water per second . the efficiency ( x 0 . 7 ) is 0 . 0403 . thus h w1 = 24 , 880 , 149 watts . we divide that by 4 . 184 to get the number of calories per second . at the warm water side , the heat of vaporization ( or condensation ) is about 580 calories per gram . that gives 10 , 253 grams or 2 . 71 gallons per second ( per cubic meter of cold water per second ). then we multiply by 49 . 31 to obtain the 100 mw power level ; 133 . 74 gallons per second or 11 . 555 million gallons per day are realized . if the same process is performed for stages 2 and 3 , then there are obtained about 34 . 12 million gallons of fresh water per day from the warm side . adding that to the 32 . 94 million gallons from the cold water side , the total is 67 . 06 million gallons per day for the 100 mw plant . the superheat energy is not used for desalination . if a question remains why the warm water side is multiplied by 49 . 31 ( the amount of cold water per second ), it is because the power p is given by p = h c e /( 1 − e ), and h c is the amount of heat delivered to the cold water when p is equal to 100 mw . to provide added strength to the warm water channels and the boiler channels , these channels may be constructed of extruded aluminum , as shown in an end view in fig4 . the outside surface 401 provides surfaces down which the water film can flow . the cross members 402 provide strength to sustain the pressure within , and they provide extra heat channels to transfer heat between the outside surface and the fluid within . the channels within 403 provide paths in which the fluids may flow . as in the boiler section , the condenser can consist of tubes or structures like fig4 . although specific embodiments have been illustrated and described in this disclosure , it will be appreciated by those of ordinary skill in the art that any arrangement that is calculated to achieve the same purpose may be substituted for the specific embodiment shown . this application is intended to cover any adaptations or variations of the present invention .

US-201414272569-A

a two part , over center buckle for belting . the buckle has a retention member on one part of the buckle which will engage a detent on the second part of the buckle when the buckle is closed . the retention member holds the buckle closed against normal vibration and jarring .

referring to the accompanying drawings in which like numerals refer to like parts and initially to fig1 a buckle according to this invention has a first buckle member 10 with a base 12 and a pair of buckle sides 14 disposed one on each side of the base member and extending upwards at a right angle to the base member . the buckle sides 14 are mounted and extend upward from the base member so as the form an open channel . each of the buckle sides 14 has a projection 16 which extends from one end of the buckle side back towards the center of the buckle and over a rectangular shape opening extending along the side to form a retaining hook . a rectangular slot 18 is also formed in the buckle sides 14 with the slot &# 39 ; s axis approximately parallel to the longitudinal axis of the first buckle member . a sliding retention bar 21 extends transversely across the buckle each end of the retention bar 21 being retained within one of the rectangular slots formed in the buckle sides 14 , the retention bar being mounted for movement along the slot . as shown , the retention bar 21 as a stepped configuration on the side of the bar closest to the center of the buckle member and a toothed surface formed on the opposite surface of the bar . a jam bar 20 has its end permanently affixed to the buckle sides 14 and is located at a point near the sliding bar and parallel thereto . when a belt is looped around the sliding bar and a free end brought back between the sliding bar and the jam bar the sliding bar can be moved to a position near the the jam bar . in this position , the belt will be held firmly between the jam bar and the sliding bar to prevent the belt from loosening . a detent 22 is formed on each side of the first buckle member with a engaging surface 24 located on the bottom side of the detent as viewed in fig1 . the engaging surface 24 can co - act with a second buckle member as set forth below . a second buckle member 26 is formed with a pair of opposed parallel sides 28 having a short stub shaft 29 formed on each side of the second buckle member and extending inward towards the interior of the buckle member . a fastening rib 30 extends transversely across the second buckle member 26 and has one end anchored in each of the sides 28 to firmly hold the rib and sides together . collars 32 are attached to the transverse fastening rib 30 near the side 28 and extend outward from the rib &# 39 ; s surface to keep the belt centered between the collars . a retention rod 34 extends transversely across the second buckle member 26 at the end furthest removed from the fastening rib , each end of the retention rod 34 being attached to one of the individual sides of the buckle member . the retention rod 34 and fastening rib 30 serve to keep the sides 26 of the second buckle member in alignment . a retaining spring 36 is formed in the shape of an open t - section having a pair of parallel extending legs 38 which are anchored in the retention rod 34 and extend longitudinally outward in the interior of the second buckle member . the legs 38 have a transversely extending portion which extends outward toward the sides of the buckle passing through a rectangular aperture 40 formed in the sides 28 of the second buckle member 26 and curving backward through the aperture to form a transversely extending spring arm 42 . referring to fig2 the buckle members of fig1 are shown in an engaged partially closed position with a webbed belt 44 having one end looped around the fastening rib 30 to form a loop , the loop being sewn shut at 46 to form a permanent attachment with the second buckle member . the stub shaft 29 of the buckle member has been placed within the retaining hook of the first buckle member 10 the projection 16 so that the stub shaft is held firmly within the projection allowing the retention rod 34 to be grasped and provide a lever arm for closing the buckle . as shown , once the stub shaft 29 has engaged the projection the retention rod can be grasped and moved in a clockwise direction to close the buckle . in fig3 the buckle is shown in the closed position with the belt 44 having been looped around the sliding retention bar 21 to form a loop 48 with the free end 50 of the belt 44 having been brought back between the sliding retention bar and the jam bar 20 . in order to tighten the belt the belt &# 39 ; s free end 50 can be pulled firmly causing additional belt to be drawn between the jam bar and the sliding bar while the buckle is in the unengaged position . when the buckle is closed the tension on the belt 44 will cause the sliding retention bar 21 to move backwards into the jam bar 20 firmly grasping the free end of the 50 of the belt between the jam bar and the sliding bar to hold it securely in place . as shown , the sliding bar has a serrated surface 52 to provide a more positive grip on the belt and minimize the slippage of the belt back through the jam bar and sliding bar interface when tension is applied to the belt . as shown the retention rod 34 has been moved until the second buckle member lies in a fully engaged position and the retention spring 36 has engaged the detent 22 . the transversely extending spring portion 42 lies below the engagement surface 24 in such a manner that as the second buckle member attempts to rotate counterclockwise to the open position the retention spring will engage the surface 24 holding the buckle in the closed position . the spring arm 42 may be retracted manually to permit the buckle to be opened by lifting the retention rod 34 . i wish it to be understood that i do not desire to be limited to the exact details of construction shown and described for obvious modifications will occur to a person skilled in the art , without departing from the spirit and scope of the appended claims .

US-8288087-A

a magnetic recording element made in accordance with the present invention comprises a layer of magnetic material applied to a carrier formed from a material of high magnetic permeability . a layer of non - ferrous , non - magnetic material is interposed between the carrier and the layer of magnetic material . the layer of non - magnetic material has a thickness between 20 and 40 microns . the magnetic recording element enables sharply defined magnetized domains to be obtained and is in a simple and repeatable fashion , by using a process in which the materials applied to the carrier of the element undergo no chemical transformation . to this end , the non - magnetic layer is produced by successively depositing , on the carrier which is used as a cathode , a first layer of copper obtained from an alkaline electrolytic solution , and then a second layer of copper which is obtained from an acid electrolytic solution .

the magnetic recording element which is shown in fig1 forms part of a magnetic printing machine which is not shown in the drawings since it has no bearing on the invention . the recording element which is used in this machine is formed , as can be seen in fig1 by a rotary magnetic drum 10 . it should , however , be mentioned that the recording element could be of a form different from that shown in fig1 and could , for example , be formed by a magnetic recording tape . it is , however , assumed that this magnetic recording element , no matter what its form , comprises a carrier formed by material having a high magnetic permeability , such as soft iron or steel . thus , in the example illustrated in fig1 the carrier is formed by a cylinder 11 of soft steel . this carrier is coated with a layer of a non - magnetic material 12 which will be discussed below , this layer 12 being covered in turn with a layer 13 of magnetic material . the magnetic drum 10 which is shown in fig1 is driven in rotation by an electric motor 14 . data is recorded on the drum by means of a recording member 15 which is formed in the example being described , by an assembly consisting of a plurality of recording heads 16 which are arranged one beside the other in a line parallel to the axis of rotation of the drum , these heads being positioned close to the surface of the drum . referring to fig2 one of the recording heads is shown in detail . it can be seen that the head 16 includes a magnetic core 17 on which is wound a winding 18 connected to an external electrical energizing circuit 19 . the outline of the magnetic core 17 is such that it has at its ends a recording pole 20 and a flux - closing pole 21 . as shown in fig2 these two poles are situated close to the surface of the magnetic drum 10 , with the result that the magnetic core 17 , the carrier 11 and the two regions 100 and 101 which lie between the core and the carrier and which are at right angles to poles 20 and 21 respectively form a closed magnetic circuit . as can be seen in fig2 where the core 17 is not in contact with the magnetic layer 13 , each of these regions 100 and 101 ( whose boundaries are marked by broken lines in the figure ) consists of three zones , namely : a zone 22 or 23 which , being situated in air , has a low magnetic permeability , a zone 32 or 33 which is situated in the magnetic layer 13 at right angles to a respective one of poles 20 and 21 , and a zone 42 or 43 which is situated in the non - magnetic layer 12 at right angles to a respective one of poles 20 and 21 . it should , however , be mentioned that , in another embodiment , the poles 20 and 21 could be positioned in contact with the surface of the magnetic drum 10 and that under these conditions each of the regions 100 and 101 would then consist of only two zones , zones 22 and 23 being absent . as can be seen in fig2 the width d of the recording pole 20 is very small in comparison with that d of the flux - closing pole 21 . under these conditions , if the electrical energizing circuit 19 transmits a current of intensity i to the winding 18 , this current creates , within the magnetic core 17 , a magnetic field whose mean line of force is represented by the broken line 24 . in the region 100 associated with recording pole 20 , this field is perpendicular to the surface of the magnetic layer 13 and the magnetization of the layer therefore does in fact take place transversely . in zone 32 , the magnetic induction set up by the head 16 is greater than the saturation induction of the magnetic layer 13 and thus causes an elementary magnet to appear in the zone which remains in being even when the winding 18 no longer carries a current . on the other hand , in zone 33 , because the width of the flux - closing pole 21 is greater than that of the recording pole 20 and because , as a result , the cross - sectional area of the magnetic circuit is far greater in zone 33 than in zone 32 , the level of magnetic induction is very much less than the saturation induction of the magnetic layer 13 and so the flux - closing pole 21 is neither capable of causing data to be recorded in the layer 13 nor of causing the data already recorded in this layer to be altered . if , after the magnetic layer 13 has been magnetized in the way which has just been described , a powder consisting of magnetic particles is applied to this layer by means of a known device such , for example , as that which is described and illustrated in french pat . no . 2 , 209 , 322 , this powder is attracted by the magnetized parts of the layer 13 and thus forms on the surface of the layer a pattern which represents the state of magnetization in layer 13 . by way of example , fig4 shows the way in which this powder p becomes distributed when it is applied to a recording element having a magnetic layer 13 covering a layer 12 of non - magnetic material which is in turn deposited on a carrier 11 made of a material of high magnetic permeability , this magnetic layer 13 having first been transversely magnetized by means of the recording head shown in fig2 so that there are formed in the layer 13 a series of elementary magnets a1 , a2 , a3 whose respective axes of magnetization are marked m1 , m2 , m3 . similarly , fig3 shows the way in which the powder becomes distributed when it is applied to a recording element which has been magnetized in exactly the same way as the recording element in fig4 but which , unlike the latter , does not contain a non - magnetic layer . with reference to fig3 and 4 , it can be seen that in the case illustrated in fig3 the boundaries of the domains to which the powder p is restricted are not clearly defined whereas , in the case illustrated in fig4 these boundaries can easily be seen . the result is that , when the recording element produced in accordance with the invention is used in a magnetic printing machine , the characters which are printed appear particularly sharp . however , none of these advantages can be achieved unless the layer of non - magnetic material , which is interposed between the magnetic layer and the carrier made of a material of high magnetic permeability , is sufficiently thick . it is to be found that , if the magnetized domains in the magnetic layer are to be clearly defined , the thickness of the layer of non - magnetic material needs to be at least 20 microns . in the example described , the material which was selected to form the non - magnetic layer was copper , but it is understood that the layer could be made of any other non - magnetic material such as , for example , aluminium , silver , gold , zinc , or even a suitable synthetic material such as , for example , that which is produced by polymerizing the insulating lacquer which is described in french pat . no . 2 , 098 , 620 . it should however , be mentioned that this non - magnetic layer could not be made of a ferrous material , such as ferric oxide , for example , for the reason that such a material could not be covered with a magnetic layer without on the one hand being adversely affected and on the other hand diffusing into the magnetic layer and , thus , altering its characteristics . it should also be pointed out that , if it is to be possible for the magnetic layer 13 to be magnetized properly and in particular for the undesirable effects of eddy currents to be avoided , the thickness of the non - magnetic layer 12 should not exceed a predetermined limiting value which , in cases where the layer 12 is formed from copper , has been found to be forty microns . in addition , it is necessary that the magnetic layer 13 which is then deposited on the non - magnetic layer 12 should have a high coercive field and that its thickness should be at least ten microns . in the example described , this magnetic layer is formed from an alloy of cobalt , nickel , and phosphorous , the ratio between the different constituents of the layer being selected in such a way that the value of the coercive field of this layer is greater than 200 oersteds and may even be as much as 900 oersteds . there will now be described the method which is employed to produce a magnetic recording element which , when it is transversely magnetized , enables precisely defined magnetic domains to be obtained . in what follows , the method is described as it applies to manufacturing a magnetic drum of the kind which is shown in fig1 . to produce a magnetic drum of this kind , a cylinder of soft iron or steel is taken as a basis and is firstly subjected to a preparatory treatment , this treatment comprising the following operations : electrolytic degreasing , using a solution containing sodium cyanide , soda and sodium carbonate , this degreasing being carried on for approximately 1 minute at a current density of the order of 15 a / dm 2 , activation for 1 minute , using a 50 % solution of hydrochloric acid , having undergone this preparatory treatment , the cylinder is then ready to receive a deposit of copper , this deposit being produced in the following way : an akaline copper coating is first produced on the cylinder , which is used as the cathode , employing an electrolyte solution containing copper cyanide , sodium cyanide , sodium carbonate , soda and rochelle salt ( sodium potassium tartrate ), the operation taking place for approximately 2 minutes at a temperature of 35 ° c . and at a current density of 3 . 5a / dm 2 . under these conditions , a layer of copper approximately 2 microns thick is obtained , the cylinder which has been coated with this layer is then rinsed in running water and subjected to neutralization for 10 or so seconds using a 10 % hydrochloric acid solution , after fresh rinsing , the cylinder , coated with a thin layer of copper , is copper plated a second time using an acid electrolytic bath containing copper sulphate , sulphuric acid and phenol , the operating taking place for approximately an hour and a half at ambient temperature and at a current density of the order of 5a / dm 2 . under these conditions a layer of copper is obtained whose thickness is of the order of 24 microns , after rinsing , the layer of copper is dressed mechanically so that its thickness is between 20 and 40 microns , for the reasons indicated above . in the example described its thickness is made equal to 30 microns . the cylinder , having been covered with copper in this way , is again subjected to a preparatory treatment similar to that described above , except that the activation is performed with a 10 % hydrochloric acid solution instead of a 50 % solution . a fresh alkaline copper plating operation is then performed which is similar to that described above , this operation being followed by rinsing . after this , the cylinder so prepared is subjected to preheating and then placed in an electrolysis vat containing a bath capable of depositing on it a magnetic layer which , for a thickness at least equal to 10 microns , has a coercive field of at least 200 oersteds . in the example described , this bath is formed by an aqueous solution containing salts of nickel and cobalt , sodium hypophosphate , ammonium chloride , and boric acid and the deposition of a magnetic layer of cobalt - nickel - phosphorous alloy takes place at a temperature of 40 ° c . for 25 minutes and at a current density of the order of 3 . 5 / dm 2 . in this way is obtained a layer of nickel / cobalt alloy whose thickness is close to 16 microns and which has a coercive field of the order of 600 oersteds . the magnetic layer which has thus been deposited on the non - magnetic layer is then subjected to polishing . after this , the magnetic layer may be coated with a suitable protective layer to protect it on the one hand against the oxidizing effect of the air and on the other hand against the corrosive effects of moisture and of the various acids present in the atmosphere . this protective layer may be formed , for example , by a layer of nickel / tin alloy of the kind which is described in french pat . no . 2 , 051 , 927 . the invention is not , of course , in any way restricted to the manners of putting it into effect described and illustrated , which are given merely as examples . on the contrary , the invention covers all means which form technical equivalents of those described and illustrated when taken separately or in combination and when used within the scope of the following claims .

US-93484978-A

a viscous polymer is passed through a filament or thread forming apparatus and introduced into a flowing solvent . the polymer containing solvent is then passed through a random flow path apparatus where the polymer is broken into fine particles and the solvent and polymer are thoroughly blended . the polymer and solvent leaving the random flow path apparatus may be introduced into a holding apparatus wherein the polymer and solvent are retained until the polymer has gelled .

while the process and apparatus of the invention may be used with any viscous polymers , particular application is found in systems where oil soluble drag reducers are used to reduce friction in hydrocarbon fluids flowing through pipelines or other conduits . oil soluble drag reducers which may be used include , but are not limited to , such materials as polyisobutylene , polyacrylates , polystyrene derivatives , polydimethylsiloxane , polyisopreme , polybutadiene , cyclopentene polymers , and copolymers of cyclopentene with other ethylenically unsaturated hydrocarbons such as isobutene , octene , butadiene and isoprene . particularly desirable drag reducers are high molecular weight non - crystalline hydrocarbon soluble polyolefin homopolymers and copolymers in which the olefin monomers may contain from 2 to 30 carbon atoms . all of the various drag reducing materials and their metholds of preparation are well known in the art . for example , u . s . pat . no . 4 , 493 , 903 to mack discloses a method for producing ultra high molecular weight oil soluble non - crystalline polymers of alpha - olefins . the drag reducers may have molecular weights ranging from 250 , 000 to as high as 5 to 10 million or higher . usually more effective drag reduction is obtained with higher molecular weight materials . polyolefin drag reducers preferably have an inherent viscosity of about 9 to about 18 deciliters / gm which equates to a molecular weight of about 1 × 10 6 to about 30 × 10 6 . the solvents employed with the oil soluble drag reducers are nonpolar and are miscible with such drag reducers . examples of such nonpolar materials are generally the organic solvents , including such materials as saturated and unsaturated hydrocarbons , as for example , hexane , benzene , and mixtures thereof ; liquified petroleum gases ; gasoline ; diesel oil ; and kerosine . it is also within the scope of the invention to use as the solvent a portion of the hydrocarbon stream to which the drag reducer is added for friction reduction . the amount of solvent used with the drag reducer will vary depending on the particular polymer employed and the specific solvent used . ordinarily , the polymer solvent blend will contain from about 1 to about 50 weight percent drag reducer , preferably from about 10 to about 20 percent . the invention is best described by reference to the drawings . fig1 shows an elongated tube or cylinder 2 containing in the upper portion thereof a manifold 6 containing a plurality of small tubes in axial alignment and spaced along the cross section of cylinder 2 . manifold 6 opens into an unobstructed portion 12 of cylinder 2 below which is disposed a mass 14 of wire - like mesh material such as steel wool which is supported on a perforated plate 16 . the manifold shown in fig1 is presented in more detail in fig2 and 3 . referring to these figures , the manifold designated 20 is comprised of upper and lower plates 24 and 26 , which are perforated to receive tubings 22 . the upper and lower plates are held in the proper spaced position by rods 28 . the tubes may be held in plate 24 by soldering , welding , gluing or other suitable means . the tubes extend into or through plate 26 with an annulus between each tube and the plate opening 23 thereby allowing passage of solvent and entrained polymer into the unobstructed portion 12 of cylinder 2 . the dimensions of the annulus are not critical but are of sufficient size to allow the desired flow of solvent . in carrying out the process of the invention , a solvent such as kerosene is introduced through inlet 10 into the area of manifold 6 surrounding tubes 8 . after introduction of the solvent , a viscous polymer , such as a high molecular weight alpha - olefin polymer drag reducer , is introduced to cylinder 2 through inlet 4 and passes into manifold 6 and through pipes 8 . upon leaving the outlets of pipes 8 , the polymer which has been formed into filaments or threads is surrounded by solvent flowing parallel to the exiting polymer , and the mixture of solvent and polymer filaments or threads passes into the unobstructed portion of cylinder 2 . shortly thereafter , the solvent polymer mixture enters the mass 14 of wire - like mesh material , in this instance , steel wool , where the polymer filaments and strands are broken up into small particles of polymer . the solvent containing the small particles of polymer then passes through plate 16 and exits cylinders 2 through 18 . the mesh material used to provide the random flow path for the solvent polymer mixture may be made up of any material which retains its shape and has sufficient strength to withstand the flow of solvent and polymer through it at the velocities encountered in carrying out the process . specific materials which may be used include steel wool , glass wool , wire - like mesh materials made from plastics or rubbers , or other similar materials . glass or metal beads of round or random shape may also be used . as the polymer dissolves in the solvent , it begins to swell and the blend becomes more viscous , eventually forming a gel . if the polymer solvent mixture is not to be used immediately and is stored before the blend has fully gelled , separation between the polymer and solvent can occur , since the solvent density is normally different than the density of the polymer . however , if the size of the polymer particles in the solvent leaving cylinder 2 is sufficiently small , separation may not occur even though the polymer has not completely gelled . to avoid any possibility of separation of the polymer and solvent during storage , the polymer solvent mixture leaving cylinder 2 may be introduced to a holding vessel where the mixture may be retained for a sufficient period of time to assure complete gelling of the polymer . to effect this result , the polymer solvent mixture is introduced to one of the holding vessels shown in fig4 a , 4b , and 4c . each of these vessels is much larger than cylinder 2 so that a substantial holding time for the polymer is provided in fig4 a , the holding vessel 30 is simply a vertical vessel with the polymer solvent mixture being introduced to the bottom through inlet 32 and withdrawn after sufficient holding time through outlet 34 . in fig4 b , the holding vessel 36 contains a series of baffles 38 whereby the solvent polymer mixture entering through inlet 40 is subjected to gentle agitation during the holding time and is ultimately removed from the holding tank through outlet 42 . fig4 c represents a holding tank 44 which is a horizontal vessel containing an inlet 48 and outlet 50 , which can be rotated in the direction shown at 46 by a suitable motor and belt apparatus or other suitable apparatus ( not shown ). if the drag reducer polymer is to be injected into a hydrocarbon pipeline immediately following its passage through cylinder 2 , then the holding tank is not necessary . also , if the solvent employed in the process is about the same density as the drag reducer polymer , then a holding tank probably would not be required . with reference to the manifold 6 contained in cylinder 2 , the size of the openings in tubes 8 will vary from about 0 . 04 inches to about 0 . 125 inches in diameter . the number of tubes 8 contained in the manifold will of course vary depending on the cross section of cylinder 2 and the rate at which polymer is passed through manifold 6 . the length of tubes 8 in manifold 6 may be varied from about 0 . 5 to about 4 . 0 inches . a substantial driving force is required to move the polymer through tubes 8 into the unobstructed portion 12 of cylinder 2 . usually this driving force will be from about 10 to about 1000 psig . the flow rate of solvent in the unobstructed portion 12 of cylinder 2 will vary from about 0 . 5 to about 20 ft / sec and preferably from about 5 to about 10 ft / sec . the flow rate of the solvent is controlled to provide a velocity equal to or greater than the velocity of the polymer leaving tubes 8 so that the solvent in effect exerts a pulling force on the polymer filaments or threads exiting manifold 6 . because of the obstruction to flow provided by steel wool 14 , the velocity of the solvent polymer mixture through steel wool 14 is substantially higher than the flow rate in the unobstructed portion 12 of cylinder 2 . this increased velocity which is usually between about 1 and about 50 ft / sec aids in the process of breaking up the polymer filaments or threads into fine particles . the velocity of the solvent polymer mixture in the holding vessel is so low as not to be significant . the holding time in this vessel usually varies from about 10 to about 60 minutes and preferably from about 15 to about 30 minutes . in any event the holding time is such that the solvent polymer blend has sufficient time to substantially complete gelling before exiting the holding vessel . once the blend of polymer and solvent has completely gelled , the viscosity of the blend is sufficient to keep the solvent and polymer from separating during storage . the apparatus and process of the invention have a number of advantages . for example , the drag reducer - solvent blend can be made on site using an available solvent source such as a slipstream off a pipeline , or stored petroleum . blends can be initiated and completed within 15 minutes or less from start - up time . the process is continuous as compared to batch processes . the rate of blend production can be varied to meet demand . the total apparatus is compact , thus it would take up minimal space on an offshore platform . the various parts of the apparatus of the invention , i . e . the manifold and tubes , the cylinder containing the manifold , the holding tanks , etc . are usually constructed of metals , such as steel or other metal alloys . it is also within the scope of the invention however to use other materials of construction , at least in part , such as glass and industrial plastics and polymers . while certain embodiments and details have been shown for the purpose of illustrating the present invention , it will be apparent to those skilled in the art that various changes and modifications may be made herein without departing from the spirit or scope of the invention .

US-81601391-A

an oxidation process for reducing the data retention loss in a famos device comprising the steps of low temperature deposition of a silicon - enriched silicon oxide over a famos transistor gate stack and annealing said silicon - enriched oxide at a high temperature in oxygen atmosphere to convert said silicon - enriched oxide to a thermal oxide . the silicon enriched oxide acts as both an oxygen getter and diffusion barrier during the annealing step .

the invention will now be described in conjunction with forming a silicon - rich oxide barrier at the gate level of a famos process . it will be apparent to those of ordinary skill in the art that the use of si - rich oxide barrier , according to the invention , can be made any device process level where oxygen gettering is required in order to protect the underlying film or device structure while oxidation is required at the overlying structures . for example , the invention may be used as liner layers for controlling etch characteristics or as a means for controlling transistor vts . the invention is a two - step oxidation process that provides a preliminary , fast , uniform , and low temperature deposition of a layer of silicon - enriched oxide followed by a reoxidation . the term silicon enriched oxide is used to refer to a silicon oxide layer having an excess of silicon atoms . the silicon - enriched oxide is stable and its composition sio x , can be accurately controlled during deposition . the preliminary oxide deposition enables the subsequent thermal oxidation step to be carried out in low pressure conditions and not at extreme temperatures . this assures a precise control of the chemical - physical features of the obtained oxide . the first step of the oxidation process according to the invention may be inserted in a famos process after the formation of a control gate and prior to the source / drain implants . a partially fabricated famos transistor 100 is shown in fig1 . one exemplary famos process will be briefly described . the invention may alternatively be incorporated into other famos processes / structures known in the art . a floating gate dielectric 110 and floating gate ( poly1 ) 112 are formed on a substrate 102 . a low voltage gate oxide 114 ( typically ono ) is then formed over the structure and the control gate stack 116 is formed . for the control gate stack , a second level of polysilicon 118 is deposited followed by the deposition of a tungsten - silicide 120 . the stack 116 is then patterned and etched . the tungsten - silicide 120 is then annealed during which process an oxide 122 is also formed . a self - aligned source ( sas ) etch is then performed resulting in the structure shown in fig1 . the implants are not performed at this time . at this point , the first step of the oxidation process may be performed . a silicon - enriched oxide 130 is deposited over the structure as shown in fig2 . silicon - enriched oxide 130 preferably has a thickness on the order of 300å ( thickness range 200 - 400 angstroms ). a low temperature deposition process is used . by low temperature , it is meant a temperature below that at which thermal oxidation occurs . preferably , this is in the range of 25 ° c . to 600 ° c . exemplary processes include , but are not limited to , plasma assisted chemical vapor deposition ( pcvd ), atmospheric pressure chemical vapor deposition ( cvd ), a low pressure chemical vapor deposition ( lpcvd ), or an energy enhanced cvd . silicon - enriched oxide layer 130 has more silicon incorporated into it than a standard stoichiometric oxide layer . as a result , the refractive index of the layer is increased from the standard 1 . 46 . a refractive index above 1 . 46 and less than 1 . 55 is preferable . increasing the refractive index too high ( by incorporating an excessive amount of silicon ) results in a conductive layer being formed rather than the desired dielectric layer . the silicon - enriched layer 130 may be accomplished in a plasma process by increasing the amount of silane introduced and / or reducing the pressure . one exemplary process for forming the silicon - enriched oxide layer 130 of the invention is performed using a single wafer parallel plate applied materials 5000 precision ™ plasma enhanced chemical vapor deposition ( pecvd ) reactor . the following process parameters may be used : the next step in the standard process is an anneal . the second step ( reoxidation ) of the oxidation process according to the invention is preferably incorporated into this anneal step . alternatively , however , the second step ( reoxidation ) of the oxidation process according to the invention may be incorporated into any one of the subsequent anneals involved in the process . however , performing the re - oxidation process according to the invention after the dopant implants can still induce defects , such as short circuits between the source and drain regions , due to dopant redistribution during high temperature treatments . preferably , this anneal 1 / reoxidation step is performed at a low pressure and a temperature in the range of 600 ° c .- 1200 ° c . for example , a furnace anneal in an oxygen ambient at a temperature on the order of 920 ° c . for a duration on the order of 3 hrs or at a temperature on the order of 1000 ° c . for 5 - 10 min . may be used . during the reoxidation step , the oxygen , diffusing from the gas phase into the silicon - rich oxide 130 , converts any excess silicon in the layer 130 into a stoichiometric ( thermal ) silicon dioxide . thus , the resulting oxide has a better electrical quality than conventional deposited oxides . the transport steps and transport models of the reoxidation step are described further hereinbelow . the reoxidation step can be controlled through the tailoring of the composition of the deposited silicon - enriched oxide ( i . e ., controlling the quantity of excess silicon ) so that the silicon ( including polysilicon ) or silicon substrate is not significantly consumed and that defects are not to be induced therein . during the reoxidation step , the silicon - enriched oxide layer 130 acts both as a diffusion barrier and an as oxygen getter . processing then continues with a source / side ( s / s ) implant ( p ), the self - aligned source ( sas ) implant ( as ), a second anneal ( including cleanup ), a famos drain implant ( as ) and a third anneal . as described above , the reoxidation step may occur at any of these anneal steps . standard interconnect and packaging steps may then be performed . 1 . oxidation at anneal 1 ( post sas etch and pre s / s and sas implants ) ensures oxidation in the absence of implanted species while ensuring repair of the oxidation induced defects . subsequent anneals ( 2 and 3 ) perform their standard ‘ repairs ’ for sas implant ( p , as ) and fd2 implant ( as ) respectively . interference of implanted species ( especially p ) is minimal ( if some oxidation induced damage still exists ) or non existent ( if all oxidation induced damage is repaired ). this could potentially reduce source - drain shorts . 2 . the use of si - rich oxide barrier reduces the oxidation rate due to a reduced chemical potential at the stack / barrier oxide interface . this enables a simultaneous diffusion of o 2 along with a reduced rate of chemical reaction so that oxidation is more uniform within the depth of the stack , rather than limited at the interface . such a process ( with time ) allows similar level of overall oxidation but with more uniformity within the stack thickness . with a stoichiometric sio 2 barrier and , in the limiting case of no barrier , the oxidation is fast and limited to the top few monolayers of the stack . the diffusion is slow compared to the chemical reaction rate . the locations on the stack where aggressive oxidation can cause lifting at the corners due to localized high and uneven oxidation rates are the wsix / poly 2 , poly 2 / ono , ono / poly1 and poly1 / si substrate interfaces . with the use of a si - rich oxide barrier the oxidation is gradual so that lifting or peeling at these edge locations is significantly reduced or eliminated . this could imply better device reliability data . 3 . use of a plasma deposited si - rich oxide barrier is more beneficial than a plasma deposited stoichiometric oxide film because during the re - oxidation / anneal step the excess si in the si - rich film gets thermally converted to stoichiometric oxide . thus , after the oxidation / anneal the oxide barrier now has thermal sio 2 within the si and o atomic layers of the plasma oxide . this enhances the overall quality of the oxide barrier and would be better for drl issues . 4 . the use of an oxide barrier implies that implantation ( both sas and fd2 ) needs to be done through the screen oxide . this scheme thus , has the benefits associated with implantation though a screen oxide . one of these benefits is the reduction of lattice damage caused by implantation . the oxidation process is an unsteady state non - equilibrium process and is best described by means of a transport model explaining the driving force or the chemical potential gradient across the oxide barrier . this is shown schematically in fig3 . o 2 is the diffusing species , and the driving force for oxidation is the chemical potential gradient of o 2 from the gas phase to the wsi x / poly stack . the process margin is defined as the additional reduction in the chemical potential of o 2 across the oxide barrier . the process steps involved are the following : 1 . o 2 from the bulk gas phase diffuses through the gas interface layer s between the silicon enriched layer 130 and the gas , 2 . the diffused o 2 gets adsorbed at the oxide barrier interface i , 3 . the adsorbed o 2 is incorporated at the solid oxide barrier interface i as determined by the equilibrium distribution coefficient for the two media , 4 . the adsorbed o 2 in the solid oxide barrier diffuses across the oxide barrier and chemically reacts with available si within the barrier causing an additional reduction in the chemical potential of o 2 within the si - rich oxide barrier , 5 . the available o 2 after diffusion and reaction within the oxide barrier ( si - rich barrier ) gets distributed at the wsi x ( or poly )/ oxide barrier interface ii as determined by the corresponding equilibrium distribution coefficients , 6 . the o 2 distributed in the wsi x ( or poly ) phase is consumed by chemical reaction by the first monolayers of w , si and poly available from the surface forming corresponding oxides , while also simultaneously diffusing through the atomic layers of the stack , 7 . as the first few atomic layers are consumed during oxidation , the o 2 species following behind have to diffuse through the thermal oxide so formed in order to oxidize the next atomic layers of the stack . thus , this comprises the case of a moving boundary . for the prior art case of a stoichiometeric oxide barrier , the oxygen adsorbed in the solid barrier ( step 4 above ) diffuses across the oxide barrier , without taking part in any chemical reaction , subject only to the chemical potential gradient of o 2 from the gas phase to the interface ii between oxide and silicide ( or polysilicon ) of the gate stack . the transport mechanism is explained by means of fundamental equations defining the chemical potential of the diffusing species , o 2 , and through the gibbs energy of reactions for the associated reactions . from basic thermodynamics , the chemical potential of a species is defined as the partial gibbs energy of the species at a particular temperature and pressure :  μ i = ( ∂ g ∂ n i ) t , p , n j * i  ⇒ μ i  ( t , p , x ) = μ i o *  ( t ) + rt   ln   ϑ i ≈ μ i o *  ( t ) + rt   ln   p i ( 1 . 1 - 1 . 2 ) where , φ i is the fugacity of the species ( o 2 , in this case ) and is well approximated as the partial pressure p i ( where ‘ i ’ implies o 2 ) due to low pressure operation . thus , the driving force for o 2 transfer across a stoichiometric barrier oxide is obtained as δ   μ o 2 i - ii = rt   ln   ( p o 2 i p o 2 ii ) ( 1 . 3 ) δμ o 2 gas - wsix / polystack depends upon the quantity δμ o 2 i - ii . the quantity in equation ( 1 . 3 ) is the process margin gained in the case of a stoichiometric sio 2 barrier oxide . for the case of a si - rich oxide barrier , we must consider a differential element of thickness ‘ dx ’ at a certain position ‘ x ’ from the gas - i interface within the oxide and determine the gibbs energy change due to the reaction : =& gt ; δμ rxn ( x )| x x + dx =− δnrt ln p o 2 ( x ) ( 1 . 4 - 1 . 5 ) integrating the above equation across the oxide barrier between interface i and ii , the chemical potential drop due to the associated reaction ( 1 . 4 ) is calculated as δ   μ o 2  i ii = ∫ x = 0 x = x _   μ o 2  ( x )  x x + dx = - rt  ∫ x = 0 x = x _   n  ( x ) n  ( x )  ln   p o 2  ( x ) ( 1 . 6 ) the quantity in the above equation ( 1 . 6 ) is the added process margin gained by the si - rich oxide barrier over the case of a stoichiometric oxide in equation ( 1 . 3 ). once the diffusion and reaction within the oxide barrier has taken place , the onset of the silicided famos poly stack begins . here several additional reactions occur together with simultaneous diffusion of o 2 through the oxide layer so formed resulting in an inwardly moving boundary . (‘ moose horn ’ equation ) w  ( wsi  x ) + x 2  o 2 = wo x  ⇒ δ   μ rxn wo x = μ wo x - x 2  μ o 2 c - μ w c ( 1 . 7  -  1 . 8 ) si ( wsi x , poly )+ o 2 = sio 2 =& gt ; δμ rxn sio 2 = μ sio 2 − μ si c − μ o 2 c ( 1 . 9 - 1 . 10 ) the quantities μ w c and μ si c are expressed as μ w c ( t , p , x w c )= μ w c0 * ( t )+ rt ln γ w c x w c μ si c ( t , p , x si c )= μ si c0 * ( t )+ rt ln γ si c x si c ( 1 . 11 - 1 . 12 ) where , γ w c and γ si c are activity coefficients of w and si in the solid phases wsi x and / or poly as the case may be , and are complex functions of t , p and composition . with the onset of wsi x oxidation the chemical potential of o 2 increases in the solid phase ( wo x and sio 2 ). the corresponding equations for μ o 2 c buildup due to the onset of oxidation are presented below : μ o 2 c = μ o 2 wo x , c + μ o 2 sio 2 , c =& gt ; μ o 2 c ( t , p , x o 2 )= μ o 2 0 * c ( t )+ rt ln γ o 2 wo x x o 2 wo 2 + μ o 2 0 * c ( t )+ rt ln γ o 2 sio 2 ( 1 . 13 ) where γ o 2 wo x , γ o 2 sio 2 are the activity coefficients of o 2 in the solid phases wo x and sio 2 respectively and are functions of t , p and x o 2 . the quantity μ o 2 0 * c ( t ) is the standard state chemical potential of pure o 2 in the solid phase at a fixed pressure and is a function of t only . the above equations ( 1 . 7 - 1 . 12 ) quantitatively describe rates of oxidations of different atomic species . the oxidation rates of w and si ( including poly si ) in the different layers of the stack depend upon the values for the gibbs energy of reactions as in the equations ( 1 . 7 - 1 . 12 ) above . the lower the gibbs energy of reaction , the more probable is the corresponding reaction . the gibbs energy values depend upon the compositions of the films and the available chemical potential of o 2 at the interface of the films . the oxidation of wsix is governed mainly by the bulk resistivity of the film which presets the value for μ w c , and by the value μ o 2 c . the ‘ moose horn ’ defects that were observed in earlier work during similar re - oxidations done in dmos4 can be well understood and controlled through the equations ( 1 . 7 - 1 . 8 ). these defects are formed when the gibbs energy of reaction ( 1 . 7 ) is low , either due to high μ w c or due to high μ o 2 c or due to both . by the use of a si - rich oxide the value of μ o 2 c is lowered , and by the use of a higher bulk resistivity wsix film the value of μ w c is lower ; both suppressing the ‘ moose horn ’ equation ( 1 . 7 ). with the onset of oxidation μw wo x and μ sio 2 increase , eventually causing oxidation rates for both w and si in the wsix to drop . compared to a pure sio 2 capox , the si - rich capox reduces μ o 2 c thereby raising δμ rxn wo x . however , δμ rxn sio 2 is also raised due to low μ o 2 c . but with the onset of oxidation , μ sio 2 is less to start with . in the case of pure sio 2 capox , δμ rxn sio 2 is low ( due to higher μ o 2 c ) so that si oxidation is higher . but with the onset of oxidation μ sio 2 increases ( and with higher μ o 2 c ) the δμ rxn sio 2 levels off to a value comparable to that for a si - rich capox process . due to this reason the oxidations of both w and si in the silicide will be higher at the beginning of oxidation for a pure sio 2 capox process than for a si - rich capox process . this ‘ process margin ’ can be used to set up a suitable ‘ process window ’ for device performance requirements depending upon the experimental observations of the stack through sem or tem cross sections . theoretically , the ‘ moosehorning ’ phenomena would be less for a si - rich capox process . also , any adverse effect of silicide or poly lifting seen during this stack oxidation would be less for a si - rich capox process . this should also be an important criterion for deciding the process margin for stack re - oxidation . these equations ( 1 . 7 to 1 . 12 ) govern the uniformity of oxidation within the stack depth , and also theoretically indicate the minimization of differential oxidations at the corners of the stack where different layers exist . the preliminary deposition of silicon - enriched oxide enables a larger process margin to be achieved with respect to the subsequent thermal oxidation , namely a larger tolerance as to the chemical - physical processing parameters , in the oxidation process of a silicon containing substrate , with drastic reduction in the economical losses due to defects induced with traditional oxidation techniques and , in the case of manufacturing a famos transistor for flash eprom devices , to low values of drl . the oxidation process according to the invention can be applied in all the productions of silicon devices where it is desired to control the oxidation aggressiveness , such as in building layers for controlling the etching characteristics and in adjusting the mos transistor threshold voltage . while this invention has been described with reference to illustrative embodiments , this description is not intended to be construed in a limiting sense . various modifications and combinations of the illustrative embodiments , as well as other embodiments of the invention , will be apparent to persons skilled in the art upon reference to the description . it is therefore intended that the appended claims encompass any such modifications or embodiments .

US-18237198-A

a process for preparing engineered tailings that are essentially immediately trafficable is provided comprising providing a source of high density sand ; mixing a source of tailings with the high density sand to give a tailings product having at least about 80 wt % solids and a solids to fines ratio of greater than 2 . 0 ; and optionally adding at least one additive to the tailings product if additional strength is required .

the detailed description set forth below in connection with the appended drawings is intended as a description of various embodiments of the present invention and is not intended to represent the only embodiments contemplated by the inventor . the detailed description includes specific details for the purpose of providing a comprehensive understanding of the present invention . however , it will be apparent to those skilled in the art that the present invention may be practised without these specific details . conventional ct production is an integrated process downstream of bitumen extraction , and uses tailings from the extraction process as the source of fft and sand for the ct / nst recipe ; thus , any variations in the extraction process impact ct production . the purpose of ct production is to consume mft and fft to create a land surface reclaimable to upland or wetland vegetation . the theory behind ct is to intersperse fines in a sand matrix . thus , sand is the continuous phase or skeleton and the fines are dispersed throughout the sand matrix . ct starts as a slurry and ends as a semi - solid , loose , silty sand deposit that is dense enough and strong enough to support hydraulic sand capping . in contrast , the present invention is directed to producing engineered tailings ( et ) which decouples its production from the bitumen extraction process to minimize variability by using dewatered sources of sand with a source of tailings . use of dewatered sand ( also referred to as high density sand ) eliminates the need for fluid containment during the consolidation process to produce an immediately trafficable deposit which can be capped and reclaimed . as used herein , the term “ tailings ” means tailings from a mining operation and the like that contain a fines fraction . as used herein , “ oil sands tailings ” mean tailings derived from an oil sands extraction process and include fluid fine tailings ( fft ) from tailings ponds and fine tailings from ongoing extraction operations ( for example , flotation tailings , thickener underflow or froth treatment tailings ) which may or may not bypass a tailings pond . in one embodiment , fft useful in the present invention is centrifuged fft , in - situ fft ( pond bottoms ), dewatered rim ditch fft , thickened fft , or fft that has not been dewatered . as used herein , the term “ sand ” refers to mineral solids with a particle size greater than about 44 μm . the dewatered sand may be sourced from beaches , sand dumps , sand stacking cyclones , filters , screens , sand screws , and the like . as used herein , the term “ sand to fines ratio ( sfr )” is defined as the mass ratio of sand to fines , i . e ., the mass of mineral solids with particle size & gt ; 44 μm divided by the mass of mineral solids with particle size ≦ 44 μm . for use in the present invention , the sand has been previously dewatered . dewatering is commonly known to those skilled in the art and will not be discussed in detail . common dewatering methods involve thickeners , centrifugation , filtration , freeze - thaw , desiccation , underdrainage , and the like . as used herein , the term “ dewatered fft ” refers to fft which has been dewatered to yield tailings having a solids content of greater than about 20 wt %. in particular embodiments described herein , engineered tailings may be produced using a process line or an assembly of components which are compact and relocatable . the components may be mobile , for example by being mounted on driven tracks , or they may be adapted for easy disassembly for periodic moving and reassembly . the term “ relocatable ” is intended to describe both versions . particular embodiments may also include the arrangement of downwardly sequenced components which rely on gravity feed . turning to the specific embodiment shown in fig1 , high density ( dewatered ) sand 10 is dumped into a hopper 12 and is removed from the hopper 12 by a bottom apron feeder 14 at a desired controlled , sustained mass flow rate . the apron feeder 14 transfers the high density sand 10 from the hopper 12 to a lift belt conveyor 16 . the operation of conveyors is commonly known to those skilled in the art and will not be discussed in detail . briefly , a conveyor is formed of individual apron plates that are linked together with hinges on its underside , thus creating a looped carrying surface on which materials can be placed and moved from one location to another . the lift belt conveyor 16 is upwardly inclined , and transports and feeds the high density sand 10 from an elevated discharge point to a slurry preparation unit 18 comprising a chute 20 positioned above a mixer 22 . in one embodiment , the mixer 22 is a rotary mixer . it is understood by a person skilled in the art that any soil mixer known in the art can be used , provided thorough mixing of the sand and tailings is achieved , i . e ., homogeneous mixing is achieved . in one embodiment , the mixer comprises a multi - stage conveyor belt system comprising a number of cascading conveyor belts that can be used to ensure proper and thorough mixing of the sand and tailings . the high density sand 10 flows from the chute 20 into the mixer 22 . tailings 24 , which may or may not be dewatered and an additive 26 are added to the high density sand 10 being fed from the lift belt conveyor 16 to the chute 20 . in one embodiment , the tailings 24 may be transferred from a rototiller mixer 28 to the chute 20 . in one embodiment , a preferred additive or mixture of additives may be selected according to the desired et recipe . suitable additives include , but are not limited to , gypsum , alum , and the like . the high density sand 10 , tailings 24 , and additive 26 combine in the mixer 22 and form product tailings ( et ) 30 , as they proceed downwardly to drop from the mixer 22 onto a stacking lift belt conveyor 32 . the stacking lift belt conveyor 32 is upwardly inclined , and transports and delivers the product tailings ( et ) 30 from an elevated discharge point to an appropriate area . the product tailings ( et ) 30 are stacked to form et deposit 34 . in one embodiment , the et deposit comprises about 83 wt % solids and about 18 wt % fines ( sfr of about 4 . 55 ). this et deposit is formed by combining about 4 portions of sand having about 90 wt % solids and about 7 wt % fines , and about 1 . 5 portions of dewatered fft having about 55 wt % solids and about 90 wt % fines . in one embodiment , the sand is beach sand . in one embodiment , the beach sand has a fines content of between about 5 wt % to about 15 wt % ( sfr of about 19 . 0 to about 5 . 7 ). in one embodiment , the dewatered fft is centrifuge cake . in one embodiment , the et deposit comprises 83 wt % solids and about 11 wt % fines ( sfr of about 7 . 85 ). this et deposit is formed by combining about 4 portions of sand having about 90 wt % solids and about 7 wt % fines , and 1 portion of fft having about 35 wt % solids and about 90 wt % fines . in one embodiment , the sand is beach sand . in one embodiment , the beach sand has a fines content of between about 5 to about 15 % ( sfr of about 19 . 0 to about 5 . 7 ). the hopper 12 , apron feeder 14 , and lift belt conveyor 16 may be mounted on a common structural frame . similarly , the stacking lift belt conveyor 32 and slurry preparation unit 18 ( including the chute 20 and mixer 22 ) may be mounted on a common structural frame . the frames may be preferably mounted for example , on tracks , so that the entire assembly may periodically be advanced to a new location . turning to the specific embodiment shown in fig2 , tailings 24 is obtained from a tailings pond 36 . tailings stream ( s ) produced from bitumen extraction is typically transferred to a tailings pond 36 where the tailings stream ( s ) separates into an upper water layer 38 , a middle fluid fine tailings layer 40 , and a bottom layer of settled solids or sand 42 . in fig2 , the middle fft layer 40 and bottom sand layer 42 are shown side - by - side to illustrate only for clarity . the bottom sand layer 38 is sufficiently dewatered to provide a source of high density sand . the fft layer 40 , which generally comprises about 35 wt % solids and about 90 wt % fines , is removed from between the water layer 38 and bottom sand layer 42 via a dredge or floating barge 44 having a submersible pump 46 . the tailings 24 ( removed fft from fft layer 40 ) and additive 26 ( for example , gypsum ) are mixed and spiked into the sand layer 42 using an auger or rototiller mixer 48 to form an in - situ et deposit directly within the tailings pond 36 . turning to the specific embodiment shown in fig3 , high density ( dewatered ) sand 10 is dumped into a hopper 12 and is removed from the hopper 12 by a bottom apron feeder 14 at a desired controlled , sustained mass flow rate . the apron feeder 14 transfers the sand 10 from the hopper 12 to a lift belt conveyor 16 . the lift belt conveyor 16 is upwardly inclined , and transports and feeds the high density sand 10 to an auger or rototiller mixer 48 . the auger or rototiller mixer 48 is carried by a dredge or floating barge 50 positioned within a tailings pond 52 . the pond 52 is formed of an upper water layer 38 and a bottom , dewatered dense fft layer 54 . in one embodiment , the dense fft layer 54 comprises a solids content of greater than about 40 wt %, with the fines content ranging between about 80 wt % to about 100 wt % ( sfr ranging between about 0 . 25 to about 0 ). the dredge or floating barge 50 within the pond 52 can be moved for example , from the center to the shore and vice versa to enable proper positioning of the auger or rototiller mixer 48 below the lift belt conveyor 16 , thereby ensuring that the high density sand 10 is dropped directly from the lift belt conveyor 16 into the auger or rototiller mixer 48 rather than into the water layer 38 . further facilitating this positioning , the hopper 12 , apron feeder 14 , and lift belt conveyor 16 are mounted on a common structural frame which may be preferably mounted for example , on tracks , so that the entire assembly is mobile and can be moved towards the pond 52 . the high density sand 10 and additive 26 ( for example , gypsum ) are mixed and spiked using an auger or rototiller mixer 48 into the dense fft layer 54 to form an in - situ et deposit directly within the pond 52 . turning to the specific embodiment shown in fig4 , a tailings pond 56 is shown formed of an upper water layer 38 , a dewatered dense fft layer 54 , and a layer of beach sand or failed or segregated subaqueous ct deposit 58 , both of which are pumpable . a dredge 60 having a submersible pump 62 is positioned within the layer of beach sand or failed ct deposit 58 . the beach sand or failed ct deposit 58 is pumped , transported and fed to a stacking cyclone 64 for dewatering to yield an underflow stream of sand 66 and an over - flow stream of water 68 . in one embodiment , the underflow stream of dewatered sand 66 is further screened to provide high density sand comprises a solids content ranging between about 80 wt % to about 95 wt %. the stacking cyclone 64 and , optionally , a screen or any dewatering equipment such as an inclined spiral classifier that allows water to immediately release from the stacking sand ( not shown ) is positioned over an auger or rototiller mixer 48 . the auger or rototiller mixer 48 is carried by a dredge or floating barge 50 , and is positioned within the dense fft layer 54 . in one embodiment , the dense fft layer 54 comprises a solids content of greater than about 40 wt %, with the fines content ranging between about 80 wt % to about 100 wt % ( sfr ranging between about 0 . 25 to about 0 ). the underflow stream of dewatered sand 66 and an additive 26 ( for example , gypsum ) are mixed and spiked into the dense fft layer 54 using an auger or rototiller mixer 48 to form an in - situ ct deposit directly within the pond 56 . the overflow stream of water 68 is recycled back into the water layer 38 . turning to the specific embodiment shown in fig5 , dewatered sand 10 is dumped into a hopper 12 and is removed from the hopper 12 by a bottom apron feeder 14 at a desired controlled , sustained mass flow rate . the sand 10 is slurried with water 70 as it is transferred from the apron feeder 14 into a suitable vessel 72 . the slurry 74 is pumped via pump 76 into line 78 . the slurry 74 is introduced into an auger or rototiller mixer 48 . the auger or rototiller mixer 48 is carried by a dredge or floating barge 50 positioned within a tailings pond 80 . the pond 80 is formed of an upper water layer 38 and a bottom , dewatered dense fft layer 54 . in one embodiment , the dense fft layer 54 comprises a solids content of greater than about 40 wt %, and a fines content ranging between about 80 wt % to about 100 wt % ( sfr ranging between about 0 . 25 to about 0 ). the slurry 74 and additive 26 ( for example , gypsum ) are mixed and spiked into the dense fft layer 54 using the auger or rototiller mixer 48 to form an in - situ ct deposit directly within the pond 80 . from the foregoing description , one skilled in the art , can easily ascertain the essential characteristics of this invention , and without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . thus , the present invention is not intended to be limited to the embodiments shown herein , but is to be accorded the full scope consistent with the claims , wherein reference to an element in the singular , such as by use of the article “ a ” or “ an ” is not intended to mean “ one and only one ” unless specifically so stated , but rather “ one or more ”. all structural and functional equivalents to the elements of the various embodiments described throughout the disclosure that are known or later come to be known to those of ordinary skill in the art are intended to be encompassed by the elements of the claims . moreover , nothing disclosed herein is intended to be dedicated to the public regardless of whether such disclosure is explicitly recited in the claims .

US-201514686195-A

input devices such as computer mice are commonly used for interacting with personal computers . increasingly , wireless computer mice are becoming popular with users due to their ability to provide cordless accessibility for interaction with the pcs . the wireless computer mice are usually powered using batteries and uses radio frequencies for transmitting the users &# 39 ; input to the pcs . the wireless computer mice usually have a fixed transmission power , thus resulting in a fixed transmission range . notably , the battery life and transmission range of the wireless mice share an inversely proportional relationship . hence , a long battery life cannot be obtained without decreasing the transmission range and vice versa . however , existing wireless computer mice typically do not have provisions for making such adjustments . an embodiment of the invention describes an apparatus and a method for managing power usage of wireless input devices .

an apparatus and a method for managing power usage of wireless input devices are described hereinafter for addressing the foregoing problems . for purposes of brevity and clarity , the description of the invention is limited hereinafter to applications related to power usage management of wireless input devices . this however does not preclude various embodiments of the invention from other applications that require similar operating performance . the fundamental operational and functional principles of the embodiments of the invention are common throughout the various embodiments . exemplary embodiments of the invention described hereinafter are in accordance with fig1 to 4 of the drawings , in which like elements are numbered with like reference numerals . fig1 shows a schematic representation of a wireless input device 100 in accordance with a first embodiment of the present invention . the wireless input device 100 is preferably a wireless computer mouse for use in conjunction with a computer 102 . when implemented as a wireless computer mouse , the wireless input device 100 comprises both primary and secondary keys ( not shown ). the primary and secondary keys are operable by a user . yet additionally , the wireless input device 100 also comprises a radio - frequency ( rf ) transmitter 106 , a transducer 108 and an indicator 110 . furthermore , since the wireless input device 100 does not receive power through a cord that typically connects a wired computer mouse to the computer 102 , usage of a battery module 112 integrated with the wireless input device 100 is necessary in order to provide power for operating the wireless input device 100 . batteries used for the battery module 112 are preferably either disposable batteries or rechargeable batteries such as aa - size batteries . the wireless input device 100 further comprises a memory module 113 for storing any miscellaneous profile settings of the wireless input device 100 . the memory module 113 is preferably a semiconductor memory device such as static random access memory ( sram ) or flash memory . the computer 102 preferably comprises a visual display device 114 . the visual display device 114 , which may be a cathode ray tube - type , active matrix display - type or other suitable device , can display a cursor ( or a pointer ) 116 , along with text and other graphical information . the computer 102 further comprises memory 118 , a processor 120 and a keyboard 122 . a rf receiver 124 is also coupled to the computer 102 , and used in conjunction with the wireless input device 100 . specifically , the rf transmitter 106 wirelessly communicates with the rf receiver 124 through a wireless communication link 126 established between the rf transmitter 106 and the rf receiver 124 . the communication link 126 is preferably established using a communication protocol such as bluetooth , wireless universal - serial - bus ( wusb ) or the like . hence , the wireless input device 100 is then able to communicate with the computer 102 in the absence of the cord , which is used conventionally by the wired computer mouse for communicating with the computer 102 . a software application 200 , as shown in fig2 , is provided to the user for varying rate of power consumption of the battery module 112 to thereby vary between a power conservation state and an increased transmission range state . when options provided in the software application 200 are adjusted by the user for operating the wireless input device 100 in the increased transmission range state , the rate of power consumption increases which in turn increases the signal transmission range ( hereinafter transmission range ) but hasten the depletion of power from the battery module 112 . conversely , when the options provided in the software application 200 are adjusted by the user for operating the wireless input device 100 in the power conservation state , the rate of power consumption decreases , which in turn slows down the depletion of power from the battery module 112 but decreases the transmission range . the rate of depletion of power from the battery module 112 determines the life of the battery module 112 . therefore , the life of the battery module 112 and the transmission range have an inversely proportional relationship . in addition , the transmission range shares a directly proportional relationship with the signal strength of the transmitted signals . the rf transmitter 106 comprises a controller ( not shown ) for modulating instruction data received by the rf transmitter 106 into instruction signals . a transceiver may alternatively be used to replace the rf transmitter 106 such that the wireless input device 100 possesses both signal transmitting and receiving capabilities . typically , the transceiver also comprises the controller for modulating instruction data into instruction signals for transmission thereof . the rf transmitter 106 is for transmitting the instruction signals for reception by the rf receiver 124 . when the user adjusts the options provided in the software application 200 , rate of power consumption of the controller is varied . fig3 shows a graph 300 depicting the inversely proportional relationship between the life of the battery module 112 and the transmission range . in addition , a free - space - propagation model governs the relationship between the power at the rf transmitter 106 and the rf receiver 124 . the free - space - propagation model is known as the friis equation , which is expressed as : p r ⁡ ( d ) = p t ⁢ g t ⁢ g r ⁢ λ 2 ( 4 ⁢ π ) 2 ⁢ d 2 ( 1 ) where p t is the transmitted power at the transmitter , p r ( d ) is the received power at the receiver , g t is the transmitter - antenna gain , g r is the receiver - antenna gain , d is the transmitter - to - receiver separation distance , and λ is the wavelength . the friis equation shows that the received power “ falls off ” as the square of the transmitter - to - receiver separation distance . the result implies that the received power decays with distance at a rate of 20 db / decade . hence , increasing the transmission range requires more power for farther transmission of signals and hence the rate of power consumption by the controller is higher , leading to increased usage of the battery power from the battery module 112 . conversely , a decreased usage of battery power by the controller from the battery module 112 can be obtained by decreasing the transmission range since lesser electrical power is required for short distance transmission . to vary the rate of power consumption by the controller , the user adjusts the options in the software application 200 , which allows dynamic alteration of the transmission range of the rf transmitter 106 based on the user &# 39 ; s selection . one or more of the rate of power consumption , the estimated transmission range and the corresponding estimated life of the battery module 112 even during and after adjustment by the user are displayable by the indicator 110 . the indicator 110 is preferably a plurality of light - emitting diodes ( leds ) formed on the body of the wireless input device 100 . when a user depresses or “ clicks ” either the primary key or secondary key of the wireless input device 100 , a switching function is executed . specifically , depressing either one of the primary key or secondary key changes an associated switch state and generates a switching signal that is communicated by the rf transmitter 106 to the computer 102 via the rf receiver 124 . in addition , displacement of the wireless input device 100 relative to a surface is detected and transduced by the transducer 108 into positional signals . the transducer 108 is typically disposed within the wireless input device 100 . furthermore , the transducer 108 is preferably either an optical sensor or a laser sensor . the positional signals are then communicated by the rf transmitter 106 to the computer 102 via the rf receiver 124 for effecting changes on the visual display device 114 , such as text scrolling or moving the cursor 116 . the software application 200 , when executed by the processor 120 of the computer 102 provides the user with the following options : an adjust - rate - of - power - consumption option , a remaining - battery - life indicator , an adjust - transmission - range option and a current - transmission - range indicator respectively . the adjust - rate - of - power - consumption option provides a slider for the user to specify the desired rate of power consumption for the wireless input device 100 . the adjust - transmission - range option also provides the user with a slider to specify if an increased or decreased transmission range is desired . the remaining - battery - life indicator displays an estimated amount of remaining life of the battery module 112 based on the settings defined in the adjust - rate - of - power - consumption option and the adjust - transmission - range option . on the other hand , the current estimated transmission range of the wireless input device 100 is then displayed in the current - transmission - range indicator . furthermore , adjustment made to settings for either the adjust - rate - of - power - consumption option or the adjust - transmission - range option automatically triggers the software application 200 to adjust the settings defined in other options accordingly since the life of the battery module 112 and the transmission range share an inversely proportional relationship . in addition , the remaining - battery - life indicator and the current - transmission - range indicator will also automatically be adjusted accordingly . the various settings as defined by the user in the adjust - rate - of - power - consumption option and the adjust - transmission - range option are then converted into data by the computer 102 and transmitted as control signals to the wireless input device 100 . upon receiving the control signals , the control signals are then decoded by the wireless input device 100 for obtaining the data contained in the control signals . the obtained data are then used by the wireless input device 100 for adjusting the power conservation state and the increased transmission range state as stipulated by the user using the software application 200 . in addition , an “ operating ” profile containing the obtained data is created and stored in the memory module 113 . the “ operating ” profile is retrievable from the memory module 113 by the wireless input device 100 and the settings defined in the “ operating ” profile is applicable for use by the wireless input device 100 whenever the wireless input device 100 is used in conjunction with any computers . alternatively , according to a second embodiment of the present invention as shown in fig4 , a wireless input device 400 similar to the wireless input device 100 of fig1 is implementable . the wireless input device 400 of fig4 comprises an actuator 402 in addition to all the features as described previously for the wireless input device 100 of fig1 . the actuator 402 allows the user to vary rate of power consumption of the battery module 112 to thereby vary between a power conservation state and an increased transmission range state . when the actuator 402 is operated towards the increased transmission range state , the rate of power consumption increases which in turn increases the transmission range but hasten the depletion of power from the battery module 112 . when the actuator 402 is operated towards the power conservation state , the rate of power consumption decreases , which in turn slows down the depletion of power from the battery module 112 but decreases the transmission range . the rate of depletion of power from the battery module 112 determines the life of the battery module 112 . as aforementioned , the relationship of the life of the battery module 112 and the transmission range is inversely proportional to each other . to vary the rate of power consumption by the controller , the user operates the actuator 402 , which allows dynamic alteration of the transmission range of the rf transmitter 106 based on the user &# 39 ; s selection . the actuator 402 is preferably one of a single button , a slider , a switch and a tactile sensor . the tactile sensor is either a capacitive sensor or a resistive sensor . one or more of the rate of power consumption , the estimated transmission range and the corresponding estimated life of the battery module 112 after adjustment by the user are then displayable by the indicator 110 . further , an “ operating ” profile corresponding to a particular desired combination of the transmission range and the rate of power consumption as selected by the user is then created and stored in the memory module 113 . the “ operating ” profile is retrievable from the memory module 113 by the wireless input device 400 and the settings defined in the “ operating ” profile is applicable for use by the wireless input device 400 whenever the wireless input device 400 is used in conjunction with any computers . yet alternatively , the software application 200 is also usable for adjusting the settings of the wireless input device 400 for varying the increased transmission range state and the power conservation state . hence , as opposed to using the actuator 402 , adjustment of the rate of power consumption of controller of the wireless input device 400 of fig4 is performable by using the software application 200 instead . the manner of usage of the software application 200 to the wireless input device 400 of fig4 is similar as to the wireless input device 100 of fig1 as aforementioned . further , the wireless input device 100 of fig1 and the wireless input device 400 of fig4 may optionally perform data transmission using the frame bursting transmission technique . under the frame bursting transmission technique , data transmission is performed in a series of burst transmissions as opposed to the typical continuous transmission . each of the burst transmission is preferably performed within a specified duration and at a specified frequency . consequently , the rate of power consumption from the battery module 112 is further determinable by at least one of the specified duration and the specified frequency of the data transmission performed using the frame bursting transmission technique . the user is able to adjust advanced settings for additional features providable by the wireless input device 100 of fig1 and the wireless input device 400 of fig4 in order to optimize the rate of power consumption of the battery module 112 by the controller during transmission of data . the adjustable advanced settings include frequency of the burst transmission , duration of the burst transmission , required signal strength of the burst transmission and the like . additionally , the user is also able to perform adjustment of the advanced settings through further options provided by the software application 200 . furthermore , the wireless input device 100 of fig1 and the wireless input device 400 of fig4 may optionally provide other advanced techniques for improving the efficiency of data transmission . by improving the efficiency of data transmission , the rate of power consumption of the battery module 112 by the controller is then optimizable . the advanced techniques include data compression , data frames concatenation and the like . in the foregoing manner , an apparatus and a method for managing power usage of wireless input devices are described according to embodiments of the invention for addressing at least one of the foregoing disadvantages . although a few embodiments of the invention are disclosed , it will be apparent to one skilled in the art in view of this disclosure that numerous changes and / or modification can be made without departing from the spirit and scope of the invention .

US-3557908-A

there is provided a process for producing l - valine which comprises cultivating , in a medium , a microorganism which belongs to the genus corynebacterium or brevibacterium , which exhibits a ) an ability to produce l - valine , b ) resistance to l - valine in a medium containing acetic acid as a sole carbon source , and c ) sensitivity to a pyruvic acid analog in a medium containing glucose as a sole carbon source , until l - valine is accumulated in the culture broth , and recovering l - valine therefrom .

microorganisms of the present invention are coryneform glutamic acid producing bacteria that belong to the genus corynebacterium or brevibacterium and exhibit a ) an ability to produce l - valine , b ) resistance to l - valine in a medium containing acetic acid as a sole carbon source , and c ) sensitivity to a pyruvic acid analog in a medium containing glucose as a sole carbon source . microorganisms having such characteristics are derived from glutamic acid producing coryneform bacteria described below : ______________________________________corynebacterium glutamicum atcc 13032corynebacterium acetoacidophilum atcc 13870corynebacterium herculis atcc 13868corynebacterium lilium atcc 15990brevibacterium flavum atcc 14067brevibacterium lactofermentum atcc 13869brevibacterium divaricatum atcc 14020brevibacterium thiogenitalis atcc 19240______________________________________ growth of these strains in a medium containing acetic acid as a sole carbon source is inhibited by l - valine . the microorganisms used in the present invention can be obtained by selecting mutants which do not exhibit sensitivity to l - valine in a medium containing acetic acid as a sole carbon source and l - valine at a concentration to which the parent strain is sensitive , and then selecting , from the resultant mutants , those which are sensitive to a pyruvic acid analog at a concentration to which the parent strain is not sensitive in a medium containing glucose as a sole carbon source . alternatively , the microorganisms to be used in the present invention can also be obtained by selecting mutants which are sensitive to a pyruvic acid analog at a concentration to which the parent strain is not sensitive in a medium containing glucose as a sole carbon source , and then selecting , from these mutants , those which do not exhibit sensitivity to l - valine in a medium containing acetic acid as a sole carbon source and l - valine at a concentration to which the parent strain is sensitive . the invention will be described concretely hereinbelow . first , a parental strain is mutagenized with a usual method such as irradiation with ultraviolet light or treatment with n - methyl - n &# 39 ;- nitro - n - nitrosoguanidine ( referred to as &# 34 ; ntg &# 34 ;, hereinafter ) or with nitrous acid . second , large colonies which have grown in a medium containing acetic acid as a sole carbon source and l - valine , or alternatively small colonies which have grown in a medium containing glucose as a sole carbon source and a pyruvic acid analog , are selected . subsequently , mutants which also possess the remaining characteristics are selected . examples of the pyruvic acid analog which can be used in the present invention include β - fluoropyruvic acid , β - bromopyruvic acid , β - chloropyruvic acid , β - cyclohexylpyruvic acid , β - mercaptopyruvic acid , β - imidazolylpyruvic acid , trimethylpyruvic acid , β - hydroxypyruvic acid , β - ketobutyric acid , etc . the microorganisms of the present invention are characterized by showing resistance to l - valine in a culture medium containing acetic acid as a sole carbon source , and showing sensitivity to a pyruvic acid analog in a culture medium containing glucose as a sole carbon source . they may have , in addition to the above mentioned characteristics , other characteristics such as auxotrophy and resistance to amino acid analogs those of which are known to give the l - valine productivity to microorganisms . strains carrying these multiple mutations can be obtained by successive mutagenesis , or by crossing the strains having different mutation via protoplast fusion . the production of l - valine by a microorganisms according to the present invention can be achieved by a usual cultivation method . as a culture medium to be used , any synthetic medium or natural medium can be utilized , provided that it contains suitable amounts of a carbon source , a nitrogen source and an inorganic substance and trace amounts of nutrients which the selected strain requires . as the carbon sources , carbohydrates such as glucose , glycerol , fructose , sucrose , maltose , mannose , starch , starch hydrolyzate , and molasses ; polyalcohols ; organic acids such as pyruvic acid , fumaric acid , lactic acid and acetic acid , can be used . furthermore , hydrocarbons or alcohols can also be used as a carbon source , depending upon the assimilability of the microorganisms used . as the nitrogen sources , ammonia ; ammonium salts of inorganic and organic acids such as , ammonium chloride , ammonium sulfate , ammonium carbonate and ammonium acetate ; urea ; and other nitrogen - containing compounds , peptone , nz - amine , meat extract , yeast extract , corn steep liquor , casein hydrolyzate , fish meal and digested substances thereof , can be used . as the inorganic substances , potassium dihydrogenphosphate , dipotassium hydrogenphosphate , ammonium sulfate , ammonium chloride , magnesium sulfate , sodium chloride , ferrous sulfate , manganese sulfate , calcium carbonate and the like , can be used . cultivation is carried out under aerobic condition with shaking or aeration . in general , the temperature of the cultivation is in the range of from 20 ° to 40 ° c . preferred that the ph of the medium is maintained around neutrality during the culture . a cultivation period is usually in the range of from 1 to 5 days . after the cultivation is completed , the recovery of l - valine from the culture broth is carried out according to a known method . for example , the cells are removed from the broth and the remaining supernatant is concentrated and crystallized after treating with active charcoal and / or ion exchange resin , etc . the present invention will further be illustrated with reference to examples . corynebacterium glutamicum atcc 13032 was cultivated at 30 ° c . for 16 hours in a complete medium ( prepared by dissolving 20 g of powdery bouillon and 5 g of yeast extract in 1 liter of water , ph adjusted to 7 . 2 ). then the cells were collected and washed with 0 . 05m tris - maleic acid buffer ( ph 6 . 0 ), and then suspended in the same buffer to a concentration of about 109 cells / ml . ntg was then added to a final concentration of 500 mg / l , and the mixture was maintained at 30 ° c . for 20 minutes . thus treated cells were then washed with the same buffer and spread on an agar medium containing 0 . 5 g / l l - valine in a minimal medium of the composition as shown in table 1 . table 1______________________________________ ( composition of minimal medium ) ______________________________________sodium acetate 5 g / l ( nh . sub . 4 ). sub . 2 so . sub . 4 2 g / lnh . sub . 4 cl 3 g / lkh . sub . 2 po . sub . 4 1 g / lk . sub . 2 hpo . sub . 4 3 g / lfeso . sub . 4 . 7h . sub . 2 o 10 mg / lmnso . sub . 4 . 4 - 6h . sub . 2 o 1 mg / l ( nh . sub . 4 ). sub . 6 mo . sub . 7 o . sub . 24 . 4h . sub . 2 o 0 . 04 mg / lbiotin 30 μg / lthiamine hydrochloride 1 mg / lp - aminobenzoic acid 5 mg / lagar 20 g / l ( ph 7 . 2 ) ______________________________________ after cultivation at 30 ° c . for 2 to 4 days , large colonies were picked up . among these colonies , those were selected which grew slowly in the minimal medium containing 5 g / l glucose instead of sodium acetate in table 1 as a carbon source and 6 mg / l β - fluoropyruvic acid ( hereinafter , referred to as &# 34 ; βfp &# 34 ;). thus , corynebacterium glutamicum av1 was selected as high l - valine producer , from these mutants . corynebacterium glutamicum av1 was deposited with the fermentation research institute of agency of industrial science and technology , japan on jul . 12 , 1990 with the accession number of ferm bp - 3006 . table 2 shows the sensitivity of the parent strain atcc 13032 and that of the mutant strain av1 to l - valine and βfp . the sensitivity was evaluated as follows : in the case of the sensitivity to l - valine , a diluted cell suspension was spread on a minimal agar medium of the composition as shown in table 1 containing 0 . 5 g / l l - valine , and in the case of the sensitivity to βfp , a diluted cell suspension was spread on a minimal agar medium containing 6 mg / l βfp and 5 g / l glucose as a carbon source . after incubation at 30 ° c . for 2 days , the sensitivity to l - valine or βfp was judged on the basis of colony size . brevibacterium lactofermentum atcc 13869 was cultivated at 30 ° c . for 16 hours in a complete medium . then , the cells were collected , washed with 0 . 05m tris - maleic acid buffer ( ph 6 . 0 ), and suspended in the same buffer to a concentration of about 109 cells / ml . ntg was added to a final concentration of 500 mg / l , and the mixture was maintained at 30 ° c . for 20 minutes . thus treated cells were then washed with the same buffer and spread on an agar medium of the composition as shown in table 1 containing g / l l - valine . after cultivation at 30 ° c . for 2 to 4 days , large colonies were picked up . among them , those colonies were selected which grew slowly in the minimal medium containing 5 g / l glucose instead of sodium acetate as a carbon source and 6 mg / l βfp . brevibacterium lactofermentum av11 was deposited with the fermentation research institute of agency of industrial science and technology , japan on jul . 12 , 1990 with the accession number ferm bp - 3007 . table 2 shows the sensitivity of the parent strain atcc 13869 and the mutant strain av11 to l - valine and to βfp . the sensitivity to l - valine and βfp was evaluated as in example 1 . table 2______________________________________carbon source l - valine βfp atcc 13032 av1______________________________________glucose - - ++ ++ - + ++ + sodium acetate - - ++ ++ + - + ++ ______________________________________carbon source l - valine βfp atcc 13869 av11______________________________________glucose - - ++ ++ - + ++ + sodium acetate - - ++ ++ + - + ++ ______________________________________ +: added ++: large colonies -: not added +: small colonies corynebacterium glutamicum av1 ( ferm bp - 3006 ) and brevibacterium lactofermentum av11 ( ferm bp - 3007 ) obtained in examples 1 and 2 , as well as their parent strains were inoculated separately into a test tube containing 3 ml of seed medium ( 1 % glucose , 2 % powdery bouillon and 0 . 5 % yeast extract ; ph 7 . 2 ), and cultivated with shaking at 30 ° c . for 24 hours . then , 1 ml of each resultant culture was inoculated into a 300 - ml erlenmeyer flask containing 20 ml of the fermentation medium having the following composition , and was cultivated with shaking at 30 ° c . for 48 hours . after cultivation , the filtrate of the culture broth was subjected to paper chromatography followed by color development with ninhydrin . the amount of the produced l - valine was measured colorimetrically . the results are shown in table 3 . composition of the fermentation medium used is as follows . 8 % glucose , 0 . 1 % kh 2 po 4 , 0 . 1 % magnesium sulfate , 5 % ammonium sulfate , 0 . 2 % urea , 120 μg / l thiamine hydrochloride , 180 μg / l biotin , 12 mg / l feso 4 · 7h 2 o , 12 mg / l mnso 4 · 4 - 6h 2 o , 1 % corn steep liquor , 2 % calcium carbonate , ph = 7 . 2 . table 3______________________________________amount of l - valine produced amount of l - valinestrain ( mg / ml ) ______________________________________atcc 13032 0 . 1av1 3 . 9atcc 13869 0 . 2av11 3 . 6______________________________________

US-45007995-A

an alkaline electrochemical cell capable of providing optimum run times at both high drain rates and low drain rates is disclosed . in one embodiment , the cell &# 39 ; s gelled anode incorporates a limited quantity of zinc powder having specific physical characteristics that enable it to discharge efficiently over a wide range of electrical discharge conditions . the anode may also include an electrolyte that is selected to improve the zinc &# 39 ; s discharge efficiency .

referring now to the drawings and more particularly to fig1 , there is shown a cross - sectional view of an assembled electrochemical cell of this invention . beginning with the exterior of the cell , the cell components are the container 10 , first electrode 50 positioned adjacent the interior surface of container 10 , separator 20 contacting the interior surface 56 of first electrode 50 , second electrode 60 disposed within the cavity defined by separator 20 and closure assembly 70 secured to container 10 . container 10 has an open end 12 , a closed end 14 and a sidewall 16 therebetween . the closed end 14 , sidewall 16 and closure assembly 70 define a cavity in which the cell &# 39 ; s electrodes are housed . first electrode 50 , also referred to herein as the cathode , is a mixture of manganese dioxide , graphite and an aqueous solution containing potassium hydroxide . the electrode is formed by disposing a quantity of the mixture into the open ended container and then using a ram to mold the mixture into a solid tubular shape that defines a cavity which is concentric with the sidewall of the container . first electrode 50 has a ledge 52 and an interior surface 56 . alternatively , the cathode may be formed by preforming a plurality of rings from the mixture comprising manganese dioxide and then inserting the rings into the container to form the tubularly shaped first electrode . the cell shown in fig1 would typically include three or four rings . second electrode 60 , also referred to herein as the anode , is a homogenous mixture of an aqueous alkaline electrolyte , zinc powder , and a gelling agent such as crosslinked polyacrylic acid . the aqueous alkaline electrolyte comprises an alkaline metal hydroxide such as potassium hydroxide , sodium hydroxide , or mixtures thereof . potassium hydroxide is preferred . the gelling agent suitable for use in a cell of this invention can be a crosslinked polyacrylic acid , such as carbopol 940 ®, which is available from noveon , inc ., cleveland , ohio , usa . carboxymethyylcellulose , polyacrylamide and sodium polyacrylate are examples of other gelling agents that are suitable for use in an alkaline electrolyte solution . the zinc powder may be pure zinc or an alloy . optional components such as gassing inhibitors , organic or inorganic anticorrosive agents , binders or surfactants may be added to the ingredients listed above . examples of gassing inhibitors or anticorrosive agents can include indium salts ( such as indium hydroxide ), perfluoroalkyl ammonium salts , alkali metal sulfides , etc . examples of surfactants can include polyethylene oxide , polyethylene alkylethers , perfluoroalkyl compounds , and the like . the second electrode may be manufactured by combining the ingredients described above into a ribbon blender or drum mixer and then working the mixture into a wet slurry . in addition to the aqueous alkaline electrolyte absorbed by the gelling agent during the anode manufacturing process , an additional quantity of an aqueous solution of potassium hydroxide , also referred to herein as “ free electrolyte ”, may also be added to the cell during the manufacturing process . the free electrolyte may be incorporated into the cell by disposing it into the cavity defined by the first electrode . the method used to incorporate free electrolyte into the cell is not critical provided it is in contact with the first electrode 50 , second electrode 60 and separator 20 . a free electrolyte that may be used in the cell shown in fig1 is an aqueous solution containing 36 . 5 % by weight koh . in the bobbin - type zinc / manganese dioxide alkaline cell shown in fig1 , the separator 20 is commonly provided as a layered ion permeable , non - woven fibrous fabric which separates the cathode ( first electrode ) from the anode ( second electrode ). a suitable separator is described in wo 03 / 043103 . the separator maintains a physical dielectric separation of the positive electrode material ( manganese dioxide ) and the negative electrode ( zinc ) material and allows for the transport of ions between the electrode materials . in addition , the separator acts as a wicking medium for the electrolyte and as a collar that prevents the anode gel from contacting the top of the cathode . a typical separator usually includes two or more layers of paper . conventional separators are usually formed either by preforming the separator material into a cup - shaped basket that is subsequently inserted into the cavity defined by the first electrode or forming a basket during cell assembly by inserting into the cavity two rectangular sheets of separator material angularly rotated ninety degrees relative to each other . the conventional preformed separators are typically made up of a sheet of non - woven fabric rolled into a cylindrical shape that conforms to the inside walls of the first electrode and has a closed bottom end . closure assembly 70 comprises closure member 72 and current collector 76 . closure member 72 is molded to contain a vent 82 that will allow the closure member 72 to rupture if the cell &# 39 ; s internal pressure becomes excessive . closure member 72 may be made from nylon 6 , 6 or another material , such as a metal , provided the current collector 76 is electrically insulated from the container 10 which serves as the current collector for the first electrode . current collector 76 is an elongated nail shaped component made of brass . collector 76 is inserted through a centrally located hole in closure member 72 . the composition of the second electrode will now be described in greater detail . a formula for a second electrode suitable for use in a cell of this invention is shown in table 1 . the quantities are expressed in weight percent . the process for preparing the anode includes the following steps . mixing the 0 . 1 n koh solution with the zinc powder . mixing the 32 weight percent koh solution with the gelling agent . the solution is absorbed by the gelling agent . the mixture of zinc powder and 0 . 1 n koh solution is mixed with the gelling agent to form a homogenous mixture wherein the zinc particles are uniformly distributed throughout the mixture . anodes that are suitable for use in a primary ( nonrechargeable ) battery having an alkaline electrolyte are typically manufactured by combining particulate zinc with a gelling agent , an aqueous alkaline solution and optional additives as described above . the ratio of any one ingredient to one or more of the other ingredients can be adjusted , within certain limitations , to comply with various limitations that are imposed by : the processing equipment ; cell design criteria such as the need to maintain particle - to - particle contact ; and cost constraints . with regard to maintaining particle - to - particle contact in mercury free batteries , which are defined herein as containing less than 50 ppm of mercury in the anode , many cell designers have specified using at least 28 volume percent zinc powder in order to maintain particle - to - particle contact between the zinc particles . in contrast to this well known limitation on the volume of particulate zinc , the quantity of zinc in the anode in a cell of this invention can be reduced to less than 28 . 0 volume percent . cells made with less than 27 . 0 volume percent zinc , more specifically 26 . 9 volume percent zinc , were made as described below . anodes made with 27 . 0 volume percent zinc , 26 . 0 volume percent zinc or 24 . 0 volume percent zinc are feasible . the volume percent zinc is determined by dividing the volume of zinc by the volume of the anode just prior to dispensing the anode into the separator lined cavity as will be explained below . the volume percent zinc must be determined before dispensing the anode into the separator basket because a portion of the electrolyte incorporated into the anode migrates into the separator and cathode as soon as the anode is inserted into the cavity defined by the separator . the volume percent zinc is determined using the following procedure . calculate the volume of zinc in a cell by dividing the weight of zinc in the cell by the density of zinc ( 7 . 13 g / cc ). calculate the volume of the anode mix by dividing the weight of the anode mix just prior to disposing the anode mix in the cell by the measured density of the anode mix . then divide the volume of zinc by the volume of the anode mix to obtain the volume percent zinc . the apparent density of the anode mix is determined using the following procedure . weigh an empty container having a known volume , such as 35 cc . dispose a quantity of anode into the container such that the anode completely fills the container . calculate the weight of the anode by weighing the filled container and then subtracting the weight of the empty container . divide the anode &# 39 ; s weight by the volume of the container to get the anode &# 39 ; s apparent density . limiting the quantity of powdered zinc to less than 28 percent of the anode &# 39 ; s volume is believed to be a contradistinction to conventional mercury free cell designs that incorporate only particulate zinc in the zinc powder . reducing the quantity of zinc to less than 28 volume percent is significant because a gelled anode containing less than 50 ppm of mercury must have a minimum volume of particulate zinc in order to establish and maintain particle - to - particle contact between the zinc particles that are uniformly distributed throughout the height and width of the anode . the particle - to - particle contact must be maintained during the entire useful life of the battery . if the volume of zinc in the anode is too low , the cell &# 39 ; s voltage may suddenly drop to an unacceptably low value when the cell is powering a device . the voltage drop is believed to be caused by a loss of continuity between some of the anode &# 39 ; s zinc particles thereby electrically isolating a portion of the anode so that it cannot participate in the cell &# 39 ; s discharge . if the voltage remains low , the cell must be replaced by the consumer . if the voltage quickly recovers to an acceptable value , the device may resume working in a normal manner . however , the consumer could incorrectly perceive the temporary interruption in the device &# 39 ; s performance as a sign that the battery is about to expire and may be motivated to replace the cell prematurely . consequently , cell manufacturers have conventionally used more than the minimum volume of particulate zinc in a mercury free gelled anode in order to insure reliable service throughout the complete life of the battery . zinc useful in a cell of this invention may be purchased from n . v . umicore , s . a ., in brussels , belgium under the designation bia 115 . the zinc is manufactured in a centrifugal atomization process as generally described in international publication number wo 00 / 48260 which published on aug . 17 , 2000 . this publication discloses the composition of the zinc alloy and the manufacturing process used to produce the zinc powder . however , many physical characteristics of the zinc particles are not disclosed . in a preferred embodiment , the zinc powder in a cell of this invention has many of the following physical and chemical characteristics . first , the zinc powder &# 39 ; s particle size is characterized as having a d 50 median value less than 130 microns , more preferably between 100 and 130 microns , and most preferably between 110 and 120 microns . the d 50 median value is determined by using the sieve analysis procedure described in the american society for testing and materials ( astm ) standard b214 - 92 , entitled standard test method for sieve analysis of granular metal powders , and the reporting procedure described in astm d1366 - 86 ( reapproved 1991 ), entitled standard practice for reporting particle size characteristics of pigments . astm standards b214 - 92 and d1366 - 86 ( reapproved 1991 ) are herein incorporated by reference . as used in this document , the zinc powder &# 39 ; s d 50 median value is determined by plotting the cumulative weight percentages versus the upper class size limits data , as shown in astm d - 1366 - 86 , and then finding the diameter ( i . e . d 50 ) that corresponds to the fifty percent cumulative weight value . second , the zinc powder &# 39 ; s bet specific surface area is at least 400 cm 2 / g . more preferably , the surface area is at least 450 cm 2 / g . the bet specific surface area is measured on micromeritics &# 39 ; model tristar 3000 bet specific surface area analyzer with multi point calibration after the zinc sample has been degassed for one hour at 150 ° c . third , the zinc powder &# 39 ; s tap density is greater than 2 . 80 g / cc and less than 3 . 65 g / cc . more preferably , the tap density is greater than 2 . 90 g / cc but less than 3 . 55 g / cc . most preferably , the zinc powder &# 39 ; s tap density is greater than 3 . 00 g / cc and less than 3 . 45 g / cc . the tap density is measured using the following procedure . dispense fifty grams of the zinc powder into a 50 cc graduated cylinder . secure the graduated cylinder containing the zinc powder onto a tap density analyzer such as a model at - 2 “ auto tap ” tap density analyzer made by quanta chrome corp . of boynton beach , fla ., u . s . a . set the tap density analyzer to tap five hundred and twenty times . allow the tap density analyzer to run thereby tapping the graduated cylinder by rapidly displacing the graduated cylinder in the vertical direction five hundred and twenty times . read the final volume of zinc powder in the graduated cylinder . determine the tap density of the zinc powder by dividing the weight of the zinc powder by the volume occupied by the zinc powder after tapping . fourth , the zinc powder has a koh absorption value of at least 14 %. more preferably , the koh absorption value is 15 % or higher . the process used to determine the koh adsorption value is described below in the portion of the specification pertaining to fig5 . in addition to the physical characteristics described above , the preferred zinc is an alloy with bismuth and / or indium and / or aluminum incorporated therein . the preferred quantity of bismuth is between 75 and 125 ppm . the preferred quantity of indium is between 175 and 225 ppm . the preferred quantity of aluminum is between 75 and 125 ppm . within the battery industry , one widely accepted protocol used to evaluate and characterize batteries involves discharging individual cells on predefined electrical test circuits and then recording the length of time the battery can maintain a minimum closed circuit voltage . these “ discharge tests ” are used by battery manufacturers to evaluate the run time of different cell constructions . in order to standardize the evaluation of a battery &# 39 ; s performance on discharge tests , many cell sizes and test regimes have been defined and approved by organizations such as the american national standards institute ( ansi ) and the international electrotechnical commission ( iec ). battery sizes , such as lr6 size batteries , are defined by the iec &# 39 ; s international standard 60086 - 2 , edition 10 . 1 , as having a maximum height of 50 . 5 mm and a maximum diameter of 14 . 5 mm . one publication that describes discharge tests for batteries , such as lr6 batteries , is entitled ansi c 18 . 1 m , part 1 - 2001 — american national standard for portable primary cells and batteries with aqueous electrolyte — general specifications which was published in 2001 by the national electrical manufacturers association . the discharge tests for the lr6 batteries described therein on page 19 are widely accepted within the battery industry as an acceptable way to evaluate a battery &# 39 ; s electrochemical service performance . some of the tests are commonly identified as “ high rate ” tests while others are identified as “ high tech ” tests and yet other tests are known as “ low rate ” tests . in one experiment , several lr6 batteries of the present invention were constructed . the physical arrangement of the cell &# 39 ; s electrodes , separator , closure assembly and container is disclosed in fig1 . the formula used to make the second electrode is disclosed in table 1 . the experimental cells were manufactured as follows . the following cathode materials were mixed together and formed into rings that were inserted into the container thereby forming a tubularly shaped cathode : electrolytic manganese dioxide ( 90 . 96 wt . %); graphite ( 4 . 49 wt . %), aqueous solution of 40 wt % koh ( 3 . 72 wt . %); coathylene binder ( 0 . 44 wt . %); and niobium doped titanium dioxide ( 0 . 39 wt . %). the inner surface of the cathode defines a circular , centrally located cavity . a strip of separator material was rolled and shaped to form a tube having an open end and a closed end . the tubularly shaped separator was inserted into the cavity defined by the cathode . a 6 . 36 gram quantity of the second electrode , having having an apparent density of 2 . 85 g / cc , was disposed into the separator lined cavity . the anode &# 39 ; s volume , 2 . 23 cc , is determined by dividing 6 . 36 g by 2 . 85 g / cc . the quantity of zinc in each cell was 4 . 27 g . the zinc &# 39 ; s volume , 0 . 60 cc , was determined by dividing 4 . 27 g by 7 . 13 g / cc . the volume percent zinc , 26 . 9 %, was determined by dividing 0 . 60 cc by 2 . 23 cc . in addition to the electrolyte contained in the second electrode , another 0 . 96 cc of 36 . 5 % by weigh koh solution was disposed into the separator lined cavity . a first portion of the 0 . 96 cc was injected into the separator lined cavity before the second electrode was inserted . the remaining portion of 36 . 5 % by weight koh solution was injected into the separator lined cavity after the second electrode had been inserted . a closure assembly was then secured to the open end of the container . a terminal cover and label were secured to the outer surface of the container . cells constructed according to the present invention were then discharged on three separate service tests as will be described below . as part of the same experiment , commercially available lr6 batteries from several different manufacturers were also evaluated on the same discharge tests . the test results are shown in fig3 . on each test , cells of this invention provided higher average service than any of the commercially available cells . one of the low rate tests for lr6 size batteries specifies that a battery be discharged across a 43 ohm resistor for four hours and then allowed to rest for twenty hours . the test is continued each day until the battery &# 39 ; s closed circuit voltage drops below 0 . 9 volts which is considered to be the functional end point at which many devices , such as a radio , stop working . as shown in fig3 , when eight cells of the present invention were discharged on the 43 ohm four hour per day test described above , the average run time was 100 . 4 hours . in contrast , the best individual run time ( not shown ) from any of the commercially available cells was 97 . 7 hours . a high tech test for lr6 size batteries specifies that the battery be discharged at 250 milliamps constant current for one hour per day and then allowed to rest for twenty - three hours . the test is continued each day until the battery &# 39 ; s closed circuit voltage falls below 0 . 9 volts . as shown in fig3 , when ten cells of the present invention were discharged on the 250 milliamp constant current test for one hour per day as described above , the average run time was 552 minutes . every cell of the present invention exceeded as least 538 minutes of run time . data in fig3 also shows that commercially available batteries from four battery manufacturers were tested on the 250 milliamp constant current test . the average run time of the commercially available cells ranged from 467 minutes to 510 minutes . a high rate test for lr6 size batteries requires the battery to be discharged continuously at a 1000 milliwatt drain rate until the battery &# 39 ; s closed circuit voltage drops below 1 . 0 volts . as shown in fig3 , when five cells of the present invention were evaluated on the 1000 milliwatt test , the average run time was 60 minutes . all of the cells of the present invention exceeded at least 58 minutes of run time . data in fig3 also shows that commercially available batteries from four battery manufacturers were tested on the 1000 milliwatt test . the highest average run time of the commercially available batteries was 47 minutes . none of the individual commercially available batteries exceeded 49 minutes . all of the battery tests described above were conducted in an environment in which the ambient temperature was approximately 21 ° c . maintaining an ambient temperature between 19 ° c . and 23 ° c . is important because a battery &# 39 ; s run time on a discharge test may increase as the ambient temperature increases and may decrease as the ambient temperature decreases . the extent of the impact of the change in ambient temperature on the run time varies by test . as is well known in the battery manufacturing industry , when batteries are discharged , the exothermal chemical reactions taking place within the battery cause the battery &# 39 ; s temperature to increase . on high drain tests , the temperature on the surface of the cell may exceed 40 ° c . consequently , the cell &# 39 ; s temperature and the ambient temperature may differ substantially and are considered to be two different characteristics . shown in fig2 is a chart of various cell constructions showing the discharge efficiency of the anode on several different discharge tests . as used herein , the discharge efficiency of the anode is determined by dividing the cell &# 39 ; s ampere hour output by the zinc &# 39 ; s theoretical ampere hour input . the zinc &# 39 ; s input is calculated by multiplying the number of grams of zinc by 821 mahr / g . for example , a cell containing 4 . 3 grams of zinc would be considered to have an input of 3 , 530 mahr . if the same cell provided 3000 mahr of output on a discharge test , then the discharge efficiency of the zinc would be 85 %. as can be seen by examining the data shown in fig2 , cells of the present invention had average anode discharge efficiencies that were higher than the average anode discharge efficiencies of five brands of commercially available cells on the low drain , high tech and high drain tests described below . for example , cells of the present invention had an average anode discharge efficiency of 77 . 8 % when discharged on the 43 ohm four hour per day low drain service test . in contrast , samples from five commercially available brands of batteries had average anode discharge efficiencies of 72 . 8 % or lower . the five percent differential , between 77 . 8 % and 72 . 8 % is a substantial and significant increase in discharge efficiency . on the 250 milliamp for one hour per day high tech test , cells of the present invention had an average anode discharge efficiency of 61 . 1 %. the five brands of commercially available batteries had average anode discharge efficiencies of 56 . 4 % or less . on the 1000 milliwatt high drain continuous test , cells of the present invention had an average discharge efficiency of 22 . 8 %. the five brands of commercially available batteries had an average discharge efficiency of 17 . 4 % or less . the 4 . 4 % improvement represents a 25 percent improvement over the best commercially available cells . fig4 is a graph showing the resistivity of several anode mixes versus the weight percent zinc in the anode . the data represents resistivity measurements from eight different anode mixes . each anode mixture contained the same four components shown in table 1 except that the solution contained 36 % by weight koh instead of 32 % by weight koh . however , as the weight percent zinc was varied from 63 % to 72 %, the quantities of the other three components also had to be adjusted . the formulas and measured resistivities for the anode mixtures are shown in table 2 . the resistivities were measured by applying a frequency that ranged from 65 k hz to 1 hz with a small voltage perturbation , such as 10 mv , to a quantity of anode mix trapped inside a cylindrical tube having a constant inside diameter herein designated as d . the length of the tube occupied by the anode is designated l . the anode &# 39 ; s resistance was derived from the impedance data at the high frequency end of the sweep . the resistivity was calculated using the following formula : the resistivities of the five anode mixtures that contained zinc used in a cell of the present invention were used to plot curve 90 in fig4 . the resistivities of the anode mixtures that contained commercially available zinc powder were used to plot curve 92 . the curves in fig4 clearly show that the resistivities of the anode mixtures containing the zinc powder used in a cell of this invention did not increase significantly when the weight percent zinc was reduced below 68 weight % whereas the anode mixtures represented by curve 92 did experience a significant increase from 4 mω · cm to more than 9 mω · cm . since any increase in the cell &# 39 ; s internal resistance results in a decrease in the cell &# 39 ; s run time , there is a definite advantage to using zinc powder that does not cause the anode mixture &# 39 ; s resistivity to increase when the weight percent zinc is decreased below 68 weight %. fig5 shows the koh absorption values for zinc powers using different weight percentages of koh . the following process was used to determine the zinc &# 39 ; s koh absorption value . first , provide a 5 cc syringe and a piece of separator that has been soaked in 32 wt % koh and is appropriately sized to facilitate insertion of the separator into the large open end of the syringe and can be pushed through the syringe thereby blocking the smaller opening in the opposite end of the syringe . second , weigh the syringe and separator containing absorbed electrolyte . third , dispose two milliliters of a 32 % by weight aqueous koh solution into the large open end of the syringe while blocking the flow of the electrolyte through the smaller opening in the opposite end of the syringe . fourth , a known quantity of particulate zinc , such as five grams , is carefully weighed and disposed into the open end of the syringe . the shape of the container , the volume of the solution and the volume of the zinc must be coordinated to insure that all of the zinc particles are fully submerged beneath the surface of the aqueous koh solution . fifth , an additional 1 . 5 cc of 32 % by weight koh solution is introduced into the container to insure that the zinc is fully covered with the solution . sixth , the koh solution is allowed to drain through the small opening at one end of the syringe for 120 minutes by orienting the syringe in a vertical position and removing the object that blocks the small opening . to insure that there are no droplets of unabsorbed solution trapped between the particles of zinc , the container is lightly tapped several times onto a paper towel until no additional koh solution is observed landing on the paper towel . seventh , the combined weight of the zinc with the solution adsorbed thereon , the syringe and the separator is then determined . the quantity of electrolyte solution adsorbed onto the surface of the zinc is determined by subtracting the weight of the dry zinc particles , wet separator and syringe from the combined weight of the syringe containing zinc with adsorbed electrolyte thereon and the wet separator . the koh absorption value is determined by dividing the weight of the koh adsorbed onto the zinc by the weight of the zinc particles prior to disposing them into the solution . in fig5 , curve 94 represents the koh adsorption values for zinc useful in a cell of this invention . curve 96 represents the koh adsorption values for commercially available zinc . although the weight percent koh in the adsorbed solution was varied from 30 % to 40 %, the quantity of solution adsorbed by the zinc useful in a cell of this invention was at least 14 %. furthermore , the koh adsorption for the same samples exceeded at least 15 %. in contrast , the koh adsorption for the commercially available zinc did not exceed 13 %. the koh adsorption value of a particular zinc powder is believed to be one of several measurable characteristics that are useful in identifying zinc that would be useful in a cell of this invention . the above description is considered that of the preferred embodiments only . modifications of the invention will occur to those skilled in the art and to those who make or use the invention . therefore , it is understood that the embodiments shown in the drawings and described above are merely for illustrative purposes and are not intended to limit the scope of the invention , which is defined by the following claims as interpreted according to the principles of patent law , including the doctrine of equivalents .

US-71383303-A

the present invention is embodied in a method and apparatus for improving a delay line circuit of a digital delay lock loop circuit . each delay stage of the delay line consists of three gates , two nands and one inverter . the reduction in the total number of gates decreases the unit delay time for each stage , improving the resolution of each stage of the delay line . in addition , the reduction in the total number of gates in each stage significantly reduces the amount of space necessary for the circuitry of the delay line , resulting in an overall decrease in the size of the ddll circuit .

the present invention will be described as set forth in the preferred embodiments illustrated in fig4 - 8 . other embodiments may be utilized and structural or logical changes may be made without departing from the scope of the present invention . fig4 illustrates in schematic diagram form a delay line circuit 400 in accordance with the present invention . a clk in signal is input at node 410 . the delay circuit 400 of pig . 4 consists of a series of n delay stages , each stage consisting of two nand gates and one inverter . each stage is either an odd stage or an even stage , depending upon its position in the line . thus , the first stage 401 is an even stage , the second stage 411 is an odd stage , a third stage ( not shown ) would be an even stage , etc . even stage 401 consists of nand gates 405 , 406 and inverter 407 . nand gate 405 acts as a switch connecting together upper delay line 402 and lower delay line 403 . the transistor gates of nand switch 405 become the load for the upper delay line 402 . shift register 415 provides a signal to open or close nand switch 405 . the delay of the lower delay line 403 slightly exceeds that of the upper delay line 402 . this delay difference becomes the unit delay time of the delay line circuit 400 . by reducing the gate count of the unit delay to one gate , i . e . inverter 407 , the unit delay time td is reduced to approximately 50 picoseconds . by reducing the unit delay time td , the resolution of each stage is increased . fig4 a illustrates in block diagram form the functioning of the circuit 400 of fig4 . each unit delay 450 , 451 , 452 , 453 , 454 in upper delay line 402 has a delay time of td , and each unit delay 460 , 461 , 462 , 463 , 464 in lower delay line 403 has a delay time of td + δ , where td is the unit delay time of the delay generator . these unit delays 450 - 454 and 460 - 464 are serially connected through switches 470 , 471 , 472 , 473 , and 474 . if only switch 470 closes , the circuit generates a delay of 5 ( td + δ ) from in node 440 to out node 499 . similarly , if switch 471 closes , the circuit generates a delay of td + 4 ( td + δ ) from in node 440 to out node 499 . since the unit time delay of the circuit 400 is now 50 picoseconds as compared to the prior art of 200 - 300 picoseconds , the resolution of the delay time is significantly increased . another aspect of the structure of delay stage 401 of delay circuit 400 is that because of the relatively low number of gates , it provides substantially symmetrical pulse widths for the input signal and output signal . this is depicted in fig5 b , where pw1 ′ is very close to pw2 ′. this is a significant advantage over the prior art shown in fig3 where each delay stage consists of five gates . because the transistors forming the inverters and the nand gates in each delay element do not have identical rise and decay times , the signal at the output of the prior art delay line circuit 300 has asymmetrical rising and falling edges as compared to the input signal . the output signal will therefore differ in pulse width from the input signal , leading to inaccuracies . a further aspect of the structure of delay line circuit 400 is the significant reduction in the amount of gates necessary to implement the delay line . each stage of the delay line circuit 400 consists of a total of three gates , i . e . two nands and one inverter . each stage of the prior art line delay circuit 300 consists of five total gates , i . e . three nands and two inverters . the reduction of the total number of gates from five to three by the present invention allows the delay line circuit 400 to occupy approximately 40 % less space than the prior art circuit 300 . this results in significant savings when each stage is replicated 50 - 100 times to target a clock input frequency of 100 mhz . in order to implement the delay line circuit 400 into a ddll , it is necessary to precharge the first stage of the delay line by toggling the first stage input at node 420 between a high logic level , i . e . “ 1 ”, and a low logic level , i . e . “ 0 ”, for every cycle that a new switch is enabled over the previous cycle . when the switch selected is an even switch , node 420 must be precharged to a logic high level , i . e . “ 1 ”. when the switch selected is an odd switch , node 240 must be precharged to a logic low level , i . e . “ 0 .” fig6 illustrates in block diagram form a ddll circuit 600 which uses the delay line circuit 400 in accordance with the present invention . ddll circuit 600 consists of delay line circuit 400 , shift register 605 , phase detect 610 , and control circuitry to perform the necessary precharging of the first stage of delay line circuit 400 , which consists of a gate 620 , which can be either an or gate as shown or an exclusive or ( xor ) gate , and t flip - flop 621 . the precharging is done in the following manner . the shift left ( sl ) and shift right ( sr ) signals sent from the phase detect circuit 610 to shift register 605 are input into the gate 620 . the output of gate 620 is input into t flip - flop 621 . the output of t flip - flop 621 is connected to node 420 of delay line circuit 400 . t flip - flop 621 will maintain its binary state , i . e . either a “ 0 ” or a “ 1 ” until directed by the input signal from gate 620 to switch states . in order to select a new switch in delay line circuit 400 , phase detect 610 will send a signal to shift register 605 , indicating either a shift left ( sl ) or shift right ( sr ) depending upon the shift required to synchronize the clock pulses . the signals on the sl and sr lines are input into the gate 620 . if either of the output lines from the phase detect goes high , indicating a shift is required and a new switch is being chosen , the output of gate 620 will cause the t flip - flop 621 to change states , i . e . toggle . if no shift is necessary , a new switch need not be selected , and t flip - flop will not toggle . thus , the appropriate signal will be applied to the input node 420 of delay line circuit 400 . fig7 shows printed circuit board ( pcb ) 700 with multiple ics 701 , 702 , 704 having differences in the phases of the ic generated internal clocks . ddll 703 operates to align the phases of the internally generated clock signals of ics 701 and 702 utilizing a delay line according to the present invention . pcb 700 could be used in a computer system where one of ics 701 and 702 is a microprocessor and the other is a memory device , a storage device controller , or an input / output device controller . a typical processor system which includes a ddll according to the present invention is illustrated generally at 800 in fig8 . a computer system is exemplary of a device having digital circuits which require synchronization of the components in the system . other types of dedicated processing systems , e . g . radio systems , television systems , gps receiver systems , telephones and telephone systems also contain electronic circuits which can utilize the present invention . a processor system , such as a computer system , generally comprises a central processing unit ( cpu ) 844 that communicates to an input / output ( i / o ) device 842 over a bus 852 . a second i / o device 846 is illustrated , but may not be necessary depending upon the system requirements . the computer system 800 also includes random access memory ( ram ) 848 , read only memory ( rom ) 850 , and may include peripheral devices such as a floppy disk drive 854 and a compact disk ( cd ) rom drive 856 which also communicate with cpu 844 over the bus 852 . a ddll circuit 860 in accordance with the present invention as described with respect to fig6 is included in the system . utilizing the method of the present invention , the phases of the internally generated clock signals of the ics in each of the devices can be aligned . it must be noted that the exact architecture of the computer system 800 is not important and that any combination of computer compatible devices may be incorporated into the system . reference has been made to preferred embodiments in describing the invention . however , additions , deletions , substitutions , or other modifications which would fall within the scope of the invention defined in the claims may be found by those skilled in the art and familiar with the disclosure of the invention . any modifications coming within the spirit and scope of the following claims are to be considered part of the present invention .

US-45553799-A

the following describes data structures , communication protocol formats and process flows for controlling and facilitating secure communications between the nodes of a mesh network , such as utility meters and gateway nodes comprising a utility network . the enabled processes include association , information exchange , route discovery and maintenance and the like for instituting and maintaining a secure mesh network .

the following charts of terms and acronyms are intended to define the frequently used terms in the context of the preferred embodiments of the present invention . the definitions provided are not intended to define the entire scope of the term . one skilled in the art appreciates the various alternatives and variations that are clearly within the scope of the invention as described . association router — router selected by a node which is not yet a member of the network , to act as a proxy to send the node &# 39 ; s association request . child — in the context of tree routing , all routers in single - hop radio frequency ( rf ) contact with a reference router , with a hop count greater than the hop count of that reference . in the context of end devices , a child refers to an end device of a specific router through which it sends and receives messages . dedicated router — a router manually configured to associate to a specific network to guarantee that the network covers a specific geographical region . device key — a key unique to the device . the initial device key is assigned by its manufacturer and is unchangeable . a database for device ids and initial device keys is made available to the system owner and is installed in the network &# 39 ; s configuration host . a device key generated by a configuration host should be known only to the configuration host and the device . device keys are used only for securing application layer communication between the configuration host and the device . as such , they are not directly part of the sm protocol , which encompasses only the data link layers . key id — keys are updated from time to time ; the specific generation of key is identified within this specification with a single bit key id , which is the low - order ( even / odd ) bit of the actual key generation count . key type — each key type has a specific usage , scope and is associated to a specific management process . this specification supports three key types : the maintenance key , the mesh key and the node key . maintenance key — this key is shared by all the devices in all pans that are administered by a single configuration host . the maintenance key is used for association request / response messages and maintenance device point - to - point - secured communication messages . the maintenance key can be factory - assigned or is assigned by the configuration host ; it can be updated by a coordinator . mesh key — this key is used for all dll mic calculations , except those secured by the maintenance key . it is also used for the network mic when the message is broadcast through the mesh or when the network security is used for device - to - device communication . the mesh key is common throughout a pan , and to all interconnected pans that are configured to support inter - pan communications . the mesh key is assigned and updated by the coordinator . network name — name assigned to a mesh network . network names are typically assigned using a dot separated hierarchy with the first level representing all mesh networks forming a single ami network . the typical format of a network name is “ utility . area . coordinatorid ”. node key — a unique key assigned to a device and used for secure communication between the coordinator ( s ) and the device . it is primarily used for the network mic header calculation and for encrypting keys distributed by the coordinator . the node key is initially assigned by the configuration host but it can be updated by either the configuration host or the coordinator . node type — refers to the class of sm node : coordinator (= 11 b ), router (= 10 b ), or end device (= 01 b ). originator count — the originator count , orig . count , is used as the nonce in the network security header . its value is the same as the source count value at the time the message is originated . parent — in the context of tree routing , all routers that have a direct rf link with a reference router and that have a hop count less than the hop count of that reference router . in the context of an end device , the router used to send and receive messages on behalf of this end device . frame — a network layer message that can traverse one or many hops . sm coordinator — referenced within this document as coordinator ; this node responsible for initializing the network , accepting association requests and assigning unique short addresses . sm end device — referenced within this document as end device ; this node is not capable of routing messages and can communicate only through its parent . an end device can be either always be listening or wake up periodically to synchronize with its parent in order to minimize energy . sm router — referenced within this document as router ; this node is capable of managing routes and routing messages . sibling — in the context of tree routing , all routers that have a direct rf link with a reference router with a hop count equal to the hop count of that reference router . sleeping end device — a sleeping end device reduces it average power consumption by turning itself off for periods of time . it requires a parent to store frames for it while it is sleeping . a sleeping end device cannot be used for routing . source count — the source count , also referenced as src . count , is used as the nonce in the dll security header . the source count is incremented with every message transmitted by the device . dll — data link layer ; the data link layer provides device - to - device networking services in conjunction with the ieee 802 . 15 . 4 mac . for the sm system the dll provides hop - by - hop security . lqi — link quality indicator ; a value based on the signal strength and other quality aspects of the received signal . lqi class — link quality between two nodes expressed as four different classes : good (= 11 b ), normal (= 10 b ), poor (= 01 b ) and no connectivity (= 00 b ). pan — personal area network , the ieee 802 . 15 . 4 name for one of its networks , whether for personal use or not . the following describes the message formats and the processes implemented by the securemesh protocol ( hereafter “ sm protocol ”) within a securemesh network ( hereafter “ sm network ”). referring to fig1 , the sm protocol in conjunction with the ieee 802 . 15 . 4 mac layer implement the open systems interconnection (“ osi ”) data - link . an exemplary sm network topology is shown in fig2 and is composed of a coordinator 15 , routers 20 and end devices 25 ( generically referred to as “ nodes ”). the preferred routes 30 between routers 20 create a tree for which the root is the coordinator 15 . each node can be a member of trees of different adjacent networks , though any single network has only a single coordinator . a sm network may include non routing nodes called end devices which are associated to a preferred parent through which messages are sent and received . the sm protocol also supports routing of messages using alternate routes 35 when a preferred parent fails ; this process is called local repair . in the preferred embodiments of the present invention , the nodes typically include utility meters and related devices , but the invention is not limited as such . the transmission of messages between nodes defined by the sm protocol is governed by the following rules : ( 1 ) fields are transmitted in their order of definition , from left to right when represented in a frame format diagram ( see , for example , fig3 - 5 ), or from top ( first ) to bottom ( last ) when listed in a table ; ( 2 ) all multi - octet fields are transmitted least significant octet first ( little endean ); ( 3 ) binary or string fields are transmitted serially starting at index zero . for backward compatibility reasons , short and long addresses can be configured as multi - octet fields transmitted least significant octet first , as specified by ieee 802 . 15 . 4 , or as binary fields transmitted serially . the transmission order of the addresses is controlled by the configuration parameter address_tx_order . a critical process to sm network formation is the association process . the association process is used by nodes to become a member of an sm network or to evaluate their current association state . the association process incorporates the following primary functions : selection of a pan ; selection of an association router to proxy messages ; association with the coordinator and the reception of a short address assignment ; and construction of the initial neighborhood table . as a first step in the association process , each device ( referred to as a node once associated ) must be commissioned with the network &# 39 ; s node key and the network &# 39 ; s maintenance key prior to associating with a network . the key commissioning process for a particular device is determined by the device &# 39 ; s application . for example , the device may be configured at manufacturing , or by a maintenance tool , or through the service request and service response messages described in below . a quick summary of the association process is described , with a follow - on detailed description . a neighbor info request is transmitted on each channel to locate and get information about neighbor nodes and neighbor sm networks . all nodes receiving the neighbor info request respond with a neighbor info response . a particular sm network is selected based on an association ratio algorithm , discussed further below . an association router , which is a member of the selected sm network , is selected based on the preferred route ratio algorithm , also discussed below . an association request is transmitted to the selected association router by the requesting device . when the association router is not the coordinator , the association request is repackaged and forwarded in the form of an association confirmation request message to the coordinator , using tree routing . if the association confirmation request is received and validated , the coordinator sends back the assigned short address in an association confirmation response message , which is then repackaged and sent to the device as an association response message . similarly , when the coordinator receives the association request directly , it returns its response directly in an association response . in the specific case of a successful association ( i . e . the association status within the association response is set to successful ), the node sends a neighbor exchange message with the immediate broadcast requested option set ( discussed below ) on the just associated sm network . as a result , this causes surrounding neighbors to broadcast a neighbor exchange message using a pseudo - random period within neighbor_ex_rnd_period , thus allowing the node to populate its neighborhood table right away . device association is started with the neighbor information request process shown in fig3 . node - a initiates the process with a neighbor info request that is broadcasted on a channel and received by other nodes in the neighborhood that are listening to that channel . each node receiving the message responds at a pseudo - random time in the interval given by the parameter neighbor_info_resp_time . the ieee 802 . 15 . 4 mac , known to those skilled in the art and described in numerous publicly available documents , resolves most collisions that occur due to nodes selecting the same response time . node - a waits for the interval neighbor_info_resp_time to receive all neighbor info response messages from its neighbors . once the node has received neighbor ( s ) information , it can start the association process . in fig4 , node - a is in the neighborhood of the coordinator for pan 1 . as it receives neighbor info response messages , it uses the association ratio algorithm and the preferred route ratio algorithm to select pan 1 and the coordinator for pan 1 as its parent . in this case it sends its association request directly to the coordinator and gets the association response back . node - a expects to get a response back within a time period established by the association_resp_time parameter . this process is repeated on each available channel . if the associating node is not in the neighborhood of the coordinator , it uses a neighbor to proxy the association request . fig5 shows this proxy process . node - a receives a number of neighbor info response messages . it uses the association ratio algorithm and the preferred route ratio algorithm to select the coordinator for pan 1 and node - b as its best neighbor for the pan . node - a then sends node - b the association request message and starts its response timer set with the value defined by association_resp_time . node - b takes node - a &# 39 ; s request and generates an association confirmation request message to the coordinator . the coordinator responds with the association confirmation response message to node - b and node - b sends the association response message to node - a . as mentioned previously , the association process described in this section is also used by a network member to re - evaluate its association status . this action is performed every association_eval_period and is intended to determine if the network member should remain on the same sm network or if it should migrate to another one . the node will change its network membership ( i . e . complete its association process on another network ) only if the resulting association ratio represents an improvement compared to its current association ratio . the required improvement must be equal or better than the association_eval_min_improvement . if it is not the case , the node maintains its membership on the current network and the whole process stops immediately . the mesh layer ( see fig1 ) routes frames to the target addresses by one of four processes : tree routing , source routing , temporary routing or mesh routing using combinations of the neighborhood table , routing table , and temporary route table . the route selection processing facilitated by the mesh layer is shown in fig6 . the frame either arrives as a frame initiated by the node ( device ) or as a received frame to be routed by the node . routed frames have an entry created in the temporary routing table to allow subsequent traffic in the reverse direction using the reverse route . the routing process used for the frame is selected based on the following logic : if the frame has a source route header it is sent to the source routing process . if there is an entry for the target address in the temporary routing table , the temporary routing process is used . if the frame &# 39 ; s target address is the coordinator , the tree routing process is used . if the frame &# 39 ; s target address is not the coordinator , the mesh routing table process is used . tree routing is the preferred routing method when a node initiates communications that target the coordinator . tree routing uses the neighborhood table to find a route to the coordinator as shown in fig7 . the device selects the neighbor entry with the preferred parent flag set in the neighborhood table . if transmission to the preferred parent does not succeed , the device attempts to select another parent in the neighborhood table ( e . g ., an entry that has a hop - count value less than the device &# 39 ; s hop - count value ), preferably ordering the selection on the device &# 39 ; s preferred route ratio value . if there are no parent entries left to try , the device looks for a sibling entry ( e . g ., an entry that has the same number of hops to the coordinator ), preferably ordered based on the device &# 39 ; s preferred route ratio value . the device will try entries in the neighborhood table until it has reached the max_tree_repair limit or until the neighborhood table is exhausted . to avoid multiple lateral transmissions through siblings , a flag in the mesh header called sibling flag is set when transmitting to a sibling . frames received with the sibling flag set can be routed only through a parent . referring to fig8 , source routing is the preferred routing method when communications initiated from the coordinator targets a specific node . the coordinator can also use the broadcast address as the target address at the end of the source route list to send a message to all the nodes that are the neighbors of the last explicitly - addressed device . source addressing is also used for communication between any two nodes if the originator knows the entire route between them . this node - to - node source route is determined by a route request to the target node with the trace route flag set , or by a route establishment request sent to the coordinator asking for a route to the target node . the source routing process sends a frame with the complete route embedded in the frame header . the node receiving a source - routed frame finds its address in the route list and uses the next address in the list as the next destination hop for the frame . a temporary return route is created when a source - routed frame is received by each node on the path , so that upstream frames can be routed using the temporary routing table . unlike tree routing , which can only be used to reach the coordinator , mesh routing can reach any node on the network . routes are established using the route discovery process which is described later . the routes are stored in a route table , whose entries contain the next hop for the target address . a route remains valid until a node tries unsuccessfully to use it or a route error message is received deleting the route table entry . a node that cannot send a frame to the node listed in the route table generates a route error message and deletes the entry from its route table . the oldest route table entry may also be deleted when a node needs space in its route table for a new entry . the use of mesh routing should be limited because of the overhead it imposes on the network . this method is used only when more preferred methods such as tree and source routing fail . referring to fig9 , the mesh routing process looks up the target address in the route table . if the target address is found , the frame is sent to the designated node . an error is generated when the mac layer ack is not received after repeated attempts or a route error message is received . in either case the route entry is removed from the route table and a route error message is broadcast to all neighbors . a route error message is also generated if the target address is not found in the route table . every time a mesh frame is forwarded , no matter the routing method used with the exception of the temporary routing itself , the forwarding node creates a temporary route entry to the originator in the temporary routing table . this allows the destination node to quickly send a reply , even if it didn &# 39 ; t previously know the route to the originator node . this route expires after a period of time determined by temp_route_to parameter . the temporary route table takes precedence over the neighborhood table and the route table . referring to fig1 , the temporary route table is accessed and the mac destination address associated with the mesh layer target address is selected . the frame is then transmitted . if the mac fails to transmit a frame , the error received condition is true and the node tries to send the frame by an alternative route using tree routing or mesh routing . in fig1 , a mesh message from node a sets the temporary return route in the table of node b . a mesh message from node c to node a is routed to node b . node b &# 39 ; s temporary return route to node a has not expired and so it uses the route to send the message to node a . sometime later another mesh message from node a restarts the temporary route expiration timer . after the time , temp_route_to , no new messages from node a arrive and node b deletes the temporary return route to node a . the number of temporary return routes that can be stored is limited . if the limit is reached , the oldest temporary return route is deleted when a new temporary return route is created . a route discovery process is performed when a node needs to create or trace a new route within the mesh network . it consists of a mesh broadcast of a route request message which is propagated through the network based on route request acceptance conditions . once received by the target node , a route reply message is returned to the originator leading to the creation of a new static route in both directions . initially , route request acceptance conditions are verified by each node receiving a route request message . this verification algorithm allows a router to forward or stop the propagation of a route request . when acceptance conditions are satisfied , the router from which the route request message was received is keep as a route candidate . a route candidate can be replaced based on route request acceptance conditions during the route discovery process to improve routing . route candidates are used at the end of the route discovery process when the route reply message is sent back to the originator . a route request is accepted as the first route candidate if it meets all of the following conditions : the request is received through a link with a minimum lqi class ( defined later ) at least equal to the requested one . for compatibility reasons , route requests received from non - neighbor nodes are accepted if the requested minimum lqi class is “ unreliable link .” a route request is accepted for route candidate upgrade if it meets all of the following conditions : a route candidate already exists for this request id ; and the request was received through a link with a minimum lqi class at least equal to the requested one . for compatibility reasons , route requests received from non - neighbor nodes are accepted if the requested minimum lqi class is one ( unreliable link ); and the request was received through a better link than the prior received one , as determined by one of the three cases summarized below : the overall route discovery process is summarized in fig1 which illustrates the simplest case , i . e ., without any route candidate upgrade . the effect of a route candidate upgrade is shown in fig1 , in which the return path is updated during the route discovery process . the originator broadcasts a route request with a minimum lqi class of “ reliable link .” every router receiving the route request accepts or rejects the request based on conditions discussed above . if the route request is accepted as a first route candidate and the router is not the target destination , it creates a route candidate to the originator and rebroadcasts the route request . if the router is the target destination , it starts a timer of rreq_rx_time milliseconds and creates a route candidate to the originator . if the route request is accepted for a route candidate upgrade , the node upgrades its route candidate without re - broadcasting the route request . at the expiration of the timer that was initialized to rreq_rx_time , the destination node converts its route candidate into a static route and sends a route reply to the next hop of the route just created . each node receiving a route reply converts its route candidate into a static route to the originator . it also creates a static route entry to the destination . the route reply is then forwarded to the originator . if the originator does not receive a route reply after the rreq_to timeout period ( 700 ms by default ), it broadcasts a second route request with a minimum lqi class set to “ average link .” if this second attempt fails , the originator tries a third and last attempt with a minimum lqi class set to “ unreliable link .” if the three attempts of broadcasting a route request fail , an error is returned to the upper layer . fig1 illustrates the route discovery process with no route candidate upgrade . fig1 illustrates the route discovery process with route candidate upgrade . if the trace route option is set in the route request message , the target node will set the trace route option in the route reply message . in this case , intermediary routes create a temporary route instead of a static route and the route is recorded in the route reply message . the originator of the request can subsequently use the temporary route or source routing to reach the destination . each route request is identified by a unique combination formed by the originator &# 39 ; s short address and the request id . it is then possible to identify a route request already received from another node . referring to fig1 , route establishment is a process in which a node asks the coordinator for a source route to another node . the originator node uses the target &# 39 ; s 8 - octet long address in its request . the coordinator constructs a route using its current knowledge of the sm network . the neighbor information contained in the periodic keep alive request messages sent by nodes is a prime source of information used by the coordinator to construct routes . the route establishment response contains the source route to the target and the target &# 39 ; s assigned short address . a route established from node - a to node - b is used for one - way communication . when node - a sends a message to node - b that requires a reply , node - b uses the temporary route set up along the route by node - a &# 39 ; s message . the neighbor exchange process is performed by all nodes on a periodic basis . the neighbors exchange process is used to update neighbor information and routing tables . each node in the network generates a periodic neighbors exchange message . all nodes receiving the request update their neighborhood table . fig1 shows one neighbor information exchange broadcast message transmitted by node - a , which is received by nodes b , c and x . an lqi measure is taken each time a neighbors exchange is received . the value “ lqi rx ” in the neighborhood table is updated according to table 2 . these rules tend to keep the “ lqi rx ” in the neighborhood table high even if a particular lqi measurement is lower or if a single neighbors exchange is missed . this is intentional . tree optimization is a recurrent process performed by all nodes to ensure the network &# 39 ; s optimal performance . the preferred route toward the coordinator is re - evaluated after each neighbors &# 39 ; exchange message is received . to avoid tree instability , the “ avg lqi ” factor is omitted for tree optimization ; it is used only at association when a node selects its initial preferred route . only one route change is allowed per 6 cycles of neighbors_exchange_period to provide enough time for the information to propagate in the network . this delay limits the rate at which child nodes change their route when the route quality improves . each node on the network shall report its presence to the coordinator from time to time using keep alive request messages to maintain its association status . the reporting period is determined by the checkpoint_period and is typically set to be one hour . the period between keep alive messages should be constant as specified by the keep alive period field within the keep alive request message . the coordinator flags a node as non responding if this node fails to communication with it within the keep alive period . if the coordinator has not received a keep alive request or a power event message in a specified time , it removes the device from is registration table . the coordinator &# 39 ; s timeout period for keep alive request / power event messages can be as long as 90 days . the checkpoint process is also used to : trace the latest tree route for subsequent requests using source routing ; send network management information such as network statistics and neighborhood information ; allow configuration of mesh layer parameters controlled centrally ; and provide a window of opportunity for the upper layer batch traffic . the checkpoint is initiated autonomously by each node . checkpoint reporting by each node is distributed pseudo - randomly within the checkpoint_period . if the coordinator needs to have better control over timing of the traffic generated on the network , it can send a keep alive initiate request prior to the autonomous transmission of the keep alive request . the keep alive initiate request relies on the routing information of the previous keep alive request . if this information is out of date , the subsequent autonomous keep alive request sent by the node will reestablish a valid route . it is important to note that a keep alive initiate request does not create an entry in the temporary route table , thereby allowing the subsequent keep alive request to trace the currently optimized tree route . in fig1 , node a sends a keep alive request frame to the coordinator as triggered by expiration of its checkpoint_period timer . the coordinator receives the request and sends a keep alive response frame . the originator node does not retry the request if it does not receive a reply . after a successful reception of the keep alive response , or timeout of a watchdog timer preset to the value of the parameter coord_response_timeout , upper layers are notified so they can start exchanging information if needed . there are three security services provided by the sm network and protocol : privacy , authentication and authorization . initially , though not all data transmitted throughout the sm network has to be kept private , there are instances where the data sent should be encrypted to protect it from discovery . for example , security key configuration information needs to be kept private . additionally , data is authenticated in two ways . first the data &# 39 ; s integrity is checked to make sure that it has not been changed when transmitted through the network . data integrity is verified from the source to the destination through one or more hops in the mesh network . like the data , the address is protected from being changed undetectably . if the key used to protect that address is unique to the source , then the authentication verifies the integrity of the source address and that the stated sender originated the message frame . further , the operations in messages have permission requirements associated with them . devices originating messages have authorizations configured in the sm network that give the devices the permission to perform operations that match the permission requirements . the sm network protocol provides security for management frames routed through the mesh . these routed frames may span more than one hop and therefore need end - to - end security . the security features used by the sm network protocol are authentication and authorization . the mesh layer operations do not require privacy , other than for the transmission of security keys , where the privacy is provided by encrypting the transported keys . the sm protocol provides data link security services for hop - by - hop message transmissions . the sm data - link protocol provides data and source authentication for each hop taken by the message . it also provides operation authorization for local communication with maintenance devices . this security level also provides replay protection for all local and routed communication . table 3 summarizes the implemented security mechanisms in accordance with a preferred embodiment of the present invention , the behavior of data link and network level counters and the key type used for each message type . for each message type in table 3 , the security method and key specified must be used or the receiver rejects the entire message . in table 3 , the following define the behavior of the counters sent : “ src . count ” is the value of the current counter of the sender of the frame ( single hop ); “ orig . count ” is the value of the current counter of the originator of the frame within the mesh network ; “ reflection ” is the response use of the value of the counter received in the request ; “ ticket ” is the counter provided by a router for use by nodes before they are associated and for maintenance devices that communicate with the device using point - to - point messages . the nonce is created by concatenating full five octet ticket with the long address of the router providing this ticket . also in table 3 , the following define the behavior of the counters received . the “[& gt ; last ]” means the recipient of the frame , may accepts any counter value , playback rejection is not required since playback is already verified by the dll security at each hop . optionally , if the recipient has the memory to store the previously received counts it may reject frames where the count is not greater than the stored count . the “= sent ” means the counter received must be equal to the counter sent in the request . the “& gt ; last ( n )” means the counter received must be greater than the rx source dll nonce count value maintained in the neighborhood table . the neighbor info response frame initializes the rx source dll nonce count in the neighborhood table . the periodic neighbor exchange message maintains its currency in the absence of regular traffic between the two devices . the “& gt ; last ( ed )” means the counter received must be greater than the last rx source dll nonce count value maintained in the end device table . the periodic end device data request message maintains its currency . and the “& gt ; last ( rc )” means the counter received must be greater than the last rx source dll nonce count value temporary maintained for a selected node and acquired in the neighbor info response or local broadcast response . the “ last ” counts are initialized to zero in the tables and then updated with the first authenticated reception . the following letters are used in table 3 to define the key type used by each message type . “ n ” is ( private ) node key ; “ s ” is shared mesh key ; and “ m ” is ( shared ) maintenance key . the sm protocol provides a dll security service with data and source authentication using a message integrity check mechanism ( mic - 32 ) as described in annex b of ieee 802 . 15 . 4 : 2006 which is incorporated herein by reference in its entirety . dll security uses the sm dll security header to select the security key and set the nonce used in the crypto calculation . the dll security header is an optional field , following the service type octet , that is present when the dll security header flag in the service type octet is set (= 1b ), as defined herein . the format of the dll security header is shown in fig1 . the first fifteen bits ( 0 - 14 ) of the dll security header contains a portion of the transmitted nonce count . bit 15 is the dll key id that selects the current version of the key used to calculate the dll mic . this key id is used to coordinate the key used during a key change process by explicitly identifying which key was used in generating the dll mic . the mic - 32 data authentication calculation uses the calculation process described in the ieee 802 . 15 . 4 : 2006 standard . the sm dll nonce used for the mic calculation is shown in fig1 . the dll nonce used in the mic calculation is thirteen octets . the dll security nonce combines the full dll nonce count and the mac layer source address used by the transmitting device . the full dll nonce count is five octets long , which ensures that its value does not repeat , within the lifetime of a key , at the frame transmission rates of sm devices . the address used in the mac nonce is either the 8 - octet long eui address , or the 2 - octet source pan id plus the 2 - octet short address prefixed by four octets of all ones . the full dll nonce count can be based on either the source counter or the ticket counter . this process is used for all message types using the source counter as listed in the summary table in table 3 . the five octets ( bits 0 - 39 ) of the full dll nonce count are constructed using the following algorithm : the least significant octet ( bits 0 - 7 ) of the transmitted nonce count is the ieee 802 . 15 . 4 mac header sequence number . the next 15 bits come from bits 0 through 14 of the dll security header &# 39 ; s sm dll count . together the 23 bits of the transmitted count forms the least significant bits of the counter portion of the sm dll nonce . the receiver checks the least significant 23 bits of the transmitted count against the last authenticated rx source dll nonce count . in the case of an end device , the last authenticated rx source dll nonce count represent the source count acquired using a neighbor info request and maintained in the end device table . in the case of mesh messages excluding the association request , the last authenticated rx source dll nonce count represents the source count acquired using a neighbor info request and maintained in the neighborhood table . the neighborhood table entry is selected using the source pan id and mac address of the received message . in the case of an association request or of point to point messages , the last authenticated rx source dll nonce count represents the source count acquired using a neighbor info response , a local broadcast response or an end device node present received and maintained temporarily for a selected node . if the transmitted count value is greater than the last authenticated rx source dll nonce count , then the transmitted counter bits ( 0 - 22 ) are combined with the most significant bits ( 2 - 39 ) of the last authenticated rx source dll nonce count to form the full dll nonce count . however , the transmitted count is assumed to have rolled over if the transmitted count value is less than the value of the corresponding bits in the last authenticated rx source dll nonce count . when this is the case the value in bits 23 through 39 of the last authenticated rx source dll nonce count is incremented by one before it is combined with the transmitted bits to form the full dll nonce count . the mic - 32 is calculated using the mesh key generation specified by the dll key id . the selected key and the secure full mesh dll nonce are used to calculate the dll mic - 32 value . if the calculated mic - 32 equals the transmitted mic - 32 , then the message data integrity is validated and the message has not been received previously . in this case the last authenticated rx source dll nonce count is updated to the value of the full dll nonce count used in the mic calculation . the sm dll security nonce ticket counter process is used for all message types using the ticket counter as listed in the summary table in table 3 . this process is used for the secured non - routed dll communications employed by association request / response messages and by point - to - point messages . for these messages at least one of the mac addresses has a long 8 - octet format , the maintenance key is used , and the process is modified . the dll key id selects the appropriate maintenance key and nonce count . the following algorithm is used to calculate the mic . the five octets ( bits 0 - 39 ) of the full dll nonce count are constructed using the following algorithm : the least significant octet ( bits 0 - 7 ) of the ieee 802 . 15 . 4 mac header sequence number is combined with bits 0 through 14 of the dll security header . together they form the 23 bits of the transmitted count bits of the dll nonce count . the ticket field in the maintenance key table contains the last authenticated count received . the receiver checks the least significant 23 bits from the table and compares them to the transmitted count . if the transmitted count value is greater than the value in the corresponding bits of ticket then the transmitted counter bits ( 0 - 22 ) are combined with the most significant bits ( 23 - 39 ) of the ticket to form the full dll nonce count . however , if the transmitted count value is less than the value of the corresponding bits in the ticket , rollover of the transmitted count value is inferred . when this is the case the value in bits 23 through 39 of the ticket is incremented by one before it is combined with the transmitted bits to form the full dll nonce count . the mic - 32 is calculated using the key specified by the maintenance key selected by the dll key id and the full dll nonce count . if the calculated mic - 32 equals the transmitted mic - 32 , then the data integrity is validated and the message has not been received previously . in that case only , the full dll nonce count is stored in the ticket count of the maintenance key table . the dll security header mic covers the sm message starting with the ieee 802 . 15 . 4 frame control octet and continuing on through to the end of the payload . as shown in fig1 , the ieee 802 . 15 . 4 physical layer preamble and the frame check sequence are not part of the dll security calculation . the dll security header provides security for data authentication and operation authorization of sm messages that can travel one hop . the sm network security header provides end - to - end security for frames , which can travel multiple hops . when present , the network security header provides authentication of data that is not dependent on trusting the intermediate routing devices . the network security header controls security for that portion of the sm frame that does not change as it is routed through the network . the network security header is present when the originator network security header flag is set as defined in the common mesh header described below the network security header is shown in fig2 . it is located in the sm header after the dll security header . the network security net mic - 32 field is located at the end of the frame , before the dll mic - 32 field and the ieee 802 . 15 . 4 fcs field ( see fig2 ). when the network security header is present , the receiver &# 39 ; s sm application layer security process uses the originator pan id and source address field of the received frame to determine if the frame is from the coordinator or some other device . the node keys stored in the node key table are used for communicating with the coordinator . the mesh keys in the neighborhood table are used to communicate with other devices . for frames received from the coordinator , bit 39 of the network security header specifies the network key id , selecting node key - 0 or node key - 1 . for frames received from other devices , the bit selects mesh key - 0 or mesh key - 1 . routed messages are typically request / response messages . the response messages reflect the value of the network count in the request . messages that require reflected counts are listed in table 3 . the sm network layer nonce is 13 octets long . its structure is shown in fig2 . when the message is a request , the combination of the network count , the originator pan id and address padded with zeros ensures the uniqueness of the nonce . when the message is a response the network count is reflected and it is combined with the target pan id and address and the originator pan id and address . devices receiving request messages use the network count to verify the integrity of the payload data and optionally check for repeated count values to reject already received responses . devices receiving responses to request messages check that the network count equals that in the request message . if it does not , the message is rejected . response frames with repeated network count values also are rejected . the sm network mic - 32 is authenticated using the following algorithm . first , the 39 bits of the network count is taken from the network security header and padded with a zero to make a 40 bit field . this forms the counter portion of the network nonce . next , the mic - 32 is calculated using the key specified by the network security header key id , using the node key for communications with the coordinator and the mesh key for communications with other devices . if the calculated mic - 32 equals the transmitted mic - 32 , then the data integrity of the received frame is validated . the coverage of the network security header mic is shown in fig2 . the network mic - 32 provides authentication for almost all the sm frame &# 39 ; s header field and payload . the portion of the sm frame &# 39 ; s header field that is not covered by the network mic is the max remaining hops field , which is decremented for each hop . keep alive request messages have a second exception to the network mic - 32 coverage : their hop addresses and number of hops fields . as with the dll , having two key in each of the mesh key table and node key table entries allows the coordinator to set up new keys for devices without causing network security header mic errors . the sm network security process used for transmitting a message with a network security header is shown in fig2 . node - a prepares a request message for transmission by incrementing its source transmission counter and calculating the network mic . it then formats the request frame with the full five octet source transmission count in the network security header and transmits the message through node - b to node - c . node - a stores the count used and starts a message response timer with a timeout set to message_response_to . node - c receives the request message and authenticates the network security header . node - c prepares a response to node - a using the same count value it received in the request . node - a receives the response and checks that the count value is the same as what it transmitted . node - a releases the stored count and stops the message response timer if the stored count is the same as the response count and the network security header is authenticated . if the tests fail and no other valid response frame is received in the timeout period , node - a fails the request / response process and releases the stored count value . messages transmitted between the coordinator and a device that employ the network security header use the node key assigned to the device . messages transmitted between devices that have a network security header use the mesh key . new devices associating with a network must be configured with the node key and maintenance key . this configuration may be done by the manufacture as a custom process for a purchaser , by a maintenance tool prior to association or over the network using the service messages described further herein . keys transported over the network must be encrypted for confidentiality . when sent in service response and service forwarding messages , the keys are generated by the configuration host and encrypted using the device &# 39 ; s device key before being placed in the message payload . the coordinator and the routing devices forward the encrypted keys without knowing the device key , so they are unable to eavesdrop on the value of the new key . this configuration process is between the device &# 39 ; s application and the configuration host application . it is not part of the overall mesh protocol . an outline of the device application to configuration host application configuration process is presented here for informational purposes . the new device uses a service request message to talk to the configuration host . the outgoing service request message contains a service mic in the payload that is calculated using the manufacturer - supplied device key . ( this service mic is not the dll or network mic .) the routing device forwards the payload in a service forwarding message and the coordinator sends the message to the configuration host . the routing device and the coordinator do not have the device key and so they do not decode the mic . the configuration host uses a well known server id (= 0 ) in the service request message . the configuration host looks up the 8 - octet device mac address and finds the device key in its database . if the mic is ok it authenticates the new device . the configuration host sends a message to all coordinators in the network that sets up a unique node key associated with the 8 - octet device mac address . this is a symmetric secret key that will be used for all secure communications between the coordinators and the new device . in preferred embodiments , node key - 0 and node key - 1 are set to the same value to avoid key synchronization problems as the system starts . this same value practice holds for the maintenance key - 0 and maintenance key - 1 values as well . after sending the node key to the coordinators , the configuration host sends a response to the new device using a service forwarding response or service response message , where the message payload contains the unique node key and the shared maintenance key , both encrypted by the new node &# 39 ; s device key . this response is sent back to the new device . the new device decrypts the node key and the shared maintenance key and stores them under the appropriate key id . a device that is newly introduced to a sm network has only a single cryptographic key : its factory - assigned permanent device key , which is unique to the device . before the device can participate in the sm network , the device must be commissioned with the network &# 39 ; s maintenance and mesh keys , together with a device - unique node key and a second system - assigned device - unique device key . this commissioning may be made over the network itself , by direct wireless messaging to the device from a proximate commissioning device , or through some extra - protocol means , such as a direct connection to the device . the maintenance , mesh and node keys are used to authenticate messaging within the sm . node keys are used to authenticate and encrypt end - to - end network management messaging within the sm . the permanent device key is used only to authenticate the newly introduced device to the sm network and to protect the system - assigned device key when it is sent in response to the newly introduced node . the system - assigned device key is then used to protect the device &# 39 ; s node key and the shared maintenance key when they are distributed to the node . in subsequent messages , the device &# 39 ; s node key is used to protect the mesh key whenever it is distributed to the node . receipt of a message that authenticates under the permanent device key zeroizes all other keys , setting them to a “ keynotdefined ” status , which restores a device &# 39 ; s key state to that when it left the factory . this action protects the network against an attacker that has compromised the device &# 39 ; s permanent device key , perhaps by gaining access to the database of all permanent device keys that exist at key repository , or to the subset database of device keys of purchased devices that was delivered to the system owner . a secure association between a device and a coordinator uses the association request and association response messages that employ the dll mic and network mic . the associating device uses the maintenance key ticket count value for the dll mic and the node key and originator count value for the network mic . the routing forwards the association request payload to the coordinator in the association confirmation request message . the payload also includes the 8 - octet mac address of the new device . this forwarding process is shown in fig2 . the coordinator validates the association confirmation request message dll security header and network security header . it then validates the embedded network security header constructed by the new device using the new device &# 39 ; s node id and the originator count in the network security header . the coordinator looks up the node id using the 8 - octet address in the association confirmation request message in a data base that has been configured by a process outside the scope of the mesh protocol . for valid association requests the coordinator constructs an association confirmation response message . the message payload has the assigned short address of the new device , the mesh key security header , the encrypted mesh key and the mesh key mic32 . the mesh key is encrypted using the new device &# 39 ; s node key version as specified in the mesh key security header . the coordinator constructs a network security header and that calculates the network mic using the coordinator &# 39 ; s reflected count in the new device &# 39 ; s network security header and the new device &# 39 ; s node key . this network header is carried as the payload of the association confirmation response message shown in fig2 . the mesh key security header follows the same format as the 40 - bit network security control word shown in fig2 with the reflected count flag set to 0 . the routing device that forwards the association response to the new device takes the payload of the association confirmation response message and generates the association response message using the maintenance key and the router &# 39 ; s source count value to calculate the dll mic . the new device decrypts the mesh key using the node key with the key id specified in the encrypted key security header , it then verifies the mesh key mic32 and stores the mesh key . devices that change the primary coordinator with which they are associated follow the same procedure as new devices . they use the same association and association confirmation messages and the same node key and maintenance key . preferred embodiments of the present invention institute key rotation practices ; changing the security keys periodically or when a security event has occurred . the mesh keys used by a device are the node key , the maintenance key and the mesh key . the coordinator changes these keys using the keep alive process and messages . each device maintains two versions of each of these keys : node key - 0 , node key - 1 , maintenance key - 0 , maintenance key - 1 , mesh key - 0 and mesh key - 1 . each message sent has key ids in the dll security header and network security header that indicate which key is being used . in between key changes all the devices use only one version of each key for transmission and reception . the coordinator writes the new key to the appropriate key and key version of each device . when the update process is finished and verified at most or all relevant devices , the coordinator signals the devices to start using the new key for transmission . after all the devices are using the new key for transmission , the coordinator deactivates the old key for reception . the coordinator starts an update of a key by getting the current state of the current write key toggle bit associated with the key . it does this by waiting for a keep alive request message from a device with the key as shown in fig2 . the keep alive request message from the device contains the write key toggle state field that tells it current status of the toggle bits for each key . the coordinator then sends the key update using the write key parameter option in the keep alive response message . the coordinator verifies that the key has been updated by reading the change in state of the selected key &# 39 ; s write key toggle bit in the next keep alive request . the process is repeated if the key has not been changed . eventually , all ( or almost all ) the devices have both the new key and the old key . only the old key is used for transmission , but either the new key or the old key can be used for reception . the reception key selection is controlled by the dll security header and the network security header . after all devices using the key have been updated and verified , the coordinator tells the devices to start using the new key for transmission . the coordinator waits for a keep alive request message from a node using the new key as shown is fig2 . in the keep alive response message , the coordinator commands the node to switch to the new key for transmission . the switch is confirmed in the next keep alive request message received from the device . after all the devices using the new key have switched , the coordinator deactivates the old key by waiting for a keep alive request and then sending a keep alive response containing the appropriate key deactivate command . the coordinator verifies the deactivation in the next keep alive request received from the device . this process is used to update node keys , maintenance keys , and mesh keys . the process for changing a generic key x , version 0 , is depicted in fig2 . note that only the coordinator is allowed to originate a keep alive response message with key control commands in it . an end device &# 39 ; s association to the network is similar to that of a regular node ( see association ). the only difference is that after the end device has selected a coordinator , it usually also needs to choose a router to help with message forwarding . fig2 shows a new end device , node - a , requesting neighbor information and receiving . in this example there are two pans and three neighbors . based on the association ratio algorithm , node - a selects the coordinator on pan 1 . it also selects node - b as its parent using the parent selection algorithm . node - a then sends node - b an association request message , which node - b converts to an association confirmation request message addressed to the coordinator . the coordinator sends the association confirmation response message back to node - b . node - b then sends the association response message to node - a . node - b adds node - a to its end device table after receiving a keep - alive request message from node - a with the “ device type ” set to end device type and the receiver on when idle bit reset ( to off ). this first keep - alive request message also carries the multicast group addresses list which is captured by node - b for future filtering and forwarding of multicast messages . the coordinator receives the keep alive request message . a parent can remove a node form its end device table if it has not received any keep alive request messages from this node for a period exceeding 24 hours . when an end device loses connectivity with its parent ( i . e . after a number of unsuccessful attempts to communicate determined by the route_lost_attempts parameter ), it tries to find another router on the same network . the end device sends a neighbor info request on the current channel and uses the parent selection algorithm to choose its new parent . then it sends a keep alive request to inform both the parent and the coordinator of this change . the processes of re - associating with the coordinator and a new neighbor are shown in fig2 . the end device , node - a , fails to communicate through node - b and , after a number ( route_lost_attempts ) of attempts it broadcasts a neighbor info request to nodes on the same channel and pan . it then selects the best neighbor with which to associate . in this case node - e is selected . it then sends a keep alive request message to the coordinator though node - e . the coordinator returns a keep alive response message . message forwarding with a non - sleeping end device is done as soon as received . referring to fig3 , a non - sleeping end device advertises its presence to its parent and to the coordinator in both the association request and the keep alive request messages . in both of these messages , the device type field is set to end device type and the receiver on when idle is set . in the case of transmission by the sleeping end device , the parent allows the end device to return to sleep as soon as the transmission acknowledgment ( 802 . 15 . 4 ack mac - pdu ) for the message is received . all frames sent to a sleeping end device ( unicast , multicast and broadcast ) are buffered by its parent and transmitted to it when it is awake . if a response is expected , a sleeping end device wakes up every resp_sleep_period until the expected response is received . if no response is expected the sleeping end device sleeps for the interval sleep_check_period . the sleeping end device wakes up periodically at each sleep_check_period to check for buffered frames . it also wakes up when it has a message to transmit . when it wakes up with a message to transmit it first checks for buffered frames before it transmits its own message . the sleeping end device frame forwarding process is illustrated in fig3 . the sleeping node - a wake ups and checks for any frames buffered in node - b by sending an end device data request message . node b replies with an end device response message with the “ no frame pending ” status that tells node - a there are no frames buffered . node - a then transmits a frame that does not require a response to a target application through its parent , node - b . node - a waits for an ack mac - pdu from node - b and then goes to sleep for sleep_check_period . this sleep is interrupted when node - a wakes up to transmit another frame . the new frame is a request that requires a response from the target . the request frame is routed to the target by node - b . when node - a receives the mac level ack from node - b , it restarts its sleep timer with a duration set to the value of resp_sleep_period . node - b forwards the request frame to the target application that then generates a response frame . node - b receives and buffers the response frame for node - a which is sleeping . node - a wakes at the end of the time period and sends node - b an end device data request message and receives an end device response message with the frame pending bit set . node - a waits for the stored frame for a maximum duration of max_mf_wait . if it does not receive a frame during this time interval , it resends the end device data request message . in fig3 , node - b sends the response frame in its buffer to node - a before the max - mf_wait_period . node - a sends node - b an ack mac - pdu and goes back to sleep with the timer duration set to the value of sleep_check_period . node - b releases the buffer when it receives the ack mac - pdu from node - a . sleeping end device wakeups periodically to verify a message is pending . each sleep_check_period the sleeping end device sends an end device data request frame to its parent and waits a predefined time , data_request_timeout , listening for pending frames before returning to sleep . fig3 and 33 show the sleeping end device checkpoint process . in fig3 a message is received for sleeping end device , node - a , and buffered by the parent node - b . node - a wakes when its checkpoint timer expires . it sends an end device data request message to node - b and receives an end device data response message with the frame - pending bit set . node - a then starts its listen timer with a duration of data_request_timeout and listens for a frame from node - b . node - b sends the buffered frame to node - a , which stops the listen timer . the frame does not have the frame - pending bit set , which tells node a that there are no more frames to receive . node - a sets the checkpoint timer with the duration checkpoint_period and goes back to sleep . node - b releases the buffer when it receives the ack mac - pdu frame from node - a . in fig3 , node - a wakes up when its checkpoint timer expires . in this case node - b has no frame stored for node - a , so when node - a sends the end device data request message node - b &# 39 ; s replying end device data response message does not have the frame - pending bit set . node - a sets its checkpoint timer with the checkpoint_period and goes back to sleep . this process exemplified in fig3 is used to initiate a point - to - point communication with a sleeping end device . typical applications for this type of communication are between a handheld device and a sleeping end device and occur during installation , operation , and maintenance processes . a physical trigger ( button , reed switch + magnet ) initiates local communication . this sets the sleeping end device in local communication mode . the sleeping end device then sends an end device node present message with a periodicity of end_device_period and listens for the interval end_device_wait for any command sent in response . this process stops and the sleeping end device goes to sleep if it has not communicated with a local device in the interval determined by the end_device_inactivity_to parameter . once a communication is initiated with a local device , the sleeping end device stays in the local communication mode for the time interval determined by the end_device_inactive_to parameter after each frame is received or transmitted . in fig3 , a sleeping end device , node - a , receives an external trigger that puts it in a mode where it looks for a local device with which to communicate . it transmits an end device node present frame and starts two timers . the first timer is the end device notification timer , end_device_period , which determines how long the sleeping end device listens for a response to the notification message . the second timer is the end device notification process timer . it determines how long the sleeping end device remains in the state where it is looking for a local device . in fig3 , node - a sends one end device node present message that is not heard by the local device . after the end device notification timer expires , it sends a second end device node present message that triggers a second response by the local device . the ack mac - pdu from the local device terminates the two timers and puts node - a in the local communication mode . in this mode node - a starts the end device communication timer that is set with a duration specified by the local_com_to parameter . during the first timer period the local device sends node - a a frame that resets the timer . during the second timer period node - a initiates a frame of its own to the local device . this transmitted frame also resets the timer . there is no communication during the third period other than the ack mac - pdu from the local device . the ack mac - pdu does not reset the timer , which then expires , causing node - a to exit from the local communication mode . the concept of dedicated routers allows the deployment of multiple coordinators at the same physical location . this approach consists of deploying multiple routers , possibly with directional antennae , where each router is dedicated to a specific mesh network / coordinator . a dedicated router has the following specific behavior : a dedicated router is associated to a specific network name and is manually configured with this name and a dedicated router can associate only to the coordinator or another dedicated router ; it is not allowed to associate with a normal ( non - dedicated ) router . this restriction is imposed to avoid the situation where a dedicated router works for some time until its environment changes in such a way that it is no longer capable of establishing a route to its coordinator . for the computation of the association ratio , a dedicated router is seen as a no - hop - distant device similar to a coordinator . this guarantees that surrounding devices will prefer the dedicated router over other routers for their association . dedicated router sets the dedicated router flag in the neighbor info response message . nodes receiving neighbor info response message with the dedicated router flag set shall consider it to be as a no - hop - distant device when computing its association ratio . the following mechanisms are provided to control the flow of messages on the network and to provide some control on message latency . most traffic is either sent from or to the coordinator . message latency is directly affected by the way the coordinator manages this traffic . internally , the coordinator orders messages based on the importance of the associated task and the notion of priority implemented by the application layer . in the case of the ansi c12 . 22 application layer , this notion of priority takes the form of the urgent flag carried in the calling ae qualifier element . to control traffic flow in the reverse direction , the protocol allows the coordinator to control the timing of the checkpoint process at each node . to do this , the coordinator sends a keep alive initiate message to each node before the end of that node &# 39 ; s checkpoint_period . frames routed within the mesh network have an urgent flag , which when set permits the router to reorder outbound frames when there are other frames of lesser priority in the transmit queue . nodes are not permitted to use the entire network capacity for any extended period of time . in the network protocol , this throttling is provided by a single - frame transmission window with an end - to - end acknowledgment . a mesh forwarding process is required for support services that are used before a node has associated with a network . this forwarding process allows the unassociated node to communicate with service hosts such as commissioning or location tracking hosts on a lan or wan segment . the commissioning process is implemented by the application . the secure mesh protocol does not determine how commissioning is done , but it does support over - the - network commissioning using the service and service forwarding messages . when used , these messages convey the node key and maintenance key that will be used by the device so that it is able to run the association processes . alternatively , the device could be commissioned with these keys during manufacturing . the forwarding process is illustrated in fig3 . the requesting device issues a neighbor info request frame and listens for neighbor info response frames . this is the same process used when the device associates with the network . the neighbor information process is shown in fig3 . the device uses the association algorithm to pick the neighbor to use as a proxy for service message forwarding . the requesting device , node - a , places the service message in a service request frame addressed to the selected neighbor , node - b . the service request frame identifies the service the message is to go to in the mesh header in the “ server ” field . the service request frame is then transmitted to node - b . node - a starts a “ halt service request timer ” when the mac ack is received from node - b . this timer is set with the parameter service_period that prevents node - a from sending more service frames until the timer has expired . node - b recognizes the service request frame from its “ service type ” and “ service code ” fields . it processes the frame by assigning the forwarding process for node - a a “ requestor id ” value and sending the contained information to the coordinator in a service forwarding frame . node - b starts a “ halt service request rx timer ” when it successfully transmits the service forwarding frame . the timer is set with the service_period parameter . while the timer is active , node - b does not accept additional service request frames from any node , including from node - a . the service_period timeout set by both node - a and node - b is cancelled as soon the service host accepts servicing the request as indicated by an appropriate service reply . the service_period timeout is reestablished for each new service request frame that is sent . the coordinator receives the service forwarding frame from node - b . it registers the “ requestor id ” value and node - b &# 39 ; s address . the coordinator sends the service message contained in the service forwarding frame to the service host identified in the “ server requested ” field . when the service host responds , the coordinator puts the service message in a service forwarding reply frame and addresses it to node - b . the coordinator also fills in the “ requestor id ” value for node - a . the coordinator sets a “ service keep - alive timer ” that will release the forwarding process if it is inactive for the duration service_to . releasing the forwarding process for node - a removes the node - a &# 39 ; s “ requestor id ” from memory . node - b receives the service forwarding frame from the coordinator and looks up the “ requestor id ” to identify node - a as the destination . the receipt of the service forwarding frame sets node - b &# 39 ; s “ service keep - alive timer ” for the duration service_to . if the timer expires before another service forwarding frame is received for node - a , the node - a “ requestor id ” is released . node - b constructs the service requestor response frame and sends it to node - a . node - a receives the service requestor response frame and extracts the host &# 39 ; s service message . the receipt of the service requestor response frame sets node - a &# 39 ; s “ service keep alive timer ” for the duration service_to . if node - a does not receive another host message in this time , it times out the service - request process . if later there is another message generated to a host , the service - request process is restarted from the beginning with a new neighbor info request frame . every node in the mesh network can notify the coordinator rapidly after it loses power or when the power is restored . the performance goal for the process is to have most nodes notify the coordinator within one minute after their status changes . those nodes that take longer should not exceed the three minutes of backup power provided by the nodes implementing the power outage routing option as advertised by the neighbors exchange service . the system load induced by this process is a critical consideration because every node may need to communicate in a very short time . power event report aggregation and low overhead tree routing are employed to reduce the amount of system communication capacity used for this reporting . fig3 shows the overall process used by a node to report a power event . the process starts with a node detecting a power event and waiting to make sure it is not a transient . for an event to be reported , it has to last more than the time defined by the po_recognition_period parameter . any node that has a power event that passes this transient - suppression test goes into the po_aggregate_period round . the leaf nodes — nodes without any children in their neighborhood table — and first hop nodes report their event in this round . to distribute these transmissions more uniformly , each reporting node transmits at a pseudo - randomly - chosen time within the interval whose duration is po_aggregate_period . nodes receiving events during this interval aggregate these events for later transmission . at the end of the po_aggregate_period round , nodes enter the po_rnd_period round . event nodes that have event reports to send schedule transmission at a pseudo - randomly chosen time within this interval . during this interval , non - aggregating nodes are free to piggyback their event report to any of the power event report frames that they may route ; however , aggregating nodes must initiate their own power event report frame since the eventual acknowledgment they receive for the forwarded aggregated event reports needs to be broadcast to the aggregator &# 39 ; s neighbor nodes . the coordinator receives power event reports and sends acknowledgements . these event acknowledgements follow a source route constructed from the entries in the power event report . because of this , the acknowledgement message follows the reverse route of the report and confirms the reception to each node reporting an event . when the target node is not the last nodes in the reporting list within the power event report , the target address is set to the broadcast address (= 0xffff ). the broadcast address allows leaf nodes to be acknowledged using a broadcast at the end of the source route path . reporting nodes that do not receive an acknowledgement from the coordinator at the end of the po_rnd_period round enter into a po_retry_rnd_period round . each such node schedules a transmission time pseudo - randomly within the following interval of duration po_retry_rnd_period . this round is repeated until the event report is acknowledged or the backup power is exhausted . nodes acknowledged prior to a scheduled power event reporting transmission do not initiate that transmission , even if they had entered into the retry round . nodes reporting a power event do not initiate any data transfer messaging of their own while they are in any of the power event reporting rounds . all event nodes continue to route the messages they receive . fig3 shows an example of the power outage reporting for a non - leaf node that is multiple hops away from the coordinator . node - a detects a power outage and waits for the time given by po_recognition_period to confirm that the outage is not a transient . node - a stops initiating data transfer messages and does not resume until power is restored . after the recognition interval , node - a waits for an interval given by the parameter po_aggregation_period to collect events from neighboring nodes . while in the aggregation state , node - a does not forward power event report frames to the coordinator unless the message contains event reports from multiple nodes . at the end of the aggregation state , node - a enters into the po_rnd_period round . node - a delays for a pseudo - randomly chosen time within the interval of duration po_rnd_period before sending a power event report frame . if node - a needs to route a power event report frame during this delay and has no events aggregated , it piggybacks its own report and sends the resulting frame to the next hop . at the end of the delay , if node - a was not able to piggyback its event , it initiates its own power event report frame including any additional aggregated events . after sending or piggybacking its event report , node - a expects an acknowledgment from the coordinator . in fig3 , node - a receives this acknowledgement and so it does not enter into a retry state at the end of the current round . even though node - a does not go into a retry round , it continues to route messages until its backup power is exhausted . fig3 depicts the process in which node - a fails to get an acknowledgement for a power event report and has to retransmit the report . the actions taken by node - a are the same as those in the failure - free case shown in fig3 until the acknowledgement from the coordinator is lost in the po_rnd_period round . at the end of the round , node - a goes into a retry round . the retry round lasts for the time determined by the po_retry_rnd_period parameter . node - a selects its retry transmit time pseudo - randomly within the period and resends a power event report containing its address . node - a does not have to originate a retry frame if it has an opportunity to add its event report to a routed power event report frame while in the retry round . an example of power event reporting for a node that is one hop from the coordinator is shown in fig3 . node - b is a neighbor of the coordinator . one - hop nodes can transmit their reports to the coordinator in the po_aggregate_period round . node - b transmits the power event report after a pseudo - randomly - chosen delay and receives an acknowledgement . if the acknowledgement were not received , the node would retransmit the event report in the following po_rnd_period round . leaf nodes transmit their reports during the po_aggregate_period round . fig4 shows a typical leaf node power event reporting process . a leaf node , node - c , chooses a pseudo - random time within the interval of duration po_aggretate_period to transmit its power event report . the acknowledgement for this report may not be received until near the end of the interval of duration po_rnd_period . in this case node - c receives the acknowledgement and its power event reporting process is completed . if an acknowledgement is not received , node - c enters an interval of duration po_retry_rnd_period and retransmits the event report . this continues until node - c runs out of backup power or an acknowledgement is received . tree routing is normally used to send power outage / restoration event notification frames . mesh routing may also be used as an alternate method if the node has been waiting to send its event for more than the time set by the parameter power_report_wait . power restoration reporting uses the same process and messaging as power outage reporting , except that the parameters po_rnd_period and po_retry_rnd_period are replaced by the parameters pr_rnd_period and pr_retry_rnd_period . for nodes that are members of overlapping networks , power outage and power restoration notifications may be done to any of the registered networks . different coordinators are selected in round - robin fashion at each attempt of reporting a notification . attempts to send power restoration notifications are repeated up to the duration restoration_timeout . nodes that are not members of overlapping networks initiate an association process after waiting an interval whose duration is restoration_timeout . after a successful association , the associating nodes do not need to send power event report messages since the association process itself sets the coordinator &# 39 ; s state for the node to “ alive .” a mesh multicast service is used to send application level information to a group of nodes that share the same group address . a group address is a 2 - octet short address within the range 0x3000 to 0x3fff . group addresses are well known or configured , with well known addresses assigned from address 0x3fff and decreasing while configured addresses are assigned from address 0x3000 and increasing . the mesh layer does not provide services to configure group addresses ; such assignment needs to be made by the application layer from a centralized location such as the coordinator . a mesh multicast service consists of a local broadcast by the originator of the multicast message . each router receiving this message verifies : that the message has been received from an authenticated node listed in its neighborhood table ; and that the message originator address and request id do not match those of a previously processed message . the router then verifies that the target address matches one of its own group addresses . if a match is found , the message is propagated to the router &# 39 ; s upper layers for processing . the router also determines whether the target address matches a group address of its child end devices . if so , the message is sent to each child end device having a matching group address . a copy of the message is saved for each sleeping end device with a matching group address . child - group - addresses are acquired by a parent router by inspecting the first keep alive request message sent by each child end device after the end device chooses or changes its primary parent . routers do not forward group - addressed frames to end devices for which they are not primary parents . multicast data transfer frames with a max remaining hops field greater than one are re - broadcast . to re - broadcast a message the router first decrements the max remaining hops field and broadcasts the resulting message to its own neighbors . duplicate multicast messages are ignored based on the messages &# 39 ; originator address and request id as specified previously . the max remaining hops field can be used to limit the region for which a multicast is sent . to target all nodes within the network , a coordinator should set the max remaining hops field to the value max_hops . to achieve the same result for frames from a different source , a non - coordinator node should set the max remaining hops field to twice the value max_hops . all sm nodes in a group have the well known group address shown in table 5 . a simple example of the mesh multicast process is shown in fig4 . node - x initiated the multicast data transfer , which progressed through the mesh network until it reached node - a and node - b , where node - a is a neighbor of node - b and node - c , and node - c is a neighbor of node - d , but node - b is not a neighbor of node - c . node - a receives the multicast data transfer frame and checks the originator address and request id . because it appears to be a previously - unreceived multicast frame and the value of the max remaining hops field is greater than one , node - a forwards the frame after decrementing the value of the max remaining hops field . the forwarded frame goes to node - b and node - c . both node - b and node - c also forward the frame to their neighbors . the frame forwarded by node - c goes to node - d where it is not re - forwarded because the value of the max remaining hops field in the received frame equals one . at a later time , node - b receives the multicast frame via another route . this duplicate frame carries the same originator address and request id as the prior frame , so it is discarded and not forwarded . the local communication process is used to initiate point - to - point communication between two nodes that may not already be part of the same mesh network . typical applications that use this type of communication are installation , operation and maintenance activities and walk - by reading of nodes using a handheld reader . local communications use the node &# 39 ; s long 8 - octet ieee eui - 64 address rather than its short 2 - octet address . in the cases of walk - by communication with targeted devices that are not sleeping , the handheld device issues the local broadcast request frame to initiate local communication . from the responses to this local broadcast , the handheld device can build a table of local devices that are awake , where each table entry includes the following information about the responding node : long and short addresses ; pan ids ; device class information ; and optionally network name , security flag , version , owner , and bar_code_id . from this resulting acquired table of device information , the user can select the device with which to communicate . there are two local communication options : 1 ) local data transfers that use the application level services using local data transfer frames , and 2 ) rf link measurements using the range test request and range test response frames . fig4 shows a typical local communication sequence . the handheld device discovers the local nodes by transmitting a local broadcast request frame . this message is answered by node - a and node - b . the handheld application selects node - a and sends it a local data transfer frame that executes an application service such as a read operation . node - a responds with a local data transfer frame containing the application response . all frames except the first broadcast frame are acknowledged with mac - level acks . the range test process uses the local communication range test request and range test response frames . the range test request command frame is used to check whether node is reachable in the local communication mode . the range test response frame reports the signal strength as recorded by the responder in the forward direction . the signal strength of the response is measured by the range test originator to determine signal strength in the return direction . the range test initiate and range initiate result frames can be used to request one node to perform a range test with a different node and to report the test results to the requester . a typical example of this function is for a handheld test tool to request a router to do a range test with an end device . fig4 shows this process , where a handheld device requests node - a to perform a range test with node - b . the range test initiate sent to node - a tells it to send a range test request to node - b . node - b receives the request and records its modem &# 39 ; s rssi and lqi values as measured during request frame reception . node - b then sends a range test response to node - a , which records its modem &# 39 ; s rssi and lqi values as measured during response frame reception . node - a then sends a range test result to the handheld device , reporting the rssi and lqi values for both the range test request and range test response frames between node - a and node - b . the frr test is used to evaluate the one - way link quality between a sender and a receiver . theses two nodes need to be able to reach each other directly . the sender sends a configurable number of frames in local communications mode to the receiver . at the end of the test , the receiver sends a result frame to the sender . this frame contains the frr and the average lqi for received frames . a frame reception rate session consists of : the transmission of the frame reception rate test init message ; multiple transmission of the frame reception rate test data messages ; the transmission of the frame reception rate test end message ; and the reception of the frame reception rate test result message . with the exception of the frame reception rate test data messages , frame reception rate test control messages are transmitted with mac layer acknowledgment and retry . in the case of a mac layer transmission failure , such control messages are re - transmitted up to a maximum of frr_test_retry times . an example of the frame reception rate test process is shown in fig4 . a handheld initiates the test in this example by sending the frame reception rate test init message to node - a . the test is set to send n test frames without acknowledgements . the handheld starts sending the first of the n test frames to node - a after it receives the ack from node - a for the test - initializing message . the frame reception rate test end message is sent after the n test frames . the test end message is acknowledged by node -, which then sends the frame reception rate test result v to the testing handheld . the ping command is used to check whether a node is reachable through the mesh network , and to determine and trace the routes used for each direction of communication . the ping frame tests the ability of a device to reach a node that is more than one hop distant , since testing of the first hop is provided by range test commands . a ping request can be used by a coordinator to determine whether a device that is awake is reachable in the intervals between keep alive requests . the ping request frame can be used with any type of routing . as the frame traverses each node , the rssi and lqi values measured during frame reception are noted . both values are added to the frame before it is forwarded . the addressed receiving device processes the ping request frame , converts it to a ping response frame , and sends that response back to the originating device . the rssi and lqi values measured during frame reception on the return path are appended to those accumulated as the ping request frame traversed its forward path . in fig4 , node a initiates a ping request message targeting node - c . the frame within the ping request message is routed through node - b . node - b updates the frame data by incrementing the hop count , and appending its 2 - octet address , the measured rssi and the observed lqi to the ping request frame &# 39 ; s accumulated data before forwarding the frame to node - c . node c converts the received ping request frame to a ping response frame and sends it to node - a . when the ping response frame arrives at node - a , it contains the path traversed by the request and response frames and the measured rssi and observed lqi values noted at each hop . the sm frame structure is presented so that the leftmost or first - described field is transmitted or received first . except for octet arrays , all multi - octet fields are transmitted or received least significant octet first . to maintain compatibility with the ieee 802 standards , addresses and pan identifiers are considered octet arrays and are transmitted unaltered , which is equivalent to transmitting them most significant octet first when viewed as multi - octet fields . each frame described in this document includes mac layer fields , which are documented within the mesh layer to provide the context on which the mesh layer operates . the mac and mesh layers are tightly coupled , so that information required by the mesh layer that is already present at the mac layer is not duplicated . descriptions of the mac layer fields are provided in this subsection so that they need not be duplicated in the description of each mesh - layer frame format . more information on these fields can be found in the ieee 802 . 15 . 4 : 2006 standard , which is the controlling specification for the mac protocol and is incorporated herein by reference in its entirety . bits 4 to 6 of the first octet of the mesh header are called the service type . this field defines the structure of the next of the mesh header and the general behavior of a group of messages . with the exception of the data transfer frame , the subsequent header prefix contains a field called service code which defines the specific message format for the last of the mesh header . table 7 enumerates all defined combinations of service type and service code . the mesh multicast message format set forth in fig4 facilitates multicast of application data to a group of nodes within a mesh network . group addresses need either to be pre - assigned or assigned by an upper layer . this layer does not provide services to remotely assign group address to nodes . the route request message is used to create a route to a target node for peer to peer communication between two nodes using mesh routing . the route request message format is shown in fig4 . the route error message is sent out to inform surrounding nodes that a route to a destination has fail and need to be invalidated . this message is sent as a broadcast frame with hop count set to 1 . each node receiving this message , re - broadcast the route error if its route table shows that other nodes use this node as a route to the destination and must therefore be informed of the invalid route . the route error message format is shown in fig5 . all messages described within this subsection share the same mac header and mesh header prefix format . this common portion of the message is shown in fig5 . the association confirmation request message is sent to the coordinator by a router when an “ association request ” is received from a node requesting an association . the association request message format is shown in fig5 . the association confirmation response message is returned by the coordinator to a router in response to an association confirmation request . the association confirmation response message format is shown in fig5 . the keep alive initiate message is sent by the coordinator to request that a node initiate immediately its keep alive request . this message is optional and used by the coordinator to control the flow and distribution of checkpoint messages . independently of this optional message , nodes autonomously initiate their checkpoint process by sending a keep alive request after each checkpoint_period . to control the flow of messages , the coordinator must send a keep alive initiate prior to the expiration of this period . warning this request is sent using source routing , routers routing this message shall not create a temporary route . this allows the following keep alive request to trace current tree route from this node . the keep alive initiate message format is shown in fig5 . the keep alive request message is sent periodically to the coordinator to maintain the node association . the keep alive request frame format is shown is fig5 . the following describes the different extensions to this basic frame format . transmission of these extensions follows these rules , which are listed in order of priority : the trace route extension is transmitted with the first keep alive sent after a node associates with a coordinator , and by default when no other extension needs to be transmitted . the multicast group addresses extension is transmitted by end devices with the first keep alive response sent after each parent change . the statistics extension is transmitted once a day with the first keep alive sent after midnight local time . the neighbors extension is transmitted once every 4 hours . the optional trace route extension is shown in fig5 . this extension is not authenticated by the network mic - 32 since the number of hops value is incremented and a pan identifier and short address is appended at each hop . the optional multicast group addresses extension is shown in fig5 . the keep alive response message is sent by the coordinator in response to a keep alive request . the keep alive response frame format is shown in fig6 . operations on the mesh key are associated with the mesh key table entry for the coordinator sending the keep alive response message . the write - switch - deactivate key parameter list member may be occurring multiple times in a message . the route establishment request message is used by a node to request from the coordinator a route to a target node for peer to peer communication using source routing . the route establishment request message frame format is shown in fig6 . the power event report message is sent by nodes to notify of a power outage or power restoration condition and the frame format is shown in fig6 . the ping message is used to test mesh communication during quality assessment ( qa ) or when the network is deployed . the ping message frame format is shown in fig6 . the service forwarding message is used by the router servicing a service request to send service messages to and from the coordinator . the service forwarding message frame format is shown in fig6 . the association request message is sent by a node to router in its neighborhood to request an association to the identified mesh network . the association request message frame format is shown in fig7 . an association response message is returned by a router to a node in response to an association request . an association response message frame format is shown in fig7 . the neighbor info request message is broadcast to get information about neighbor routers . the frame format shown in fig7 is used when the originator of the message is not a network member . the frame format shown in fig7 is used when the originator of the message is a network member . the neighbor info response message is sent by each neighbor router when a neighbor info request is broadcast . this message contains the network name and coordinator load of the responding neighbor , the quality of the requesting node &# 39 ; s signal as received by this neighbor , and the list tree position of this neighbor on different network trees . the neighbor info response message frame format for an non - network originator is shown in fig7 . the neighbor info response message frame format for an in - network originator is shown in fig7 . the neighbors exchange message is broadcast locally by each node and used to maintain the neighborhood information and to optimize the network tree . the neighbors exchange message frame format is shown in fig7 . the end device data request message is used by an end device to request pending data messages from its parent . the end device data request message frame format is shown in fig7 . the end device data response message is used in response to an end device request to indicate the presence or not of pending data . the end device data response message frame format is shown in fig7 . the service request message is used by a device non - member of the network to communicate with a specific service such as the commissioning service . the router used as a proxy is responsible for limiting the flow of messages to provide protection from denial of service attacks . see the forwarding service messages for more detail . the service request message frame format is shown in fig7 . the service request response frame format is shown in fig8 . the local data transfer message is used to transport upper layers information for a point to point communication . the local data transfer message frame format is shown in fig8 . the frame reception rate test init messages are used to compute the frame reception rate . this function is provided mainly in support of radio manufacturing . a test is initiated by sending a frame reception rate test init frames , follow by one or a multitude of frame reception rate test data frames , followed by an optional frame reception rate test end frame . the target node responds to the frame reception rate test end frame with a frame reception rate test result frame . when a frame reception rate test result is not received , the originator can retry by sending one or more frame reception rate test end frames . the frame reception rate test init message frame format is shown in fig8 . the local broadcast request message is used to retrieve a list of local devices . the local broadcast request message frame format is shown in fig8 . the local broadcast response message is sent by all nodes which have received a local broadcast request with matching criteria ( rssis and payload ). the local broadcast response message frame format is shown in fig8 . the end device node present message is sent by a battery operated device , e . g ., a sleeping device to a wake - up device , following an impulse , such as a magnetic impulse , from a wake - up device , e . g ., hand - held device . the end device node present message frame format is shown in fig9 . the range test request message is used to record the signal strength ( rssi ) in both directions between two nodes . the range test request message frame format is shown in fig9 . the range test initiate command is used to request that a node initiate a range test request to a target node . the range test initiate command frame format is shown in fig9 . the range test result command is used in response to a request that a node initiate the range test request to a target node . the range test result command frame format is shown in fig9 . the 802 . 15 . 4 standard states the following about link quality indicator (“ lqi ”). the lqi measurement is a characterization of the strength and / or quality of a received frame . the measurement may be implemented using receiver ed , a signal - to - noise ratio estimation , or a combination of these methods . in a preferred embodiment , transceivers , are used to measure signal strength . the lqi is calculated as follows : where l is the received signal level in db above the sensitivity level of the radio on the meter ( node ). the sensitivity is measured for each radio model used in the mesh network . it is defined as the signal level above ambient noise for which a frame reception rate of 99 % is obtained . measurement is done with a wired lab setup with frame lengths of 127 octets . lqi classes group together links that have similar probability of successful transmission . various studies on rf propagation , mostly targeting cellular market , suggest using a fade margin between 20 and 40 db . since the meters in the preferred embodiment are fixed and time dependent , attenuation is only caused by the movement of external obstacles ( persons , vehicles ). accordingly , a margin of 15 db should be sufficient to have a reliable link . in other words we consider a link with a signal strength 50 db above the sensitivity level has about the same chances of success as a link with a signal strength 15 db above sensitivity . the limit for average links is set at 5 db above sensitivity . table 59 summarizes the significance of the lqi classes . the association ratio is calculated by a node to select which coordinator to choose . it is a weighted sum of : the “ number of hops ” to the coordinator ( from neighbor info response ), the “ coordinator load ” ( from neighbor info response ), the number of local neighbors ( from the number of neighbor info responses received for the selected network ) and the “ min lqi class ” ( maximum value from all neighbor info response adjusted for last hop ). table 60 lists the weighting factors . the preferred route ratio is computed by a node to select within its parents , the one that represents the optimized path to access the coordinator . this ratio is calculated based on the neighborhood table information as received within a neighbor info response or a neighbors exchange . for all the possible routes with the best min lqi class , select the routes with the least number of hops from this remaining list , select the one with the best avg lqi ( not used to change the preferred routers ) end devices selects a neighboring router based on the following criteria applied in the order indicated : from the list of neighbors with the best lqi class ( class computed only on the link between the rfd and its neighbor ) select the routers with the lowest “ router load ” from the remaining list , select a router with the least number of hops from the remaining list , select the routers with the best avg lqi the pseudo - random delays required by nodes for this layer are computed based on the following equation : each time a pseudo - random number is generated , i = (( i + 1 ) % 8 ) the pseudorandomvalue represents a value within the radio which changes over time , such as the neighbor table checksum or the “ number of frames transmitted ” statistic . the ieee 802 . 15 . 4 short addresses are assigned sequentially by the coordinator . six bits of this address are used to partition nodes into 64 different groups . this number represents bits 8 to 13 of the final pseudo - random number . for example , if a network has 432 nodes , between 6 and 7 end points will share the same 6 bits . bit 0 to 7 of the pseudo - random number is computed based on the ieee 802 . 15 . 4 long address and a pseudo - random value that changes over time . the pseudo - random number generated is a number between 0 and 8191 , which needs to be scaled for the appropriate range . the following tables propose data structure definitions in support of the implementation of the sm layer discussed herein and may be adapted for each specific implementation . the mesh key tables stores the mesh key ( s ) used by the device . each mesh key is associated with the pan id of the coordinator it is used with . mesh keys are administered by the associated coordinator . when the dll key id is set to 0 . in the context of the when the dll key id is set to 1 . in the context of the the node key table stores the node key ( s ) used by the device . the sm network security process uses the node key table to look up the information needed for the network security mic calculation for messages between the coordinator and devices . the information in the node key table is retained during a power outage and a device reset . the maintenance table stores the information used for nodes associating with the network and for maintenance devices that access the nodes using point - to - point messages . the information in the maintenance table is retained during a power outage and a device reset . the neighborhood table data structure is maintained in each radio to keep the information about neighbor nodes . this data structure is required to implement at least the following processes : association , tree routing , route discovery , neighbors exchange , tree optimization , checkpoint . minimum of all lqi rx and lqi tx for each hop between set to true if this entry has not been sent at least once in an entry when this flag set to true . the intent of this flag neighbor can still be used for tree routing if its number when the number of neighbors exceeds the capacity of the neighborhood table , the goal is to keep in the table 5 best parents / siblings ( best routes ) and all nodes that set the current node as preferred parent ( avoid tree instability ). we also want to give a chance to new candidates to flag the current node as preferred parent . this is done by including them in a round robin fashion among others entry . the radio applies the following logic when it receives a new candidate . if the new candidate is a not a parent , replace the next entry that : is not one of the 5 best parents / siblings has not select the current node as preferred parent was sent at least once in a neighbor exchange message . this last clause ( 3 ) allows candidates to receive the information needed to choose this node as preferred parent . if the new candidate has flagged the current node as preferred parent , this last condition is ignored . if we have less than 5 best parents / sibling , use the same scheme as if it was not a parent . in last resort , replace a node that set the current node as preferred parent using the same round robin scheme . if we have already 5 best parents / sibling , replace the worst parent / sibling if the candidate &# 39 ; s preferred route ratio is greater than its preferred route ratio . the routing table is used to maintain routes established using the route discovery process . freshness use : the freshness value is used when the table is full and a new entry is added . the entry with the smallest freshness value is replaced with the new entry . if more than one entry has a value of zero , anyone can be replaced . this case only occurs if the table size is greater than 255 entries . every time a mesh frame is forwarded , no matter the routing method used , at the exception of the keep alive initiate , the forwarding node creates a temporary route entry to the originator in temporary route take . this allows the destination node to quickly send a reply , even if it didn &# 39 ; t previously know the route to the originator node . this route expires after temp_route_to . the end device table is used to maintain information about each end device child . security events are provided to the upper layers for diagnostic and auditing purposes . the content of each event is described bellow . the source route table is used to maintain source routes established by the route discovery process with the trace route flag bit set and through the route establishment process . hop away . therefore the number of hops is at least one . entry . reset to 0x1f ( 31 ) each time the entry is used .

US-55413509-A

the invention relates to a layered product containing different types of plastic waste and process for preparing the same . due to its toughness , weldability , insulation property and chemical resistance the layered product according to the invention is usable among others in construction industry , electric industry and chemical industry .

during conducting examinations directed to recycling dangerous plastic waste we found that plastic sheets having excellent physical - chemical properties can be prepared by the use of layered structure a - b - a according to the present invention . the advantageous properties of the layered product according to the invention is attained in the presence of reinforcing fibers or fiber reinforced ground bmc and / or smc particles , which are surrounded and fully covered by polyolefin matrix . by recycling the plastic waste according to invention its harmful effect to the environment is neutralized , at the same time easily weldable product is obtained . the length of the reinforcing fibers used is adjusted by grounding the bmc and / or smc particles to proper size . thus a product having pre - planned properties is prepared . larger amounts of longer glass fibers results in more flexible product . on the other hand , in the case of smaller particles , the glass fibers extending from them bind the particles tight to the surrounding resin and thus a more rigid structure is obtained . in addition to this the chopped pet bottle , which has been incorporated in the product without melting , keeps its original flexibility and fulfills reinforcing function as well . the present description includes the following technical terms of plastic technology : a matrix is a thermoplastic ( i . e . a basic polymer ) to which mainly inorganic materials ( reinforcing and / or filling materials ) are added , then homogenized . this is practically a pre - product . the term compound relates to a reinforced and / or filled thermoplastic ( usually in the form of granulate , prepared for further processing ) which contains components having properties different from ( i . e . better than ) the properties of the matrix , such as higher elastic modulus , better fire retardant effect , higher uv resistance , better pigmentation , etc . a composite is typically a ( glass -) reinforced unsaturated epoxy or polyester thermoset . its final rigidity is attained by heat curing . agglomerate represents a transitional state between ground and granulate . in an agglomerating equipment plastic foil shrinks on the effects of heat and sprayed water , and binds to particles usable in further technology . epdm ( by exact name , ethylene - propylene - diene caoutchouc terpolymer ) has excellent oil - and uv - resistant properties . this is an architectural insulation / protection sheet of general use . introducing recyclate formed from epdm waste into layer a according to the invention decreases the resultant rigidity of the multilayer product by shifting the matrix properties toward elasticity . due to the low melting temperature of the thermoplastic polyolefines included in layer a , the mixing extruder used in the process according to the invention for the preparation of layer a may be operated at a temperature as low as 160 to 180 ° c ., which is 100 ° c . lower than the melting temperature of the pet bottle waste used as layer b . thus the latter does not melt and also functions as reinforcing material , thereby improving the mechanical properties of the layered material according to the invention . a further advantage of the present process is that it can be carried out without actually melting the recycled pet waste , i . e . in energy efficient manner , by which harmful emissions from combustion are avoided . a still further advantage is that it permits the use of pet bottles in mixed colour , the utilization of which was not solved until now . moreover , according to the invention unwashed pet bottles may also be used , which decreases environmental load . by proper setting of technological parameters , like line roller pressure and the sizes of the ground pet waste particles , inclusions of air may be formed in layer b . the advantageous properties of the layered product containing plastic waste , according to the invention allow a great variety of uses . the layered product according to the invention has excellent mechanical properties , like high strength and excellent shock resistance . besides , a sheet prepared from said product shows multiple rigidity comparing to conventional plastic sheets , moreover its bending strength is higher . furthermore its life span is long and its weather resistance is excellent . in view of these properties they can be used in the building industry , for example as waterproof sheets and as wear resistant surfaces , footpaths , pavements and platforms and the like . due to their adhesive surfaces they can also be used as formworks . by their application the use of expensive live wood can be avoided . due to its excellent heat -, sound - and resonance - insulating properties the product according to the invention can well be used as self - retaining sound insulation panels . this particularly applies to the embodiment where layer b includes inclusions of air . since the recycled starting material of the product by itself belongs to the self - quenching degree of flammability , the end - product can easily be made self - quenching by applying further fire retardant protection . this enables its use in the electric industry . because of its high electric strength this product can be used for example as cable duct . it can also incorporate inductive or capacitive sensors . in view of its chemical resistance its use as covers of containers storing dangerous goods can also be considered . over and above these favorable properties a further advantage is the good workability . this product shows good flexibility in the forms of both thick and thin films . further it is easily weldable and thus it can be welded to panels . this way , large self - retaining panels can well be prepared . the above properties can further be improved by adding various additives , and thus for example flame - tightness , uv stability and mechanical properties of the product can be improved . the product according to the invention has an advantageous effect on the environment , since its preparation involves disposal of dangerous plastic waste . furthermore the waste gradually arising from the product according to the invention is not as dangerous to the environment as the starting materials from which it is prepared , since it incorporates and fully covers the above - mentioned dangerous plastic waste basic materials . in the following the invention further explained by way of examples . it is emphasized however that the invention is not limited to the embodiments disclosed in the examples . lightning protection base plate having high electric strength is prepared by pressing , final size 300 × 400 × 8 mm . the lightning protection plate is placed between the roof insulation and the structure ( buck ) fastening the lightning arrester , which releases over - voltage . 55 % by weight original granular polyolefin , particle size : 3 to 5 mm , 30 % by weight ground waste including smc and bmc in half - and - half ratio , particle size : 0 . 1 to 0 . 5 mm , 14 % by weight polyethylene foil agglomerate , particle size : 3 to 5 mm , 1 % by weight uv resistant inorganic colourant . at first , layer “ a ” is prepared . measured amount of the above composition is spread in an open press tool , then the upper die is let down and molding is carried out on 160 ° c . applying pressure of 100 mpa . the temperature of the press tool , holding ( baking ) time and final pressure is set using plc ( programmable logic controller ). the base plate represented by structure “ a - b - a ” is prepared in another press tool . layer “ a ” is preheated to 80 ° c . and placed in the tool , then the carefully portioned chopped pet as layer “ b ” is spread on its top , finally it is closed with a second layer “ a ” which was preheated according to the foregoing . the used pressing temperature is 170 ° c ., final pressure is 220 mpa . the thickness of the end - product is 8 ± 0 . 25 mm , wherein layer “ a ” is 3 . 2 mm , layer “ b ” is 1 . 6 mm , within the defined tolerance limits . the electric strength data have been verified by experimental measurements . the electric strength of the lightning protection base plate prepared above is 200 kv / mm measured according to hungarian standard msz en 60450 : 2004 . insulation sheet against groundwater is prepared in continuous process , between heated calender rolls , resultant width 2 m , thickness 2 . 5 mm . the insulation sheet is marketed in the form of roll stock with interposed impregnated paper layer to prevent adhesion . 75 % by weight polyolefin component containing 65 % by weight recycled ground polyolefin , typical particle size 3 mm , further 10 % by weight epdm recyclate , particle size also 3 mm , 15 % by weight ground smc and bmc waste , particle size : 0 . 1 to 0 . 5 mm , 10 % by weight mixed polyethylene and polypropylene foil agglomerate , maximum particle size : 3 mm , when preparing the layer of composition “ a ”, the components are mixed intimately , then this mixture is filled in the feed throat of an extruder screw . the homogenized material is converted to sheet in one step , applying wide mouth output ( also called as wide slot output ) commonly used in the practice of plastic industry . the operating temperature of the mixing extruder is between 160 to 170 ° c . after that this sheet is lead between multiple pairs of heated rolls to obtain layer “ a ” having width 2 m and thickness to about 1 . 2 to about 1 . 3 mm , which is then cooled and stored , as pre - product , in rolled form . the preparation of sandwich structure “ a - b - a ” proceeds from two rolls of layer “ a ”. they are passed between feed rolls pre - heated to 100 ° c ., and pet forming layer “ b ” is evenly added between the two layers “ a ”. in the practice this is carried out using a charging bend conveyor or a reciprocating screen . the layers are joined and final pressure is applied by a pair of calender rolls operating on 160 ° c . line pressure of 40 mpa is applied . of course the effective pressure in the neutral line of the material moved with wheel feed does not appear along a theoretical line . this process is carried out as described above with the difference that two extruders are simultaneously used . the layers are joined right after production . the end - product is 2 . 5 mm thick , wherein “ a ” = 1 mm and “ b ” = 0 . 5 mm . it is marketed in rolled form . the watertight sheet is welded , with the sheet &# 39 ; s own material at the place using a special apparatus and a hot air blower . anti - adhesive layer of plain form panel is prepared in continuous process . the anti - adhesive surface of form work system used in building industry is always the surface that communicates with the poured concrete . anti - adhesive element base size : 2 × 3 mm , thickness : 25 mm . 62 . 5 % by weight recycled ground polyolefin , particle size : 5 to 6 mm , 31 . 0 % by weight mixed ground smc and bmc , particle size : 2 to 3 mm , 5 . 0 % by weight polyethylene and polypropylene foil agglomerate , particle size : the preparation of layer “ a ” is carried out according to process b ) of example 2 . two extruders are used in continuous process . the operating temperature of the extruders is 170 to 180 ° c . a width of 2 m and a thickness of about 11 to 12 mm each are reached by passing each layer between two pairs of rolls heated to 140 ° c . the chopped pet bottles forming layer “ b ” is added between layers “ a ”. the gathered layers are joined by passing them , between a single pair of high performance calender rolls . the temperature of the rolls is 180 to 200 ° c ., the applied line pressure is 45 to 60 mpa . the thickness of the anti - adhesive layer is 25 mm , that of layer “ a ” is 10 mm and layer “ b ” is 5 mm . the lamination is clearly visible to the necked eye . the width of the sheet is 200 cm . the multilayer sheet prepared in continuous process is cut to 300 cm long panels by commonly used wood working machine with intensive cooling . the elastic modulus of the prepared anti - adhesive layer is 8 000 n / mm 2 . the preparation of continuous , large size surfaces is carried out by binding form panels with hot air welding . robust , rigid and wear resistant form work system is prepared this way . the anti - adhesive form panels prepared according to the foregoing is used for continuous concreting in sliding form work technology . trap - troughs are prepared . they are used to catch oil and other dangerous liquids under electroplating tanks , acid accumulators , oil filled transformers , etc . in the practice , the size of a trap - troughs are individually planed or otherwise , pre - planed in a suitable volume series . starting size of panel : 430 × 610 × 10 mm ( standard a3 size , ⅛ m 2 ). the panel is formed by pressing , side walls are cut off from the panels , and the trough is prepared by welding the base and the side walls together . 60 % by weight original granular polyolefin and recycled ground polyolefin , predominating particle size : 2 to 4 mm , 25 % by weight ground smc and bmc waste , typical particle size : 2 to 3 mm , 15 % by weight mixed polyethylene and polypropylene foil waste , average particle size of agglomerate : 3 mm . the preparation of layer “ a ” corresponding to the starting panel size is carried out as disclosed in example 1 . layered structure “ a - b - a ” is also prepared as disclosed in example 1 with the difference that the final pressure is 330 mpa . the thickness of the finished trap - trough base panel is 10 mm , that of layer “ a ” is 4 mm and layer “ b ” is 2 mm . the panels prepared this way are shaped with conventional wood working tools . the trap - trough is assembled by binding the base panel and side walls using a hot air welding equipment and a welding rod made of the panel &# 39 ; s own material . trap - troughs having basic area smaller than the size of the starting panel are formed by warming and raising the side walls using a special tool . the recultivation thick foil is prepared in continuous process , between heated rolls . width of foil : 1 . 6 m , thickness : 5 mm . it is marketed in the form rolled bala . 60 % by weight particles of original granular polyolefin and recycled ground polyolefin with particle size : 2 to 3 mm , 21 % by weight ground smc and bmc waste : particle size 1 to 3 mm , 15 % by weight chopped polyethylene foil waste agglomerate , particle size : 2 to 3 mm , 1 % by weight anti - mold additive , 3 % by weight uv - resistant colouring pigment . the preparation of layer “ a ” is carried out as disclosed in example 2 . in this example two parallel extruders are operated in continuous process . the operating temperature of the mixing extruders is 170 ° c . each layer is passed between two pairs of rolls heated to 150 ° c . to reach a width of 1 . 6 m and a thickness of 2 . 2 mm each . the preparation of structure “ a - b - a ” is carried out between calenders heated to 180 ° c ., applying line pressure of 50 mpa . the cross section are data of final recultivation foil is 5 mm , wherein layer “ a ” is 2 mm and layer “ b ” is 1 mm . in the practice , the recultivation foil is used for large scale covers of dust holes , and to contain the dust of harmful materials ( e . g . red mud ) in storage . the foil can easily be spread and a continuous , air tight surface is formed applying hot air welding at the place . the foil is fixed by spreading soil on the surface . the sound and resoinance damping panel is prepared in continuous process . width of the panel : 1 m , thickness : 30 mm . the length of the panel is set to meet the requirements of specific application . 70 % by weight polyolefin component containing 50 % by weight recycled ground polyolefin , typical particle size 3 to 5 mm , and 20 % by weight epdm recyclate , particle size 4 to 5 mm , 15 % by weight ground smc and bmc waste , particle size : 0 . 15 to 0 . 55 mm , 15 % by weight chopped polyethylene and polypropylene foil agglomerate , particle size : 3 to 4 mm . layer “ a ” is prepared as disclosed in example 2 . again , two parallel extruders are operated in continuous process . layer “ b ” is added between the two layers “ a ” as disclosed in the foregoing . the technical parameters are identical with those mentioned in example 3 with the difference that the line pressure between the calender rolls joining the layers is set suitable low , i . e . 35 mpa . this relatively low pressure value is favorable to the formation of tiny inclusions of air , i . e . which have diameter from 0 . 5 to 1 mm , in layer “ b ”. the sound and resonance damping panels prepared this way are usually cut to panel size 1 × 1 m . it may also be prepared with linear dimension of 2 m if required . the thickness of the end - product is 30 mm , that of layer “ a ” is 12 mm and layer “ b ” is 6 mm . the damping of the sound and resonance damping panel prepared this way is 25 to 30 db . the degree of sound or resonance damping can be enhanced by putting multiple damping panels according to the invention in acoustic series .

US-201214363616-A

the present invention is a side - mounted position indicator for use with a flapper check valve . the indicator is located outside the valve body and attaches to an internal , cylindrically - shaped roller that allows limited rotation about one axis . this roller has a tripper rod that extends from one side of the roller and has a round , non - marring plastic ball on its opposite end . the ball is held in contact with the valve flapper using a mechanical spring . a separate flush port is provided to allow for periodic internal cleaning without substantial disassembly .

referring to fig1 and 2 , the position indicator ( 20 ) of the present invention is designed for use with a flapper swing check valve assembly ( 53 ) with a valve body ( 52 ) that includes an inlet ( 49 ) and outlet ( 50 ). the media flow path is indicated by a flow arrow ( 55 ). the valve body ( 52 ) has a top opening ( 56 ) which is enclosed by a cover ( 57 ). the valve body ( 52 ) also houses a flapper ( 58 ). this flapper ( 58 ) includes a hinged attachment ( 59 ) to the valve body ( 52 ), which allows the flapper ( 58 ) to rotate between open and closed positions within the valve body ( 52 ). the flapper ( 58 ) is normally in the closed position , as shown in fig1 , when no media flow is present in the valve body ( 52 ). this flapper ( 58 ), when in the closed position , rests against a metal seating area ( 69 ). the flapper ( 58 ) can incorporate a sealing bead ( 60 ), or other sealing mechanism , that insures drop tight sealing under pressure . referring more specifically to fig1 , 2 and 3 , the preferred embodiment of the present invention provides a position indicator ( 20 ) that preferably attaches by threaded plug or bushing ( 01 ) into a like threaded hole on top of the valve cover ( 57 ). other attachments mechanisms may also be used . the position indicator ( 20 ) further comprises : ( i ) a bracket assembly ( 15 ) that is attached to plug ( 01 ) and straddles the opening in the top of valve cover ( 57 ) or body , ( ii ) a roller ( 02 ) that is rotationally mounted within the bracket assembly ( 15 ), ( iii ) a rod ( 06 ) attached to the bottom of the roller ( 02 ) that extends into the valve body ( 52 ) so as to contact the flapper ( 58 ), and ( iv ) an exterior position indicator ( 08 ) that is mounted on at least one side of bracket assembly ( 15 ) and interacts by connecting the corresponding end of roller ( 02 ) to indicate the position of flapper ( 58 ) as roller ( 02 ) rotates . each interactive roller ( 02 ) end can extend from the side of the valve body ( 52 ), as shown in fig3 , or can be exposed to exterior position indicator ( 08 ) inside the bracket assembly ( 15 ). and now with reference to fig4 and 5 , in a preferred embodiment , the bracket assembly ( 15 ) further includes a clean - out port ( 11 ), as well at least one side wall ( 03 ) that interacts with the exterior position indicator ( 08 ) to indicate whether the valve is open or closed . more specifically , the clean - out port ( 11 ) is a tapped opening at the top of the bracket assembly ( 15 ). a stopper ( 14 ) seals the clean - out port ( 11 ). the stopper ( 14 ) is preferably threaded and engages threading within the clean - out port ( 11 ). side wall ( 03 ) preferably contains markings or wording that corresponds to the position of the exterior position indicator ( 08 ) to indicate an “ open ” or “ closed ” valve position . in an alternative embodiment , two side walls ( 03 ) can be used so that the position of the flapper ( 58 ) can be ascertained from viewing either side of valve assembly ( 53 ). also , in an alternative embodiment , a spring ( 04 ) may be employed to create tension against the exterior position indicator ( 08 ) and force it and , by interaction through the roller ( 02 ) and the rod ( 06 ), the flapper ( 58 ) to a closed position . preferably , the exterior position indicator ( 08 ) is a fully adjustable indicator flag . in particular , the exterior position indicator ( 08 ) and the side wall ( 03 ) can have different insertion holes ( 16 ) and slots ( 17 ) for use in connection with the spring ( 04 ), which , in turn , allow the exterior position indicator ( 08 ) to adapt to the closed position of the internal flapper . related adjustment of the exterior position indicator ( 08 ) can be made at its point of connection to the roller ( 02 ), and , more specifically , loosening of the attachment mechanism ( 09 ). in an alternative embodiment of the present invention , the exterior position indicator ( 08 ) can employ other position indicators , including both mechanical and electronic indicators . for example , in an alternative embodiment of the present invention , a common electrical switch may also be added by bracketry to the bracket assembly ( 15 ) to interact with the roller ( 02 ) where it extends outward from the bracket assembly ( 15 ) to detect the position of the flapper ( 58 ) and to transmit a corresponding signal back to a control device . fig4 illustrates one embodiment of the present invention that utilizes an electrical position indicator . fig4 illustrates the exterior side view of the position indicator assembly ( 20 ) with a mountable limit switch . the roller ( 02 ) trips the sensing whisker on the limit switch . this , in turn , sends a signal to a remote control panel to indicate that the flapper ( 58 ) is in the open or closed position . referring to fig1 , 2 , and 3 , in preferred embodiments of the rod and roller elements of the present invention , the roller ( 02 ) is sealed , preferably with o - ring seals ( 13 ), so as to prevent fluid within the valve from leaking outside the valve body at the surface of roller ( 02 ). a plastic ball ( 05 ) is preferably attached to the bottom end of rod ( 06 ) to engage the flapper ( 58 ). the ball ( 05 ) can also be comprised of other materials . for example , if gravity alone is used to hold the ball ( 05 ) against the flapper ( 58 ) and help force the flapper ( 58 ) to a closed position in the absence of flow ( 55 ), the ball ( 05 ) can be comprised of a heavier material . the roller ( 02 ) provides for a low friction rotation with higher pressure at the point of contact with the roller o - rings ( 13 ) than in prior art designs using a ball pivot mechanism . such higher pressure makes the o - rings ( 13 ) function more efficiently . in operation , flow within valve body ( 52 ) causes the flapper ( 58 ) to pivot upward . such movement , in turn , lifts rod ( 06 ) and causes roller ( 02 ) to rotate such that position indicator ( 08 ) also rotates to indicate an “ open ” position on side wall ( 03 ). ball ( 05 ) helps rod ( 06 ) move smoothly against flapper ( 58 ) during such movement . when flow ceases , the flapper ( 58 ) closes and the spring ( 04 ) causes the position indicator ( 08 ) to return to a closed position . in contrast to the pivot ball of prior art designs , the roller ( 02 ) holds the rod ( 06 ) and the ball ( 05 ) at the end of the tripper rod ( 06 ) in a rigid position , i . e . the rod ( 06 ) to the roller ( 02 ) such that the rod ( 06 ) cannot move from side to side . as shown in fig2 and 3 , in the preferred embodiment of the present invention a retaining ring ( 07 ) may be used on each side to hold the roller ( 02 ) from shifting inside the bushing ( 01 ) as the flapper ( 58 ) opens and closes . in the preferred embodiment of the present invention , a lockwasher ( 10 ) may be used to keep the exterior position indicator ( 08 ) from slipping as a result of the spring ( 04 ) tension when the flapper ( 58 ) is opening and closing . when flow enters the valve body ( 52 ) the flapper ( 58 ) begins to move upward , which in turn contacts the ball ( 05 ) on the tripper rod ( 06 ), which turns the roller ( 02 ) and rotates the exterior position indicator ( 08 ) to the open position . in a preferred embodiment of the present invention , the bushing ( 01 ) is made of bronze ( alloy 360 ). the roller ( 02 ), rod ( 06 ), retaining ring ( 07 ), position indicator ( 08 ), attachment mechanism ( 09 ), lockwasher ( 10 ), and clean out port ( 11 ) are made of 303 stainless steel . the side wall ( 03 ) is made of epoxy - coated aluminum and the spring ( 04 ) is stainless steel . the ball ( 05 ) is delrin and the o - rings ( 12 , 13 ) are buna - n . these materials comprise the preferred embodiment of the present invention , but it will be obvious to those skilled in the art that the components of this invention may be comprised of an almost infinite combination of various materials that will function and serve the various purposes of the present invention . all such variations are included in the invention . the above - provided discussion of various embodiments of the present invention is intended to be an illustrative , but not exhaustive , list of possible embodiments . for example , the position indicator may attach to a valve &# 39 ; s opening that is located elsewhere than at the top of a valve body . it will be obvious to one skilled in the art that other embodiments are possible and are included within the scope of this invention .

US-26343505-A

in accordance with the present invention , a method and system is described for controlling the delivery of vapor from a bubbler containing a supply of chemical fluid through which a carrier gas is bubbled and from which bubbler vapors are delivered in a vapor stream entrained with the carrier gas . in general , the present invention involves equilibrating the pressure within the head space to that of the chemical fluid fill line , thus maintaining a constant fluid level based on pressure and not relying on conventional level sensors and controllers .

the liquid vapor delivery system 10 according to the present invention is best seen in fig1 . the liquid vapor delivery system 10 is designed to provide a vapor stream of an easily vaporizable liquid or reagent 38 which is contained in a reservoir 94 and in a bubbler 12 . in general , the present invention involves adjusting the pressure within the headspace of bubbler 12 to that of the chemical fluid level line 38 , thus creating a repeatable fluid level based on pressure , fluid dynamics , and not relying on conventional level sensors and controllers . this is accomplished in two stages . during the first stage , all inlets and outlets of the bubbler 14 , are set in a closed position except valves 102 , 104 and 106 . to begin the refill cycle , valves 120 and 110 are then opened to initiate the flow of liquid 38 from liquid source 94 to the bubbler 12 . the system , during the refill cycle , allows overfilling of the liquid level 38 in bubbler 12 to a level controlled by the pressure of the liquid delivery conduit 19 , thereby compressing the volume of vapor in bubbler 12 and creating a pressure approximating the liquid source line 12 . construction and placement of vapor extraction tube 28 prevents liquid from being forced into it . during the second stage , valve 110 is closed , pressure supply is removed from the liquid source 94 , and valve 124 is opened forcing excess liquid through liquid level set tube 37 back to bulk liquid source 94 . liquid delivery system 10 can be essentially viewed as having two major components , bubbler 12 and conduits system 90 . when compared to tradition bubblers bubbler 12 constitute an upside down design , in that all of the gas and liquid conduits that communicate with bubbler 12 are attached to bubbler floor 14 . this design arrangement of bubbler 12 led to an unexpected capability of cleaning bubbler 12 in - situ . bubbler floor 14 is designed so that the lowest point occurs at opening 21 which is attached to liquid source line or conduit 19 . thus , bubbler 12 can be readily cleaned in - situ without removing , disassembly , or contamination to the atmosphere . cleaning is simply accomplished by closing all valves except valves 110 , 128 and 130 . vacuum generator 136 is activated and reagent 38 is withdrawn through vent 152 . alternatively valve 132 may be opened to withdraw reagent 38 . valves 128 and 130 are then closed and a cleaning solvent ( not shown ) can be attached to conduit 19 , in place of reservoir 94 , and cleaning solvent may then be introduced into bubbler 12 . once cleaned , the cleaning solvent is then withdrawn from bubbler 12 as discussed previously in the case of reagent 38 . conduit system 90 essentially comprises a liquid source line 19 , vapor stream conduit 26 , level set line 37 and carrier gas conduit 92 all of which allow for fluid communication between bubbler 12 and carrier gas source 98 , liquid reagent source reservoir 94 and a vacuum system that comprises a vacuum generator 136 , purge gas supply 96 , vacuum generator supply 100 and vent 152 . it will be readily apparent to one of skill in the art that conduit system 90 would take on many permutations by simply changing the configuration of the valves consequently fig1 is exemplary of one configuration that will accomplish the methods of the present invention . as discussed previously , bubbler 12 communicates with a fluid reagent source reservoir 94 by way of conduit 19 . reservoir 94 is designed to maintain a large supply of ultrahigh purity chemical reagent 38 which is used to periodically replenish bubbler 12 , preferably after every run . reservoir 94 may simply be in the form of a carboy , but it will be understood that specially designed refill reservoirs may be required . any kind of reservoir 94 which is chemically inert to the contained reagent 38 , and which can be suitably connected to a conduit system for carrying reagent 38 to bubbler 12 may be used . carrier gas intake conduit 92 extends from a source of pressurized carrier gas 98 into a flow controller unit 114 . after passing through the flow controller unit 114 conduit 92 is directed into bubbler 12 terminating with a lower outlet or orifice 24 located in the bottom of bubbler 12 . a vapor stream conduit 26 extends downwardly from a unshaped neck intake orifice 28 , located in the headspace 30 in the top of bubbler 12 , through a number pneumatic valves to the process tool 154 . level set line 37 is placed within bubbler 12 so that excesses reagent 30 can be dismissed from bubbler 12 as the head pressure is set . furthermore , level set line 37 is adapted so that its height within bubbler 12 can be adjusted thus allowing one to set the depth of reagent 38 . a typical operation of the system 10 is now described as merely exemplary of the invention . it will be understood that the precise sequence and mode of operation may vary somewhat , depending upon the type of treatment zoned or furnace , which is being fed , and upon the kind of product being produced . thus , the following description is merely exemplary . considering the invention as designed to provide a stream of carrier gas 98 , which is either , saturated or partially saturated with reagent 38 to a processing tool 154 , the overall flow of gases and fluids will be as described . taking the system 10 at an equilibrium operating state , with the processing tool 154 in operation , the flow of gases is as follows . carrier gas 98 which may be an inert gas , such as and but not limited to argon , helium , oxygen , nitrogen or hydrogen is contained within a cylinder from which it flows through conduit system 92 thereby being introduced through orifice 24 into reagent 38 contained within bubbler 12 . bubbler 12 includes a heater / chiller 16 which for example may be a strap heater that is jacketed about an outer surface of bubbler 12 . the heater / chiller 16 is used to provide energy to increase or decrease the temperature and to vaporize reagent 38 in bubbler 12 . as carrier gas 98 travels up through reagent 38 , it becomes either saturated , or partially saturated , depending upon the rate of flow , the depth of reagent 38 , the temperature , etc ., with reagent 38 . reagent - ladened gas 40 then flows into headspace 30 and our vapor stream conduit 26 , which is connected to process tool 154 . vapor stream conduit 26 is u - shaped so that as gas bubbles 40 break the surface 36 of reagent 38 splattered fluids will not drop down into inlet tube 26 . there may be provided , in addition to this gas flow , other streams . for example , other streams of inert gas , or reactive gas , or reagents , may also be provided . these are not part of this invention , however , and would be provided separately and independently of this invention , depending upon the precise reaction that was desired to be carried out . the system , as thus described , may be considered the equilibrium system . during the period of time process tool 154 is in a deposition mode , the reagent - laden gas 40 is being provided to processing tool 154 , and the fluid level 36 is decreasing an extremely small percentage of total bubbler volume . consequently , after each run the refill cycle is activated . as discussed previously all inlets and outlets of bubbler 12 , as shown in fig1 are switched into a closed position except valves 102 , 104 and 106 . to begin the refill cycle , valves 120 and 110 are then opened to initiate the flow of reagent 38 from reservoir 94 to bubbler 12 . alternatively , valves 120 and 122 or 124 may be opened to fill bubbler 12 . the system , during refill cycle , allows over - filling of the liquid level in bubbler 12 to a level controlled by the pressure of the liquid delivery conduit 19 , thereby compressing the volume of vapor in the bubbler and creating a pressure approximating the liquid source line 19 . construction and placement of vapor extraction tube 28 prevents liquid from being forced into it . during the second stage , valve 110 is closed , pressure supply is removed from reservoir 94 , and valve 124 is opened forcing excess liquid within bubbler 23 out through fluid level set line 37 back to bulk liquid source 94 . the length of the refill cycle is thus dependent on the total bubbler volume . during filling sequence , head pressure 30 is dependent upon the pressure of conduit 19 , reagent 38 will automatically flow from reservoir 94 into bubbler 12 until the pressure in head space 30 equilibrates with that of conduit 19 . thus the level of reagent 38 in bubbler 12 is replenished to an overfilled state , in preparation for the leveling sequence described earlier . once the liquid pressure in bubbler 12 reaches an equilibrium state , a valve is closed to liquid flow , and is opened to gas flow , thus flushing out of the conduit system all of the liquid reagent . this provides important safety protection , since the liquid is maintained in the conduit system 90 only during the refill cycle , and , also , minimizes contamination since the reagent is not held in the conduit system , which has large surface area exposure . the conduit system 90 is maintained at a positive pressure with inert gas . because the principle of operation works on pressure differences , not absolute pressures we can easily deliver very low pressure fluids and much higher pressure condensed fluids . the absolute vapor pressure of the fluid we are trying to deliver is not so critical as it is in other conventional bubblers . once bubbler 12 is refilled , the valve returns to its operating position . inert gas from conduit 92 flows through the inlet bubbler tube 24 , through the outlet tube 26 and to processing tool 154 as previously described . in a highly unique and novel arrangement , the system includes means including a conduit system 90 for transferring vapor or liquid reagent 38 during a first time period from the refill reservoir 94 through the conduit system 90 into the bubbler 12 , flushing reagent 38 out of the conduit system 90 , filling the conduit system 90 with inert gas , and maintaining a predetermined pressure of inert gas in said conduit system 90 between the periodic transfer of reagent 38 there through , a substantially gas tight enclosure for the refill reservoir 94 and means for providing inert gas 98 at a predetermined pressure to the enclosure to maintain the refill reservoir in an inert atmosphere , and may also include means for providing inert gas 98 at a predetermined pressure and rate to the refill reservoir , and means for feeding a stream of inert gas into bubbler 12 to be at least partially saturated with chemical fluid only during a second time period , the first and second time periods alternating with time . in the embodiment shown in fig1 optional heater / chiller 16 may be added to control the temperature of the liquid in the supply and deposition bubbler 12 , respectively , to vaporize liquid therein . a modular fluid handling assembly , shown in fig2 and similar to that disclosed in u . s . pat . no . 6 , 298 , 881 which is incorporated herein by reference , includes a plurality of fluid handling units . each fluid handling unit includes a fluid passage and associated port , a vacuum passage and associated port , a vacuum pressure source , and a containment seal . the fluid passage ports and vacuum passage ports of adjacent fluid handling units respectively communicate . the containment seal is disposed between adjacent fluid handling units and surrounds the communicating fluid passage ports and vacuum passage ports . the vacuum pressure source is in continuous communication with the vacuum passages of the fluid handling units , generates an urging force , which aids in sealing adjacent fluid handling units together , and draws off any fluid that may leak from a fluid passage port . a sensor can be tapped into the vacuum line to sense whether any fluid has leaked from a fluid passage port . it is to be understood with respect to the enclosed conduit system , which comprises both the conduit and valving enclosed in suitable gas tight , or substantially gas tight enclosure mechanisms , and filled with inert gas , that the specific configuration , construction and operation of the valve is of secondary significance , and any valve may be used . what is significant is that the entire conduit system , or a substantial portion of the conduit portion , sufficient to protect the conduit system and prevent contamination through the walls of the conduit system , is enclosed in one or more envelopes filled with inert gas . the foregoing description is considered as illustrative only of the principles of the invention . the words “ comprise ,” “ comprising ,” “ include ,” “ including ,” and “ includes ” when used in this specification and in the following claims are intended to specify the presence of one or more stated features , integers , components , or steps , but they do not preclude the presence or addition of one or more other features , integers , components , steps , or groups thereof . furthermore , since a number of modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and process shown described above . accordingly , all suitable modifications and equivalents may be resorted to falling within the scope of the invention as defined by the claims , which follow .

US-66312303-A

the problem of stabilizing operation of a load division control is resolved using a phase angle counter circuit which calculates phase angle insensitive to frequency changes of the output voltage waveform . the phase angle counter circuit includes a series of counters for calculating phase angle .

with reference to fig1 a block diagram representation illustrates an electrical power generating system ( epgs ) 20 including a generator control unit ( gcu ) 22 according to the invention . in the illustrated embodiment , the epgs 20 is used in an aircraft providing power to aircraft loads . the gcu 22 could be used in connection with various other generating systems , as is obvious to those skilled in the art . in addition to the gcu 22 , the epgs 20 includes an integrated drive generator ( idg ) 24 . the idg 24 receives mechanical power at varying speed from an aircraft engine 26 through a rotating shaft 28 and delivers electric power at constant frequency at a power bus 30 . with reference also to fig2 the epgs 20 is illustrated in connection with a multi - channel power generating system including three parallel epgs &# 39 ; s 20 - 1 , 20 - 2 and 20 - 3 , each of which is identical in construction . specifically , each of the three epgs &# 39 ; s 20 - 1 , 20 - 2 and 20 - 3 are connected through associated input shafts 28 - 1 , 28 - 2 and 28 - 3 , respectively , and gear boxes 29 - 1 , 29 - 2 and 29 - 3 to engine output shafts 27 - 1 , 27 - 2 and 27 - 3 connected to the aircraft engines 26 - 1 , 26 - 2 and 26 - 3 . each epgs 20 develops output power to supply the bus 30 through associated contactors 38 - 1 , 38 - 2 and 38 - 3 . in accordance with the invention , it is desired that the load sharing to the bus 30 be distributed equally among the three epgs &# 39 ; s 20 - 1 , 20 - 2 and 20 - 3 , as discussed below . since each of the epgs &# 39 ; s 20 - 1 , 20 - 2 and 20 - 3 is identical in construction , only one is described specifically herein and is referred to without the suffix comprising the generator number . the idg 24 includes a constant speed drive 32 and a generator 34 . the constant speed drive 32 receives mechanical input power from the shaft 28 at varying speed and delivers mechanical power from its output shaft 36 at constant speed . the generator 34 is driven by the shaft 36 and develops electrical output power through suitable fault protection circuits represented by a generator relay or contactor , illustrated schematically at 38 , to the bus 30 . with reference also to fig3 the generator 34 includes a main generator 40 , a rotating rectifier bridge assembly 42 , an exciter 44 and a permanent magnet generator ( pmg ) 46 . each of the main generator 40 , exciter 44 and pmg 46 includes a rotor driven by the constant speed drive 32 via the common shaft 36 . as is well known , the generator 34 may be mounted in a common housing with the constant speed drive 32 and , more specifically , may be mounted in line or side - by - side , as is necessary or desired . the main generator 40 is a salient pole machine having a rotating field producing output power at a frequency of 400 hz . particularly , a four pole machine is used at 12 , 000 rpm , while a two pole machine is used at 24 , 000 rpm . the main generator 40 includes a rotor carrying a dc field winding 48 , and a stator carrying a polyphase ac armature winding 50 . the exciter 44 is a multi - pole salient pole machine which provides excitation to the main generator 40 . the exciter 44 includes a stator carrying a dc field winding 52 and a rotor carrying a polyphase ac armature winding 54 . the armature winding 54 is connected through the rotating rectifier bridge assembly 42 to the main armature dc field winding 48 . the pmg 46 is a pilot generator in which field flux is provided by a permanent magnet 56 mounted on a rotor driven by the shaft 3 and which is magnetically coupled with a polyphase stator armature winding 58 . the pmg stator winding 58 is connected through the gcu 22 to the exciter dc field winding 52 . although not specifically illustrated herein , the gcu 22 includes a rectifier which converts the polyphase ac power from the pmg stator winding 58 to dc power which is regulated to drive the exciter dc field winding 52 . as is conventional in brushless power generators , rotation of the shaft 36 by the aircraft engine 26 through the constant speed drive 32 and a gearbox , not shown , results in generation of a polyphase voltage in the exciter armature windings 54 as they traverse the magnetic field set up by the exciter dc field winding 52 . this polyphase voltage is rectified by the rotating rectifier bridge assembly 42 , and the rectified power is coupled to the main generator field winding 48 . the current in the main generator field winding 48 and the rotation of the shaft 36 sets up a rotating magnetic field in space occupied by the main generator stator windings 50 . the stator windings 50 develop polyphase output power at constant frequency which is delivered to the ac bus 30 for powering loads . with reference also to fig4 a block diagram illustrates a control loop for regulating excitation to the exciter dc field winding 52 . specifically , a voltage regulator control 60 in the gcu 22 controls generator output voltage at a point of regulation ( por ) using sensors 62 for sensing system conditions , such as voltage and current . the gcu 22 regulates the energy coupled from the exciter field winding 52 to the exciter armature winding 54 and ultimately to the main generator 40 . with reference to fig5 a block diagram illustrates a speed control loop for controlling output speed of the constant speed drive 32 . the gcu 22 includes a speed control 64 which receives a frequency signal on a line 66 from the generator 34 . as is well known , the frequency of the power on the line 66 is representative of speed of the shaft 36 . the speed control 64 alters the position of a servo valve or trim head 68 in the constant speed drive 32 in order to maintain a constant output speed on the shaft 36 . with reference to fig6 a combined schematic and functional block diagram illustrates a representation of the gcu 22 - 1 according to the invention . the gcu &# 39 ; s 22 - 2 and 22 - 3 for the remaining generators in the multi - channel system are identical in construction and therefore are not described in detail herein . for simplicity , the suffix relating to the generator number is omitted . the generator &# 39 ; s three phase voltage signals are sensed at the point of regulation by the sensors 62 , see fig4 and are conditioned by an analog condition circuit 68 and are applied to both the voltage regulator 60 and the speed control 64 . the analog condition circuit 68 also receives a signal from a load division current transformer loop 70 representing deviation of generator load from the average load . this ct loop 70 comprises a series string of current transformer secondary ct1 - ct3 and associated respective burden resistors r1 - r3 . each current transformer ct1 - ct3 is on the same phase of its respective associated generator . the analog condition circuit 68 receives a signal representing voltage across the burden resistor r1 which represents the difference from average current for the first electrical power generating system 20 - 1 . as is well known , the output of any one of the current transformers ct1 - ct3 is the difference between the current in that generator and the average current of the parallel generators . the magnitude of the current indicates how much the output of the generator has deviated from its required share of the load , and the phase angle indicates whether the generator is carrying more or less than its share of the load . since the output of the current transformers represents total current , the real and reactive components must be derived . the voltage regulator 60 includes a voltage regulation control loop 72 and compares point of regulation voltage to a reference to develop an error which is compensated to pulse width modulate an exciter field drive switching circuit ( not shown ) to vary the field current to the exciter field winding 52 , see fig4 . a load division module 74 is operative for multi - channel parallel systems . this module 74 receives signals from the analog condition circuit 68 representing phase information for the por waveform and phase and amplitude information for the difference from average current . the output of the load division module 74 is applied to the voltage regulator loop 74 to bias the voltage error to trim the generator excitation current to ensure equal real and reactive load division . the speed control 64 includes a speed control loop 76 which responds to actual speed and desired speed for developing a pwm signal having a duty cycle which varies the position of the servo valve or trim head 68 , see fig5 to control speed . the speed control 64 also includes a load division module 78 which is operative for multi - channel parallel systems . this module 78 receives signals from the analog condition circuit 68 representing phase information for the por voltage waveform and phase and amplitude information for the difference from average current waveform . the output of the load division module 78 biases the speed error in the speed control loop 76 in order to maintain real load division . with reference to fig7 a series of waveforms illustrate the phase angle to be measured by the load division modules 74 and 78 , see fig6 . the por voltage is represented by a sinusoidal waveform 80 having a period p . the difference from average current signal is represented by a waveform 82 , which is also sinusoidal , and is offset in time from the waveform 80 by a phase difference t which represents a phase angle θ . the phase angle φ is determined by dividing the time difference t between zero crosses of the waveforms 80 and 82 by the period p and multiplying this quotient by 2 * π , as is well known . the function of the load division modules 74 and 78 is to divide loading equally between the three generators by making the reactive and real components of the difference from average current approach zero . the real and reactive components are obtained by the following equations : k is a programmable gain constant = turns ratio of the current transformer ct1 times the resistance of the burden resistor r1 ; with reference to fig8 a functional block diagram represents a circuit for the voltage regulator load division module 74 . although not specifically illustrated , the speed control load division module 78 may be identical in construction and is therefore not disclosed in detail herein . the load division module 74 is a peripheral circuit in the voltage regulator 60 which is free running and generates a completion flag to the voltage regulator to update information . in the illustrated embodiment , the voltage regulator circuit 60 uses custom very large scale integration ( vlsi ) technology to reduce size , weight , life cycle costs and improve reliability . the load division module 74 receives the por voltage waveform signal at a block 84 and a difference from average current waveform at a block 86 . a phase difference control 88 , comprising a programmable logic array , operates in connection with a phase and frequency counter circuit 90 to determine the phase difference between the two waveforms . specifically , the counter circuit 90 develops an address used by a rom lookup table 92 to determine the sine and cosine of the phase angle to determine real and reactive components of the power for use in the voltage regulator loop 72 and speed control loop 76 , as discussed above . with reference to fig9 a hardware block diagram illustrates a preferred embodiment for the phase and frequency counter circuit 90 . the circuit 90 uses a series of counters of conventional design . a divide by 256 counter , comprising a first up counter , 94 receives the 10 mhz system clock and has a carry output connected to the clock input of a por period counter 96 . the divide by 256 counter 94 allows all successive counters to have an eight - bit less word width . the equation representing the carry output of the divide by 256 counter 94 can be derived by the following equation : ## equ1 ## the por period counter 96 receives an enable signal from the control 88 representing the period of the por waveform . the por period counter output is updated every rising edge of the por waveform . the equation for the output of the por period counter 96 is as follows : ## equ2 ## the output of the por period counter 96 is applied to a latch circuit 98 which stores the por period and is reset by a logic signal from the control 88 comprising a pulse at the rising edge of the por waveform . the output of the latch 98 is connected to a phase clock counter 100 which comprises a down counter . the phase clock counter 100 is configured to provide a phase measurement clock signal independent of the system clock and the por waveform frequency specifically , the phase clock 100 generates a clocking signal which guarantees 256 pulses each cycle of the por waveform . the output of the phase clock counter 100 is represented by the following equation : ## equ3 ## the output of the phase clock counter 100 is applied to a phase angle counter 102 which counts pulses from the phase clock counter 100 subsequent to the resetting of the latch circuit 98 . a logic signal from the control 88 enables the phase angle counter 102 during the time t between zero crosses , see fig7 . the output of the phase angle counter 102 is stored in a latch circuit 104 which receives a difference from average rising edge pulse from the control circuit 88 . the latch circuit 104 is effective to store the calculated or measured phase angle between the por and difference from average current in accordance with the following equation : ## equ4 ## the output of the latch 104 defines an address , representing the phase angle , to the rom lookup table 92 , see fig8 . thus , in accordance with the above , the counter circuit 90 calculates a measurement of the phase angle which is insensitive to frequency changes of the point of regulation output .

US-43879389-A

a method of manufacturing a composite photochromic ophthalmic lens having an index of refraction of at least 1 . 49 is disclosed . the method comprises providing against a front portion of a mold , a first ophthalmic lens - forming composition including a polymerizable monomer , oligomer , or polymer and a photochromic compound ; filling a rear portion of the mold with a second ophthalmic lens - forming composition , sufficiently different from the first ophthalmic lens - forming composition such that a distinct phase boundary results between the two compositions after complete curing of the two compositions , the second ophthalmic lens - forming composition including a polymerizable monomer , oligomer or polymer that is different from the monomer , oligomer or polymer of the first ophthalmic lens - forming composition , such that the second ophthalmic lens - forming composition is in contact with the first lens - forming composition , wherein either the first or second ophthalmic lens - forming composition is gelled before adding the other ophthalmic lens - forming composition , in an ungelled state , to the mold ; and curing the first and second ophthalmic lens - forming compositions simultaneously , while the first and second ophthalmic lens - forming compositions are in intimate contact .

any photochromic dye - containing ophthalmic lens - forming composition that includes a radical polymerizable monomer or oligomer can be used for the front portion of the lens . to achieve the full advantage of the present invention , the lens - forming composition used for the front portion of the lens preferably has a seb abrasion resistance , after curing , below 20 psi , preferably below about 15 psi , according to the method disclosed in u . s . pat . nos . 4 , 544 , 572 and 4 , 758 , 448 . the layers may be brought to the gel state , and subsequently cured using any suitable method including thermal and radiation curing techniques . preferably , both the front and rear layers include a photopolymerization initiator so that both layers can be cured simultaneously with light having a suitable wavelength . conventional ultraviolet or visible light photoinitiators can be used in the front or rear layer compositions . examples of the front layer ( photochromic dye - containing ) and rear layer ( containing no photochromic dyes ) ophthalmic lens monomers and / or oligomers include mono , di , tri , tetra and pentafunctional acrylates , such as alkoxylated acrylates derived from di or trimethylol alkanes or pentaerethrytol marketed by sartomer , polysciences and others ; methacrylates ; vinyl monomers such as styrene ; allyl monomers such as hiri , cr - 39 and cr - 307 marketed by ppg industries ; epoxies ; urethanes and / or esters terminated with acrylic groups ; and unsaturated polyester resins and mixtures of polyester resins and these compounds . examples of radical - polymerizable monomers usable in one or both layers of the lenses of the present invention are as disclosed in u . s . pat . no . 5 , 910 , 516 , hereby incorporated by reference . the acrylate and methacrylate compounds include , for example , tridecyl methacrylate , diethylene glycol diacrylate and dimethacrylate , triethylene glycol diacrylate and dimethacrylate , tetraethylene glycol diacrylate and dimethacrylate , and higher molecular weight polyethylene glycol diacrylates and dimethacrylates , butanediol dimethacrylate , hexamethylene dimethacrylate , bisphenol a dimethacrylate , 1 , 12 - dodecanediol dimethacrylate , 2 , 2 - bis ( 4 - methacryloyloxyethoxy - 3 , 5 - dibromophenyl ) propane , 2 , 2 - bis ( 4 - methacryloyloxyphenyl ) propane , 2 , 2 - bis ( 4 - methacryloyloxydiethoxyphenyl ) propane , 2 , 2 - bis ( 4 - methacryloyloxytriethoxyphenyl ) propane , 2 - 2 - bis ( 4 - methacryloyloxypentaethoxyphenyl ) propane , trimethylolpropane triacrylate , alkoxylated acrylates and methacrylates , alkoxylated diacrylates and dimethacrylates , alkoxylated triacrylates and trimethacrylates , isobornyl acrylate and methacrylate , cyclohexyl acrylate and methacrylate , and trimethyl cyclohexyl acrylate and methacrylate . epoxy group - containing acrylate or methacrylate compounds include , for example , glycidyl acrylate , glycidyl methacrylate , β - methylglycidyl acrylate , β - methylglycidyl methacrylate and bisphenol a monoglycidyl ether methacrylate . urethane acrylates and methacrylates include mono , di , tri , and tetra functional urethane acrylates and methacrylates sold by sartomer , degussa , and others . the vinyl compounds include , for example , bis - 4 - vinylbenzyl ether , bis - 4 - vinylbenzyl sulfide , 1 , 2 -( p - vinylbenzyloxy ) ethane , 1 , 2 -( p - vinyl - benzylthio ) ethane and bis -( p - vinylbenzyloxyethyl ) sulfide . in addition , the composition can include an unsaturated carboxylic acid , an acrylic or methacrylic acid ester , a fumaric acid ester and an aromatic vinyl compound . the unsaturated carboxylic acid includes , for example , acrylic acid , methacrylic acid , maleic anhydride , fumaric acid and acrylic acid . the acrylic and methacrylic acid esters includes , for example , methyl acrylate , methyl methacrylate , benzyl methacrylate , phenyl methacrylate , tribromophenyl methacrylate , 2 - hydroxyethyl methacrylate , and trifluoromethyl methacrylate . the fumaric acid ester includes , for example , monomethyl fumarate , diethyl fumarate and diphenyl fumarate . the aromatic vinyl compound includes , for example , styrene , chlorostyrene , alpha - methylstyrene , 4 - methylstyrene , vinylnaphthalene , isopropenyl naphthalene , bromostyrene and divinylbenzene . these radical - polymerizable monomers may be used singly or in admixture of two or more . suitable unsaturated polyester resins includes those made from unsaturated dicarboxylic acids such as maleic and fumaric acids , saturated dicarboxylic acids , such as orthophthalic acid and isophthalic acid , and polyhydric alcohols such as ethylene glycol , diethylene glycol , neopentyl glycol , and hydrogenated bisphenol - a . the preferred front portion of the lens is a composition comprising mono , di , or tri functional acrylic or methacrylic monomers ; mono , di , or tri functional urethane acrylates or methacrylates , allylic monomers , unsaturated polyester resins , vinyl monomers , and mixtures thereof . preferably , the front portion of the ophthalmic lens , and the rear ( eye - facing ) portion , have a refractive index of at least 1 . 49 . the index of refraction of either portion can be at least about 1 . 49 , at least about 1 . 53 , at least about 1 . 56 , or at least about 1 . 58 . preferred acrylates and methacrylates include mono , di , and tri functional acrylates and methacrylates including tridecyl methacrylate ; 1 , 12 - dodecanediol dimethacrylate ; and trimethylolpropane trimethacrylate . the preferred allylic monomers include diallyl phthalate , diethylene glycol bisallyl carbonate , diallyl diphenate , bisphenol a bisallyl carbonate , and 2 , 2 ′- diallylbisphenol - a . the photochromic compound contained in the photopolymerizable composition used as the front lens layer of the present invention may be any known photochromic compound as long as it has an absorption in a visible light region when the compound is activated ( i . e ., darkened ). photochromic compounds showing an absorption property in a range of around 400 to 480 nm develop a yellow to orange color ; photochromic compounds showing absorption property in a range of around 480 to 550 nm develop a red to purple color ; and photochromic compounds showing absorption property in a range of around 550 to 600 nm develop a purple to blue color . these photochromic compounds may be used singly but , when used in combination of two or more , can develop a neutral color such as gray , brown , amber or the like . preferred photochromic additives are , for example , spiropyrans , spirooxazines , naphthopyrans , benzopyrans or chromene compounds , spironaphthoxazines , spirobenzoxazines , organo - metal dithizonates , and fulgide or fulgimide compounds and mixtures thereof . examples of these families follow . as the chromene compounds , any known compounds having a chromene skeleton and a photochromic property can be used . specific examples thereof include 2 , 2 - diphenyl - 7 - octoxy ( 2h ) benzo ( f ) chromene , spiro ( bicyclo [ 3 . 3 . 1 ] nonane - 9 , 2 ′-( 2h ) benzo ( h ) chromene ), spiro ( norbornane - 2 , 2 ′-( 2h ) benzo ( h ) chromene ), 7 ′- methoxyspiro ( bicyclo [ 3 . 3 . 1 ] nonane - 9 , 2 ′-( 2h ) benzo -( h ) chromene ), 7 ′- methoxyspiro ( norbornane - 2 , 2 ′-( 2h ) benzo ( h ) chromene ), and 2 , 2 - dimethyl - 7 - octoxy ( 2h ) benzo ( f ) chromene . the fulgide compounds may be any known compounds having a fulgide skeleton and a photochromic property . specific examples thereof include n - methyl - 6 , 7 - dihydro - 4 - methylspiro ( 5 , 6 - benzo [ b ] thiophene - dicarboxyimido - 7 , 2 - tricyclo [ 3 . 3 . 1 . 1 ] decane , n - cyanomethyl - 6 , 7 - dihydro - 4 - methyl - 2 - phenylspiro ( 5 , 6 - benzo [ b ] thiophenedicarboxyimido - 7 , 2 - tricyclo -[ 3 . 3 . 1 . 1 ] decane , n - cyanomethyl - 6 , 7 - dihydro - 4 - methyl - 2 ( p - methoxyphenyl )- spiro ( 5 , 6 - benzo [ b ] thiophenedicarboxyimido - 7 , 2 - tricyclo -[ 3 . 3 . 1 . 1 ] decane , n - cyanomethyl - 6 , 7 - dihydro - 4 - methylspiro ( 5 , 6 - benzo [ b ] thio - phenedicarboxyimido - 7 , 2 - tricyclo [ 3 . 3 . 1 . 1 ] decane , n - cyanomethyl - 6 , 7 - dihydro - 4 - cyclopropylspiro ( 5 , 6 - benzo [ b ]- thiophenedicarboxyimido - 7 , 2 - tricyclo [ 3 . 3 . 1 . 1 ] decane , and 6 , 7 - dihydro - n - methoxycarbonylmethyl - 4 - methyl - 2 - phenylspiro ( 5 , 6 - benzo [ b ] thiophenedicarboxyimido - 7 , 2 - tricyclo [ 3 . 3 . 1 . 1 ] decane . as the spriooxazine compounds , any known compounds having a spirooxazine skeleton and a photochromic property can be used . specific examples thereof include 1 , 3 , 3 - trimethyl - spiro ( indole - 2 , 3 -[ 3 , 2 - a ][ 1 , 4 ] naphthooxazine , 1 , 3 , 3 - trimethyl - 6 ′- piperidinospiro ( indole - 2 , 3 -[ 3 , 2 - a ][ 1 , 4 ]- naphthooxazine , 6 - fluoro - 1 ′- methyl - 8 ′- methoxy - 6 ′- morpholinodispiro ( cyclo - hexane - 1 , 3 ′-( 3h ) indole - 2 ′-( 2 ′ h ), 3 ′-( 3h ) naphtho ( 3 , 2 - a )( 1 , 4 )- oxazine ), 1 ′- methoxycarbonylmethyl - 8 ′- methoxy - 6 ′-( 4 - methylpiperazino ) dispiro ( cyclohexane - 1 , 3 ′-( 3h ) indole - 2 ′-( 2 ′ h ), 3 ′( 3h )- naphtho ( 3 , 2 - a )( 1 , 4 ) oxazine ), 1 ′-( 2 , dioxazine - 2 - yl ) ethyl )- 6 ′- morpholinodispiro ( cyclo - hexane - 1 , 3 ′( 3h ) indole - 2 ′-( 2 ′ h ), 3 ′-( 3h ) naphtho ( 3 , 2 - a )( 1 , 4 ) oxazine ), 5 - fluoro - 1 ′- methyl - 6 ′- piperidinodispiro ( cyclohexane - 1 , 3 ′-( 3h ) indole - 2 ′-( 2 ′ h ), 3 ′-( 3h ) naphtho ( 3 , 2 - a )( 1 , 4 ) oxazine ), and 8 ′- methoxydispiro ( cyclohexane - 1 , 3 ′-( 3 h ) indole - 2 ′-( 2 ′ h ), 3 ′-( 3h ) naphtho ( 2 , 3 - a )( 1 , 4 ) oxazine ). preferred photoinitiators for both layers are the phosphinates , such as ethyl 2 , 4 , 6 - trimethylbenzoylphenyl phosphinate ; and phosphine oxides , such as 2 , 4 , 6 - trimethylbenzoyl - diphenylphosphine oxide ; bis ( 2 , 6 - dimethoxybenzoyl )- 2 , 4 -, 4 - trimethylpentyl phosphine oxide , bis ( 2 , 4 , 6 - trimethylbenzoyl ) phenyl phosphine oxide and commercial mixtures containing these compounds such as irgacure 1850 , irgacure 1700 , darocur 4265 , and the like . preferred thermal initiators include azo compound initiators such as 2 , 2 ′- azobis ( 2 - methylbutyronitrile ) and 2 , 2 ′- azobis ( isobutyronitrile ). the amount of the photochromic compound used in the front layer composition will depend on the desired contribution to developed color density . a usable range would be about 0 . 001 to 1 . 0 percent by weight , more preferably about 0 . 005 to about 0 . 5 percent by weight , based on the weight of the polymerizable compound ( s ) contained in the front layer . the front and rear photopolymerizable compositions of the present invention can contain , as necessary , various stabilizers and additives such as mold - releasing agents , ultraviolet absorbers , hindered amines or other ultraviolet light stabilizers , antioxidants , coloring inhibitors , antistatic agents , fluorescent dyes , dyes , pigments , or the like . to produce the composite photochromic semifinished lenses of one aspect of the present invention , a two - part gasket is used . a gasket used to normally produce a 75 mm diameter semifinished lens , as shown in fig2 with an edge thickness of 10 mm was circumferentially cut as shown in fig3 using a lathe in such a way as to produce a “ front half - gasket ” 4 consisting of a front mold sealing surface and a gasket wall approximately 1 . 7 mm in height . the gasket piece remaining after cutting forms the “ rear half - gasket ” 5 which consists of a rear mold sealing surface and a gasket wall approximately 8 . 3 mm in height . a front glass single vision mold with a 6 diopter concave surface radius of curvature was seated into the sealing area of the “ front half - gasket . approximately 10 grams of a photochromic dye - containing composition ( see table 1 ) was poured onto the mold . a second glass mold with a 6 diopter convex surface curvature was then placed on the 1 . 7 mm high wall . the resulting assembly consisted of a 6 diopter concave front mold and a 6 diopter convex rear mold separated by a gap of 1 . 7 mm , the gap being filled with the photochromic dye - containing composition ( see fig4 ). note : sunsensors monomer is a proprietary composition of corning , incorporated . the monomer composition contains photochromic dyes . the monomer was prepolymerized to a viscosity of approximately 400 centistokes prior to combining the prepolymerized monomer in the composition above . the front half - gasket assembly just described was exposed to the light produced by a fusion “ v ” bulb filtered with a single layer of edmund # 39 , 426 ultraviolet filter film . the arrangement was such that the light entered the assembly through the convex rear mold . the intensity of the light was approximately 1 . 0 milliwatt / cm 2 measured with an international light il1400 radiometer equipped with a 405 nm narrow bandwidth filter . exposure time was 8 minutes . after exposure , the convex rear mold was separated from the assembly . the front half assembly then consisted of the front half - gasket , the concave front mold , and a uniform gel layer of approximately 1 . 7 mm thickness . the rear half - gasket was prepared by drilling two small holes for the introduction of the non - photochromic casting composition ( fig5 ). the rear half - gasket was then placed onto the front half assembly such that the cut surfaces of the gasket wall were in contact . a 6 diopter convex glass rear mold was placed on the rear mold sealing surface of the rear half - gasket , and the entire assembly was clamped together with a clamp configured such that light could pass through the rear mold into the assembly ( fig5 ). a non - photochromic ( rear layer ) polymerizable composition ( table 2 ) was injected through the drilled holes in the rear half - gasket , such that the cavity formed between the photochromic gel and the convex rear mold was filled with the composition . the holes were sealed by means of adhesive tape . the assembly was then exposed to the unfiltered light from a fusion “ v ” lamp such that the light entered from the rear mold of the assembly . light intensity was approximately 4 . 0 mw / cm 2 measured by the il 1400 apparatus mentioned previously . exposure time was 15 minutes . the assembly was then turned over and exposed to “ v ” lamp light filtered with the previously mentioned edmund ultraviolet filter at an intensity of 1 mw / cm 2 for an additional 67 minutes . the arrangement was such that the light entered the assembly through the front concave mold . at the conclusion of the exposure period , the assembly was removed from the source of illumination , the clamp and the gasket pieces were removed , as were the molds . the resulting composite lens consisted of a uniform photochromic layer approximately 1 . 7 mm thick attached to a uniform non - photochromic layer approximately 8 mm thick . the font curvature was approximately + 6 diopters , the rear approximately − 6 diopters . when exposed to sunlight , the lens had good photochromic response with uniform color and density . additional examples of photochromic dye - containing compositions useful in accordance with the preferred method and articles follow in examples 1 - 4 . it should be understood that the compositions shown in examples 1 - 4 also can be used as the non - photochromic polymerizable compositions by omitting the photochromic dye , however , it is preferred to use harder , more abrasion - resistant resins such as the polyesters or bisallyl carbonates as the non - photochromic composition , as shown in example 5 and table 2 . the following examples are included to demonstrate preferred embodiments of the invention . it should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention , and thus can be considered to constitute preferred modes for its practice . however , those of skill in the art should , in light of the present disclosure , appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention . subsequent to the lens produced as described above , other lenses have been made following the same basic procedure with front curvatures ranging from 0 . 5 diopters to 8 diopters , photochromic layers from 1 . 25 to 2 . 2 mm , and overall lens thicknesses from approximately 10 mm to 16 mm . single vision , flat top bifocal , and progressive addition lenses have also been cast . when making lenses of various front curvatures , the rear convex mold curvature used in making the photochromic gel layer is approximately matched with the curvature of the front concave mold to give a generally uniform layer thickness . rear molds used for this purpose have been made from various plastic materials ( e . g ., ptfe film , cast plastic compositions , glass ). an in - mold coating ( approximately 2 or 3 microns ) has also been applied to the surface of the front concave mold and partially polymerized ( see u . s . pat . no . 4 , 544 , 572 ) prior to fitting the mold to the sealing surface of the front half - gasket . in this way , a strongly adhering scratch resistant coating is bonded to the front photochromic layer of the composite lens . semifinished composite lenses which have been made using the procedure outlined above have been successfully processed to prescription power using equipment suitable for processing cr - 39 type lenses . they have demonstrated the capability of passing the fda impact test , and have resisted delamination during thermal shock testing ( alternating cycles of immersion in boiling water and ice water ). to prepare the gel - form intermediate from the rear lens - forming composition , a front glass single vision mold with a 6 diopter concave surface radius of curvature ( the front mold ) was seated into the sealing area of a gasket with an inside wall thickness of approximately 14 mm . the composition described in table 3 was poured into this assembly . a second glass mold with a 6 diopter convex surface curvature ( the rear mold ) was then placed on top of the gasket to form a closed assembly . the assembly was then exposed to the light produced by a fusion “ v ” bulb . the arrangement was such that the light entered the assembly through the convex rear mold . the intensity of the light was approximately 4 . 0 milliwatts / cm 2 measured with an international light il1400 radiometer equipped with a 405 nm narrow bandpass filter . exposure time was 13 minutes . after exposure , the gasket was removed from the assembly , and the front mold was carefully separated from the gelled composition . the rear mold remained attached to the gel . a second front mold , also of 6 diopter concave curvature , was fitted to a gasket having an inner wall height of approximately 1 . 7 mm . approximately 10 grams of a photochromic dye - containing composition ( see table 4 ) was poured into the mold . the gel - form intermediate was then placed into the mold and gasket such that the exposed surface of the gel was in contact with the photochromic dye - containing composition and the open end of the gasket , thus forming a closed assembly . this assembly was then exposed to the light of fusion “ v ” lamp with intensity of approximately 4 . 0 mw / cm 2 as previously described for a period of about 45 minutes . the light entered the assembly through the convex rear mold attached to the gel - form . the gel - form contains a uv absorbing material which helps shield the photochromic layer from wavelengths shorter than about 390 nm . this allows for protection of the photochromic dye during curing , but allows for the passage of wavelengths of approximately 400 to 450 nm to cure the photochromic composition . note : sunsensors monomer is a proprietary composition of corning , incorporated . the monomer composition contains photochromic dyes . the monomer was prepolymerized to a viscosity of approximately 400 centistokes prior to use in the composition above . to assure complete cure of the photochromic layer , the assembly was inverted after 45 minutes and exposed to the light produced by a fusion “ v ” bulb filtered with a single layer of edmund # 39 , 426 ultraviolet filter film . this arrangement was such that the light entered the assembly through the front mold . the intensity of the light was approximately 1 . 0 milliwatt / cm 2 using the previously described radiometer apparatus . exposure time was approximately 45 minutes . at the conclusion of the exposure period , the assembly was removed from the source of illumination and the gasket and molds were removed from the polymerized lens . the resulting composite lens consisted of a uniform front photochromic dye - containing layer approximately 1 . 7 mm thick attached to a uniform rear non - photochromic layer approximately 13 mm thick . the front curvature was approximately + 6 diopters , the rear approximately − 6 diopters . when exposed to sunlight , the lens had good photochromic response with uniform color density . subsequent to the lens produced as described above , other lenses were made following the same basic procedure with front curvatures ranging from 0 . 5 diopters to 8 diopters , photochromic dye - containing front layers ranging in thickness from about 1 . 0 to 2 . 0 mm , and overall lens thicknesses from approximately 10 mm to 16 mm . an in - mold coating ( approximately 2 or 3 microns in thickness ) has also been applied to the surface of the front concave mold and partially polymerized ( see u . s . pat . no . 4 , 544 , 572 ) prior to fitting the mold to the 1 . 7 mm gasket and placing the photochromic dye - containing composition into the mold assembly . in this way , a strongly adhering , scratch - resistant coating is bonded to the front photochromic dye - containing layer of the composite lens . this coating may also contain uv - absorbing compounds that absorb light at wavelengths which can degrade the photochromic dye , but allow light to pass which effectively activates the dye . in this way , the lifetime of the lens can be increased . the choice of photoinitiator in the front or rear layer composition can be made to include a combination of a shorter wavelength - sensitive photoinitiator with a photoinitiator that is sensitive to both shorter and longer wavelengths . this is the case with ciba specialty chemicals irgacure 1850 . when the curing light passes from the front or rear mold in a direction to pass first through the gel - form composition ( front or rear layer ) during the initial gel - forming stage , the gelled layer surface contacting the mold hardens more than the gelled surface farther away from the source of curing light , so that the mold separates quite easily at the gelled surface farther from the curing light . this ease of separation can be further enhanced by the treatment of the front or rear mold with a mold release material , such as relisse ® casting release polymer from nanofilm , ltd . semifinished composite lenses made using the procedures outlined above have been successfully processed to prescription power using equipment suitable for processing cr - 39 type lenses . they have demonstrated the capability of passing the fda impact test , and have resisted delamination during thermal shock testing ( alternating cycles of immersion in boiling water and ice water ). the preferred compositions of the rear layer ( inner or eye - facing ophthalmic lens layer ) of the present invention includes an unsaturated polyester resin in an amount of about 25 % to about 70 % ( excluding monomer diluents , e . g ., styrene ) or about 40 % to about 95 % of the composition if calculated to include a diluent monomer , e . g ., styrene ; preferably about 35 % to about 60 % by weight unsaturated polyester calculated without diluent monomer , as disclosed in this assignee &# 39 ; s u . s . pat . no . 6 , 099 , 123 , hereby incorporated by reference . unsaturated polyesters are well known and can be manufactured by the reaction of one or more polyols with one or more polycarboxylic acids , with olefinic unsaturation being provided by one or more of the reactants , usually the acid . the resultant unsaturation in the polyester enables these resins to form thermosetting , cross - linked reaction products with compounds that contain olefinic double bonds , such as styrene , methyl methacrylate , and the like . commercially available unsaturated polyesters which can be used in accordance with the present invention include the reaction products of one or more saturated or unsaturated dicarboxylic acids , or their ester - forming derivatives , with a saturated or a vinyl - group - containing polyhydric alcohol . examples of suitable unsaturated dicarboxylic acids for reaction to form the unsaturated polyester include maleic acid , fumaric acid , citraconic acid , itaconic acid , meconic acid , and anhydrides thereof , lower alkyl esters or acid halides thereof . examples of suitable saturated dicarboxylic acids for reaction to form the unsaturated polyester include aliphatic dicarboxylic acids , such as malonic acid , succinic acid , glutaric acid , adipic acid , suberic acid , azelaic acid , pimelic acid , or sebacic acid ; and aromatic dicarboxylic acids , such as orthophthalic acid , terephthalic acid , isophthalic acid , m , p - diphenyl dicarboxylic acid , and diphenic acid ; and anhydrides of these acids , such as phthalic anhydride and maleic anhydride , lower alkyl esters or acid halides of these acids , and mixtures thereof . examples of suitable polyols for reaction with the dicarboxylic acid to form the unsaturated polyester include ethylene glycol , propylene glycol , butylene glycols , neopentyl glycol , dipropylene glycol , and the poly ( ethylene glycol ) s of the foregoing , such as diethylene glycol , triethylene glycol , tetraethylene glycol , and mixtures thereof . the base polyester resin used in the compositions and methods of the present invention should have a number average molecular weight in the range of about 1 , 000 to about 5 , 000 , preferably about 1 , 500 to about 4 , 000 , and should be without haze . suitable unsaturated polyesters having such properties are well known in the art , as disclosed in this assignee &# 39 ; s u . s . pat . no . 5 , 694 , 195 , hereby incorporated by reference . as examples of suitable unsaturated polyester resins , the base polyester can be a polyester formed by the reaction of propylene glycol , phthalic anhydride and maleic anhydride , such as the “ s - 40 ” unsaturated polyester disclosed in bright u . s . pat . no . 5 , 319 , 007 . the composition disclosed in the bright patent includes a phenoxyethyl acrylate , which is preferably not included as an acrylate additive in accordance with the present invention . another suitable unsaturated polyester is formed by the reaction of maleic anhydride , orthophthalic anhydride and propylene glycol , such as “ aropol l - 2506 - 15 ” of ashland chemical co ., also disclosed in the above - identified bright u . s . pat . no . 5 , 319 , 007 , hereby incorporated by reference . the preferred polyester resins useful in accordance with the present invention include the reaction products of one or more acids or anhydrides selected from phthalic acid , isophthalic acid , maleic acid , phthalic anhydride , maleic anhydride , and particularly mixtures of two or more of such acids or anhydrides , with a polyol selected from ethylene glycol , propylene glycol , diethylene glycol , dipropylene glycol , and neopentyl glycol , preferably two or more of those glycols , having a number average molecular weight in the range of about 1 , 500 to about 4 , 000 . one of the most difficult problems encountered in attempting to formulate a polyester resin - based composition into a suitable ophthalmic lens formulation is that of providing the cast and cured composition with sufficient optical clarity , or freedom from optical distortion . in conventional procedures for the casting of plastic ophthalmic lenses , the reactants used to form the resin are introduced between spaced apart glass or metal mold surfaces . the mold sections are sealed together about their inner periphery by means of a non - reactive , resilient gasket or retainer ring . since exothermic materials are employed , the mold outer surfaces are immersed in a cooling fluid , e . g ., water , or otherwise cooled to dissipate the heat of polymerization and cross - linking from the mold cavity , and to maintain an optimum polymerization and curing temperature . during the polymerization reaction , particularly prior to gelation and cross - linking , convection currents are created in the resin , while the resin is in the liquid state , as a result of a substantial temperature differential between the polymerizing resin in the mold cavity and the coolant that surrounds the mold . these convection currents tend to freeze into the polymer as polymerization proceeds through gelation and curing , resulting in striation or visible “ waves ” in the cured polyester resin . lenses that contain such visible “ waves ” are unacceptable due to extensive optical distortion or optical non - uniformity . the problem of obtaining rapid and uniform photocure while simultaneously providing relatively high levels of ultraviolet absorbency needed for customers desiring a uv cutoff ( e . g ., less than 5 % transmission at 380 nm wavelength for a semifinished lens processed to 1 . 5 mm thickness ) and improved weathering characteristics is solved in accordance with a preferred embodiment of the present invention by the use of photoinitiators having at least some activity at wavelengths above 380 nm . photoinitiators that are active at a wavelength above 380 nm include benzoyl phosphine oxides ; xanthones and thioxanthones ; visible light photoinitiators , including : ( a ) fluorone dye / onium salt / amine systems , ( b ) dye / borate systems , and ( c ) borate photoinitiators ; benzyl dialkyl ketals ; and substituted morpholino ketones . in this manner , uv absorbers capable of absorbing light at wavelengths of 380 nm and below will provide the desired uv cutoff , while the photoinitiator ( s ) having activity at wavelengths above 380 nm will be activated ( generate free radicals ) for rapid and uniform photocure of the polyester resin . preferred initiators include phosphinates , phosphine oxides , particularly substituted phosphine oxides , and mixtures of one or more phosphinates and / or phosphine oxides with α - hydroxy ketones , such as : 2 , 4 , 6 - trimethylbenzoyldiphenylphosphine oxide ( basf lucirin tpo ); ethyl 2 , 4 , 6 - trimethylbenzoylphenylphosphinate ( basf lucirin tpol ); bis ( 2 , 6 - dimethoxybenzoyl )- 2 - 4 -, 4 - trimethylpentyl phosphine oxide ; bis ( 2 , 4 , 6 - trimethylbenzoyl ) phenyl phosphine oxide ; a 50 %/ 50 % by weight mixture of 2 , 4 , 6 - trimethylbenzoyldiphenylphosphine oxide and 2 - hydroxy - 2 - methyl - 1 - phenylpropan - 1 - one ( ciba darocur 4265 ); a 25 %/ 75 % by weight mixture of bis ( 2 , 6 - dimethyoxybenzoyl )- 2 - 4 -, 4 - trimethylpentyl phosphine oxide and 2 - hydroxy - 2 - methyl - 1 - phenylpropan - 1 - one ( ciba irgacure 1700 ); a 25 %/ 75 % by weight mixture of bis ( 2 , 6 - dimethyoxybenzoyl )- 2 - 4 -, 4 - trimethylpentyl phosphine oxide and 1 - hydroxycyclohexyl phenyl ketone ( ciba cgi 1800 ); and a 50 %/ 50 % by weight mixture of bis ( 2 , 6 - dimethyoxybenzoyl )- 2 - 4 -, 4 - trimethylpentyl phosphine oxide and 1 - hydroxycyclohexyl phenyl ketone ( cgi 1850 ). other suitable photoinitiators include 1 - hydroxycyclohexyl phenyl ketone ( ciba irgacure 184 ); 2 - benzyl - 2 - n , n - dimethylamino - 1 -( 4 - morpholinophenyl )- 1 - butanone ( ciba irgacure 369 ); a mixture of 50 % by weight 1 - hydroxycyclohexyl phenyl ketone and 50 % by weight benzophenone ( ciba irgacure 500 ); 2 , 2 - dimethyoxy - 2 - phenyl acetophenone ( ciba irgacure 651 ); 2 - methyl - 1 -[ 4 -( methylthio ) phenyl ]- 2 - morpholino propan - 1 - one ( ciba irgacure 907 ); 2 - hydroxy - 2 - methyl - 1 - phenylpropan - 1 - one ( ciba darocur 1173 ); bis ( 2 , 6 - dimethoxybenzoyl )- 2 - 4 -, 4 - trimethylpentyl phosphine oxide ( ciba cgi 403 ); 4 -( 2 - hydroxyethoxy ) phenyl - 2 -( 2 - hydroxy - 2 - methylpropyl ) ketone ( ciba irgacure 2959 ); bis ( η5 - 2 , 4 - cyclopentadien - 1 - yl )- bis -[ 2 , 6 - difluoro - 3 -( 1h - pyrrol - 1 - yl ) phenyl titanium ( ciba irgacure 784 dc ); isobutyl benzoin ether ( stauffer vicure 10 ); methyl benzoylformate ( stauffer vicure 55 ); a mixture of 2 - butoxy - 1 , 2 - dipehnylethanone and 2 -( 2 - methylpropoxy )- 1 , 2 - diphenylthanone ( sartomer esacure eb3 ); 2 , 2 - diethoxyacetophenone ( upjohn deap ); 2 , 2 - di - sec - butoxyacetophenone ( upjohn uvatone 8301 ); diethoxyphenyl acetophenone ( upjohn uvatone 8302 ); a mixture of 70 % by weight oligo 2 - hydroxy - 2 - methyl - 1 -[ 4 -( 1 - methylvinyl phenyl ) propanone ] and 30 % by weight 2 - hydroxy - 2 - methyl - 1 - phenyl propan - 1 - one ( sartomer esacure kip 100 f ); a mixture of isopropyl thioxanthone and a photoactivator such as ethyl 4 -( dimethylamino ) benzoate ( sartomer esacure itx and esacure edb , respectively ); a mixture of isopropyl thioxanthone and 2 , 4 , 6 - trimethylbenzophenone and 4 - methylbenzophenone ( sartomer esacure x 15 ); a mixture of 2 , 4 , 6 - trimethyl - benzophenone and 4 - methylbenzophenone ( sartomer esacure tzt ); a mixture of 30 % by weight oligo 2 - hydroxy - 2 - methyl - 1 -[ 4 -( 1 - methylvinyl phenyl ) propanone ] and 70 % by weight of a mixture of 2 , 4 , 6 - trimethylbenzophenone and 4 - methylbenzophenone ( sartomer esacure kt 37 ); fluorone dye / onium salt / amine photoinitiator systems , such as those available from spectra group ltd ., and borate and dye / borate systems , such as those available from ciba . if it is unnecessary to include a uv absorber in the polyester lenses , or if a uv absorber is included that absorbs light having a wavelength cutoff below 380 nm , polymerization can be initiated with any of the above - mentioned photoinitiators , particularly the benzoin ethers ; hydroxyl alkyl phenyl ketones ; substituted acetophenones ; and the sulfonic esters of alpha - hydroxy benzoin derivatives . the use of such photoinitiators in a formulation made to be very reactive , such that the amount of photoinitiator can be minimized , helps to reduce coloration of the lens during cure . together with trace amounts of a blue and red dye , the lens can be made to be “ water - white ”. in addition to the photoinitiator ( s ), it has been found that the unsaturated polyester composition , in the preferred embodiment , also includes an additive selected from the group consisting of an allylic ester , an acrylate monomer , and mixtures thereof , to provide improved tint speed and / or improved optical uniformity . best results are achieved with a combination of an allylic ester and an acrylate monomer , particularly since the allylic ester also functions to increase the impact strength of the cross - linked polymer network , and the acrylate additionally functions to increase the abrasion resistance . any low color allylic ester and / or any low color acrylate monomer or oligomer is suitable as an optional additive in accordance with the preferred embodiment of the present invention . suitable allylic esters include monoallylic esters , diallylic esters and triallylic esters , preferably an allylic ester selected from the group consisting of diallyl phthalate ; diethylene glycol bis ( allyl carbonate ); triallyl cyanurate ; diallyl diphenate ; and mixtures thereof . other suitable allylic esters include allyl acrylate ; allyl benzene ; triallyl isocyanurate ; diallyl maleate ; diallyl diglycollate ; dimethallyl maleate ; allyl benzoate ; diallyl adipate ; and mixtures thereof . the allylic ester , when incorporated as a composition additive , should be included in an amount in the range of about 1 % to about 20 %, based on the total weight of the polyester - based lens composition , preferably about 2 % to about 10 % by weight ; and more preferably about 4 % to about 10 % by weight , with best results achieved at about 4 % to about 8 % by weight . suitable acrylic monomers include monoacrylates , diacrylates , triacrylates , tetraacrylates , pentaacrylates , and the higher poly - functional acrylates . the preferred acrylate monomer is selected from the group consisting of methyl methacrylate ; ethylene glycol diacrylate ; ethylene glycol dimethacrylate ; polyethylene glycol diacrylate ; polyethylene glycol dimethacrylate ; 1 , 6 hexanediol diacrylate ; ethoxylated bisphenyl a diacrylate ; ethoxylated bisphenyl a dimethacrylate ; trimethylolpropane polyoxyethylene triacrylate ; dipentaerythritol pentaacrylate ; bis ( 4 - methacryloylthiophenyl ) sulfide and mixtures thereof . other suitable monofunctional acrylates include alkyl and substituted alkyl acrylates and methacrylates , such as ethyl acrylate ; cyclohexyl methacrylate ; 2 - hydroxyethyl methacrylate ; 3 - hydroxypropyl acrylate ; and mixtures thereof . additional suitable monofunctional acrylates and methacrylates include any haloalkyl acrylate and methacrylate , such as alpha - bromoethyl acrylate ; alpha - chloroethyl acrylate ; chloromethyl methacrylate ; 2 - bromoethyl methacrylate ; and mixtures thereof . aryl acrylates and methacrylates also are suitable as optional additives for the polyester - based compositions , such as 2 - naphthyl - methacrylate ; para - tolyl acrylate ; and mixtures thereof . also suitable are the haloaryl acrylates and methacrylates , such as para - chlorophenyl methacrylate ; meta - bromophenyl acrylate ; 2 , 4 , 6 - tribromophenyl acrylate ; and mixtures thereof . the benzyl acrylates and methacrylates which can be used as composition additives , in accordance with the present invention , include benzyl acrylate ; benzyl methacrylate and their derivatives , such as para - chlorobenzyl methacrylate ; meta - methoxybenzyl methacrylate ; para - ethylbenzyl acrylate ; and mixtures thereof . other suitable polyfunctional acrylates and methacrylates include the polyol diacrylates and dimethacrylates , such as neopentyl glycol diacrylate ; polyethylene glycol acrylates , methacrylates , and dimethacrylates , such as the acrylate and methacrylate esters of diethylene glycol , trimethylene glycol , tetraethylene glycol , and the like ; thiodiethylene glycol dimethacrylate ; and mixtures thereof . additional useful polyfunctional acrylates and methacrylates include the polyol polyacrylates and polymethacrylates , such as pentaerythritol triacrylate ; glycerol triacrylate ; trimethylolpropane triacrylate ; tris ( 2 - hydroxyethyl ) isocyanurate trimethacrylate ; and the aliphatic and aromatic monofunctional and polyfunctional urethane acrylates and methacrylates ; and mixtures thereof . the acrylate monomer , when incorporated into the polyester composition , should be included in an amount in the range of about 1 % to about 50 %, based on the total weight of the polyester - based lens composition , preferably about 2 % to about 40 % by weight ; and more preferably about 5 % to about 35 % by weight , with best results achieved at about 10 % to about 25 % by weight . when the composition is used to first make a rear layer gel - form , it is preferred to use an exotherm depressant to extend the time the composition is in a suitable gel state for ease of removal of the front mold prior to assembling the gel - form such that it is contact with the photochromic - containing composition , and prior to completing the simultaneous cure of the two layers . examples of exotherm depressant compounds suitable for this purpose include alpha - methyl styrene , terpinolene , gamma - terpinene , and dilauryl thiopropionate . examples illustrating the use of exotherm depressants in unsaturated polyester compositions suitable for ophthalmic lens manufacturing can be found in this assignee &# 39 ; s u . s . pat . nos . 5 , 694 , 195 ; 5 , 852 , 112 ; 5 , 886 , 764 ; and 6 , 099 , 123 , hereby incorporated by reference . the preferred exotherm depressant is alpha - methylstyrene in an amount of about 2 to about 10 weight percent . the resulting lens will have a relatively high index of refraction ( greater than 1 . 50 ), a relatively low density ( less than 1 . 38 grams / cc ), and an acceptable abbe value ( greater than 30 ). the lens will have sufficient hardness to be able to be surfaced with commonly used optical laboratory equipment . additionally , by the addition of various ultra - violet absorbing materials capable of absorbing uv radiation having a wavelength below about 380 nm ( such as cyanamid cyasorb uv5411 ; ciba geigy tinuvin 234 ; and the like ) and color - correcting dye ( s ), the lens can be made “ water white ” and will not appreciably yellow during exposure to sunlight . activating the photoinitiator , in accordance with the preferred embodiment , is accomplished using radiation with wavelengths above 380 nm , but below that wavelength at which the photoinitiators are no longer active . for the system described , an emission line of approximately 405 nm ( such as that obtained by a fusion systems “ v ” bulb ) is very satisfactory . intensity of the uv light is one parameter that can be varied over a wide range to produce the rapid reaction and exotherm such that optical uniformity is achieved . optical uniformity in polyester lenses can be obtained using the photocuring and photoinitiator ( s ) of the present invention so long as the polyester - based composition gels in about 7 minutes or less , and preferably in about 5 minutes or less . a number of other parameters can be varied while achieving gelation within about 7 minutes including the peak exotherm temperature ; time to reach peak exotherm temperature ; time that the composition is photopolymerized and photocured with the uv light ; photoinitiator concentration ; whether or not an exotherm depressant is included in the composition ( and its concentration ); and the wavelength cutoff of the uv absorber ( at a lower wavelength cutoff , less uv light intensity is required since the absorber blocks less uv light ). preferably , a light intensity of at least about 300 microwatts / cm 2 is used to achieve rapid gelation , more preferably about 500 microwatts / cm 2 to about 7 , 000 microwatts / cm 2 . also , it is preferred that the time to reach peak exotherm temperature ( which preferably is higher than about 150 ° f . ( 66 ° c .)) be less than about 1 hour , and more preferably less than about 45 minutes . another suitable formulation for the rear ( eye - facing ) lens layer of the first embodiment is comprised of : the resin , silmar d - 910 , is a clear , unsaturated polyester ortho resin intermediate formed from the reaction of phthalic anhydride , maleic anhydride , propylene glycol , ethylene glycol and diethylene glycol with a number average molecular weight of about 2 , 200 . it contains approximately 30 % by weight styrene as a diluent monomer . the polyester resin serves as the basis for the formulation . the other ingredients utilized are believed to perform the following functions : diallyl phthalate is added to increase tintability of the final lens product . ethylene glycol dimethacrylate is used to promote rapid curing , and together with methyl methacrylate , contributes to the overall hardness of the lens . styrene is added to adjust the index of refraction and as a diluent monomer for further viscosity reduction . cyasorb uv - 5411 and tinuvin 234 are used for conveying strong ultraviolet absorbency to the final lens product and to improve weathering characteristics of the lens . darocur 4265 is the photoinitiator and has some reactivity at wavelengths above 380 nm . the blue and red dyes are used to adjust the final lens to a “ water - white ” color . the components of the formulation are thoroughly mixed , with precaution taken to shield the mixing vessel from bright light . after filtration through a 1 micron filter , the formulation is poured into the lens mold assembly . since many of the components are quite volatile , precautions must be taken to avoid much evaporation during the pouring process . the lens assembly configurations have been previously described . the gasket should be composed of a material chemically resistant to the formulations used . glass molds , through which the curing radiation will pass , should be transparent and free from markings or other conditions which would interfere with light transmission through the formulation . the lens assembly is then exposed to the curing radiation . the composition disclosed will cure best from a source of light with sufficient intensity in the wavelength region of 380 nm to 430 nm . a fusion systems , inc . type “ v ” bulb has intense output at approximately 405 nm and 420 nm and is ideally suited for exposure , although other lamp types can also be used . light from the lamp is diffused by means of a piece of sandblasted sheet glass or “ opal ” glass placed between the lamp and the lens assembly . in the first embodiment , the light is directed from the source to the rear convex mold , then through the composition . the exposure intensity and time should be sufficient to initiate a rapid rate of polymerization and exotherm in order to achieve optical uniformity . the intensity of the “ v ” bulb light measured with a calibrated radiometer fitted with a narrow bandpass filter at 405 nm should be at least about 300 microwatts / cm 2 , preferably at least 500 microwatts / cm 2 . higher intensity is even more desirable to obtain better optical and tint uniformity . lower intensities will require somewhat longer exposure than higher intensities . a good practical value is approximately 4 , 000 microwatts / cm 2 for 30 minutes . it is important to take precautions that the light is uniform over the lens surface . intensity has an effect on base curvature of the completed lens , and variations in intensity will cause a non - uniformity of the curvature . likewise , intensity can effect tint rate and non - uniformity of exposure could cause tint blotchiness . after curing , the assembly is allowed to cool to an appropriate temperature of , e . g ., about 200 ° f . ( 93 ° c .) or less , for ease of disassembly . rear ( inner lens ) layers produced from the disclosed composition and cured as described have the following properties : an additional formulation suitable for producing the rear lens non - photochromic layer for either the first embodiment or the second embodiment can be produced with the following components . when used as a gel - form of the second embodiment , exposure time to the light of the fusion “ v ” bulb measured at approximately 4 . 0 milliwatts / cm 2 , as previously described , is 2 minutes . the front mold can then be carefully separated from the gelled composition , and the process of making a composite photochromic lens is carried forward as previously described . when this composition is used as the non - photochromic polymerizable composition of the first embodiment , the process previously disclosed for the composition of table 2 is adequate for curing the composite lens . when used in either the first or second embodiment , the polymerized non - photochromic layer exhibits an index of refraction of approximately 1 . 594 . an additional formulation suitable for the rear lens non - photochromic layer of the second embodiment can be produced containing the following components . when used as a gel - form , exposure time to the light of the fusion “ v ” bulb measured at approximately 4 . 0 milliwatts / cm 2 , as previously described , is 3 minutes . the front mold can then be carefully separated from the gelled composition , and the process of making a composite photochromic lens is carried forward as previously described . all of the compositions and / or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure . while the compositions and methods of this invention have been described in terms of preferred embodiments , it will be apparent to those of skill in the art that variations may be applied to the compositions and / or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept , spirit and scope of the invention . more specifically , it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved . all such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit , scope and concept of the invention .

US-23244702-A

a double - walled flexible dispenser sump connection system prevents fuel leaks into a dispenser sump located below a fuel dispenser . an inner flexible connector and an outer flexible connector are configured such that the dispenser sump connection system may be installed on newly constructed fuel delivery systems or be retrofitted onto existing fuel delivery systems in order to bring them into compliance with recently environmental regulations .

referring now to the drawings , and particularly to fig2 , and 4 thereof , there is shown the dispenser sump connection system 30 of the present invention . an inner flexible connector 32 is connected to the inner pipe 16 for completing the conveyance of fuel to the dispenser 12 . an outer flexible connector 34 is installed over and completely encloses the inner flexible connector 32 . the lower end of the outer flexible connector 34 is connected in fluid communication with the outer pipe 26 . the upper end of the outer flexible connector 34 is connected to the shear valve 24 thereby completing the containment of any leaks from either the inner pipe 16 and the inner flexible connector 32 . the interstitial space between the outer flexible connector 34 and the inner flexible connector 32 is either pressurized or vacuum sealed thereby preventing any fuel leakage into the dispenser sump 18 . the flexible connectors 32 and 34 used in conjunction with the present invention are described in detail in currently pending u . s . patent applications ser . no . 10 / 689279 filed oct . 20 , 2003 ; ser . no . 10 / 736 , 416 filed dec . 15 , 2003 ; and ser . no . ______ filed jan . 21 , 2005 ( attorney docket number 200625 - 1003 ). in the embodiment shown in fig2 through 4 , the inner flexible connector 32 couples to the inner pipe 16 through an elbow joint 36 comprising an inner elbow joint 38 secured to the distal end of the inner pipe and an outer containment clamshell 40 , which glues over the inner elbow joint 38 to contain any leaks that may occur therefrom . the dispenser sump connection system 30 of the present invention may be also be secured directly to the inner and outer pipes 16 and 26 , or by other connection means known to those skilled in the art and suitable for use in fuel and hazardous material delivery systems . fig3 is an exploded view and fig4 is a sectional view of the dispenser sump connection system 30 . the inner flexible connector 32 threadedly secures into the inner elbow joint 38 , thereby completing the connection of the inner flexible connector 32 to the inner pipe 16 . the top of the inner flexible connector 32 has male threads for threadedly securing the inner flexible connector into the shear valve 24 . the outer flexible connector 34 installs over the inner flexible connector 32 and is connected to the elbow joint 36 by a lower connection ring 42 , which extends around the end of the inner elbow joint 38 . the outer containment clamshell 40 when glued over the inner elbow joint 38 covers and thereby contains the connection of the lower connection ring 42 to the inner elbow joint 38 . the lower end of the outer flexible connector 34 is secured to the lower connection ring 42 by a first hinged circular clamp 44 having a threaded locking mechanism 46 . a gasket 48 is mounted between the outer flexible connector 34 and lower connection ring 42 . wedge shaped surfaces on the outer flexible connector 34 and on the lower connection ring 42 and corresponding shapes on the inner surfaces of the circular clamp 44 , combined with the gasket 48 , cause the outer flexible connector 34 and the lower connection ring 42 to form a compression seal as the threaded locking mechanism 46 is tightened . the upper end of the outer flexible connector 34 is connected to the shear valve 24 by an upper connection ring 50 . the outer flexible connector 34 is secured to the upper connection ring 50 by a second hinged circular clamp 44 having a threaded locking mechanism 46 . a gasket 48 is positioned between the outer flexible connector 34 and upper connection ring 50 . wedge shaped surfaces on the outer flexible connector 34 and on the upper connection ring 50 and corresponding shapes on the inner surfaces of the circular clamp 44 , combined with the gasket 48 , cause the outer flexible connector 34 and the upper connection ring 50 to form a compression seal as the threaded locking mechanism 46 is tightened . the upper connection ring 50 comprises female threads for threadedly securing an outer housing 52 of the shear valve 24 thereinto . near the upper end of the outer flexible connector 34 is an orifice 54 which facilitates either vacuum sealing or pressurization of the interstitial space between the inner flexible connector 32 and the outer flexible connector 34 . the lower connection ring 42 , the upper connection ring 50 , and the hinged circular clamps 44 may be formed from stainless steel , bronze , brass , monel , other metals , various polymeric materials , and other materials that will not be adversely affected by the fluid that will flow through the inner and outer flexible connectors 32 and 34 . the inner elbow joint 38 and the outer elbow joint 40 are commercially available parts used in conjunction with fuel delivery systems and other hazardous material delivery systems . although preferred embodiments of the invention have been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the embodiments disclosed , but is capable of numerous rearrangements , modifications , and substitutions of parts and elements without departing from the spirit of the invention .

US-6138805-A

the invention pertains to a filter bag for a vacuum cleaner , with a retainer plate made of a cardboard - paper material that can be attached to a dust bag , for example by gluing , and that has a sealable opening for a suction tube ) of a vacuum cleaner , where the opening can be closed off with a separate closure piece which can be moved from an open position to a closure position , being slid between two tiers . for greater ease of handling the invention proposes that the closure piece be practically fully enclosed in an outer contour of the retainer plate in the open position and in the closure position and that the closure piece lie exposed in a recess of the uppermost tier separate from the opening , the longitudinal extension of the recess conforming to the closure piece .

the electrical vacuum cleaner 1 shown is formed as a hand appliance . it has a housing 2 , at the upper end of which there is connected a handle 3 , the handle 3 having a grip 4 at its end . in the transition region between grip 4 and handle 3 , there is an on and off switch 5 . the electric cable connection is designated by the reference numeral 9 . the housing 2 is divided into a motor housing 6 and a chamber 7 extending above the motor housing for the reception of a dust filter bag 8 . the motor fan is not shown in detail in the drawings . the side of the dust filter bag 8 directed towards the motor housing 6 stands , in the operating disposition of the vacuum cleaner according to fig1 in a nozzle connectional relationship with a blower air channel of the motor fan , on the underside of the motor housing 6 , the housing has a transition into a tubular coupling 10 , which provides the airflow connection to a suction nozzle 11 . in regard to the suction nozzle 11 , there may be in question a so - called suction / brush nozzle , which has a brush roller in the nozzle mouth , the brush roller being set in rotation by way of a separate drive . the fan motor functions therefore from below in an upward direction , forcing as a result the dust - laden air into the dust filter bag 8 located in an inverted disposition above the motor housing 6 . the cross - section of the housing 2 is longitudinally rectangular over its entire height with long sides gently curved in an outward direction and similarly formed short sides . in fig1 the vacuum cleaner is to be seen from the long side . the chamber 7 receiving the dust filter bag 8 of corresponding cross - section is defined by a textile bag 12 stiffened by means of wiremesh , the lower end of which bag , that is , the end of the bag at the motor housing , has a transition into a stiffened edge in the form of a filter frame 13 . the stiffened textile bag 12 may be associated with this filter frame 13 by way of the releasable clip insertion connection . the attachment region is offset for this . for withdrawal of the dust filter bag , the housing 2 is opened out for substantially full exposure of its cross - section . the folded out position may be seen from fig1 ( in this case shown in chain - dotted manner ), 3 , 4 , and 11 to 13 . the pivot axis 14 enabling this is located on one of the short or narrow sides of the housing 2 . the bearing eyes on the filter frame for this pivot axis are designated by the reference numeral 15 . these bearing eyes 15 are located at the transition region between a short side and a long side of the chamber 7 . between the two bearing eyes 15 , there extends a continuous bearing eye of the motor housing 6 . in the separating joint region between motor housing 6 and chamber 7 , there is comprised in addition a drag cover t in the form of an intermediate support , on which the dust filter bag 8 is seated , an intermediate support or carrier t of this kind is known from german published patent application 39 11 580 of the present applicant . reference is made to this document in the present connection , as to the full content of the document . the drag cover t has a shape in plan view adapted to the cross - section of the housing , set back however from the sleeve wall of the housing 2 , so that in the coaxial disposition of motor housing 6 and chamber 7 shown in fig1 the drag cover t is substantially completely out of sight . the drag cover t is also formed to be pivotable , the drag cover t having two bearing eyes on the hinge side , as is also the case for the filter frame 13 in this way , the drag cover t pivots about the same pivot axis 14 as the chamber 7 . the dust filter bag 8 connected directly to the drag cover t has a base formed as a mounting plate 16 . the general shape in plan view of this mounting plate also corresponds to the cross - sectional shape of the filter frame 13 , which has peripheral steps 17 provided on the internal wall for supporting abutment of the mounting plate 16 . in this way , the mounting plate 16 cannot fall into the chamber 7 in the pivoted disposition of the appliance . the common pivot axis 14 of filter frame 13 and drag cover t extends over substantially the height of the supporting peripheral step 17 of the filter bag mounting plate 16 . when the housing 2 is closed , that is , in the working configuration of the vacuum cleaner 1 , the blower air channel of the motor fan penetrates into the lower region 18 &# 39 ; of a suction connection 18 by means of an offset cylindrical mouth end . this suction connection 18 projects above the upper side of the drag cover t , the suction connection 18 being formed similar to the drag cover t and the suction connection 18 projecting into the interior of the dust filter bag 8 in an edge sealing manner , to penetrate through an opening 19 of the filter bag mounting plate 16 , the opening 19 being of corresponding cross - section to that of the suction connection 18 . the suction connection 18 tapers towards its free end , so that the introduction of the connection 18 into the opening 19 has in effect a centering action . for withdrawal of the dust filter bag 8 , the chamber 7 with the drag cover t is swung into the open position shown in fig3 after release of a closing catch on the housing . in order to now release the dust filter bag 8 for withdrawal , the drag cover t is pivoted away from the chamber 7 , for which a handgrip 20 is provided on the upper side of the drag cover t which is directed away from the suction connection 18 . this handgrip 20 is pivotably disposed on the upper face of the drag cover t by means of a film hinge . in order to prevent the falling back of dust and dirt into the motor housing region 6 , in the operating disposition of the vacuum cleaner according to fig1 because of the inverted position of the dust filter bag 8 , a flap valve may be provided at the free end of the suction connection 18 . on the underside of the drag cover t , i . e . on the side of the cover t directed towards the suction connection 18 , there is associated with this cover t a pivotable plate 21 for holding an actuation projection b . this plate 21 is pivotably disposed at the free end of the drag cover t by means of a hinge 22 . the plate 21 extends forwardly from the hinge 22 up to substantially the middle of the drag cover t , to surround the suction connection 18 for this latter , the plate 21 has an opening 23 of oblong form . the region of the plate 21 directed away from the hinge 22 is taperingly formed . in this regions a receiving chamber 24 of rectangular shape in cross - section is defined in a positive manner , which chamber projects out beyond the end region of the plate 21 . in this receiving chamber 24 , the actuation projection b is mounted to be freely displaceable , the actuation projection b being comprised substantially of an actuation arm 25 which is of rectangular shape in cross - section and an actuation nose 26 formed at the free end of this actuation arm 25 , that is , at the end of the arm directed away from the receiving chamber 24 . the actuation nose extends in the configuration shown in fig3 towards the dust filter bag 8 . the actuation projection b is arranged to be spring - biassed in its longitudinal direction . for this , there serves a compression spring 27 accommodated in the receiving chamber 24 , which spring surrounds a pin 28 provided at the end of the actuation arm 25 projecting into the receiving chamber 24 . at the other end , the compression spring 27 abuts against an end wall 29 of the receiving chamber 24 . this receiving chamber 24 is closed - off by a cover 30 , which engages around the end wall 29 and the side walls of the receiving chamber 24 . in the open end region , that is , in the region in which the actuation arm 25 projects into the receiving chamber 24 , the cover 30 has an inwardly projecting supporting collar 31 . this latter serves as an abutment stop for the actuation arm 25 which is biassed in the outward direction by the compression spring 27 , the actuation arm having a matching corresponding abutment edge 32 . the plate 21 and the actuation projection b carried by this are pivotable about the hinge 22 against a spring 33 . for this purpose , this spring 33 extends between the underside of the drag cover t and the side of the plate 21 directed towards this underside . to achieve this , a corresponding recess 34 for reception of one of the ends of the spring 33 is provided on the underside of the drag cover t . the other end of the spring 33 engages around a circular projection 35 of the plate 21 in the region of the transition from the plate 21 to the receiving chamber 24 . the spring 33 biasses the plate 21 and the actuation projection b connected to this plate at all times towards the dust filter bag 8 . the path of pivoting of the plate 21 is limited in such a manner that on pivoting the drag cover t away from the dust filter bag 8 and away from the holding plate 16 for this bag , the edge of the projection 35 of the plate 21 , which projection extends into the aperture region 23 , abuts against a collar 36 on the outer periphery of the suction connection 18 ( see fig1 ). the spring 33 , as has already been further described in detail above , is in particular also of importance for the further execution and especially for the completion of the closing or sealing movement when opening the vacuum cleaner . the dust filter bag 8 is comprised substantially of the mounting plate 16 already mentioned and of a dust bag 37 , preferably formed from paper , on the underside of this mounting plate 16 , for example adhesively connected to the plate . the mounting plate 16 has a shape corresponding closely to the inner side of the filter frame 13 and comprises four layers of cardboard - paper material laid one over the other . these layers 38 to 41 are glued to one another . the mounting plate 16 thus formed is supported in the inserted condition of the dust filter bag 8 on the peripheral steps 17 of the filter frame 13 . in order to prevent the dust filter bag 8 from being dislodged in the operating configuration of the vacuum cleaner 1 according to fig1 retaining features 42 are provided , which are located on the inner side of the filter frame 13 and act on the upper side of the mounting plate 16 . the dust filter bag 8 is thus held in its mounting plate region 16 . for locationally correct secure placement of the dust filter bag 8 , the mounting plate 16 has orientation features 43 in its two short side regions , which engage in corresponding counter - features 44 of the inner wall of the filter frame 13 . in regard to the orientation features , there are in question projections of trapezoidal shape on the short or narrow side of the plate - shaped body forming the mounting plate 16 . there is thus achieved a position which is correct as to alignment between opening 19 and suction connection 18 . on the peripheral edges of the longer sides , the mounting plate 16 has gripping openings 45 . the two gripping openings 45 are bevelled and are open towards the corresponding inner wall of the filter frame 13 . in the open disposition of the housing 2 and after the drag cover t has been swung back , the dust filter bag 8 may be comfortably grasped by gripping across the set back central zone of the mounting plate 16 , which is of wasp - waist shape , and the bag may be lifted out of the chamber 7 . as already mentioned , the mounting plate 16 comprises four layers 38 to 41 laid one over the other , the paper dust bag 37 being glued onto the lowermost layer 41 on the underside . this lowermost layer 41 has a circular aperture 46 . the layer 40 located above this layer 41 is formed to be the same as the layer 41 as to shape and surface area and also has an aperture 47 located coaxially with the aperture 46 , which aperture 47 also has the same radius as the aperture 46 . the layer 39 located over the layer 40 is formed as a spacing layer for the layer 38 providing the top and serves to define a free space 48 . fig1 shows a plan view of the layer 39 with omission of the layer 38 which lies over this layer 39 and forms the top . the layer 39 is in general formed as an edge strip having the same external shape as the other three layers . in practice , this is so effected that layer sections 49 to 51 are provided at the outer edge in the region of the aperture 47 of the layer 40 , which layer sections extend from the respective outer edge to the vicinity of the aperture 47 , leaving a spacing between the aperture 47 and the inner edge of the respective layer strip . the layer strips 49 and 51 provided on the long sides of the mounting plate 16 are connected to the layer strip 50 at the end edge directed towards the aperture 47 and extend outwardly from this layer strip 50 into the gripping opening regions 45 , which gripping openings are formed by corresponding recesses in the layers 38 , 40 and 41 . the spacing between the two peripherally inner edges of the layer strips 49 and 51 is in this connection selected to be greater than the spacing between the peripheral edges of the gripping openings 45 directed towards one another on the opposite side of the gripping openings 45 from the layer strips 49 and 51 , the layer strips continue as layer strip sections 49 &# 39 ; and 51 &# 39 ;, with retention of the same width . while maintaining a spacing from the gripping openings 45 , the layer strip sections 49 &# 39 ; and 51 &# 39 ; are widened in such a manner that proceeding from the outer periphery of the mounting plate 16 , they extend into the central region of the mounting plate 16 , while leaving a slit 52 . this widened region of the layer 39 , which as a result is located in the end region of the mounting plate 16 opposite to the aperture 47 , are indicated by reference numerals 53 and 54 . in the transition region between the layer strip sections 49 &# 39 ; and 51 &# 39 ; and the regions 53 and 54 , there are therefore defined abutments 55 which are effective in the longitudinal direction of the mounting plate 16 . the uppermost layer 38 defining the top has a configuration which is the same as that of the layers 40 and 41 as to shape and almost the same as to area . in this case also , an aperture 56 is provided , coaxial with the apertures 46 and 47 . these apertures 46 , 47 and 56 define the opening 19 , already mentioned , in the mounting plate 16 . the uppermost layer 38 is further provided with a recess 57 located above the slit 52 of the layer 39 , the recess 57 being open at the edge and having almost the same width as the slit 52 . this recess 57 extends proceeding from the short or narrow side of the mounting plate 16 opposite the opening 19 in the direction of the longitudinal extent of the mounting plate 16 to substantially the middle of this latter . between the two lower layers 40 and 41 , a rubber seal 58 is inserted and preferably glued in position . this rubber seal 58 is provided in the region of the apertures 46 and 47 and has a circular opening 59 , which is formed to have a smaller diameter than the diameter of the apertures 46 and 47 . the opening 59 of the rubber seal 58 is in this connection aligned coaxially with the apertures 46 and 47 . the rubber seal 58 serves for the sealing connection between the dust filter bag 8 and the suction connection 18 , when the suction connection 18 enters through the opening 59 and projects into the interior of the dust filter bag 8 . in the free space 48 defined between the layers 38 and 40 and bounded by the layer strips of the layer 39 , a closure member v is displaceably mounted ( see fig1 ). the closure member v is for this substantially of spade shape in plan view , a spade handle 60 being located , in the disposition shown in fig1 , in the slit 52 of the layer 39 . the closure plate 61 connected to the spade handle 60 has a width almost corresponding to the spacing between the peripheral inner sides of the layer strips 49 and 51 and the layer strip sections 49 &# 39 ; and 51 &# 39 ; and extends , in the disposition according to fig1 , proceeding from the abutments 55 of the layer 39 , to the edge of the aperture 47 of the layer 40 and to the edge of the opening 19 . the spade handle 60 of the closure member v is in this regard exposed within the recess 57 provided in the uppermost layer 38 and serves as an actuation section . for this , the spade handle 60 has a handling projection m in the form of a fold location 62 . by this , there results at the free end of the spade handle 60 , a section 63 which may be folded out from the spade handle . it is also possible for the handling projection m to be formed in such a manner that at the free end region of the spade handle 60 , a thickened region is provided . alternatively , for this purpose , there may also be provided in this region , a recess in the form of a longitudinal slit or the like . because of this formation of the mounting plate 16 , it is now possible to selectively close or open the aperture 19 by means of the closure member v . for this , the closure member v is displaced longitudinally in the free space region 48 of the layer 39 , the closure member v being fully accommodated within the external contour of the mounting plate 16 both in the closed position and also in the open position , as well as at every intermediate position . this means that portions of the closure member v do not project outside the external shape or contour of the mounting plate 16 , either in the closed disposition or in the open disposition . this is also not possible in the case of the embodiment shown , since the shape and size of the filter frame 13 of the vacuum cleaner 1 would not allow any enlargement of the external shape or contour of the mounting plate 16 . the displacement of the closure member v takes place by grasping or gripping at the handling projection m , which is exposed for engagement in the recess region 57 of the uppermost layer 38 . for this purpose , this recess 57 corresponds in its longitudinal extent to the path of displacement of the closure member v . by displacing the closure member v from the open disposition according to fig1 into a closed disposition in the direction of the arrow y , the opening 19 in the mounting plate 16 is closed by means of the closure plate 61 . for this , the closure member v is guided at its sides by the layer strips 49 and 51 . the end position for the closed configuration is achieved when the end edge of the closure plate 61 abuts against the inner peripheral edge of the end edge of the layer strip 50 . the open disposition is defined by the abutment , already mentioned , of the closure plate 61 against the stops 55 of the layer 39 . for withdrawal of a dust filter bag 8 provided with a mounting plate 16 of this kind from the chamber 7 , the dust bag together with the drag cover t is first of all pivoted out of the operating disposition according to fig1 into a withdrawal position according to fig3 . as is to be seen from this drawing , the pivotable plate 21 provided with the actuation projection b is here disposed parallel to the drag cover t between this latter and the mounting plate 16 . the actuation nose 26 of the actuation projection b thus engages behind the section 63 of the spade handle 60 of the closure member v , which section 63 may be folded out of the plane of the spade handle . if the drag plate t is subsequently pivoted away from the chamber 7 by means of the handgrip 20 , the actuation nose 26 engaging at the foldable - out section 63 then effects a displacement of the closure member v in the closing direction for the opening 19 . in the course of pivoting the drag cover t , the plate 21 with the actuation projection b pivots at the same time about the hinge 22 , because of the spring 33 , in such a manner that the foldable - out section 63 of the closure member v is engaged at all times by the actuation nose 26 at least over a major part of the path of pivoting of the drag cover t . there is effected by this a scissors - type opening action between the drag cover t and the plate 21 provided with the actuation projection b . because of the actuation arm 25 being spring - biassedly mounted in the receiving chamber 24 , this may give way in the course of movement into the receiving chamber 24 . the spring - biassed support of the actuation projection b and the spring - biassed pivotability of the plate 21 and the actuation projection b connected to this plate , guarantee at all times that the actuation nose 26 engages behind the foldable - out section 63 over the entire path of displacement of the closure member v . as soon as the closure member v reaches the closed position for the opening 19 , the end edge of the closure member v or that of the closure plate 61 abuts , as already mentioned , against the inwardly located peripheral edge of the layer strip 50 of the layer 39 . in this disposition , the fold location 62 of the spade handle 60 also reaches the end edge 64 of the recess 57 of the uppermost layer 38 . the actuation protection b continues to endeavour , in this dispositions to displace the closure member v further in the direction of the arrow y . the actuation nose 26 thus still continues to engage behind the foldable - out section 63 of the spade handle 60 . in the course of the further pivoting of the drag cover t away from the chamber 7 , there now takes place engagement of the actuation nose 26 beneath the foldable - out section 63 , which section , because of this and because of the urging in the direction of the arrow y , which still continues to prevail , folds out in an upward direction , that is , by moving out through the recess 57 of the uppermost layer 38 . by this , there is introduced a second fold location 65 ( see fig1 ). here it is shown that the spade handle 60 may be formed to be of the same width as the recess 57 , but it may also optionally be narrower than this recess , since otherwise the region which is impacted against and gripped beneath by the actuation nose 26 in the disposition shown in fig1 cannot give way outwardly . this would lead to damage of the closure member v in the region of the engagement surface for the actuation nose 26 . in so far however as the displacement of the closure member and the action on the spade handle 60 is not effected by way of a folded portion , but only by a handling projection m mounted for example on the spade handle , it is also possible and is preferred for the spade handle 60 to be formed to have a greater width than the recess 57 , so that the edges of the recess are engaged from below by the spade handle . in the course of the further pivoting of the drag cover t into a disposition according to fig1 in which the dust filter bag 8 may be released , the actuation nose 26 of actuation projection b passes over the foldable - out section 63 , whereby this latter is moved to an upward location , passing out of the recess 57 of the uppermost layer 38 . the actuation projection b reaches in this way a predefined end position , while , as already described , the projection 35 extending into the aperture 23 of the plate 21 abuts against the collar 36 provided on the external periphery of the suction connection 18 . the drag cover t may also be pivoted still further than the 90 ° disposition shown in fig1 , so that the dust filter bag 8 may be removed in a problem - free manner from the chamber 7 . for removal of the dust filter bag 8 , this is grasped in the gripping opening regions 45 of the mounting plate 16 and drawn out of the chamber 7 against the retaining action of the retaining features 42 of the filter frame 13 . if a closed dust filter bag 8 of this kind is however to be used again , opening of the aperture 19 may be effected in the simplest manner . for this , the drag cover t is pivoted back in the direction of the chamber 7 , so that the free end region of the actuation arm 25 of the actuation projection b engages against the fold location 62 located at the end edge 64 of the recess 57 in the mounting plate 16 . in the course of the further pivoting of the drag plate t into the closed position , the actuation projection b displaces the closure member v into an open position for the aperture 19 , in that the actuation arm 25 pushes the closure member v in front of it , the pushing taking place in the spade handle region 60 of the closure member . as already discussed previously above , the ability to vary the longitudinal location of the actuation projection b against the compression spring 27 is also of particular importance in this connection . thus , in the event of an inappropriate angular disposition , a potential blocking effect may be introduced by the actuation projection b meeting up with the spade handle 60 . instead of this , the length of the actuation arm 25 is first of all reduced , whereby the actuation angle on the spade handle 60 is also changed , so that any self - arresting or blocking effect which may occur may be overcome . in the further course of the pivotal movement of the drag cover t , there closes also the scissors form arrangement of drag cover t with respect to the plate 21 and also with respect to the actuation projection b mounted on the plate 21 . after complete opening of the aperture 19 of the mounting plate 16 , whereby corresponding edges of the closure plate 61 abut against the stops 55 of the layer 39 , the actuation projection b passes over the foldable - out section 63 in the free end region of the actuation arm 25 and the actuation nose 26 of the arm 25 seats itself once again behind this section 63e in this connection , it is also of importance that the actuation projection 26 travels against a stop 26 &# 39 ; fixed to the housing ( see for example fig3 ). this takes place preferably also with the development of a certain level of noise , which signals to the user a correct open condition of the filter bag and altogether a functionally problem - free preparedness of the vacuum cleaner for operation . the dust filter bag 8 shown and described is , with its mounting plate 16 , also insertable in vacuum cleaners 1 which have no arrangement for automatic closing and opening in the course of opening or closing the vacuum cleaner . here nonetheless there is also the possibility of displacing the closure member v by hand into the respective disposition , in that the foldable - out section 63 is grasped by hand and a displacement of the closure member v may thus be effected . in addition , there is also the possibility of engaging the closure member v in the region of the gripping openings 45 , in that the closure member v may be engaged and displaced by means of a clamping grip in the exposed region between the layers 38 and 40 . this also functions in the particular example as shown in the embodiment , in which the closure member in the region of the gripping openings 45 reaches only to the edge of the contour of the mounting plate 16 and does not project beyond this contour . in use of a vacuum cleaner 1 which is provided with an actuation projection b as shown and described , use of conventional dust filter bags may also be envisaged , that is , dust filter bags without closure member v . in this case , the actuation projection b would run out over the mounting plate 16 during pivoting of the drag cover t into an open or closed position , without functions of any kind being carried out . it is finally also possible for the plate 21 of the drag cover t to be provided with registration projections . these registration projections travel , after completion of pivoting of the actuation projection b , into corresponding registration openings , which in the embodiment shown , may be the gripping openings 45 of the mounting plate 16 . for this , the arrangement is such that closure of the vacuum cleaner 1 is only possible when the registration projections have entered into the registration openings or the gripping openings 45 . this arrangement is to provide that closure of the vacuum cleaner 1 is only possible when a dust filter bag 8 has been inserted . if a dust filter bag 8 is inserted into the chamber 7 , the actuation projection b pivots , as already described , in the course of the closing movement , in the direction of the underside of the drag cover t , whereby the registration projections are also correspondingly displaced to such an extent that they may enter into the corresponding registration openings or gripping openings 45 in the closed disposition of the chamber 7 with respect to to the drag cover t . if however no dust filter bag 8 is introduced , the actuation projection b finds no opposition to pivoting , so that the registration projections remain in their blocking position . in this blocking position , these projections abut for example against the outer edge of the filter frame 13 in the course of the closing movement of the drag cover t , so that there is opposition to closing the vacuum cleaner 1 . if now also , differently sized registration projections are associated with correspondingly differently sized registration openings , a locationally correct insertion of the dust filter bag 8 in the chamber 7 is also assured . there is shown and described , initially with reference to fig1 , a mounting plate 101 for a dust filter bag . the mounting plate 101 is , as may be seen from fig1 , formed from a total of four layers ( fig1 is a greatly enlarged representation ). an upper layer 102 has a circular opening 103 with a peripheral edge 104 . in addition , a relatively wide slit 105 is provided in the upper layer 102 . underneath the upper layer 102 , there is a provided a displaceable closure member v . the closure member v is provided at its narrow end with an attachment 106 , which in the embodiment also comprises a card layer . the attachment 106 projects into the slit opening 105 . by means of this attachment 106 , the closure pusher v may be displaced by hand or automatically . the closure pusher v is indicated in fig1 as to its external dimensions by the dotted lines . the opening 107 of the middle layer 108 , i . e . the third layer from the top of the mounting plate 101 , is formed to be larger than the upper opening 103 and also larger than the lower opening 109 ( see fig1 ). a rubber seal 111 is mounted between the layer 108 and the lowermost layer 110 of the mounting plate 101 . the rubber seal 111 may for example be secured between the layers 108 and 110 by gluing . the rubber seal 111 extends inwardly from the peripheral edge 104 in annular manner and has an inner peripheral edge 112 . a stabilising portion in the form of a tongue 113 is provided on the middle layer 108 , i . e . the third layer from the top of the mounting plate 101 . the tongue 113 is provided at the location on the opening 103 which is most remote from an end edge 114 of the closure member v ( with reference to the withdrawn position of fig1 ). by the provision of the tongue 113 on the layer 108 of the mounting plate 101 , it follows that this may also comprise a card - paper material , in the case of the present embodiment , as also applies for the remaining layers of the mounting plate . the tongue 113 has a dimension e , proceeding from the peripheral edge 104 towards the interior of the opening 103 , which dimension corresponds to one - half of the dimension e of the rubber seal 111 from the peripheral edge 104 towards the interior of the opening 103 . for the present embodiment , a diameter d of the circular opening 103 is approximately 5 cm . the dimension e corresponds approximately to one - tenth of this diameter , thus approximately 5 mm , while the rubber seal 111 extends approximately 1 cm into the interior of the opening 103 ( dimension e ). the sectional view of fig1 shows a section in the plane between the layer 115 , the second layer from the top , and the layer 108 . in order to indicate that these layers are glued to one another and thus are connected to one another , the section plane , in so far as it coincides with the gluing , is indicated by cross - hatching . it will be apparent that the tongue 113 is provided directly on the layer 115 . the rubber seal 111 is mounted between the layer 115 and the layer 108 , the outer periphery of the rubber seal extending only partially circularly . from the representations of fig1 and 18 , the behaviour of the tongue 113 and the action of the tongue 113 in the operating condition of the vacuum cleaner will be apparent . there is in question in this case in particular a vacuum cleaner having a so - called drag cover 116 , on which a suction tube 117 is provided . in regard to the features of the vacuum cleaner in detail , reference is made for example to ep - a - 25 32 057 , the content of which is herewith incorporated fully in the disclosure of the present application , also for the purposes of inclusion of such features in the claims . the suction tube 117 penetrates the openings 103 and 109 as well as the openings of the layers of the mounting plate 101 disposed between these openings . the dimensions of the openings and in particular the dimension of the tongue 113 are determined in relation to the diameter of the suction tube 117 in such a way that a folding of the tongue 113 into the interior of the dust bag is achieved . the tongue 113 engages however completely over the seal 111 -- and furthermore extends radially inwards -- and abuts in a fully engaging manner against the suction tube 117 . on withdrawal of the suction tube 117 from the mounting plate 101 of the dust filter bag , there remains because of the bending of the tongue 113 which has taken place , a definite pre - stress in the inward direction and a corresponding action of the tongue 113 on the rubber seal 111 . this has the result that the rubber seal 111 does not in any way extend upwardly towards the opening 103 and thus the closure member v may be moved into a closed disposition without any further action . in the closed condition , the closure member v runs onto the tongue 113 on its upper side , with reference to a representation in accordance with fig1 . referring to fig1 and 20 , there is shown in partial cross - section , a receiver 118 for a dust filter bag . in regard to the dust filter bag , there is to be seen in detailed cross - section , a mounting plate 101 , as already described above . the vacuum cleaner or the receiver 118 comprises a solid plate 119 , which has the suction tube 117 already discussed in addition , an actuation projection 120 is to be seen , which has a nose 121 , by which the projection acts on the closure member v of the dust filter bag . the actuation projection 120 is displaceable in a receiver 122 against the force of a spring 123 , in addition , the closure pusher 120 is directly connected to the closure plate 119 by means of a strap 124 . in particular , the connection point 125 for the strap 124 is provided on the underside of the closure plate 119 , close to a pivot joint 126 . for the position shown in fig1 , in which the actuation pusher 120 only rests on the mounting plate 101 of the dust filter bag , the strap 124 is in an unloaded condition . it still has a certain increment of length , which may be used . for the position shown in fig2 , a pivoting movement of the closure plate 119 has been initiated , so that this pivots about the axis of the joint 126 towards the mounting plate 101 for the dust filter bag . during this movement , the relative position of the actuation projection 120 with respect to the mounting plate 101 initially remains unchanged . the actuation projection 120 moves only a little against the spring force of the spring 123 into the actuation projection receiver 122 . this movement may continue until such time as the strap 124 is stretched . this stretching occurs before the maximum amount of inward travel of the actuation projection 120 into the receiver 122 has been used up . as soon as the strap 124 is stretched , a dragging away of the actuation projection 120 is introduced by any further pivoting of the closure plate 119 about the axis of the joint 126 , so that this projection 120 pivots by means of the receiver 122 , into a closed disposition about its joint arrangement 127 relative to the closure plate 119 , which is located on the underside of the closure plate 119 . in this way , there is prevented any further increase in the force applied by the actuation projection 120 to the mounting plate 101 for the dust filter bag . in addition , reference is also made to the unpublished contents of german patent application no . 43 41 248 for the general construction of the receiver and the closure plate and the actuation projection . alternatively , which however is not illustrated in detail , supports may also be formed on the actuation projection 120 at the side , i . e . perpendicular to the plane of the drawing . these supports may come for example into abutment against the inner periphery 128 of the receiver 118 for the dust filter bag . by a suitable relationship between the overall length of the actuation projection 120 and the arrangement of the supports , it may be achieved not only that the nose 121 of the actuation projection 120 comes into abutment against the mounting plate 101 for the dust filter bag , but also that on the described pivoting of the closure plate 119 , the resulting increased force in the course of the linear resilient compression of the actuation projection 120 is taken up by the abutment edge 128 . the receiver edge 128 or the supports which are formed on the sides of the actuation projection 120 , may then in particular also be so formed that they slide on one another with the least possible frictions for a further embodiment , a closure plate 219 having a suction connection 217 is pivotably mounted in known manner by way of a pivot joint 226 relative to a vacuum cleaner housing 202 . an actuation projection 220 on a plate 221 is pivotably mounted by way of a hinge 222 at the free end of the closure plate 219 . an expansion spring 233 is located at the axis 227 of the hinge 222 , which abuts against the underside 237 of the closure plate 219 by means of a loop 234 , the loop matching the annular shape of the suction connection 217 and enclosing this connection . by virtue of the force of the expansion spring 233 , when the closure plate 219 is opened , the plate 219 and the plate 221 take up a narrow v shape . the angle of opening of this v shape is limited by abutment of a nose 224 formed in the shape of an l against this connection 217 , the nose adjoining an oval aperture 223 for the connection 227 , see fig2 . the suction connection 217 is provided with a flap valve 205 at its free end , which prevents the falling back of dust and dirt arising out of the inverted disposition of the dust filter bag 208 in the operating configuration . there is in question in this regard a membrane reinforced by ribs , which is simply riveted in place at a pin 218 . the plate 221 pivotably mounted on the underside 237 of the closure plate 219 carries an actuation projection 220 mounted for displacement against the force of two springs 228 , 229 . in the extended disposition , the contour line of the plate 221 with extended actuation projection 220 corresponds approximately to the contour shape of the closure plate 219 or that of the inner side of the filter frame 213 receiving the closure plate 219 and plate 221 . this means that the actuation arm 225 has approximately the same width as the plate 221 . at its free end , the actuation arm 225 carries an actuation nose 216 , slightly displaced off centre , which nose moves a closure member v of a mounting plate 201 for the dust filter bag 208 along with the nose in the manner described above . the mounting of the actuation projection 220 on the plate 221 is explained in more detail with reference to fig2 to 26 . the plate 221 has perpendicularly extending shanks 230 , 231 on which the the actuation projection 220 is mounted at its sides , the shanks being connected at their free ends by means of a bar 232 at the opposite end from the axis 227 . the actuation arm 225 of the actuation projection 220 is guided between the underside 235 of the plate 221 and the bar 232 . a retaining nose 236 abuts against the bar 232 on extension of the springs 228 , 229 and prevents the arm from being withdrawn . the springs 228 , 229 are mounted in channels 238 , 239 of the actuation projection , the channels being formed to be u - shaped in cross - section . the free shank ends of the channels 238 , 239 lie against the underside 235 . for better guidance of the actuation projection , there extend from the free shanks 230 , 231 of the plate 221 , projections 240 , 241 , so that the channels 238 , 239 are provided between these projections and the underside 235 . in the longitudinal direction , each channel 238 , 239 is closed at one end by a wall , against which the springs 228 , 229 abut . the opposite longitudinal end is open and the springs 228 , 229 there abut against counterbearings 242 , 243 secured to the plate . when the dust filter bag 8 is closed , the actuation projection 220 is initially pushed in the direction of the aperture 223 against the force of the springs 228 , 229 . the aperture 223 is thus located between the channels 238 , 239 , and the actuation arm 225 connecting the channels 238 , 239 may therefore have a rounded shape 244 . for limiting the displacement of the actuation projection 220 towards the aperture 223 , abutments 246 are provided on the wall 245 of the nose 224 , against which the end face of the rounded portion 244 of the actuation projection 220 engages . the mounting plate 201 with the closure member v is formed substantially in accordance with the preceding embodiments . it has here however a handling projection for the spade handle 260 in the form of an attachment 261 , see fig2 , which is connected to the uppermost layer of the mounting plate 201 , this layer forming the top . the width of the attachment 261 corresponds to somewhat less than the width of the slit in the uppermost layer of the mounting plate 201 , see in this connection also fig9 which is necessary for the actuation of the closure member v . the actuation nose 216 of the actuation projection 220 projects in the direction of movement , towards the angular space formed by the upper side of the spade handle 260 and the longitudinal side of the attachment 261 , so that a counterbearing is found . as an alternative to the attachment , a recess may also be provided . on pivoting the closure plate 219 inwardly out of the position shown in fig2 into the position according to fig2 , the plate 221 and the actuation projection 220 abut against the underside 237 of the closure plate 219 , if the mounting plate 201 is missing and there is therefore maintained the v disposition between the closure plate 219 and the plate 221 and the actuation projection 220 , it is not possible to close the closure plate 219 . registration projections 203 , 204 on the plate 221 , formed by a widening opposite to the free end of the plate 221 and the actuation projection 220 , move on maximum pivoting into registration receiving portions 206 of inwardly projecting receivers 207 on the filter frame 213 . thus closure of the vacuum cleaner is also only possible when a filter bag 208 has been introduced . in closed condition , see fig2 , 29 , the closure plate 219 is latched by retaining noses 209 penetrating apertures 210 in the closure plate 219 . the retaining noses 209 may project from a sealing edge 212 , which is provided in free standing manner at an angle 211 of the filter frame 213 at least over the longitudinal extent of the filter frame 213 . in the closed condition , a peripheral sealing lip 214 on the outer side of the closure plate 219 comes into sealing abutment against the flat inner side of the sealing edge 212 . also in the case of this embodiment , as already described , a connection of the actuation projection 220 to the closure plate 219 may be effected , for example by means of a flexible , stretchable connecting means , so that in the course of compression of the actuation projection 220 , simultaneous pivoting of the actuation projection 220 is initiated .

US-65260296-A

a compress / melt waste processor includes a frame ; a chamber housing havingalls which define a chamber therein ; a ram movably disposed in the chamber ; a sensor which senses pressure applied by the ram ; an actuator operatively connected to the ram to move the ram ; a chamber hatch upon which the housing is mounted , the chamber housing walls , the ram and the chamber hatch defining a space therebetween ; and a device for feeding contaminated plastic waste into the chamber . the apparatus also includes a device for heating the housing walls , the ram and the chamber hatch ; a device for cooling the housing walls , the ram and the chamber hatch , a device for detecting temperature of the housing walls , the ram , the chamber hatch and the contaminated plastic waste in the chamber ; and a control device for controlling the actuator and the heating and cooling devices . the control device activates the actuator so that the ram applies pressure to the contaminated plastic waste and also activates the heating device such that pressure and heat are concurrently applied to the plastic waste until the plastic waste reaches a predetermined temperature . the control device also activates the cooling device when a predetermined temperature has been reached in order to cool the heated plastic waste . a method incorporating the functional features of the apparatus produces an end product which is in a sanitary inert form such that it can be stored for a long period of time without creating a health hazard .

in fig1 the compress / melt plastic waste processor 1 is shown as including a frame assembly 3 which supports all of the other components of the compress / melt plastic waste processor 1 . a compress / melt chamber housing 5 is disposed on top of a chamber hatch 7 to define a chamber 9 between the walls 11 of the compress / melt chamber housing 5 and the chamber hatch 7 . chamber 9 has an open end 12 through which mixed plastic waste contaminated with , for example , food , oil , metal and other non - plastics , can be placed in chamber 9 . a compaction ram 13 is operably connected to a linear actuator 14 such that the actuator 14 can move the compaction ram 13 within the chamber 9 . thus , the compaction ram 13 can be moved into contact with the contaminated mixed plastic waste in the chamber 9 in order to compress / compact the contaminated mixed plastic waste against the chamber hatch 7 thereby forming a slug 15 ( densely packed contaminated plastic waste ) out of the contaminated mixed plastic waste . all of the outer surfaces of the slug 15 are forced against corresponding inner surfaces 16 , 17 , 18 which are respective inner surfaces of the chamber housing walls 11 , the compaction ram 13 and the chamber hatch 7 . the actuator 14 could , for example , be a hydraulic cylinder , a pneumatic cylinder , ball screws , or some other mechanical or electro - mechanical actuator . the walls 11 of the compress / melt chamber housing 5 , the compaction ram 13 and the chamber hatch 7 are all controllably heated by heat sources 19 which can be embedded or clamped in place on each of the aforementioned structures . heat sources 19 may be any appropriate heating device capable of heating walls 11 , compaction ram 13 and the chamber hatch 7 as , for example , conventional electric resistive heating elements . in fig1 the heat sources 19 are shown as being embedded in place . the heat sources 19 could also be in the form of a heat blanket . alternatively , instead of using electric resistive elements , rings or tubes , having steam or heated fluid therein , can be disposed around or formed in the chamber housing walls 11 , the compaction ram 13 and chamber hatch 17 . the steam or heated fluid would be heated by a conventional external source and continually circulated to perform the required heating . control of the heating of the walls 11 , the compaction ram 13 and chamber hatch 7 can either be manual or automatic . in fig1 a controller 21 , such as a computer , is operatively connected to thermocouples 23 , 25 and 27 which continually send a signal , representative of the temperature of the structure in which they are embedded , to the controller 21 . alternatively , resistive temperature devices ( rtu &# 39 ; s ) or other appropriate temperature sensing devices can be used instead of or in combination with thermocouples 23 , 25 and 27 . the controller 21 which is connected to the heat sources 19 can be programmed to turn the heat sources 19 on and off depending on whether the signals from the thermocouples 23 , 25 and 27 are above or below a predetermined value . in this manner , the temperature of the walls 11 , compaction ram 13 and chamber hatch 7 are controlled . in a manual mode , the temperature readings from the thermocouples 23 , 25 , 27 could be displayed on a monitor ( not shown ) such that an operator could turn power to the heat sources 19 on and off based on the temperature readings . an additional thermocouple 29 can be passed through an opening 31 in compaction ram 13 and secured in place so that it extends outward from inner wall 17 and into slug 15 . thermocouple 29 is operatively connected to controller 21 and provides a signal thereto which is indicative of the approximate temperature at the center of slug 15 . the compaction ram 13 , compress / melt chamber walls 11 , and chamber hatch 7 are all heated during the operation of the compress / melt plastic waste processor as discussed in more detail below , in order to ensure that all of the outer surfaces of the slug 15 which contact a corresponding one of the inner surfaces 16 , 17 , 18 are all melted during heating . it is to be noted that upon the melting and subsequent cooling of the plastic waste material within the compress / melt plastic waste processor , the slug 15 is formed with a final hardened shape . the cross - sectional shape of the compaction ram 13 , the compress / melt chamber housing 5 and the chamber hatch 7 will determine the final shape of the slug 15 . the cross - sectional shape of these components can , for example , be oval , cylindrical , triangular , rectangular or any other desired shape . the geometry of the top and bottom faces of the slug will be determined by the faces of the compaction ram 13 and the chamber hatch 7 . thus , the compaction ram 13 and the chamber hatch 7 can be manufactured , for example , to produce flat or cup shaped slugs . in order to more fully understand the claimed invention , the operation of the apparatus will be described with reference to fig2 - 7 . with respect to the figures , fig2 and 3 show the apparatus in an initial feed step , fig4 shows the apparatus in a compress step , fig5 shows the apparatus in a compress / melt step , fig6 shows the apparatus in a cooling step , and fig7 shows the apparatus in an ejection step . in fig2 the linear actuator 14 has been operated to retract the compaction ram 13 out of chamber 9 . this allows the plastic waste feed 33 to be placed in the chamber 9 via the open end 12 in the top of the compress / melt chamber housing 5 . in fig3 a second embodiment is shown in which the compaction ram 13 has been retracted by the linear actuator 14 above an opening 35 in one of the walls 11 of the compress / melt chamber 5 . thus , the plastic waste feed 33 is inserted into the chamber 9 via the opening 35 . a chute 36 is shown as a means for feeding the plastic waste feed 33 into opening 35 . however , any conventional feeding means could be used including manual feeding . as shown in fig4 once a certain amount of plastic waste feed 33 has been placed in the chamber 9 , the compaction ram 13 is lowered by the linear actuator 14 in order to compress the plastic waste feed 33 into a slug 15 . this compression step is performed without any heat being applied to the chamber hatch 7 , the compaction ram 13 , and the chamber / melt chamber walls 11 . the feed and compress steps of fig2 , and 4 are repeated as required until a slug 15 is produced of a desired thickness and at a desired pressure . that is , the plastic waste feed 33 is compressed until a preferable compaction pressure of approximately 40 to 50 psi ( 275 - 345 kpa ), is achieved . the actuator 14 is operatively connected to the controller 21 . in addition , a means for sensing the compaction pressure , such as a strain gauge 37 mounted on a piston rod 39 , is also connected to the controller 21 . the controller 21 can then control the actuator 14 and the applied pressure based on feedback from the strain gauge 37 . a load cell or other known pressure measuring device may be used in place of or in combination with strain gage 37 . alternatively , when actuator 14 is a hydraulic or pneumatic actuator , compaction pressure sensing can be achieved by monitoring the hydraulic pressure or air pressure therein . once a sufficient amount of plastic waste feed has been introduced into the compress / melt chamber housing 5 in order to produce a slug 15 at the desired thickness and desired compaction pressure , the compress / melt step as shown in fig5 begins . during this step , heat is applied to the compaction ram 13 , the compress / melt chamber 5 and the chamber hatch 7 via the heat sources 19 . the respective inner surfaces 16 , 17 and 18 of the walls 11 , compaction ram 13 and chamber hatch 7 must be heated to a temperature sufficient to melt the bulk of the plastic waste and to boil off any liquid trapped on the plastic waste , but must not be high enough to ignite any of the plastic waste nor produce any hazardous fumes associated with the burning of the waste . a temperature range of approximately 325 ° f . to 350 ° f . ( 163 °- 177 ° c .) is preferable in that it is sufficient to melt the major constituent , polyethylene , of the typical navy ship and municipal plastic waste stream and to drive the thermal conductivity required to heat the entire slug 15 . moreover , as the temperature gets closer to 400 ° f ., the burning of oils and paper will produce smoke while the burning of teflon , polyurethanes and polyvinyl chlorides will produce hazardous fumes . as the heat is being applied , the linear actuator 14 concurrently moves the compaction ram 13 thereby compressing the slug 14 to an even thinner thickness . at a point when the contaminated plastic waste begins to soften due to the heat and compaction pressure , the compaction pressure can be reduced ( though it is not necessary ) to approximately 20 psi ( 140 kpa ). the reduction in pressure helps to prevent the melted plastic from being forced into the gap 41 which exists between the compaction ram 13 and the walls 11 of the compress / melt chamber 5 . the prevention of melted plastic from entering gap 41 is important because during this process , it is desirable to heat all of the slug 15 to a point where all of the moisture contained therein is evaporated . the time required to get heat to the center of the slug 15 is dependent on the temperature of all of the heated surfaces 16 , 17 , 18 and on the distance from the heated surfaces 16 , 17 , 18 to the center of the slug 15 . increasing the compaction force by the actuator 14 and the compaction ram 13 compresses the slug 15 thereby reducing the distance to the center of the slug . however , if excessive compaction force is used , the melted plastic would fill the gap 41 . if the gap 41 is filled by melted plastic , any steam generated by the heating of the slug 15 has no means to escape from chamber 9 in order to allow the slug 15 to dry . moreover , if melted plastic enters the gap 11 , it will solidify therein during the below described cooling step . this will produce &# 34 ; flashing &# 34 ; around the edges of the finally formed slug 15 which makes it more difficult to remove slug 15 from chamber 9 and to stack the slugs 15 during their subsequent storage . the compress / melt step continues until the temperature at the center of the slug 15 exceeds the boiling point of water , at which time almost all of the moisture in the plastic waste should be evaporated . the compress / melt step is further continued to a point where the slug is surrounded by a minimum of a quarter of an inch of a melted plastic layer . the melted plastic layer is measured as extending from all of the inner surfaces 16 , 17 , and 18 . in a typical navy mixture of plastic waste which is primarily made up of polyethylene , polypropylene , polystyrene , and food contaminates , the melted plastic layer encapsulates any unmelted plastic , food and non - plastic materials , including metal pieces , which may be part of the waste . once the compress / melt step has been completed , a cooling step commences . as shown in fig6 cooling tubes 43 are disposed around chamber walls 11 , compaction ram 13 , and chamber hatch 7 , and supplied with cooling water or cooling oils in order to cool the respective components about which they are disposed . the cooling tubes 43 can be mounted to the outside of the component being cooled such as shown in fig6 for the compaction ram 13 and the chamber walls 11 , or can be integrally formed within a component as shown for chamber hatch 7 . the circulation of the cooling fluid is conventional and will not be further described . however , the controller 21 can be used to control the flow of fluids by being connected to , for example , a solenoid valve . additional cooling techniques such as using forced air or simply allowing cooling to take place passively can be used in lieu of the cooling tubes . during the entire cooling process , the compaction ram 13 continues to actively compress the slug 15 . cooling continues until the core of the slug is below 212 ° f . ( 120 ° c .) so that if there is any remaining steam , it is condensed thereby preventing any steam explosions when the slug 15 is subsequently ejected from the compress / melt chamber . moreover , the slug 15 is not ejected from the compress / melt chamber until the surface of the slug 15 is cooled to a point where the melted plastic layer has hardened and has the majority of its stiffness , thereby preventing the slug from deforming during or after ejection . in the typical mix of plastics used by the navy as discussed above , experience has shown that when the temperature of the inner surfaces 16 , 17 and 18 have cooled to approximately 140 ° f ., the required slug stiffness has been achieved . at this point in time , the entire slug 15 has a hardened plastic covering formed from the cooled melted layer . as shown in fig7 the chamber hatch 7 is slidably mounted on the frame 1 and can be moved from a position directly below the compress / melt chamber 5 in order to permit the linear actuator 14 to move the compaction ram 13 to eject the end product slug 15 from the compress / melt chamber housing 5 . the compress / melt chamber housing 5 can be securely mounted to the frame 3 or movably mounted thereto . in the situation where the compress / melt chamber housing 5 is fixably mounted in place , it could for example , have wedged grooves therein which receive corresponding wedges on the chamber hatch 7 so that when the chamber notch 7 is slid into place directly below the compress / melt chamber housing 5 , the compress / melt chamber housing 5 and chamber hatch 7 are securely connected to each other . the movement of the chamber hatch 7 beneath the compress / melt chamber 5 could be manually accomplished or can be accomplished through the use of a linear actuator . if the compress / melt chamber 5 is movably mounted to the frame 3 , the tongue and groove arrangement between the compress / melt chamber 5 and the chamber hatch 7 can be eliminated and , for example an additional linear actuator could be connected to the compress / melt chamber housing 5 and the frame 3 in order to move the compress / melt chamber housing 5 into and out of contact with the chamber hatch 7 . the vertical apparatus structure shown in the figures could be inverted or could also be horizontally oriented . in either of these configuration the chamber hatch 7 could be hingedly mounted to the compress / melt chamber housing 5 in a conventional manner such that it opens and closes as a door . in a preferred embodiment , the respective inner surfaces 16 , 17 , 18 , of the compress / melt chamber housing walls 11 , the compaction ram 13 and the chamber hatch 7 are smooth thermally conductive surfaces such as , for example , hard polished aluminum , which helps to prevent the slug 15 from sticking thereto . in another embodiment , the hard polished aluminum may be anodized . however , additional conventional non - stick surfaces or coatings can be used in lieu thereof . the above - discussed method and apparatus for processing plastic waste offers simplicity in design . in its simplest form , the inventive apparatus incorporates only two moving parts , the compaction ram 13 , and the chamber hatch 7 . the controls required to operate the inventive apparatus are only temperature controls for the heat sources 19 and a force pressure control for the linear actuator 14 . the inventive process has a very high tolerance to variations in plastic waste content . the process works just as well for mixed plastic waste with non - plastic mixed in , as for a clean and pure plastic infeed as required for devices such as extruders . the inventive process greatly increases the infeed plastic waste density such that a 30 to 1 reduction in volume is obtained . thus , the plastic waste can be efficiently stored and cost effectively transported commercially for recycling or disposal . moreover , any food waste in the plastic waste feed stream is dehydrated during the heating of the slug thereby providing a product that can be stored for extended periods of time without any sanitation problems . furthermore , the slug contains any unsanitary items within its plastic covering . no other conventional method for handling plastic waste combines the simplicity of the instant design with the ability to produce dense slugs of plastic waste that are suitable for long term sanitary storage . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details , and representative devices , shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents . for example , while the preferred embodiment is directed toward a mix of plastic waste typically encountered in a navy environment , the apparatus and method can be modified to work on other plastic mixes by adjusting the temperatures and pressures used . additionally , a conventual shredding device can be added to the apparatus to shred the contaminated plastic waste prior to feeding the waste into the chamber . the shredder permits large objects to be reduced in size so that they do not prevent compaction of the plastic waste . such modifications are well within the ability of those skilled in the art without requiring undue experimentation .

US-12841093-A

disclosed is a door catch that can help to prevent door sag , especially for heavy or tall residential or commercial doors , and provides for post - installation catch tension adjustment without removal or adjustment of mounting members . in one aspect , the door catch can include a ball catch base , a threaded ball plunger assembly , a catch bumper , and a bumper base . in another aspect , the catch bumper and the bumper base can optionally be combined into a single catch bar bracket . the ball plunger assembly is adjustably mounted within a threaded aperture of ball catch base . a ball captive in one end of the ball plunger assembly engages a detent in the catch bumper , or catch bar bracket , providing friction to hold the door open . the position of the ball plunger assembly can be adjusted vertically to increase or decrease the tension between the detent and the ball plunger assembly .

the following description is made with reference to figures , where like numerals refer to like elements throughout the several views , fig1 shows a door catch 10 of the present disclosure mounted near the top of a door 11 and corresponding wall 13 . fig2 shows a portion of fig1 detailing the door catch 10 in relation to the door 11 and corresponding wall 13 . fig3 shows a portion of the door 11 in the open position where the catch portions are separate and not engaged . referring to fig2 - 3 , the door catch 10 of fig2 includes a catch bar bracket 15 secured to the door and a ball catch base 17 secured to the wall . referring to fig3 , the catch bar bracket 15 includes a detent 19 in the lower surface of the catch bar portion of the catch bar bracket 15 . the door catch 10 holds the door 11 in place through friction . when the door 11 is in the fully open position , the detent 19 aligns a ball plunger assembly 21 in order to create a friction force that holds the door open . one of the utilities of the door catch 10 of this disclosure is the ability to adjust the frictional force that holds the door in place without removing or moving the catch bar bracket 15 or ball catch base 17 . the friction between the ball plunger assembly 21 and the detent 19 can be adjusted by moving the ball plunger assembly 21 up and down relative to the top of the ball catch base 17 . the ball plunger assembly 21 is shown from the bottom with a slot 27 for engaging a screwdriver or similar tool for adjusting the height of the ball plunger assembly 21 relative to the ball catch base 17 . in fig1 - 3 , the catch bar bracket 15 and ball catch base 17 are shown as mounted between a door 11 and a wall 13 . it should be understood by the reader , that in fig1 - 3 , and throughout this disclosure , that the catch bar bracket 15 and ball catch base 17 can be mounted between the door 11 and other mounting surfaces that can be intersected by a door when open ; for example , a folding door panel . fig4 shows the door catch 10 of fig1 in top perspective view showing the relationship between the catch bar bracket 15 and the ball catch base 17 when frictionally engaged ; for example , when the door 11 is open and proximate to the wall 13 . fig5 shows a sectional view of the door catch 10 of fig4 shown along section lines 5 - 5 . referring to fig4 - 5 , the catch bar bracket 15 and ball catch base 17 are secured respectively to the door 11 and wall 13 by apertures 23 and corresponding threaded fasteners 25 through the apertures 23 through the surface of the catch bar bracket 15 and the ball catch base 17 . the catch bar bracket 15 and the ball catch base 17 need to be mounted in a way to withstand the rotational torque of the door 11 with respect to its hinges in order prevent the door 11 from sagging over time . one way to assure this is to provide mounting holes where the fastener is mounted in fixed mounting holes without any possibility for vertical or horizontal movement within the hole . as an example , the apertures 23 in fig4 - 5 are round and countersunk . in fig5 , the ball plunger assembly 21 is shown threaded into the ball catch base 17 and can be rotated to increase or decrease friction between the ball plunger assembly 21 and the catch bar bracket 15 . a slot 27 is provided to engage a screwdriver or other similar tool . when the ball plunger assembly 21 is rotated upward into the ball catch base , the friction between the ball plunger assembly 21 and the catch bar bracket 15 is increased . as the ball plunger assembly 21 is rotated downward out of the ball catch base , the friction between the ball plunger assembly 21 and the catch bar bracket 15 is decreased . the door 11 is illustrated in fig5 as being made of wood . the wall 13 is illustrated as having a drywall outer surface with the threaded fasteners 25 engaging drywall anchors or the like . the door catch 10 can be mounted on most common commercial or residential door materials . for example , the door material can be steel , steel over foam core , metal , wood , or fiberglass framed - glass . fig6 shows a top perspective exploded view of the ball catch base 17 and the ball plunger assembly 21 of the door catch of fig4 . fig7 shows a top assembled view of the ball catch base 17 and ball plunger assembly 21 of fig6 . fig8 shows a sectional view of the fig7 shown along section lines 8 - 8 . fig9 shows a front view of the ball catch base 17 and ball plunger assembly 21 of fig7 . fig1 shows a bottom view of the ball catch base 17 and ball plunger assembly 21 of fig7 . referring to fig6 - 10 , a bumper 29 is shown optionally attached to the ball catch base 17 . depending on the whether the ball catch base 17 is secured to the door 11 , wall 13 of fig1 for example , or a doorframe , the bumper 29 can be used to protect the opposing surface from damage . the bumper 29 can be made generally of a pliant material such a soft plastic or an elastomer such as silicone rubber or butyl rubber . those skilled in the art will readily recognize materials suitable for the bumper 29 . referring to fig6 , the ball catch base 17 is illustrated in the shape of a bracket . the ball catch base 17 includes a base portion 31 that when mounted to a wall or door projects approximately perpendicularly away from the door . if the door is mounted vertically , as in the door 11 illustrated in fig1 - 3 , then a top surface 33 of the base portion 31 lies substantially in the horizontal plane . the ball catch base 17 includes a mounting portion 35 that lies in the same plane as the mounting surface of the door , wall , or doorframe . the mounting portion 35 projects approximately perpendicularly away from the plane of the top surface 33 of the base portion 31 of the ball catch base 17 . while the mounting portion 35 is shown projecting upward from the base portion 31 , the mounting portion 35 can optionally be constructed to project both upward and downward with respect to the base portion 31 for additional support . fig6 - 10 all show the mounting portion 35 in various views . fig6 , 8 , and 9 show the apertures 23 for mounting the ball catch base 17 to the wall or door in relation to the mounting portion 35 . fig6 and 8 shows the apertures 23 as countersunk . as previously described , the aperture 23 is shaped so that threaded fastener 25 of fig4 - 5 is fixed in position without the opportunity to slide or move under the downward torque of the open door . fig6 shows a threaded aperture 37 sized and threaded to receive the ball plunger assembly 21 . fig8 shows the ball plunger assembly 21 threaded inside the threaded aperture 37 . the ball plunger assembly 21 can be moved up and down with respect to the top surface 33 of the base portion 31 of the ball catch base 17 by rotationally engaging the slot 27 with a screwdriver or similar tool . referring to fig6 - 9 , the ball plunger assembly 21 includes a tension ball 39 . referring to fig8 - 10 , the ball plunger assembly 21 includes a tool - engaging plunger base 41 with a slot 27 or other shape for engaging a tool in rotational motion . fig1 shows , in top view , the ball plunger assembly 21 of the door catch 10 of fig4 . fig1 shows a cross sectional view of the ball plunger assembly 21 of fig1 taken along section lines 12 - 12 . fig1 shows a side view of the ball plunger assembly 21 . fig1 shows a bottom view of the ball plunger assembly 21 . fig1 - 13 show the tension ball 39 . the tension ball 39 is shown in cross section in fig1 . the tension ball 39 generally has a circular profile or spherical shape . other shapes can be used to produce specific frictional profiles . for example , an elliptical shape with the top of the tension ball 39 along the major axis of the elliptical shape , assuming uniform deformation of the tension ball 39 , the force at the point of contact with the detent 19 of fig3 would tend to be concentrated over less of an area than a tension ball 39 that is spherically shaped . the door would tend to release more abruptly as the force of friction would be overcome over less surface area than the tension ball 39 of spherical shape . similarly , an elliptical shape with the top of the tension ball 39 along the minor axis of the elliptical shape , assuming uniform deformation of the tension ball 39 , would tend to release less abruptly than a tension ball 39 with a corresponding spherical shape . fig1 shows the internal construction of ball plunger assembly 21 including the tension ball 39 , the threaded ball plunger body 43 , tool - engaging plunger base 41 , and the slot 27 . the ball plunger assembly 21 is similar in construction to spring plungers used in the art for positioning fixtures , punch presses , or forging dies . the tension ball 39 is typically installed through the top opening using a plunger wrench . the plunger wrench typically includes projections that are complementary to rectangular insertion points 45 shown in fig1 . referring again to fig1 , the ball plunger assembly 21 includes a spring 47 . the spring provides compression force , and thereby holding friction , when the tension ball 39 makes contact with the detent 19 of fig3 . in fig1 - 14 , the ball plunger assembly 21 , when rotated , moves linearly as an integrated unit within the threaded aperture 37 of ball catch base 17 of fig6 . the slot 27 of the tool - engaging plunger base 41 is a typical tool - engaging screw drive . alternatively , other tool - engaging screw drives may be used , for example , phillips , frearson , cross , robertson ( square shaped ), allen ( hex shaped ), torx , or ttap , as long as they are able to engage the ball plunger assembly 21 with sufficient force and grip to prevent stripping . fig1 shows a front top perspective view of the catch bar bracket 15 of the door catch 10 of fig4 . fig1 shows a front bottom perspective view of the catch bar bracket 15 . fig1 shows a top view of the catch bar bracket 15 . fig1 shows a sectional view the catch bar bracket 15 of fig1 taken along section lines 18 - 18 . referring to fig1 - 18 , the catch bar bracket 15 includes an integrated catch bar / base 49 and a mounting portion 51 . the mounting portion 51 projects approximately perpendicularly away from integrated catch bar / base 49 . in fig1 - 16 and 18 , the mounting portion 51 is shown projecting perpendicularly away from both above and below both the integrated catch bar / base 49 . with a typical vertically mounted door , wall , and doorframe , the mounting portion 51 would be oriented vertically and the integrated catch bar / base 49 would be projecting horizontally away from the door . the mounting portion 51 includes apertures 23 . the apertures 23 of the catch bar bracket 15 are round and countersunk to prevent any possibility of vertical or horizontal movement within the hole so as to withstand the rotational torque of the door 11 with respect to its hinges in order prevent the door 11 from sagging over time as previously described . fig1 and 18 show the detent 19 for frictionally engaging the tension ball 39 of fig1 - 14 . the detent 19 is shown having a circular profile that is complementary to the spherical shape of the tension ball 39 of fig1 - 14 . other arcuate shapes can be used to adjust the frictional force of engagement or disengagement . for example , given the same spherically shaped tension ball , an elliptical shaped with the center line along its minor axis would tend to more gradually disengage and engage but potentially provide a weaker frictional holding force than a comparable spherical shaped detent . fig1 shows a top view of a door catch 10 with alternative construction of the catch bar bracket 15 and alternative construction of the ball catch base 17 . fig2 shows a sectional view of the door catch 10 of fig1 taken along section lines 20 - 20 . fig1 - 20 show the alternatively constructed versions of the catch bar bracket 15 , ball catch base 17 , the ball plunger assembly 21 , and an alternatively shaped version of the bumper 29 , in engaged cooperation as previously described . a catch stop 53 projects downward from the catch bar bracket 15 and functions to horizontally limit the motion of the ball catch base 17 when frictionally engaged with the catch bar bracket 15 . the bumper 29 , here shown as hemi - spherically shaped , dampens the force between the catch stop 53 and the ball catch base 17 . fig2 shows a bottom view of the catch bar bracket 15 of fig1 . fig2 shows a bottom view of the ball catch base 17 of fig1 . fig2 shows in the detent 19 and the catch stop 53 . fig2 shows bumper 29 and the bottom of the ball plunger assembly 21 . the ball plunger assembly 21 is shown with the slot 27 for rotationally engaging the ball plunger assembly 21 , as previously described . fig2 - 38 show several configurations of door catches 10 where the catch bar is horizontally adjustable with respect to its mounting surface . this may be desirable when a specific distance between the open door and wall needs to be maintained . fig2 - 31 illustrate horizontal adjustment using a serrated catch bar and catch bar base with complementary serrations . fig2 shows a top perspective view of a door catch with a catch bar 55 and catch bar base 57 where the position of the detent 19 from the wall 13 or doorframe is adjustable . the ball catch base is shown secured to a door 11 . the detent 19 is shown in hidden lines . fig2 shows a cross sectional view of the door catch 10 of fig2 taken along section lines 24 - 24 with the catch bar base secured to the wall 13 and the ball catch base secured to the door 11 . the door 11 is illustrated as having a fiberglass or metal frame , and the wall including a wood member . as previously described , the door catch 10 can be mounted to most common residential door and wall materials . fig2 shows a cross sectional view of the door catch 10 of fig2 taken along section lines 24 - 24 with a spacer 59 . fig2 shows a top view of the catch bar 55 of fig2 . fig2 shows a bottom view of the catch bar 55 of fig2 . fig2 shows a side view of the catch bar 55 of fig2 . fig2 shows a top view of the catch bar base 57 of fig2 . fig3 shows a sectional view of the catch bar base 57 of fig2 taken along section lines 30 - 30 . fig3 shows a top perspective view of the catch bar base 57 of fig2 . referring to fig2 , the door catch 10 includes the ball catch base 17 previously described for fig6 - 10 , the catch bar 55 and catch bar base 57 . referring to fig2 - 28 , the catch bar 55 includes a detent 19 that frictionally engages the ball plunger assembly 21 ; the ball plunger assembly 21 is illustrated frictionally engaging the catch bar 55 in fig2 - 25 . the force of friction between the ball plunger assembly 21 and the catch bar 55 is adjustable by rotationally engaging the ball plunger assembly 21 causing it to move up or down depending on the direction of rotation as previously described . the distance between the catch bar base 57 and the ball catch base 17 can be adjusted by extending the catch bar 55 along the catch bar base 57 . a slot 61 , shown in fig2 , and 26 - 27 , can adjustably secure the position of the catch bar 55 relative to the catch bar base 57 . complementary serrations on the bottom surface of the catch bar 55 , shown in fig2 - 25 , and 27 - 28 , and the catch bar base 57 , shown in fig2 - 25 , and 29 - 31 ensure that the when secured , slippage may not occur between the catch bar 55 and catch bar base 57 under the forces exerted by the door . the threaded fastener 25 is illustrated in fig2 - 25 . fig2 - 30 show the threaded aperture 37 for receiving the threaded fastener 25 . the catch bar 55 of fig2 - 28 can be manufactured in different standard lengths to accommodate various distance ranges between the door and wall / doorframe . alternatively , a universal catch bar can be supplied that can be designed to be cut to length to accommodate a specific installation requirement . in fig2 a spacer 59 secured to the front of the catch bar base 57 to provide a bumper surface between the catch bar base 57 and the ball catch base 17 . the spacer 59 is shown secured to the catch bar base 57 by a threaded fastener 25 . the spacer 59 can similarly be secured by a spring - loaded snap fit fastener . fig3 - 31 show the mounting portions 51 projecting perpendicularly upwardly and downwardly away from the horizontal plane of the catch bar base 57 . as previously discussed , the mounting portion 51 includes apertures 23 . the apertures 23 of the catch bar bracket 15 are round and countersunk to prevent any possibility of vertical or horizontal movement within the hole so as to withstand the rotational torque of the door with respect to its hinges in order prevent the door from sagging over time as previously discussed . fig3 shows a top view of the door catch 10 alternatively constructed where the position of the detent from the door 11 or alternatively the wall is adjustable by a threaded rod 63 . fig3 shows a sectional view of fig3 taken along section lines 32 - 32 showing the door catch assembly in the catch position between the door 11 and wall 13 . fig3 shows a side exploded view of catch bar assembly 65 of fig3 showing the detent 19 in broken lines representing hidden lines . referring to fig3 - 34 , the catch bar assembly 65 includes the threaded rod 63 , a mounting base 67 , jamb nut 69 , and a catch bumper 71 . referring to fig3 , the mounting base 67 and the catch bumper 71 include a threaded aperture 37 for receiving the threaded rod 63 . the jamb nut 69 locks the threaded rod 63 in place once the distance is adjusted . the threaded rod 63 can come in a variety of standard lengths to accommodate specified distances between the door 11 and wall 13 of fig3 - 33 . optionally , a universal length version of the threaded rod 63 can provided and cut to length by the door installer . the ball catch base 17 of fig3 - 33 and the ball plunger assembly 21 of fig3 can be the same ball catch base 17 and ball plunger assembly 21 as previously described in fig6 - 10 . the apertures 23 of the mounting base 67 are round and countersunk to prevent any possibility of vertical or horizontal movement within the hole so as to withstand the rotational torque of the door with respect to its hinges in order prevent the door from sagging over time as previously discussed . fig3 shows a top view of the door catch 10 of alternative construction where the position of the catch bar detent from the wall or doorframe is adjustable by a rod and pin arrangement . fig3 shows a sectional view of the door catch 10 of fig3 taken along section lines 36 - 36 . fig3 shows a side exploded view of the catch bar assembly 65 of fig3 . fig3 shows a bottom exploded view of the catch bar assembly 65 of fig3 showing the detent 19 . referring to fig3 - 37 , the catch bar assembly 65 includes a non - threaded rod 73 , a mounting base 67 , holding pins 75 , and a catch bumper 71 . referring to fig3 , the mounting base 67 and the catch bumper 71 each include an aperture 23 for receiving the non - threaded rod 73 . each of the apertures 23 is indicated by broken lines . fig3 shows a series of apertures 23 in the non - threaded rod 73 and a corresponding apertures 23 in the mounting base 67 and the catch bumper 71 for receiving the holding pin 75 of fig3 . in fig3 , the holding pins 75 are inserted in place in the non - threaded rod 73 once the distance is adjusted . the non - threaded rod 73 of fig3 - 38 can come in a variety of standard lengths to accommodate specified distances between the door and the wall . optionally , a universal length version of the non - threaded rod 73 can provided and cut to length by the door installer . the ball catch base 17 of fig3 - 36 and the ball plunger assembly 21 of fig3 can be the same ball catch base 17 and ball plunger assembly 21 as previously described in fig6 - 10 . the apertures 23 of the mounting base 67 are round and countersunk to prevent any possibility of vertical or horizontal movement within the hole so as to withstand the rotational torque of the door with respect to its hinges in order prevent the door from sagging over time as previously discussed . the door catch of this disclosure may readily be adapted for use with a pivot door . fig3 shows an upper portion of a pivot door 77 in a partially open position in top front perspective view . an alternative version of the door catch 10 is shown mounted to the top of the pivot door 77 with respect to a doorframe 79 . fig4 shows a bottom view of the pivot door 77 , the door catch 10 of fig3 , the doorframe 79 , and the wall 13 with the pivot door 77 in the closed position . fig4 shows a bottom view of the pivot door 77 and door catch 10 of fig3 with the pivot door 77 in the open position and with the door catch 10 fully engaged . fig4 shows the pivot door 77 in relation to the doorframe 79 and the wall 13 . in fig3 - 40 , the door catch 10 includes a ball catch base 17 and a catch bar bracket 15 . the same ball catch base 17 can be used as previously described , for example , in fig6 - 10 , 23 - 25 , and 32 - 33 . using the same ball catch base 17 across multiple applications simplifies manufacturing , forecasting , and inventory management . fig4 - 46 shows the catch bar bracket 15 of fig3 - 40 in several views . fig4 shows the catch bar bracket 15 in a front perspective view , fig4 in front view , fig4 in side , and fig4 in bottom view . referring to fig4 - 45 the catch bar bracket 15 of fig3 - 40 includes a downward facing l - bracket portion 81 and a planar - back mounting portion 83 . the planar - back mounting portion 83 is shown with apertures 23 for mounting the planar back to doorframe 79 of fig3 - 41 . the apertures 23 of the catch bar bracket 15 of fig4 - 43 , and 46 are round and countersunk to prevent any possibility of vertical or horizontal movement within the hole so as to withstand the rotational torque of the door with respect to its hinges in order prevent the door from sagging over time as previously discussed . in fig4 the catch bar bracket 15 is shown secured to the doorframe 79 with threaded fasteners 25 . a metal stiffener plate 85 is shown to provide added support if needed . in fig4 - 45 , the bottom the downward facing 1 - bracket portion 81 includes the detent 19 for frictionally engaging the top of the ball plunger assembly 21 of fig4 . note that in fig4 , the ball plunger assembly 21 and the corresponding ball catch base 17 is mounted in the opposite direction as in fig6 - 10 . this reversible configuration allows the ball catch base 17 to be used in a variety of different applications . in fig4 , the ball catch base 17 is shown mounted to the door 11 with the mounting portion 35 facing downward . as in the other disclosed configurations , the ball plunger assembly 21 is rotationally adjustable from below . fig4 shows an alternative door catch in top perspective view mounted to the bottom of a door 11 and wall 13 . fig4 shows a sectional view of the door catch of fig4 shown along section lines 48 - 48 . referring to fig4 - 48 , the door is shown with the catch bar bracket 15 frictionally engaged with the ball plunger assembly 21 of the ball catch base 17 to hold the door open . the ball catch base 17 is shown with mounting portion extending perpendicularly upward and downward for additional support . this configuration allows the ball catch base 17 to be fully supported in either the upward facing or downward facing direction . in fig4 - 48 , where the door catch 10 is mounted at the bottom of the door , the slot 27 of the ball plunger assembly 21 is facing upward for easy adjustment with a screwdriver or the like from above . as the ball plunger assembly is rotated so it screws downward and into the ball catch base 17 , the ball plunger assembly 21 and catch bar bracket 15 become more frictionally engaged . as the ball plunger assembly is rotated so it screws upward and out of the ball catch base 17 , the ball plunger assembly 21 and the catch bar bracket 15 become less frictionally engaged . also shown in fig4 - 48 are the threaded fasteners 25 and aperture 23 for receiving the threaded fasteners 25 into either the door 11 or wall 13 . in fig4 , both the wall 13 and the door 11 are shown as wood . the door 11 or wall 13 can also be any combination of standard door and wall materials . for example , the wall 13 can be drywall , metal , or concrete or a fiberglass frame and the door can include a fiberglass or metal frame structure in addition to the illustrated wood structure . those skilled in the art will readily recognize other suitable door and wall materials . the door catch thus far described has been applied to frictionally hold a door in an open position . it may also be desirable to frictionally hold a door in a closed position . for example , local fire and safety codes may require certain exit door include a crash bar or “ panic bar ” where a simple push on the bar releases the door for easy egress during an emergency . many historical buildings require that their facade be maintained including the original doors and these may not suitable or adaptable for integration of a panic bar . in this situation it may be possible to adapt the door catch 10 described thus far to function in the closed position . for example by extending perpendicular brackets outward from the inside of the door and the wall to provide suitable mounting surfaces for the catch bar bracket 15 and ball catch base 17 while the door is in the closed position . a novel door catch has been described . it is not the intent of this disclosure to limit the claimed invention to the examples , variations , and exemplary embodiments described in the specification . those skilled in the art will recognize that variations will occur when embodying the claimed invention in specific implementations and environments . as an example , while the catch bar bracket is shown in specific examples mounted to a door and in others mounted to a wall , those skilled in the art will readily recognize from the disclosure that the catch bar bracket can be mounted on either the door or the wall in any of the examples . the same can be said for the ball catch base . in addition , various materials , for example , wood , metal , fiberglass , or drywall has been shown for the wall material in specific examples . similarly , various material variations have been shown for the door . it should be understood , that the choice of material is simply as an aid in understanding the broad scope for which the disclosed door catch can be utilized . in each example , any of the other disclosed materials as well as any standard material for commercial or residential door and wall construction can be used to mount the door catch . it is possible to implement certain features described in separate embodiments in combination within a single embodiment . similarly , it is possible to implement certain features described in single embodiments either separately or in combination in multiple embodiments . it is the intent of the inventor that these variations fall within the scope of the claimed invention . while the examples , exemplary embodiments , and variations are helpful to those skilled in the art in understanding the claimed invention , it should be understood that , the scope of the claimed invention is defined solely by the following claims and their equivalents .

US-201313960308-A

a hands - free system for connecting and disconnecting a tool from an adjustable length extension pole . the system includes first and second slidably interconnected elongated members , a tool - holding assembly releasably coupled to the second elongated member , and a locking assembly disposed between the first and second elongated members . the relative sliding of the first and second elongated members can be selectively restrained by rotating the first and second elongated members relative to one another . the tool - holding assembly can be disconnected from the second elongated member by sliding the first and second elongated members together .

referring initially to fig1 , the extension pole selected for illustration comprises a base member 20 and an extension member 22 . the base member 20 includes a base tube 24 having a proximal end 26 and a distal end 28 . the extension member includes an extension tube 30 having a proximal end 32 and a distal end 34 . proximal end 32 of extension tube 30 has an opening 36 for receiving base tube 24 . distal end 28 of base tube 24 is slidably received in extension tube 30 in a telescopically interfitting relationship . base tube 24 and extension tube 30 share a common longitudinal axis around which they are at least partially rotatable relative to one another . base tube 24 and extension tube 30 can be shifted relative to one another along the longitudinal axis between an extended position where the reach of the extension pole is maximized and a retracted position where the reach of the extension pole is minimized . base tube 24 and extension tube 30 are preferably composed of a relatively strong but light weight aluminum or synthetic resin material . base tube 24 and extension tube 30 each are preferably substantially hollow and present a round cross sectional area . base tube 24 and extension tube 30 are preferably configured to inhibit debris from entering the interior of the extension pole when base tube 24 and extension tube 30 are slidably intercoupled . most preferably , base tube 24 and extension tube 30 have substantially no openings in their external , exposed surfaces which would allow debris to enter the extension pole . proximal end 26 of base tube 24 presents an opening which is preferably enclosed by an end cap 38 . end cap 38 prevents debris from entering base tube 24 through the opening in proximal end 26 . a base grip 40 is preferably mounted on proximal end 26 . base grip 40 includes a fixed portion 42 and a slidable ( or compressible ) portion 44 . the interior surface of fixed portion 42 is fixedly secured to the exterior surface of base tube 24 by any means known in the art such as , for example , a flowable adhesive or two - sided tape . slidable portion 44 is shiftably disposed on the exterior surface of base tube 24 . slidable portion 44 preferably includes a plurality of ribs 46 which are capable of being deformed when a longitudinal force is applied to the terminal end of slidable portion 44 , as shown in fig2 . base grip 40 is preferably composed of a resilient , deformable , synthetic material . most preferably , base grip 40 is composed of foam rubber . as shown in fig1 , an extension grip 48 is mounted on proximal end 32 of extension tube 30 . extension grip 48 is fixedly secured to the outer surface of extension tube 30 by any means known in the art such as , for example , a flowable adhesive or two - sided tape . extension grip 48 can be composed of the same material used for base grip 40 . as shown in fig2 , when the extension pole is in the retracted position with base tube 24 being slid into extension tube 30 nearly as far as possible , the terminal end of slidable portion 44 contacts an opposing terminal end of extension grip 48 in an abutting relationship . as base tube 24 is further slid into extension tube 30 , the abutting relationship of slidable portion 44 and extension grip 48 forces ribs 46 of slidable portion 44 to be compressed and deformed , as illustrated in fig2 . the compression of slidable portion 44 provides a longitudinal force which resists further sliding of base tube 24 into extension tube 30 . as best seen in fig2 , an alignment member 50 is fixedly attached to distal end 34 of extension tube 30 . alignment member 50 is adapted to be received in a tool - holding assembly 52 . tool - holding assembly 52 includes a tube - receiving end 54 for receiving alignment member 50 and a tool - holding end 56 for holding a working tool element 58 . tool - holding assembly 52 includes an alignment notch 60 extending from the terminal end of tube - receiving end 54 towards tool - holding end 56 . alignment notch 60 is adapted to receive an alignment protrusion 62 which extends radially from alignment member 50 to thereby properly align extension member 22 and tool - holding assembly 52 and restrain relative rotation of extension member 22 and tool - holding assembly 52 when extension member 22 and tool - holding assembly 52 are coupled together . it will be appreciated that tool holding assembly 52 is preferably in the form of a handle so that the assembly and tool element cooperatively form a handheld tool that can be used apart from the extension pole . referring now to fig3 , a locking assembly 64 is coupled to distal end 28 of base tube 24 by any means known in the art . locking assembly 64 comprises a lock body 66 and a lock collar 68 rotatably coupled to the lock body 66 . lock body 66 presents a tapered end 70 for facilitating insertion of lock body 66 into distal end 28 of base tube 24 . lock body 66 further presents an outer securing surface 72 which is fixedly secured to the interior surface of base tube 24 . a circumferential eccentric slot 74 is formed in lock body 66 and defines an eccentric compression member 76 around which lock collar 68 is disposed . in fig3 , lock collar 68 is shown separate from lock body 66 , however , during normal operation lock collar 68 will reside in eccentric slot 74 and around eccentric compression member 76 . a ring 78 is disposed between eccentric slot 74 and securing surface 72 to restrain lock collar 68 from sliding onto base tube 24 . a sliding surface 80 is disposed next to lock collar 68 on the side opposite of ring 78 and prevents lock collar 68 from sliding off of lock body 66 . sliding surface 80 and the outer surface of ring 78 are adapted to fit flushly with an inner surface 82 of extension tube 30 and to be slidably received therein . tool - holding assembly 52 comprises a body 84 and a releasable catch 86 . releasable catch 86 is adapted to be received and secured within tube - receiving end 54 of body 84 . releasable catch 86 is fixedly secured in body 84 by any means known in the art such as , for example , compression - fitting an outer holding surface 88 of releasable catch 86 with an inner surface 90 of body 84 , as perhaps best seen in fig8 . referring again to fig3 , tool - holding end 56 of tool - holding assembly 52 can be coupled to working tool element 58 via an attachment device 92 . as shown in fig3 , tube - receiving end 54 of tool - holding assembly 52 is adapted to be coupled to extension tube 30 via alignment member 50 , a resilient latch 94 , and a latch - receiving opening 96 . alignment member 50 is fixedly secured to distal end 34 of extension tube 30 by any means known in the art . alignment member 50 includes projection 62 and an outer surface 97 . outer surface 97 is configured to fit generally flush within inner surface 90 of body 84 . when alignment member 50 is inserted into tube - receiving end 54 of body 84 , resilient latch 94 enters extension tube 30 and snaps into latch - receiving opening 96 , thereby securing tool - holding assembly 52 to extension member 22 . releasable catch 86 includes a guide 98 to guide resilient latch 94 through alignment member 50 and into extension tube 30 . releasable catch 86 also includes a lip 99 which presses against a front surface 100 of alignment member 50 when resilient latch 94 is secured in latch - receiving opening 96 to thereby prevent further insertion of releasable catch 86 into extension tube 30 . resilient latch 94 includes a sloped contact surface 102 which allows resilient latch 94 to be shifted between a latched position in which resilient latch 94 is substantially undeformed and a unlatched position in which resilient latch 94 is partially elastically deformed and flexed . moreover , the angle of surface 102 provides a cam that permits the tool to be automatically latched to the pole simply by inserting the alignment member 50 into the tube - receiving end 54 of assembly 52 . particularly , the contact surface 102 allows resilient latch 94 to be partially deformed during extension of resilient latch 94 through alignment member 50 and into extension tube 30 and then snapped into a latched position when resilient latch 94 is aligned with latch - receiving opening 96 . in an alternative embodiment ( not illustrated ), latch receiving opening 96 in extension tube 30 can be eliminated . in this configuration , the interior of alignment member 50 is formed with a suitable notch , rib , or ridge configured to receive resilient latch 94 and thereby secure tool - holding assembly 52 to extension member 22 . in order for resilient latch 94 to be received in the latch - receiving notch , rib , or ridge of alignment member 50 , distal end 34 of extension tube 30 is only partially received in alignment member 50 so that extension tube 30 does not cover or interfere with the latch - receiving notch , rib , or ridge formed on the inner surface of alignment member 50 . fig4 is a sectional view showing tool - holding assembly 52 secured to extension tube 30 by resilient latch 94 . in fig4 , resilient latch 94 is inserted into latch - receiving opening 96 in a latched position . fig4 illustrates that a front surface 104 of lock body 66 defines an inwardly projecting cavity 105 . fig5 illustrates resilient latch 94 being deformed by front surface 104 into an unlatched position . front surface 104 of lock body 66 is positioned into contact with contact surface 102 of releasable catch 86 by shifting base tube 24 into extension tube 30 until , as shown in fig2 , slidable portion 44 of base grip 40 is contacted with and deformed by extension grip 32 . thus , working tool 50 and tool - holding assembly 52 can be disconnected from extension member 22 by simply sliding base tube 24 into extension tube 30 until front surface 104 of lock body 66 causes resilient latch 94 to be removed from latch - receiving opening 96 and pushes tool - holding assembly 52 out of contact with alignment member 50 . cavity 105 at least partially receives resilient latch 94 when front surface 104 is slid into contact which contact surface 102 of resilient latch 94 to thereby release resilient latch 94 from latch - receiving opening 96 . the illustrated arrangement therefore provides “ hands free ” disconnection ( and connection as described above ) of the pole and tool . referring now to fig6 and 7 , lock collar 68 is a ring - shaped member having a thin - walled portion 106 and a thick - walled portion 108 . thick - walled portion 108 has a break 110 therein which allows for circumferential expansion and contraction of lock collar 68 . lock collar 68 further comprises a plurality of friction ridges 112 protruding radially outward from thick - walled portion 108 and contacting interior surface 82 of extension tube 30 . lock collar 68 is received in eccentric slot 74 and rotatably disposed around eccentric compression member 76 . lock collar 68 exerts an outward radial force on interior surface 82 of extension tube 30 . the magnitude of the outward radial force exerted by lock collar 68 is adjustable by changing the relative position of lock collar 68 and eccentric compression member 76 . in operation , when base tube 24 is rotated relative to extension tube 30 eccentric compression member 76 rotates relative to lock collar 68 . when eccentric compression member 76 is positioned closest to thin - walled portion 106 , as shown in fig7 , friction ridges 112 of lock collar 68 exert minimal force on interior surface 82 of extension tube 30 . thus , fig7 illustrates an unlocked position . when base tube 24 and extension tube 30 are rotated relative to one another so that compression member 76 is rotated into contact with thick - walled portion 108 , as shown in fig6 , friction ridges 112 of lock collar 68 are forced outward and exert a radial securing force on inner surface 82 of extension tube 30 , thereby restraining relative sliding movement of base tube 24 and extension tube 30 . thus , fig6 illustrates a locked position . in order to function properly , lock collar 68 is preferably composed of a resilient material such as , for example , a synthetic resin . the configuration of the locking assembly 64 shown in fig3 , 6 , and 7 allows the relative sliding of base tube 24 and extension tube 30 to be controlled by simply rotating base tube 24 and extension tube 30 relative to one another in either a clockwise or counter - clockwise direction . furthermore , the grips 40 and 48 and the arrangement of the tubes 24 and 30 provide two - handed operation of the pole at a point close to the user &# 39 ; s body . additionally , in the illustrated arrangement , with the outer tube 30 serving as the connection to the tool , debris ( e . g ., paint , dust , etc .) is essentially prevented from contaminating the sliding interconnection of the tubes , the lock mechanism , etc . the preferred forms of the invention described above are to be used as illustration only , and should not be utilized in a limiting sense in interpreting the scope of the present invention . obvious modifications to the exemplary embodiments , as hereinabove set forth , could be readily made by those skilled in the art without departing from the spirit of the present invention . the inventors hereby state their intent to rely on the doctrine of equivalents to determine and assess the reasonably fair scope of the present invention as pertains to any apparatus not materially departing from but outside the literal scope of the invention as set forth in the following claims .

US-69056210-A

an article of a plastic substrate and a bond layer of a plasma polymerized cyclosiloxane having select unsaturation and a method of forming same .

without limitation plastic substrates include those comprised of thermoplastic polymers and thermoset polymers . the substrate , by way of exemplification only , typically comprises a polymer resin . for example , the substrate may comprise a polycarbonate . polycarbonates suitable for forming the substrate are well - known in the art and generally comprise repeating units of the formula : where r 1 is a divalent aromatic radical of a dihydric phenol ( e . g ., a radical of 2 , 2 - bis ( 4 - hydroxyphenyl )- propane , also known as bisphenol a ) employed in the polymer producing reaction ; or an organic polycarboxylic acid ( e . g . terephthalic acid , isophthalic acid , hexahydrophthalic acid , adipic acid , sebacic acid , dodecanedioic acid , and the like ). these polycarbonate resins are aromatic carbonate polymers which may be prepared by reacting one or more dihydric phenols with a carbonate precursor such a phosgene , a haloformate or a carbonate ester . one example of a polycarbonate which can be used as a plastic substrate in the present invention is lexan ®, manufactured by general electric company . aromatic carbonate polymers may be prepared by methods well known in the art as described , for example , in u . s . pat . nos . 3 , 161 , 615 ; 3 , 220 , 973 ; 3 , 312 , 659 ; 3 , 312 , 660 ; 3 , 313 , 777 ; 3 , 666 , 614 ; 3 , 989 , 672 ; 4 , 200 , 681 ; 4 , 842 , 941 ; and 4 , 210 , 699 . the plastic substrate may also comprise a polyestercarbonate which can be prepared by reacting a carbonate precursor , a dihydric phenol , and a dicarboxylic acid or ester forming derivative thereof . polyestercarbonates are described , for example in , u . s . pat . nos . 4 , 454 , 275 ; 5 , 510 , 448 ; 4 , 194 , 038 ; and 5 , 463 , 013 . the plastic substrate may also comprise a thermoplastic or thermoset material . examples of suitable thermoplastic materials include polyethylene , polypropylene , polystyrene , polyvinylacetate , polyvinylalcohol ; polyvinylacetal , polymethacrylate ester , polyacrylic acids , polyether , polyester , polycarbonate , cellulous resin , polyacrylonitrile , polyamide , polyimide , polyvinylchloride , fluorine - containing resins and polysulfone . examples of suitable thermoset materials include epoxy and urea melamine . acrylic polymers , also well known in the art , are another material from which the plastic substrate may be formed . acrylic polymers can be prepared from monomers such as methyl acrylate , acrylic acid , methacrylic acid , methyl methacrylate , butyl methacrylate , cyclohexyl methacrylate , and the like . substituted acrylates and methacrylates , such as hydroxethyl acrylate , hydroxybutyl acrylate , 2 - ethylhexylacrylate , and n - butylacrylate may also be used . polyesters may also be used to form the plastic substrate . polyesters are well - known in the art , and may be prepared by the polyesterification of organic polycarboxylic acids ( e . g ., phthalic acid , hexahydrophthalic acid , adipic acid , maleic acid , terephthalic acid , isophthalic acid , sebacic acid , dodecanedioic acid , and the like ) or their anhydrides with organic polyols containing primary or secondary hydroxyl groups ( e . g . ethylene glycol , butylene glycol , neopentyl glycol , and cyclohexanedimethanol ). polyurethanes are another class of materials which can be used to form the plastic substrate . polyurethanes are well - known in the art , and are generally prepared by the reaction of a polyisocyanate and a polyol . examples of useful polyisocyanates include hexamethylene diisocyanate , toluene diisocyanate , isophorone diisocyanate , and biurets and triisocyanurates of these diisocyanates . examples of useful polyols include low molecular weight aliphatic polyols , polyester polyls , polyether polyols , fatty alchohols , and the like . examples of other materials from which the substrate may be formed include acrylonitrile - butadiene - styrene , valox ® ( polybutylenephthalate , available from general electric co .) xenoy ® ( a blend of lexan ® and valox ®, available from general electric co .) and the like . in the various embodiments of the invention , the substrate comprises a clear polymeric material , such as polycarbonate ( pc ) ( sold under the trademark lexan ® by the general electric company ), polyestercarbonate ( ppc ), polyethersulfone ( pes ) ( sold under the trademark radel ® by amoco ), polyetherimide ( pei or polyimide ) ( sold under the trademark ultem ® by the general electric company ) and acrylics . the plastic substrate can be formed in a conventional manner , for example by injection molding , extrusion , cold forming , vacuum forming , blow molding , compression molding , transfer molding , thermal forming , and the like . the article may be in any shape and need not be a finished article of commerce , that is , it may be sheet material or film which would be cut or sized or mechanically shaped into a finished article . the substrate may be transparent or not transparent . the substrate may be rigid or flexible . blends of the foregoing materials with each other , and blends with additives such as fillers , plasticizers , tints , colors and the like are also contemplated . the preferred substrate is formed of polycarbonate . the term polycarbonate as used herein also intends blends of polycarbonate with other materials such as polyesters and impact modifiers . as appreciated by those in the art , the choice of plastic for the substrate and the thickness of the substrate itself is a function of the use setting for the article . without limitation , the thickness of the substrate is typically not less than 0 . 05 mm ; in other practices the thickness is about 4 mm to about 6 mm . the bond layer ( bl ) is comprised of a plasma reacted cyclosiloxane wherein said cyclosiloxane has at least one c 2 to c 10 alkenyl group attached to a silicon atom . in one embodiment , the cyclosiloxane can be unsubstituted ; in another embodiment it can be organo - substituted with one or more lower alkyl groups of c , to c 3 , i . e . the cyclosiloxane can be substituted with one or more methyl , ethyl , propyl and / or isopropyl groups or combinations of same . in particular practices , the cyclosiloxane is configured as a cyclic trimer ( or cyclotrisiloxane ); a cyclic tetramer ( or cyclotetrasiloxane ); or a cyclic pentamer ( or cyclopentasiloxane ). at least one alkenyl group having 2 to 10 carbon atoms is attached directly to a silicon atom of the cyclosiloxane . in a particular embodiment , only one such alkenyl group is so attached . for practices where the alkenyl group has 3 or more carbon atoms , the double bond can be located anywhere in the moiety . in another embodiment , the alkenyl group in this regard has a terminal carbon - carbon double bond . examples of alkenyl groups include vinyl , allyl , hexenyl and the like . without limitation , a particular cyclosiloxane contemplated by the invention has the structure : wherein each r is independently hydrogen , methyl or ethyl with the proviso that at least one r is a c 2 to c 10 alkenyl group , and n is an integer from 2 to 8 . in one embodiment of this practice , at least one r is a c 2 to c 6 alkenyl group , and n is 3 , 4 or 5 . in another embodiment of this practice , each r is methyl with the proviso that only one r is a c 2 to c 6 alkenyl group , for example , vinyl , and n is 4 . in an particular embodiment of the invention the cyclosiloxane is heptamethyl ( vinyl ) cyclotetrasiloxane ( vinyl - d4 ). the cyclosiloxane bond layer can be applied to the plastic substrate by plasma deposition methods known in the art , for example by plasma enhanced chemical vapor deposition ( pecvd ) as described e . g . in u . s . pat . no . 6 , 420 , 032 , by inductively coupled plasma ( icp ), electron cyclotron resonance ( ecr ) and the like , or by expanding thermal plasma ( etp ), especially in - line etp as described in commonly - owned u . s . pat . no . 6 , 397 , 776 . the plastic substrate may be cleaned in known manners prior to the deposition of the cyclosiloxane , such as by being washed with alcohol solvents , e . g . ispropanol . the thickness of the bond layer depends upon the plastic substrate and the nature of the use setting for the article as aforesaid . without limitation , use settings include those where the article is preferably a vehicle window , such as a car , truck , motorcycle , tractor , boat or airplane window . the substrate may also comprise a display screen , such as a television screen , lcd screen , computer monitor screen , a plasma display screen or a glare guard for a computer monitor . these screens also benefit from being coated with a uv absorption and ir reflective layers to prevent the screen from turning yellow and to prevent uv radiation and heat from damaging electronic components inside the display . the substrate may also comprise an electronic device substrate , such as a solar cell or a liquid crystal display ( lcd ) substrate . without restriction , the bond layer in the ordinary course is no less than 10 nm thick . in various practices , the bond layer is about 20 nm to about 100 nm thick . for still other practices it is about 200 nm to about 500 nm thick . after the bond layer has been deposited by plasma reaction , other coatings may be applied on top of same as needed . for example , one or more uv absorption layers which are typically but need not be metal oxides , may be applied . by way of exemplification only , preferred metal oxides include zinc oxide ( zno ), doped zinc oxides such as indium doped zinc oxide ( izo ) and aluminum doped zinc oxide ( azo ), titanium dioxide ( tio 2 ), cerium oxide ( ce 2 o 3 ) and the like as known in the art . other coatings include transparent conducting coatings formed of materials such as indium tin oxide ( ito ), tin oxide ( sno 2 ) and the like as known in the art . in yet another practice , one or more abrasion resistant coatings may optionally be employed , for example , such coatings may be applied over the uv absorbing layer . abrasion resistant layers in this regard include those known in the art , e . g . those formed of plasma reacted and oxidized organosilicon materials such as d4 , hmdso , tmdso and the like . ir reflective coatings may also be optionally employed . as known in the art , these include , without limitation , metals such as silver ( ag ) and aluminum ( al ), and ir reflective oxides such as e . g . ito ; and including multi - layer stacks such as , without limitation , tio 2 / ag / tio 2 ; zno / ag / zno ; izo / ag / izo ; and azo / ag / azo and their combinations . the invention is generally useful for any application requiring the use of coatings on plastic substrates . more specifically , it is useful as a bond layer for applications such as automotive windows , headlamps and body panels , architectural windows , displays , solar cells and collectors , aircraft windows and canopies , and appliances . the most specific application is automotive glazing . the following example is illustrative only and is not restrictive of scope . plasma reaction of heptamethyl ( vinyl ) cyclotetrasiloxane ( vinyl - d4 ) onto polycarbonate ( pc ) substrates was used as a bond layer for uv filtering and abrasion resistant coatings to improve their resistance to thermal cycling and hydrolytic stability . all depositions were performed using an expanding thermal plasma ( etp ) in an in - line configuration as described in u . s . pat . no . 6 , 397 , 776 . a separate etp was used for each of the layers . pc sheets were cleaned with isopropyl alcohol , rinsed , air dried , then baked overnight at 80 ° to 100 ° c . in vacuum . substrates were loaded onto a rack in a load lock , pumped down to typically 1 mt then introduced into the in - line coater . the substrates were coated by translating past a series of etps . typically , the first station was an infra - red ( ir ) heater to raise the surface temperature of the pc to the desired level prior to the bond layer deposition . for comparison , similar bond layers were formed using a variety of organosilicones , such as octamethylcyclotetrasiloxane ( d4 ), dimethyldimethoxysilane ( dmdms ), vinyltrimethylsilane ( vtms ) and tetramethyldisiloxane ( tmdso ). the criteria for comparison was initial adhesion to the pc measured either by a cross hatch tape test ( astm 1044 using a rating system with units of ib to 5b ) or a tensile pull test , adhesion after water immersion at 65 ° c . for 3 days (“ ws adh ”), and adhesion or cracking after 10 thermal cycles from − 50 to 135 ° c . the performance of the coating as a bond layer was evaluated by repeating these tests on a 6 - layer system consisting of the pc / bl / uv absorbing layer and 4 abrasion resistant layers . the uv absorbing layer was comprised of zno as described in u . s . pat . no . 6 , 420 , 032 . the abrasion resistant layers were each made of plasma polymerized and oxidized d4 . table 1 compares the performance of these bl materials . performance of the package is labeled “ p - adh ” and “ p - ws adh ” for initial adhesion and adhesion after water immersion . all of the materials studied provided good compliance to the stack during thermal cycling such that the 6 - layer package passed the thermal cycle test with no loss of adhesion or cracking . the key differentiator was adhesion as initially deposited and after water immersion both as a stand alone coating and as a bond layer for the 6 - layer structure . as shown in table 1 , v - d4 exhibited excellent adhesion initially and after water immersion both as a stand alone coating and as a bond layer for the 6 - layer structure . for v - d4 , a total of 34 samples were evaluated before and after water immersion . the mean adhesion and standard deviations were 3377 and 1617 initially and 2838 and 1243 after immersion showing no statistically significant deterioration after water immersion . the package also passed the cross hatch test ( 5b adhesion ) after thermal cycling and water immersion . several samples have also passed 6 days immersion . to further stress the bond layer , coatings of increasing thickness from 100 to 600 nm were applied to the pc . with v - d4 , no difference in performance was observed . in comparison , d4 without the vinyl group had very low adhesion , which deteriorated after water immersion even for very thin coatings . coatings of approximately 300 nm and greater failed water immersion . packages with a thin d4 bond layer deteriorated during 3 - day water immersion to typical values of 2 - 3b and several samples of 1b with spontaneous delamination . the performance of dmdms was slightly better than d4 with improved initial adhesion , 1787 psia , but poor water soak performance , 316 psia . package performance was typical of d4 with good initial adhesion but poor water soak performance , typical values being of 2 - 3b and several samples were 1b with spontaneous delamination . vtms had good initial adhesions but also poor water soak performance . most packages with vtms bond layers , however , spontaneously delaminated during water immersion . tmdso had poor initial adhesion and poor water immersion performance . an additional feature of the v - d4 bond layer is that no plasma treatment of the pc substrate is required , thus eliminating one process step and associated cost . moreover , the practice of the present invention provides improved robustness to practice where oxygen is added to the plasma . for example , in practices heretofore , when additional oxygen was provided to the plasma using , e . g . d4 or dmdms as hard layers , delamination occurred at thinner coating thicknesses , e . g . on the order of 300 nm . in contrast , the present invention , e . g . non - limitingly as embodied in the use of v - d4 as a bond layer , permits incorporation of about 0 . 2 liters per minute ( lpm ) to about 0 . 06 lpm of added oxygen to the plasma while maintaining adhesion even at the thicker coatings . e . g ., 600 nm .

US-26941502-A

the invention contemplates a check - valve construction wherein a plurality of at least three generally triangular valve members are independently hinged to the respective base lines of a pyramidal seat configuration , the base lines being in a plane which essentially establishes the upstream end of the valve , and the apex of the pyramid essentially establishes the downstream end of the valve .

preferred illustrative embodiments of the invention will be described in conjunction with the accompanying drawings , in which : fig1 is a partly broken - away , perspective view of a check valve of the invention , viewed from a downstream aspect ; fig2 is a view in side elevation of the structure of fig1 partly broken - away and in section at the alignment 2 -- 2 of fig1 ; fig3 is a view similar to fig2 but taken at the alignment denoted 3 in fig1 ; and in fig1 to 3 , the invention is shown in application to a check valve comprising a body 10 having a cylindrically annular outer surface 11 for accommodation in the bore of a conduit , pipe , fitting or the like ; the check valve is designed to permit fluid flow through the bore of body 10 in the downstream direction denoted by arrow 12 , and to establish a block against fluid flow in the opposite direction . seat structure for a plurality of at least three valve members comprises a frame in the geometrical configuration of a pyramid which may be separately formed and then mounted to body 10 but which in the form shown is integrally formed with body 10 . also , for present illustration , the geometrical pyramid is square and establishes independent seating for each of four like valve members 14 , one at each of the triangular sides of the pyramid . more specifically , the seat structure comprises four seat - post legs 15 of equal length , which length exceeds the effective radius of the bore of body 10 . upstream ends of legs 15 are connected to body 10 at equal angular spacings in a single radial plane of body 10 ( to define the base of the pyramid ), and their downstream ends are interconnected at 16 ( to define the apex of the pyramid ). the seat opening between each pair of adjacent legs 15 is thus one of four isosceles triangles the base edge 17 of which is essentially a chord with respect to the bore of body 10 . each of the base edges 17 extends slightly downstream from an associated radial end face 18 , to enable definition of a peripherally continuous seat for fully lapped accommodation of its associated valve member 14 ; each such end face 18 will be seen as a truncated sector defined essentially by a chord edge 17 and by the adjacent arc of surface 11 which it subtends . and the bore of body 10 is desirably faired , as shown in section in fig2 and 3 , to adapt from the cylinder of surface 11 to the polygonal ( square ) opening defined by edges 17 at the base of the pyramid . hinging of all valve members 14 is on axes lying a single radial plane of the body bore , at or slightly downstream from the base plane of the pyramid . to this end , in fig1 to 3 , each valve member 14 is formed with two spaced hinge arms 20 which are axially located by two spaced hinge lugs or bosses 21 , formed with or mounted to the adjacent associated end face 18 . a single pintel 22 extends through both arms 20 and both bosses 21 , and wire - spring means 23 with coils around the pintel and located between lugs 21 has arms 24 applying constant resilient loading upon the associated member 14 , in the valve - closing direction . the outer end of these arms is shown with a curved offset formation 25 , serving an up - stop function upon contact with conduit - bore wall or the like 26 for the full - open condition of the valve , as suggested by phantom outlines in fig2 . in the embodiment of fig4 the hinging of each valve member 14 &# 39 ; is via a downstream - directed hinge post or offset 27 , permanently assembled to body 10 &# 39 ; via the swaged reduced end of post 27 . short lateral offsets 28 further characterize post 27 and axially locate between hinge arms 20 &# 39 ; of member 14 &# 39 ;, and a single pintel passes through both arms 20 &# 39 ; and both offsets 28 . finally , a single wire spring has central reference to post 27 and spaced coils ( located on offsets 28 ) with spaced end arms symmetrically apply resilient valve - closing force to the downstream side of the associated valve member 14 &# 39 ;. up - stop action is provided by a valve - member abutment 30 at contact with a suitable flat or truncation 31 at the downstream end of the associated hinge post 27 . it will be seen that the described invention meets all stated objects . in particular , valve - member displacement between open and closed positions is reduced to substantially less than 45 degrees , being a smaller angular displacement the greater the number of sides to the pyramid , for a pyramid of given base - diagonal and altitude proportions ; in the disclosed forms , this total displacement is approximately 30 degrees , and the valve members cannot be subjected to the destructive closing impact ( with attendant metal fatigue ) which has characterized past constructions . additionally , the employment of downstream - directed pyramidal seat framing provides at least as great ( and preferably more ) valve - open area as is represented by the effective bore or throat area of the body 10 . in the four - member versions shown , this throat area is essentially determined by the largest square which can be tolerably designed within the outer cylindrical surface . for valves with greater numbers of valve members , involving base polygons with sides exceeding four , the throat area approaches the area within cylinder 11 , but no matter what the number of valve members ( triangular sides of the polygonal pyramid ) the total valve - open area they collectively serve can always equal or exceed the throat area , due to the pyramid - seat concept of the invention . while the invention has been described for the preferred forms shown , it will be understood that modifications may be made without departure from the claimed scope of the invention .

US-8353979-A

a method and apparatus are disclosed for multi cell wireless communication , wherein a status of a secondary serving cell is determined . on the condition that the secondary serving cell is disabled , a hybrid repeat request process associated with the secondary serving cell is released .

when referred to hereafter , the terminology “ wireless transmit / receive unit ( wtru )” includes but is not limited to a user equipment ( ue ), a mobile station , a fixed or mobile subscriber unit , a pager , a cellular telephone , a personal digital assistant ( pda ), a computer , a machine to machine ( m2m ) device , a sensor , or any other type of device capable of operating in a wireless environment . when referred to hereafter , the terminology “ base station ” includes but is not limited to a node - b , a site controller , an access point ( ap ), or any other type of interfacing device capable of operating in a wireless environment . a network may assign at least one downlink and / or at least one uplink carrier as an anchor downlink carrier and an anchor uplink carrier , respectively . in multi - carrier operation a wtru may be configured to operate with two or more carriers , also referred to as frequencies . each of these carriers may have distinct characteristics and logical association with the network and the wtru , and the operating frequencies may be grouped and referred to as anchor , or primary carrier , and supplementary , or secondary carrier . hereinafter , the terminologies “ anchor carrier ” and “ primary carrier ”, and “ supplementary carrier ” and “ secondary carrier ” will be used interchangeably , respectively . if more than two carriers are configured the wtru may comprise more than one primary carrier and / or more than one secondary carrier ( s ). the embodiments described herein are applicable and can be extended to these scenarios as well . for example , the anchor carrier may be defined as the carrier for carrying a specific set of control information for downlink / uplink transmissions . any carrier that is not assigned as an anchor carrier may be a supplementary carrier . alternatively , the network may not assign an anchor carrier and no priority , preference , or default status may be given to any downlink or uplink carriers . hereinafter , the terms “ anchor carrier ”, “ primary carrier ”, “ uplink carrier 1 ”, “ first carrier ”, and “ first uplink carrier ”, are used interchangeably herein for convenience . similarly , the terms “ supplementary carrier ”, “ secondary carrier ”, “ uplink carrier 2 ”, “ second carrier ”, and “ second uplink carrier ” are also used interchangeably herein . for multi - carrier operation more than one supplementary carriers or secondary carriers may exist . fig3 shows an example wireless communication system 100 where uplink transmissions may be handled with a single carrier 160 and downlink transmissions may be handled using multiple carriers 170 . the wireless communication system 100 includes a plurality of wtrus 110 , a node - b 120 , a controlling radio network controller ( crnc ) 130 , a serving radio network controller ( srnc ) 140 , and a core network 150 . the node - b 120 and the crnc 130 may collectively be referred to as the utran . as shown in fig3 , the wtrus 110 are in communication with the node - b 120 , which is in communication with the crnc 130 and the srnc 140 . although three wtrus 110 , one node - b 120 , one crnc 130 , and one srnc 140 are shown in fig3 , it should be noted that any combination of wireless and wired devices may be included in the wireless communication system 100 . fig4 shows an example wireless communications system 200 according to an example where uplink transmissions are handled using multiple carriers 260 , and downlink transmissions are handled using multiple carriers 270 . the wireless communication system 200 includes a plurality of wtrus 210 , a node - b 220 , a crnc 230 , a srnc 240 , and a core network 250 . the node - b 220 and the crnc 230 may collectively be referred to as the utran . as shown in fig4 , the wtrus 210 are in communication with the node - b 220 , which is in communication with the crnc 230 and the srnc 240 . although three wtrus 210 , one node - b 220 , one crnc 230 , and one srnc 240 are shown in fig4 , it should be noted that any combination of wireless and wired devices may be included in the wireless communication system 200 . fig5 is a functional block diagram of the wtru 410 and the node - b 420 of the wireless communication system 200 of fig4 . as shown in fig5 , the wtru 410 is in communication with the node - b 420 and both are configured to perform a method wherein uplink transmissions from the wtru 410 are transmitted to the node - b 420 using multiple uplink carriers 460 . the wtru 410 includes a processor 415 , a receiver 416 , a transmitter 417 , a memory 418 , an antenna 419 , and other components ( not shown ) that may be found in a typical wtru . the antenna 419 may include a plurality of antenna elements or plurality of antennas may be included in the wtru 410 . the memory 418 is provided to store software including operating system , application , etc . the processor 415 is provided to perform , alone or in association with software and / or any one or more of the components , a method of performing uplink transmissions with multiple uplink carriers . the receiver 416 and the transmitter 417 are in communication with the processor 415 . the receiver 416 and the transmitter 417 are capable of receiving and transmitting one or more carriers simultaneously . alternatively , multiple receivers and / or multiple transmitters may be included in the wtru 410 . the antenna 419 is in communication with both the receiver 416 and the transmitter 417 to facilitate the transmission and reception of wireless data . the node - b 420 includes a processor 425 , a receiver 426 , a transmitter 427 , a memory 428 , an antenna 429 , and other components ( not shown ) that may be found in a typical base station . the antenna 429 may include a plurality of antenna elements or plurality of antennas may be included in the node - b 420 . the memory 428 is provided to store software including an operating system , applications , etc . the processor 425 is provided to perform , alone or in association with software and / or any one or more of the components , a method wherein uplink transmissions from the wtru 410 are transmitted to the node - b 420 using multiple uplink carriers in accordance with methods disclosed below . the receiver 426 and the transmitter 427 are in communication with the processor 425 . the receiver 426 and the transmitter 427 are capable of receiving and transmitting one or more carriers simultaneously . alternatively , multiple receivers and / or multiple transmitters may be included in the node - b 420 . the antenna 429 is in communication with both the receiver 426 and the transmitter 427 to facilitate the transmission and reception of wireless data . methods described herein provide several approaches for implementing multi - carrier uplink transmission , performing power control on multiple uplink carriers , and allocating power and data across multiple different uplink carriers . it is noted that although methods described herein are described in terms of a dual uplink carrier scenario , it should be understood that the methods described herein are applicable to scenarios where any number of uplink carriers are implemented . it is also noted that although the methods described herein are described with reference to channels associated with 3gpp releases 4 through 7 , it should be noted that the methods are applicable to further 3gpp releases ( and the channels used therein ), such as lte release 8 , as well as any other type of wireless communication system , and the channels used therein . it should also be noted that the methods described herein may be applicable in any order or in any combination . in multicarrier systems , such as that shown in fig3 , wtrus 110 may include mac entities ( e . g . mac - ehs ) which comprise multiples harq entities , where each harq entity may be associated with a different carrier . the anchor carrier and secondary carriers may be activated and deactivated based on wtru requirements and / or network signaling . for example , it may be desirable , to prevent the resetting of the entire mac entity when a secondary cell is disabled but other cells remain operational . accordingly , the wtru 410 may be configured to utilize signaling from the network 200 to reset predetermined harq processes entities . this signaling , for example , may be a layer 3 ( l3 ) message , e . g ., radio resource control ( rrc ) message received from the network indicating that a secondary serving hs - dsch cell is disabled . the status of each serving cell may be assigned a status variable indicating its availability for receiving signaling via anchor and secondary carriers . a triggering mechanism may be predetermined or signaled to trigger an evaluation of the variable . in this configuration , a variable value of “ false ” may indicate that reception is not enabled on a carrier . a value of true may mean reception on the respective carrier is enabled . for example , in dc - hsdpa the status of a secondary serving hs - dsch cell reception may be determined using a secondary cell status variable , e . g ., secondary_cell_hs_dsch_reception . when the secondary cell status variable is true , the secondary serving hs - dsch cell may be enabled and ready to be used for hs - dsch reception . conversely , when the variable is false , the secondary serving hs - dsch cell is disabled . accordingly , the status variable is evaluated by the wtru 410 each time a new rrc message is received that might affect the status , or whenever required . in one embodiment , the wtru 410 may be configured to evaluate the status variable of the carriers based on a trigger ( e . g . rrc signaling ). on a condition that that the status variable for the anchor carrier is set to false ( indicating reception is not available ), then the wtru 410 may be configured to assume that reception on the secondary carrier ( s ) is also disabled . accordingly , the wtru 410 may be configured to perform a reset on the entire mac entity . alternatively , if the status variable for the anchor carrier is set to false , the wtru 410 may be configured to determine the status variable for each secondary carrier and accordingly reset the harq processes for selected secondary carriers . fig6 is a flow diagram for procedures for disabling secondary cells . upon receipt of an rrc message , the wtru 410 determines the status of the secondary serving hs - dsch cell ( 601 ). this determination may be performed by checking a variable included in the rrc message that may indicate whether the secondary cell is enabled . also , if the rrc message does not include information relating to the secondary hs - dsch cell , the previous status of the cell may be checked . if the previous status was true ( i . e ., indicating that the secondary hs - dsch serving sell was enabled ), the wtru 410 may determine that the non - inclusion of the secondary hs - dsch information means that the secondary hs - dsch is to be disabled , or that the status remains the same . if the wtru 410 determines that the secondary serving hs - dsch cell is to be disabled , the wtru 410 sets the status variable , secondary_hs_dsch_reception to false ( 602 ). the wtru 410 then ceases any hs - scch and hs - dsch reception procedures related to the secondary serving hs - dsch cell ( step 603 ). the variable h_rnti is cleared , and any stored h_rnti associated with the secondary serving hs - dsch cell is removed ( 604 ). the wtru 410 then flushes the harq buffers for all harq processes associated with the secondary serving hs - dsch cell and releases all harq resources associated with the secondary serving hs - dsch cell ( 605 ). in another method , the wtru 410 may be configured to activate / deactivate a secondary carrier via a layer 1 ( l1 ) control signal . by way of example , the l1 control signal for deactivating the secondary hs - dsch carrier is conveyed via a hs - scch order . the wtru 410 may then detect that a secondary serving hs - dsch cell has been deactivated in an hs - scch order . next the wtru 410 may flush the harq buffers associated with the secondary hs - dsch serving cell . upon reactivation of the secondary downlink carrier ( e . g ., via an hs - scch order ), the mac layer may treat the next received harq transmission for each configured harq processes associated with the secondary hs - dsch serving cell as a first transmission ( i . e ., a new data indicator bit is reset . in another method , the secondary serving hs - dsch cell may be disabled based on the status of the primary serving hs - dsch cell . accordingly , primary status variable , e . g ., hs - dsch_reception , may be monitored by the wtru 410 . the variable hs_dsch_reception relates to hs - dsch reception on the anchor carrier ; when it is true , hs - dsch reception on the serving hs - dsch cell may be enabled and when it is false , hs - dsch reception on the serving hs - dsch cell may be disabled . when the primary status variable indicates a false , the wtru 410 recognizes that the primary serving cell has been disabled . as such , the wtru 410 sets the status of the secondary status variable to false for the secondary serving hs - dsch cell and performs the remaining procedures as described above . in accordance with this disclosed method , when hs_dsch_reception is false , the secondary_cell_hs_dsch_reception may also be false and the rrc in that case may release all the hs - dsch resources and reset the entire mac - ehs . when the primary status variable is true , the wtru 410 determines the status of the secondary status variable and operates in accordance with the method disclosed above and shown in fig6 . the variable secondary_cell_hs_dsch_reception may be set to true when the wtru 410 is in cell_dch state and operating in frequency - division duplexing ( fdd ); the wtru 410 has stored the information element ( ie ) “ downlink secondary cell info fdd ”, ie “ harq info ”, ie “ measurement feedback info ”, and ie “ uplink dpch power control info ” including stored δ ack , δ nack and ack - nack repetition factor ; hs_dsch_reception is set to true ; the variable h_rnti ( associated with the secondary serving hs - dsch cell ) is set ; and the wtru 410 has a stored ie “ hs - scch info ” ( associated to the secondary serving hs - dsch cell ). on the condition that these are not met , and the variable secondary_cell_hs_dsch_reception is set to true , the wtru 410 disables the secondary serving cell by setting the variable secondary_cell_hs_dsch_reception to false , for example . any hs_scch reception procedures are ceased by the wtru 410 that are related to the secondary serving hs - dsch cell . the variable h_rnti may then be cleared , and any stored h - rnti associated with the secondary serving hs - dsch cell removed . when the variable secondary_cell_hs_dsch_reception is set to true , the wtru 410 performs hs - dsch reception procedures for the secondary serving hs - dsch cell according to the stored hs - pdsch configuration . while described in the context of a dual - cell hs - dspa 3gpp wcdma network , some of the concepts may also apply to other technologies employing harq with multiple carriers . in addition , while the invention is described in the context of a single supplementary cell , the concepts may also apply to multiple cells as well . although features and elements are described above in particular combinations , each feature or element can be used alone without the other features and elements or in various combinations with or without other features and elements . the methods or flow charts provided herein may be implemented in a computer program , software , or firmware incorporated in a computer - readable storage medium for execution by a general purpose computer or a processor . examples of computer - readable storage mediums include a read only memory ( rom ), a random access memory ( ram ), a register , cache memory , semiconductor memory devices , magnetic media such as internal hard disks and removable disks , magneto - optical media , and optical media such as cd - rom disks , and digital versatile disks ( dvds ). suitable processors include , by way of example , a general purpose processor , a special purpose processor , a conventional processor , a digital signal processor ( dsp ), a plurality of microprocessors , one or more microprocessors in association with a dsp core , a controller , a microcontroller , application specific integrated circuits ( asics ), field programmable gate arrays ( fpgas ) circuits , any other type of integrated circuit ( ic ), and / or a state machine . a processor in association with software may be used to implement a radio frequency transceiver for use in a wireless transmit receive unit ( wtru ), user equipment ( ue ), terminal , base station , radio network controller ( rnc ), or any host computer . the wtru may be used in conjunction with modules , implemented in hardware and / or software , such as a camera , a video camera module , a videophone , a speakerphone , a vibration device , a speaker , a microphone , a television transceiver , a hands free headset , a keyboard , a bluetooth ® module , a frequency modulated ( fm ) radio unit , a liquid crystal display ( lcd ) display unit , an organic light - emitting diode ( oled ) display unit , a digital music player , a media player , a video game player module , an internet browser , and / or any wireless local area network ( wlan ) or ultra wide band ( uwb ) module .

US-61587109-A

a method of removing the cap from a gate of an embedded sige semiconductor device includes the formation of the embedded sige semiconductor device with the cap consisting of a cap material on top of the gate , first sidewall spacers on side surfaces of the gate , and embedded sige in source and drain regions . second sidewall spacers are formed on the first sidewall spacers , these second sidewall spacers consisting of a material different from the cap material . the cap is stripped from the top of the gate with an etchant that selectively etches the cap material and not the second sidewall spacer material .

the present invention addresses and solves problems related to the formation of arrangements having embedded sige fets . in particular , the present invention addresses problems related to protecting the polysilicon gate from growth of epitaxial sige during manufacture . this is accomplished by providing a cap , such as a silicon nitride cap , on top of the gate electrode prior to the formation of the embedded sige regions . a spacer layer is formed over the sidewall spacers and the cap . the spacer layer is then etched to form second sidewall spacers on the first sidewall spacers , with the caps being exposed . an etching , either a wet or a dry etching , is performed to remove the silicon nitride cap . the second sidewall spacers , which may be made of an oxide material , protect the first sidewall spacers ( formed of silicon nitride , for example ) during the stripping of the cap . following the cap strip step , semiconductor processing may proceed as normal , including formation of silicide regions in the gate and source and drain regions . fig1 depicts a cross - section of a semiconductor arrangement during one phase of manufacture in accordance with embodiments of the present invention . the arrangement 10 includes a pfet 11 and an nfet 13 . the pfet 11 and nfet 13 are located on a silicon - on - insulator “ soi ” arrangement , for example , but can be on a bulk silicon layer in other embodiments . a oxide layer 14 , formed of a buried oxide layer and a shallow trench isolation ( sti ) oxide , for example , is provided on a silicon substrate 12 . body areas 16 , formed of silicon , for example , are provided within the oxide layer 14 . in a conventional manner , the pfets 11 and nfets 13 are formed . this includes the creation of polysilicon gates 22 , source and drain regions 18 and source and drain extensions . each of the pfets 11 and nfets 13 include a liner oxide / offset spacer 20 . first sidewall spacers 24 are provided on the liner oxide / offset spacer 20 , for both the pfets 11 and nfets 13 . the first sidewall spacers are made of silicon nitride , for example . the top of each of the gates 22 is capped by a cap 26 , which may also be made of silicon nitride , for example . in certain embodiments of the invention , the first sidewall spacers 24 and the cap 26 are made of the same material , such that removal of the cap 26 by etching could potentially damage the material of the first sidewall spacers 24 , unless preventive measures are taken . the pfet 11 is an embedded sige pfet , and includes embedded sige regions 28 that have been deposited by selective epitaxy . in this process , recesses are first etched into the silicon of the body area 16 at the source and drains 18 in the pfets 11 . the caps 26 on top of the gates 22 protect the polysilicon of the gates 22 from being etched during this process . the nfets 13 are masked off so as not to etch the sources and drains 18 during that period . following the etching of the recesses in the sources and drains 18 in the pfets 18 , a selective epitaxial deposition of sige on the silicon in the body areas 16 of the pfets 11 is performed , to create sige regions 28 . during this step , the cap 26 protects the top of the gate electrode 22 and the pfet 11 from the growth of epitaxial sige . the nfets are still masked off to prevent growth on the sources and drains 18 . once the structure in fig1 has been created , the cap 26 has to be removed without substantially etching the sides of the first sidewall spacers 24 , which are made of the same material as the cap 26 . in certain embodiments of the invention , this material is silicon nitride . accordingly , in fig2 , the present invention provides a second sidewall spacer material layer 30 , which in certain embodiments of the invention is an oxide layer . it is possible but not essential to employ a thin second sidewall spacer material layer 30 , in the order of 3 nm to 6 nm thick , for example . maintaining a relatively thin second sidewall spacer material layer allows the distance between the silicide 38 and the polysilicon gate electrode 22 to be kept to a minimum , to enhance device performance by reducing the electrical series resistance between the silicide 38 and the edge of the channel of the mosfet . a conventional methodology for depositing the second sidewall spacer material layer 30 may be employed . in fig3 , an etching process , such as an anisotropic dry etch , is performed to expose the caps 26 and form relatively thin second sidewall spacers 32 on the sides of the first sidewall spacers 24 . a conventional anisotropic dry etch process may be employed to create the second sidewall spacers 32 and expose the tops 34 of the caps 26 . following the formation of the second sidewall spacers 32 , an etching process is performed to strip the caps 26 and expose the top surfaces 36 of the gates 22 . this etch may be a wet etch or a dry etch . for example , when silicon nitride is employed as the cap material for the caps 26 , hot phosphoric acid may be used to strip the caps 26 . alternatively , a dry etch may be used to strip the caps 26 . whether a wet etch or a dry etch is employed , the first sidewall spacers 24 need to be protected during the stripping of the caps 26 . this is achieved by the second sidewall spacers 32 . this is because the second sidewall spacers 32 are made of a material that will not be substantially etched during the cap stripping process . for example , in the exemplary described embodiment , the caps 26 are made of silicon nitride and the second sidewall spacer material is an oxide . during a wet etch process , for example , employing hot phosphoric acid , only the silicon nitride in the caps 26 will be etched , and the second sidewall spacers 32 will not be affected by the hot phosphoric acid . during this etch , the oxide protects the sidewalls of the first sidewall spacers 24 . with the caps 26 now removed by the etching process , and the first sidewall spacers 24 protected during the etch process , as depicted in fig4 , the formation of the pfets 11 and nfets 13 can now be completed . in fig5 , a silicide 38 is grown on top of the polysilicon gates 22 as well as the source and drains 18 . in the pfets 11 , the silicide is formed in the sige portions 28 of the sources and drains 18 . the second sidewall spacers 32 remain in place after the salicidation process . a conventional salicidation process may be employed to create the silicide regions 38 . if the second sidewall spacers 32 are very thin , they have substantially little effect on the series resistance between the silicide and the edge of the channel . with the present invention , a production - worthy method of forming embedded sige devices is provided . epitaxial growth of sige on top of the gate electrodes is prevented by caps , and the caps are removed by a method that prevents compromising the integrity of the first sidewall spacers . although the present invention has been described and illustrated in detail , it is to be clearly understood that the same is by way of illustration and example only , and is not to be taken by way of limitation , the scope of the present invention being limited only by the terms of the appended claims .

US-87654404-A

catalysts of certain combinations of platinum , tin , acidic molecular sieve and aluminum phosphate binder achieve the isomerization and dealkylation activities characteristic of platinum - containing catalysts yet enjoy the low net c 6 naphthenes make properties .

the catalysts used in the processes of this invention comprise an acidic molecular sieve having a pore diameter of from about 4 to 8 angstroms , platinum and tin in an amorphous aluminum phosphate binder . examples of molecular sieves include those having si : al 2 ratios greater than about 20 : 1 , and often greater than about 35 : 1 or 40 : 1 , such as the mfi , mel , euo , fer , mfs , mtt , mtw , ton , mor and fau types of zeolites . pentasil zeolites such as mfi , mel , mtw and ton are preferred , and mfi - type zeolites , such as zsm - 5 , silicalite , borolite c , ts - 1 , tsz , zsm - 12 , ssz - 25 , psh - 3 , and itq - 1 are especially preferred . the zeolite is combined with binder for convenient formation of catalyst particles . the relative proportion of zeolite in the catalyst may range from about 1 to about 99 mass -%, with about 2 to about 90 mass -% being preferred . the binder or matrix component comprises an amorphous phosphorous - containing alumina ( herein referred to as aluminum phosphate ) component . the atomic ratios of aluminum to phosphorus in the aluminum phosphate binder / matrix generally range from about 1 : 10 to 100 : 1 , and more typically from about 1 : 5 to 20 : 1 . preferably the aluminum phosphate has a surface area of up to about 450 m 2 / gram , and preferably the surface area is up to about 250 m 2 / g . the amount of the aluminum phosphate binder is preferably sufficient to reduce the transalkylation activity of the catalyst , e . g ., co production of toluene and trimethylbenzene . advantageously , the catalysts of this invention can be characterized as having under evaluation conditions , a net make of toluene and trimethylbenzene of less than about 3 , preferably less than about 2 , mass -% based on the mass of c 8 aromatics ( xylenes and ethylbenzene ) in the feed . the aluminum phosphate may be prepared in any suitable manner . one suitable technique for preparing aluminum phosphate is the oil - drop method of preparing the aluminum phosphate which is described in u . s . pat . no . 4 , 629 , 717 . this technique involves the gellation of a hydrosol of alumina which contains a phosphorus compound using the well - known oil - drop method . generally this technique involves preparing a hydrosol by digesting aluminum in aqueous hydrochloric acid at reflux temperatures of about 80 ° to 105 ° c . the mass ratio of aluminum to chloride in the sol often ranges from about 0 . 7 : 1 to 1 . 5 : 1 . a phosphorus compound is added to the sol . preferred phosphorus compounds are phosphoric acid , phosphorous acid and ammonium phosphate . the relative amount of phosphorus and aluminum expressed in atomic ratios ranges from about 10 : 1 to 1 : 100 , and often 10 : 1 to 1 : 10 . if desired , the molecular sieve can be added to the hydrosol prior to gelling the mixture . one method of gelling involves combining a gelling agent with the mixture and then dispersing the resultant combined mixture into an oil bath or tower which has been heated to elevated temperatures such that gellation occurs with the formation of spheroidal particles . the gelling agents which may be used in this process are hexamethylene tetraamine , urea or mixtures thereof . the gelling agents release ammonia at the elevated temperatures which sets or converts the hydrosol spheres into hydrogel spheres . the spheres are then continuously withdrawn from the oil bath and typically subjected to specific aging and drying treatments in oil and in ammoniacal solution to further improve their physical characteristics . the resulting aged and gelled particles are then washed and dried at a relatively low temperature of about 100 ° to 150 ° c . and subjected to a calcination procedure at a temperature of about 450 ° to 700 ° c . for a period of about 1 to 20 hours . the combined mixture preferably is dispersed into the oil bath in the form of droplets from a nozzle , orifice or rotating disk . alternatively , the particles may be formed by spray - drying of the mixture at a temperature of from about 425 ° to 760 ° c . in any event , conditions and equipment should be selected to obtain small spherical particles ; the particles preferably should have an average diameter of less than about 5 . 0 mm , more preferably from about 0 . 2 to 3 mm , and optimally from about 0 . 3 to 2 mm . alternatively , the catalyst may be an extrudate . the well - known extrusion method initially involves mixing of the molecular sieve with optionally the binder and a suitable peptizing agent to form a homogeneous dough or thick paste having the correct moisture content to allow for the formation of extrudates with acceptable integrity to withstand direct calcination . extrudability is determined from an analysis of the moisture content of the dough , with moisture content in the range of from about 30 to about 50 mass -% being preferred . the dough is then extruded through a die pierced with multiple holes and the spaghetti - shaped extrudate is cut to form particles in accordance with techniques well known in the art . a multitude of different extrudate shapes is possible , including , but not limited to , cylinders , cloverleaf , dumbbell and symmetrical and asymmetrical polylobates . it is also within the scope of this invention that the extrudates may be further shaped to any desired form , such as spheres , by marumerization or any other means known in the art . another alternative is to use a composite structure having a core and an outer layer containing molecular sieve and aluminum phosphate . often , the thickness of the molecular sieve layer is less than about 250 microns , e . g ., 20 to 200 , microns . the core may be composed of any suitable support material such as alumina or silica , and is preferably relatively inert towards dealkylation . advantageously , at least about 90 mass -% of the platinum in the catalyst is contained in the outer layer . the catalyst may be in any suitable configuration including spheres and monolithic structures . the catalyst may contain other components provided that they do not unduly adversely affect the performance of the finished catalyst . these components are preferably in a minor amount , e . g ., less than about 40 , and most preferably less than about 15 , mass -% based upon the mass of the catalyst . these components include those that have found application in hydrocarbon conversion catalysts such as : ( 1 ) refractory inorganic oxides such as alumina , titania , zirconia , chromia , zinc oxide , magnesia , thoria , boria , silica - alumina , silica - magnesia , chromia - alumina , alumina - boria , silica - zirconia , phosphorus - alumina , etc . ; ( 2 ) ceramics , porcelain , bauxite ; ( 3 ) silica or silica gel , silicon carbide , clays and silicates including those synthetically prepared and naturally occurring , which may or may not be acid treated , for example , attapulgite clay , diatomaceous earth , fuller &# 39 ; s earth , kaolin , kieselguhr , etc . ; and ( 4 ) combinations of materials from one or more of these groups . often , no additional binder component need be employed . the catalyst of the present invention may contain a halogen component . the halogen component may be fluorine , chlorine , bromine or iodine or mixtures thereof , with chlorine being preferred . the halogen component is generally present in a combined state with the inorganic - oxide support . the optional halogen component is preferably well dispersed throughout the catalyst and may comprise from more than 0 . 2 to about 15 mass -%, calculated on an elemental basis , of the final catalyst . the halogen component may be incorporated in the catalyst composite in any suitable manner , either during the preparation of the inorganic - oxide support or before , while or after other catalytic components are incorporated . preferably , however , the catalyst contains no added halogen other than that associated with other catalyst components . if desired , the catalyst composite can be dried and then calcined . drying is often at a temperature of from about 100 ° to about 320 ° c . for a period of from about 2 to about 24 or more hours and , usually , calcining is at a temperature of from 400 ° to about 650 ° c . in an air atmosphere for a period of from about 0 . 1 to about 10 hours until the metallic compounds present are converted substantially to the oxide form . if desired , the optional halogen component may be adjusted by including a halogen or halogen - containing compound in the air atmosphere . the catalytic composite can optionally be subjected to steaming to tailor its acid activity . the steaming may be effected at any stage of the molecular sieve treatment , but usually is carried out on the composite of molecular sieve and binder prior to incorporation of the platinum . steaming conditions comprise a water concentration of about 1 to 100 vol -%, pressure of from about 100 kpa to 2 mpa , and temperature of from about 600 ° to about 1200 ° c . ; the steaming temperature preferably is at least about 650 ° c ., more preferably at least about 750 ° c ., and optionally may be about 775 ° c . or higher . in some cases , temperatures of about 800 ° to 850 ° c . for preferably least about one hour . alternatively or in addition to the steaming , the composite may be washed with one or more of a solution of ammonium nitrate , a mineral acid , and / or water . considering the first alternative , the catalyst may be washed with a solution of about 5 to 30 mass -% ammonium nitrate . when acid washing is employed , a mineral acid such as hcl or hno 3 is preferred ; sufficient acid is added to maintain a ph of from more than 1 to about 6 , preferably from about 1 . 5 to 4 . the catalyst is maintained in a bed over which the solution and / or water is circulated for a period of from about 0 . 5 to 48 hours , and preferably from about 1 to 24 hours . the washing may be done at any stage of the preparation , and two or more stages of washing may be employed . if the molecular sieve is in a metal salt form , the composite is ion - exchanged with a salt solution containing at least one hydrogen - forming cation such as nh 4 or quaternary ammonium to provide the desired acidity . the hydrogen - forming cation replaces principally alkali - metal cations to provide , after calcination , the hydrogen form of the molecular sieve component . usually , the ion exchange is conducted prior to providing the platinum and tin components . platinum is an essential component of the present catalyst . the platinum component may exist within the final catalyst composite as a compound such as an oxide , sulfide , halide , oxysulfide , etc ., or as an elemental metal or in combination with one or more other ingredients of the catalyst composite . it is believed that the best results are obtained when substantially all the platinum component exists in a reduced state . the platinum component is preferentially deposited in the molecular sieve . the concentration of platinum ( calculated on an atomic basis ) based upon the mass of molecular sieve present falls within a relatively narrow range . with too little platinum , not only will the isomerization activity of the catalyst suffer but also the ethylbenzene dealkylation activity suffers and transalkylation side reactions may become more prominent . if the amount of platinum is too great , net naphthene make increases as does transalkylation . accordingly , by this invention , the concentration of platinum is typically within the range of 150 and 600 , preferably between about 150 and 450 , mass - ppm based upon the mass of the molecular sieve . the catalysts of this invention , and the processes of this invention use catalysts , have the platinum component preferentially in the molecular sieve as compared to the amorphous aluminum phosphate . determining where the platinum component resides in a finished catalyst is difficult and is subject to uncertainties . accordingly , the up - take analysis procedure is adopted as an indicator of where platinum would be preferentially deposited . it is not , nor is it intended to be , a measure of the amounts and portions of platinum actually deposited on the molecular sieve and on the aluminum phosphate binder . hence , the catalysts of this invention may actually have a lesser portion of the platinum in the molecular sieve based upon total molecular sieve and aluminum phosphate than indicated by the up - take analysis . nevertheless , the up - take analysis , by indicating where the platinum is preferentially deposited , is a viable and useful tool for characterizing the catalysts . the platinum component may be incorporated into the catalyst composite in any suitable manner that achieves the preferential deposition in the molecular sieve . the platinum may be incorporated before , during or after incorporation of the tin component . one method of preparing the catalyst involves the utilization of a water - soluble , decomposable compound of platinum to impregnate the calcined sieve / binder composite . alternatively , a platinum compound may be added at the time of compositing the molecular sieve component and binder . complexes of platinum which may be employed according to the above or other known methods include chloroplatinic acid , ammonium chloroplatinate , bromoplatinic acid , platinum trichloride , platinum tetrachloride hydrate , platinum dichlorocarbonyl dichloride , tetraamineplatinum chloride , dinitrodiaminoplatinum , sodium tetranitroplatinate ( ii ), and the like . the tin component is provided in a critical amount . with insufficient tin , the low net naphthene make is not achieved , but as the amount of tin is increased , the ethylbenzene dealkylation activity decreases . moreover , the optimal amount of tin will depend upon the amount of platinum in the catalyst . often , the amount of tin ( calculated as atomic tin ) is in an atomic ratio to platinum in the catalyst of between about 1 . 2 : 1 to 30 : 1 , preferably 1 . 5 : 1 to 25 : 1 , and in some instances from about 1 . 5 : 1 to 5 : 1 . the tin component may be incorporated into the catalyst composite in any suitable manner and may be incorporated before , during or after incorporation of the platinum component . one method of preparing the catalyst involves the utilization of a water - soluble , decomposable compound of tin to impregnate the calcined sieve / binder composite . alternatively , a tin compound may be added at the time of compositing the molecular sieve component and binder . it is essential that the manner in which the tin is provided to the catalyst does not result in undue loss of acidity of the molecular sieve . the tin compound and composition of the impregnating solution can have an effect on the desired association of tin with platinum group metal . tin compounds include halogens , hydroxides , oxides , nitrates , sulfates , sulfites , carbonates , phosphates , phosphites , halogen - containing oxyanion salts such as chlorates , perchlorates , bromates , and the like , as will as hydrocarbyl and carboxylate compounds and complexes , e . g ., with amines and quaternary ammonium compounds . exemplary compounds include , but are not limited to tin dichloride , tin tetrachloride , tin oxide , tin dioxide , chlorostannous acid , tetrabutyl tin , tetraethyl tin , ammonium hexachlorostannate , and tetraethylammonium trichlorostannate . it is within the scope of the present invention that the catalyst composites may contain other metal components . such metal modifiers may include rhenium , germanium , lead , cobalt , nickel , indium , gallium , zinc , uranium , dysprosium , thallium , molybdenum and mixtures thereof . catalytically effective amounts of such metal modifiers may be incorporated into the catalysts by any means known in the art to effect a homogeneous or stratified distribution . the preferred processes of this invention for making the catalyst comprise depositing platinum on a molecular sieve and binder support from a solution , preferably an aqueous solution , in which the platinum is in a cationic form such as tetraamineplatinum chloride . the solution containing the sought amount of platinum , and optionally tin component , and support are combined an mixed and the solvent is evaporated while mixing , preferably at a temperature of at least about 70 ° c ., and more preferably between about 80 ° c . and 140 ° c ., and the catalyst is dried , e . g ., at a temperature of between about 100 ° c . and 250 ° c . the catalysts of this invention are preferably calcined , e . g ., at a temperature within the range of about 400 ° c . and 800 ° c ., preferably in the presence of steam , e . g ., about 0 . 5 to 20 volume percent of the vapor phase , for about 1 to 24 , preferably about 1 to 6 , hours . the prepared catalyst , especially due to the calcining , will contain platinum and tin in oxidized states . to obtain the beneficial performance properties , the catalyst is subjected to reducing conditions . adequate reducing conditions exist for the purposes of activating the catalyst in the isomerization process itself . if desired , the catalyst may be partially or completely pre - reduced . any suitable reducing technique may be employed . often the pre - reducing comprises using a gaseous atmosphere comprising at least one of hydrogen and hydrocarbon at elevated temperatures , e . g ., from about 250 ° to 550 ° c . for 0 . 5 to 50 hours . catalysts may be regenerated . where the loss of catalytic activity is due to coking of the catalyst , conventional regeneration processes such as high temperature oxidation of the carbonaceous material on the catalyst may be employed . the feed stocks to the aromatics isomerization process of this invention comprise non - equilibrium xylene and ethylbenzene . these aromatic compounds are in a non - equilibrium mixture , i . e ., at least one c 8 aromatic isomer is present in a concentration that differs substantially from the equilibrium concentration at isomerization conditions . thus , a non - equilibrium xylene composition exists where one or two of the xylene isomers are in less than equilibrium proportion with respect to the other xylene isomer or isomers . the xylene in less than equilibrium proportion may be any of the para -, meta - and ortho - isomers . as the demand for para - and ortho - xylenes is greater than that for meta - xylene , usually , the feed stocks will contain meta - xylene . generally the mixture will have an ethylbenzene content of about 1 to about 60 mass -%, an ortho - xylene content of 0 to about 35 mass -%, a meta - xylene content of about 20 to about 95 mass -% and a para - xylene content of 0 to about 30 mass -%. usually the non - equilibrium mixture is prepared by removal of para -, ortho - and / or meta - xylene from a fresh c 8 aromatic mixture obtained from an aromatics - production process . the feed stocks may contain other components , including , but not limited to naphthenes and acyclic paraffins , as well as higher and lower molecular weight aromatics . the alkylaromatic hydrocarbons may be used in the present invention as found in appropriate fractions from various refinery petroleum streams , e . g ., as individual components or as certain boiling - range fractions obtained by the selective fractionation and distillation of catalytically cracked or reformed hydrocarbons . concentration of the isomerizable aromatic hydrocarbons is optional ; the process of the present invention allows the isomerization of alkylaromatic - containing streams such as catalytic reformate with or without subsequent aromatics extraction to produce specified xylene isomers and particularly to produce para - xylene . according to the process of the present invention , the feedstock , in the presence of hydrogen , is contacted with the catalyst described above . contacting may be effected using the catalyst system in a fixed - bed system , a moving - bed system , a fluidized - bed system , and an ebullated - bed system or in a batch - type operation . in view of the danger of attrition loss of valuable catalysts and of the simpler operation , it is preferred to use a fixed - bed system . in this system , the feed mixture is preheated by suitable heating means to the desired reaction temperature , such as by heat exchange with another stream if necessary , and then passed into an isomerization zone containing catalyst . the isomerization zone may be one or more separate reactors with suitable means therebetween to ensure that the desired isomerization temperature is maintained at the entrance to each zone . the reactants may be contacted with the catalyst bed in upward -, downward -, or radial - flow fashion . the isomerization is conducted under isomerization conditions including isomerization temperatures generally within the range of about 100 ° to about 550 ° c . or more , and preferably in the range from about 150 ° to 500 ° c . the pressure generally is from about 10 kpa to about 5 mpa absolute , preferably from about 100 kpa to about 3 mpa absolute . the isomerization conditions comprise the presence of hydrogen in a hydrogen to hydrocarbon mole ratio of between about 0 . 5 : 1 to 6 : 1 , preferably about 1 : 1 or 2 : 1 to 5 : 1 . one of the advantages of the processes of this invention is that relatively low partial pressures of hydrogen are still able to provide the sought selectivity and activity of the isomerization and ethylbenzene conversion . a sufficient mass of catalyst ( calculated based upon the content of molecular sieve in the catalyst composite ) is contained in the isomerization zone to provide a weight hourly space velocity with respect to the liquid feed stream ( those components that are normally liquid at stp ) of from about 0 . 1 to 50 hr − 1 , and preferably 0 . 5 to 25 hr − 1 . the isomerization conditions may be such that the isomerization is conducted in the liquid , vapor or at least partially vaporous phase . for convenience in hydrogen distribution , the isomerization is preferably conducted in at least partially in the vapor phase . when conducted at least partially in the vaporous phase , the partial pressure of c 8 aromatics in the reaction zone is preferably such that at least about 50 mass -% of the c 8 aromatics would be expected to be in the vapor phase . often the isomerization is conducted with essentially all the c 8 aromatics being in the vapor phase . usually the isomerization conditions are sufficient that at least about 10 , preferably between about 20 and 80 or 90 , percent of the ethylbenzene in the feed stream is converted . generally the isomerization conditions do not result in a xylene equilibrium being reached . often , the mole ratio of xylenes in the product stream is at least about 80 , say , between about 85 and 99 , percent of equilibrium under the conditions of the isomerization . where the isomerization process is to generate para - xylene , e . g ., from meta - xylene , the feed stream contains less than 5 mass -% para - xylene and the isomerization product comprises a para - xylene to xylenes mole ratio of between about 0 . 20 : 1 to 0 . 25 : 1 preferably at least about 0 . 23 : 1 , and most preferably at least about 0 . 236 : 1 . the particular scheme employed to recover an isomerized product from the effluent of the reactors of the isomerization zone is not deemed to be critical to the instant invention , and any effective recovery scheme known in the art may be used . typically , the isomerization product is fractionated to remove light by - products such as alkanes , naphthenes , benzene and toluene , and heavy byproducts to obtain a c 8 isomer product . heavy byproducts include dimethylethylbenzene and trimethylbenzene . in some instances , certain product species such as ortho - xylene or dimethylethylbenzene may be recovered from the isomerized product by selective fractionation . the product from isomerization of c 8 aromatics usually is processed to selectively recover the para - xylene isomer , optionally by crystallization . selective adsorption is preferred using crystalline aluminosilicates according to u . s . pat . no . 3 , 201 , 491 . improvements and alternatives within the preferred adsorption recovery process are described in u . s . pat . no . 3 , 626 , 020 , u . s . pat . no . 3 , 696 , 107 , u . s . pat . no . 4 , 039 , 599 , u . s . pat . no . 4 , 184 , 943 , u . s . pat . no . 4 , 381 , 419 and u . s . pat . no . 4 , 402 , 832 , incorporated herein by reference . the following examples are presented only to illustrate certain specific embodiments of the invention , and should not be construed to limit the scope of the invention as set forth in the claims . there are many possible other variations , as those of ordinary skill in the art will recognize , within the spirit of the invention . catalyst a : steamed and calcined aluminum - phosphate - bound mfi zeolite spheres are prepared using the method of example i in u . s . pat . no . 6 , 143 , 941 . the pellets are impregnated with an aqueous solution of 1 : 2 : 6 moles of tin ( ii ) chloride : ethylenediamminetetraacetic acid : ammonium hydroxide and tetra - ammine platinum chloride to give 0 . 023 mass -% platinum and 0 . 20 mass -% tin on the catalyst after drying and calcination in air with 3 % steam at 538 ° c . catalyst b : steamed and calcined aluminum - phosphate - bound mfi zeolite spheres are prepared using the method of example i in u . s . pat . no . 6 , 143 , 941 . the pellets are impregnated with an aqueous solution of 1 : 2 : 6 moles of tin ( ii ) chloride : ethylenediamminetetraacetic acid : ammonium hydroxide and tetra - ammine platinum chloride to give 0 . 039 mass -% platinum and 0 . 29 mass -% tin on the catalyst after drying and calcination in air with 3 % steam at 538 ° c . catalyst c : steamed and calcined aluminum - phosphate - bound mfi zeolite spheres are prepared using the method of example i in u . s . pat . no . 6 , 143 , 941 . the pellets are impregnated with an aqueous solution of 1 : 2 : 6 moles of tin ( ii ) chloride : ethylenediamminetetraacetic acid : ammonium hydroxide and tetra - ammine platinum chloride to give 0 . 046 mass -% platinum and 0 . 11 mass -% tin on the catalyst after drying and calcination in air with 3 % steam at 538 ° c . catalysts a , b and c are evaluated in a pilot plant for the isomerization of a feed stream containing 7 mass -% ethylbenzene , 1 mass -% para - xylene , 22 mass -% ortho - xylene and 70 mole - percent meta - xylene . the pilot plant runs are at a hydrogen to hydrocarbon ratio of 4 : 1 , total pressure of 1200 kpa , and weight hourly space velocity of 10 based on the total amount of catalyst loaded . the pilot plant runs are summarized in the following table . the product data are taken at approximately 50 hours of operation . catalyst a b c sn / pt atomic ratio 14 12 4 eb conversion , % 75 75 75 wabt *, ° c . 385 390 385 para - xylene / xylene 23 . 8 23 . 8 23 . 8 toluene + trimethylbenzene , mass -% yield 1 . 8 1 . 6 2 . 0 c 6 naphthenes , mass -% yield 0 . 02 0 . 04 0 . 08 * weighted average bed temperature catalysts are prepared using similar procedures and components as in example i and are evaluated in a similar manner to that described in example ii . the following table sets forth the catalyst compositions and performance . the benzene purity ( bz purity ) is the mass percent benzene based upon total benzene and naphthenes and paraffins of 6 and 7 carbon atoms . the table also sets forth the temperature of the impregnation of each catalyst . the evaluation is at 75 percent conversion of ethylbenzene . para - pt sn %- impreg wabt bz purity xylene / catalyst ppm - m mass temp ° c . ° c . %- mass xylene % m 220 0 . 19 130 391 99 . 9 23 . 70 n 280 0 . 22 100 393 99 . 7 23 . 65 o 430 0 . 096 130 388 99 . 6 23 . 80 p 280 0 . 22 130 396 99 . 8 23 . 74 q 450 0 . 052 130 388 99 . 6 23 . 83 r 380 0 . 07 130 384 99 . 7 23 . 45 s 230 * 0 . 07 130 387 99 . 9 23 . 40 t 350 0 . 04 130 387 99 . 7 23 . 60 u 370 0 . 04 130 387 99 . 3 23 . 60 * catalyst s , when analyzed appears to not be at target platinum concentration .

US-46618006-A

a closed loop system for processing the effluent of drilling mud , cuttings , diesel , water and ultrafines includes a first mechanism for separating the cuttings from the mud , ultrafines and diesel utilizing washing fluid and shaking mechanisms . a second system is also provided to separate the majority of the diesel and water and ultrafines into water and diesel and ultrafines separately .

as shown in fig1 a rig 1 produces mud which is introduced in the shale shakers 2 . the mud effluent from the shale shakers 2 travels to the active mud tanks 3 as is well known in the art . the mud effluent from the mud cleaners 4 also travels to the active mud tanks 3 , as is also well known in the art . mud pumps 5 connected to the mud cleaner 4 convey the mud back to the rig 1 but also convey fluids to fluid trap 500 . in the prior art , the effluent waste from the shale shakers 2 , active mud tanks 3 and mud cleaners 4 are dumped into a disposal pit ( not shown ). in the present invention , waste effluents from the shale shakers 2 , active mud tanks 3 and mud cleaners 4 are sent by conveyor 10 to mud saver 20 . in the prior art and in the current invention a centrifuge 7 also cleans some of the effluent from the shale shakers 2 for reintroduction into the active mud tanks 3 and conveyor 10 . as shown in fig1 and 2 , all cuttings including entrained mud and liquid effluents that are discharged from shale shakers 2 , mud cleaners 4 , and centrifuge 7 , are discharged onto a discharge conveyor 10 which in turn empties onto mud saver 20 . mud saver 20 includes a special conveyor assembly having two doors 21 , 22 . the first door 21 opens onto a screen assembly 35 of mud saver 20 . the second door 22 opens to a chute or slide 70 which is at the exit of mud saver 20 , as discussed below . door 21 is open during normal operation and door 22 is closed . however , if one of the screens of screen assembly 35 breaks , then it is necessary to bypass mud saver 20 . bypassing mud saver 20 should not shut the rig 1 down . therefore , cuttings must continue to be accommodated . to do so , door 21 is closed and door 22 is open so that the cuttings are introduced downstream of mud saver 20 . mud saver 20 also includes as a part of the screen assembly 35 an upper screen 25 and a lower screen 30 ( shown in cutaway below screen 25 ). typically screen 25 will be a 60 - mesh screen whereas screen 30 will be a 200 - mesh screen . the reason for the difference in mesh is that the feed of the initial cuttings and mud mixture come from a variety of screenings , and therefore it is necessary to remove both larger material and fine material . screen 25 receives the initial particles ( not shown ) which come from screen sizes of 60 to 100 screen mesh , for shakers 2 , through screen sizes of 200 to 250 screen mesh , for the mud screening process of mud cleaners 4 . screen 25 is required to have a mesh of 60 mesh to screen out the larger particles , and screen 30 is required to have a screen size of 200 mesh to screen out the finer particles to produce the resultant mud 50 . a tank 40 is supplied underneath the screens 25 , 30 and is connected by springs 45 to screen assembly 35 . thus , the screens 25 , 30 vibrate while the tank 40 receives mud 50 coming from screen 30 . the mud 50 contained in the tank 40 after vibration is pumped by a pump 65 that receives the discharge from tank 40 and pumps it through line 55 back to the active mud system through active mud tanks 3 as mud having been screened through 200 - mesh screen . a counter 60 ( fig2 ) is provided associated with the pump 65 . counter 60 measures the number of strokes of pump 65 , thereby giving the operator an indication of how much mud is being saved . as shown in fig1 and 2 , the outlet of the mud saver 20 is a set of particles discharged by slide 70 to cuttings washer 80 . cuttings washer 80 is cylindrical in shape having outer cylinder 85 suspended on roller bearings and roller stop guides inside it which surrounds an inverted screw or auger 90 which conveys the particles from slide 70 to the other discharge end 95 of cuttings washer 80 . cylinder 85 of cuttings washer 80 slowly rotates as the particles progress from slide 70 to discharge end 95 . a series of spray barbs 101 connected to wash line 100 are provided in the interior of the cylinder 85 of cuttings washer 80 and spray wash solution onto the cuttings . also the same wash solution is sprayed by spray barbs 101 at discharge 105 of mud saver 20 to aid the particles to slide down slide 70 . cuttings washer 80 is also provided with chute 96 . chute 96 is movable from the position shown in fig2 to a position ( fig3 ) where it extends to the discharge 95 of cuttings washer 80 . thus , if shaker dryer 150 , discussed below , is not in commission , because of a screen break of screens 102 , chute 96 may be put in place to catch the effluent . fluids from discharge 95 are collected in container 97 and pumped through line 98 to the inlet 110 of pump 112 as discussed below . the cuttings remaining in container 97 may be mechanically delivered or hand shoveled onto conveyor or chute 70 at such time as shaker dryer 150 is again placed into service . the wash solution from line 100 as introduced to the cuttings by spray barbs 101 is collected in a tank 160 of a shaker dryer 150 , as shown in fig1 and 2 . tank 160 is mounted by springs 161 to the screens 102 . as shown in fig1 and 2 , the particles from the discharge 95 of cuttings washer 80 with the wash solution are discharged onto a single shaker dryer 150 . dryer 150 dries off any remaining solution , which solution also drops through the screens 102 into the tank 160 of shaker dryer 150 . the dried cuttings are discharged from shaker dryer 150 to cuttings conveyor 6 ( fig1 ) which conveys the cuttings to disposal pit 8 . as shown in fig2 the dirty wash solution in tank 160 is pumped through line 110 by pump 112 housed in fluid processor 130 , and discharges through line 111 ( fig2 ) to settling tank 115 . line 111 discharges the washing fluid into settling tank 115 ( fig6 ) such that the fluid impinges on coalescing plates 120 mounted in the interior of settling tank 115 , and then drops to the bottom of settling tank 115 . as shown in fig1 and 2 , the fluid is then discharged by discharge line 125 into fluid processor 130 . as a result of settling , ultra - fine solids are collected in traps 135 provided in settling tank 115 and can be discharged manually as clean waste as they become full . coalescing plates 120 help the water , wash fluid and diesel separate . as shown in fig2 the discharge from line 125 into fluid processor 130 is via pump 200 which has line 125 as its inlet . the discharge of pump 200 is through line 205 to the inlet 210 of filter system 215 or filter system 220 . the liquid discharge from line 125 which flows through inlet 210 and then through either filter system 215 or filter system 220 enters either discharge manifold 225 or discharge manifold 230 , respectively , to the bottom 240 of fluid processor 130 . fluid in bottom 240 will eventually fill all of fluid processor 130 . fluid processor 130 has coalescing plates , such as plates 585 ( fig4 ), to permit the diesel entrained in the wash fluid to separate from the water and other soaps such that the diesel floats above the water and other material of that sort to the top of processor 130 . a switch 255 is supplied at the top of fluid processor 130 that permits diesel to flow to line 245 as the discharge of diesel from fluid processor 130 to tank 40 in mud saver 20 . switch 255 also activates pump 300 thus preventing water from reaching the top of fluid processor 130 . when switch 255 activates pump 300 , the soapy water in fluid processor 130 is discharged by pump 300 through line 310 to cuttings washer spray 100 of cuttings washer 80 and discharge 105 of mud saver 20 where it is again used as the cleaning fluid or wash solution . switch 255 will stop pump 300 before fluid processor 130 is completely empty of water . filters 215 , 220 are used to filter out solids that may be in the fluid introduced through inlet 210 . the two banks of filters 215 , 220 are hand cleaned . therefore , there are two banks 215 , 220 so that one set may be operating while the other is being cleaned for which appropriate valving is applied . thus this closed loop system avoids having to have a pit where cuttings , diesel , some mud , and water are all dumped as part of the process in a waste that is not biodegradable . as shown in fig1 and 4 , diesel and water discharged from the drilling operation of rig 1 are introduced into a fluid trap 500 which collects the fluids from the drilling operation . fluid trap 500 has an overflow or discharge line 505 where it is introduced into the inlet of pump 510 which pumps fluid through line 520 to a second settling tank 530 which is identical to the above described settling tank 115 , except that is has a larger capacity , such as forty barrels , which separates diesel , water and solids . if separation is sufficiently complete , then fluids may be pumped directly ( not shown ) to storage . solids from settling tank 530 are removed manually from traps 540 and transferred to conveyer 10 of the cuttings washer system . fluid is continuously discharged from settling tank 530 through line 550 of settling tank 530 . the discharge line 550 provides the inlet feed to pump 560 in a fluid processor 570 which is in two parts . the first part is substantially identical to fluid processor 130 except sized for larger capacity and has coalescing plates 585 and discharges in a different manner . further , the discharge 310 from fluid processor 570 does not have soaps associated with it but is water used to supply rig 1 and mud pumps 5 through a water tank 9 . thus , fluid is pumped into either filter manifold 564 or filter manifold 563 and then enters fluid processor separator vessel 580 at the bottom of vessel 580 , eventually filling all of separator vessel 580 . vessel 580 has coalescing plates 585 to accelerate the separation of diesel and water . a fluid switch 590 at the upper part of separator vessel 580 permits diesel to flow but will not permit water to flow past this point . when water reaches switch 590 , it activates pump 595 , thus pumping water from vessel 580 but will not pump the vessel dry . the diesel discharge from fluid processor 570 is introduced back into the diesel system 11 for rig 1 . to achieve this , the diesel flows from the top of vessel 580 through line 600 to tank 610 . when tank 610 is full , a fluid level switch 615 activates pump 620 and pumps diesel via line 650 to storage in system 11 . when switch 590 activates pump 595 , water is pumped to water reservoir storage tank 9 . fluid manifold 563 and fluid manifold 564 each have three filters to filter out ultra - fine solids . as discussed above , only one of these manifolds is in operation at any given time thus allowing the changing of filters without interrupting the operation of the fluid processor 570 . if gravity flow would permit diesel from line 650 to be introduced into diesel system 11 , no vessel 610 is needed . however , if a pump is required , a pump 620 is connected near the bottom of tank 610 and discharges through line 650 as discussed above . pump 620 is activated by a level switch 615 connected to tank 610 to maintain an appropriate level in tank 610 as discussed above and is deactivated by a level switch 616 to prevent the tank 610 from being totally drained . normally fluid processor 580 and tank 610 ( if tank 610 is used ) are mounted in one physical enclosure 570 . the embodiment set forth herein are merely illustrative and do not limit the scope of the invention or the details therein . it will be appreciated that many other modifications and improvements to the disclosure herein may be made without departing from the scope of the invention or the inventive concepts herein disclosed . because many varying and different embodiments may be made within the scope of the inventive concept herein taught , including equivalent structures or materials hereafter thought of , and because many modifications may be made in the embodiments herein detailed in accordance with the descriptive requirements of the law , it is to be understood that the details herein are to be interpreted as illustrative and not in a limiting sense .

US-4912493-A

a cardiac valve implanted within the heart is given where a expansible valve maintained in a collapsed form by cold temperature is percutaneously inserted along a releasable guide wire in a cooled sheath and when positioned is expanded by withdrawing the cold temperature .

as noted earlier , cardiac valvular surgery is performed in cases where there is a diminished flow area within a cardiac valve which results in a blockage of normal flow which can leads to cardiac failure . surgery is often required in cases of valvular incompetence in which back flow of blood occurs across a valve that cannot close fully . replacement of stenotic and regurgitant cardiac valves can be accomplished in accordance with this invention using percutaneous techniques allowing for avoidance of many major open - heart surgery procedures . this invention describes a device that serves as a replacement for a diseased stenotic or regurgitant cardiac valve . by this invention , a technique and the devices which serve as a replacement for a stenotic or regurgitant diseased cardiac valves is given . this technique and the devices employed are particularly useful in replacement of diseased mitral valves . in this invention , compressed devices are inserted percutaneously by way of an appropriately sized sheath using the jugular venous routes and expanded to form new valve mechanisms which provide replacement cardiac valves . the catheter and delivery sheath of this invention are appropriately sized for use . one such appropriate catheter is a 14f plastic catheter used for delivery and deployment of both stents and the valve structures of this invention . such a delivery sheath is used in the normal matter and may have a pusher capable of moving a stent or other valve part to its ultimate location in the heart . with reference to fig1 fig2 and fig3 in the technique and procedure of this invention , the percutaneous cardiac valve is introduced via the right internal jugular venous approach . following puncture of this vein , a catheter and needle combination ( not shown ) are used to puncture the interatrial septum 4 allowing passage of a guide wire 8 and catheter 6 from the right to the left atrium . the same catheter and guide wire or catheter is then floated with blood flow out the left ventricle and into the thoracic aorta 10 . the transjugular guide wire is then captured by a snare or basket ( not shown ) and dragged out through the right or left common femoral artery . this allows control over both ends of the guide wire used to introduce the percutaneous cardiac valve . over the guide wire 8 , a high - pressure balloon catheter ( not shown ) is advanced across the diseased mitral valve where it is inflated . once the valve is fully dilated , the balloon catheter is deflated and replaced with a 14f delivery sheath 6 inserted via the right internal jugular approach . the sheath &# 39 ; s tip will be positioned in the left ventricle . a compressed nitinol stent , doubly - flared stent 12 as shown , is advanced to the site of the dilated valve by means of pusher rod ( not shown ). all the while , the delivery sheath is being flushed with iced cold heparinized saline to keep the stent compressed , soft , and flexible . once the stent has been pushed to the distal end of the sheath 6 where it bridges the site of the dilated valve , the pusher will be held steady while the sheath is withdrawn allowing the stent to come into contact with body temperature . this will cause the rapid expansion of the stent 12 as shown in fig2 and create a channel for adequate flow lumen through the diseased valve . at this point , a valve mechanism is inserted . while various valve mechanisms can be employed , this invention is particularly effective with a sliding obturator 14 position as shown in fig3 and shown in more detail in fig4 . alternatively , a silicone sphere can be deployed with the appropriate valve stent as shown in fig5 . since both versions of the stent have a hydrophilic silicone coating , when the sliding obturator or silicone sphere come into contact with the stent lumen , a seal is created when the valve is closed preventing backflow of blood . the devices of this invention are fabricated from a &# 34 ; shaped memory &# 34 ; alloy , nitinol , which is composed of nickel and titanium . nitinol wire is first fashioned into the desired shape for the device and then the device is heat annealed . when the components of the valve are then exposed to ice - cold temperatures , they become very flexible and supple , allowing them to be compressed down and pass easily through a delivery sheath . cold temperature is maintained with the sheath during delivery to the deployment site by constantly infusing the sheath with an iced saline solution . once the valve components are exposed to body temperature at the end of the sheath , they instantaneously reassume their predetermined shapes , thus allowing them to function as designed . the sliding obturator cardiac valve has two components . as shown in fig2 one of the components is a stent 12 which comprises a meshwork of nitinol wire of approximately 0 . 008 inch gauge formed into a tubular structure with a minimum central diameter of 20 mm . away from its central portion , the tubular structure flares markedly at both ends in a trumpet - like configuration . the maximum longitudinal dimension of this stent , or more particularly , a doubly - flared stent , is approximately 20 mm . the maximum diameter of the flared ends of the stent is approximately 30 mm . the purpose of the stent is to maintain a semi - rigid patent channel through the diseased cardiac valve following its balloon dilation as shown in fig2 . the flared ends of the stent maintain the position of this component across the native valve following deployment . the stent contains a thin hydrophilic plastic coating ( not shown ) that helps prevent thrombus formation along the inner surface of the stent . the second component of the sliding obturator valve design is shown in fig4 . at one end of this component are two nitinol wires of 0 . 038 inch diameter which are fashioned into dual loops 16 and 18 at right angles to one another . at the other end these dual wires are connected to an umbrella - shaped structure 20 composed of small , thin slats of nitinol metal covered by silicone rubber with a hydrophilic coating . the dual wires and umbrella structure can be compressed down so as to fit through a delivery sheath with continuous flushing of this sheath with ice - cold heparinized saline . when exposed to body temperature at the end of the delivery sheath , the sliding obturator will expand to its functional size , with a final umbrella diameter of 20 - 25 mm . the sliding obturator will be deployed within the expanded stent as shown in fig4 a and 4b . the loops 16 and 18 formed by the dual wires of the sliding obturator will have sufficient diameter so as not to allow the sliding obturator being carried away by the force of blood flow . the umbrella portion 20 of the sliding obturator will flair out so that its widest diameter will face the interior of the cardiac ventricle . this will allow the sliding obturator to move forward during diastole or relaxation of the heart as shown in fig4 b , thus opening the valve and allowing filling of the ventricle allowing flow as shown by arrows . however , during systole or contraction of the heart , when there is markedly increased intraventricular pressure , the force of blood will act against the open or widest portion of the umbrella 20 as shown in fig4 a pushing back against the flared opening of the wire mesh stent , thus closing the valve . the sliding obturator will therefore allow blood flow in only one direction . in another embodiment of the percutaneous cardiac valve which may be used in this invention , a ball design is employed . in this design as shown in fig5 the distal end of the wire mesh stent possesses two curved wires 24 and 26 that extend beyond the stent into the ventricle , forming a cage structure that will house a small silicone rubber sphere or ball 28 . the silicone sphere will have a hydrophilic coating to diminish thrombogenicity . the silicone sphere will be introduced deflated ( not shown ) attached to the end of a smaller catheter , such as , for example one sized 8f , through the same delivery sheath used for the placement of the stent with the distal cage . once in position within the cage , the sphere will be inflated with a polymer mixture that will have a rapid set - up time hardening within minutes . silicone materials are well known to be suitable for this purpose . after the sphere has been inflated as shown in fig6 it will be separated from its delivery catheter and will remain inflated due to a self - sealing valve 30 at its attachment point with the delivery catheter . during diastole or the ventricular filling stage , the sphere will be carried forward by blood flow , thus opening the valve . the cage will act to restrict the motion of the sphere , preventing it from being lost within the ventricle . during systole , the sphere will be forced backwards due to markedly increased intraventricular pressure , thus closing the valve . the design of the ball version of the percutaneous cardiac valve useful in this invention is similar to the starr - edwards cardiac valve which also uses a ball - valve mechanism to allow only one - way flow through the valve . uniquely in this invention , the stent and valves of this invention are made from a shaped memory nitinol alloy with a transition temperature in the range of about 90 ° to about 96 ° f . and preferably about 95 ° f . those skilled in the art will appreciate that the transition temperatures of the nitinol family of alloys can be manipulated over a wide range by altering the nickel - titanium ratio , by adding small amounts of other elements , and by varying deformation and annealing processes . therefore , no further description of the composition of the shape memory nitinol alloy is necessary . in this invention , the cool and cold temperatures used are those temperatures below about 75 ° f . in particular , iced - cold temperatures are generally below about 32 ° f . and those skilled in the art will appreciate that the compression temperatures of the nitinol family of alloys can be manipulated over a wide range by altering the nickel - titanium ratio , by adding small amounts of other elements , and by varying deformation and annealing processes . therefore , no further description of the composition of the shape memory nitinol alloy is necessary . while this invention has been described in its preferred form with a certain degree of particularity , it is understood that the present disclosure of the preferred forms and embodiments have been made only by way of example and that numerous changes in the details of construction and the combinations and arrangement of parts may be resorted to without departing from the spirit and the scope of the invention as claimed .

US-88196992-A

hierarchically layered tables are stored in a mass memory . each table has entries containing a symbol of a telecommunication network item , location data of the symbol to be displayed in a display unit , and an identifier specifying a lower - layer table . a pointing device is used for selecting an symbol being displayed corresponding to a symbol of an upper layer table . a relocation processor is responsive to a keyboard command for detecting a given entry of the upper layer table that contains the selected symbol , reading information from all entries of a lower layer table specified by the given entry of the upper - layer table , securing a space around the selected symbol using the location data of the read information , and storing it into that entry of the upper layer table . a display processor displays , in the second space , multiple symbols stored in the given entry of the upper layer table .

referring now to fig1 a network map display system of the present invention is illustrated as comprising a network map display processor 11 , a mass memory 12 in which map data are stored , a crt display unit 13 , a map symbol relocator 14 for relocating symbols in a displayed map and reconstructing the map , and data input means 15 such as keyboard and pointing device . the network map processor 11 displays the output of the map symbol relocator 14 using the stored map symbols in a plurality of windows on the display unit 13 . further provided are an expansion memory 16 and a compression memory 17 both of which are connected to receive data from map relocator 14 and supply output data to display processor 11 . as shown in fig2 the data stored in the memory 12 are organized into a plurality of management tables 20 , 21 and 22 arranged in hierarchical order to be displayed as maps in separate windows . each of these tables is divided into multiple rows ( or entries ) for network items and divided into multiple columns for different types of information , i . e ., symbol names ( i . e ., network items ), symbol identifiers , map identifiers for specifying lower layer maps ( i . e ., windows ), x - y coordinate location data of the symbol to be displayed in the display unit 11 . in the illustrated example , table 20 is identified as an upper layer map m0 and related to lower layer maps , or submaps m1 , m2 and m3 . table 21 is identified as submap m2 and contains four entries one of which is related to table 22 that is identified as submap m4 . maps 20 , 21 and 22 are displayed in respective windows . one or more symbols which are currently displayed on the crt display 13 are relocated from a lower layer window to an upper layer window . this relocation process starts with the selection of one or more symbols being currently displayed in the upper layer window by using the pointing device and keyboard input of a &# 34 ; relocate &# 34 ; command . as illustrated in fig3 a , the operation of the map relocator 14 starts with step 30 in which flag f is set equal to 0 and flow proceeds to step 31 to check to see if there is only one symbol that is selected in a map ( i . e ., window ) m j . if this is the case , flow proceeds to step 32 to set flag f to 1 and proceeds to step 33 to detects a symbol s i corresponding to the selected symbol and search through the map m j for a submap m j + 1 corresponding to symbol s i . if submap m j + 1 is found ( step 34 ), flow proceeds to step 35 to read data from submap m j + 1 and secure a space around the selected symbol sufficient to display the symbols of submap m j + 1 using location data to submap m j + 1 and move the read data into map m j ( step 36 ). if submap m j + 1 is not found , flow proceeds from step 34 to the end of the routine . flow proceeds to step 37 to delete submap m j + 1 from mass memory 12 . at step 38 , map relocator 14 commands the display processor 11 to display the symbols of map m j transferred from submap m j + 1 within the secured space . at step 39 , flag f is checked to see if it is 0 to 1 . if f = 1 , flow proceeds to the end of the routine . if there is more than one symbol selected in map m j , the decision at step 31 is negative and flow proceeds to step 41 ( fig3 b ) to choose one of the selected symbols . at step 42 , relocator 14 detects a symbol s i corresponding to the chosen symbol and search through the map m j for a submap m j + 1 corresponding to symbol s i . if submap m j + 1 is found ( step 43 ), flow proceeds to step 44 to determine whether all the selected symbols are tested . if not , flow returns to step 41 , and if so , flow proceeds to step 45 to use all location data of map m j to determine whether the window of this map has a sufficient space to display all submaps . if the decision at step 45 is affirmative , flow proceeds to step 52 ( fig3 a ) to select one of the submaps and repeatedly execute steps 35 to 40 until all the selected submaps are displayed in new positions . if map m j has not sufficient space to display all the submaps , the decision at step 45 is negative and flow proceeds to step 46 to read all information of the submaps from mass memory 12 into the expansion memory 16 and read all information of map m j from mass memory 12 into the compression memory 17 . at step 47 , map relocator 14 waits for the entry of a select command from the pointing device when the user selects one or more symbols of map m j and an &# 34 ; enlarge &# 34 ; command from the keyboard . if an &# 34 ; enlarge &# 34 ; command is entered , flow proceeds from step 47 to step 48 to command the display processor 11 to display the selected symbols of map m j in an enlarged window using the symbols stored in the expansion memory 16 , and flow proceeds to step 49 . if no &# 34 ; enlarge &# 34 ; command is entered at step 47 , flow also proceeds to step 49 to check to see if one or more symbols of map m j are selected in the display unit and a &# 34 ; reduce &# 34 ; command is entered . if so , flow proceeds to step 50 to command the display processor 11 to read the symbols stored in the compression memory 17 and display the selected symbols of map m j in reduced size within the enlarged window and merge all the displayed symbols . if no &# 34 ; reduce &# 34 ; command is entered at step 49 , flow proceeds to step 51 to determine whether an &# 34 ; end &# 34 ; command is entered . if so , flow proceeds to the end of the routine , otherwise , it returns to step 47 to repeat the process . the present invention will be fully understood by the following description with reference to fig4 to 7 . fig4 shows an exemplary case of three windows displayed in the crt display 13 . the window 60 displays symbols 63 , 64 , 65 corresponding respectively to symbols s1 , s2 and s3 of the map m0 ( i . e ., table 20 ), showing interconnections between head office located at position ( x1 , y1 ) and branch offices &# 34 ; a &# 34 ; and &# 34 ; b &# 34 ; located respectively at positions ( x2 , y2 ), ( x3 , y3 ). the window 61 displays symbols s4 to s7 of the submap m2 ( i . e ., table 21 ) relating to symbol s2 ( branch office &# 34 ; a &# 34 ;), and the window 62 displays symbols s8 to s11 of the submap m4 ( i . e ., table 21 ) relating to symbol s4 ( the computer room of branch office &# 34 ; a &# 34 ;). in fig4 if it is desired to relocate the window 62 into the computer room of window 61 , the user selects the symbol 66 in window 61 by clicking it with the pointing device and enters a &# 34 ; display &# 34 ; command . since the input data indicates that the command is of single - symbol case , the map relocator 14 recognizes that the selected symbol 66 corresponds to symbol s4 in map m2 and searches through map m2 for a submap ( step 33 ). since the submap is found to be m4 , all data of submap m4 are reach out of this submap and a space is secured around the selected symbol 66 and the read data are moved into the computer room entry of map m2 ( steps 34 - 36 ). submap m4 is then deleted ( step 37 ) and the transferred symbols of window 62 are displayed within the secured space of window 61 ( step 38 ) as illustrated in fig5 . likewise , the submaps of symbols 63 and 65 of window 60 are displayed in the same manner as in fig5 . if it is desired to display multiple symbols of map m0 , the user may clicks symbols 63 , 64 , 65 displayed in window 60 , fig4 with the pointing device and enters a &# 34 ; relocate &# 34 ; command ( step 31 ). since multiple symbols are selected , the map relocator 14 proceeds to step 41 where one of the symbols 63 , 64 and 65 is chosen and a corresponding symbol in map m0 is detected ( step 42 ). this process is repeated until all symbols are determined corresponding to the selected multiple symbols ( steps 41 - 44 ). if the window 60 has a sufficient space to display all the submaps of the selected symbols , the relocator proceeds to step 49 to display them by executing steps 35 to 40 . otherwise , the map relocator 14 executes steps 46 to read all symbols of the submaps m1 , m2 and m3 from mass memory 12 into the expansion memory 16 and read all symbols of map m0 from memory 12 into the compression memory 17 . if the user clicks all symbols of map m0 in the window 60 ( fig4 ) and enters an &# 34 ; enlarge &# 34 ; command , flow proceeds from step 47 to step 48 and the contents of expansion memory 16 are used by the display processor 11 to display all the submaps m1 , m2 and m3 of map m0 and their lower ranking submaps ( only m4 is shown ) are displayed in window 60 as indicated by numerals 70 , 71 and 72 in fig6 . if the user desires no further symbols to be displayed , the entry of an &# 34 ; end &# 34 ; command is detected at step 51 . if the user clicks symbol 64 in window 60 , fig4 and enters an &# 34 ; enlarge &# 34 ; command , step 48 is executed to display the contents of expansion memory 16 as indicated at 71 in fig7 . if the user further selects symbols 63 and 65 displayed in window 60 and enters a &# 34 ; reduce &# 34 ; command , flow proceeds from step 49 to step 50 . the contents of the compression memory 17 corresponding to the selected symbols 63 and 65 are read into the display processor 11 and the selected symbols 63 and 65 are displayed in reduced size and merged with the symbol 71 in the enlarged window as shown in fig7 .

US-80816597-A

a data processing apparatus has a first processing unit for processing an input data , a second processing unit responsive to the data processed by the first processing unit for executing a processing dependent on the data and producing a display data , and a display unit having a display drive unit and a display device for displaying the display data . the second processing unit is selectively inactivated and activated under control of the first processing unit to reduce power consumption in the second processing unit . the display drive unit is also selectively inactivated and activated under control of the first processing unit to reduce power consumption in the display unit . the display device has a memory function that maintains its display image even when supply of a display drive signal from the display drive unit is stopped , so that a latest image before inactivation of the second processing unit and / or the display drive unit for power consumption reduction is visible by an operator during the inactivated and low power consumption state of the apparatus .

preferred embodiments of the present invention will be described referring to the accompanying drawings . fig1 is a block diagram of a data processing apparatus showing a first embodiment of the present invention . the data processing apparatus comprises a data input unit 3 , a first processing block 1 , a second processing block 98 , and a display block 99 . in operation , a data input which is fed to the data input unit 3 of the data processing apparatus by means of key entry with a key - board or communications interface is transferred to the first processing block 1 in which a first processor 4 examines which key in key entry is pressed or what sorts of data are input from the outside and determines the subsequent procedure according to the information from a first memory 5 . if no input is supplied to the data input unit 3 throughout a given period of time as shown in fig2 - a and also , the action of a second processor 7 has been completed , the feeding of clock signals to the second processor 7 and a display circuit 8 is halted by an interruption controller 6 and / or a process of energy saving is systematically executed . the energy saving process will now be described referring to fig2 . as shown in fig2 - a , a data input entered at t 1 using an n - th key of the key - board is transferred from the data input unit 3 to the first processor 4 . the first processor 4 when examining the data input and determining that further processing at the second processor 7 is needed delivers a start instruction via the interruption controller 6 and a start instruction line 80 to the second processor 7 which thus commences receiving the data input from the first processor 4 . the second processor 7 starts processing the data input when t = t 3 as shown in fig2 - c and upon finishing , sends an end signal to the first processor 4 . in turn , either the first processor 4 or the interruption controller 6 delivers a stop instruction to the second processor 4 via the startup instruction line 80 . accordingly , the second processor 4 transfers finally processed data from its ram memory or register to the second memory for temporary storage and then , stops processing action when t = t 5 as shown in fig2 - c or enters into an energy saving mode where a consuming power is sharply attenuated . after t 5 where the actuation of the second processor 7 is ceased , the data remains held in the second memory 9 due to its nonvolatile properties or due to the action of a back - up battery . if display change is needed , the second processor 4 sends a display change signal to the first processor 4 . the first processor 4 then delivers a display start instruction via a display start instruction line 81 to the display circuit 8 for starting actuation . when t = t 4 as shown in fig2 - d , the command signal is transmitted to the display circuit 8 which in turn retrieves the data of a previous display text from a video memory 82 or the second memory 9 and displays a new image corresponding to the display change signal and data from the second processor 7 . when t = t 6 , the display circuit 8 sends its own instruction or an end signal via the interruption controller 6 to the first processor 4 and upon receiving an instruction from the first processor 4 , stops or diminishes clock generation to enter a display energy saving mode . thereafter , the power consumption of the display circuit 8 will largely be declined as illustrated after t 6 in fig2 - d . after t 6 , the display circuit 8 stays fully or nearly inactivated but a display 2 which is substantially consisted of memory retainable devices , e . g . ferroelectric liquid crystal devices , continues to hold the display image . the arrangement of the display 2 will now be described . the display 2 , e . g . a simple matrix type liquid crystal display , contains a matrix of electrodes in which horizontal drive lines 13 and vertical drive lines 14 coupled to a horizontal driver 11 and a vertical driver 12 respectively intersect each other , as best shown in fig3 . fig4 illustrates a pixel of the display 2 in action with a voltage being applied . in each pixel , a ferroelectric liquid crystal 17 is energized by the two , horizontal and vertical lines 13 , 14 which serve as electrodes and are provided on glass plates 15 and 16 respectively . more particularly , fig4 - a shows a state where light is transmitted through . when a signal is given , the ferroelectric liquid crystal 17 changes its crystalline orientation and acts as a polarizer in which an angle of polarization is altered , thus allowing the light to pass through . when a voltage is applied in the reverse direction , the ferroelectric liquid crystal 17 causes the angle of polarization to turn 90 degrees and inhibits the passage of light with polarization effects , as shown in fig4 - b . the ferroelectric liquid crystal 17 also has a memory retainable effect as being capable of remaining unchanged in the crystalline orientation after the supply of voltage is stopped , as shown in fig4 - c . accordingly , throughout a duration from t = t 6 to t = t 14 , explained later , the display remains intact without any operation of the display circuit 8 . while the energy saving mode is involved after t 6 , both the data input unit 3 and the first processor 4 are only in action . the first processor 4 performs only conversion of key entry to letter code or the like . in general , the key entry is conducted by a human operator and executed some tens times in a second at best . the speed of data entry by a human operator is 100 times or more slower than the processing speed of any microcomputer . hence , the processing speed of the first processor 4 may be as low as that of a known hand calculator and the power consumption will be decreased to hundredths or thousandths of one watt as compared with that of a main cpu in a desktop computer . as shown in fig2 - b , the first processor 4 continues operating while a power switch 20 of the data processing unit 1 is closed . however , it consumes a lesser amount of energy and thus , the power consumption of the apparatus will be low . when n + 1 - th key entry is made at t 11 , the first processor 4 examines the data of the entry at t 12 and if necessary , delivers a start instruction via the interruption controller 6 or directly to the second processor 7 for actuation . upon receiving the start instruction , the second processor 7 starts processing again with the use of clock signals so that the data stored in the second memory 9 , i . e . data at a previous stop when t = t 5 , such as memory data , register information , or display data , is read out and the cpu environment when t = t 5 can fully be restored . when t = t 13 , the data in the first processor 4 is transferred to the second processor 7 for reprocessing . the second processor 7 is arranged to operate at high speeds and its power consumption is as high as that of a desk - top computer . if the second processor 7 is continuously activated , the life of batteries will be shortened as well as in a known note computer . the present invention however provides a series of energy saving mode actions during the operation , whereby the energy consumption will be minimized . the energy saving mode is advantageous . for example , the duration required for processing the data of a word processing software is commonly less than 1 ms while the key entry by a human operator takes several tens of milliseconds at maximum . hence , although the peak of energy consumption during a period from t 13 to t 15 is fairly high in the second processor 7 as shown in fig2 - c , the average is not more than a tenth or a hundredth of the peak value . it is now understood that the energy saving mode allows lower power consumption . when t = t 14 , the second processor 7 sends a desired portion of the display data to the display 2 . before t 14 , the display 2 continues to display the text altered at t 6 due to the memory effects of the ferroelectric liquid crystal 17 while the display circuit 8 remains inactivated . the desired data given through the key entry at t 11 is written at t 14 for regional replacement . the replacement of one to several lines of display text is executed by means of voltage application to corresponding numbers of the horizontal and vertical drive lines 13 and 14 . this procedure requires a shorter period of processing time and thus , consumes a lesser amount of energy as compared with replacement of the entire display text . the second processor 7 then stops operation when t = t 15 and enters into the energy saving mode again as shown in fig2 - c . at the moment when the operation of the second processor 7 has been finished before t 15 or when a stop instruction from the first processor 4 is received , the second processor 7 saves the latest data in the second memory 9 . when t = t 14 , the second processor 7 stops operation or diminishes an operating speed and enters into the energy saving mode . when the input data is fed at short intervals , e . g . at t 21 , t 31 , t 41 , and t 51 , through a series of key entry actions or from a communications port , the second processor 7 shifts to the energy saving mode at t 23 , t 33 , and t 43 as shown in fig2 - c . if the first processor 4 detects that the interval between data inputs is shorter than a predetermined time , it delivers an energy saving mode stop instruction to the second processor 7 which thus remains activated without forced de - energization and no longer enters into the energy saving mode . the energy saving mode is called back only when the interval between two data inputs becomes sufficiently long . also , when the first processor 4 detects that the key entry is absent during a given length of time , it actuates to disconnect the power supply to primary components including the first processor 4 for shift to a power supply stop mode . the memory data is being saved by the back - up battery while the power supply is fully disconnected . before disconnection of the power supply , the first processor 4 however sends a power supply stop display instruction directly or via the second processor 7 to the display circuit 8 for display of an “ off ” sign 21 shown in fig5 - b and then , enters into the power supply stop mode . the off sign 21 remains displayed due to the memory effects of the display 2 after the power supply is disconnected , thus allowing the operator to distinguish the power supply stop mode from the energy saving mode . in the energy saving mode , the operation can be started again by key entry action and thus , the operator will perceive no interruption in the processing action . in the power supply stop mode , the off sign 21 is displayed and the operator can restart the operation in succession with the previous data retrieved from the second memory 9 by the second processor 9 when the power switch 20 is turned on . this procedure is similar to that in the conventional “ resume ” mode . the foregoing operation will now be described in more detail referring to a flow chart of fig6 . when the power switch 20 is turned on at step 101 , the first processor 4 starts activating at step 102 . the input data given by key entry is transferred from the data input unit 3 to the first processor 4 at step 103 . at step 104 , it is examined whether the duration of no - data entry lasts for a predetermined time or not . if the no - data entry duration t is greater than the predetermined time , the procedure moves to step 105 where the actuation of the second processor 7 is examined . if the second processor 7 is in action , the procedure moves back to step 103 . if not , the entire apparatus is de - energized , at step 106 , and stops actuating at step 107 before restarting with step 101 where the power supply switch 20 is closed . if the no - data entry duration t is greater than the predetermined time , but is as short as a few minutes , the procedure is shifted from step 104 to step 108 . when the processing frequency in the first and second processors 4 and 7 is low , the procedure moves from step 108 to step 109 where a back light is turned off for energy saving . if the no - data entry duration t is not greater than the predetermined time , the operation in the first processor 4 is prosecuted at step 110 . also , it is examined at step 110 a whether the data of text is kept displayed throughout a considerable length of time or not . if too long , refreshing action of the data display is executed at step 110 b for prevention of an image burn on the screen . at step 110 c , the processing frequency in the second processor 7 is examined and if it is high , the second processor 7 is kept in action at step 110 d . if the processing frequency is low , the procedure moves to step 111 . when it is determined at step 111 that no further processing in the second processor 7 is needed , the procedure returns to step 103 . when further processing in the second processor 7 is required , the procedure moves from step 111 to step 112 a where the actuation of the second processor 7 is examined . if the second processor 7 is not in action , a start instruction is fed at step 112 b to the second processor 7 which is in turn activated at step 113 by the first processor 4 and the interruption controller 6 . the second processor 7 then starts processing action at step 114 . if it is determined at step 115 that a change in the text of display is needed , the procedure moves to step 116 a where a display change instruction is supplied to both the interruption controller 6 and the first processor 4 . then , the interruption controller 6 delivers a display energizing instruction to the display block 99 at step 116 b . the display circuit 8 is activated at step 116 c and the display change on the display 2 including the replacement of a regional data with a desired data is carried out at step 117 . after the display change is checked at step 118 , a display change completion signal is sent to the first processor 4 at step 117 a . when the display change completion signal is accepted at step 117 b , the display 2 is turned off at step 119 . if no change in the display text is needed , the procedure moves from step 115 to step 120 where the completion of the processing in the second processor 7 is examined . if yes , a processing completion signal is released at step 120 a . as a result , the second processor 7 stops operation at step 121 upon receiving a stop signal produced at step 120 b and the procedure returns back to step 103 . fig7 - a and 7 - b are block diagrams of a note - size computer according to the first embodiment of the present invention . as shown in fig7 - a , a data input block 97 comprises a keyboard 201 , a communication port 51 with rs232c , and a floppy disk controller 202 . also , a hard disk unit 203 is provided separately . a first processing block 1 is mainly consisted of a first processor 4 . a second processing block 98 contains a second processor 7 which is a cpu arranged for shift to and back from the energy saving mode upon stopping and feeding of a clock signal respectively and is coupled to a bus line 210 . also , a rom 204 for start action , a second memory 9 of dram , and a backup ram 205 which is an sram for storage of individual data of returning from the resume mode are coupled to the bus line 210 . both ends of the bus line 210 are connected to the first processor 4 and a display block 99 respectively . the display block 99 has a graphic controller 206 and a liquid crystal controller driver 207 arranged in a display circuit . there are also provided a video ram 209 and a liquid crystal display 208 . for energy saving operation , corresponding components only in the arrangement are activated while the remaining components are de - energized . this energy saving technique is illustrated in more detail in table 1 . in general , input operation for e . g . word processing involves an intermittent action of keyboard entry . hence , the power supply is connected to every component except the communications i / o unit . while a clock signal is fed to the first processing block 1 , no clock signals are supplied to the second processing block 98 and the display block 99 . power is thus consumed only in the first processing block 1 . if necessary , the second block 98 and / or the display block 99 are activated within a short period of time . if more frequent operations are needed , the second processing block 98 is kept activated for acceleration of processing speeds . when the key entry is absent for a given time , the second processing block 98 is disconnected and simultaneously , its processing data is stored in a backup memory for retrieval in response to the next key entry . fig7 - b is similar to fig7 - a , except that the first processor 4 having a lower clock frequency is used as a “ monitor ” for the total system and the processing will be executed by the second processor 7 having a higher clock frequency . the first processor 4 is adapted for operating an event processing method by which the second processor 7 is activated for processing action corresponding to data of the keyboard entry . the second processor 7 stops operation for the purpose of energy saving when the processing action is finished and remains inactivated until another key entry commences . the display block 99 starts operating in response to a display signal from the second processor 7 and stops automatically after completion of display . this procedure can be executed with a common operating system similar to any known operating system , thus ensuring high software compatibility . for example , ms - dos is designed to run with the use of one complete cpu . hence , the energy saving effect will hardly be expected during operation with conventional application software programs . it is then a good idea that a specific operating system and a corresponding word processing software which are installed in two cpus are provided in addition to the conventional operating system . accordingly , a word processing job can be performed using the specific software with the operating system of the present invention and thus , the power consumption will be reduced to less than a tenth or hundredth . also , general purpose software programs can work with the conventional operating system — although the energy saving effect will be diminished . it would be understood that about 80 % of the job on a note - size computer is word processing and the foregoing arrangement can contribute to the energy saving . fig7 - c is a block diagram of another example according to the first embodiment and fig7 - d is a flow chart showing a procedure with the use of a conventional operating system such as ms - dos . the second processor 7 is a cpu capable of holding data from its register and internal ram during actuation of no clock or de - energization . when key entry is made at step 251 , a keyboard code signal from the keyboard 201 is transferred by the first processor 4 to a start device 221 which remains activated , at step 252 . at step 253 , the start device 221 delivers a clock signal to a main processor 222 which is de - energized . both of the register 223 and the internal ram 224 are coupled to a backup source and thus , start operating upon receipt of the clock signal . at step 254 , the main processor 222 starts the program which has been on stand - by for key entry . the program is then processed for e . g . word processing according to data of the key entry , at step 255 . at step 257 , a display instruction is released for replacement of display text if required at step 256 . at step 258 , the graphic controller 206 is activated . the data in the video ram 209 is thus rewritten at step 259 . after the liquid crystal controller driver 207 is activated at step 261 , a desired change in the display text is made on the liquid crystal display 208 formed of ferroelectric liquid crystal . then , the video ram 209 is backup energized at step 262 and the display block 99 is de - energized , at step 263 , thus entering into the energy saving mode . when the processing in the second processor 7 is completed at step 270 , the program stops and moves into a “ keyboard entry stand - by ” stage at step 271 . at step 272 , the data required for re - actuation of the register 223 and the internal ram 234 is saved and the second memory 9 is backup energized before a clock in the cpu is stopped . then , the second processor 7 stops operation , at step 273 , thus entering into the energy saving mode . as the start device 221 remains activated , the second processor 7 stays on stand - by for input through keyboard entry at step 251 or from the communications port 5 . as understood , the start device 221 only is kept activated in the second processing block 98 . the cpu shown in fig7 - c provides backup of registers with its clock unactuated and ensures instant return to operation upon actuation of the clock . as a single unit of the cpu is commonly activated , a conventional operating system can be used with equal success . also , existing software programs including word processing programs can be processed with less assignment and thus , private data stock will be permitted for optimum use . consequently , it would be apparent that this method is eligible . in addition , the consumption of electric energy will be much decreased using a technique of direct control of the first processor 1 on display text change which will be described later with a second embodiment of the present invention . as understood , the resume mode allows most components to remain de - energized when no keyboard entry lasts for a long time . as a ferroelectric liquid crystal material has a memory effect , permanent memory results known as protracted metastable phenomenon will appear when the same text is displayed for a longer time . for prevention of such phenomenon , a display change instruction is given to the first processor 4 and the power switch 20 upon detection with the timer 22 that the display duration exceeds a predetermined time in the energy saving mode or power supply stop mode . accordingly , the display circuit 8 actuates the display 2 to change the whole or a part of the display text , whereby permanent memory drawbacks will be eliminated . if it is happened that the persistence of such permanent memory effects allows no change in the display text on the display 2 , the crystalline orientation of liquid crystal is realigned by heating up the display 2 with a heater 24 triggered by a display reset switch 23 . then , arbitrary change in the display text on the display 2 will be possible . energy saving can be promoted by stopping the clock in the second processor 7 during the energy saving mode . when more or full energy saving is wanted , the power supply to the second processor 7 or the display circuit 8 is disconnected by the interruption controller 6 . as understood , the power supply stop mode requires a minimum of power consumption for backup of the second memory 9 . as shown in fig1 , the back light 25 is turned off when the power source is a battery and a reflective device 27 is activated by a reflection circuit 26 for display with a reflection mode . the reflective device 27 is composed of a film of ferroelectric liquid crystal which provides a transparent mode for transmission of light , as shown in fig8 - a , and an opaque mode for reflection as shown in fig8 - b , for alternative action . incoming light 32 is reflected on the reflective device 27 and runs back as reflected light 33 . at this time , polarization is also effected by the polarizers in the display 2 and the reflective device 27 , whereby the number of components will be reduced . also , a film - form electrochromic display device may be used for providing a transmission mode and a white diffusion screen mode in which it appears like a sheet of white paper . the reflective device 27 may be of fixed type , as shown in fig8 - c and 8 - d , comprising a light transmitting layer composed of low refraction transmitting regions 28 and high refraction transmitting regions 29 and a reflecting layer 31 having apertures 30 therein . as shown in fig8 - c , light emitted from the back light 25 enters the high refraction transmitting regions 29 where it is fully reflected on the interface between the high and low refraction transmitting regions 29 , 28 and passes across the apertures 31 to a polarizer plate 35 . the polarized light is then transmitted to a liquid crystal layer 17 for producing optical display with outwardly emitted light . during the reflection mode in battery operation , outside light 32 passes the liquid crystal layer 17 and is reflected by the reflecting layer 31 formed by vapor deposition of aluminum and reflected light 33 runs across the liquid crystal layer 17 again for providing optical display . the reflective device 27 requires no external drive circuit , thus contributing to the simple arrangement of a total system . it is known that such a combination of high and low refraction transmitting regions is easily fabricated by a fused salt immersion method which is commonly used for making refraction distributed lenses . although such a transmission / reflection combination type liquid crystal display is disadvantageous in the quality of a display image as compared with a transmission or reflection speciality type liquid crystal display , the foregoing switching between transmission and reflection allows display of as good an image as of the speciality type display in both the transmission and reflection modes . this technique is thus suited to two - source , battery and ac application . when the external power source is connected , the back light 25 is lit upon receiving an instruction from the first processor 4 which also delivers a transmission instruction to the reflection circuit 26 and thus , the reflective device 27 becomes transparent simultaneously . accordingly , transmitting light can illuminate the display as shown in fig8 - a . when the battery is connected , the first processor 4 delivers a reflection signal to the reflection circuit 26 and the reflective device 27 becomes opaque to cause reflection and diffusion . as a result , the display is made by reflected outside light as shown in fig8 - b while an amount of electric energy required for actuation of the back light 25 is saved . also , the same result as shown in fig8 - c and 8 - d may be provided with the use of a transmitting reflective plate 34 which is formed of a metal plate , e . g . of aluminum , having a multiplicity of tapered round apertures therein , as illustrated in fig8 - e and 8 - f . as set forth above , the cpu in this arrangement provides intermittent actuation in response to the intermittent key entry and the average power consumption of the apparatus will be declined to an appreciable rate . also , the text remains on display during the operation and thus , the operator can perceive no sign of abnormality when the processing unit is inactivated . more particularly , a great degree of energy saving will be ensured without affecting the operability . more particularly , each key entry action takes several tens of milliseconds while the average of cpu processing durations in word processing is about tens to hundreds of microseconds . hence , the cpu is activated 1 / 100 to 1 / 1000 of the key entry action time for accomplishing the task and its energy consumption will thus be reduced in proportion . however , while the energy consumption of the cpu is reduced to 1 / 1000 , 1 / 10 to 1 / 20 of the overall consumption remains intact because the display unit consumes about 10 to 20 %, namely 0 . 5 to 1 w , of the entire power requirement . according to the present invention , the display unit employs a memory effect display device provided with e . g . ferroelectric liquid crystal and thus , its power consumption will be minimized through intermittent activation as well as the cpu . as the result , the overall power consumption during mainly key entry operation for e . g . word processing will be reduced to 1 / 100 to 1 / 1000 . fig9 is a block diagram showing a second embodiment of the present invention . in the second embodiment , the first processor 4 is improved in the operational capability and the second processor 7 of which energy requirement is relatively great is reduced in the frequency of actuation so that energy saving can be encouraged . as shown in fig9 , the arrangement of the second embodiment is distinguished from that of the first embodiment by having a signal line 97 for transmission of a display instruction signal from the first processing block 1 to the display block 99 . in operation , the first processor 4 of the first processing block 1 delivers a display change signal to the display circuit 8 of the display block 99 for change of the display text on the display 2 . as understood , the second processor 7 delivers such a display change signal to the display circuit 8 according to the first embodiment . fig1 - a is a block diagram showing in more detail the connection of the first processor 4 , in which the first memory 5 comprises a first font rom 40 for storage of dot patterns of alphabet and japanese character fonts or the like in a rom , an image memory 41 , and a general memory 42 . as shown in fig1 b , the second memory 9 may contain a second font rom 43 which serves as a font memory . in operation , a series of simple actions for display text change can be executed using the first processor 4 . character codes are produced in response to the key entry and font patterns corresponding to the character codes are read from the first 40 or second font memory 43 for display on the display 2 after passing the display circuit 8 . the second memory 9 may also contain a second general memory 44 . during input of a series of data characters which requires no large scale of processing , the first processor 4 having less energy requirement is actuated for operation of the display text change . if large scale of processing is needed , the second processor 7 is then utilized . accordingly , the frequency of actuation of the second processor 7 is minimized and energy saving will be guaranteed . also , as shown in fig1 , the memory size of the first memory 5 can be decreased because of retrieval of font patterns from the second font rom 43 of the second memory 9 . the operation according to the second embodiment will now be described in more detail referring to flow charts of fig1 - a and 11 - b . fig1 - a is substantially similar to fig6 which shows a flow chart in the first embodiment . a difference is that as the first processor 4 directly actuates the display circuit 8 , a step 130 and a display flow chart 131 are added . when the first processor 4 judges that the display is to be changed in step 130 and that a desired data for replacement in the display text is simple enough to be processed by the first processor 4 at step 111 , the procedure moves to the display flow chart 131 . the display flow chart 131 will now be described briefly . it starts with step 132 where the display block 99 is activated . at step 133 , the display text is changed and the change is examined at step 133 . after the confirmation of the completion of the text change at step 134 , the display block 99 is de - energized at step 135 and the procedure returns back to step 103 for stand - by for succeeding data input . fig1 - b illustrates the step 133 in more detail . after the display block 99 is activated , at step 132 , by a start instruction from the first processing block 1 , the movement of a cursor with no restriction is examined at step 140 . if yes , data input throughout the cursor movement is executed at step 141 . if not , it is then examined whether the desired input area on the display 2 is occupied by existing data or not at step 142 . this procedure can be carried out by reading the data in the image memory 41 with the first processor 4 . if no , partial text replacement with desired data is executed at step 143 . if yes , the procedure moves to step 144 where the existing data in the input area of the display block 99 is checked using the image memory 41 and examined whether it is necessarily associated or not with the desired data to be input . if no , overwriting of the desired data is executed at step 143 . if yes , the existing data is retrieved from the image memory 41 or read from the second font rom 9 and coupled with the desired data for composition , at step 145 . at step 146 , it is examined whether a black / white inversion mode is involved or not . if yes , the data is displayed in reverse color at step 147 . if no , the text change with the composite data is carried out at step 148 . then , the completion of the text change is confirmed at step 134 and the display block 99 is turned off at step 99 . for a more particular explanation , the processing action of corresponding components when the key entry is made is illustrated in fig1 . when the key entry with “ i ” is conducted at t 1 as shown in fig1 - e , the first processor 4 shifts input data into a letter “ i ” code , reads a font pattern of the letter code from the first font rom 40 shown in fig1 , and actuates the display circuit for display of the letter “ i ” on the display 2 . with the memory effect display having ferroelectric crystal liquid , partial replacement in a character can be made . the partial replacement is feasible in two different manners ; one for change dot by dot and the other for change of a vertical or horizontal line of dots at once . the dot - by - dot change is executed with less energy requirement but at a higher voltage , thus resulting in high cost . the line change has to be done in the group of dots at once even when one dot only is replaced but at relatively lower voltages . both manners in this embodiment will now be explained . when the horizontal and vertical drivers 11 , 12 shown in fig3 accept higher voltages , it is possible to fill the dots forming the letter “ i ” one by one . accordingly , the letter “ i ” can be displayed by having a font data of a corresponding character pattern supplied from the first processor 4 . however , ics accepting such a high voltage are costly . it is thus desired for cost saving that the operating voltage is low . it is now understood that every data processing apparatus is preferably arranged , in view of capability of up - to - date semiconductors , for providing line - by - line text change operation . it is also necessary that the first memory 5 of the first processor 4 carries at least data of one text line . for japanese characters , the one text line data is equal to 640 × 24 dots . the writing of the letter “ i ” thus involves replacement of 24 of 640 - dot lines . in operation , the previous data of a target line is retrieved from the image memory 41 of the first memory 5 and also , the pattern data of the letter “ i ” is read from the first font rom 40 . then , the two data are combined together to a composite data which is then fed to the display circuit 8 for rewriting of one text line on the display 2 . simultaneously , the same data is stored into the image memory 41 . the input of “ i ” is now completed . none of the first font rom 40 and the image memory 41 is needed when the second font rom 43 is employed for the same operation , which is capable of processing coded data . in particular , the same text line can be expressed with about 40 of 2 - byte characters and thus , 40 × 2 = 80 bytes per line . therefore , the first memory 5 may carry coded data of the entire screen image . during the processing of data input “ i ” in either of the two foregoing manners , the second processor 7 provides no processing action as shown in fig1 - c . similarly , a series of key inputs are prosecuted by the first processor 4 , “ space ” at t 2 , “ l ” at t 3 , “ i ” at t 4 , “ v ” at t 5 , and “ e ” at t 6 . although the first processor 4 is much slower in the processing speed than the second processor 7 , the replacement of one text line on display can be pursued at an acceptable speed with less energy consumption . as shown in fig1 , t 7 represents the key input of an instruction for processing a large amount of data , e . g . spelling check in word processing , translation from japanese to english , conversion of japanese characters into chinese characters , or calculation of chart data . when the first processor 4 determines that the processing at the second processor 7 is needed , the second processor 7 is turned on at t 71 . the start - up of the second processor 7 is the same as of embodiment 1 . as shown in fig1 - c , the second processor 7 upon being activated at t 71 returns to the original state prior to interruption and starts processing the data of text lines fed from the first processor 4 . as the processing is prosecuted , each character of changed text is displayed on the display 2 through the display circuit 8 as shown at t 72 in fig1 - d . this procedure will now be explained in the form of data entry for translation from japanese to english . after the letter k is input at t 1 , as shown in fig1 - f , and displayed on the screen , as shown in fig1 - h . then , the letter a is input at t 2 and the display reads “ ka ” as shown in fig1 - h . by then , the second processor 7 remains inactivated as shown in fig1 - c . when a key of translating conversion is pressed at t 7 , the second processor 7 starts processing at t 71 . accordingly , the japanese paragraph “ kareha ” is translated to “ he is ” in english . the resultant data is sent to the display circuit 8 for dot - by - dot replacement for display . now , the display reads “ he is ” as shown in fig1 - h . the dot - by - dot character replacement shown in fig1 - g requires less electric energy than the text line replacement shown in fig1 - d . for the purpose of saving energy during the movement of the cursor , the black / white inversion or negative mode is used as shown in fig1 - a and 13 - b . this however increases the power consumption in the line replacement . when a bar between the lines is used for display of the cursor as shown in fig1 - c and 13 - d , the replacement of the full line is not needed and thus , energy saving will be expected . also , the speed of processing is increased and the response will speed up during processing with the low speed first processor 4 . this advantage is equally undertaken in the dot - by - dot replacement . as shown in fig1 - a , the movement of the cursor is expressed by the bar . for ease of viewing , the bar may be lit at intervals by means of control with the first processor 4 . when a key data input is given , a corresponding character is displayed in the reverse color as shown in fig1 - b . this technique will also reduce the energy consumption at least during the cursor movement . fig1 - a to 14 - g illustrate the steps of display corresponding to t 1 to t 7 . fig1 - h shows the conversion of the input text . fig1 - a to 15 - f shows the insertion of a word during dot - by - dot replacement . it is necessary with the use of the second font rom 43 in the arrangement shown in fig1 that the data of one text line is saved in the image memory 41 because the first font rom 40 does not carry all the chinese characters . when the cursor moves backward as shown in fig1 - c and 15 - d , the letter n is called back from the image memory 41 . accordingly , the data prior to insertion can be restored without the use of the second processor 7 or the second front rom 43 as shown in fig1 - d . fig1 - a to 16 - g show the copy of a sentence “ he is a man ”. the procedure from fig1 - a to fig1 - f can be carried out with the first processor 4 . the step of fig1 - g involves an insertion action which is executed by the second processor 7 . according to the second embodiment , most of the job which is processed by the second processor 7 in the first embodiment is executed by the low power consuming first processor 4 . thereby , the average energy consumption will be much lower than that of the first embodiment . the optimum of a job sharing ratio between the first and second processors 4 and 7 may vary depending on particulars of a program for e . g . word processing or chart calculation . hence , a share of the first processor 4 in operation of a software program can be controlled by adjustment on the program so as to give an optimum balance between the energy consumption and the processing speed . also , a video memory 82 may be provided in the display block 99 for connection via a connecting line 96 with the first processor 4 . this allows the data prior to replacement to be stored in the video memory 82 and thus , the image memory 41 shown in fig1 - a will be eliminated . fig1 is a block diagram showing a third embodiment of the present invention . the difference of the third embodiment from the first and second embodiments will now be described . as shown in fig1 , the first embodiment has the display start instruction line 81 along which both a start instruction and a stop instruction are transferred from the first processing block 1 to the display block 99 while equal instructions are transferred by the start instruction line 80 from the same to the second processing block 98 . the third embodiment contains no display start instruction line 81 to the display block 99 as shown in fig1 . also , the start instruction line 80 of the third embodiment allows only a start instruction but not a stop instruction to be transmitted from the first processing block 1 to the second processing block 98 . the second processor 7 stops itself upon finishing the processing and enters into the energy saving mode . when the second processor 7 determines that the display change is needed , it delivers a display start instruction via a data line 84 to the display block 99 which is then activated . after the display change on the display 2 is completed , the display block 99 stops operation and enters into the display energy saving mode . this procedure will be explained in more detail using a flow chart of fig1 . the flow chart is composed of a first processing step group 151 , a second processing step group 152 , and a third processing step group 153 . at first , the difference of this flow chart will be described in respect to the sequence from start to stop of the second processing block 98 . there is no control flow from the second processing step group 152 of the second processing block 98 to the first processing step group 151 , unlike the flow chart of the first embodiment shown in fig6 . more specifically , the first processor 4 delivers , at step 112 , a start instruction to the second processor 7 which is then activated . this step is equal to that of the first embodiment . however , the second processor 7 is automatically inactivated at step 121 , as compared with de - energization by an instruction from the first processor 4 in the first embodiment . at step 103 , the second processor 7 is turned to a data input stand - by state . the difference will further be described in respect to the sequence from start to stop of the display block 99 . in the first embodiment , a display start instruction to the display block 99 is given by the second processor 7 after completion of display data processing . according to the third embodiment , the start instruction is delivered by the second processing block 98 to the display block 99 , at step 115 a shown in fig1 . then , the display block 99 is activated at step 116 and the display change is conducted at step 117 . after the display change is examined at step 118 , the display block 99 stops itself at step 119 . as understood , the third embodiment which is similar in the function to the first embodiment provides the self - controlled de - energization of both the second processing block 98 and the display block 99 . also , a start instruction to the display block 99 is given by the second processing block 98 . accordingly , the task of the first processing block 1 is lessened , whereby the overall processing speed will be increased and the arrangement itself will be facilitated . fig2 is a block diagram showing a fourth embodiment of the present invention , in which an energy saving manner is disclosed with the use of an input / output port for communications with the outside . a data processing apparatus of the fourth embodiment incorporates an input / output unit 50 mounted in its data input block 97 . the input / output unit 50 contains a communications port 51 and an external interface 52 . in operation , the unit 50 performs actions as shown in a timing chart of fig2 which is similar to the timing chart of key data entry shown in fig1 . when a series of inputs from the communications port are introduced at t 1 to t 74 , as shown in fig2 - a , the input / output unit 50 delivers corresponding signals to the first processing block 1 . the first processor 4 sends an input data at t 1 to the display circuit 8 which in turn actuates , as shown in fig2 - d , for display of a data string as illustrated in fig2 - e . if an input at t 7 is bulky , the second processor 7 is activated at t 71 as shown in fig2 - c . the second processor 7 delivers a start instruction at t 72 to the display circuit 8 which is then actuated for data replacement on the display 2 . if the input through the communications port is not bulky , it is processed in the first processor 4 or the input / output unit 50 while the second processor 7 remains inactivated . accordingly , energy saving during the input and output action will be ensured . fig2 is a block diagram showing a fifth embodiment of the present invention , in which a solar battery 60 is added as an extra power source . the first processor 4 operates at low speeds thus consuming a small amount of electric energy . accordingly , the apparatus can be powered by the solar battery 60 . while the action is almost equal to that of the first embodiment , the solar battery however stops power supply when the amount of incident light is decreased considerably . if the supply is stopped , it is shifted to from the source 61 . when no key entry is made throughout a length of time and no power supply from the solar battery 60 is fed , the source stop mode is called for as shown in fig2 - b . the first processor 4 saves processing data into the first memory 5 and then , stops operation . thus , the power consumption will be reduced . when a power supply from the solar battery 60 is fed again at t 71 or another key input data is fed from the data input unit 3 , the first processor 4 starts actuating for performance of an equal action from t 72 . one example of the start procedure of the first processor 4 will now be described . as shown in fig2 , a key input device 62 of the data input unit 3 feeds a voltage from the battery 64 to a hold circuit 63 . the hold circuit 63 upon pressing of a key connects the power source to the first processor 4 for energization . simultaneously , the key input device 62 transfers a key input data to the first processor 4 and processing will start . each key of the key input device 62 may have a couple of switches ; one for power supply and the other for data entry . accordingly , as the solar battery is equipped , the power consumption will be minimized and the operating life of the apparatus will last much longer . the solar battery 60 , which becomes inactive when no incoming light falls , may be mounted on the same plane as of the display 2 so that no display is made including text and keyboard when the solar battery 60 is inactivated . hence , no particular trouble will arise in practice . in case of word processing in the dark e . g . during projection of slide pictures in a lecture , a key entry action triggers the hold circuit 3 for actuation of the first processor 4 . as the data processing apparatus of the fifth embodiment provides more energy saving , it may be realized in the form of a note - size microcomputer featuring no battery replacement for years . also , the first and second processors in any of the first to fifth embodiments may be integrated to a single unit as shown in fig2 . it was found through experiments of simulative calculation conducted by us that the average power consumption during a word processing program was reduced from 5 w of a reference value to as small as several hundredths of a watt when the present invention was associated . this means that a conventional secondary cell lasts hundreds of hours and a primary cell , e . g . a highly efficient lithium cell , lasts more than 1000 hours . in other words , a note - size computer will be available which lasts , like a pocket calculator , over one year in use of 5 - hour a day without replacement of batteries . as understood , intensive attempts at higher - speed operation and more - pixel display are concurrently being prosecuted and also , troublesome recharging of rechargeable batteries needs to be avoided . the present invention is intended to free note - size computers from tangling cords and time - consuming rechargers . the advantages of high speed and high resolution attributed to ferroelectric liquid crystal materials have been known . the present invention in particular focuses more attention on the energy saving effects of the ferroelectric liquid crystal which have been less regarded . no such approach has been previously made . the energy saving effects will surely contribute to low power requirements of portable data processing apparatuses such as note - size computers . although the embodiments of the present invention employ a display device of ferroelectric liquid crystal for utilization of memory effects , other memory devices of smectic liquid crystal or electrochromic material will be used with equal success . the liquid crystal display is not limited to a matrix drive as described and may be driven by a tft drive system .

US-9271905-A

the invention relates to nucleic acids containing a nucleotide sequence encoding a polypeptide , the polypeptide having the p2 and p3 regions of a swine vesicular disease virus polyprotein , and an amino acid sequence heterologous to the polyprotein . the invention also includes methods of preparing such nucleic acids and methods of using such nucleic acids to express rna or protein .

the invention relates to a new viral expression system based on the svdv genome and life cycle . svdv nucleic acid sequences and virus clones are readily available . see , e . g ., zhang et al ., j . gen . virol . 80 : 639 - 651 , 1999 , and references cited therein , as well as u . s . ser . no . 09 / 116 , 032 . without further elaboration , it is believed that one skilled in the art can , based on the above disclosure and the construction of svdv expression vectors described below , utilize the present invention to its fullest extent . the following examples are to be construed as merely illustrative of how one skilled in the art can make and use svdv vectors for expressing heterologous rna and proteins , and are not limitative of the remainder of the disclosure in any way . all publications cited in this disclosure are hereby incorporated by reference . the pci (□ δxbai )/ svdv - t ( xbai ) vector was constructed as shown in fig2 using pci / svdv - t as the starting material ( u . s . ser . no . 09 / 116 , 032 ). the xbai site in the parent pci vector was deleted , and another xbai site was introduced into the svdv cdna at about position 760 bp ( all numberings are as in u . s . ser . no . 09 / 116 , 032 ), just upstream of the protein 1a coding sequence . consequently , the new xbai site , together with the nari site at about position 3300 bp oust downstream of the protein 1d coding sequence ) can be used to replace the p - 1 region with a heterologous sequence . the specific procedure for constructing pci (□ δxbai )/ svdv - t ( xbai ) is described below . the pci / svdv - t vector was treated with xbai at 37 ° c . for 2 hours . after purification of the digestion products , both ends of the vector were blunted with 5 u / 100 μl of pfu dna polymerase at 72 ° c . for 1 hour , and ligated using t4 dna ligase . the ligation products were used to transform dh5 □ α e . coli . the bacteria were grown , and the plasmid dna purified from the bacteria . the purified vector was then digested with xbai to confirm the identity of the plasmid . this plasmid deleted for the xbai site was named pci (□ δxbai )/ svdv - t ( fig2 ). the 1 , 732 bp dna fragment between the noti and nari sites in the pci (□ δxbai )/ svdv - t was prepared using overlap extension pcr ( fig2 ). an xbai site was inserted at about nucleotide position 760 . the pcr - generated fragment was then used to replaced the corresponding noti to nari fragment in pci (□ δxbai )/ svdv - t to produce pci (□ δxbai )/ svdv - t ( xbai ). the detailed procedure is described below and in fig2 . pci (□ δbai )/ svdv - was used as template , along with primers spn (+), sx760 (−), sx760 (+), and svdv1732 (−). the primer sequences were : the pcr solution contained of 10 μl of 10 × extag buffer ( takara ), 8 μl of 2 . 5 mm each dntp , 0 . 2 μg of each primer , 0 . 05 μg of template , and 2 . 5 u of extag ( takara ). water was added to achieve a 100 μl volume . the pcr was performed at 94 ° c . for 1 minute ; for 30 cycles of 94 ° c . for 30 seconds , 58 ° c . for 30 seconds , 72 ° c . for 1 minute ; then at 72 ° c . for 3 minutes . the pcr product was analyzed using 0 . 8 % agarose gel electrophoresis . a 780 bp dna product was observed using spn (+) and sx760 (−), and a 980 bp dna product was observed using sx760 (+) and svdv1732 (−). the dna fragments were digested with restriction endonuclease and purified for a second pcr reaction . the second pcr reaction contained 0 . 1 mg each of the 780 bp and 980 bp fragments , 0 . 2 mg each of spn (+) and svdv1732 (−), 10 μl of 10 × extag buffer , 8 μl of 2 . 5 mm each dntp , 2 . 5 u of extag , and water to 100 μl total volume . the pcr was performed at 94 ° c . for 1 minute ; for 30 cycles at 94 ° c . for 30 seconds , 60 ° c . for 1 minute , 72 ° c . for 2 minutes ; and at 72 ° c . for 3 minutes . the pcr product was analyzed using 0 . 8 % agarose gel electrophoresis . a 1 . 8 kb dna product was clearly observed . the dna fragment was purified and digested with noti and nari at 37 ° c . for 2 hours . after separation using 0 . 8 % agarose gel electrophoresis , the dna fragment was purified and stored at 4 ° c . the pci (□ δxbai )/ svdv - t vector was also digested with noti and nari at 37 ° c . for 2 hours . after separation using 0 . 8 % agarose gel electrophoresis , the 8 . 0 kb linear dna was purified and ligated to the 1 . 8 kb pcr product . the ligation was carried out at 16 ° c . for 30 minutes using t4 dna ligase . dh5 □ α bacteria were transformed with the ligation reaction and grown . clones which yielded a single full length linear fragment after digestion with xbai were sequenced to confirm the identity of plasmid pci (□ δxbai )/ svdv - t ( xbai ). the pci (□ δxbai )/ svdv - t (□ δp1 )/ gfp expression vector was constructed as shown in fig3 . the purpose of this construct was to determine whether the svdv dna vector can express heterologous proteins . the green fluorescence protein ( gfp ) gene having xbai and nari restriction sites on the 5 ′ and 3 ′ ends , respectively , was prepared by pcr . the gfp fragment was then used to replace the xbai to nari fragment of pci (□ δxbai )/ svdv - t ( xbai ). in other words , the p - 1 region of the svdv genome was replaced with a gfp coding sequence . the detailed procedure is described below . pires - egfp ( clontech ) was used as template for pcr , utilizing pcr primers xeep (+) ( ttctagatatcgtgagcaagggcgaggagctgttcacc [ seq id no : 5 ]) and nep (−) ( tttggcgccagtggtcttgtacagctcgtccatgccgaaagt [ seq id no : 6 ]). the pcr reaction contained 10 μl of 10 × extag buffer , 8 μl of 2 . 5 mm each dntp , 0 . 2 μg each primer , 0 . 05 μg of template , 2 . 5 u of extag , and water to 100 μl total volume . pcr was performed at 94 ° c . for 30 seconds ; and for 30 cycles of 55 ° c . for 40 seconds , 72 ° c . for 45 seconds . the pcr product was analyzed using 0 . 8 % agarose gel electrophoresis . a 0 . 7 kb dna product was observed . the 0 . 7 kb dna fragment was purified and digested with xbai and nari at 37 ° c . for 2 hours . after separating the dna fragment using 0 . 8 % agarose gel electrophoresis , the 0 . 7 kb product was purified and stored at 4 ° c . pci (□ δxbai )/ svdv - t ( xbai ) vector was digested with xbai and nari at 37 ° c . for 2 hours . after separating the vector fragment using 0 . 8 % agarose gel electrophoresis , the 9 . 5 kb linear dna was purified and ligated to the 0 . 7 kb gfp fragment . the ligation was carried out at 16 ° c . for 30 minutes using t4 dna ligase . dh5 □ α bacteria were transformed with the ligated products and grown clones containing only one cutting site for ecorv was selected and sequenced to the confirm identity of the new svdv / gfp expression vector pci (□ δxbai )/ svdv - t (□ δp1 )/ gfp . pci (□ δxbai )/ svdv - t (□ δp1 )/ gfp vector was linearized using bamhi at 37 ° c . for 2 hour . the linear dna was separated using 0 . 8 % agarose gel electrophoresis . the 10 kb dna fragment was purified and stored at 4 ° c ., then used as a template for in vitro transcription using t7 rna polymerase . the detailed procedure is described below . the transcription reaction contained 20 μl of 5 × transcription buffer ( promega ), 10 μl 100 mm dtt , 100 u of rnasin ( gibco - brl ), 2 μl of 25 mm rntp mixture ( promega ), 50 u of t7 rna polymerase ( promega ), 2 μg of template , and water to 100 μl total volume . after incubation at 37 ° c . for 1 hour , 10 u of dnasei ( gibco - brl ) was added to the reaction , and the incubation continued at 37 ° c . for 10 minutes . the reaction was extracted with phenol / chloroform . the extracted rna was precipitated with ethanol , dissolving in water , and analyzed using 1 . 0 % agarose gel electrophoresis . the agarose gel indicated the presence of rna of about 5 . 5 kb and provided no evidence of residual pci (□ δxbai )/ svdv (□ δp1 )/ gfp vector . about 1 - 2 × 10 5 mvpk porcine kidney cells were seeded in each well of a 6 - well microplate and cultured in 3 ml of mem medium supplemented with fetal bovine serum to 5 %, at 37 ° c . in a 5 % co2 2 incubator . when the cells were grown to about 80 % confluency , the following solutions were prepared . solution a : 1 μg of pci (□ δxbai )/ svdv (□ δp1 )/ gfp or 0 . 5 μg of the chimeric rna produced in example 2 was added to 100 μl of opti - mem ( gibco - brl ). solution b : 20 μl of lipofectin ( gibco - brl ) was dissolved in 100 μl of opti - mem . solutions a and b were mixed together and incubated at room temperature for 15 minutes . the mvpk cells were washed twice with 1 × pbs buffer . about 0 . 8 ml of opti - mem was added to each well , followed with the addition of the a / b mixture . the transfected mvpk cells were incubated at 37 ° c . for 6 hours and then washed with pbs . three milliliters of mem supplemented with fetal bovine serum to 5 % was added to the washed cells , and the cells incubated at 37 ° c . after 16 hours growth , mvpk cells were observed under a fluorescent microscope . mvpk cells transfected with either the chimeric rna or the dna vector showed abundant fluorescence in individual cells , when compared to control cells transfected with the parent svdv vector without gpf . the fluorescence in rna - transfected cells appeared to be stronger than in dna - transfected cells . in addition , the expression of gfp was evaluated using western blotting and an anti - gfp antibody ( clontech ). the western blot results ( fig4 ) were similar to the fluorescence results . both cells receiving the dna or the rna vector expressed gfp , though again rna - transfected cells appear to produce more gfp than dna - transfected cells . the western blots also confirmed that gfp was cleaved from the svdv polyprotein . these results indicate that a heterologous polypeptide can be expressed using either rna or dna svdv expression vectors . it is to be understood that while the invention has been described in conjunction with the detailed description thereof , the foregoing description is intended to illustrate and not limit the scope of the invention , which is defined by the scope of the appended claims . other aspects , advantages , and modifications are within the scope of this invention . for example , svdv genomes containing a p - 1 sequence replacement can be packaged into virions using cells that stably express svdv structural proteins . such viral vectors would be expected to infect cells and express whatever heterologous sequences are present in p - 1 .

US-68454600-A

the disclosure being made by the video cassette selection machine is that of an automated library retrieval system of video tape cassettes combined with the additional features of a complete playback system which include : a cassette player , t . v . unit , and speaker system . additional features provided are the ability to exchange the contents of the cassette library with new cassettes in order to expand the scope of the cassette library . a machine memory allows the storage of a number of input selections to be recorded with the machine . the inclusion of a currency monitor requires a monitary compensation . the complete system is , therefore , one that upon receiving monitary compensation , the selection of one or more video tape cassettes is made from a library of video cassettes . the selected cassettes is then automatically obtained from the cassette library and placed into a cassette player which then communicates the information contained on the cassette to appropriate t . v . and speaker units for the consumption of the selector of the cassette .

the present invention is that of a library of video tape cassettes , combined with an automated method of selecting , in random order , any of the singular cassettes contained within the cassette library , automatically placing the selected cassette in conjunction with a cassette playback device , displaying the pre - recorded program material contained on the cassette directly to the customer , in its entirety , through either singular or multiple t . v . units located remotely from the cassette library , reproducing the sound from the cassette by either monaural or stereophonic means by speakers either internal or external to the cassette library , automatically rewinding and replacing the cassette back in its original position within the cassette library , allowing the above procedure to proceed through monitory compensation ( coin operation ), directly to the machine that is complete with &# 34 ; memory &# 34 ; with regards to selections paid for and made . a typical video cassette selection system is represented in fig1 . enclosure 1 contains the video cassette library with complete selection systems , systems control , video cassette playback device , and coin unit 5 . connected directly to the system control unit contained in enclosure 1 is the customer selector 2 . this unit contains the title board 3 which identifies the program material that has been pre - recorded onto each of the individual cassettes located in the cassette library . this board further supplies a selection ordinate 8 that is used as input to the cassette ordinate selector 4 , a set of pushbuttons located in the customer selector 2 . this supplies a uniquely associated ordinate to the system control unit by way of the selection memory located in the library enclosure 1 that identifies the exact cassette in the cassette library . t . v . units 6 , as well as speaker systems , are connected directly to the cassette playback system located in the library enclosure 1 and provide the means upon which the video portion of the playback signal is viewed and the audio portion is heard . the coin unit 5 is the currency monitor by which the machine control system determines that the proper amount of compensation has been made for each selection desired . the operation of the selection machine would be as follows : the customer would deposit the required coin or coins as would be required per selection into the coin unit 5 . the coin unit would signal the system control unit that cassette selection may proceed . the system control unit lights a lamp that informs the customer to &# 34 ; make selection &# 34 ; while at the same time activating the cassette ordinate selector 4 . the customer makes the selection of the cassette of choice and inputs the proper selection ordinate 8 by activating the proper pushbuttons of the cassette ordinate selector 4 . the ordinate signal is entered into the selector memory which is a portion of the system control memory which is a part of the overall system control unit . the selector memory passes the ordinate information to the system control memory which matches the input ordinate with a machine coordinate that identifies the row and column position of the selected cassette within the cassette library . the system control unit then performs the functions necessary to place the selected cassette into the cassette playback device . the playback device is activated upon receipt of a cassette and supplies the proper video signal to the t . v . unit 6 or units 6 provided , as well as supplying the audio signal to the speaker system 7 . the customer receives the complete playback of the program material contained on the selected cassette . upon completion of the cassette playback , the cassette itself signals the playback device and automatic rewind is completed . the playback device signals the system control , the cassette is completed , and the system control causes the removal of the cassette from the playback device and returns the cassette to its proper location in the cassette library . the system control checks to see if there are selections remaining in memory to be played back . if there are , the selection machine continues to make playbacks until there are none , at which time the system control checks to see if there are additional selection choices to be made , and if not , it places the machine in standby mode until the coin unit 5 is again activated . a more detailed description of the eternal elements of the video tape selection machine is now given with references to the electrical control portion of the operation given in fig2 a block diagram of the electrical elements of the selection machine . a worker skilled in the art will understand the operation of each of these elements through the description given here to exactly that function ( s ) each element will be required to perform . this will further allow a worker skilled in the art to readily understand how these elements are functionally interconnected to provide an operative control system for the mechanical elements of the selection machine . referring to fig2 the selection machine contains its own internal power source 15 that supplies both a / c power tape playback device 20 , t . v . amplifier 21 , t . v . units 23 , audio amplifiers 22 , as well as d / c power for motors 17 , 18 , 19 , solenoids 16 , systems control 10 , coin unit 11 , and selector 12 . the selection machine contains a coin unit 11 . this unit is of standard design that is well known to one skilled in the art . its function is to screen and count coins deposited and send said information to the system control 10 for tabulation . upon receipt of a signal from the coin unit 11 , that coin input has been receiving , the system control unit 10 activates the selector 12 , which is composed of a signal lamp to notify the customer that selection may proceed and also a set of pushbuttons that allows the customer to input the proper ordinate code , obtained from the title board 13 , corresponding to the title of the desired program material . this code is input to the selector memory 14 , which is directly connected to the system control memory portion of system control 10 . the function of the selector memory is to store , in selected random order , input selection ordinates received from the selector 12 , and to dispense these input ordinates to the system control memory as they are required by the system control 10 to provide additional playback of cassette . this process continues until all selections stored in memory have been processed . the system control memory is a permanent memory located in the system control unit 10 , in which the row and column coordinates used by the system control unit 10 , locate the row and column position of the selected cassette , within the cassette library . the system control memory contains a set of four bit binary numbers that identify the row and column of every cassette located in the cassette library ; the first two digits signifying the column . these numbers are uniquely associated with each ordinate input supplied from the selector memory 14 , so that an ordinate selection made by title and input by the selector 12 , is given a row and column coordinate location within the cassette library that can be used by the system control unit 10 . the function of the system control memory is to receive the binary ordinate input number from the selector memory 14 , assign the correct binary location number to that ordinate and pass that binary coordinate number onto the system control unit 10 . the system control unit 10 , is the central processing unit of the entire electrical system of the selection machine . its functions are to receive input signals from the coin unit 11 , tabulate the number of selections that compensation has been received for , notifying the customer through selector 12 . to make the tabulated number of selections , activate the selector pushbuttons until the tabulated number of selections has been made , receive the input binary code number from the control memory for each selection , use the binary code number to determine the row and column location of the selected cassette , use the row position ( half of the memory code number ) to supply electric current to the proper row solenoid 16 so that the proper mechanical linkage in the selected row will be accomplished , receive an electrical binary signal from electrical contacts ( fig3 ) by which it can be determined where the horizontal position is located , and compare the position arm binary number with the binary code number received from memory as to the required row containing the cassette . if the two numbers are equal , then the position arm is in the proper location and no current is passed to the horizontal position arm motor 17 . if the current position location number is greater than the code number received from memory , then current is passed to the horizontal position arm motor 17 causing it to rotate in a counterclockwise fashion that causes the position arm to raise until the control unit 10 receives the binary signal from the position arm contacts , which makes the two numbers equal and the current to the motor is stopped . if the current position location number is less than the memory code number , then current is passed to the horizontal position arm motor 17 causing it to rotate in a clockwise fashion causing the arm to lower until the numbers are equal and current is stopped . having properly positioned the horizontal position arm according to the memory code number , the control unit 10 receives the current verticle position binary number that identifies the position of the verticle position arm . again , the current location number is compared to the memory code number received from the control memory . this time if the code number is less than the current number , current is passed causing counterclockwise rotation of the verticle position arm motor 18 and the movement of the verticle position arm is to the left . if the current position number is less than the memory code number , the rotation of the verticle position arm motor 18 is clockwise , and the movement of the position arm is to the right until the numbers are equal and the arm position is correct . the system control unit 10 has now positioned the horizontal and verticle position arms to which the cassette playback device is attached in the position indicated by the intersection of the proper row ( horizontal ) and column ( vertical ) dictated by the binary memory code number . the playback device is in a position to receive the selected cassette from the cassette library . the control unit 10 now uses the column location half of the binary code number and supplies current to the corresponding tape selector motor 19 rotating it in a clockwise manner and with the proper row solenoid 16 already activated , the proper mechanical function occurs that inserts the selected cassette into the cassette playback device , activating such electrical contacts as are required to cause the playback device to become operational and cause complete playback of the entire customer selected cassette . upon completion of playback and automatic rewind , the system control unit 10 receives a signal from the playback device that playback is completed and passes electric current to the selector motor 19 causing it to rotate in a counterclockwise manner and therefore , removing the cassette from the playback device and returning it to its position in the cassette library . the system control unit 10 then deactivates the row solenoid 16 and either receives additional input for selection from the control memory or places the system on standby for the next input signal from the coin unit 11 that will begin the entire sequence again . the playback device 20 is a front loading video cassette player . its function is to accept the selected cassette from the cassette library read the encoded signal contained on the magnetic tape contained within the cassette , and supply the signal to the video amplifier 21 and audio amplifier 22 . the playback device 20 also receives a signal from the cassette when the magnetic tape is finished . this causes the playback device 20 to automatically rewind the tape in the cassette so the cassette always enters the playback device 20 in the start position of the tape . upon completion of the rewind , the playback device 20 signals the system control unit 10 that the playback and rewind is complete and the system control unit 10 causes the cassette to be removed from the playback device 20 and returned to the cassette library . the playback device 20 can be of any given format , ( i . e ., beta , vhs , 1 / 2 in ., 8 mm , etc .) as long as it is the same compatible format as all of the cassettes located in the cassette library . the playback device 20 can be of current design as would be known by one skilled in the art as long as it is of the front loading and not the top loading design . the playback device 20 in this embodiment has been modified because current commercial designs contain many more features , ( i . e ., internal amplifiers , programability , fast forward , etc .) than are necessary to the playbacks supplied by the selection machine . if included , this causes the playback device to be larger and heavier than necessary . therefore , in order to save weight and space and to ease the movement of the position arm , the signal amplifiers for both video amplification 21 and audio amplification 22 have been removed and relocated within the selection machine . all other features have been removed except rewind . these modifications will be readily understood by one skilled in the art . the playback device 20 is now a basic tape transport with read heads and rewind . the additions made to the playback device of adding switches to activate the device when a selected cassette is inserted , will be understood by one skilled in the art . the functions of video amplifier 21 is to receive the encoded video signal from the video &# 34 ; read head &# 34 ; of the playback device 20 and to process that signal in such a fashion that it can be received and used by the t . v . unit ( s ) 23 to provide the customer with the final video presentation of the selected cassette . the audio amplifier receives the audio signal from the audio &# 34 ; read head &# 34 ; of the playback device 20 and processes that signal so that it can be used by the speakers to provide the audio portion of the cassette presentation . an illustrative example of specific components that would perform the necessary functions required of the electrical control portion of the video - cassette selection machine is given here with reference to u . s . pat . no . 4 , 300 , 040 . u . s . pat . no . 4 , 300 , 040 , ordering terminal , shows an electronic control system comprising a keyboard entry means for specification and entry of video cassette title selection through a computer interface called &# 34 ; system control logic ,&# 34 ; to an msc - 8001 computer . u . s . pat . no . 4 , 300 , 040 further shows a credit card reader interfacing with said computer , as well as interface with a playback device , a character display , and a printer . the video - cassette selection machine is controlled in a like fashion . the operation and modification would be readily parent to one skilled in the art . the keyboard entry of the selection machine would be from the customer selector 12 , to the computer system control unit 10 , through a ram memory , the selector memory 14 ; both the selector memory 14 , and the customer selector 12 are able to be separately addressed by the computer system control unit 10 . the coin unit 11 replaces the credit card reader and interfaces directly to the computer system control unit 10 as does the customer selection notification means , this being as simple as a lamp identified as &# 34 ; make selection &# 34 ; that remains lit until all selections paid for are made . computer system control unit 10 interface with the playback device 20 , remains the same except , the required functions are -- playback , rewind , and status of operation . additional interface with the computer system control unit 10 enables the computer of unit 10 to receive status information as to the current position of the vertical and horizontal position arms by reading the encoded signal sent from the electrical contacts 99 , through similar interface circuits as those used to encode signals sent from the keyboard pushbuttons . to compare the current status of the position arms with the required position of the arms according to the selection being processed , and to interface with the position arm motors 17 and 18 , acquire the required positioning of the arms and the playback device . further interfacing with the system control unit computer 10 and the row solenoid 16 , as well as the selection motor 19 , enables the correct cassette selection to be displaced from the cassette library and placed in conjunction with the playback device and allows replacement of the cassette to the library upon completion of playback . the core memory of the msc - 8001 computer comprising the system control unit 10 , contains the operational program required to perform the necessary functions described as well as addressing the system control memory 10 in which the encoded row and column coordinates used for cassette location identification are stored . reference is now made to the mechanical elements that are controlled and operated by the electrical elements described . reference to fig3 shows the overall relationships and positions of the various elements of the system , both electrical and mechanical , less the t . v . units and speaker systems which are shown in fig1 . fig3 shows the coin unit 11 , title board 13 , ordinate selector 12 , power supply 15 , system control box 10 which contains the selector memory , system control memory and system control unit of fig2 . the functions of these elements have previously been given . fig3 further shows the electromechanical elements . the horizontal position arm motor 17 that is used to position the horizontal ( row ) position arm 48 by rotating a tooth gear along a toothed track 56 in either a clockwise or counterclockwise fashion . the movement of this arm is verticle . the required direction of movement is indicated by the system control unit 10 . the position arm is stabilized between two verticle control arms 50 and 51 . these arms keep the position arm 48 level at all times and also contain the electrical contacts 99 that signal the system control unit 10 as to the exact row location of the position arm 48 as each row is contacted by the position arm - slide - 52 . the verticle position arm motor 18 and the verticle position arm 63 are shown . this motor functions in the same fashion , only the movement is horizontal not verticle . this motor drives along the toothed track 59 and is kept perpendicular to the horizontal position arm 48 by horizontal control arms 60 and 61 . such electrical contacts 99 as needed to identify the exact column ( verticle ) location of this arm which are located on one of these arms and contacted by the verticle position arm - slide 62 . fig4 shows the intersection of the horizontal and vertical arms in detail . the horizontal position block 47 is located around the horizontal position arm 48 . it is allowed to move along the entire length of the arm on linear bearings 49 , thereby , keeping friction to a minimum . its movement is controlled by movement of the verticle position block 64 which is attached to it . the verticle position block 64 surrounds the verticle position arm 63 . therefore , any movement of the verticle position arm 63 horizontally moves the block surrounding it and correspondingly , moves the horizontal position block 47 attached to it in a horizontal manner . verticle movement of this connection is similarly controlled by verticle movement of the horizontal block 47 of these two blocks by movement of the opposing position arm , which means , this intersection of blocks can be positioned exactly at any of the intersection points between columns and rows that locates cassettes in the cassette library . attached to this intersection of position blocks 47 and 64 is the video cassette playback device 20 . therefore , by positioning the blocks with the playback device attached at any of the column row intersections , any of the cassettes may be inserted into the cassette playback device 20 . fig5 shows the mechanical elements located at each of the column row intersections . each cassette , fig3 , is held by a cassette holder ; fig3 , attached to a cassette holder shaft 39 . this shaft has the end not holding the cassette inserted into a cassette selector sleeve 34 . this sleeve also holds a linkage completion pin 30 which is held by a completion pin slide holder 26 that allows the completion pin to traverse the width of the holder . this holder is connected to a completion pin control shaft 23 that is inserted into the row solenoid 16 and holds all of the completion pin holders 26 for a given row of cassettes in the cassette library . activation of the row solenoid 16 by the system control unit according to the binary selection number causes the solenoid to draw the completion pin control shaft 23 into the solenoid 16 and , therefore , causes all of the completion pins 30 of the given row to be drawn into the cassette selector sleeves 34 of that row thus causing a connection to be established between the selector sleeves 34 and the cassette holder shafts 39 for all the sleeves and holders located in that row . this connection continues until the row solenoid 16 is deactivated at which time a spring , fig3 , removes the control shaft 23 from the solenoid 16 and therefore , the completion pin from the sleeves 34 . the selector sleeves 34 are further attached to a selector sleeve control arm 80 by a pin 85 located in a slot in sleeve control arm 80 . all of the sleeve control arms 80 in any given column are connected to a verticle shaft that spands the complete height of the given column , fig3 , and is attached at one end to the cassette selector gear 73 which in turn is in conjunction with the cassette selector motor 19 which receives directional activation from the system control unit 10 according to the binary code number designating the column location of the selected cassette . upon receiving activation from the system control , the cassette selector motor 19 rotates in a clockwise manner thus moving the cassette selector gear 73 in a counterclockwise rotation and further moving all of the sleeve control arms 80 attached to the shaft 76 and representing the selector sleeve controls of all of the cassette selector sleeves 34 in a given column in a similar counterclockwise direction . all of the cassette selector sleeves in the given column being attached to these sleeve control arms 80 , therefore , move forward by converting the rotary motion of the control arms to linear motion along the cassette holder shafts 39 . the connection created by the completion pin 30 between the cassette selector sleeve 34 and the cassette holder shaft 39 designating the row location of the selected cassette coupled with the cassette selector sleeve 34 motion designating the column location of the selected cassette causes the selected cassette located at this intersection between row and column to be moved forward and inserted into the cassette playback device 20 which has already been pre - positioned to accept the cassette . the insertion of the cassette into the playback device 20 becomes operational and playback of the cassette proceeds . upon completion of cassette , it is rewound and the system control 10 is signaled . the tape selector motor 19 is activated in a counterclockwise rotation reversing the movement of the gear 73 , shaft 76 , arm 80 , sleeve 34 , and cassette holder 39 thus removing the cassette from the playback device and returning the cassette library to its original condition . the row solenoid 16 is deactivated and the completion pin 30 is removed from the cassette holder 39 . the entire selection system is now ready to receive additional selection requests . in an alternative to the embodiment that has been described , the coin unit 11 , fig2 the title board 13 , fig2 and the customer selector 12 , fig2 being of the same design and performing the same function as has been described in the previous description , are located together in a separate enclosure from the enclosure housing the cassette library and connected to the system control unit 10 , fig2 by wiring . the selector of this unit is connected , as in the previous description , to the selector memory 14 , fig2 . the coin unit 11 , fig2 of this unit is connected to the system control 10 , fig2 . this locational placement allows the customer selector to be placed in a more convenient customer location . it is understood that the size of the video cassette library presented is for illustration only and to increase the size of the library , one need only add additional rows of cassettes or increase the total number of columns of cassettes , or both . in either case , the functions of the elements that comprise the cassette selection machine remain the same . the capacity of the control memory would be increased to reflect the increased library size but system modifications necessary would be known to one skilled in the art . the base concepts of selecting a singular cassette from a group of cassettes remain unchanged , as does the ability to provide playback and display of the selected cassette .

US-47672983-A

a display controller for a communication terminal is connected to a base station through a radio channel for making radio communications with the base station . a first display control unit displays a moving image on a display unit . a second display unit has a first storage unit for storing a plurality of color numbers , and a second storage unit for storing color data in correspondence to each of the color numbers , and displays color data corresponding to a color number read from the first storage unit on the display unit as a graphics image . a determination unit determines , when the moving image and the graphics image are displayed on the display unit , which of the moving image and the graphics image is preferentially displayed depending on whether or not the color number read from the first storage unit is a predetermined number .

in the following , one embodiment of the present invention will be described in detail with reference to the accompanying drawings . in a radio communication terminal for transmitting / receiving video data according to this embodiment , a video signal received from the mm processing unit 211 and a video signal from the camera 204 in fig9 are sent to the lcd control unit 205 in the form of yuv video signal . the lcd control unit 205 converts these video signals to rgb signals for display on the lcd 206 . [ 0049 ] fig1 is a block diagram illustrating the configuration of an lcd control unit and components associated therewith according to this embodiment of the present invention . also , fig2 a , 2b , 2 c and 2 d show possible combinations of images displayed on an lcd 404 . fig2 a shows a displayed moving image 50 which may be sent from a remote terminal or shot by an associated camera . similarly , fig2 b shows characters 51 which are displayed through a cpu 400 that functions as a general control unit . fig2 c shows an animation 52 and characters 51 displayed in combination . while a combination of the moving image 50 and the animation 52 or the characters 51 is additionally contemplated , this may be regarded as a combination of the moving image 50 and a graphics image 53 as shown in fig2 d . next , description will be made on the operation of an lcd controller for displaying the combined images as mentioned . first , how to display a moving image will be explained with reference to fig3 . an mm processing unit 401 outputs a yuv signal , which is a chroma signal of a moving image , to an lcd control unit 403 in this embodiment . the yuv signal is serially output in synchronism with dsync and dclk applied from the lcd control unit 403 to the mm processing unit 401 . here , dsync includes a vertical synchronization signal and a horizontal synchronization signal for providing one image of a moving image , and dclk is a timing clock for outputting a yuv serial signal . [ 0052 ] fig4 is a diagram for explaining the relationship between synchronization signals and a moving image . as described above , moving image yuv data is stored in a memory of the mm processing unit 401 , and the lcd control unit 403 applies the mm processing unit 401 with the horizontal synchronization signal , vertical synchronization signal and timing clock for retrieving the yuv data . in response , the mm processing unit 401 enters one horizontal period of a moving image sequence for staring the delivery of yuv data of a moving image when a predetermined number of horizontal periods of the moving image sequence have passed , i . e ., when a vertical blanking period has passed after it had received the vertical synchronization signal . similarly to the vertical period , horizontal moving image yuv data is sent after the horizontal synchronization signal period and the horizontal blank period in one horizontal period of the moving image sequence in which the mm processing unit 401 sends yuv data . in sequence , as a scan in the horizontal direction is completed for a vertical size of the moving image , a horizontal scanning period continues , in which no yuv data is sent , until entering the aforementioned horizontal period of the moving image sequence of the next frame , in which the mm processing unit 401 starts sending the yuv data . in the following , similar operations are repeated to send continuous moving image yuv data . for the lcd control unit 403 , the operation of sending data in the mm processing unit 401 corresponds to the operation of receiving the data . therefore , the mm processing unit 401 and the lcd control unit 403 require that a variety of parameter values are identical , including the horizontal synchronization signal period ; horizontal blanking period ; horizontal size of the moving image ; one horizontal period of the moving image sequence ; vertical synchronization signal period ; vertical blank period ; vertical size of the moving image ; and one vertical period of the moving image sequence . when these parameter values are fixed in the mm processing unit 401 , the lcd control unit 403 also performs hardware and software operations in accordance with the parameter values . however , since this results in a combination of the mm processing unit 401 and the lcd control unit 403 fixed in one - to - one correspondence , these settings are made programmable in the lcd control unit 403 such that the values are written into registers of the lcd control unit 403 from a higher rank layer . in this way , as illustrated in fig3 the lcd control unit 403 serially receives a yuv signal from the mm processing unit 401 , and converts the received yuv signal to an rgb signal by an rgb converter unit 403 - 1 . then , the lcd control unit 403 supplies the lcd 404 with the rgb signal , a display control signal ( ctrl ), a display clock ( lclk ), and a display synchronization signal ( lsync ). completely in a similar manner to retrieval of moving image data from the mm processing unit 401 , a variety of parameter values inherent to the lcd 404 must have been determined when the lcd control unit 403 supplies the lcd 404 with rgb display data . there are a horizontal synchronization signal period ; vertical blank period ; horizontal size of a panel ; display system — horizontal period ; vertical synchronization signal period ; vertical blank period ; vertical size of the panel ; display system — vertical period , and the like , the values of which depend on the size and characteristics of the lcd 404 . therefore , these values are made arbitrarily settable in registers in the lcd control unit 403 , so that a variety of ldc displays can be provided by writing data from the higher rank cpu . next , description will be made how to display a graphics image . graphics image data is written from the cpu 400 into a frame memory ( first storage unit ) 403 - 2 in the lcd control unit 403 in a bit map form . the number of pixels in the frame memory 403 - 2 corresponds to at least the number of pixels on the lcd 404 . next , description will be made on how data is written into the frame memory 403 - 2 and the data is displayed . [ 0061 ] fig5 shows the flow of operations when a lookup table method is employed . first , data is written from the cpu 400 into the frame memory 403 - 2 in the lcd control unit 403 ({ circle over ( 1 )}). the data may be , for example , an 8 - bit color number . therefore , 256 different colors are available . a lookup table ( second storage unit ) 403 - 3 stores each rgb color data corresponding to the color number , so that for displaying , a color number is read from a certain bit in the frame memory 403 - 2 ({ circle over ( 2 )}) to retrieve rgb color data corresponding to the read color number from the lookup table 403 - 3 . next , the resulting rgb color data is supplied to the lcd 404 together with other signals ({ circle over ( 3 )}). in this event , assuming that rgb color data are each represented by six bits , 262144 possible combinations of colors are provided , where this embodiment features in selecting 256 colors from them . while the lookup table method involves writing a color number into the frame memory 403 - 2 , the color data writing method directly writes color data into the frame memory 403 - 2 . for example , assuming that each rgb color data has six bits , one pixel is represented by 19 bits which consist of 18 - bit color data and one display control bit , later described , in the frame memory 403 - 2 . for displaying , rgb color data may be directly retrieved sequentially from the frame memory 403 - 2 subsequent to an lsync signal , and output to the lcd 404 . description will be next made on a simultaneous display of a moving image and a graphics image . as illustrated in fig2 d , a moving image and a graphics image may be simultaneously displayed on the lcd 404 . for implementing this simultaneous display , in this embodiment , a selection is made as to which is preferentially displayed when determining moving image color data and graphics image color data to be displayed at an arbitrary pixel on the lcd 404 . the aforementioned lookup table method provides 256 color numbers , from which an arbitrary number is assigned to a color number with which a moving image is preferentially displayed . for example , assuming that color number 0 is assigned , when the color number 0 is written into the frame memory 403 - 2 , moving image color data is output for that pixel . when no moving image is displayed , the function of color number 0 is lost , and it may be used as a normal color pallet . description will be next made on how color data is directly written into the frame memory 403 - 2 . likewise , in this case , discriminatory data , corresponding to color number 0 in the lookup table method , is required for discriminating from other color numbers . here , the number of bits for one of rgb color data is increased by one bit which is added to the most significant bit side , such that the preference for displaying a moving image is identified by checking whether or not the additional bit is “ 1 ”. for example , assuming that rgb color data each have four bits , r color data , which should essentially have four bits , is increased by one bit to have five bits . the color data is represented by the four least significant bits , with the fifth bit functioning as a display control bit or a moving image display preference bit . a moving image is preferentially displayed when this bit is “ 1 ” or “ 0 ”. while the 4 - bit color data is herein taken as an example , the number of bits of the color data is arbitrary . alternatively , instead of adding the display control bit for determining whether or not a moving image is preferentially displayed , a moving image may be preferentially displayed when rgb color data themselves are predetermined data . next , referring to fig6 description will be made on how to set an operation clock required by the lcd control unit 403 . a clock sysclk required by the lcd control unit 403 for its internal operation is supplied from the outside or generated by a built - in clock generator . described herein is the clock supplied from the outside . the lcd control unit 403 also requires a clock lcdcclk which is the basis of the timing at which moving image data is captured , and color data is sent to the lcd 404 . sysclk and lcdcclk at high frequencies are not preferable for saving the power consumption of the lcd control unit 403 . however , the lcd control unit 403 may not often be supplied with a clock at a desired frequency for reasons of the system . thus , before the lcd controller 403 is powered to start the operation , an externally supplied clock sysclko is divided by an arbitrary division ratio . after the completion of setting , sysclk is generated from sysclk 0 and supplied to respective circuits in the lcd control unit 403 . the same concept can be applied to lcdcclk . specifically , immediately after the lcd control unit 403 is powered , a division ratio is set for lcdcclk 0 supplied from the outside . then , the lcd control unit 403 starts operating and can be provided with the required lcdcclk . when lcdcclk is set identical to sysclk , a circuit for generating lcdcclk is not required , in which case the single clock sysclk may be connected to lines to circuits , which would otherwise require lcdcclk , within the lcd control unit 403 . in the following , description will be made on a method of setting registers . as will be understood from the foregoing description , the lcd control unit 403 has a number of various parameter values to be stored . data pertinent to the mm processing unit 401 such as the horizontal synchronization signal period , horizontal blank period , horizontal size of a moving image , one horizontal period of the moving image sequence , and so on , and data pertinent to the lcd 404 are written through registers . also , an internal operation mode is set through a register , and graphics image data is also written through registers . these values , though some of them may be set by default , cannot be fixed , so that they must be able to be programmably set in registers , including those values which may be set by default . when there are such a large number of registers which should be set , this embodiment sets the registers in the following procedure . [ 0072 ] fig7 is a diagram for explaining a register setting procedure . the lcd control unit 403 is provided with an address register 403 - 4 and an internal register 403 - 5 . data is actually set in the internal register 403 - 5 which does not allow an external cpu and the like to directly write data thereinto or read data therefrom . the cpu 400 reads and writes data from and into the internal register 403 - 5 by writing an address of the internal register 403 - 5 into the address register 403 - 4 . the address register 403 - 4 is assigned addresses of the internal register 403 - 5 , and the cpu 400 writes an address of the internal register 403 - 5 into the address register 403 - 4 in a manner similar to a general data write with i / o . in this embodiment , the internal register 403 - 5 has addresses 000 - 255 , which are represented by an 8 - bit address signal , as an example . the addresses in the internal register 403 - 5 , however , may be increased or decreased as required . for writing data into a specified address in the internal register 403 - 5 after writing the address of the internal register 403 - 5 , desired data is sequentially written into the address register 403 - 4 , causing the data to be transferred to the specified address of the internal register 403 - 5 . the data written into the internal register 403 - 5 in this way is referenced in an internal operation of the lcd control unit 403 as required . on the other hand , for reading data from the internal register 403 - 5 in which the status indicative of a situation of internal operation has been written , or for referencing previously written data , an address of the internal register 403 - 5 is written into the address register 403 - 4 , and subsequently , the address register 403 - 4 is read . when data is either written into or read from the internal register 403 - 5 , associated data in the internal register 403 - 5 is transferred to the address register 403 - 4 after an address of the internal register 403 - 5 is written into the address register 403 - 4 in order to minimize a time required for such operations . in this way , in reading data from the internal register 403 - 5 , data to be read has already been set in the address register 403 - 4 . a location of the address register 403 - 4 into which an address of the internal register 403 - 5 is written may be identical to or different from a location of the address register 403 - 4 in which data read from the internal register 403 - 5 is stored . described next is an lcd display speed control . as previously described , images displayed on the lcd 404 include a moving image and a graphics image . in comparison of display speed between a moving image and a graphics image , a higher speed is required for displaying the moving image . since the lcd control unit 403 can recognize whether or not moving image data is being displayed on the lcd 404 , the lcd control unit 403 increases the lcd display speed in this situation such that a natural moving image is displayed . on the other hand , when a graphics image is only displayed , the lcd control unit 403 reduces the lcd display speed in accordance with the characteristics of the lcd 404 , and a flicker characteristic of the image to save the power consumption . this may be implemented by reducing the frequency of lclk , previously described , and correspondingly reducing the period of lsync . in addition , a sleep mode is provided for saving the power consumption of the lcd control unit 403 itself . a sleep mode setting bit is assigned to a certain register , such that as the bit indicates a transition to the sleep mode under the control of the cpu 400 , the lcd control unit 403 entirely stops supplying the clock to circuits other than those associated with an interface with the cpu 400 for receiving a release from the sleep mode . by the time the sleep mode is entered from the time the sleep mode was set , image frame data which had existed at the time of setting should have been output to the lcd 404 . for releasing the sleep mode , on the other hand , a release of the sleep mode can be accepted since a circuit which recognizes the release of the sleep mode is in a normal state even in the sleep mode . upon receipt of the release of the sleep mode under the control of the cpu 400 , the lcd control unit 403 resumes supplying the clock to those circuits to which no clock has been supplied in the sleep mode . according to the present invention , a display controller for a radio communication terminal can be provided for optimally and efficiently displaying a moving image and a graphics image on a display unit . also , according to the present invention , a display controller for a radio communication terminal can be provided for saving the power consumption of the display controller . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .

US-98449601-A

a conductor strip includes a first end portion soldered to a printed circuit board , and a second end portion welded to a rechargeable battery . the conductor strip also includes a connecting portion disposed between the first and the second end portions . the connecting portion has a smaller width than that of the first end portion so that the peeling force acting on the first end portion is alleviated .

preferred embodiments of the present invention will be described below with reference to the accompanying drawings . throughout these figures , similar or identical elements are indicated by the same reference signs . fig1 a shows the principal components of a battery pack utilizing conductor strips provided by the present invention . the battery pack may be used as a power source for a cell phone , notebook computer , etc . as illustrated , the battery pack includes a rechargeable battery cell 1 and a protection unit u 1 . the cell 1 has a side surface 1 a in which a cathode and an anode ( not shown ) are provided . the protection unit u 1 is connected to the cell 1 for preventing the cell 1 from over - discharging or being overcharged . the unit u 1 includes an insulating substrate 2 , pads 3 formed on the substrate 2 , electronic devices 4 mounted on the substrate 2 , and two conductor strips 5 . the substrate 2 , made of e . g . a glass - fabric - based epoxy resin , has an upper surface 2 a upon which a wiring pattern ( not shown ) is formed of cupper . the wiring pattern is connected to the electronic devices 4 and the pads 3 . each of the conductor strips 5 has a first terminal 5 a connected to the pad 3 and a second terminal 5 b connected to the cathode or anode of the battery cell 1 . the strip 5 may initially be flat as a whole , but be bent to be connected to the cell 1 , as shown in fig1 a . in the illustrated embodiment , a staple - shaped ( u - shaped ) slit 6 ( k = 0 . 4 mm ) is formed in the first terminal 5 a of each strip 5 , whereby the strip 5 is provided , as shown in fig1 b , with two connecting portions 5 c and a rectangular projection 5 d ( h = 0 . 5 mm ) disposed between the connecting portions 5 c . the width w 1 of each connecting portion 5 c is smaller than the width w 2 (= 2 . 5 mm ) of the conductor strip 5 . the technical significances of the slit 6 will be described later . the first terminal 5 a of each strip 5 is soldered to the pad 3 in the following manner . first , as shown in fig2 a , solder paste is applied to the pad 3 to form a narrow paste land ( first land ) 7 a and a larger , rectangular paste land ( second land ) 7 b spaced from the first land 7 a by a prescribed short distance . a linear region 8 is between the two lands 7 a and 7 b , which is left uncovered by the solder paste . the application of the solder paste may be performed by using a mask formed with openings corresponding to the first and the second lands 7 a , 7 b . the mask is laid on the pad 3 , and then solder paste is spread over the mask with a squeegee . as shown in fig2 b , the conductor strip 5 is placed on the pad 3 so that a part of the solder - void region 8 is observed through the slit 6 . the strip 5 may be automatically set into place with the use of a suction collet . then , the substrate 2 together with the strips 5 ( the “ strip - substrate assembly ” below ) is heated in a furnace to melt the applied solder paste 7 . the molten solder material is spread over the pad 3 under the weight of the conductive strip 5 . then , the strip - substrate assembly is taken out of the furnace to allow the solder material to cool . subsequently , the solder solidifies , to secure the strip 5 to the pad 3 . for fixing the strip 5 to the pad 3 properly , the molten solder needs to be spread uniformly between the first terminal 5 a and the pad 3 . when this ideal condition is attained , the first terminal 5 a as a whole will be fixed to the pad 3 after the strip - substrate assembly is brought out from the furnace . advantageously , the slit 6 formed in the first terminal 5 a enables ready inspection of whether the soldering has been performed properly or not . specifically , when the molten solder is spread uniformly between the first terminal 5 a and the pad 3 , the linear region 8 will disappear . when the solder has failed to be spread properly , on the other hand , the linear region 8 will remain partially or entirely . in the illustrate embodiment , the remaining or disappearing of the region 8 can be simply observed through the slit 6 . in addition to the above advantage , the slit 6 contributes to the improvement in peel strength of the conductor strip 5 . referring to fig3 , the graph shows the relation between the ‘ peel strength ’ and the ‘ distance of pull ’ (“ ps - dp relation ” below ) with respect to the conventional strip 400 ( fig1 ) and the strip 5 of the present invention . the ‘ distance of pull ’ indicates how much the second terminal 5 b or 400 b is pulled upward ( see fig4 a and 4b ). the graph of fig3 shows that the maximum peel strength cmax of the conventional strip 400 is about 20 n ( newton ), whereas the maximum peel strength pmax of the strip 5 of the present invention is nearly 40 n . the reason why the peel strength pmax of the strip 5 is greater than the peel strength cmax of the conventional strip 400 is as follows . as seen from fig1 , the first terminal 400 a of the conventional strip 400 is a simple rectangular plate provided with no countermeasure to resist the peeling force . thus , as the graph of fig3 shows , the peel strength of the conventional strip is relatively low after the maximum peel strength cmax is attained . the strip 5 of the present invention exhibits generally the same “ ps - dp relation ” as that of the conventional strip 400 when the distance of pull is about 0 ˜ 0 . 6 mm ( see fig3 ). then , when the distance of pull is about 0 . 6 ˜ 1 . 6 mm ( the range sw in fig3 ), the strip 5 is peeled off the substrate more easily than the conventional strip 400 . the strip 5 exhibits the weaker peel strength because the peeling is proceeding with respect to the relatively narrow connecting portions 5 c . thereafter , the peel strength of the strip 5 becomes greater than that of the conventional strip 400 . this is because the projection 5 d of the strip 5 clings to the substrate 2 , as shown in fig4 a , thereby serving as an additional resisting portion against the peeling force f . in the above - described embodiment , the strip 5 is supported by the substrate 2 so that the slit 6 as a whole is located on the substrate 2 . the present invention is not limited to this , and the slit 6 may partially be off the substrate 2 , as shown in fig5 . further , the strip 6 may not have the staple - like , angular configuration , but have a smooth , arcuate ( u - shaped ) form , as shown in fig6 . still further , the conductor strip 5 may be formed with two slits 6 , as shown in fig7 . in the illustrated example , each of the two end portions of the strip 5 is formed with one slit 6 and connected to a substrate 2 or 2 ′. fig8 a shows another possible configuration of the strip 5 . in this embodiment , the first terminal 5 a is formed with two rectangular cutouts spaced across a relatively narrow connecting portion 5 c . with such an arrangement again , the remaining or disappearing of the linear region 8 ( fig2 a ) is observed through the rectangular cutouts . thus , the quality inspection of the reflow soldering is readily performed . in the illustrated example , d 1 may be 3 . 0 mm , d 2 may be 3 . 0 mm , and d 3 may be 0 . 25 ˜ 0 . 75 mm . if the above inspection is not required , the strip 5 may be positioned so that the connecting portion 5 c projects from the edge of the substrate 2 entirely as shown in fig8 b or partially as shown in fig8 c . the position of fig8 c is more advantageous to performing self - alignment of the strip 5 than that of fig8 b , since the molten solder 7 can enclose the connecting portion of the strip 5 more thoroughly . like the slit - forming arrangement described above , the cutout - forming arrangements of fig8 a ˜ 8c contribute to the improvement of the peel strength of the strip 5 . referring to fig9 , when an upward external force f is exerted on the second terminal 5 b , the first terminal 5 a is about to be pulled upward . differing from the prior art case ( fig1 ), the effect of the pulling force acts on the first terminal 5 a via the relatively narrow connecting portion 5 c . as a result , part of the external force f may be directed in the normal direction to the substrate surface 2 a , which is the most effective direction for peeling off the first terminal 5 a , while the other part of the external force f will act in slant directions to the substrate surface 2 a , which are less effective peeling - off directions . consequently , a greater external force is required to peel off the strip 5 than in the case of the conventional strip 400 . the cutout formed in the strip 5 may be semi - circular , as shown in fig1 . according to the present invention , the first terminal 5 a of the strip 5 shown in fig8 a may be provided with two protrusions 5 e that extend from the first terminal 5 a toward the second terminal 5 b , as shown in fig1 a . with such an arrangement , the first terminal 5 a is kept attached to the pad 3 more firmly than when only the narrow connecting portion 5 c is provided between the first and the second terminals 5 a , 5 b . the reason is as follows . referring to fig1 , when the upward external force f acts on the second terminal 5 b , the pulling force is transmitted to the first terminal 5 a via the narrower connecting portion 5 c . thus , as in the case described with reference to fig9 , the first terminal 5 a is attached to the pad 3 more strongly than is conventionally possible . further , according to the arrangement of fig1 , the projections 5 e remain to be attached to the substrate 2 even after the connecting portion 5 c is peeled off . accordingly , the binding strength between the first terminal 5 a and the substrate 2 is rendered much stronger . as shown in fig1 b , the connecting portion 5 c may partially protrude from the edge of the substrate 2 . according to another embodiment of the present invention , a plurality of grooves 9 may be formed on the bottom side of the first terminal 5 a of each conductor strip 5 , as shown in fig1 a and 13b . in the illustrated example , each groove 9 extends widthways of the strip 5 and has a triangular cross section ( see fig1 ). in this arrangement , the molten solder material 7 fills the grooves 9 , as shown in fig1 , and then hardens . the above groove arrangement is advantageous to achieving reliable fixation of the strip 5 to the substrate 2 . the reason is as follows . referring to fig1 , the triangular configuration of each groove 9 is defined by a first slant surface 9 a and a second slant surface 9 b . when an upward external force f is exerted on the second terminal 5 b of the strip 5 , the second slant surface 9 b of the rightmost groove 9 may be peeled off the solder material 7 rather readily because the peeling force f 1 acts in a direction generally perpendicular to the second slant surface 9 b . after the second surface 9 b is detached , a peeling force f 2 is exerted on the first slant surface 9 a . the acting direction of this force , however , is generally parallel to the first slant surface 9 a , as seen from fig1 . since the bonding force of the solder 7 is strong in this direction , the first terminal 5 a can remain to be attached to the substrate 2 against a great external force . as shown in fig1 , the conductor strip 5 may additionally be formed with a plurality of grooves 10 extending longitudinally of the strip 5 . with such an arrangement , the strip 5 can remain to be attached to the substrate 2 upon application of a rather great torsional force f 3 about the longitudinal axis la . according to the present invention , the grooves 9 may not be straight or have a triangular cross section . the grooves 9 and / or 10 may be formed in the conductor strip shown in fig1 a , 6 , 7 , 8 a ˜ 8 c , 10 or 11 a ˜ 11 b . the present invention being thus described , it is obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the present invention , and all such modifications as would be obvious to those skilled in the art are intended to be included within the scope of the following claims .

US-91600204-A

a portable , mechanically operated , key - duplicating machine that relies on a punch - cutting system that selectively punches out the particular notches or “ bittings ” of a key blank in response to the details of an adjacent and aligned master key . the duplicating machine comprises a frame having cutting end and an alignment end . the frame defines a longitudinal axis . a carriage is movable along the longitudinal axis and includes a transverse axis . a key clamping assembly has a first key clamp for holding the key blank and a second key clamp for holding the master key . the key assembly is selectively slidable along the transverse axis . a cutting assembly is located at the cutting end and includes a punch - type cutter pin that is adapted to selectively cut pre - shaped notches from the held key blank . the cutter pin includes a guide section that aligns with the notch - profile of the held master key . the key clamping assembly is rotatable about the transverse axis and with respect to the carriage so that the mounted keys face either the cutting end or the alignment end of the frame .

this invention is a key - duplicating machine that is completely manual in operation and requires no power supply to operate . the machine is quick and easy to use , and can easily cut a key blank following the contours of an already cut key ( a key master ). referring to fig1 , a key - duplicating machine 10 is shown including a flat base plate 12 , a slider block 14 , a reference set - up block 16 , and cutting block assembly 18 . the slider block 14 is slidably mounted to base plate 12 between a set - up position and a cutting position , as described in greater detail below . referring to fig2 , 4 , 5 , 6 , and 11 , base plate 12 is generally rectangular in shape and includes two long sides 20 , two relatively shorter ends 22 , an upper surface 24 , and lower surface 26 . base plate 12 further includes contact feet 28 which are secured to the lower surface 26 of base plate 12 , preferably at each corner . collectively , feet 28 are used to raise the machine 10 above a surface making room for the components of the machine 10 to operate correctly , as described below , and to ensure that the machine 10 remains stable on a surface during use . base plate 12 includes two elongated slots 30 formed parallel to each other and parallel to long sides 20 of base plate 12 . the exact location , size and shape of slots 30 are not critical for the present invention to function properly . slots 30 offer a preferred way to control the limits of movement of slider lock 14 with respect to base plate 12 , and to introduce a spring bias to the movement of slider block 14 , as described below . slider block 14 includes a horizontal sliding plate 32 , two vertical slide support plates 34 , and a transverse support pin 36 . sliding plate 32 includes two side edges 38 , each of which are generally parallel to long sides 20 of base plate 12 , and secured to the side support plates 34 by appropriate fasteners such as machine bolts ( not shown ). each vertical slide support plate 34 defines an inside surface 39 and an outer surface 40 . a channel 42 ( see fig6 ) is provided within inner surface 39 of each vertical side plate 34 . each channel 42 is formed parallel to horizontal sliding plate 32 and is sized and shaped to receive both a respective side edge 38 of sliding plate 32 and a respective long side 20 of base plate 12 . the arrangement is such that when sliding plate 32 is secured within the channels 42 of each vertical side plate 34 , the space provided within each channel 42 is sufficient to provide a snug - fit sliding engagement with each long side 20 of base plate 12 , as shown in section view in fig6 . to this end , the width of sliding plate 32 is equal to the width of base plate 12 so that side plates 34 secured to side edges 38 of sliding plate 32 slidingly engage the long sides 20 of base plate 12 . with this arrangement , slider block 14 can be slid along base plate 12 , as described below , while maintaining a high tolerance fit relative to the base plate 12 and cutting block assembly 18 , so that the cutting system will ensure high - tolerance cuts to keys blanks . as shown in fig5 and 6 , adjacent to each slot 30 of base plate 12 , a vertically disposed anchor pin 44 is secured to the lower surface 26 of base plate 12 . a vertically disposed spring pin 46 is secured to a lower surface 50 of sliding plate 32 of slider block 14 and positioned within each slot ( two pins , as shown in fig6 ). each spring pin 46 is sized and shaped to snugly slide within each respective slot 30 and help guide slider block 14 as it moves along the upper surface of base plate 12 and effectively controls the range of movement of slider block 14 ( as defined by the length of the slots 30 ). a spring 48 is attached between each spring pin 46 and its respective anchor pin 44 so that the two springs 48 remain parallel to each other and to long sides 20 . springs 48 effectively introduce a spring bias to slider block 14 with respect to base plate 12 so that slider block is biased toward cutting block assembly 18 , as described below . as shown in fig1 , 2 , 9 and 10 , a key - movement handle 51 is provided , pivotally attached to a portion of base plate 12 at a pivot point 52 between a fully raised position , shown in fig9 , and a fully depressed position , shown in fig1 . movement of key - movement handle 51 about pivot point 52 causes clamped keys ( not yet discussed ) to move within a horizontal plane which is parallel to the upper surface 24 of base plate 12 . a link arm 54 is pivotally attached at a pivot point 56 to a portion of slider block 14 and also at another pivot point 58 to a portion of key - movement handle 51 so that angular displacement of key - movement handle 51 about pivot point 52 translates into linear movement of slider block 14 along base plate 12 . when slider block 14 moves linearly along the upper surface 24 of base plate 12 , its range of motion is limited by the length of slots 30 and , as mentioned above , block 14 is always biased towards the cutting block assembly 18 by springs 48 . transverse support pin 36 is supported in a bore 60 located within each vertical side support plate 34 . support pin 36 is preferably slidably - fit into bores 60 so that pin 36 may freely slide within bores 60 with respect to side support plates 34 . fixed to support pin 36 , between side support plates 34 , is a key - clamping assembly 62 which is shown in fig4 , 6 , 7 , 11 , and 12 . key - clamping assembly 62 is used to hold both a key master 64 and a key blank 66 in perfect alignment with respect to each other . key clamping assembly 62 includes a clamp block 68 , which includes a bore 70 at one end that is sized and shaped to press - fit onto support pin 36 . key master 64 and key blank 66 are both secured to an opposing clamp end 72 of clamp block 68 . key clamping assembly 62 is generally rectangular and includes two opposing flat surfaces 74 at end 75 . each flat surface 74 includes a first stepped surface 76 and a channel 78 . located within each stepped surface 76 is a clamping plate 80 . each clamping plate 80 is secured to within each respective stepped surface 76 by a bore 82 and a fastener 84 . as shown in fig4 , each fastener 84 includes an easy to operate knob 86 so that the clamping assembly may be operated by the operator without requiring tools . appropriate springs 81 are used to bias each clamping plate 80 in an open position so that each respective channel 78 remains open and accessible for insertion of a key 64 , 66 . each of the two channels 78 is formed along the outer edge 75 of clamp block 68 and is sized and shaped to receive a portion of either the master key 64 or the key blank 66 so that a portion of either respective key 64 , 66 extends beyond its respective channel 78 . in this arrangement , a user can rotate knob 86 of each fastener 84 to tighten down each respective clamping plate onto the extended portion of each respective key located in its channel 78 . the purpose of clamp block 68 is to allow both master key 64 and key blank 66 to be held along a non - cutting edge of each key thereby exposing an edge of the key blank 66 to be cut , and the already cut edge detail of the master key 64 . clamp block 68 with keys 64 , 66 in place in their respective channels 78 is pivotable about support pin 36 between a set up position ( shown in fig1 and 9 ), wherein keys 64 , 66 are both directed towards the rear of the base plate 12 and reference set - up block 16 , and a cutting position ( shown in fig1 ), wherein keys 64 , 66 face the front of base plate 12 and cutting block assembly 18 . the swinging action of clamp block 68 , is shown in fig4 . referring to fig1 , 2 , 4 and 11 , reference set - up block 16 includes an alignment post which has a vertical portion 90 and a base portion 92 . base portion 92 of the alignment post includes a slot 94 which is parallel to the long side 20 of base plate 12 . two alignment pins 96 are affixed within base plate 12 so that they extend above upper surface 24 . the pins are sized and shaped to fit snugly within slot 94 so that set - up block 16 may be selectively displaced between a rear position and a forward position . an appropriate fastener 100 is positioned within slot 94 and threaded within a threaded bore 102 located within base plate 12 so that set - up block 16 may be secured at a particular desired location between its range of movement , as shown in fig4 . as shown in fig1 , 2 and 4 , cutting block assembly 18 is located at the front end of base plate 12 and includes an anchor block 104 which is affixed to upper surface 24 of base plate 12 using an appropriate fastener ( not shown ). an upper end 109 of anchor block 104 includes a handle - channel 106 . a plunger handle 108 is pivotally attached to anchor block 104 within handle - channel 106 . anchor block 104 further includes a cartridge - receiving channel 110 , as shown in fig4 . cartridge - receiving channel 110 is sized and shaped to snugly receive a cutting cartridge 112 , described in greater detail below . as shown in fig4 , cartridge 112 may be snugly positioned within channel 110 and secured into a cutting position against anchor block 104 using a bolt 114 that is positioned through a bore 116 of anchor block 104 and preferably includes a hand - operative knob 118 . in this arrangement , an operator may easily remove and secure any one of several cutting cartridges 112 , depending on the type and brand of key being cut , as described below . plunger handle 108 is pivotally attached to upper end 109 of anchor block 104 , as shown in fig4 , at pivot point 119 and is pivotal from a compressed position , generally shown in fig4 , wherein the cutter assembly has completed its cutting stroke , described below , and a fully open position , shown in fig2 , wherein plunger handle 108 is out of the way so that a user may easily remove cartridge 112 . plunger handle 108 includes a handle portion 120 and a pivot support portion 122 . pivot support portion 122 is preferably made from a strong rigid material and includes a contact surface 124 . referring to fig1 , 4 , 8 , and 12 a , cutting cartridge 112 includes a block - frame 126 having an open channel 128 and an intersecting bore 130 . a cutter pin 132 is sized and shaped to slidingly fit within bore 130 between a resting position ( shown in fig4 ) and a fully cut position . cutter pin 132 includes a guide section 134 which is aligned with open channel 128 so that it is exposed and accessible to the user . guide section 134 is generally triangular in section with the apex 135 of the triangle facing towards the rear of the base plate 12 . cutter pin 132 further includes a cutting nib section 136 which is positioned just below the shaped guide section 134 so that the shape of the eventual cut matches the shape of the guide section 134 . cutting nib section 136 includes an angled cutting edge 138 , shown in fig8 . a cutting support surface 140 is formed at the lower end of open channel 128 and is used to support the key blank during the cutting process , as described below in greater detail . cutter pin 132 is designed to move a sufficient distance to ensure that cutting edge 138 extends equal to or preferably slightly below support surface 140 . cutter pin 132 is designed to be moved from a resting position to a depressed cutting position . to provide the required spring bias to keep cutter pin 132 in its resting raised position , shown in fig8 , a spring 142 is provided about an upper portion of cutter pin 132 and is located within a spring bore 144 ( axially aligned with bore 130 ). located adjacent spring 142 and affixed through cutter pin 132 is a spring pin 146 . spring pin 146 passes generally perpendicularly to the longitudinal axis of cutter pin 138 and extends a prescribed distance beyond the cutter pin 132 on either side , as shown in fig8 . spring 142 is a compression type spring and pushes against a lower section of spring bore 144 and against spring pin 146 in a known and understood manner to bias cutter pin 132 to a raised position , as shown in fig8 . elongated cross - slots 148 are provided within block - frame 126 of cutting cartridge 112 on opposing sides of spring bore 144 to receive the extended portions of spring pin 146 and provide for its movement as cutter pin 132 moves its full range . also , engagement of spring pin 146 with elongated cross slots 148 ensures that the entire cutter pin 132 remains aligned and moves in predictable manner during its entire range of movement . as shown in fig8 , cutter pin 132 is supported in bore 130 at both sides of open channel 128 to ensure that cutter pin 132 remains aligned and supported , so that each cut made into the key blank is accurate and predictable . cutter pin 132 includes a contact portion 150 which extends beyond an upper section 152 of block - frame 128 . contact portion 150 is designed to be contacted and depressed by contact surface 124 of plunger handle 108 . referring to fig1 , the relative cutting position of a held key blank 66 and a held and aligned key master 64 is shown with respect to cutter pin 132 . the figure shows how apex 135 of guide section 134 of cutter pin 132 fits snugly into each bitting or notch of key master and in doing so , automatically and correctly positions the held key blank 66 . when cutter pin 132 is depressed , as described below , cutting edge 138 engages key blank 66 and cuts a corresponding notch into key blank 66 . in operation , a user first determines the type and size of key to be cut by referring to appropriate known charts . the user then selects an appropriate key blank 66 and an appropriate cutter cartridge 112 . once selected , the cutter cartridge 112 is inserted and seated within channel 110 and held in position by tightening knob 118 . once tightened within channel 110 , cutter cartridge 112 is automatically aligned and ready to cut keys . handle 108 may be pivoted to its fully open position , as shown in fig2 , to provide more access to channel 110 during insertion of cutter cartridge 112 , if necessary . once the cutter cartridge is positioned within channel 110 , the user then positions the key - clamping assembly 62 so that it faces towards the key - reference block 16 ( as shown in fig1 ) by pivoting the key - clamping assembly 62 and transverse support pin 36 within bores 60 of side support plates 34 . when the key - clamping assembly 62 is in this rearwardly facing position , the user mounts a key master 64 into the lower clamp of key - clamping assembly 62 ( with its “ teeth ” facing away from the clamp ) by positioning key 64 within channel 78 and rotating knob 86 and fastener 84 to tighten clamping plate 80 against key 64 , holding it within channel 78 . the user then places an appropriate key blank 66 in a similar manner into the upper key clamp with “ teeth ” portion ( portion to be cut ) facing away from the clamp . to ensure that both keys are transversely aligned ( with respect to the longitudinal axis of base plate 12 ), both key master 64 and key blank 66 are positioned so that their respective shoulders abut against a respective portion of clamp block 68 , as shown in fig1 . the user has already adjusted reference set up block 16 to an appropriate position by loosening fastener 100 and sliding the base portion 92 along slot 94 . the appropriate position will depend on the type and size of key being cut , but for the most part , one location of the reference set - up block 16 will be appropriate for a majority of key types and sizes . the user then pushes down on key - movement handle 51 so that slider block 14 is drawn rearwardly and so that the clamped keys 64 , 66 are both advanced towards reference block 16 . the user lightly forces both held keys into contact with vertical portion 90 of reference block 16 to ensure that both held keys are aligned with respect to each other as they are held in their respective clamps of key - clamping assembly 62 . key clamps may be adjusted if necessary and the keys moved until they both align longitudinally as well . when both key master 64 and key blank 66 are correctly mounted within their respective lower and upper channels of clamp block 68 , the entire key - clamping assembly 62 ( including fixed transverse support pin 36 ) is pivoted within bores 60 of slider block 14 so that the clamped keys 64 , 66 face forward and lie adjacent to cutting block assembly 18 , as shown in fig1 and 12 . owing to the function of slider block 14 and springs 48 , it will be necessary for the user to simultaneously push down on key - movement handle 51 so that slider block 14 moves away from the cutter cartridge 112 as the clamp block 62 is pivoted from a rearwardly facing position to a forward - facing position . this is required so that the keys 64 , 66 clear the cutting assembly and are allowed to settle in a proper cutting position with respect to cutter cartridge 122 , as shown in fig1 and 12 . once the clamped keys 64 , 66 are facing and are adjacent to the cutter cartridge 112 , the user manipulates the key - movement handle 51 and the transverse support pin 36 to control the relative position of the keys with respect to the cutter pin 132 . the user moves the key master 64 along the guide section 134 until a particular notch of the key master 64 engages the guide section 134 . when this occurs , the user merely releases key - movement handle 51 so that springs 48 biases slider block 14 ( and therefore key master 64 ) into tight engagement with guide section 134 of cutter pin 132 . when apex 135 of guide section 134 rests within the “ valley ” of the particular notch of key master 64 , the user may operate the cutter to cut a matching notch into the adjacent key blank 66 . to operate the cutter , the user pushes down on plunger handle 108 so that the contact surface 124 presses directly down on contact portion of cutter pin 132 . as cutter pin 132 advances downwardly , angled cutting edge 138 forces the matching aligned portion of key blank 66 between it and the support surface 140 . this interaction is similar to a tool and die press . eventually , sufficient force is applied to cut a notch in the relatively soft metal key blank 66 . spring pin 146 ensures that cutter pin 132 returns to its home , rest position above the key master and key blank . spring pin 146 preferably is strong enough to assist in lifting handle 108 as well . once the notch is cut , the user moves apex 135 of guide section 134 to the next notch detail of key master 64 and the process is repeated until the exact notch arrangement of key master is reproduced on the key blank 66 . once all notches of key master 64 are reproduced onto key blank 66 , the duplication process is complete and the keys are removed from clamp assembly by loosening knobs 86 .

US-29568705-A

a known valve controllable by means of an electromagnet includes at least one spring installed with prestressing , the prestressing of which must be within a relatively narrow tolerance range , if the valve is to function properly . since then , when the valve has been assembled , the spring , which is subject to manufacturing tolerances , and other components subject to manufacturing tolerances , have been replaced with other components of different dimensions until a suitable prestressing was arrived at . the invention seeks to avoid this replacement work . the problem is solved by disposing an element that is displaceably installed so as to overcome frictional forces , and one end of a spring is supported on this element . one or more such elements are advantageously usable in multi - position magnetic valves , which for instance belong to vehicle brake systems and in particular to their anti - skid systems .

the valve 2 according to the invention and shown in fig1 has an electromagnet 3 with a coil 4 , a magnetic short circuit 5 and a pole piece 6 , an armature 7 , a first valve seat 8 having a connecting tube 9 for fluid flow , a first closure member 10 , a first closure member holder 11 , a second valve seat 12 having a connecting tube 13 for fluid flow , a second closure member 14 , a closure member holder 15 , a valve closing spring 16 , a first armature restoring spring 17 and a second armature restoring spring 18 , as well as an element 19 disposed in the armature 7 . element 19 is provided for adjustment of the spring forces which will be described later . the electromagnet 3 , its coil 4 , the magnetic short circuit 5 and the pole piece 6 are embodied in the manner known from the prior art . an example can be found in u . s . pat . no . 3 , 989 , 063 . in the vicinity of the second valve seat 12 , the armature 7 has a cylindrical bore 20 for receiving the element 19 . this element 19 is preferably embodied in the manner of a thin - walled tube and at one end has a restriction 21 and a rim 22 facing radially inward . the rim 22 serves as a stop shoulder 23 for the second closure member holder 15 . the second connecting tube 13 begins at the pole piece 6 and protrudes into the armature 7 and into the inside of the element 19 . the second armature restoring spring 18 is embodied in the manner of a plate spring , it surrounds the second connecting tube 13 , and rests on the pole piece 6 . the lower end 24 of the armature 7 is oriented toward the second armature restoring spring 18 . the first armature restoring spring 17 is inserted between this second armature restoring spring 18 and the rim 22 , and the restriction 21 serves to center the first armature restoring spring 17 . on its upper end 25 , the armature 7 has bore steps 26 and 27 of different radii . the lower bore step 26 forms a stop shoulder 28 for the first closure member holder 11 . a stop ring 29 is inserted into the stepped bore 27 and forms an additional stop shoulder 30 oriented toward the first closure member holder 11 . inside the stepped bore 27 , the stop ring 29 is secured by means of bracing means 31 . the stop shoulders 28 and 30 are spaced apart by a distance such that the first closure member holder 11 is axially movable to some extent in the axial direction of the armature 7 . the valve closing spring 16 that is installed with prestressing is located between the first closure member holder 11 and the second closure member holder 15 . the valve closing spring 16 urges the second closure member holder 15 toward the element 19 . the closure members 10 and 14 are preferably embodied in the form of balls , which facing valve closing spring 16 are connected firmly to the respective closure member holder 11 or 15 . the closure members 10 and 14 are aligned with the valve seats 8 and 12 . both the first closure member holder 11 and the second closure member holder 15 are disposed such that they are radially movable to a sufficient extent inside the armature 7 so that an exact alignment of the closure members 10 and 14 with their respective valve seats 8 and 12 is possible for the sake of good sealing . by the disposition of apertures 32 , a flow through the closure member holders 11 and 15 in the longitudinal direction of the armature 7 is possible . the valve 2 according to the invention is shown in the current less state of the coil 4 . as a result , the first armature restoring spring 17 and the second armature restoring spring 18 , via the rim 22 and the element 19 , displace the armature in the direction toward the first valve seat 8 , until after the first closure member 10 has arrived at the first valve seat 8 the valve closing spring 16 is compressed so far that the first closure member holder 15 rests on the stop shoulder 28 of the armature 7 . as a result , the first connecting tube 9 is blocked off relative to the second connecting tube 13 and to a connecting opening 33 that is open toward the armature 7 and is open to a pressure container 34 which is connected to the valve . if the coil 4 is excited with a first current intensity , forces of attraction develop between the pole piece 6 and the end 24 of the armature 7 , increasing as the distance between the end 24 and the pole piece 6 decreases . these forces cause a displacement of the armature 7 in the direction of the pole piece 6 , and both the first armature restoring spring 17 and the second armature restoring spring 18 are compressed somewhat beyond the extent of their original prestressing . the valve closing spring 16 , because it is supported via the first closure member holder 11 and the first closure member 10 on the first valve seat 8 , acts in the direction of the forces of attraction exerted by the pole piece 6 upon the armature 7 . this causes displacement of the armature 7 until such time as the closure member 14 meets the valve seat 12 and closes it . from that moment on , the valve closing spring 16 acts as a so called barrier spring , with the consequence that the armature 7 comes to a stop and the valve seats 8 and 12 are closed . accordingly , a flow of pressure fluid cannot develop either between the first valve seat 8 and the connecting opening 33 or between the second valve seat 12 and the connecting opening 33 . if the coil 4 is excited with a second current intensity that is greater than the first , the armature 7 moves the first closure member holder 11 , together with the first closure member 10 , away from the first valve seat 8 , via the stop 29 . as a result , a flow connection is established , as desired , between the first valve seat 8 and the connecting opening 33 to the pressure container 34 . as can be readily inferred from the description , the springs 16 , 17 and 18 must be correctly adapted to one another in both their stiffness and their prestressing , after they are installed in the valve 2 according to the invention . however , since the spring stiffness deviates within tolerance limits because of manufacturing circumstances , and because the dimensions of the springs 16 , 17 and 18 to be measured in the axial direction also are subject to tolerances while they are not yet installed , care must be taken that in the compressions of the springs associated with the above - described positions of the valve closure members 10 and 14 , a favorable ratio of the force of the spring 16 to that of the springs 17 and 18 prevails . the disposition of the aforementioned element 19 , which is located in the cylindrical bore 20 will now be set forth . in the as yet uninstalled state , the element 19 has an outer diameter that is greater than the inside diameter of the cylindrical bore 20 . when the element 19 is introduced into the cylindrical bore 20 , its outside diameter decreases , which produces pressure forces and accordingly frictional forces between the element 19 and the cylindrical bore 20 that counteract a displacement of the element 19 inside the cylindrical bore 20 . the dimensions of the element 19 are selected such that even though the element 19 can be displaced in the longitudinal direction of the cylindrical bore 20 when it is installed , displacement of the element 19 from the stress of the springs 16 , 17 and 18 and from vibration caused by the motion of the armature 7 is precluded . it will be readily appreciated that by displacing the element 19 in the direction toward the stop ring 29 , the valve closing spring 16 can be prestressed to a progressively greater extent , and that on the other hand , at a given length of the first armature restoring spring 17 , its prestressing will be correspondingly less . as a result , the element 19 and the armature 7 , with its cylindrical bore 20 , forms an infinitely adjustable device for adjusting the prestressing of springs and thereby for adapting the prestressing to a ratio that assures malfunction - free operation of the valve 2 according to the invention at two different excitement stages of the coil 4 . the device is especially economical , because the existing friction lock between the element 19 and the cylindrical bore 20 makes additional securing elements unnecessary . the device also has the advantage that because elements having extended smooth surfaces are used , the installation process does not produce chips that would contaminate the pressure fluid to be controlled and damage components acted upon by the pressure fluid . the tubular element 19 can for instance be produced by chip - producing machining of a relatively thick - walled tube . to reduce the cost , however , it is more practical to generate a stop shoulder 23 , for example , by crimping of a thin - walled length of tubing . the restriction 21 can then also be made by narrowing the tube . if the height of the element 19 is selected as only half as great as its diameter , it is more advantageous to make the element 19 by deep drawing . a conicity produced in deep drawing can then advantageously be utilized for introducing the element 19 into the cylindrical bore 20 . the second exemplary embodiment of the valve 2a shown in fig2 differs from the first primarily in having a different kind of armature 7a . this armature 7a is cylindrical over its entire length , so that a cylindrical bore 20a extends continuously between its ends 24a and 25a . there is room , with radial play , inside the cylindrical bore 20a for a first closure member holder 11a and a second closure member holder 15a . a valve closing spring 16a is again installed between the closure member holders 11a and 15a . armature restoring springs 17a and 18a are again provided . an element 19a corresponding to the element 19 of the first embodiment is embodied simply , because the restriction 21 of the first embodiment has been omitted . to replace the stop ring 29 and stop shoulder 30 of the first exemplary embodiment , a second element 19b is installed in the armature 7a ; this second element may have the same dimensions as the element 19a . closure members 10a and 14a , to which valve seats 8a and 12a belong , are again associated with the closure member holders 11a and 15a . as is readily apparent from a comparison of fig1 and 2 , the exemplary embodiment of fig2 is less expensive to produce . by disposing the second element 19b in the vicinity of the first closure member holder 11a , an additional adjustment option for the prestressing of at least one spring is attained ; that is , the armature restoring spring 17 can now be adjusted with the element 19a , and the valve closing spring 16a can additionally be adjusted with the element 19b . the concept of the invention has been described above in terms of two so - called 3 / 3 - way valves 2 and 2a , which in their middle positions disconnect all three of their connections . naturally the invention is also applicable to valves embodied differently from the exemplary embodiments shown . for instance , the elements 19 , 19a and 19b can logically also be used in valves having two or even four positions , in which it is even more important for the spring forces to be adapted to one another . instead of the elements 19 , 19a and 19b of cylindrical circumference , other elements may naturally be used , which can be displaced inside a bore by overcoming friction locking . such elements may for instance be slit rings or slit lengths of tubing . even starshaped elements having friction faces aimed at the cylindrical bore 20 or 20a are possible . the valve according to the invention is advantageously usable in vehicle brake systems and in their anti - skid systems . the valve according to the invention is also suitable for use in vehicle leveling devices and in clutch and transmission control systems . it will be obvious to one skilled in the art that elements associated with the armature and not attracted thereby should be made nonmagnetic materials . the foregoing relates to preferred exemplary embodiments of the invention , it being understood that other variants and embodiments thereof are possible within the spirit and scope of the invention , the latter being defined by the appended claims .

US-31014389-A

a holster for securing a pistol having a barrel with a chamber , a muzzle , a slide having a front and rear portion , includes an open - bottom enclosure sized to accommodate the slide , wherein a cavity defined in a front portion of the enclosure is sized to receive the muzzle but not allow the slide to enter therein ; a securing member pivotally attached within the enclosure near a rear portion thereof and shaped to correspondingly mate with a rear portion of the slide ; a lever disposed externally to the enclosure and attached via a connecting member to the securing member ; a spring disposed between an interior surface of the enclosure and the securing member ; and a protuberance extending from the interior surface of the enclosure and sized to be received into the chamber when the pistol is secured within the enclosure .

for purposes of the description hereinafter , spatial or directional terms shall relate to the invention as it is oriented in the drawing figures . however , it is to be understood that the invention may assume various alternative variations , except where expressly specified to the contrary . it is also to be understood that the specific apparatus illustrated in the attached drawings , and described in the following specification , is simply an exemplary embodiment of the invention . hence , specific dimensions and other physical characteristics related to the embodiments disclosed herein are not to be considered as limiting , unless otherwise indicated . in reference to the disclosure of the invention throughout fig1 - 18 b , similar references to similar parts are used uniformly throughout the disclosure of a security holster 60 including a holster body 10 and a securing lever 62 connected by a pivot pin 16 and a guide pin 64 to a locking safety lever 12 . the securing lever 62 and the locking safety lever 12 pivot in concert about the axis provided by the pivot pin 16 between an opened position 19 and a closed position 33 . an optional cam locking lever pressure spring 58 is provided to bias the securing lever 62 into the closed position 33 . the securing lever 62 and locking safety lever 12 work synergistically with the dimensions and mechanics of a slide 53 of a slide action pistol as disclosed herein . referring to fig3 through 13 c , the holster body 10 of the security holster 60 includes a front platform 66 separated from a back platform 68 , which are connected by a top wall 70 , a right side wall 72 , and a left side wall 74 , all of which define a pistol receiving space 76 . referring to fig3 and 4 , the exterior surface of the holster body 10 includes several structural components . a trigger finger guide groove 11 is provided in the right side wall 72 of the holster body 10 for a right - handed holster and alternatively would be provided in the left side wall 74 of the holster body 10 for a left - handed holster . corresponding back of holster receiving holes 8 are provided through the right side wall 72 and the left side wall 74 of the holster body 10 adjacent the back platform 68 of the holster body 10 . the corresponding back of holster receiving holes 8 are adapted to receiving a lynch pin 38 or key lockable rod 39 . lynch pin 38 and key lockable rod 39 in the corresponding back of holster receiving holes 8 lock a pistol in the security holster 60 by preventing the movement of the locking safety lever 12 from the closed position 33 to an opened position 19 . corresponding front of holster 9 receiving holes are provided through the right side wall 72 and the left side wall 74 of the holster body 10 adjacent the front platform 66 of the holster body 10 . the corresponding front of holster receiving holes 9 are adapted to receive a lynch pin 38 or key lockable rod 39 . lynch pin 38 and key lockable rod 39 in the corresponding front of holster receiving holes 9 lock a pistol in the security holster 60 by preventing forward movement of the barrel 1 of a pistol secured in the holster body 10 of the security holster 60 . referring to fig4 , a safety lever shield 17 and securing slot 18 for a holster hip mount are provided with the left side wall 74 of the holster body 10 for right - handed holsters and alternatively are provided with the right side wall 72 of the holster body 10 for left - handed holsters . a locking safety lever receiving space 14 a is provided between grooved safety lever stops 15 in the left side wall 74 of a holster body 10 of a right - handed security holster 60 and , alternatively , is provided in the right side wall 72 of a holster body 10 of a left - handed security holster . the locking safety lever receiving space 14 a is generally l - shaped to receive the generally l - shaped locking safety lever 12 . the l - shaped locking safety lever 12 includes a first arm 12 a connected to a second arm 12 b . the first arm 12 a is connected to the pivot pin 16 as disclosed herein . a safety lever thumb actuator 13 is provided on the exterior surface of the second arm 12 b of the locking safety lever 12 . a raised member is positioned on the interior surface of the second arm 12 b of the locking safety lever 12 . the raised member engages a first safety lever securing indent 14 provided in the locking safety lever receiving space 14 a of the holster body 10 when the locking safety lever 12 is in a closed position 33 . the raised member engages a second safety lever securing indent 14 provided in the locking safety lever receiving space 14 a of the holster body 10 when the locking safety lever 12 is in an opened position 19 . referring to fig5 through 10 , the interior surface of the holster body 10 includes several structural components . a front sight protective pocket 24 is provided at the front of the holster body 10 adjacent the front of the slide to lower receiver interlock stopping block platform 25 . a covered rear sight pocket 22 is provided at the back of the holster body 10 adjacent the back of the slide to lower receiver interlock stopping block platform 25 . the securing lever 62 is positioned within the pistol receiving space 76 , and the securing lever 62 is connected by a pivot pin 16 and a guide pin 64 to a locking safety lever 12 positioned outside of the receiving space 76 for actuation by an operator . the securing lever 62 of the security holster 60 is positioned adjacent to the back platform 68 and within the pistol receiving space 76 of the holster body 10 . the securing lever 62 is a three - dimensional , u - shaped member including a main body 62 a with a first arm 62 b and a second arm 62 c protruding at substantially a 90 degree angle along a first axis from each end of the main body 62 a . a pivot pin 16 and a guide pin 64 are provided to connect the securing lever 62 to the locking safety lever 12 . the pivot pin 16 is fixed within the main body 62 a of the securing lever 62 adjacent the first arm 62 b of the securing lever 62 . a first end and a second end of the pivot pin 16 protrude at a 90 degree angle from the main body 62 a along a second axis that is generally perpendicular from the first axis of the first arm 62 b and the second arm 62 c . the first end and the second end of the pivot pin 16 are housed in corresponding first and second receiving spaces provided in the interior surfaces of the right side wall 72 and the left side wall 74 of the security holster 60 . for holsters configured for right - handed operators , the pivot pin 16 transits through the left side wall 74 of the security holster 60 and is fixed within a receiving space of the locking safety lever 12 actionable along the exterior surface of the right side wall 72 of the security holster 60 . alternatively , for holsters configured for left - handed operators , the pivot pin 16 transits through the right side wall 72 of the security holster 60 and is fixed within a receiving space of the locking safety lever 12 actionable along the exterior surface of the right side wall 72 of the security holster 60 . the pivot pin 16 provides an axis upon which both the securing lever 62 and locking safety lever 12 pivot together between an opened position 19 and a closed position 33 . the guide pin 64 is fixed within the main body 62 a of the securing lever 62 adjacent the second arm 62 c of the securing lever 62 . a first end and a second end of the guide pin 64 protrude at a 90 - degree angle from the main body 62 a along the second axis parallel the pivot pin 16 and generally perpendicular from the first axis of the first arm 62 b and the second arm 62 c . for holsters configured for right - handed operators , a cam locking lever driving pin positioning slot 57 provides a slot that transits through the left side wall 74 of the security holster 60 . the first end of the pivot pin 16 protrudes into the cam locking lever driving pin positioning slot 57 . the second end of the pivot pin 16 is flush against the surface of the securing lever 62 . the first end of the guide pin 64 guides the movement of the securing lever 62 and locking safety lever 12 to pivot in concert between the opened position 19 and the closed position 33 . alternatively , for holsters configured for - left handed operators , a cam locking lever driving pin positioning slot 57 provides a slot that transits through the right side wall 72 of the security holster . the second end of the pivot pin 16 protrudes into a cam locking lever driving pin positioning slot 57 . the first end of the pivot pin 16 is flush against the surface of the securing lever 62 . furthermore , an additional second cam locking lever driving pin positioning slot 57 can be provided opposing the first cam locking lever driving pin positioning slot 57 provided in either a left - handed or right - handed holster . in this case , the first end and the second end of the guide pin 64 protrude into each of the opposing cam locking lever driving pin positioning slot 57 provided in the right side wall 72 and the left side wall 74 of the security holster . with this configuration , the first end and the second end of the guide pin 64 guide the movement of the securing lever 62 and locking safety lever 12 to pivot in concert between the opened position 19 and the closed position 33 . alternatively , for left - handed operators , the securing lever 62 is connected by a pivot pin 16 and a guide pin 64 that transit through the right side wall 72 of the holster body 10 to an actionable locking safety lever 12 . with this configuration , the locking safety lever 12 is positioned adjacent to an exterior surface of the right side wall 72 . the locking safety lever 12 is positioned adjacent to an exterior surface of either the right side wall 72 or the left side wall 74 depending upon holster configuration . the locking safety lever 12 and securing lever 62 pivot about an axis provided by the pivot pin 16 between an opened position 19 and a closed position 33 . a guide pin 64 guides the locking safety lever 12 and securing lever 62 between the opened position 19 and a closed position 33 in a cam locking lever guide pin positioning slot 57 . an optional cam locking lever pressure spring 58 is provided between the securing lever 62 and the holster body 10 , which biases the securing lever 62 and lockable safety lever 12 into a closed position 33 . referring to fig5 through 10 , a slide muzzle end stop 29 of the holster body 10 of the security holster 60 is provided adjacent the front platform 66 of the holster body 10 and within the pistol receiving space 76 of the holster body 10 . the slide muzzle end stop 29 is connected to the right side wall 72 , the left side wall 74 , and the top wall 70 of the security holster 60 . the slide muzzle end stop 29 is positioned parallel to and adjacent the front platform 66 of the holster body 10 . the slide muzzle end stop 29 includes a hole or receiving space configured to receive a barrel 1 of a pistol without impeding movement of the barrel 1 through the hole . additionally , the slide muzzle end stop 29 of the holster body 10 is positioned adjacent a barrel muzzle access channel 27 and a slide to lower receiver access channel 28 all positioned adjacent the front platform 66 and generally within the pistol receiving space 76 of the holster body 10 . the interior surface of the front platform 66 is a first length from the slide muzzle end stop 29 . the first length provides a distance that a barrel 1 of a pistol can be inserted into the barrel muzzle access channel 27 that is generally shorter than the length of a cartridge casing in order to prevent ejection of a chambered round in the pistol as the pistol is being holstered in the security holster 60 . optionally , a stop can be provided on the interior surface of the front platform 66 to limit the distance that the barrel 1 is inserted into the barrel muzzle access channel 27 . a slide to lower receiver interlock stopping block platform 25 and slide to lower receiver interlock stopping block 26 is provided on the interior surface of the top wall 70 of the holster body 10 of the security holster 60 . the slide to lower receiver interlock stopping block 26 protrudes from the slide to lower receiver interlock stopping block platform 25 at a distance that allows the slide to lower receiver interlock stopping block 26 to rest against a casing of a cartridge chambered in the pistol . the slide to lower receiver interlock stopping block 26 is positioned at a distance from the slide muzzle end stop 29 of the holster body 10 of the security holster 60 . the distance is generally approximately slightly longer than the barrel length of the pistol so that the slide to lower receiver interlock stopping block 26 can rest against a casing of a cartridge positioned in the chamber of a pistol holstered in the security holster 60 . in order to understand the action of the security holster 60 , the relationship of the positions of a slide 53 and a lower receiver of a pistol suitable for use with the security holster 60 as shown in fig1 should be understood . the pistol has a cartridge chambered into battery . the slide 53 and the lower receiver are locked together by the expansion of the recoil spring , placing the trigger 4 in an activated condition ready to fire when pulled . fig1 indicates that the barrel 1 is locked in battery with the firing chamber fully closed . the barrel muzzle 2 is in its set position relative to the closed chamber 6 of the pistol . guide rod 3 has expanded its spring to its most relaxed status , ready for full compression under the reciprocating opposing forces to be exerted upon the pistol when fired . upon firing the pistol , the force of the discharged round leaving the pistol causes the slide 53 to recoil to the rear of the pistol . as the slide 53 recoils , the chamber 6 becomes opened and at the same time the extractor of the pistol ejects the spent cartridge . as the recoil spring expands , the slide 53 returns to a forward position and a cartridge is removed from the magazine and inserted into battery . with the slide 53 in the most forward position , the barrel 1 is fully locked within the slide 53 , which is locked proportionally to the lower receiver of the pistol . in this condition , the pistol is ready to be fired again . the trigger 4 actuates the reciprocating parts by firing the pistol . a mounting rail 5 is provided with the pistol for mounting a high - intensity illuminator and / or a laser sight . referring to fig2 , the relationship of the positions of the slide 53 and the lower receiver of the pistol are shown as if the pistol were contained in the security holster 60 . when a pistol is secured in the security holster 60 , the slide 53 and the lower receiver are not locked together , as indicated by the open chamber 6 with a portion of the cartridge 7 retained by the extractor . barrel muzzle 2 is shown slightly exposed as the pistol slide 53 is in a partially retracted condition . in the slightly retracted condition , the pistol cannot fire as the interface between the lower receiver trigger assembly and firing pin actuator are interrupted by the partially open chamber of the partially open slide 53 . the trigger 4 will not function with the firing pin and , therefore , the gun cannot fire . referring to fig3 , the right side of the security holster 60 with holster body 10 is shown with a right hand configuration securing a pistol . the back of holster receiving hole 8 is shown capable of receiving a lynch pin 38 or key lockable rod 39 , and the front end locking hole 9 is shown for insertion of lynch pin 39 or key lockable rod 39 . the trigger finger guide groove 11 for a right - handed user is shown . the trigger finger guide groove 11 protects the trigger finger from accessing the trigger 4 of the pistol when holstering and drawing the pistol from the security holster 60 . referring to fig4 , the left side of the security holster 60 with holster body 10 is shown with a right hand configuration securing a pistol . the safety lever shield 17 protrudes from the holster body 10 as a physical shield against a frontal assault , denying access to the locking safety lever 12 and the safety lever thumb actuator 13 . the thumb safety lever securing detents 14 serve to secure the locking safety lever 12 in a closed position 33 as shown in fig4 or in an opened position 19 . the grooved safety lever stops 15 control the pivoting movement of the locking safety lever 12 . the locking safety lever 12 and pivot pin 16 pivot about a first axis between a closed position 33 as shown in fig4 or in an opened position 19 . safety lever shield 17 is positioned in front of the locking safety lever 12 to protect against a frontal grab by securing the safety lever thumb actuator 13 . the securing slot 18 provides for an adjustment factor of over two inches when the holster body 10 is secured with a variable height hip mount 40 . referring to fig5 , a pistol is shown partially inserted into the pistol receiving space 76 of the holster body 10 . the securing lever 62 is shown in an opened position 19 so that the second arm 62 c of the securing lever 62 contacts with the top rear of slide 20 , while at the same time the slide 53 engages the bearing surface of the slide muzzle end stop 29 . the guide pin 64 is in the rear portion of the cam locking lever driving pin positioning slot 57 . as shown , the slide 53 is aligned with the entry point of the barrel muzzle access channel 27 , the slide muzzle end stop 29 and the slide to lower receiver interface channel 28 . the covered rear sight pocket 22 is shown prepared to receive the rear sight 21 of the pistol . the front sight protective pocket 24 is shown receiving the front sight 23 of the pistol . the slide to lower receiver interlock stopping block platform 25 and slide to lower receiver interlock stopping block 26 are shown on the interior surface of the top wall 70 of the holster body 10 of the security holster 60 . referring to fig6 , a pistol is shown partially inserted into the pistol receiving space 76 of the holster body 10 similar to fig5 . the optional cam locking lever pressure spring 58 is shown positioned between the securing lever 62 and the back platform 68 of the holster body 10 . cam locking lever pressure spring 58 is shown compressed as the securing lever 62 is in the opened position 19 from downward pressure on the locking safety lever 36 by the thumb of an operator &# 39 ; s hand , which causes the locking safety lever to move to the opened position 19 as shown in fig6 . in the opened position 19 , the pistol can be inserted into the security holster 60 with a short forward movement of the grip or alternatively removed from the security holster 60 with a short rearward movement of the grip . referring to fig7 , the securing lever 62 is shown in an opened position 19 bearing on the top of the slide 53 as pressure is exerted in a downward motion against the pistol . with the downward motion , the pistol has a partially opened chamber 30 causing by the tipped and forward positioned barrel breach 31 and the protruding barrel muzzle end 32 entering the barrel muzzle access channel 27 . the cartridge 7 is retained by the extractor , which has partially withdrawn the cartridge , previously in battery , out of battery . in this condition , the cartridge is in an unfireable position because the trigger 4 is automatically disengaged when the slide 53 and lower receiver are not positively locked together with the chamber 6 fully closed and locked . with the chamber 6 partially open , the slide to lower receiver interlock stopping block 26 is in line to enter the chamber 6 when the pistol is rotated forward into the holster body 10 . referring to fig8 , a pistol is shown partially inserted into the pistol receiving space 76 of the holster body 10 similar to fig7 . the pistol is shown halfway inserted into the security holster 60 , keeping pressure on the distal end of the securing lever 62 in an opened position 19 and compressing the cam locking lever pressure spring 58 . the cam locking lever driving pin 56 moves through the cam locking lever driving pin positioning slot 57 , causing a corresponding downward movement of the locking safety lever 12 into a closed position 33 . referring to fig9 , the pistol is shown holstered in the security holster 60 . with the pistol secured in a holstered state , the cam locking lever 34 has been pivoted into a closed position 33 such that the first arm 62 b of the securing lever 62 captures the top rear of slide 20 and the second arm 62 c of the securing lever 62 captures the bottom rear of slide 53 , thereby actuating the locking safety lever 12 into a closed position 33 . the lower receiver bearing point 35 of the pistol contacts the second arm 62 c of the securing lever 62 to prevent rearward motion of the lower receiver of the pistol . referring to fig1 , the pistol is shown holstered in the security holster 60 similar to fig9 . the pistol is secured by the securing lever 62 in a closed position 33 in the security holster 60 , thereby allowing the cam locking lever pressure spring 58 to bias the securing lever 62 and the locking safety lever 12 into the closed position 33 . the pistol is removed from its locked position in the security holster 60 by gripping the pistol &# 39 ; s grip and depressing the locking safety lever 12 into an opened position 19 in a relatively short downward and rearward motion while simultaneously moving the pistol away from the holster body 10 . referring to fig1 a , an embodiment of the locking safety lever 12 is shown in a closed position 33 . referring to fig1 b , the embodiment of the locking safety lever 12 shown in fig1 a is shown in an opened position 19 . furthermore , in reference to fig1 c , an alternative embodiment of the locking safety lever 12 is shown in a closed position 33 . referring to fig1 d , the embodiment of the locking safety lever 12 shown in fig1 c is shown in an opened position 19 . referring to fig1 a , a lynch pin 38 is shown inserted in the front of holster receiving holes 9 , which would prevent the forward movement of a barrel 1 of a pistol holstered in the security holster 60 . alternatively , the lynch pin 38 is shown inserted in the rear of holster receiving holes in fig1 b and 12 c , thereby securing the locking safety lever 12 into a closed position 33 . referring to fig1 a , a key lockable rod 39 is shown inserted in the front of holster receiving hole 9 , which would prevent the forward movement of a barrel 1 of a pistol holstered in the security holster 60 . alternatively , a key lockable rod 39 is shown inserted in the rear of holster receiving holes in fig1 b and 13 c , thereby securing the locking safety lever 12 into a closed position 33 . referring to fig1 a through 14 d , a variable height hip mount 40 is shown with multiple screw mounting holes 44 and access holes 45 . the multiple screw mounting holes 44 are adapted to receive screws that secure the holster body 10 through the securing slot 18 to the variable height hip mount 40 . compression screws 46 are shown , which are used to secure the front of the variable height hip mount 40 to the back of the variable height hip mount 40 . referring to fig1 a and 15 b , the front of the variable height hip mount 40 is shown secured to the back of the variable height hip mount 40 with compression screws 46 . a belt 49 is shown inserted through the variable height hip mount 40 . referring to fig1 , a holster body 10 of the security holster 60 is shown secured by a plurality of bolts and corresponding nuts to multiple screw mounting holes 44 of the variable height hip mount 40 secured to a belt with compression screws 46 . the holster body 10 is shown securing the variable height hip mount 40 in a relatively low position . alternatively , the holster body 10 is shown in fig1 secured to the variable height hip mount 40 in a relatively high position . referring to fig1 a and 18 b , a holster body 10 of the security holster 60 is shown secured by a plurality of bolts and corresponding nuts to multiple screw mounting holes 44 of the variable height hip mount 40 secured to a belt with compression screws 46 . the holster body 10 is shown in a forward cant position in fig1 a . alternatively , the holster body 10 is shown in a backward cant position in fig1 b . in accordance with the invention , a pistol can be holstered in the security holster 60 without any need to change the configuration or parts of the pistol . the locking system works in synergy with the structure and mechanical function of the pistol . all components of the security holster 60 can be manufactured from plastic polymer , metal , and / or any other suitable material known in the art . the present invention has been described with reference to the preferred embodiments . modifications , combinations and alterations will occur to others upon reading the preceding detailed description . it is intended that the invention be construed as including all such modifications , combinations and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .

US-91337006-A

a three transmission position shift control includes a forward position , a neutral position and a reverse position , and a switch or button operable for engaging a park brake or park lock when in the neutral position . the control can include a shift lever shiftable or between the forward , neutral and reverse positions . the park switch or button which can be a momentary switch on the lever or a hand grip of the lever is operable for controlling a solenoid that activates the park brake or park lock . park is deactivated or released by shifting into forward or reverse .

referring now to the drawings , in fig1 a transmission shift control 10 constructed and operable according to the present invention for selecting forward , reverse , neutral and park , is shown . control 10 includes a shift lever assembly 12 locatable adjacent to the operator position such as in the operator cab adjacent to the operator seat , or at another convenient location on a vehicle , which can be a work machine such as a tractor ( not shown ). shift lever assembly 12 will be suitably connected to a transmission control ( not shown ) of the vehicle in a well known manner , and includes a shifter lever 14 selectably movable relative to a controller 16 between a neutral position shown aligned along a line 18 , and forward and reverse positions aligned along lines 20 and 22 , respectively , for shifting the transmission of the vehicle between neutral , forward , and reverse operating modes in the well known manner . when lever 14 is in the neutral position it is desirable to have the capability to actuate or engage a park or parking brake or lock , without having to move an additional , separate element such as a lever or pedal , and to automatically deactuate or disengage or release the brake or lock when lever 14 is moved from the neutral position to either of the forward or reverse positions . the park brake or lock will be controlled by a park brake / lock solenoid 24 which will receive power from a power source 26 of the vehicle , through controller 16 . preferably , the park brake or lock will be actuated or engaged when solenoid 24 does not receive power from power source 26 , and disengaged when solenoid 24 is energized by the power source . the park brake or lock is manually actuable or engageable by depressing or otherwise changing the state of a park switch 28 located at a predetermined position on lever 14 . lever 14 is movable from the neutral position by depressing a neutral latch 30 , also on lever 14 . controller 16 is connected to power source 26 , solenoid 24 , and the transmission control by suitable conductive paths , such as wires of a wiring harness of the vehicle or the like , in the well known manner . referring also to fig2 , which shows a diagram 32 including steps of a preferred method of operation of control 10 , beginning at start block 34 , it is determined if shifter lever 14 is in the neutral position , as denoted at decision block 36 . if not , the manual control of the parking brake or lock through switch 28 is disabled , that is , switch 28 cannot be used to actuate the brake or lock , as denoted at block 38 . if shifter 14 is in the neutral position , the parking brake or lock is enabled , as denoted at block 40 . that is , switch 28 can be used . it is now determined if there is a change of state of switch 28 , as denoted at decision block 42 . if not , the state of brake remains the same . if the state of switch 28 changes , it is determined if the brake is actuated , as denoted at block 44 . if the brake is not presently actuated , it is actuated , as denoted at block 46 . if at block 44 the brake is presently actuated , the brake is deactuated or released , as denoted at block 48 . this illustrates the capability to actuate and deactuate or release the brake with shifter 14 in the neutral position using switch 28 . the brake is also automatically deactuated or released when shifter 14 is moved from the neutral position to either of the forward or reverse positions . referring also to fig3 , a preferred embodiment of controller 16 for shift control . 10 is illustrated . controller 16 includes a forward switch 48 , a reverse switch 50 , and a neutral switch 52 , all being single pole , single throw switches having first contacts connected commonly to a power source and second contacts individually connected to an electronic control unit ( ecu ) transmission control 54 that can be of conventional construction and operation . park switch 28 is shown as a normally closed momentary contact switch having a contact connected to the second contact of neutral switch 52 through a diode 58 and an opposite contact connected to one side of a coil of a relay 56 . relay 56 has a first contact connected to the power source and a second contact connected to the second contact of neutral switch 52 through diode 58 . solenoid 24 is connected commonly with park switch 28 and relay 56 through diode 58 to the second contact of neutral switch 52 . as noted , controller 16 is shown in neutral with normally closed park switch 28 pressed which opens the switch to effect a change of its state . in operation , at start up in neutral , neutral switch 52 is open and park switch 28 is in its normally closed state , such that no power is present at solenoid 24 and , as a result , the park brake or lock is actuated . then , when the shifter is shifted into either forward or reverse , neutral switch 52 closes , supplying power to solenoid 24 to automatically deactuate or release the brake . at the same time , because park switch 28 is normally closed , power through neutral switch 52 will flow through park switch 28 to the coil of relay 56 to close or latch it so as to connect solenoid 24 to power therethrough . then , the shifter can be shifted through forward , reverse and neutral with the park brake or lock deactuated or released . to actuate park , when in neutral , park switch 28 can be pressed to change its state to open . this de - energizes relay 56 causing it to open . because neutral switch 52 is open , power is removed from solenoid 24 and the brake is actuated . then , when the shifter is moved to one of the other positions , power is supplied through neutral switch 52 to the solenoid and through the park switch to the relay to latch it and deactuate or release the brake . turning also to fig4 , a simpler version of controller 16 is shown for use with an ecu transmission control 60 having an electronic actuator and circuitry for controlling solenoid 24 via a high side driver ( hsd ). controller 16 includes forward switch 48 , reverse switch 50 , and neutral switch 52 connected essentially as before to an ecu transmission control 60 . park switch 28 connects directly to the power source and to the ecu 60 , and is operable for actuating solenoid 24 in a desired manner , such as described in reference to fig2 above . in fig5 , a shifter grip 64 for lever 14 is shown , including park switch 28 at a predetermined location recessed into the side of grip 64 and upshift and downshift switches 66 and 68 thereabove . neutral latch 30 is shown in essentially the same position as in fig1 . here , it should be noted that the grip configuration shown in fig5 is but one option and that many alternative configurations are contemplated . for example , switch 28 can alternatively be located in the upper region of grip 64 or elsewhere , as desired . it will be understood that changes in the details , materials , steps , and arrangements of parts which have been described and illustrated to explain the nature of the invention will occur to and may be made by those skilled in the art upon a reading of this disclosure within the principles and scope of the invention . the foregoing description illustrates the preferred embodiment of the invention ; however , concepts , as based upon the description , may be employed in other embodiments without departing from the scope of the invention . accordingly , the following claims are intended to protect the invention broadly as well as in the specific form shown .

US-60140803-A

preparation of granules by making nuclei grow , in a fluidized bed , by causing a liquid material to solidify thereon . the liquid material is sprayed in the bed upwards , with the aid of a spraying device provided with a central channel through which the liquid material is supplied , and a channel concentric therewith carrying a powerful gas stream , with the liquid material contacting the gas stream and being carried with the gas stream to a dilute zone where the growth of the nuclei takes place , which zone is created by the gas stream and is completely within the fluidized bed . the liquid material is made to come out of the central channel as a virtually closed , conical film , with a thrust exceeding the thrust of the gas stream , and this film is nebulized to very fine droplets with the aid of the gas stream . in this process a very small amount of high - energetic gas is needed , while no agglomeration occurs in the bed .

the liquid material is sprayed with the aid of a spraying device provided with a central channel through which the liquid material is supplied and a concentric channel provided around it through which a powerful gas stream , in particular air , is supplied . this powerful gas stream hits the liquid material coming out of the central channel , whereby the liquid material is converted to drops that are carried along with the gas stream . in addition , the powerful gas stream creates a zone above the sprayer in the bed where the concentration of nuclei is considerably lower than in the rest of the bed . nuclei are sucked into this dilute zone from the surrounding bed and are in the dilute zone covered with droplets of liquid material , which solidifies on the surface as the particles rise in the dilute zone . the velocity of the gas stream gradually decreases with increasing height , and the height of the bed is so chosen that local disturbances of the bed surface are prevented . an essential part of the present invention is the manner in which the liquid material comes out of the central channel , that is , as a virtually closed conical film . relative to the known processes discussed in the introduction , where the liquid material is as a jet or as drops hit by the gas stream , this has the advantage that a considerably smaller amount of high - energetic gas suffices . this is because the total amount of gas is utilised for nebulizing , and , moreover , the gas hits the liquid film in such a way that nebulizing occurs instantaneously , while the gas still has substantially its initial velocity . a closed conical film can , in principle , be obtained in various ways . for example , the liquid material can with the aid of a tapered part at the end of the outlet channel be converted to a film . advantageously , the conical film is obtained by giving the liquid material a rotation . of course , besides the rotational speed given to the liquid material , also the hydrostatic pressure on the liquid material is important . in general , the liquid material is supplied under a hydrostatic pressure of 2 to 11 bar , in particular 4 to 8 bar . particularly , a sprayer provided with a rotation chamber is used . in this arrangement , the liquid is under hydrostatic pressure pressed through one or more channels leading into the rotation chamber tangentially . the material thus brought into rotation is subsequently let out through an outlet channel which , in general , has a smaller diameter than the rotation chamber . the material , which as a liquid film moves along the wall of the outlet channel , has a horizontal velocity component there resulting from the rotation , and a vertical velocity component depending on throughout . the vertex angle of the cone - shaped film formed after exit from the outlet channel is determined by the ratio of these two velocity components . this vertex angle is in general 50 °- 110 °, in particular 80 °- 100 °. a smaller vertex angle is less desirable , since in that case it would become difficult , if not impossible , to achieve a sufficiently wide angle of impact with the powerful gas stream . on the other hand , a wider vertex angle is constructionally more complicated and offers little or no advantage for nebulizing . according to the invention , the film exiting in this way is hit by the powerful gas stream at an angle of , for example , 30 °- 80 °. a smaller angle of impact is undesirable , as mixing and nebulizing are then considerably poorer . on the other hand , a wider angle of impact is almost impossible to realize in practice . particularly , the angle of impact is set to 40 °- 70 °. this angle of impact is of course determined by the above - mentioned vertex angle of the outcoming film and the angle at which the powerful gas stream possibly converges at the outlet opening . in principle , in the process of the invention a non - converging gas stream can be applied , but advantageously this stream is made to converge at a small angle , e . g . 5 °- 25 °, and particularly 5 °- 15 °. a smaller angle of convergence is less desirable because then the angle of impact becomes too small . on the other hand , for obtaining an angle of convergence exceeding 25 ° an extremely large amount of energy is required . adequate nebulizing in part depends on the velocity of the powerful gas stream . it appears that with a low gas velocity a sufficiently fine nebulization can never be obtained . it has been found that the smallest average drop diameter that can be obtained depends on the relation between the density of the gas , the potential velocity of the gas and the surface tension of the liquid material . it has been found that the ratio : ρ gas = the density of the gas , in kg / m 3 , u gas = the potential velocity of the gas , in m / sec ., and σ 1 = the surface tension of the liquid material , in n / m , should be at least 10 5 m - 1 to achieve a sufficiently fine nebulization , in particular 5 × 10 5 to 50 × 10 5 m - 1 . it has been found that , to this end , the gas velocity should generally be 200 to 350 m / sec , and in particular 250 - 300 m / sec . in principle , a gas with a lower velocity may suffice , if a surface - tension reducing agent is added to the liquid . the required size of this powerful gas stream is small in the present process . generally , a mass ratio of powerful gas stream to liquid material of between 0 . 25 : 1 and 0 . 45 : 1 is used . the temperature of the powerful gas stream is generally chosen equal to or slightly higher than the temperature of the liquid material to be granulated . as mentioned above , the said powerful gas stream not only serves for fine nebulizing of the liquid material but also for creating a dilute zone above the spraying device , for aspiration of nuclei from the bed to this dilute zone , and for carrying the particles upward in this dilute zone . although all these functions can be performed by one powerful gas stream , it has been found that for the transportation of the nuclei in principle a gas can be used which has a lower velocity than necessary for nebulizing . the velocity of such a gas should be higher , though , than the free - fall velocity of the particles aspirated . a gas with a velocity of 50 - 150 m / sec ., in particular about 100 - 125 m / sec ., has been found to be sufficient for this . according to one mode of realisation of the present invention , therefore , a portion of the high - energetic gas is replaced by a gas with a lower velocity . this can be realised by providing the spraying device with three concentric channels , with the inner channel carrying the liquid material , the intermediate one a high - energetic gas stream ( for example with a velocity ≧ 200 m / sec .) and the outer one a less energy - rich gas stream ( for example 100 m / sec .). another essential part of the present invention is that the thrust of the liquid material exceeds the thrust of the gas . thrust is here defined as ρv 2 , where ρ is the density , in kg / m 3 , and v the outlet velocity , in m / sec . the thrust requirement derives from the fact that for good mixing and nebulizing it is necessary that at the place of impact the film moves straight ahead , i . e . into the gas stream , so that the gas energy is optimally utilized . is chosen to be greater than 5 , in particular 8 to 16 . with the present invention it is important that the film surface displays a certain roughness or rippling . this is achieved by turbulences in the liquid material caused by , among other things , the finish of the spraying device . to this end , the outlet channel of the spraying device can be provided with a roughened wall , for example . in addition , turbulence is determined by the liquid velocity of the film . it has been found that for sufficient internal turbulence the dimensionless weber number ( weδ ), expressed as : ρ 1 = the density of the liquid material , in kg / m 3 , u 1 = the potential velocity of the liquid material , in m / sec ., σ 1 = the surface tension of the liquid material , in n / m , and δ = the film thickness upon exit from the central channel , in m . it has been found that , to this end , the liquid velocity should in general be greater than 20 m / sec . advantageously , a liquid velocity of 20 - 50 m / sec . is used , in particular 25 - 40 m / sec . besides the above - mentioned roughness of the wall of the spraying device and the liquid velocity , the film geometry is of importance for the required nebulization . fine nebulizing is promoted by small film thickness . as the film thickness is greatest upon exit from the spraying device and then gradually decreases , it is desirable to make the gas jet hit the film at some distance from the outlet opening . this has the additional advantages that the film , which at first has a relatively smooth surface , becomes rougher further downstream owing to internal liquid turbulence . on the other hand , the gas stream should not come into contact with the liquid material at too large a distance from the outlet opening , since the film falls apart after a certain distance . the present process can be used for the granulation of all kinds of liquid materials , whether in the form of a solution , melt or suspension . the process is particularly suitable for the granulation of water - containing liquid materials , where besides solidification quick evaporation of water should take place . examples of materials granulatable with the present process are ammonium salts , such as ammonium nitrate , ammonium sulphate , or ammonium phosphate and mixtures thereof , single fertilizers such as calcium ammonium nitrate , magnesium ammonium nitrate , compound np and npk fertilizers , urea and urea - containing compounds , sulphur , organic substances such as bisphenol and caprolactam , and the like . in addition , the process is suitable for applying liquid material to nuclei of a composition which differs from that of the liquid material , such as the coating of fertilizers or urea particles with , for example , sulphur . in the process according to the invention , the temperature of the liquid material to be granulated may vary within wide limits . in principle , this temperature should be chosen as near to the solidification point of the material as possible , to achieve quick solidification upon spraying . on the other hand , a certain temperature difference relative to this solidification temperature is desirable , to prevent accretion of crystallizing material around the outlet opening of the feeding device . in general , a liquid material with a temperature about 5 °- 15 ° c . above the solidification temperature is used . as nuclei in the fluidized bed , in principle all kind of pellets can be used , for example prills separately prepared from a portion of the liquid material to be sprayed , or from a melt obtained by melting of the oversize fraction obtained after screening of the granulate . in particular , as nuclei granules are used which have been obtained during screening and / or crushing of the granulate obtained from the bed . the average diameter of these nuclei may vary , partly depending on the nature of the material to be granulated and especially on the desired particle size of the product . in general , nuclei will be used with a minimum average diameter of 0 . 75 mm . the quantity of nuclei introduced may vary . in general , such an amount of particles is introduced that the weight ratio of the particles introduced to the liquid material introduced is between 1 : 1 and 1 : 2 . the bed of nuclei is kept in a fluidized state by an upwardflowing gas , in particular air . this fluidization gas should have a minimum superficial velocity to ensure that the bed is completely kept in a fluidized state . on the other hand , this velocity should not be excessively high , in connection with energy costs and to prevent dust emission . in general with an average particle size of the final product of 2 - 4 mm a fluidization gas with a superficial velocity of 1 . 5 - 2 . 5 m / sec ., in particular 1 . 7 - 2 . 2 m / sec . is used . the temperature of the fluidization gas depends on , among other things , the desired bed temperature , which , as usual , is set by a convenient choice of the temperature of the material to be sprayed , the spraying gas , the nuclei supplied and the fluidization gas . the height of the bed can be chosen within wide limits , for example 50 to 150 cm . the invention will be explained in detail with reference to the accompanying drawings . fig1 represents a longitudinal section of the spraying device with which the process according to the invention can be conducted . fig2 represents a longitudinal section of the outlet part of such spraying device , fig2 a representing schematically , a cross section of the rotation chamber in such a sprayer , viewed from the top . fig3 represents a longitudinal section of the outlet part of a spraying device which has been provided with two concentrically applied gas channels . fig3 a represents schematically , a cross section of the rotation chamber in such a sprayer , viewed from the top . in fig1 the spraying device is given the general designation a . it is composed of a feeding section i and a spraying section ii . the spraying device is mounted in the granulation installation ( omitted from the drawing ) with bottom part b and fitted in the bottom plate c , which has been provided with perforations ( d ) for admitting fluidization air , and discharges via outlet opening g . the spraying device is composed of a central channel 1 , which at one end connects with a liquid line omitted from the drawing and at the other end leads into a rotation chamber 3 . further , the spraying device is provided with a channel 4 which has been fitted concentrically around the central channel , channel 4 being at one end via opening 5 connected to a gas line omitted from the drawing and at the other end provided with a narrowing part 6 , which terminates into outlet opening 7 . the outlet section e surrounded by the dotted rectangle in the figures is represented in detail in fig2 . in fig2 the outlet part of the spraying device is given the general designation e and is composed of a liquid - outlet around which a narrowing gas channel 6 provided with outlet opening 7 has been fitted . the liquid outlet f is composed of a liquid feeding channel 1 , which via openings 8 and feed slots 9 connects with a rotation chamber 3 , which has been provided with a central outlet channel 10 with outlet opening 11 . in fig2 a a schematic cross section along line a -- a of the rotation chamber 3 of fig2 is indicated . the feed slots are indicated by 9 . in fig3 a modified outlet section of the spraying device is represented . it differs from the embodiment according to fig2 in that around the concentric gas channel 6 a second concentric gas channel 12 has been provided , which terminates into outlet opening 13 . to a circular fluidized - bed granulator with a diameter of 29 cm and having a perforated bottom plate ( diameter of the holes 2 mm ), which granulator contained a bed of urea particles with a height of about 80 cm , a 95 wt .% urea solution containing 0 . 6 wt .% formaldehyde , with a temperature of about 140 ° c . and under a feed pressure of 6 bar , was continuously supplied at a rate of 200 kg / h , from the bottom of the bed upwards . the solution was supplied via the central channel 1 of a spraying device as represented in fig1 and 2 . in addition , via a gas channel of this spraying device provided concentrically around this central channel 4 , a powerful air stream was supplied with a temperature of about 140 ° c ., under a feed pressure of 1 . 50 bar and at a rate of 89 kg / h . the spraying device had been fitted in the perforated bottom plate c in such a way that the vertical distance from the outlet opening c of the spraying device to the bottom plate c was about 4 cm . the most important dimensions of the spraying device were as follows : diameter of tangential slots ( 2x ) in the rotation chamber ( 9 ): 1 . 5 mm the liquid came out of the central channel as a rippled , closed , conical film with a vertex angle of 89 °, a film thickness of about 220 μm and a velocity of 29 . 6 m / sec . the film had a fairly high internal turburlence ( weδ approx . 3400 ). the powerful air stream came out of the concentric channel with a velocity of 275 m / sec . and hit the film at an angle of about 51 ° c . at a distance of about 10 mm from the outlet opening ( 10 ) of the central channel . the film thickness at the moment of impact was about 60 μm , while the thurst ratio of fim to air was about 12 : 1 . upon impact , the film was virtually instantaneously nebulized in the air stream . to the bed of urea particles , which had a temperature of about 100 ° c . and was kept fluidized with the aid of an upward air stream with a temperature of about 60 ° c . and a superficial velocity of 2 . 0 m / sec ., also about 180 kg / h of solid urea particles with an average diameter of 1 - 1 . 5 mm and a temperature of about 39 ° c . was supplied , the particles having been obtained in screening and crushing of the granulate from the bed . via an overflow , granules ( temperature approx . 100 ° c .) were continuously discharged from the bed to a drum cooler , where they were cooled to about 43 ° c . countercurrent with an air stream of ambient temperature . the cooled granules were subsequently led to a screening section provided with flat engelman sieves of aperture size 2 and 4 mm . the fine fraction obtained here ( about 165 kg / h ) was returned to the bed , while the coarse fraction obtained ( about 15 kg / h ) was crushed to a δ 50 of 1 . 1 mm with a roller crusher . the fine dust , with a particle size below 750 μm , was separated out with a wind sifter , after which the residual crushed material was returned to the bed . as product screening fraction ( 2 - 4 mm ) about 180 kg of granules were obtained per hour , which had the following properties : the crushing strength was measured by placing an granule between two plates and exerting a gradually increasing pressure on the top plate , until such a pressure was reached that the granule broke . the roundness was determined by bringing the granules on a rotating disc mounted at an angle of 7 . 5 ° and measuring the percentage of granules sliding downward . the impact resistance was determined by shooting pellets against a plate mounted at an angle of 45 ° and measuring the roundness percentage before as well as after the treatment . the fluidization air ( 100 ° c .) which came from the fluidized bed and which contained urea dust was washed in a wet washer , yielding a urea solution of about 40 wt .%, which was added to the urea solution supplied to the bed . the air coming from the drum cooler ( 60 ° c .) and the dust - containing air obtained in the windsifting process were passed through a bag filter . the urea dust so obtained was molten and added to the urea solution supplied to the bed . in the same manner as in example i a urea solution was supplied to a fluidized bed of urea particles , but a spraying device as represented in fig3 was used , which spraying device had been provided with two concentrically applied gas - supply channels . through the inner concentric gas channel ( width of annular outlet 1 . 9 mm ), air was supplied at a rate of 67 kg / h and with a temperature of 140 ° c ., a feed pressure of 1 . 45 bar and a velocity at the outlet of 275 m / sec . through the outer concentric gas channel ( width of annular outlet 3 . 5 mm ; angle of convergence 6 °), air was supplied at a rate of 90 kg / h and with a temperature of 120 ° c ., a feed pressure of 1 . 1 bar and a velocity at the outlet of 125 m / sec . the other process conditions were the same as in example i . in the same manner as in example i , a 99 wt .% urea solution containing 0 . 4 wt .% formaldehyde and having a temperature of 140 ° c . was under a feed pressure of 5 bar and at a rate of 200 kg / h supplied to a circular fluidized - bed granulator ( diameter 44 cm ) with the aid of a spraying device as described in example i . in addition , via the spraying device air of 140 ° c . was supplied at a rate of 78 kg / h under a feed pressure of 1 . 45 bar , via a concentric gas channel whose annular outlet was 2 . 3 mm wide and which converged at the outlet end at an angle of 10 °. the liquid came out of the central channel as a rippled conical film ( weδ about 3000 ) with a vertex angle of 87 °, a film thickness of 240 μm and a velocity of 27 m / sec ., while the air stream came out with a velocity of 260 m / sec . the angle of impact between film and air was 56 . 5 °. the other conditions during ( and after ) granulation were virtually the same as those described in example i . the product granules ( 2 - 4 mm ) obtained after cooling and screening had the following properties : in the same way as in example i , an ammonium nitrate solution ( 200 kg / h ) and a powerful air stream ( 87 kg / h ) were continuously supplied to a circular fluidized - bed granulator ( diameter 45 cm ) which contained a bed of ammonium nitrate particles with a height of 70 cm , which bed ( temperature 128 ° c .) was kept fluidized with an upward air stream with a superficial velocity of 2 . 1 m / sec . and a temperature of 140 ° c ., use being made of a spraying device as described in example i , while also solid ammonium nitrate particles obtained in screening and crushing of the granulate discharged from the bed were added , at a rate of about 195 kg / h . the supplied ammonium nitrate solution contained 4 . 9 wt .% h 2 o and 0 . 3 wt .% ca ( no 3 ) 2 ( calculated as cao ), and was supplied with a temperature of 147 ° c ., under a feed pressure of 8 bar , coming out as a rippled conical film ( vertex angle 88 °; film thickness 190 μm ; velocity 32 m / sec . ; weδ about 3900 ). the powerful air stream was supplied with a temperature of 150 ° c . under a feed pressure of 1 . 6 bar and came out of the spraying device with a velocity of about 300 m / sec . the granulate discharged from the bed ( temperature approx . 128 ° c .) was screened while hot , the screening fraction with a particle size of more than 4 mm being crushed and returned to the bed together with the screening fraction with a particle size of less than 2 mm . the product fraction ( 2 - 4 mm ) was quickly cooled to about 55 ° c . with a fluidized - bed cooler . the granules obtained had the following properties : in the same manner as in example iv , an ammonium nitrate solution was granulated in a circular fluidized - bed granulator with a diameter of 45 cm , the bed temperature being 138 ° c . the supplied ammonium nitrate solution contained 5 . 2 wt .% h 2 o , 0 . 5 wt .% caco 3 and 2 wt .% of a clay . as clay , a product was used which is available from the tennessee mining and chemical corporation under the name of sorbolite , with a particle size below 5 μm , consisting mainly of sio 2 ( 73 wt .%) and al 2 o 3 ( 14 wt .%). the ammonium nitrate solution was supplied at a rate of 150 kg / h with a temperature of 145 ° c . and under a feed pressure of 7 bar , via a spraying device as described in example i except that it had a liquid outlet opening with a diameter of 2 mm . the liquid came out as a conical film with a vertex angle of 91 °, a velocity of 30 m / sec ., a film thickness of 190 μm and a weber number of about 3300 . the powerful air stream ( temperature 147 ° c .) fed via the spraying device was supplied under a pressure of 1 . 6 bar at a rate of 60 kg / h and came out of the spraying device with a velocity of 300 m / sec . in addition , solid ammonium nitrate particles ( temperature about 135 ° c .) obtained from the screening and crushing section were supplied to the bed at a rate of about 148 kg / h . the granulate discharged from the bed was screened while hot , and the product fraction thus obtained ( 2 - 4 mm ) was cooled to about 35 ° c . with a drum cooler . a portion of this product was five times heated and cooled between 15 ° and 50 ° c . the properties of the product obtained and of product subjected to five heating - and - cooling cycles were as follows : ______________________________________ product product after 5 cycles______________________________________nitrogen content 33 . 85 % 33 . 85 % h . sub . 2 o content 0 . 09 wt . % 0 . 08 wt . % bulk density 946 kg / m . sup . 3 946 kg / m . sup . 3rolling capacity 75 % round 75 % roundimpact resistance 100 % 100 % crushing strength 40 bar 40 baroil absorbing capacity 0 . 20 wt . % 0 . 30 wt . % ______________________________________ in the same manner as in example i , a urea solution and solid urea particles were continuously supplied to a rectangular fluidized - bed granulator with a length of 2 m and a width of 1 m , which had been provided with a perforated bottom plate in which 30 spraying devices of the type described in example i had been fitted . the total amount of urea solution supplied was about 6 tons / h , while also urea particles were supplied at a rate of 5 . 5 tons / h . the bed , whose bottom plate was mounted at an angle of about 3 °, was at its lowest point provided with a discharge in the form of a vertical pipe with a control valve . the other process conditions were virtually the same as those of example i . the total amount of spraying air was about 2600 kg / h and about 86 kg per hour per spraying device . as the product fraction ( 2 - 4 mm ) in screening of granulate that had been discharged from the bed and cooled , about 5 . 5 tons of urea granules were obtained per hour , which had virtually the same properties as those described in example i .

US-64302484-A

the present invention provides an electromagnet device which can obtain a desirable attraction force between an iron core and a movable iron piece , a method of assembling the electromagnet device and an electromagnetic relay using the electromagnet device , the electromagnet device including an electromagnet block having the iron core being wound by a coil and an auxiliary yoke fixed to one end portion of the iron core , a yoke connected to the one end portion of the iron core via a permanent magnet , the movable iron piece pivotably supported on a pivoting shaft center located in an end face edge portion of the yoke so that the movable iron piece pivots on a basis of magnetization and demagnetization of the electromagnet block , where the permanent magnet is located on an extension line of an axial center of the iron core and is interposed between the auxiliary yoke and the yoke .

an electromagnet device according to the present invention is described with reference to the fig1 a to 10b . the electromagnet device is incorporated into a latching type electromagnetic relay as illustrated in fig1 a to 8b . in this case , the electromagnetic relay includes a base 10 , an electromagnet device 20 , a contact mechanism 70 , a card 80 and a box - shaped cover 90 . further , the card 80 is connected to the electromagnet device 20 and drives the contact mechanism 70 . as illustrated in fig2 and 3 , in the base 10 has an approximately c - shaped insulation wall 11 which protrudes from an upper surface of the base 10 and is located at a center portion on the upper surface . in addition , the electromagnet device 20 described below is arranged on one side on the upper surface , and the contact mechanism 70 is arranged on the other side on the upper surface . the insulation wall 11 includes fitting grooves 12 formed in both inside surfaces , respectively which face each other . in the fitting grooves 12 , both side edge portions of a yoke 50 are press - fitted . in addition , a center portion of an upper end of the insulation wall 11 is provided with a pair of guide ribs 13 that are in parallel with each other and protrude from an upper surface thereof . as illustrated in fig4 a , 4 b , and 5 , the electromagnet device 20 includes an electromagnet block 30 in which an iron core 40 having an almost t - shaped cross section passes through a central hole 33 of a spool 32 around which a coil 31 is wound , and an auxiliary yoke 45 is caulking - fixed to an upper end portion 41 end ( one end portion ) of the iron core 40 which is passed through the central hole 33 . the electromagnet device 20 further includes the yoke 50 having an l - shaped cross section which is assembled so that a plate - like permanent magnet 21 is interposed between the yoke 50 and an upper end face of the iron core 40 , a support spring 55 attached to a rear surface of the yoke 50 , and a movable iron piece 60 which is pivotably supported on a lower end face edge portion of the yoke 50 via the support spring 55 . the lower end face edge portion of the yoke 50 serves as a fulcrum for pivoting the movable iron piece 60 . in the spool 32 , extended wires of the coil 31 are connected and soldered to coil terminals 35 , wherein the coil terminals 35 are press - fitted in corner portions of a lower guard portion 34 . in the spool 32 , an alignment protrusion 37 protrudes from an upper surface of an upper guard portion 36 . the alignment protrusion 37 aligns a position of the auxiliary yoke 45 . the iron core 40 includes a cylindrical iron core body 40 a , a cylindrical upper end portion ( one end portion ) 41 which is formed via a step portion 40 c in an upper end of the iron core body 40 a and has a smaller diameter than the iron core body 40 a , and a disk - like magnetic pole portion 42 which is formed in a lower end of the iron core body 40 a and has a larger diameter than the iron core body 40 a . a curving portion 40 b is formed along a circumferential direction in the boundary of the iron core body 40 a and the magnetic pole portion 42 . the auxiliary yoke 45 has a caulking hole 46 in the center . in the auxiliary yoke 45 , connection narrow - width portions ( also referred to as narrow - width portion ) 47 extend in parallel with each other from adjacent corner portions of the auxiliary yoke 45 respectively . the connection narrow - width portions 47 are magnetic resistance portions with a small cross - sectional area compared with a side surface of the auxiliary yoke 45 . in an upper surface edge portion of the caulking hole 46 , an annular step portion 46 a , one step lower than the upper surface , is formed . the plate - like permanent magnet 21 has a width dimension substantially the same as a width dimension of the auxiliary yoke 45 . the yoke 50 having an almost l - shaped cross section includes a vertical portion 51 provided with notch portions 52 which are formed at both sides of the vertical portion 51 respectively . the notch portions 52 function to elastically engage the support spring 55 . the yoke 50 further includes a horizontal portion 53 which laterally extends from an upper end of the vertical portion 51 . as illustrated in fig5 and fig6 , in the support spring 55 , a pair of elastic arm portions 56 extend in parallel with each other from both side edges of the support spring 55 respectively and an elastic support portion 59 extends from a lower edge portion of the support spring 55 . an engaging pawl 57 is protrudes from a leading end of either of the elastic arm portions 56 and a latching pawl 58 stands up from a leading end of the other elastic arm portion 56 . the movable iron piece 60 includes an attracted surface 66 and a step portion 62 . the attracted surface 66 has an approximately rectangular shape and is formed in a rear half portion on an upper surface of the horizontal portion 61 . the step portion 62 is lower by one step than the attracted surface 66 and is formed in a front half portion . a contact protrusion 63 of a rectangular shape having a smaller area than the attracted surface 66 protrudes from the step portion 62 through a protruding process . the movable iron piece 60 has notch portions 65 for engaging the card 80 at both side edges of a leading end portion of the vertical portion 64 of the movable iron piece respectively . the boundary between the horizontal portion 61 and the vertical portion 64 serves as a pivoting shaft center 67 . the pivoting shaft center 67 is latched to a lower end edge portion of the yoke 50 . as illustrated in fig2 , the contact mechanism 70 includes first and second fixed touch pieces 71 , 72 arranged to face each other at a predetermined distance , and a movable touch piece 73 arranged between the first and second fixed touch pieces 71 , 72 . a movable contact 73 a is provided in the movable touch piece 73 . the first and the second touch pieces 71 , 72 include a first and a second fixed contact respectively . the movable contact 73 a is alternately attached to and detached from the first fixed contact 71 a and the second fixed contact 72 a . two sets of latching pawls 74 , 75 are provided in an upper end portion of the movable touch piece 73 . the latching pawls 74 , 75 vertically latch a remaining end edge portion 83 of the card 80 . as illustrated in fig2 and 3 , in the card 80 , the contact protrusion 81 protrudes from one end of edge portion 83 , a pair of elastic arm portions 82 extend from both sides of the contact protrusion 81 respectively , and a pair of latching arm portions 84 extend from both ends of the remaining end of the edge portion 83 respectively . the box - shaped cover 90 has a box shape which can fit in the base 10 . the box - shaped cover 90 is provided with a position - regulating projecting portion 91 that bulges downward from a ceiling surface ( refer to fig8 ) thereof , and a degassing hole 92 provided in the bottom of the position - regulating projecting portion 91 . the position - regulating projecting portion 91 prevents the card 80 aligned under the position - regulating projecting portion 91 from lifting . the box - shaped cover 90 has a marking recess 93 in an end portion of an upper surface thereof . accordingly , when assembling the electromagnetic relay , first , the permanent magnet 21 is integrally joined to the horizontal portion 53 of the yoke 50 ( refer to fig7 a and 7b ). in this case , since the side surface of the horizontal portion 53 and the side surface of the permanent magnet 21 are flush with each other , alignment accuracy of the yoke 50 with respect to the permanent magnet 21 is increased . next , the iron core 40 is inserted in the central hole 33 of the spool 32 around which the coil 31 is wound , and the upper end portion 41 which is passed through the central hole 33 is fixed to the auxiliary yoke 45 by spin caulking . in this way , the electromagnet block 30 is assembled . in this case , since the upper end portion 41 is subjected to spin caulking in a state in which the upper end portion 41 is fitted in the caulking hole 46 , the iron core 40 can be fixed to the auxiliary yoke 45 with high alignment accuracy . moreover , since the upper end portion 41 is fixed to the annular step portion 46 a of the auxiliary yoke 45 by spin caulking , the caulked and crushed upper end portion 41 can be received within the annular step portion 46 a . accordingly , the permanent magnet 21 can be kept in area contact with the auxiliary yoke 45 in a state in which the crushed upper end portion 41 does not protrude from an upper surface of the auxiliary yoke 45 . the term “ spin caulking ” means a method of pressing down the end portion of the upper end portion 41 while rotating a jig , thereby caulking the end portion into the caulking hole 46 of the auxiliary yoke 45 . the movable iron piece 60 is positioned in the lower end edge portion of the vertical portion 51 of the yoke 50 . the engaging pawl 57 and the latching pawl 58 of the support spring 55 are engaged with and latched to the notch portions 52 of the yoke 50 respectively . in this way , the movable iron piece 60 is pivotably supported . then , the connection narrow - width portion 47 of the electromagnet block 30 is joined to the vertical portion 51 of the yoke 50 by laser bonding . thus , the electromagnet device 20 in which the plate - like permanent magnet 21 is interposed between the auxiliary yoke 45 and the horizontal portion 53 is completed . since the connection narrow - width portions 47 that extend as two strips are laser - welded to the yoke 50 , they can be easily welded in a simple manner , and the auxiliary yoke 45 and the yoke 50 can be stably fixed without wobbling . then , both side edge portions of the yoke 50 are press - fitted in the fitting grooves 12 provided in the inside surfaces of the insulation wall 11 of the base 10 . in the present embodiment , the connection narrow - width portions 47 are fixed to the yoke 50 by laser welding . however , the fixing method is not limited to laser wielding and any fixing method can be used which connects and fixes the connection narrow - width portions 47 to the yoke 50 . on the other hand , assembling is performed so that the second fixed touch piece 72 , the movable touch piece 73 , and the first fixed touch piece 71 of the contact mechanism 70 are press - fitted on the other side in the upper surface of the base 10 which is partitioned by the insulation wall 11 . subsequently , the contact protrusion 81 of the card 80 is brought into contact with an upper end portion of the movable iron piece 60 , and the pair of elastic arm portions 82 are engaged with the pair of engaging notch portions 65 provided in the vertical portion 64 of the movable iron piece 60 respectively . the latching pawls 74 and 75 of the movable touch piece 73 are latched to the remaining end edge portion 83 of the card 80 . finally , the following process is performed and assembling work is completed . that is , the box - shaped cover 90 is fitted into the base 10 , and sealing is performed by injecting a sealing material ( not illustrated ) into the bottom of the base 10 . after that , inner gas is degassed through the degassing hole 92 of the box - shaped cover 90 , and then the degassing hole 92 is subjected to heat caulking . next , an operation of the magnetic relay having the above - described structure will be described . as illustrated in fig8 a , when a voltage is not applied to the coil 31 , while the contact protrusion 63 of the movable iron piece 60 is separated from the magnetic pole portion 42 of the iron core 40 , the movable contact 73 a is in contact with the first fixed contact 71 a . in addition , the permanent magnet 21 is located on an extended line of the axial center of the iron core 40 and is interposed between the auxiliary yoke 45 and the yoke 50 . as a result , in regard to the magnetic flux of the permanent magnet 21 , as illustrated in fig9 a , the magnetic flux from out of the permanent magnet 21 flows through a magnetic circuit ( an auxiliary magnetic circuit ) m1 which is constructed of the auxiliary yoke 45 , and leakage flux from out of the permanent magnet 21 forms a magnetic circuit ( a main magnetic circuit ) m2 via the yoke 50 . the movable iron piece 60 is maintained by balance between a spring force of the movable touch piece 73 and the magnetism generated by the magnetic flux which flows through the magnetic circuit m1 and the magnetic flux that flows through the magnetic circuit m2 . although the magnetic circuit m1 is magnetically saturated , since the yoke 50 and the auxiliary yoke 45 are connected to each other via the connection narrow - width portions 47 having a cross section smaller than that of a contacted surface of the yoke 50 , the magnetically saturated state more easily forms . when the voltage is applied so that magnetic flux of the same direction as the magnetic flux of the permanent magnet 21 is generated in the coil 31 , the magnetic flux generated by the voltage applied to the coil 31 flows to the magnetic circuit m2 ( refer to fig9 b ), and an attraction force which attracts the movable iron piece 60 increases . for this reason , the movable iron piece 60 pivots on the pivoting shaft center 67 , resisting against the spring force of the movable touch piece 73 . thus the movable iron piece 60 is attracted to the magnetic pole portion 42 of the iron core 40 , and the contact protrusion 63 is attached to the magnetic pole portion 42 . when the contact protrusion 63 is attracted to the magnetic pole portion 42 , the vertical portion 64 of the movable iron piece 60 presses the movable touch piece 73 via the card 80 , and the movable contact 73 a separates from the first fixed contact 71 a , and comes into contact with the second fixed contact 72 a ( fig8 b ). subsequently , even though the application of the voltage to the coil 31 is stopped , as illustrated in fig1 a , a combined magnetic force of the magnetic flux which flows to the magnetic circuit m1 which includes the auxiliary yoke 45 from the permanent magnet 21 , and the magnetic flux which flows to the magnetic circuit m2 which includes the yoke 50 , the movable iron piece 60 , and the iron core 40 is larger than the spring force of the movable touch piece 73 . for this reason , the movable iron piece 60 maintains this current state , without pivoting . when a return voltage of a direction reversed to the previously described application voltage is applied to the coil 31 ( refer to fig1 b ) so that the magnetism of the permanent magnet 21 acting on the movable iron piece 60 will be canceled , the movable contact 73 a separates from the second fixed contact 72 a , comes into contact with the first fixed contact 71 a , and returns to the original state . even though the return voltage is applied in the present embodiment , since the magnetic circuit m1 is in a magnetically saturated state , the magnetic flux does not flow through the magnetic circuit m1 . whole magnetic flux of the coil is generated by the applied return voltage and flows to the magnetic circuit m2 which includes the yoke , the movable iron piece , and the iron core , and a return operation is carried out . it results in a latching type electromagnetic relay having high magnetic efficiency and consuming less power . the present invention is not limited to the above - described embodiment , but various modifications thereof are possible . in the above embodiment , at the time of assembling the electromagnet device 20 , the connection narrow - width portions 47 are fixed to the yoke 50 by laser welding . however , the assembling method is not limited to laser wielding . for example , as illustrated in fig1 , in regard to the auxiliary yoke 45 and the yoke 50 , the auxiliary yoke 45 and the yoke 50 may be joined to each other by applying an epoxy - based adhesive 95 to an inside surface of the plate - like permanent magnet 21 . since the auxiliary yoke 45 and the yoke 50 can be connected to each other only by a simple measure of applying an adhesive 95 , assembling performance of the electromagnet device 20 improves . in addition , the method of applying the adhesive 95 and the method of laser - welding the connection narrow - width portions 47 to the yoke 50 both may be simultaneously employed . in this embodiment , the electromagnet block 30 is assembled after the permanent magnet 21 is integrally joined to the horizontal portion 53 of the yoke 50 . alternatively , for example , the permanent magnet 21 may be integrally joined to an outer surface of the auxiliary yoke 45 after the electromagnet block 30 is assembled . with this method , alignment accuracy of the permanent magnet 21 with respect to the iron core 40 is improved . it is needless to say that the electromagnet device according to the present invention is applied not only to an electromagnetic relay but also to other electronic equipment . there has thus been shown and described an electromagnetic device and an electromagnetic relay which fulfills all the advantages sought therefore . many changes , modifications , variations and other uses and applications of the subject invention will , however , become apparent to those skilled in the art after considering this specification and the accompanying drawings which disclose the preferred embodiments thereof . all such changes , modifications , variations and other uses and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention , which is to be limited only by the claims which follow . although the invention has been described in detail for the purpose of illustration based on what is currently considered to be the most practical and preferred embodiments , it is to be understood that such detail is solely for that purpose and that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover modifications and equivalent arrangements that are within the spirit and scope of the appended claims . for example , it is to be understood that the present invention contemplates that , to the extent possible , one or more features of any embodiment can be combined with one or more features of any other embodiment

US-201313954054-A

an improved low specific speed pump is disclosed , which provides for greater consistency of pump operating efficiencies obtainable by pumps of any given group of like size pumps . in the present pump , the internal dimensions of the pump chamber and discharge passage are enlarged to provide for a reduction in flow velocities therewithin compared to a conventional pump of a given design flow capacity and a controlled size restrictor is arranged adjacent the pump discharge in order to reduce the resultant increase in flow capacity to such given design value .

reference is first made to fig1 wherein 10 designates a centerline discharge , low specific speed centrifugal pump having a casing 12 formed to define a pump chamber 14 , an inlet opening 16 connected to a fluid supply , not shown , and a discharge passage 18 having an outlet end 20 connected to a discharge pipe 22 ; and an impeller 24 mounted for rotation within pump chamber 14 for purposes of pumping fluid between inlet opening 16 and outlet end 20 . pump chamber 14 is shown as being of the volute type , wherein the distance between its radial , outer boundary surface 26 and the rotational axis 28 of impeller 24 progressively increases in the direction of rotation of the impeller from adjacent a cut - water 30 to an inlet end or throat area 32 of discharge passage 18 . however , the present invention is also adpated for use in pumps of the type in which outer boundary surface 26 is disposed essentially concentrically of axis 28 . further , the present invention is equally adapted for use with pumps having closed or open impellers . the full line showing in fig1 - 3 depicts a pump formed in accordance with the present invention , which differs from a known pump having the same operating characteristics principally with respect to the internal size and shape of its pump chamber and discharge passage . for purposes of comparison , broken lines 26 &# 39 ; are used in fig1 and 3 to indicate the placement of the outer boundary wall of the known pump . by referring to fig4 it will be understood that for known low specific speed pumps , i . e ., pumps having specific speeds below about 600 - 700 , loss in efficiency is primarily due to losses occasioned by frictional effects , although mixing losses tend to become a progressively greater loss factor as the specific speed of the pump increases . it will also be understood that frictional losses for pumps of any given type and size , which are provided with cast metal casings , are not constant , due to minor variations in size and surface finish of the chamber and throat areas of a pump typically encountered in such castings . as by way of example , for the case of 11 / 2 × 2 - 9 size pumps ( the numerals designating discharge opening diameter , inlet opening diameter and nominal impeller diameter in inches ) manufactured by goulds pumps , incorporated of seneca falls , n . y ., individual pumps of a group of ten such pumps , will typically have actual performance efficiencies of between about 45 percent and 50 percent , thus creating an actual difference in efficiency between pumps of such group of about 10 percent . while the design efficiencies of a pump will vary directly with its discharge flow rate and / or specific speed , there still remains a range of differences in actual efficiencies obtained by pumps within a group of like size pumps . in that this variation is not acceptable , it is normally necessary to perform hand work on one or more of the pumps in order for them to meet desired minimum performance standards . again referring to fig1 it will be understood that in accordance with the present invention , the interior of the casing of a given size of pump is cast oversize , as compared to a like sized known pump , so as to achieve a decrease in the velocity of fluid within pump chamber 14 and through the throat area of discharge passage 18 . it has been found that for the previously mentioned 11 / 2 × 2 - 9 size pump , an increase of the size of pump chamber 14 effected by arranging points along boundary surface 26 at a distance from rotational axis 28 , which are more than about 15 percent to 20 percent greater than the distance measured between 26 &# 39 ; and such rotational axis , while maintaining the same axial dimension or width of the pump chamber and discharge passage , there may be achieved about a 15 percent decrease in flow velocity within the pump chamber , which is sufficient to substantially diminish frictional losses due to minor variations in size and surface finish normally found in casings of this size pump . it is , of course , possible to further enlarge pump chamber 14 of any given size pump to achieve reductions in flow velocities of 50 percent or more , but there are certain practical limitations including the size of discharge pipe 22 and the cost of casting a casing having an exterior size sufficient to provide a safe casing wall thickness , as measured outwardly of boundary surface 26 . in general , the relative percentage increase of the size of the interior of a pump will be required to increase as the specific speed of such pump decreases . thus , for example , percentage increases in the range of 30 percent to 40 percent are contemplated as being required for pumps having specific speeds below about 450 . this is due to the fact that interior flow velocities tend to increase as specific speed decreases . as by way of example , pumps having specific speeds of 70 and 450 may have internal velocities on the order of about 75 feet / second and 125 feet / second , respectively . it is to be noted that the position of cut - water 30 and the radial distance between such cut - water and the periphery of impeller 24 or its rotational axis 28 remain unchanged from that of an unmodified or known pump . as will be apparent , simply increasing the size of pump chamber 14 of any given size pump would serve to produce a much larger pump discharge flow rate than desired . accordingly , in the present invention , a restrictor 34 is placed adjacent outlet end 20 of discharge passage 18 for purposes of throttling the output of the pump to a value equal to the design flow rate of the unmodified pump , i . e ., the design flow rate resulting from a pump having a chamber and discharge passage boundary wall 26 &# 39 ; determined by standard design criteria . restrictor 34 is preferably formed by integrally casting a constriction adjacent the outlet end of discharge passage 18 and then machining an accurately sized flow opening or bore 36 therethrough , as by performing drilling and reaming operations . the constriction , as formed , may completely close the discharge passage , but is preferably formed with a small pilot hole to facilitate the machining operation . frictional loss occasioned by flow opening 36 is relatively small , due to its relatively smooth machined surface and short axial length . the following examples of low specific speed pumps formed in accordance with the present invention and prior practice are given as by way of illustration : __________________________________________________________________________ prior new design design area of area of spec . pump area of casing casing speed q impellersize restrictor throat throat ( ns ) ( gpm ) type__________________________________________________________________________11 / 2 × 2 - 7 . 29 . 35 . 22 533 55 closed11 / 2 × 2 - 9 . 60 . 61 . 39 508 120 closed11 / 2 × 3 - 11 . 74 . 88 . 57 511 200 closed 1 × 2 - 10 . 57 . 60 . 40 466 180 open 2 × 3 - 13 1 . 23 1 . 66 . 81 500 350 closed__________________________________________________________________________ it will be understood that pump size per se is not limited on this present invention , as long as the pump has a relatively low specific speed at which sufficient variations in frictional losses between like sized pumps warrant practice of the present invention . by increasing the size of the pump chamber and discharge passage and employing an accurately sized flow opening , as opposed to throat area 32 as in conventional pumps , to limit the flow rate to a desired value , two advantages are obtained ; namely , the overall loss due to friction is substantially reduced and the variation in frictional losses within a group of like pumps is substantially diminished , as indicated in fig4 . on the other hand , an obvious disadvantage of increasing the size of the pump chamber is that mixing losses substantially increase , also as indicated in fig4 . however , it has been found that the net effect of these decreased and increased losses due to friction and mixing , respectively , is advantageous for the case of low specific speed pumps . in this respect , it has been determined that for the type of pump under consideration , the reduction in frictional loss and the increase in mixing loss tend to balance each other with some possible small increase in overall pump efficiency being noted . however , of more importance is the fact that the variation in total loss between like pumps is substantially decreased . thus , for the case of the 11 / 2 × 2 - 9 size pump mentioned above , conventionally formed pumps will have actual efficiencies typically varying between 45 percent and 50 percent within a given group of such pumps , whereas like pumps formed in accordance with the present invention will have actual efficiencies varying between 49 percent and 50 percent , with some pumps appearing to even slightly exceed the design efficiency of 50 percent . the operating characteristics of the improved and unmodified or known pumps will otherwise be essentially the same . thus , the primary advantage of the present invention , is that pumps having efficiencies lying within a relatively small range of acceptable manufacturing tolerances may be consistently manufactured without resorting to hand machining of individual pumps to bring same within acceptable tolerances . a further advantage flowing from the practice of the present invention is that a given size pump may be modified to provide a family of pumps having different characteristics by merely varying the diameter of the restrictor flow opening . thus , as by way of example , the 11 / 2 × 2 - 9 size pump may be used to create a family of pumps having for instance maximum flow rates of about 120 gpm , 110 gpm and 70 gpm by providing restrictor flow openings of 7 / 8 inch , 13 / 16 inch and 11 / 16 inch , respectively . of course , the actual efficiency of the 110 gpm and 70 gpm pumps will be less than the actual efficiency of the 120 gpm pump , but the percentage of efficiency variation within any group of such smaller output pumps will remain sufficiently small , so as to permit consistent manufacture thereof without hand working of individual pumps to bring same within acceptable tolerances . while in accordance with the presently preferred form of the invention , the internal size of a pump is changed by increasing only its radial dimension , it is contemplated that an increase in size may be obtained , if desired , by increasing both the radial and axial dimensions or only the axial dimension of the pump chamber and discharge passage .

US-84451886-A

a beverage container insulating sleeve for insulating a user &# 39 ; s hand from a cold or hot beverage container while maintaining the serving temperature of the beverage . the material of the sleeve comprises insulating polyethylene foam . the sleeve is a low cost , lightweight , ergonomic , solution for consumers , advertisers , and anyone who sells hot or cold bottled beverages . the sleeve is further conformable to various beverage container styles and shapes due to a plurality of vertical slits formed therein .

before describing in detail the particular beverage container sleeve in accordance with the present invention , it should be observed that the present invention resides in a novel and non - obvious combination of elements . accordingly , the elements have been represented by conventional elements in the drawings , showing only those specific details that are pertinent to the present invention so as not to obscure the disclosure with details that will be readily apparent to those skilled in the art having the benefit of the description herein . most bars and restaurants chill beverages such as beer , specialty liquor drinks , bottled water , etc ., either by placing said items in a refrigerated cooler or in a tub filled with ice . when a customer wraps her hand around the beverage container , it is typically very cold . further , the temperature differential between the container and ambient , causes liquid to condense ( referred to as sweating ) on the container &# 39 ; s external surface . once in the ambient atmosphere , the beverage temperature warms and eventually reaches the ambient temperature . over many years of observation , the inventors have observed consumers wrapping beverage napkins around these cold containers to soak up the condensation and to maintain a comfortable hand temperature by shielding their hand from the cold container . a sleeve constructed according to the present invention insulates the user &# 39 ; s hand from the cold temperature of the container and the liquid it contains . the consumer thus maintains a dry hand as the sleeve reduces the container sweating ( due to the decreased temperature differential between the container and the ambient environment ) and absorbs any condensation that does form on the container . use of the napkin or other absorbing material is avoided and the consumer instead is presented with a comfortable , ergonomic and safe gripping surface for the container . further , the sleeve insulates the beverage container from the ambient atmosphere , significantly lengthening the time interval for the beverage to reach the ambient temperature . as illustrated in fig1 , an insulating sleeve 10 is wrapped about a bottle 12 , which is representative of the various types and styles of beverage containers suitable for use with the insulating sleeve 10 . an advertisement or other suitable message can be printed on the sleeve 10 , as indicated by a reference character 14 . note that the sleeve 10 does not provide an insulating surface on the bottom of the bottle 12 . however , this is not believed to be a disadvantageous , as the bottle &# 39 ; s bottom surface is insulated by the surface on which the bottle 12 is resting and container sweating from the bottom surface is not problematic for the user . in one embodiment the sleeve 10 is constructed from an insulating polyethylene foam material . in another embodiment the polyethylene material is about ⅛ inch thick . the polyethylene foam has a relatively high coefficient of friction , thus providing a secure gripping surface for the user and a good friction fit to the container . in another embodiment of the invention , a thicker material can be used to form the sleeve 10 to provide additional insulating capacity . in still another embodiment , other known types of insulating foam can be used to form the sleeve 10 . advantageously these foams are environmentally friendly . the sleeve 10 further comprises a plurality of substantially vertical incisions or slits 20 formed through the thickness of the sleeve material . fig2 is a close - up view of a region 26 of the sleeve 10 , illustrating the slits 20 in a closed position . the slits 20 can be positioned in various patterns relative to each other ; the fig2 embodiment illustrates the slits 20 in a staggered vertical pattern wherein a second row 22 of slits 20 is staggered between the slits 20 of a first row 24 . the slits 20 permit the sleeve 10 to be expanded to the diameter of the beverage container , such as the bottle 12 , with which it is to be slidably engaged . further , the sleeve 10 is conformable to any size and shape beverage container by expansion of the slits 20 . thus a sleeve constructed according to the teachings of the present invention provides a “ one size fits all ” benefit . in different embodiments , the slits 20 are disposed along the entire sleeve length or disposed in only a portion of the sleeve length . fig3 illustrates a close - up view of the region 26 , showing the slits 20 in an expanded or open position , as the sleeve 10 expands to wrap around any size or shape of beverage container . the slits 20 are shown in an open state in fig1 where the sleeve 10 is wrapped around the bottle 12 . thus expansion of the slits 20 into the open state allow the sleeve 10 to conform to any container shape or size . fig4 shows the sleeve 10 in a flat or collapsed state . to fit the sleeve 10 around a bottle or other beverage container , opposing edges 30 and 32 are compressed in a direction toward each other to form the sleeve 10 into a generally tubular shape . in fig4 , the slits 20 are in a generally closed state . in one embodiment , in the closed state the sleeve 10 is about six inches long by about three inches wide . the sleeve 10 can be expanded into a tubular shape having a circumference of about 13 inches . the length and open state diameter of the sleeve 10 can be selected depending on the size , height and shape of the beverage container with which it is to be used . fig5 is an inside top view of the sleeve 10 in an expanded state , illustrating the open slits 20 and the generally tubular shape of the sleeve 10 , but without the bottle 12 . fig6 is a cut - away inside view of the sleeve 10 , illustrating the slits 20 in an expanded or open state . fig7 illustrates the sleeve 10 in position about a soda beverage container 40 . in addition to a tubular or substantially cylindrical shape , the sleeve 10 is capable of expanding to conform to a frustocomcal ( i . e ., a truncated circular cone ) shaped container , such as a beverage container 50 illustrated in fig8 . the sleeve 10 constructed according to the teachings of the present invention is considerably smaller , thinner , lighter and more compact than the prior art sleeves . additionally , the sleeve 10 is disposable due to its relatively low manufacturing cost . one market segment where the benefits of the sleeve 10 are especially advantageous is the bar , restaurant , and hotel industry . customers typically do not carry a prior art foam or neoprene “ koozie ” into a bar or restaurant because transporting the “ koozie ” is inconvenient and impractical . the sleeve 10 , on the other hand , can be provided by a bar , restaurant , hotel , coffee stand , convenience store , etc . because it is far less expensive than competing products and is disposable . a customer may use the sleeve 10 while at the establishment and discard it before leaving . alternatively , the user may keep the sleeve 10 for future reuse or as a memorabilia item . given its collapsibility and minimum storage requirements , the sleeve 10 can easily be carried by a user . thus the user will continue to be exposed to the advertising logo or message during each use . in one embodiment the sleeve 10 further comprises a substantially non - expansible band or collar region 55 in which no slits are formed . see fig4 – 6 . typically , the sleeve is slidably engaged over the container top , and slid down over the container sidewalls until a sleeve lower edge 58 reaches the bottom of the container . see fig1 . in this position , the band region 55 prevents further downward motion of the sleeve 10 as the band constricts about a neck 59 of the container 12 . note that the band 55 is absent in the fig8 embodiment . because of its thermal properties , the sleeve 10 can also be used as an insulating thermal wrap for containers of hot liquids , such as a cup of coffee , providing the same insulating features as when in use with cold beverage containers . in one embodiment , when the beverage container has an open mouth , the sleeve 10 slidably engages the hot beverage container at a bottom surface , as to engage from the top may result in spillage of the beverage . in fact , any open container can be slidably engaged with the sleeve 10 from the bottom . in one embodiment of a sleeve constructed according to the teachings of the present invention for slidable engagement from the bottom of a beverage container , the band 55 is not included . typically , the logo 14 is printed in up to four colors , offering an attractive and eye - catching advertising space . the ability to print at this high quality gives the sleeve 10 a beautiful look and is of great benefit to advertisers and consumers alike . the relatively low cost of the sleeve 10 provides affordable logo advertising space for both major and minor beverage manufacturers . the sleeve 10 can either be given away or sold at a minimal price by the advertiser . the low cost also allows advertisers to give sleeves to bar / restaurant patrons , such as , as a promotional give away item . the sleeve 10 can also be used to cover the advertising logo on a beverage container . for example , if a bar patron is consuming brand x &# 39 ; s beverage and brand y is giving away or selling sleeves with their logo , a consumer will put the brand y sleeve over the brand x container . the container is no longer a brand x container , but rather it has been transformed to a brand y container with the addition of the sleeve 10 . this transformation produces major advantages for advertisers . in one embodiment , the sleeve 10 can be formed from material of various colors , providing additional variety and selection . in the beverage manufacturing industry , a sleeve 10 can be included in a six pack or twelve pack of bottles or aluminum cans , printed with the manufacturer &# 39 ; s logo or advertising message . the sleeve 10 can also be sold as a stand - alone item , such as in convenience stores or offered at beverage distribution machines . one process for manufacturing the sleeve 10 includes printing the logo 14 on a film laminate that is then attached to the polyethylene foam . the foam , in the form of rolled material , is cut into individual strips and the slits formed also by cutting action . individual sleeve blanks are perforated and the opposing edges of the blank are joined , typically by heat treating , to form the closed sleeve . individual sleeves are separated from the roll at the perforations . while the invention has been described with reference to preferred embodiments , it will be understood by those skilled in the art that various changes may be made and equivalent elements may be substituted for elements thereof without departing from the scope of the present invention . the scope of the present invention further includes any combination of the elements from the various embodiments set forth herein . in addition , modifications may be made to adapt a particular situation to the teachings of the present invention without departing from its essential scope . therefore , it is intended that the invention not be limited to the particular embodiment disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims .

US-63081603-A

a process is described for cracking a heavy hydrocarbon to form a light oil and for producing hydrogen by the use of a catalyst containing at least 30 wt % fe which comprises a first step wherein steam and heavy hydrocarbon are simultaneously contacted with the catalyst in a reduced state to produce hydrogen , cracked gases , and a cracked light oil , to oxidize the reduced - state catalyst , and to deposit coke on the catalyst ; and a second step wherein the oxidized - state catalyst on which said coke is deposited is contacted with an oxygen - containing gas insufficient for achieving complete combustion of the coke , to thereby partially combust the coke and regenerate the catalyst to a reduced state .

the term &# 34 ; a catalyst containing at least 30 wt % fe &# 34 ; as used herein assumes that the catalyst has been prepared by suitable means such as calcination in a conventional oxidizing atmosphere ; thus the term refers to a catalyst which , when most of iron in the catalyst is in the form of fe 2 o 3 , contains at least 30 wt % iron ( fe ). such catalyst can be prepared by pulverizing , kneading , granulating and calcining materials by the conventional manners , which materials have a high iron content , such as natural ores containing iron in the form of hydroxide , oxide or carbonate , ( e . g ., laterite , magnetite , siderite , limonite , and hematite ), or chemical compositions of iron oxides , hydroxides or carbonates , or mixtures thereof with inorganic refractory materials , such as alumina , silica , magnesia , calcium hydroxide , and nickel oxide , and natural ores , e . g ., garnierite , dolomite and limestone . to have high catalytic activity , these catalysts preferably have a specific surface area of from 0 . 1 to 30 m 2 / g , and for use in a fluidized bed , the catalyst particles preferably have a mean diameter of from 60 to 600μ . if the fe content of the catalysts is below 30wt %, only a small amount of hydrogen is produced . therefore , it is essential that the catalysts contain at least 30 wt % of fe . the fe content preferably does not exceed 70 wt % because otherwise bogging ( i . e ., sintering and agglomeration of catalyst particles ) occurs during reduction of the catalyst in the second step . the terms &# 34 ; in an oxidized state &# 34 ; and &# 34 ; in a reduced state &# 34 ; are used herein as a relative measure of the degree of reduction of iron in the catalyst particles . the degree of reduction ( r ) of the catalyst particles can be represented by the following formula : ## equ1 ## if r 1 , which is the degree of reduction of the catalyst at the end of the first step , is smaller than r 2 , which is the degree of reduction of the catalyst at the end of the second step , this invention achieves its object , and the greater the difference between r 2 and r 1 , the greater the amount of hydrogen that will be generated per given amount of catalyst recycled to the first step . therefore , according to this invention , a catalyst having a degree of reduction of r 1 is referred to as a catalyst in an oxidized state ( or as an oxidized - state catalyst ), whereas the catalyst having a degree of reduction of r 2 is referred to as a catalyst in a reduced state ( or as a reduced - state catalyst ). both r 1 and r 2 are preferably greater than 11 . 1 %; r 2 is preferably in the range of from 12 to 34 %, and more preferably from 15 to 30 %. the heavy hydrocarbons that can be cracked to light oils with advantage by this invention include the relatively inexpensive high - boiling residual oils having more than 10 wt % conradson carbon such as atmospheric residual oil , vacuum residual oil , solvent - deasphalting residue , tar sand , and shale oil . in the first step of the process of this invention , steam is supplied to a catalyst bed filled with the particles of a catalyst in a reduced state which are held at a temperature between about 450 ° and 600 ° c . and a pressure between about 0 and 15 kg / cm 2 g . as a result of the steam - iron reaction , steam is decomposed to generate hydrogen and oxidize the catalyst particles in a reduced state . simultaneously , a heavy hydrocarbon is supplied to the catalyst bed by the steam atomizing method to thereby crack the heavy hydrocarbon . in the first step , the catalyst preferably forms a fluidized bed using the steam as a fluidizing gas . the heavy hydrocarbon thereby breaks down to form cracked gases , cracked light oils , and coke . the coke is deposited on the catalyst particles . the amount of the coke deposited on the catalyst increases with the content of conradson carbon in the heavy hydrocarbon and with the progress of the cracking reaction in the first step . for the purpose of this invention , the amount of coke deposited is preferably from 2 to 15 wt %, and more preferably from 2 to 10 wt %, based on the weight of the catalyst . if the amount of coke deposited is too small , the iron oxide in the catalyst is not reduced adequately , or , to provide a good heat balance for the reaction system , additional heat must be supplied in a great quantity from an external source . if the amount of coke deposited on the catalyst is too high , the catalytic activity of the catalyst is decreased or the reaction between the steam and the reduced - state iron is inhibited to decrease the amount of hydrogen generated . the reduced - state iron in the catalyst ( typically wustite ) reacts with steam to generate hydrogen and becomes iron in an oxidized state ( typically magnetite ). in other words , the catalyst in a reduced state turns to the catalyst in an oxidized state . part of iron sulfide that is present in the catalyst which is formed by capturing sulfur in the subsequent regeneration step also reacts with steam to be converted to iron oxide and hydrogen sulfide to generate the ability of the catalyst to capture sulfur . the last - mentioned reaction proceeds faster if the amount of steam supplied is increased and the reaction temperature is raised . the coke on the catalyst reacts with steam to a slight extent to generate hydrogen , carbon monoxide and carbon dioxide , but this reaction is insignificant at a temperature lower than 600 ° c . the amount of heavy hydrocarbon supplied to the first step is properly determined depending upon the amount of coke deposited and the amount of catalyst particles recycled to the first step , whereas the amount of steam supplied is properly selected based on the degree of reduction of the catalyst , the desired amount of hydrogen generated and the amount of catalyst particles recycled to the first step . it is economically preferred that more than 10 wt % of the steam is decomposed in the first step . hydrogen and hydrogen sulfide thus generated in the reactions described above are discharged from the reaction system in the form of a gas and vapor containing cracked gases , light oils , uncracked heavy hydrocarbon and steam . the discharged gas and vapor enter into a scrubber or distillation column where they are freed of the uncracked heavy hydrocarbon which is recycled to the feedstock and subjected to further cracking . hydrogen , cracked gases , and the light oil are supplied to the refining step for recovery . the cracked gases and hydrogen are recovered from the refining step as a gaseous mixture which contains hydrogen as the major component plus methane , ethane , ethylene , c 3 fractions , c 4 fractions , and h 2 s . by purifying the mixture by suitable means , such as distillation , an amine absorption method , a pressure swing adsorption method ( psa method ( see , for example , cep , january ( 1976 ), pp . 44 - 49 )), or cryogenic processing ( see , for example , cep , september ( 1969 ), pp . 78 - 83 )), which may be used alone or in combination , the mixture can be recovered as three substances , i . e ., high - purity hydrogen gas , high - concentration hydrogen sulfide gas and cracked gases . for example , the mixture can first be freed of c 3 and c 4 fractions by distillation or absorption , then freed of h 2 s by amine absorption , and then freed of hydrogen and light hydrocarbon gases such as methane and ethylene by the psa method or cryogenic processing . the cracked light oil is fed to the refining step where it is separated into a naphtha fraction , kerosine fraction , gas oil fraction , etc . which are desulfurized in a desulfurization step to provide the desired end products . in the second step of this invention , the catalyst in an oxidized state with coke deposited thereon is converted to a reduced state by contacting it with an oxygen - containing gas at a temperature from about 750 ° to 950 ° c . and a pressure from about 0 to 15 kg / cm 2 g . the catalyst preferably forms a fluidized bed using the oxygen - containing gas as a fluidizing gas as in the preceding cracking step . the amount of oxygen supplied to the second step is preferably from 0 . 1 to 0 . 6 mol , and more preferably from 0 . 2 to 0 . 4 mol , per mol of carbon supplied to the second step . in the second step , the coke deposited and co gas react with iron in an oxidized state in the catalyst to form iron in a reduced state ( typically wustite ). therefore , the catalyst in an oxidized state is converted to a catalyst in a reduced state . as specified hereinbefore , the degree of reduction in the second step is preferably from about 12 to 34 %. the degree of reduction preferably should not exceed 34 %, because otherwise bogging easily occurs during the reduction of the catalyst . in the second step , the coke on the catalyst reacts with oxygen in the oxygen - containing gas and oxygen in the iron oxide in the catalyst to form gases such as co and co 2 . simultaneously with gasification of coke , part of the resulting iron in a reduced state captures , as iron sulfide , gaseous sulfur compounds such as h 2 s , cos , and sox that have been formed as a result of gasification of the sulfur compounds in the coke . hence , the large quantity of exhaust gas from the second step contains a very low level of sulfur compounds . as the reaction temperature is higher and more coke is deposited on the catalyst , the reactions described above proceed faster . it is preferred that the reaction temperature not exceed 950 ° c . because otherwise bogging makes the fluidization of the catalyst difficult in a high - temperature reducing atmosphere . hence , the reactions in the second step are preferably performed at a temperature between about 750 ° and 950 ° c . the temperature can be maintained in this range by the partial combustion of coke . it is to be understood that if there is the possibility that the heat balance in the reaction system may be upset , the system may be cooled or heated by a conventional external or internal means . cooling can be achieved simply using a boiler type fluidized bed , and heating can be simply achieved by supplying the reaction system with torch oil directly . the amount of heat generated in the reaction system can also be controlled by varying the amount of oxygen in the fluidizing gas , but if the amount of oxygen is increased , iron oxides are not adequately reduced , and if the amount of oxygen is decreased , the amount of residual coke on the catalyst can increase and have an adverse effect on the cracking reaction and the generation of hydrogen . therefore , it is necessary that the molar ratio of o 2 / c be kept within the above defined range . the catalyst thus - freed of coke and rendered to a reduced state is desirably recycled to the first step for further cracking of heavy hydrocarbons and generation of hydrogen . the gases resulting from the reduction of the catalyst and partial combustion of coke are discharged outside the reaction system as a less polluting emission substantially free of hydrogen sulfide , sulfurous acid and nox . advantageously , the emission is connected to a power recovery step using a conventional gas expander or a heat energy recovery step using a conventional co boiler . in an industrially advantageous embodiment of this invention , the catalyst is recycled through two reaction columns , one for cracking heavy hydrocarbons and generating hydrogen , and the other for gasifying coke and regenerating the catalyst by reduction . as discussed in the foregoing , the process of this invention achieves efficient cracking of relatively inexpensive heavy hydrocarbons having a high content conradson carbon and provides light oils and hydrogen without producing large quantities of polluting substances . this invention is now described in greater detail by reference to the following examples and reference examples , which are provided for illustrative purposes only and are not intended to limit the scope of the invention . a laterite ore containing 55 . 1 wt % fe , 1 . 26 wt % ni , 2 . 6 wt % mgo , 4 . 7 wt % sio 2 and 2 . 81 wt % al 2 o 3 was granulated into particles having a mean diameter of 1 . 2 mm . the particles were calcined at 1160 ° c . for 3 hours to make catalyst particles . the catalyst was reduced with hydrogen at 850 ° c . to form a catalyst in a reduced state . the degree of reduction of the catalyst was 33 . 3 %. the catalyst was used to crack kuwait vacuum residual oil ( specific gravity d 4 15 : 1 . 020 , residual carbon : 21 . 2 wt %) under the conditions indicated in table 1 below . the results of cracking are set forth in table 2 in the column headed &# 34 ; example 1 &# 34 ;. a catalyst was prepared in the same manner as described above except that the calcined catalyst was not reduced , and it was used to crack the same kuwait vacuum residual oil under the same conditions . the results of cracking are also set forth in table 2 in the column headed &# 34 ; reference example 1 &# 34 ;. table 1______________________________________cracking temperature 540 ° c . run time 15 minwater supplied 0 . 38 g / g of feedstockwhsv 0 . 696 h . sup .- 1catalyst in bed 405 g______________________________________ table 2______________________________________ referenceyield ( wt %) example 1 example 1______________________________________cracked gases 8 . 4 12 . 1naphtha fraction ( c . sub . 5 ˜ 180 ° c .) 17 . 8 15 . 9kerosine fraction ( 180 ˜ 230 ° c .) 1 . 8 3 . 1gas oil fraction ( 230 ˜ 310 ° c .) 4 . 2 5 . 3vgo ( vacuum gas oil ) fraction 24 . 5 24 . 4 ( 310 ˜ 560 ° c .) uncracked oil ( 560 ° c .˜) 23 . 6 22 . 5coke 21 . 4 16 . 4hydrogen generated ( nl ) 30 . 7 0 . 06conversion ( wt %) 77 . 5 76 . 4______________________________________ the above data shows that the reaction of generating hydrogen proceeds simultaneously with the cracking reaction in the presence of the reduced catalyst of this invention , but substantially does not occur in reference example 1 . an iron oxide based catalyst containing 49 . 7 wt % fe , 1 . 44 wt % ni , 5 . 54 wt % mgo , 8 . 61 wt % sio 2 and 2 . 85 wt % al 2 o 3 was granulated into particles having a mean diameter of 0 . 2 mm . the catalyst particles were calcined at 1160 ° c . for 3 hours to form an iron - nickel catalyst which was then reduced with hydrogen at 850 ° c . to provide a catalyst in a reduced state . the degree of reduction of the catalyst was 20 %. kuwait vacuum residual oil as used in example 1 was cracked with the resulting catalyst under the conditions indicated in table 1 . the results are shown in table 3 in the column headed &# 34 ; example 2 &# 34 ;. then the same kuwait residual oil was cracked with the same catalyst under the same conditions as above , except that instead of water indicated in table 1 , the cracking column was supplied with 0 . 5 normal liters of n 2 gas per gram of the feedstock . the results of this cracking are set forth in table 3 below in the column headed &# 34 ; reference example 2 &# 34 ;. table 3______________________________________ referenceyield ( wt %) example 2 example 2______________________________________cracked gases 8 . 4 8 . 6naphtha fraction ( c . sub . 3 ˜ 180 ° c .) 9 . 0 9 . 0kerosine fraction ( 180 ˜ 230 ° c .) 3 . 5 1 . 5gas oil fraction ( 230 ˜ 310 ° c .) 6 . 4 1 . 8vgo fraction ( 310 ˜ 560 ° c .) 27 . 2 16 . 5uncracked oil ( 560 ° c .˜) 26 . 5 40 . 7coke 19 . 1 21 . 9hydrogen generated ( nl ) 15 . 9 2 . 8conversion ( wt %) 73 . 5 59 . 1______________________________________ the data shows that hydrogen was generated in the example according to the invention , but not in the reference example . a laterite ore used in example 1 was granulated and calcined as described in example 2 . the resulting catalyst was recycled through a stainless steel cracking column ( id : 12 . 7 cm , height : 160 cm ) and a stainless steel regenerating column ( id : 15 . 1 cm , height : 180 cm ) as it formed a fluidized bed under the conditions indicated in table 4 . the cracking column was continuously fed with the same vacuum residual oil as was used in example 1 . all of the uncracked oil was recycled to the cracking column as a feedstock . the results of cracking and regeneration are shown in table 5 below . table 4______________________________________cracking column temperature 640 ° c . pressure 1 kg / cm . sup . 2 g catalyst hold up 13 kg catalyst recycled 39 kg / hr feedstock supplied 4 kg / hr steam supplied 2 kg / hrregenerated column temperature 850 ° c . pressure 1 kg / cm . sup . 2 g catalyst hold up 20 kg air supplied 5 nm . sup . 3 / hrtorch oil 0 . 06 kg / hr______________________________________ table 5______________________________________cracking column yield of cracked gases 35 wt % yield of c . sub . 5 ˜ 180 ° c . fraction 20 wt % yield of c . sub . 5 180 ˜ 230 ° c . 6 wt % fraction yield of c . sub . 5 230 ˜ 310 ° c . 4 wt % fraction yield of c . sub . 5 310 ˜ 360 ° c . 7 wt % fraction yield of coke 5 . 5 wt % hydrogen generated 2 . 2 nm . sup . 3 / hr conversion 72 wt % molar concentration of 78 % h . sub . 2 in cracked gases molar concentration of 0 . 5 % h . sub . 2 s in cracked gasesregenerating gases generated 6 . 7 nm . sup . 3 / hrcolumn molar ratio of co in gases 14 . 5 % generated molar ratio of co . sub . 2 in gases 14 . 5 % generated molar ratio of h . sub . 2 s and sox 200 ppm in gases generated molar ratio of nox in gases trace generated______________________________________ as is clear from table 5 , the exhaust gas from the regenerating column contained only a very small amount of sox and nox , indicating that the process of this invention is very advantageous from a view point of pollution control . while the invention has been described in detail and with reference to specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .

US-19161780-A

a tamperproof fire hydrant which can only be operated with the use of a special operating tool thus preventing the opening of the hydrant by unauthorized persons for unauthorized use . additionally the tubular hold - down nut for the operating nut is so designed to prevent unauthorized disassembly of the hydrant by unauthorized personnel . to prevent unauthorized use or unauthorized disassembly the polygonal shaped operating nut is concealed by a dome shaped cap covering both the hold - down nut and the operating nut , the cap being freely rotatable with respect thereto . the dome shaped cap permits only limited access to the operating nut . additionally the hold - down nut for the operating nut is also protected in this manner and is provided with a specifically shaped outer surface which requires a special tool usable only when the dome shaped cap for the operating nut is removed .

referring now to the drawings wherein like characters or reference numerals represent like or similar parts , the tamperproof fire hydrant of the present invention as shown in fig1 - 3 , inclusive , is identified generally by the numeral 10 and it is adapted to be attached to a water main 12 . the hydrant 10 includes a hydrant barrel member 14 comprising a shoe 16 having an upwardly open mouth surrounded by a peripheral flange 18 , a lower barrel section 20 and an upper barrel section 22 . the flange 18 of the shoe 16 is detachably bolted to the lower end of the lower barrel section 20 by bolt members 21 and further the shoe is provided with a main hydrant valve brass seat ring 24 , the brass seat ring having a downwardly facing frusto - conical seat for seating with a reciprocating main valve element 26 . the valve element 26 is provided with an upwardly extending valve stem means 28 and with upwardly extending rib elements 30 which cooperate with longitudinally extending grooves in the seat ring 24 . as is now evident , the ribs 30 prevent the valve element 26 as well as the upwardly extending valve stem 30 from rotating but such ribs permit the valve element and valve stem to reciprocate vertically . the upper barrel section 22 has its lower end connected to the upper end of the lower barrel section 20 by means of a frangible flange connection 32 . additionally the upper barrel section 22 is provided with at least one and preferably more hydrant nozzles 34 having closures 36 detachably carried thereon . each of the closures is provided with a polygonal nut 38 , preferably of pentagon shape . the hydrant thus far described may be of the type shown in u . s . pat . no . 4 , 083 , 377 to luckenbill issued apr . 11 , 1978 or u . s . pat . no . 4 , 154 , 259 to ellis et al issued may 15 , 1979 , both being assigned to the common assignee of this application , mueller co ., decatur , ill . the upper section 22 of the barrel member 14 has an open end portion for receiving a top closure member 40 which may be in the form of a bonnet as shown herein and in u . s . pat . no . 4 , 154 , 259 or it may be in the form of the flat closure member shown in u . s . pat . no . 4 , 083 , 377 . in both instances , the top closure member 40 has an aperture 42 extending therethrough . the aperture 42 which extends through the top closure member 40 from the exterior to the interior thereof , is provided with an inwardly extending annular shoulder 44 and an interiorly threaded portion 46 above the shoulder . although not shown in the drawing , the top closure member 40 may be provided with a lubricant reservoir extending downwardly beneath the shoulder 44 such as disclosed in u . s . pat . nos . 4 , 154 , 259 and 4 , 083 , 377 . the valve stem means 28 extends upwardly through the barrel member 14 and is operatively provided on its upper end with exterior threads 48 . the exterior threads 48 are arranged to cooperate with interior threads 50 on a rotatable operating nut 52 as best shown in fig3 . the rotatable operating nut 52 is provided with an exterior annular flange 54 which is arranged to abut the upper face of the inwardly extending shoulder 44 of the top closure member 40 as well as the lower end 56 of a tubular hold - down nut member 58 . as is conventional , the rotatable operating nut 52 extends out the aperture 42 of the top closure member 40 and is provided with a polygonal end portion 60 , preferably a pentagon shape . in the prior art arrangements of fire hydrants , a box end hydrant wrench was usually applied over the polygonal end portion 60 of the operating nut 52 for rotating the same to cause the valve stem means 28 to reciprocate and , thus , open and close the hydrant . the hold - down nut member 58 is provided with exterior threads 62 which cooperate with the interior threads 46 in the aperture 42 of the top closure member 40 . the hold - down nut member 58 , which prevents axial movement of the rotatable operating nut 52 , but allows rotary movement of the same , is provided with an upper end portion 64 which extends out of the aperture 42 of the top closure member 40 . the end portion 64 , rather than having a polygonal cross section for reception of a wrench as is found in conventional hydrants , is provided with a frusto - conical surface 66 which tapers inwardly in an upward direction . by providing frusto - conical surface 66 on the hold - down nut member , an unauthorized person cannot remove the same with a conventional wrench and , thus , steal valuable parts from the hydrant 10 . in order to insert or remove the tubular hold - down nut member 58 , it will be noted in fig5 that the outer frusto - conical surface 66 is provided with at least two inwardly extending circumferentially spaced holes 68 . preferably there are three such holes 68 spaced 120 ° apart . as shown in fig8 and 10 , an annular socket type drive tool 70 having pins 72 extending from its lower frusto - conical surface 73 is arranged to rotatively fit over the end portion 60 of the operating nut 52 , the pins being received in the holes 68 . in more detail , the socket type drive tool is annular and is provided with an upper exterior portion of polygonal or non - circular cross section as indicated at 74 . it will be obvious now that the tubular hold - down nut 58 can only be removed with the use of the special tool as shown in fig8 and 10 . returning now to the description for making the hydrant 10 tamperproof with respect to operation of the same by unauthorized persons , it will be noted that the upper end portion 60 of the rotatable operating nut 52 is provided with an annular groove 76 spaced downwardly from the outer end of the same . the groove 76 is arranged to receive an inner portion of a flat annular retaining means 78 which comprises two semi - circular c - clips 80 and 82 . the c - clips 80 and 82 have a thickness such that their inner portions 84 are loosely received in the groove 76 . prior to inserting the flat semi - circular c - clips 80 and 82 in the groove 76 , an annular retainer member 86 having an inside diameter sufficient to loosely fit over and rotate relative to said polygonal end portion 60 of said operating nut 52 , is slipped over the same . the annular retainer member 86 has an outer peripheral surface which is threaded as indicated at 87 and has a lower surface 88 provided with at least two circumferentially spaced holes 90 for receiving a spanner type wrench 92 as shown in fig1 . the spanner type wrench 92 is a flat member having a pair of pins 94 extending therefrom and arranged to be received in the holes 90 . once the annular retainer member 86 has been slipped over the polygonal end portion 60 of the operating nut 52 then the flat c - clips 80 and 82 are positioned in the groove 76 . a dome shaped cap member 94 having an interior diameter greater than the polygonal end portion 60 of the operating nut 52 is slipped over the end portion of the operating nut . a downwardly facing annular surface 96 is provided as a shoulder in the dome shaped cap member , this inner surface accommodating the outer portion of the c - clips 80 and 82 of the retaining means 78 . it will be noted that the interior of the outer skirt 98 of the dome shaped cap member 94 is threaded as indicated at 100 , the threads 100 mating with the exterior threads 87 on the annular retainer member 86 . when the cap member 94 has been positioned over the end portion 60 and rests on the c - clips 80 and 82 , the spanner wrench 92 is used to lift the annular retainer member 86 upwardly so that the dome shaped cap member can be threaded onto the threads of the annular retainer member and , thus , the dome shaped cap member is retained on the end portion 60 of the operating nut 52 . the dome shaped cap member 94 may freely rotate with respect to the operating nut 52 in that the annular retainer member 86 is provided with an annular recess in its upper face as indicated at 102 for loosely receiving the outer portion 85 of the c - clips 80 and 82 . when the dome shaped cap member 94 has been so positioned , it will be noted that it can freely rotate with the annular retainer member relative to the retaining means 78 as well as with respect to the end portion 60 of the operating nut member 52 . additionally since the retaining means 78 is loosely carried in the groove 84 as well as between the dome shaped cap member 94 and the annular retainer member 86 , there is no chance of binding . while the dome shaped cap member 94 is preferably made from ductile iron , the annular retainer member 86 would preferably be made of brass or could be stainless steel or high strength plastic . in order to operate the tamperproof hydrant 10 just described , it will be noted that the dome shaped cap member 94 provides limited access to the polygonal end portion 60 of the operating nut 52 . the space between the dome shaped cap member 94 and the tubular hold - down nut 58 is so limited that a conventional open end wrench would not fit and consequently only authorized personnel provided with a flat wrench 104 such as shown in fig1 can get into the limited access space to engage the polygonal end portion 60 of the operating nut 52 . the wrench shown in fig1 may be of the type shown in the diaz u . s . pat . no . re . 27 , 616 and it would include two metal strips 106 and 108 pivoted to one another at 110 and having operational end portions 112 and 114 provided with recesses 116 and 118 to define a polygonal configuration . referring now to fig1 and 14 , there is disclosed an improved type of adjustable wrench 104 &# 39 ; capable of operating the tamperproof hydrant heretofore described . the wrench 104 &# 39 ; is adjustable for different size polygonal shaped end portions 60 of the operating nut 52 and includes a flat fixed jaw part 120 having a configuration 121 for engaging two sides of the operating nut 52 and a flat movable jaw part 122 for contacting an opposite side of the operating nut . additionally the wrench includes a heavy handle assembly 124 with a head part 126 having a polygonal configuration 128 . this head part 126 is also adjustable by means of the movable member 130 and is utilized for removing the closure 36 from the hydrant nozzle 34 . a detailed disclosure of the tool 104 &# 39 ; will be found in the copending u . s . application ser . no . 736 , 831 , filed concurrently on may 22 , 1985 herewith by joseph l . daghe , dennis w . humes and dale stanley and entitled &# 34 ; operating wrench for tamperproof hydrants &# 34 ;. the terminology used throughout the specification is for the purpose of description and not limitation , the invention being defined by the scope of the appended claims .

US-73683085-A

the present invention relates to dispensing cartons for sheet materials such as polymeric sheets , metallic foils , and other sheet materials , particularly those suitable for use in the containment and protection of various items including perishable materials . the present invention further relates to such cartons which permit end - loading of the roll of product into the carton during the manufacturing process . the present invention provides an asymmetrical carton for containing and dispensing a roll of sheet material . the carton has a longitudinal axis , and has both an erected condition and a flattened condition . the carton when erected forms a cylindrical structure having an asymmetrical polygonal cross - section formed from a plurality of substantially planar side panels . the carton has fold lines defined by the intersection of adjacent side panels , and is foldable into a flattened condition by folding the carton at two fold lines to form a substantially planar structure .

[ 0025 ] fig1 depicts a carton 10 according to the present invention which is suitable for containing and dispensing a web 20 of sheet material from a roll 30 . the carton 10 includes a bottom panel 1 , two end panels 2 and 3 , and side panels 4 , 5 , 8 , and 9 , as well as a lid 25 which includes top panel 7 and flap 15 . in the embodiment shown , the flap 15 overlaps at least a portion of the front side panel 5 when the lid is in the closed configuration . gussets 6 at each end of the lid 25 aid in maintaining the flap 15 in a perpendicular relationship to the top panel 7 of the lid 25 . panels 1 , 4 , 5 , 7 , 8 , and 9 all function as “ side ” panels and are joined to one another by fold lines ( or in the case of panels 5 and 15 , an overlapping relationship to form a substantially planar front side referred to herein as composite front panel 5 / 15 ) to form a cylindrical structure having a polygonal cross - section . such a cylindrical structure is enclosed by end panels 2 and 3 to form a closed carton . the centerline of the product roll ( illustrated as “ cl ” in fig5 ) defines a longitudinal axis of the carton and the “ side ” panels are all substantially parallel to the longitudinal axis and the end panels are substantially perpendicular to the longitudinal axis . the carton 10 also includes a blade 40 for severing a desired portion of the sheet material . in the presently preferred ( but only representative ) configuration shown in fig1 the blade 40 is located on the distal edge 16 of the flap 15 such that the teeth of the blade extend at least slightly outwardly beyond the edge of the flap in overlying relationship to the front side panel 5 . in the configuration illustrated in fig1 the blade is affixed to the inner surface of the flap 15 such that the teeth extend outwardly beyond the marginal edge of the flap . if desired , however , the blade 40 may be mounted either on an inside or outside surface of the carton and may be located elsewhere on the carton , such as the lower edge of the front panel 5 of the carton . [ 0027 ] fig2 and 3 provide additional perspective views of the carton of fig1 from different vantage points to better illustrate the three - dimensional geometry of the carton construction . fig4 is also a partial perspective view of the carton of fig1 - 3 , illustrating the interior elements of the lid / flap / top panel , the mounting of the blade 40 , and the carton portion of the locking feature ( aperture 55 in panel 11 ) which will be described hereafter . in use , the web of sheet material 20 may be drawn against the blade 40 to sever a desired length of sheet material from the roll when the flap 15 is held in the closed position overlying the front panel 5 of the carton . this arrangement prevents the tail of the rolled material from being lost within the carton after severance of a length of material , since the “ tail ” or terminal edge of the continuous sheet material created by the severing operation will be held between the flap 15 and the front panel 5 . the numeral 21 identifies the terminal edge of the sheet material , which typically comprises the “ tail ” remaining after the previous severing operation . [ 0029 ] fig5 is a cross - sectional view of the carton 10 of fig1 - 4 , depicting in greater detail the dimensions and angular relationships of the various “ side ” surfaces of the carton . panels 1 , 5 / 15 , and 7 are each perpendicular to one another with top and bottom panels 7 and 1 , respectively , being substantially parallel to one another and joined by the front panel 5 / 15 which is substantially perpendicular to the panels 1 and 7 . the carton is thus semi - rectangular with respect to the portion of the cross - section lying to one side of the centerline of the product roll , and has prominent protruding corners for stability when placed upon solid surfaces . the remaining side panels 4 , 8 , and 9 enclose the portion of the polygonal cross section opposite from the front panel 5 / 15 and form what may be termed a composite rear panel 4 / 8 / 9 which opposes composite front panel 5 / 15 . while a composite panel formed from three panel elements has been illustrated , the number of panel elements may be 2 , 3 , 4 , 5 , or more as desired . the relationship of the lengths ( in the cross - sectional direction ) of the side panels of the carton , as well as the angles relating various sides ( such as angles cc and ee in fig5 ) are such that the carton may be folded to form a flattened cylindrical structure via fold lines at the junctures of sides 7 / 15 and 1 / 9 . therefore , in both folded / flattened and erected states the dimensional relationships are such that the sum of the lengths a + b equals the sum of the remaining lengths c + d + e + f , or in other words a + b = c + d + e + f . however , in order to maintain the desired orthogonal relationships of the top , bottom and front panels in the erected condition ( such that the carton is semi - rectangular ) the sum of the projected lengths of the sides 4 , 8 , and 9 in the a direction must be equal to length a . it is presently preferred that side 4 be substantially parallel to side 5 / 15 for purposes of packaging and stacking pluralities of cartons 10 . therefore , the sum of length b plus the projected length of side 9 in the b direction must be equal to the sum of length f plus the projected length of side 8 in the f direction . the relationships of the sides to one another are such that the carton when folded from a unitary blank of material can have the ends of the blank readily glued to one another to form a continuous structure by joining edges which naturally align when the carton is in its flattened condition . the carton can then be re - oriented to an erected condition in conventional fashion to its final cross - section and the assembly can then be completed by closing and securing the end panels after the product roll has been inserted and positioned / secured via the core end caps . the carton of the present invention has a cross - section perpendicular to the longitudinal axis which is asymmetrical , which as defined herein means that there is no plane which can be drawn through the package parallel to the longitudinal axis which will divide the carton into symmetrical halves . in a presently preferred embodiment , dimensional values for a - f in fig5 are 2 . 75 inches , 2 . 38 inches , 1 . 00 inches , 1 . 00 inches , 1 . 00 inches , and 2 . 13 inches , with a maximum roll diameter of 2 . 40 inches and a maximum circumscribed diameter ( diameter of circle illustrated as “ r ”) of 2 . 71 inches , providing a clearance between product and carton of about 0 . 31 inches . the angles cc and ee are 19 degrees and 36 degrees respectively . the overall carton height and width , respectively , are 2 . 75 inches and 2 . 71 inches . the outside diameter of the core tube for the product roll is 1 . 5 inches , and the overall carton length is approximately 12 . 0 inches . as shown in fig1 the carton of the present invention preferably includes core end caps 50 which secure and retain the roll 30 within the carton 10 . fig6 - 10 depict various views of a preferred embodiment of a core end cap 50 . as shown in fig6 and 7 , the core end cap preferably includes a tapered guide portion 51 which permits ease of alignment when inserted into the ends of the roll to hold the roll in position within the carton . the core end cap 50 also includes a flange 52 which prevents the core end cap 50 from being inserted too far into the carton . the cylindrical core support 61 tightly engages the core of the product roll to both maintain the end caps within the carton and to secure the roll to the carton . shoulder portion 62 provides an abutment to prevent over - insertion of the end caps into the core and provides a bearing surface for engaging the apertures ( shown in fig1 ) in the ends of the carton . the core end cap 50 further includes , as shown in fig8 and 10 , a grip portion 53 which is preferably unitarily formed with the end cap to provide an element which is substantially flush with the outer surface of the flange 52 , or recessed within the flange 52 , yet may easily be grasped and manipulated by a consumer to rotate the roll of product to locate the end of the web and / or retract extra web material back into the carton by winding it upon the roll . core end cap 50 also preferably includes a small projecting button 54 or similar protrusion which is substantially centrally located and protrudes outwardly beyond other features of the core end cap such as the flange and grip portion . button 54 engages a corresponding recess or aperture 55 in a panel 11 on an interior surface of the gusset 6 to provide a lid lock - down feature to maintain the carton in a closed but easily accessible orientation . button 54 may be unitarily formed with the end cap or may be a separate element secured thereon . fig8 is an elevational cross - sectional view of the end cap 50 taken from the same vantage point as fig6 and fig9 is a perspective view of the lower portion of the end cap . the end caps may be made from any suitable material , although unitarily formed caps thermoformed from high impact polystyrene have been found particularly suitable . blades utilized with cartons in accordance with the present invention preferably utilize tooth design parameters which have been selected and optimized to provide superior severing performance under in - use conditions with a wide variety of materials , particularly comparatively low modulus ( low force to elongate ) sheet materials and sheet materials of three - dimensional geometry which exhibit a lower modulus than their compositional material would exhibit in two - dimensional form . such blades are described in greater detail in commonly - assigned u . s . pat . no . 5 , 839 , 634 , issued nov . 24 , 1998 to pollard , et al ., the disclosure of which is hereby incorporated herein by reference . blades suitable for use with cartons in accordance with the present invention may be fabricated from a wide variety of suitable materials , such as metals , plastics , glass , rubber , paperboard , wood , ceramic , etc . however , for reasons of economy and manufacturing expediency the use of tin - plated steel such as is commonly commercially available is presently preferred . the blades may be manufactured by any suitable method commonly utilized in the art for the particular material desired , such as molding ( injection or otherwise ), casting , sintering , grinding , stamping , forging , machining , electrical discharge machining , etching , hobbing , etc . [ 0040 ] fig1 illustrates a blank 60 suitable for forming the carton illustrated in fig1 - 4 , with the various sides and elements identified with their respective numbers as depicted in earlier figures . the blank 60 also includes additional tabs and panels to form surfaces for gluing and / or reinforcing other panels of the carton , as well as for retaining and supporting the core end caps . more specifically , panel 56 is joined to panel 15 along a line of weakness , preferably a line of perforations , to form a removable tear strip which protects the blade prior to use . tear strip 56 is initially glued to front panel 5 at locations 59 , which are sufficiently small as to be easily overcome to remove the tear strip . panel 57 is folded behind panel 5 as a reinforcing element and glued along line 58 . if the carton is fabricated from an oriented material such as corrugated paperboard , the direction “ x ” is a preferred direction for the orientation of the flutes of the material . the cartons of the present invention may be manufactured from any suitable material , although for reasons of cost and manufacturing expediency various paperboard products have been found particularly suitable . a presently preferred type of paperboard is a type “ f - flute ” material , which is a double - faced corrugated paperboard . any desired weight of material consistent with its intended use may be utilized , and for the carton design described herein a 23 pound medium and inner liner have been found suitable . [ 0042 ] fig1 depicts a typical in - use scenario wherein a blade mounted on the carton according to the present invention is utilized to sever a desired length of sheet material from a roll of stock material . as shown in fig1 , a carton 10 of the type depicted in fig1 is held in a closed condition in one hand 70 while the other hand grasps the terminal edge 21 of the sheet material 20 . the terminal edge 21 of the sheet material is drawn outwardly until the desired length ( relative to the location of the blade 40 ) of the sheet material extends outwardly from the roll between the blade and the front panel 5 . at this point the hand reaches the location depicted by hand 80 a . the grasping action of hand 70 aids in pinching the lid 15 against the front panel 5 to reduce the likelihood that the severing operation will cause the sheet material to slip relative to the blade . to accomplish the severing of the length of sheet material , the terminal edge 21 of the sheet material is pulled back over the location of the blade 40 as indicated by the large arrow in fig1 such that the material partially wraps the blade 40 and the material is drawn at an angle toward the user and upwardly from the direction of the carton 40 . at this time , the hand 80 a crosses over the hand 70 and reaches the location depicted by hand 80 b as the tearing process progresses . drawing the sheet material back across the blade at an angle concentrates the pulling force at the edge of the sheet material near the carton end panel 3 such that the force per unit area exerted by the sheet material over the blade teeth exceeds the penetration pressure required to pierce the sheet material . the numerical identifier 90 identifies the location of the leading edge of the tear line which is progressing downwardly in the illustration from the upper edge of the sheet material downwardly along the blade toward the lower edge of the material . the sheet material located along the tear line below the location 90 may be under little or no tension while the tension near the location 90 is maintained in excess of the required penetration pressure . when the tear line reaches the farthest edge of the material near the carton end panel 2 , the separation is complete and a new terminal edge 21 is formed on the remaining sheet material at the location of the toothed side of the blade . cartons in accordance with the present invention may be utilized in the packaging , dispensing , and severing of a wide variety of sheet - like materials , whether predominantly two - dimensional in nature or formed into three - dimensional structures . one material of current interest comprises a three - dimensional , conformable web comprising an active substance such as adhesive on at least one surface protected from external contact by the three - dimensional surface topography of the base material . such materials comprise a polymeric or other sheet material which is embossed / debossed to form a pattern of raised “ dimples ” on at least one surface which serve as stand - offs to prevent an adhesive therebetween from contacting external surfaces until the stand - offs are deformed to render the structure more two - dimensional . representative adhesive carrier structures include those disclosed in commonly assigned u . s . pat . nos . 5 , 662 , 758 , issued sep . 2 , 1997 to hamilton and mcguire , entitled “ composite material releasably scalable to a target surface when pressed thereagainst and method of making ”, and 5 , 871 , 607 , issued feb . 16 , 1999 to hamilton and mcguire , entitled “ material having a substance protected by deformable standoffs and method of making ”, and commonly - assigned , co - pending u . s . patent application ser . nos . 08 / 745 , 339 , filed nov . 8 , 1996 in the names of mcguire , tweddell , and hamilton , entitled “ three - dimensional , nesting - resistant sheet materials and method and apparatus for making same ”, 08 / 745 , 340 , filed nov . 8 , 1996 in the names of hamilton and mcguire , entitled “ improved storage wrap materials ”. while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .

US-41362303-A

a novel chromogenic substrate to peroxidase enzymes is provided which is comprised of a mixture of a colorless mixture of two compounds , such as , 3 - methyl - 2 - benzothiazolinone hydrazone and 2 - hydroxy - 2 , 4 , 6 - cycloheptatrienone , which undergo an oxidative coupling in the presence of peroxidase and hydrogen peroxide forming a purple indamine dye . under certain circumstances the dye will precipitate out from the buffered solution and thus provide a permanent record of the determination . the mixture is also stable and unaffected by oxygen of the air or by hydrogen peroxide .

as indicated above , the chromogenic substrate to peroxidase enzymes of formula iii is prepared by the reaction of a hydrazone of formula i and a 2 - hydroxy - 2 , 4 , 6 - cycloheptatrienone of formula ii . in the chromogen substrate r represents a group containing from 1 to 25 , and more preferably , 1 to 12 carbon atoms and includes an alkyl group , e . g ., methyl , ethyl , n - propyl , isobutyl , n - amyl , isoamyl , and the like ; an alkenyl group . e . g ., allyl , methallyl , and the like ; an aralkyl group , e . g ., benzyl , phenethyl and the like ; an alkoxyalkyl group , e . g ., methoxyethyl , ethoxyethyl , and the like ; an aryloxyalkyl group , e . g ., phenoxymethyl , phenoxyethyl , and the like ; a hydroxyalkyl group , e . g ., hydroxymethyl , hydroxyethyl , betahydroxypropyl , and the like ; a carboxyalkyl group , e . g ., carboxymethyl , carboxyethyl , carboxypropyl , and the like ; a carboalkoxyalkyl group , e . g ., carbomethoxymethyl , carbomethoxyethyl , carboethoxyethyl , acetoxyethyl , acetoxypropyl , and the like ; an arylthioalkyl group , e . g ., phenylmercaptomethyl , phenylmercaptoethyl , and the like ; a sulfohylalkyl group , e . g ., sulfonic acid butyl , and the like ; r 1 - r 4 represent hydrogen , halogen , no , no 2 , so 3 h , cooh , or a group containing from 1 to 25 and more preferably 1 to 12 carbon atoms , and can be a substituted or unsubstituted alkyl , alkoxy , aryl , heteroaryl , aryloxy , and the like . x represents an anion selected from the group consisting of f , cl , br , i , acetate , phthalate , phosphate , citrate , borate , sulfate and nitrate ; and z represents a group containing non - metallic atoms necessary to complete a heterocyclic or heterobicyclic ring with the atoms to which it is attached . preferably , z contains carbon , oxygen or sulfur and up to a total of 25 and more preferably , up to 18 carbon atoms . z can also be substituted with one or more substituents selected from the group consisting of lower alkyl , nitro , halogen , carboxyl , sulfonyl , amino and diamino groups . in a preferred embodiment of the present invention , the chromogenic substrate is formed from a mixture of 3 - methyl - 2 - benzothiazolinone hydrazone hydrochloride iv and 2 - hydroxy - 2 , 4 , 6 - cycloheptatrienone v ## str4 ## these compounds undergo an oxidative coupling in the presence of peroxidase and hydrogen peroxide to form an indamine dye having the general formula vi ## str5 ## wherein x is as indicated above . the product formed is a purple to blue dye which absorbs at 540 nm . the developed dyes serve as an indicator allowing a qualitative or quantitative determination of peroxidase in biological fluids and other immunodiagnostic formats . in general , a biological sample containing peroxidase enzymes such as , for example , horseradish peroxidase , develops a red to purple color when a mixture of iv and v , and hydrogen peroxide is added . the red to purple color which develops upon the oxidative interaction of iv and v is due to formation of the indamine dye vi . the dye under certain conditions involving an aqueous solution , precipitates from the reaction mixture forming a permanent record . furthermore , a mixture of iv and v in buffer solutions in which hydrogen peroxide has been added remains unchanged without the development of any color . only upon addition of the peroxidase , does the colored dye develop , thus revealing the presence of peroxidase activity . the molar ratios of i and ii in buffer solutions may vary from equal molar , to 1 mol of i and up to 100 moles of ii or 1 mol of ii and up to 100 moles of i with the preferred molar ratio being 10 mols of i and 1 mol of ii . the buffers constituting the solutions of the mixture of i and ii among others are phosphate , citrate , saline , borate , phthalate or combination of more than one with the preferred buffer being citric acid - dibasic sodium phosphate , ph 7 . 0 buffer . the chromogenic substrates to peroxidase of the present invention are useful in a wide variety of areas , as a biochemical tool for the detection and measurement of peroxidase activity in biological samples and in the detection and measurements of biological components . for example , the chromogenic substrates of the present invention due to their stability against hydrogen peroxide , light , and oxygen of the air can be employed in immunodiagnostic assays involving pairs of antibodies , one bound to a solid phase and the other labeled with peroxidase to permit detection . due to the unique characteristics of precipitating from buffer solution , this substrate can be employed in the development of positive - negative immunoassays leaving a permanent record of the determination . the substrate of the present invention is also useful in systems involving labeled avidin / strepavidin and biotinylated antibodies employed in histochemistry and other diagnostic formats . as previously indicated , the chromogenic substrates of this invention are ideal agents due to their photochemical stability and their stability against oxygen of the air and hydrogen peroxide . this is in addition to the precipitating property of the chromogen formed during the oxidative interaction which makes these substrates useful in a variety of applications where peroxidases are involved . the following examples illustrate the best mode presently contemplated for the practice of this invention . 1 millgram of horseradish peroxidase was dissolved in 100 milliliters of phosphate - saline buffer prepared by diluting 2 . 76 grams of sodium phosphate ( monobasic ), 11 . 36 grams of sodium phosphate ( dibasic ) and 1 . 8 grams of sodium chloride to 1 liter with distilled water . 50 milligrams of urea peroxide was dissolved in 100 milligrams of phosphate - citric acid buffer ( ph 7 . 0 ) prepared by diluting 500 . 0 milliters of 0 . 2m sodium phosphate ( dibasic ) with 120 milliliters 0 . 1m citric acid to 1 liter with distilled water . 150 milligrams of 3 - methyl - 2 - benzothiazolinone hydrazone hydrochloride and 200 milligrams ( excess ) of 2 - hydroxy - 2 , 4 , 6 - cycloheptatrienone dissolved in 100 milliliters of phosphate - citric acid buffer prepared by diluting 120 milliliters of 0 . 1m citric acid and 500 milliliters of 0 . 2m dibasic sodium phosphate to 1 liter with distilled water . to this was added 4milliliters of urea peroxidase solution prepared as in example 2 and 2 milliliters of horseradish peroxidase prepared as in example 1 and the mixture stirred for two hours . the dye formed was filtered and washed with water . recrystallization from methanol gave 50 milligrams of the indamine dye . absorption in methanol showed peaks at 537 , 358 , 306 and 267 nm . nmr ( cdcl 3 ) tms internal standard showed peaks at 7 . 8 ( m , 8h , aromatic ); 6 . 5 ( m , 5h , citric acid ); and 2 . 75 ( m , 3h , ch 3 -- n + ) ppm . 120 milligrams of 2 - hydroxy - 2 , 4 , 6 - cycloheptatrienone ( hct ) was dissolved in 10 . 0 milliliters of phosphate - citric acid buffer ph 7 . 0 prepared by diluting 20 milliliters of 0 . 1m citric acid and 500 milliliters of 0 . 2m dibasic sidium phosphate to 1 liter with distilled water , 215 milligrams of 3 - methyl - 2 - benzothiazolinone hydrazone hydrochloride ( mbh ) was dissolved in 10 milliliters of the same phosphate - citric acid buffer . the chromogen substrate solution was then prepared by mixing one part of hct solution with one part of mbh solution and eight parts of the urea peroxide buffer solution ph 5 . 5 as prepared in example 2 . reagents to perform a sandwich immunoassy for strep a were obtained from a commercial source . to strep a antibody bound to a plastic device ( paddle ) was added positive strep a control . antibody labeled with horseradish peroxidase was then added and allowed to incubate for two minutes at ambient temperature . the paddle was then washed with tap water for one minute to remove unbound material . to the paddle was then added the chromogen substrate mixture of example 4 and incubated at ambient temperature for two minutes . a positive sample gave a reddish - purple color . the paddle was washed with tap water for one minute leaving a permanent red - violet color that remained fixed to the paddle . although the invention has been illustrated by the preceding examples it is not to be construed as being limited to the materials employed therein , but rather , the invention relates to the generic area as hereinbefore disclosed . various modifications and embodiments can be made without departing from the spirit or scope thereof .

US-15621088-A

a holding device for temporarily attaching a facial tissue box or similar container to a supporting structure such as glove box door , sun visor , window , bed railing or headboard , or similar . the device is removably attachable to both the box and the supporting structure . two laterally projecting arms grip the box while a clip attaches to the structure . the arms may comprise hooks , points or other features designed to enhance their grip on a paperboard , or similar , box . these features may optionally penetrate , crimp , or depress the side of the container . if desired , one or both of the arms may be adjustable to accommodate a range of box widths and / or depths .

the following discussion focuses on the preferred embodiments of the inventive holder , a single piece embodiment adapted to a single size of facial tissue box and an adjustable embodiment adaptable to a range of box sizes . it also presents several alternative embodiments for holding tissue boxes . however , as will be recognized by those skilled in the art , the disclosed apparatus is applicable to a wide variety of situations in which a removable retainer or holder for a box or other container is desired . for larger containers , multiple instances of the present holder could be used for added security . the following is a brief glossary of terms used herein . the supplied definitions are applicable throughout this specification and the claims unless the term is clearly used in another manner . arm — either of the laterally extending portions which engage or support the box . box — in the preferred embodiments this is a facial tissue box . however , any box or similar container , regardless of contents or shape , is considered equivalent . clip — generally that portion used to attach the inventive device to a supporting structure . spine — generally that portion which spans the width or height of the box and to which the other elements attach . note that one element could attach directly to another , rather than to the spine , without departing from the principles of the invention . the disclosed invention is described below with reference to the accompanying figures in which like reference numbers designate like parts . generally , numbers in the 200 &# 39 ; s refer to prior art elements or elements in the surrounding environment while numbers in the 100 &# 39 ; s refer to elements of the invention . fig1 - 6 illustrate a first preferred embodiment of the present invention which is non - adjustable and adapted to fit a single size of tissue box . spine , 108 , is sized to closely match the width of the box to be held and provides an attaching point for the remaining elements . clip , 102 , attaches the holder to a supporting structure , such as a glove box door , window , bed rail or any other structure . optional teeth , 110 , increase the holding power of the clip . upper arm , 104 , extends laterally away from the spine and embraces and retains one side of the box . it preferably ends in a relatively small radius hook positioned to grip the corner of the box . lower arm , 106 , similarly extends laterally , embraces and retains the opposite side of the box . it preferably ends in an angled portion which extends for at least a short distance along the face of the box opposite the spine of the holder . preferably , this angled portion angles back towards the spine of the holder , applying a biasing force to the box , urging it against the spine of the holder . clearly the ends terminating the two arms could be interchanged or either type could be used on both arms . note that while the arms in the preferred embodiment extend away from the spine at substantially right angles , this is not a requirement of the invention . nor is it a requirement that they be straight . curved arms would also adapt the device to holding containers which are cylindrical or otherwise curved . fig3 - 6 illustrate the inventive holder attached to a tissue box . upper arm , 104 , grips the upper corner of the box . preferably the hook is positioned so that the inner radius closely receives the side of the box and the end of the hook presses into the face of the box forming a depression , 202 , in the face . in this manner , the box provides a biasing force as it tries to return to its original shape , which helps retain the box in place relative to the holder . the hook shape is advantageous in that it actually strengthens the corner of the box by crimping the corner of the box . that portion of the face immediately adjacent the corner is rolled back toward the side of the box , effectively doubling the thickness of material at that point , see fig6 . lower arm , 106 , grips the lower side of the box and bears against the face of the box . where the angle of the lower arm end is sufficient , the face of the box will be depressed , 204 , in a manner similar to that for the upper arm , but would not crimp the corner . the holder is typically installed by hooking the upper arm on one corner of the box and rotating the holder into position spanning the box as shown . the lower arm is flexed away from the box to provide clearance and then allowed to relax into the position shown . the clip is then attached to any desired supporting structure . the following alternative embodiments offer various advantages in structure or function without departing from the principles of the invention . [ 0058 ] fig7 illustrates an embodiment of the invention which incorporates a larger , curved clip , 112 . this shape is more optimal for attachment to larger supporting structures such as the rail on a hospital bed or a piece of equipment near where tissues are needed . the embodiment of fig8 uses a straight upper arm , 114 . this allows the use of the holder with boxes of varying depth , as the length of arm need not closely match the depth of the box . this works well in combination with the lower arm illustrated in fig9 or lower arm , 106 , fig1 but having a more steeply angled end . it does however permit angular movement of the box in a plane parallel to that of the sides of the holder because the side of the box adjacent the upper arm is free to move away from the spine of the holder , unless the upper arm is made very rigid . the embodiment of fig9 incorporates a pointed lower arm . while the pointed tip can function as in the above preferred embodiment , by enclosing the box , it is also adapted to contact the side of the box . the point may either press against the side of the box or penetrate the box side . if desired , the point could be barbed to assist retention within the hole formed in the side of the box . clearly , the arm configurations of fig8 & amp ; 9 can each be used on either arm . the combination of one straight arm , like that of fig8 and one pointed arm , as in fig9 would allow the holder to be used with any depth of box . the only critical dimension to the holder is then the length of the spine , which needs to match the width of the box being held . this is a relatively minor limitation since the box sizes are substantially standardized . [ 0062 ] fig1 illustrates an alternative embodiment in which both upper and lower arms have pointed ends , 116 and 118 . as above , this point may either contact or penetrate the side of a tissue box . in addition , the arms are shorter for increased strength more compact shape . since the arms do not need to encompass the side of the box , there is no need for additional length . this configuration readily attaches to boxes of a wide range of depth . the upper arm , 104 , of the embodiment of fig1 incorporates multiple hooks , allowing it to connect to multiple depths of boxes . the inner - most hook , 120 , is adapted to grip the corner of a box , immediately adjacent the spine . the middle hook , 122 , is adapted to grip the edge of the opening in the side of the box through which tissues are extracted . the outer hook , is the same as that in the preferred embodiment above and can grip either the corner of a box , or the edge of an opening in a box . the embodiments of fig1 and 13 incorporate a grip to facilitate removal of the holder from the structure to which it is attached . while probably not necessary when used with a relatively thin structure , such as a glove box door , it can be very helpful with a larger structure such as a hand rail or pipe , which may require significant effort to remove the holder . this is especially important where the holder is used by a disabled or convalescent user . fig1 illustrates a t - shaped grip , 124 , and fig1 illustrates a circular , or loop , grip , 126 . clearly other shapes are equally applicable . a second preferred embodiment of the present inventive holder is illustrated in fig1 - 16 . this embodiment differs from the first preferred embodiment primarily in that it is adjustable for different box widths . further , the upper and lower arms are shortened and adapted to grip the side of the box in a manner similar to that of the embodiment of fig1 , discussed above . in the extreme , the upper and lower arms could be considered to have been eliminated and replaced by hooks or other gripping means . other than that , the overall structure and function is the same . spine , 154 , serves as the attaching point for the other elements including clip , 162 , upper arm , 152 , and lower arm , 156 . the upper arm is shortened relative to the first embodiment and angles inward to press against the side of the box . it preferably ends in a hook , 164 , angled back toward the spine to further help in retaining the holder in position relative to the box . preferably , the inner face of the hook is perpendicular to the spine of the holder for optimum grip , but other angles could be used . as in the first preferred embodiment , the action of the arm and hook crimps the corner of the box . the lower arm , 156 , has a shape similar to that of the upper arm , angled inward and then preferably hooked back toward the spine . as with hook , 164 , the inner face is preferably perpendicular to the spine , but could vary . it differs in that it is adjustable along at least a portion of the spine to adapt the holder to boxes of various widths . the spine is toothed , with the teeth arranged to engage the lower arm and hold it in position . as shown in fig1 , the lower arm has an opening , 160 , through which the spine passes . preferably , the slot is angled so that when the arm is tilted inward , the opening is sufficiently wide to pass over the teeth and when the arm is tilted outward , the opening is the width of the spine itself and the lower face of the arm rests against the shoulder of a tooth . clearly notches rather than teeth could be used as could any other of the well know techniques for providing adjustment of this type . alternatively , the spine could be smooth and the arm adapted to grip the spine when forced outward in a manner similar to the sliding stop on a screen door closer or catch on a caulking gun . as shown in fig1 , the upper , 152 , and lower , 156 , arms are adapted to grip the corner of a box , 200 , by at least somewhat depressing the side of the box immediately adjacent the corner . the hook portion of the arm then engages the surface of the box to further increase the hold on the box . this approach allows the holder to be attached to any depth of box . where the dimensions of the hook portions are sufficiently small , they provide a crimping action similar to that described above with respect to the first preferred embodiment . optional stop , 160 , retains the lower arm on the spine so that it does not become lost . it is preferably angled inward so that the arm is easy to insert onto the spine , but difficult to remove . clearly , the stop and / or the teeth could be moved to the opposite side of the spine , or even positioned on the edges of the spine if desired . the clip , 162 , illustrated on this embodiment is an alternate approach to those discussed above with respect to the first preferred embodiment . the large space near the top is adapted to fit over large structures such as a pipe or railing and the lower portion of the clip is adapted to fit a thinner structure such as glove box door , draw front , etc . the following alternative embodiments offer various advantages in structure or function without departing from the principles of the invention . the embodiment of fig1 is similar to that of the second preferred embodiment but differs in the shape of the upper , 164 , and lower , 166 , arms . rather than angling inward , they are substantially perpendicular to the spine with hooks on the end adapted to engage the side of the box . [ 0075 ] fig1 illustrates an embodiment which uses an upper arm , 168 , of the same design as in the first preferred embodiment and a sliding lower arm , 170 , similar to that of the second preferred embodiment . this lower arm is somewhat longer and is intended to both support the corner of the box , near the spine , and to grip the side of the box at the distal end using point , 172 . any of a variety of arm designs may be used including those illustrated in fig1 a - c . note that the arm configuration of fig1 c has points both at the distal end , to engage the side of the box , and near the spine , to engage the corner of the box . the embodiments of fig2 - 23 adapt the design of the second preferred embodiment by using a two - piece spine to provide adjustment rather than moving the lower arm relative to the spine . in the embodiment of fig2 and 21 , the upper portion , 174 , of the holder is slideably received in the lower portion , 176 , of the holder . preferably the lower portion forms a substantially c - shaped cavity which closely receives the spine of the upper portion . this design is similar to that used for telescoping curtain rods and the like . other techniques well known in the field for providing a telescoping fit would also be applicable . clearly , the male / female relationship of the upper and lower portions could be reversed . teeth or serrations could be added to increase the resistance to the relative movement of the upper and lower portions . the alternative embodiment of fig2 and 23 utilizes a sliding collar , 182 , which encloses the spine for alignment while pin , 184 , engages one of the holes , 186 , to fix the relative longitudinal position of the two portions of the holder . clearly , the pins and holes could be switched to the opposite parts . [ 0078 ] fig2 illustrates an embodiment that extends the adaptability of the embodiment of fig1 by also incorporating an adjustable cross - piece . the upper arm , 188 is toothed in the same manner as the spine , 154 , and uses a movable tab , 190 , similar to the adjustable lower arm , 170 . a variety of forms of tabs / arms can be used on the cross arm including those shown in fig1 a - c . while the preferred form of the invention has been disclosed above , alternative methods of practicing the invention are readily apparent to the skilled practitioner . the above description of the preferred embodiment is intended to be illustrative only and not to limit the scope of the invention .

US-91875301-A

several embodiments of electric vehicle control and control apparatus wherein the amount of regenerative braking of the vehicle and the type of braking is determined by current conditions to provide simpler and more effective control regardless of condition of the power source for the vehicle .

referring now in detail to the drawings and initially to fig1 , an electrically powered vehicle such as a golf cart , as an example of vehicle with which the invention may be practiced is identified generally by the reference numeral 21 . this golf cart 21 is provided with a body , frame 22 that rotatably supports in any desired manner paired front wheels 23 and rear wheels 24 . in the illustrated embodiment , the rear wheels 24 are driven by a shunt type electric motor 25 through a transmission 26 . associated with some or all of the wheels 23 and 24 ( only the front wheels 23 in the illustrated embodiment ) are brakes 27 of any desired type . an operator may be seated on a suitable seat ( neither of which are shown ) behind an accelerator pedal 28 , for controlling the speed of the electric motor 25 , a brake pedal 29 , for operating the wheel brakes 27 , and a steering wheel 31 , for steering the front wheels 23 in any desired manner . also juxtaposed to the operator &# 39 ; s position is a main switch 32 , and a direction control switch 33 , for controlling the direction of travel of the golf cart 21 by controlling the direction of rotation of the motor 25 . the main switch 32 and the direction control switch 33 are connected to a controller 34 . operation of the accelerator pedal 28 is transmitted to an on off pedal switch 35 and an accelerator opening degree sensor 36 connected to the controller 34 , to send on or off state of the accelerator 28 and its degree of opening to the controller 34 . a plurality of batteries 37 as power sources are mounted suitably on the body frame 22 and are connected through a relay 38 to the controller 34 . referring now to fig2 this is a circuit block diagram of the electric vehicle 21 using the shunt motor 25 and embodying the invention . electric power sent from the batteries 37 is supplied through the relay 38 to an mpu 39 having a memory and a control circuit to supply the necessary power to various driving circuits as will be described . signals from the main switch 32 , the pedal switch 35 , the direction control switch 33 and the accelerator opening sensor 36 are inputted to the mpu 39 , from which a command signal for drive - controlling the motor 25 is outputted . further it is possible to interconnect a personal computer 41 or an external terminal device 42 and the mpu 39 through wire or wireless means such as infrared rays either to input a control program into the mpu 39 or read contents stored in the mpu 39 . continuing to refer to fig2 , the motor 25 is of the shunt coil type with an armature coil 43 and a field coil 44 connected to an armature driving circuit 45 and a field driving circuit 46 , respectively . the armature driving circuit 45 is a bipolar circuit formed as shown in fig2 with upper and lower rows of fets , eight in each row . driving current is supplied to the armature coil 43 by alternately switching on or off the upper and lower rows of fets . the field driving circuit 46 is an h - bridge circuit formed with four fets and capable of changing the direction of current by simultaneously turning on or off the diagonally opposing fets . it should be noted that the number of the fets used in the armature driving circuit 45 and the field driving circuit 46 is not limited to that mentioned above but may be appropriately determined according to the amount of current required for the motor 25 . a current sensor 47 is interposed between the armature driving circuit 45 and the armature coil 43 of the motor 25 . in a like manner , current sensor 48 is interposed between the field driving circuit 46 and the field coil 44 of the motor 25 . the current sensors 47 and 48 detect currents actually flowing through the coils 43 and 44 respectively . the detected currents of the motor driving command signals coming from the mpu 39 are feedback - controlled . in this way , the currents flowing in the armature and field sides are accurately controlled to produce torque in the motor 25 corresponding to the depression amount of the accelerator pedal . the motor 25 is provided with a speed sensor 49 made up of an encoder and other components . a method of control by the controller 34 , as shown in fig2 will now be described by reference to the block diagram of fig3 the input signal from the accelerator pedal 28 operated by the driver is amplified by an amplifier 51 and sent together with the vehicle speed signal from the speed sensor 49 to a vehicle speed determination circuit 52 . the vehicle speed determination circuit 52 determines the speed of the vehicle 21 and determines whether or not the vehicle speed has exceeded a specified reference value ( for example a limit speed of 22 km / h in a golf course ). a determination result of the vehicle speed determination circuit 52 or a binary signal of determination on whether or not the vehicle speed has exceeded the specified limit speed , together with the signal from the accelerator pedal 28 , is inputted to an armature command current operation circuit 53 . in addition , the on / off signal of the pedal 28 from the pedal switch 35 and the accelerator opening ( depression amount ) signal from the accelerator opening sensor 36 are sent to the armature command current operation circuit 53 directly or through the vehicle speed determination circuit 52 . the armature command current operation circuit 53 is a circuit built within the mpu 39 shown in fig2 to calculate a command current value for driving the motor 25 according to the accelerator pedal depression amount . this calculation is carried out for example with a map predetermined according to the accelerator pedal depression amount . the power source voltage from the batteries 37 is converted based on the calculated command current value into a coil driving voltage . the command current ( la ) of a calculated pulse width is applied to the armature coil 43 by a pwm control method . the mpu 39 is provided with a map ( la - lf map ) 54 for the field coil current ( lf ) for driving the motor 25 at a maximum efficiency according to the armature coil current ( la ). a field coil current lf is determined from the la - lf map 54 according to the command current la of the armature coil 43 and inputted to a field command current operation circuit 55 . the field command current operation circuit 55 converts the power source voltage from the batteries 37 into a coil driving voltage based on the lf obtained with the map 54 and applies a command current ( lf ) of a calculated pulse width to the field coil 44 by a pwm control method . since the motor 25 is driven with the la and lf calculated as described , a torque commensurate with the accelerator pedal depression amount is obtained . in addition , regenerative braking is performed as shown in the following embodiment with the regenerative current corresponding to operating conditions based on the armature current la detected with the current sensor 47 . this applies regenerative breaking when the operator releases the accelerator pedal 28 . this will now be described by reference to fig4 - 6 . fig4 is a chart showing how a regenerative braking process is applied at the time when the driver of the electric vehicle releases the accelerator pedal 28 . the release of the accelerator pedal at the time t 1 is detected by the pedal switch 35 ( fig2 ). the horizontal axis represents elapsed time . at the same time as the driver releases the accelerator pedal 28 at a time t 1 when driving , the armature current la which has been flowing in the positive direction is set to zero . from the time t 1 , the vehicle 21 coasts . after that , with a dwell interval of about several milliseconds interposed for electric stability , an armature current la is applied beginning at the time t 2 in a negative direction . this is in the regenerative direction opposite to the driving direction . the armature current la is controlled by changing its pulse width by the pwm of the armature command current operation circuit 53 . up to the time t 1 , a command current of a pulse width calculated according to the accelerator pedal opening up to that time is applied . from the time t 1 on , a command current with no substantial pulse signal with zero pulse width is applied . next , from the time t 2 on , command current is applied while its pulse width being gradually increased by the pwm control of the armature command current operation circuit 53 . due to the change in the pulse width , regenerative current increases gradually . the rate of increase in the regenerative current ( gradient toward the negative side of the graph ) is predetermined with a fixed gain constant . in this way , regenerative current is obtained within the pulse width and the freewheeling speed decreases gradually . the amount of regenerative armature current la is determined with the v - la map of fig5 representing the relationship between the vehicle speed v and the armature current la . for example , it is programmed as follows . in cases where the vehicle speed when the driver releases the accelerator pedal is not lower than the limit speed of 22 km / h in the golf course , the armature current la takes a maximum value of 250 amperes . when the vehicle speed slows down to 22 km / h or below by braking , the current value becomes a value commensurate with the vehicle speed . when the vehicle speed slows down below 10 km / h , the armature current la is made to zero so that regenerative braking is over . these values for the vehicle speeds may be set as desired by the program . the field current amount corresponding to the armature current la is determined according to the la - lf map shown in fig6 ( counterpart of the la - lf map 54 of fig3 ) representing the relationship between the armature current la and the field current lf . regenerative braking is performed with the armature current la and the field current lf determined as described above . the regenerative braking starts from a time t 3 slightly after the time t 2 by applying the current lf to the field coil 44 . the field current lf is of a value corresponding to the armature current la of up to the time t 1 , up to the time t 2 and decreases from the time t 2 on . this rate of decrease ( gradient of the graph ) is predetermined with a fixed gain constant . from the time t 3 on , field current lf is applied according to the la - lf map to obtain regenerative current corresponding to the la . the time t 3 ( point a ) is the time point when the value of lf according to the la - lf map becomes greater than the value of lf up to that time . after the point a , lf is applied according to the la - lf map . the time t 4 ( point b ) is the time point when the value of armature current la obtained with the v - la map of fig5 becomes greater . from a time t 4 on , the armature current la is calculated according to the v - la map while the field current lf is calculated according to the la - lf map . when the vehicle decelerates down to 10 km / h as set from the v - la map of fig5 at a time t 5 , the armature current la becomes zero . the field current lf starts decreasing at a time t 6 with a little delay and takes a minimum value at a time t 7 when the regenerative braking process comes to an end . after that , when the driver intends to stop the vehicle , the driver operates the brake pedal . in order to speed up , the driver operates the accelerator pedal . incidentally , it is also possible to design a v - la map to perform regenerative braking until the vehicle speed comes to zero . another embodiment of regenerative braking is shown in fig7 and 8 . this embodiment applies regenerative braking to limit maximum vehicle speed . referring first to fig7 this is a time chart showing a regenerative braking process for controlling that the vehicle does not exceed a limit speed even when the driver continues depressing the accelerator pedal 28 . the dotted curve denotes the vehicle speed during this operation . in case the vehicle speed exceeds the limit speed v 1 at a time t 1 , caused by , for example the vehicle going down an incline , the armature current la of positive direction is lowered to zero toward a time t 2 by decreasing pulse width by pwm control 53 . after a lapse of several milliseconds , predetermined by a timer , from a time t 3 on , armature current la is applied in negative direction to start regenerative braking . in this case , whether or not the vehicle speed has exceeded the limit speed v 1 is determined with the vehicle speed determination circuit 52 shown in fig3 . if it has , control is made to start regenerative braking . the field current lf is controlled according to the la - lf map of fig8 . the armature current la during regenerative braking increases in proportion to the amount the vehicle speed exceeds the limit value . after the armature current la in negative direction flows to start regenerative braking , the vehicle speed may still increases due to inertia for some period of time , and then decreases . when the vehicle speed lowers down to the limit speed at a time t 4 , la is decreased according to a predetermined gain constant down to zero at a time t 5 then the regenerative braking is stopped . if the driver continues depressing the accelerator pedal 28 , after the time t 5 at which regenerative braking is stopped , the armature current la increases in positive direction to continue driving state of the vehicle . if the vehicle speed again exceeds the limit speed v 1 , the regenerative braking as aforenoted is repeated . fig9 and 10 illustrate another embodiment of regenerative braking in a case where an unattended vehicle starts descending on a slope or the like . when no accelerator input is detected and a vehicle speed greater than a specified speed , for example 1 km / h , is detected , the mpu 39 determines the vehicle to be in an unattended driving state . in that case , first it is detected in which direction , forward or reverse , the vehicle is moving . fig9 is a graph showing a search current process for detecting the direction the vehicle 21 is moving . this is done by applying a search current in either a positive or negative direction of the field coil 44 and finding which direction of applying the search current , positive or negative , results in the detection of current on the armature coil 43 indicated with the dotted curve . the current flowing in the armature coil 43 is the regenerative current . in the event current is detected in the armature coil 43 when a search current in positive direction is applied to the field coil 44 , the electric vehicle 21 is determined to be moving forward . in this case , a current ( regenerative current ) will not be detected if a search current in the negative direction is applied . in contrast , if a current is detected on the armature coil 43 when a search current in negative direction is applied , the vehicle 21 is determined to be moving in reverse direction . after the driving direction is detected by the search current process of fig9 , regenerative braking is started as shown in fig1 . the period from time t 1 to time t 2 of fig1 represents the search current process time shown in fig9 . for example , if the vehicle 21 is determined to be moving forward , an armature current la is applied so as to produce torque in reverse direction , against the moving direction of the vehicle 21 . when the vehicle speed becomes zero at a time t 4 , the armature current la is also brought back to zero . if the search current applied to the field coil is different in direction , positive or negative , from the field current lf for regenerative braking , a time interval of about several milliseconds is required between the time t 2 and t 3 to securing electric stability . also , before and after the period of time ( between t 5 and t 6 ) in which the field current lf is lowered with a fixed gain constant , the field current is kept constant for a period of several milliseconds by a timer . after the vehicle stops the regenerative braking process is concluded and current flow becomes zero both in the armature and field coils 43 and 44 . referring now to fig1 and 12 , these show are a regenerative braking process in the so - called plugging operation , in which the driving direction , forward or reverse , is switched by operating the direction control switch 33 when driving the vehicle with the accelerator pedal 28 depressed without operating the brake pedal 29 or changing the position of the accelerator pedal 28 . simultaneously with operating the direction control switch 33 at a time t 1 while driving forward , the armature current la becomes zero . at the time t 2 the armature current la flows in the negative direction . in this case , in order that the vehicle 21 moving forward is quickly braked and switched to move in reverse , the field current lf is made to be the maximum , 25 amperes , regardless of the vehicle speed as shown in fig1 . when the vehicle speed lowers to a speed of for example 1 km / h just before a stop ( at a time t 3 ), the armature current la is set to zero , and after a time interval of several milliseconds set by a timer , the field current lf is set to zero . then , again after a time interval of several milliseconds set by the timer , the driving direction is switched at a time t 6 to drive in reverse . incidentally , as the driver continues depressing the accelerator during that time , the field current after the time t 6 flows in the reverse driving direction . it should be apparent that the maps for the current control used in the regenerative braking operations described are only examples and may be appropriately modified according to driving conditions and motor performance , etc . it is possible to perform regenerative braking while monitoring the vehicle speed according to preset limit speed , corresponding to various conditions of use of the electric vehicle , as a golf cart for driving on cart paths with varying grades or for other uses . this invention may be applied to various types of vehicles using a dc shunt motor as a driving source . of course those skilled in the art will readily understand that the described embodiments are only exemplary of forms that the invention may take and that various changes and modifications may be made without departing from the spirit and scope of the invention , as defined by the appended claims .

US-90759405-A

a process for producing organic acid esters using continuous countercurrent reactive distillation using acid catalysts in a structured packing in a single column is described . in the reactive distillation an organic acid ester is formed by chemical reaction and can be purified to its final state within the single column . organic acid esters are produced at relatively low cost , with less waste production , and in a less complicated manner than prior processes . organic acid ester have uses as solvents , as intermediate chemicals , and in consumer products .

all patents , patent applications , government publications , government regulations , and literature references cited in this specification are hereby incorporated herein by reference in their entirety . in case of conflict the present description , including definitions , will control . the improved process to make organic acid esters via reactive distillation is simple , inexpensive , and does not create large quantities of waste . the process is unique and has several advantages that distinguish it from prior methods for making esters . first , the use of a reactive distillation column is less expensive than the conventional batch process because it is a continuous process and because an unsoluble acidic ion exchange resin in structured packing elements is used as a catalyst instead of a soluble mineral acid . the ester formation and purification of the product can take place in a single piece of equipment , whereas a conventional process may require up to ten separate pieces of equipment . this reactive distillation process avoids the inherent difficulties associated with membrane processes . the process does not require external heating of the column . the mode of operation of the reactive distillation column is different from that used to make methyl and ethyl acetate , and acetate esters because the relative volatilities of the lactate esters , water , and alcohols are different than with acetates . in an acetate formation column , the acetate ester product is removed at the top of the column and water exits at the bottom . in the present invention as applied to organic acids such as lactic acid , propionic acid , and others , the ester product exits at the bottom of the column and water is distilled off at the top along with the extra alcohol . the ester product is refluxed to heat the column . the prior art on fatty acid esterification describe a reactive distillation column mode of operation similar to the present invention , but pure organic acid feeds are usually used as feedstocks . the present invention uses acids fed in an aqueous solution in an amount of 10 to 80 % by weight water . the reactive distillation process has an advantage over existing processes for producing organic acid esters , in that transesterification reactions can be carried out in the reactive distillation column to produce different esters from a single parent ester . methyl propionate can be produced as a parent ester via the reaction of methanol and propionic acid . ethyl propionate can be produced via the reaction of methyl propionate with ethanol , or butyl propionate via reaction of methyl propionate with butanol . any other propionate ester can likewise be produced in this way . the distinct advantage of this approach is that all of these reactions , including the original parent ester formation , can be carried out in the same piece of relatively inexpensive equipment . the ability to make a family of products using a single piece of equipment greatly improves process economics , provides better flexibility , and creates less risk than a process geared to produce a single product . there exists a large potential market for converting biomass - based organic acids , produced by fermentation of corn - or other crop - derived sugars , to their ethyl esters from ethyl alcohol which is produced in the fermentates . these ethyl esters have the advantages of being nontoxic , effective as solvents , and “ green ” in that they are produced from renewable resources . the potential markets for esters such as ethyl lactate have been described ( watkins , k ., chemical & amp ; engineering news 80 ( 2 ), 15 ( 2002 ); and formasari , g ., chimica e i &# 39 ; industria ( milan ) 82 ( 1 ), 26 ( 2000 )). presently operating corn ethanol plants can be expanded to include production of organic acids and their esters . the total market for petrochemical based solvents is several billion 1 b / yr — esters could replace a substantial of these and thus have an annual market exceeding one billion pounds . the improved reactive distillation process is shown via examples of ethyl lactate and methyl lactate formation in fig1 to 3 . fig1 shows a scheme for the bench scale production ( example 5 ) of ethyl lactate in a process that consists of a single reactive distillation column 10 in which absolute ethanol or an ethanol / water mixture is fed near the bottom of the column and lactic acid solution in water is fed near the top of the column . ethyl lactate product is generated and exits at the bottom of the column from a reboiler 11 , either in a pure form or along with small quantities of ethanol . if present , ethanol can be easily separated from the product ester by simple distillation and recycled . at the top of the distillation column , water and excess ethanol exit and undergo treatment to recover using a condenser 12 and recycle unused ethanol via one of several means . if the reactive distillation process is integrated into an existing fuel ethanol production facility , the ethanol / water top product can easily be recycled back into the ethanol purification facility to recover the unused ethanol in pure form . typically , this is accomplished by first distilling the ethanol to form an ethanol - water azeotrope and then using molecular sieves to break the ethanol - water azeotrope formed by distillation . in an alternate scheme , the ethanol - water azeotropic mixture can be directly recycled back to the reactive distillation column . this facilitates a reactive distillation process with feeding of azeotropic ethanol either alone or along with absolute ethanol at the same or at different feed positions along the reactive distillation column for production of ethyl lactate . in a third scheme , applicable for alcohols which do not form azeotropes with water , a second distillation column can be used to separate the excess alcohol from water and recycle it back to the column feed . fig2 ( example 10 ) shows a representative example of bench scale methyl lactate production . fig3 shows a representative bench scale transesterification ( example 12 ) in the same column 10 . ethanol and methanol are shown as example alcohols . alcohols greater than c4 are less volatile and therefore are less likely to be used . equipment and methods : reactive distillation experiments were conducted in laboratory and pilot scale facilities . the reactive distillation columns consist of pyrex tubes 5 . 0 cm in diameter and 2 . 0 m in height for the laboratory - scale column 10 and up to 6 . 0 meters in height for the pilot - scale column . the columns were equipped with feed ports at different points along their length to accommodate both acid and alcohol feed streams ; ports not used for feed streams were equipped with thermocouples to monitor column temperature over the course of reaction . the columns were fitted with katapak - sp catalytic structured packing from sulzer , inc . ( pasadia , tex . and winterthur , switzerland ) or katamax catalytic structured packing from koch - glitsch , inc . ( wichita , kans .). the preferred structure is shown in u . s . pat . no . 5 , 470 , 542 to sulzer , inc . the packing contained 75 g amberlyst 15 ™ rohm & amp ; haas , philadelphia , pa .) strong cationic exchange resin per meter of height as catalyst . amberlyst 15 ™ is a sulfonic acid macroreticular ion exchange resin . the column was also outfitted with a one - liter reboiler flask 11 and condenser 12 with reflux splitter to facilitate designation of reflux ratio . the system also included separate feed pumps for alcohol and acid . products from reactive distillation were analyzed by one of several methods . alcohol , water , and ester products were identified and quantified by gas chromatography using a varian 3700 ™ ( palo alto , calif .) gas chromatograph equipped with a porapak q ( alltech , inc ., deerfield , ill .) column and a thermal conductivity detector . acetonitrile was used as an internal standard to facilitate quantitative analysis . lactic acid concentration was determined by direct titration of bottoms stream using naoh . outlet and feed concentrations were placed into an excel ™ spreadsheet to allow calculation of overall product purities , conversion of lactic acid , and to facilitate an overall material balance on the column . bench - scale ethyl lactate formation . the following experiments in examples 1 to 8 , involve lactic acid and alcohols , using the bench - scale reactive distillation process for producing organic acid esters of the present invention . ethyl lactate formation : in the reactive distillation process for ethyl lactate formation , absolute ethanol or azeotropic ethanol was fed near the bottom of the column and lactic acid solution in water was fed near the top of the column . ethyl lactate was generated in the reactive zone of the distillation column and exited at the bottom of the column . depending on the feed compositions , ethyl lactate sometimes contained a small quantity of ethanol and water that was easily separated by simple distillation and recycled . water and excess ethanol exited at the top of the column . if the reactive distillation process was integrated into an existing ethanol production facility , the ethanol / water top product can be recycled back into the process to recover the unused ethanol in absolute form . alternatively , both recycled azeotropic and absolute ethanol can be fed into the column either at the same or at different locations of the reactive distillation column to produce ethyl lactate . experiments performed for ethyl lactate formation are given in table 1 ; a schematic of the reactant and product flow for a typical experiment ( example 5 ) is given in fig1 . absolute ethanol was fed at the bottom of the reactive distillation column reactive zone and lactic acid solution at the top of the reactive zone . ethanol and water were collected at the top of the column and ethyl lactate with unreacted lactic acid were collected from the column reboiler . a small quantity of ethyl lactate was observed in the distillate stream for some experiments , but that loss was overcome by optimizing column operation . the highest lactic acid conversion observed was 83 % ( example 5 ); this number is significant for a relatively short distillation column and is much higher than the equilibrium lactic acid conversion (− 55 %) at the same temperature . this conversion was achieved without reflux and with lactic acid fed very near the top of the column ; thus the column was operated essentially as a reactive stripping column . reasonable purity of ethyl lactate ( 80 mol %) was observed from the small column with the majority of impurity being unreacted lactic acid and small quantities of ethanol and water . a taller column , where additional conversion of lactic acid and better stripping of ethanol and water can be achieved , provides a bottoms product of essentially pure ester . it should be noted that examples 5 - 8 in table 1 were conducted by preheating the ethanol feed to an elevated temperature ( 82 ° c .) where it is vaporized . this results not only in reduced reboiler duty but in a lower water content in the bottom product . ethanol preheating has a beneficial effect in column operation . methyl lactate formation : the formation of methyl lactate in the laboratory scale reactive distillation column was studied in much the same fashion as in ethyl lactate formation . results of experiments conducted are given in table 2 ; a schematic of a typical experiment ( example 10 ) is given in fig2 . methanol and water were produced at the top of the distillation column , and methyl lactate along with unreacted lactic acid was produced at the bottom of the column . again , a slight amount of methyl lactate was observed in the distillate stream in some cases . a lactic acid conversion as high as 90 % was observed experimentally . the primary advantage of producing methyl lactate over ethyl lactate is that methanol and water do not form an azeotrope . thus , the methanol - water mixture produced at the top of the reactive distillation column was separated by simple , low temperature distillation and the methanol recycled to the column . in this way , only a stoichiometric quantity of methanol is consumed in the esterification and the overall processing costs are lower . trans - esterification of methyl lactate to ethyl lactate : the ability to produce methyl lactate straightforwardly by reactive distillation opens an additional pathway to lactate ester formation — that of transesterification . the advantage of transesterification reactions is that there is no water produced or required in the system , thus hydrolysis of the esters is not a concern . to explore this route , several transesterification experiments were conducted in the lab scale reactive distillation column . in transesterification , methyl lactate was fed at the top of the column reactive zone and ethanol is fed at the bottom of the reactive zone . ethanol moved up the distillation column and reacted with methyl lactate to give ethyl lactate and methanol . all methanol and excess ethanol exited at the top of the column , and ethyl lactate , unreacted methyl lactate , and a small quantity of ethanol were removed continuously from the reboiler . results of the transesterification of methyl lactate to ethyl lactate are shown in table 3 in examples 11 and 12 ( example 12 is in fig3 ). a methyl lactate conversion of 94 % was achieved with an ethyl lactate purity in the bottoms stream exceeding 90 % by weight . thus it is clear that transesterification is a viable method for producing a family of organic acid esters from a single parent ester . in a larger column complete transesterification will take place with pure product formation . computer simulations of the reactive distillation process for ester formation using aspenplus ™ version 11 . 1 and 11 . 2 ( aspen technology inc ., cambridge mass .) process simulation software . using aspenplus ™, the performance of the laboratory bench scale column was simulated on the computer using the equilibrium stage model with a height of an equivalent theoretical plate ( hetp ) equal to 0 . 6 meters of packing was simulated . from this , the parameter values that gave the best depiction of the actual process were identified . those same parameter values were used to simulate a commercial - scale esterification process at a production rate for ethyl lactate at 25 million pound per year ( 13 . 88 mol / min ). results of those simulations are given in table 4 for several monomeric lactic acid feed compositions . it is seen that feed solutions having a high acid content were readily converted to esters in high yields . as monomer acid concentration in the aqueous feed stream is reduced , it is necessary to add larger quantities of alcohol in order to maintain high acid conversion . as a consequence , the quantity of ethanol in the bottoms increases with increasing ethanol feed rate . it should be noted that , in the simulation , both lactic acid solution and ethanol were fed to the column as liquids at room temperature ( 298 ° k .). the state of the feed clearly influences both reboiler duty and the quantity of ethanol and water in the bottoms product . there is an opportunity to reduce ethanol content in the bottoms via preheating the feed streams ( examples 5 - 8 ). even without exploiting additional possibilities , the simulations demonstrate that the process can be used to esterify organic acids in relatively dilute aqueous solutions and achieve high yields of the ester product . table 5 provides a summary of the simulated commercial - scale column configurations for esterification of a 70 wt % lactic acid solution with absolute ethanol and methanol in a 3 : 1 alcohol : lactic acid ratio , and for transesterification of pure methyl lactate with absolute ethanol . it is seen that simulation predicts reasonably - sized commercial scale columns for producing organic acid esters . pilot - scale reactive distillation studies were conducted for the production of ethyl lactate . the column was configured such that the stripping zone constitutes the bottom 0 . 7 m of the column while the rectifying occupied the top 0 . 9 m below the condenser . the reactive zone thus made up the center 2 . 9 meters of the column . the column was assumed to contain a total of equilibrium 10 stages including reboiler and condenser . lactic acid solution (˜ 58 wt % monomer ) was fed at the 2 nd stage ( 0 . 3 m below condenser ) and absolute ethanol was fed at the 9 th stage ( 0 . 3 m above reboiler ); both feeds were at room temperature ( 298 ° k ). as with the bench - scale column , a reflux ratio of zero was found to give the best overall conversion of lactic acid to ethyl lactate . following several shakedown runs , a set of conditions were identified that give 81 % lactic acid conversion to ethyl lactate . this value is similar to the conversion obtained after limited optimization in the bench - scale column . with further optimization of the pilot - scale column ( see results of simulation below ) conversions exceeding those in the bench - scale column can be achieved . the pilot - scale reactive distillation column was simulated at reaction conditions and using the experimental reaction equilibrium data obtained in the laboratory scale column . the equilibrium stage model with an hetp of 0 . 6 m was used for the simulation . a comparison of the experimental and simulated results is given in table 6 ( examples 17 and 18 ) below ; there is reasonably good agreement between the product stream compositions and overall lactic acid conversion . temperatures and stage - by - stage compositions for both simulations and experiments are given in fig4 and 5 , respectively . additional simulations of the pilot - scale column were conducted by varying several operating parameters such as feed temperature , reboiler duty , feed flow rate and mole ratio . at optimal conditions , a lactic acid conversion of 92 % was achieved with an ethyl lactate product purity of 84 % by weight . in the following examples 19 to 40 the pilot - scale column was operated as shown in table 7 . the column configuration in table 7 is compared to the bench scale apparatus . the results are shown in tables 8 , 9 and 10 . c : a mixture consisting of ethyl ester of dimeric , trimeric lactic acid , as well as unreacted lactic acid monomer & amp ; dimer and higher oligomers and their esters c : a mixture consisting of ethyl ester of dimeric , trimeric lactic acid , as well as unreacted lactic acid monomer & amp ; dimer and higher oligomers and their esters 1 . parameters in example 19 were fixed as best optimized reaction parameters for the current process . various different parameters were altered in subsequent experiments to study their effect on process performance and results were compared with that from example 19 . 2 . examples 19 to 26 ( table 8 ) were performed by feeding ethanol near the bottom of the stripping section , i . e . 0 . 09 m above the reboiler ; while examples 27 to 40 ( tables 9 and 10 ) were performed by feeding ethanol near the bottom of the reactive zone , i . e . 1 m above the reboiler . 3 . examples 19 to 28 & amp ; 31 to 40 were performed by feeding absolute ethanol ; while examples 29 and 30 were performed by feeding a mixture of 95 wt % ethanol and 5 wt % water . 4 . examples 19 to 21 illustrate the effect of ethanol : lactic acid mole ratio . as the mole ratio of ethanol to lactic acid decreased from 3 . 60 to 1 . 44 , overall yield of ethyl lactate decreased from 67 % to 59 %, which is due to decrease in ethanol concentration in reactive zone ; but at the same time the bottoms product at low ethanol : lactic acid feed ratios is almost free from water and ethanol and makes the separation of final product much simpler in one distillation column . 5 . examples 19 , 22 and 23 illustrate the effect of ethanol feed temperature . increasing ethanol feed temperature from 25 ° c . to 78 ° c . ( liquid ) and then up to 85 ° c . ( vaporized ) has a deleterious effect on yield of ethyl lactate even though water and ethanol concentration in reboiler and thus bottoms stream are at their lowest level facilitating ease of separation of ethyl lactate from the mixture . results from example 21 ( liquid ethanol feed ) and example 23 ( vaporized ethanol ) are comparable . it can be observed that in both the cases of lower ethanol mole ratio and vaporized ethanol feed , the ethanol concentration in reactive zone is less than in example 19 and this has a favorable impact on maintaining lower ethanol concentration in reboiler , albeit with some loss in overall conversion and yield . 6 . examples 19 and 24 to 26 illustrate the effect of reflux ratio . as the reflux ratio was increased from 0 to 0 . 2 and subsequently to 0 . 5 & amp ; 1 , a decrease in overall lactic acid conversion as well as ethyl lactate yield was observed . increasing reflux ratio results in higher water concentration in the reactive zone , hence thereby reducing the conversion of lactic acid . 7 . examples 19 and 27 illustrate the effect of ethanol feed location ( i . e . 0 . 09 m above reboiler for example 19 and 1 m for example 27 ). ethanol feed points were altered to observe the effect of stripping section length on ethanol fractionation . no significant difference in results obtained from example 19 and example 27 was observed . therefore subsequent examples from 28 to 40 were performed by keeping the ethanol feed point at 1 m above the reboiler . 8 . examples 27 and 28 illustrate the effect of reflux ratio . as the reflux ratio was increased from 0 to 0 . 5 , a decrease in lactic acid conversion as well as ethyl lactate yield was observed . these observations are similar as those obtained with the same set of reflux ratios for ethanol feed 0 . 09 m above the reboiler ( examples 19 and 25 ). 9 . examples 27 and 29 illustrate the effect of ethanol feed composition . ethanol feed composition was varied between absolute ethanol ( example 27 ) and azeotropic composition of ethanol and water ( example 29 ). feeding water along with ethanol decreases lactic acid conversion and increases in the water concentration in reboiler and bottoms stream . 10 . examples 29 and 30 illustrate the effect of ethanol feed temperature when azeotropic ethanol feed was used . azeotropic ethanol was fed in its vapor form to observe whether complete removal of water from the reboiler is possible . by vaporizing ethanol feed , water and ethanol concentrations in the reboiler and bottoms stream were lowered . 11 . examples 27 and 32 illustrate the effect of aqueous lactic acid feed composition . the most advantageous aspect about 85 wt % aqueous solution is minimum quantity of water associated with it , which helps in increasing lactic acid conversion . however , 85 wt % lactic acid contains dimer ( lactoyllactic acid ) and trimers ( lactoyllactoyl lactic acid ) and higher linear oligomers besides lactic acid monomer and this poses a significant challenge in obtaining high yields of ethyl lactate primarily due to the esterification of dimer ( lactoyllactic acid ) and trimer ( lactoyllactoyl lactic acid ) to their respective ethyl esters . it was thought beneficial to use 50 % by weight lactic acid solution which contains a minimal amount of dimer ( lactoyllactic acid ) in order to increase overall yield of ethyl lactate . the mole ratio of ethanol to lactic acid used in example 32 is 7 . 28 : 1 . examples 32 to 40 were carried out with 50 wt % lactic acid solution . 12 . examples 33 and 34 illustrate the effect of lactic acid feed temperature . lactic acid feed temperature was increased from 25 ° c . to 100 ° c . ; a marked increase was observed in lactic acid conversion , yield of ethyl lactate and decrease in water content was also seen in reboiler . 13 . examples 33 and 35 illustrate the effect of ethanol to lactic acid molar feed ratio and ethanol feed temperature . since positive effects were observed at higher lactic acid feed temperature , it was thought to increase the ethanol to lactic acid molar feed ratio from 7 . 14 to 9 . 3 . ethanol was fed in its vapor form and this enhanced lactic acid conversion and ethyl lactate yield . the most significant result was absence of water in the reboiler and bottoms stream , even though more diluted solution of lactic acid was used than in earlier examples 21 to 31 . 14 . examples 35 and 36 illustrate the effect of ethanol to lactic acid feed ratio when both reactants are fed at higher temperature . significant amount of ethanol was observed in reboiler in example 35 , therefore ethanol to lactic acid mole ratio was reduced to 7 . 14 from 9 . 3 . by lowering ethanol feed rate and vaporizing it as well as feeding heated lactic acid solution , both ethanol and water were eliminated in the reboiler and bottoms streams , albeit with a modest decrease in ethyl lactate yield . 15 . examples 33 and 37 illustrate the effect of ethanol feed temperature at same feed rate . increasing ethanol feed temperature from 25 ° c . to 85 ° c . ( vaporized ) had a positive effect on lactic acid conversion . the conversion of lactic acid increased from 56 % ( example 33 ) to 91 % ( example 37 ) and ethyl lactate yield increased as well . feeding ethanol at its vapor temperature also greatly reduces the quantity of water and ethanol in the reboiler and bottoms streams . 16 . examples 37 and 38 illustrate the effect of ethanol feed rate at same feed temperature . since a small amount of ethanol was observed in the reboiler in example 37 , the ethanol to lactic acid molar feed ratio was further decreased from 7 . 3 to 5 . 3 . this decrease in ethanol feed rate further decreases ethanol and water in the reboiler and bottoms streams , albeit with slightly lower lactic acid conversion and ethyl lactate yield . 17 . examples 38 and 39 illustrate the effect of ethanol feed temperature at same feed rate . it was assumed that feeding ethanol at a lower rate in its vaporized state might result in lower ethanol concentration in the reactive zone , which in turn would explain lower lactic acid conversion and ethyl lactate yield . in example 39 , ethanol was fed as a saturated liquid at 78 ° c . this resulted in substantial quantity of ethanol in the reboiler and bottoms streams . a lower conversion of lactic acid was also observed although yield of ethyl lactate remained comparable to that in example 38 . 18 . examples 37 , 38 and 40 illustrate the effect of ethanol to lactic acid molar feed ratio at the same feed temperature . when ethanol mole ratio was decreased from 7 . 31 ( example 37 ) to 5 . 3 ( example 38 ), a negligible amount of ethanol was seen in reboiler with some loss in lactic acid conversion and ethyl lactate yield . upon increasing ethanol to lactic acid molar feed ratio to 9 . 2 ( example 40 ), ethyl lactate yield is enhanced but a substantial quantity of ethanol appears in the reboiler and bottoms stream . the person of skill in the art would recognize that the present invention can be applied to esterify organic acids besides lactic acid , including other biomass - derived acids such as succinic acid , propionic acid , malic , glutaric , adipic , glyceric , 3 - hydroxy propanoic , citric , levulinic , and amino acids such as alanine , serine , glycine and lysine . lactic acid is unique in that it dimerizes and trimerizes in reactive distillation . the oligomer products of the process are useful as non - volatile solvents for paints and in paint removers . the solvents are considered to be “ green ”. hydrolysis experiment was performed with 37 g of residue , collected by completely removing ethyl lactate by vacuum distillation , and 37 g of water ( to maintain the concentration of final solution in a range of 50 wt %). this residue contains monomer , dimer , and trimer lactic acid along with dimer and trimer ethyl esters . a reaction was performed in batch reactive distillation apparatus to remove the ethanol as it was formed during the hydrolysis reaction . a schematic of the reaction set - up is provided in fig6 . reaction was catalyzed by amberlyst - 15 ion exchange resin at a loading of 3 wt % of total weight of reaction mass . reaction mixture was first allowed to reflux for 2 minutes before adding the catalyst and after adding the catalyst , periodic samples were collected to follow the concentration profile of reactants and products . the reaction proceeded with hydrolysis of the ethyl ester of dimer lactoyllactic acid and trimer lactoyllactoyl lactic acid yielding ethanol . the reaction was allowed to proceed for 7 h and sample was analyzed for final concentration of lactic acid and dimer . all dimer and trimer esters were consumed along with all trimer acid . lactic acid and dimer acid were determined by direct titration with naoh and back titration of excess naoh by sulfuric acid . lactic was estimated to be 52 wt % while dimer was estimated around 6 wt % of the solution . water was estimated by gas chromatograph to be 41 wt %. these compositions are consistent with the equilibrium concentrations of monomer and dimer as reported in literature at this concentration level of lactic acid . an efficiency of 95 % was obtained in apparatus in fig6 . fig7 shows an apparatus 100 wherein dimer ethyl ester and trimer ethyl ester are separated in a separate column 106 , hydrolyzed in column 109 and then recycled to lactic acid via recycle line 111 to the lactic acid feed 101 at the upper part of the column 103 . the elements of the apparatus are as follows : 101 — lactic acid feed line 102 — ethanol feed line 103 — ethyl lactate synthesis column 104 — bottom stream line from ethyl lactate synthesis 105 — water and unreacted ethanol line 106 — distillation column for separating dimers and trimers 107 — ethyl lactate line 108 — dimer and trimer esters , dimer and trimer acids 109 — hydrolysis column 110 — water 111 — lactic acid recycle line 112 — ethanol / water recycle line 113 — ethanol purification including breaking of etoh : h 2 o azeotrope 114 — ethanol recycle 115 — water using this system of columns , efficiencies of ethyl lactate production of over 95 % can be achieved . it is intended that the foregoing description be only illustrative of the present invention and that the present invention be limited only by the hereinafter appended claims .

US-89430704-A

the present invention relates to a chromogenic reagent for determining the iron content and the iron - binding capacity of serum , comprising chromazurol b , a buffer for keeping the ph at 4 . 5 - 5 , a surface - active substance in a concentration of at least 500 mg / l , a salt suitable for imparting an ionic strength expressed in terms of nacl concentration of at least 100 g / l and an aminoacid suitable for selectively binding the cu 2 + ions , in a concentration expressed in terms of glycine concentration ranging between 1 and 40 g / l .

fig1 illustrates the colorimetric absorption spectrum of cab to which an aminoacid has been added , according to the present invention , and in contact with a serum containing copper ions ( lower curve ) in comparison with the spectrum of the cab without aminoacid in contact with an identical serum containing the above said ions ( upper curve ). from fig2 it can be seen that in the reagent without aminoacid the chromogen has reacted with the cu 2 + ions of the sample yielding the strongly interfering colored compound the spectrum of which is depicted by the upper curve . fig2 illustrates absorption spectra of chromogenic reagents which have reacted with interfering proteins , of which the continuous curve relates to the reagent according to the present invention , the dot - and - dash curve relates to a reagent with a halved concentration of surface - active substance , the broken line curve relates to a reagent with the ionic strength reduced to one third and the dotted curve relates to a reagent without surface - active substance . the proteic interferences examined in this figure have been studied by precipitating in the serum , with edta ( 100 - 150 mg / ml ) the ions ( among which iron , too ) which react with the chromogen . from fig2 it can be seen that the surface - active substance , by dissolving the chromogen more finely , alters the structure thereof , while the increase in the ionic strength determines a rightward shift of the absorption maximum . fig3 again illustrates absorption spectra of reagents which have reacted with interfering proteins , of which the continuous curve is related to the reagent according to the invention , the dot - and - dash curve relates to the same reagent with a halved concentration of surface - active substance , the broken line curve relates to the reagent according to the invention but with the ionic strength reduced to one third and the dotted curve relates to the same reagent without cab . from fig3 it can be seen that the chromogenprotein reaction determines a spectrum with three peaks , two positive ones and a negative one therebetween , which are the algebraic sum of the color which forms from the reaction itself minus the color which disappears due to the decrease of cab in the reagent . of these three peaks , only the rightmost positive one yields interferences in the readouts in the useful interval of λ = 610 - 650 nm and therefore errors . therefore , it must be eliminated . the originality of the research which has led to the present invention lies in that it has shown that , by significantly increasing the concentration of the surface - active substance , the protein - cab interactions decrease . furthermore , by shifting the negative peak rightwards as the ionic strength increases , the rightmost positive peak disappears . it has thus been found that with a reagent according to the invention there are no interferences at λ greater than 610 nm and the absorptions , in the range of 0 . 004 ± 0 . 002 , are fully comparable to those which are obtained on sera treated with reagent without cab and therefore are negligible as far as analysis is concerned . accordingly ( see fig4 ), at lengths greater than 610 nm , the spectrum on the standard has the same pattern as the spectrum on the sera , and therefore the calculated values of iron concentration remain constant as λ varies . this is illustrated in fig4 which depicts , to the left , the absorption spectra on a standard ( st ) ( consisting of a fe 3 + 30 mmol / l solution ), on a control serum ( rn ) ( consisting of control serum roche ) and on two human test sera ( s 1 and s 2 ). the same fig4 to the right , illustrates the values of serum iron concentration calculated with the formula : ## equ1 ## the chromogen used in the reagent according to the present invention is ex conc . bn azure dichrome ( c . i . mordant blue 1 / 4380 ) commonly termed chromazurol b ( cab ). a quantity of chromogen is used which may vary between 40 to 80 mg per liter of reagent . the surface - active substance which can be used in the reagent according to the invention may be any one commonly used in similar analytical reagents . as an example , it is possible to use cetyltrimethylammonium bromide ( ctma ), triton x100 produced by b . d . h . and composed of isooctylphenoxypolyethoxyethanol , therit produced by carl klinke and composed of hydroxypolyethoxydodecane , or ethylhexadecyldimethylammonium bromide by kodak , of which the first , i . e . ctma , is preferred . the salt which may be used to impart the ionic strength required in the reagent according to the invention may be any . obviously , for reasons of availability and cost , nacl is preferred . the ionic strength of the reagent is calculated , as is known , according to the formula ## equ2 ## the aminoacid preferably used in the reagent according to the invention is glycine or its derivative glycylglycine , glycylalanine , but it is equally possible to use other aminoacids such as alanine , glutamic acid , etc ., or a derivative thereof containing said aminoacids in its structure . the reagent according to the invention may be prepared by means of conventional methods by purifying cab , salifying it with the amount of salt suitable to impart the abovementioned ionic strength thereto , and mixing it with the surface - active substance , the aminoacid and an appropriate buffer suitable to keep the ph at 4 . 5 - 5 , e . g . a buffer of acetic acid - sodium acetate . the following example illustrates a method of preparing the reagent according to the invention . ______________________________________chromazurol b 65 mgsodium acetate 32 gmagnesium chloride 108 gacetic acid 8 mlctma 1 g25 % ammonia 50 mlglycine 7 . 5 g______________________________________ the whole is dissolved into one liter of distilled h 2 o . the reagent thus obtained is useful in determining the concentration of iron and the iron - binding capacity of serum with the conventional colorimetric methods , without the use of blank sample . thus , in the determination of the iron , the sample of serum , a standard and a blank composed of distilled water are mixed with an equal amount of reagent , and after accurate agitation of the mixture the readout is performed of the absorption of the sample and of the standard against the blank , at 630 nm . then the iron concentration is calculated with the formula described above in relation to fig4 . in order to determine the total iron - binding capacity , the sample of serum is saturated with an iron saturation agent , then left to react after accurate agitation , the excess iron is removed by absorption on carbon dust and subsequent centrifugation and the iron present in the supernatant is metered with the same process used above to determine the iron . from what has been described , it can be seen that the reagent according to the invention achieves the intended objects , constituting a safe and reliable means of analysis which eliminates the ionic and proteic interferences and allows to achieve accurate and reproducible analysis results .

US-94713386-A

a device for servicing fabric that is composed primarily of man made fibers such as polyester . the device includes a heated cutting element and two channels that smooth and form the melted edges of the fabric to a desired contour and thickness .

referring now to fig1 there is shown a length of fabric 10 passing through a loom having rollers 11 and 12 to direct the fabric . the fibres of the fabric may be wholly or partially man made such as polyester . synthetic fibers of the type included in the fabric will melt when subjected to heat . the fabric that is severed by the present invention will comprise 70 % or more of these man made meltable fibers . it is desirable to have lengths of fabric of predetermined width less than the width of the fabric as it comes from the loom . in the example of fig1 the fabric 10 is severed into strips 13 and 14 of predetermined width . the severing is accomplished by three cutting heads 15 , 16 and 17 located at predetermined lateral distances and mounted in any suitable manner to engage the fabric . as shown , cutting head 15 is mounted to sever one outer edge and cutter head 17 the other edge whereas cutter head 16 is centered to divide the fabric 10 into the two strips 13 and 14 . each of the three cutting heads are of similar construction and shown in detail in fig3 and 5 . the head comprises a casing made of a unitary bottom and sides piece 18 and top 19 secured to 18 by screws 21 . the cutting tool 22 is secured to a shank 23 by any suitable means which in turn is screw threaded into standoff 24 which is made of a low thermal conductive material such as ceramic . another screw 25 passes through a cross plate 26 and serves as a mounting screw for the cutting tool assembly 22 , 23 and 24 . the cross plate is mounted to the underside of head top 19 by standoffs 20 , 25 and their mounting screws 27 , 28 , 29 and 31 . standoffs 20 , 25 are made of the same low thermal conductive material as standoff 24 . a resistance heater coil 32 surrounds shank 23 and serves to heat the cutting tool 22 . a pair of leads 33 connected to the heater coil 32 lead to a suitable electrical control circuit that supplies electrical energy by conventional means . shoe 34 is separated slightly from case top 27 , typically by about twice the thickness of the fabric to be cut and sealed . spacers 35 , 36 separate the shoe from the case and by means of screw 37 the distance between the case and shoe may be adjusted . the spacers 35 , 36 and screw 37 are downstream of the cutting tool 22 so that the fabric is cut and parted before reaching the spacers and screw . in this manner it passes on both sides of these elements which consequently do not interfere with the fabric flow . the details of the cutting tool are more clearly shown in fig6 and 8 . it consists of two plate members 38 , 39 each having a substantially flat inner surface , the two inner surfaces facing each other and separated a predetermined distance . the plate members are held apart by wedge 41 having a cutting edge 42 which serves to sever the fabric . an important feature of the invention is the channel on each side of the wedge 41 through which the severed fabric edge passes to control , limit and smooth out each edge of the fabric . one channel is designated 43 and is defined by the two inner flat surfaces of members 38 , 39 and the side 44 of wedge 41 . the other channel 45 is defined by the flat surfaces of members 38 , 39 and the other side 46 of the wedge . it is understood that as the fabric is severed by heated edge 42 , the two severed edges are pulled into the two channels . as the fabric is cut , surface tension causes the edges to begin to bead , but because it is forced into the channels the undesirable beading is prevented and the fabric is shaped and smoothed by the channels . fig2 shows the fabric 13 with a smooth and shaped edge 47 . it is understood that the fabric edge is in a melted state as it passes cutting edge 42 and is promptly directed into channels 43 , 45 . the channel thickness is chosen to prevent a bead from naturally forming on the severed edge of the fabric as it would in the absence of the channel . the channel will serve to form the melted severed edge as shown at 47 in fig2 . the relative speed of the moving fabric and length of the channel is such that as the fabric exits from the rear of the channel the fabric edge is sufficiently solidified that it will retain its form . the thickness of one size of fabric severed by the present invention is 0 . 016 inches and the channel spacing is 0 . 020 inches . as a result the formed edge has a thickness only 0 . 004 inches thicker than the fabric . although the invention has been described with respect to a specific embodiment thereof , it is understood that various embodiments and modifications may be made within the spirit and scope of the appended claims .

US-88887186-A

a device for anchoring an end of an elongated tensile flexible element guided along a tunnel provided through the bones of a joint for reconstruction of a ligament , comprising a female element , which defines an internal thread and can be inserted in the tunnel , and a male element , which defines an external thread and is suitable to be screwed with play into the female element so as to secure the elongated element between the internal and external threads .

with reference to the figures , the reference numerals 1 and 2 designate the heads of the two bones that form the articulation whose ligaments are to be reconstructed . for the sake of illustration , it is assumed for example that the heads 1 and 2 are respectively the heads of the tibia and of the femur and that the ligament to be reconstructed is the anterior cruciate ligament . according to known methods which are not included within the scope of the present invention and therefore are not described , a cylindrical tunnel 3 is provided through the heads 1 and 2 of the tibia and of the femur , and an elongated tensile flexible element is guided through the tunnel as a replacement for the torn ligament . such elongated element is constituted by a natural or synthetic tendon 4 whose anchoring inside the tunnel 3 is performed by the device according to the present invention . such device is generally designated by the reference numeral 5 in fig9 and 10 and comprises a female element 6 and a male element 7 . the female element 6 ( fig2 - 4 ) is constituted by a sort of cylindrical cage formed by means of a filament which is coiled so as to define a cylindrical helix composed of turns 8 which have a constant pitch . the turns 8 form an internal thread which is adapted to accommodate the male element 7 by screwing . conveniently , the turns 8 have an external flat region 9 which facilitates the insertion of the element 6 in the tunnel 3 . in order to prevent the element 6 from rotating inside the tunnel 3 , the turn located at the end designed to remain proximate to the inlet of the tunnel 3 is extended by a tangential part 10 ending with a portion 11 which is folded axially and by means of which a rotation - preventing anchoring is achieved on the cortex of the bone . the male element 7 ( fig6 and 7 ) is constituted by a screw which has an axis a and is composed of a core or shank 12 provided with a hemispherical head 13 . the shank 12 has a convex shape and a thread 14 runs around it with a pitch which is equal to the pitch of the female element 6 and has a semicircular cross - section narrower than the distance that separates the turns 8 of the female element 6 . the turns of the thread 14 are separated by a tunnel 15 having a semicircular cross - section which is narrower than the diameter of the filament of which the female element 6 is made . the disclosed device is completed by a washer 16 constituted by a disk which is convex like a spherical dome and has a cavity 17 whose dimensions are such that it can accommodate the head 13 of the male element 7 . in the bottom of the cavity 17 an opening 18 is provided through which the shank 12 of the male element is guided . the opening 18 extends diametrically in order to give the male element 7 a certain freedom of movement with respect to the washer 16 . the cavity 17 has a spherical shape complementary to the shape of the head 13 of the male element 7 . in this manner , the washer 16 can be orientated with respect to the axis a in order to adapt perfectly to the cortex of the bone . a chamfer 19 of the washer 16 facilitates its inclination without interfering with the female element 6 . the device is applied by first inserting the female element 6 in the tunnel 3 . this can be achieved by means of a tool 20 which is shown in fig5 and is composed of a shank 21 having , at one end , a handle 22 and , at the opposite end , a threaded portion 23 suitable to be screwed into the female element 6 until it abuts against a collar 24 . after positioning the female element 6 in the tunnel 3 so that the portion 11 anchors in the cortex of the bone 1 , the new tendon 4 is guided therethrough so that its end portions protrude from the tunnel 3 . finally , the male element is inserted by screwing and , thanks to its convex shape , forces the tendon t to engage between the turns 8 of the female element , while the washer 16 , by abutting against the cortex , blocks its end portions . the device according to the invention allows to obtain a double substantial advantage . first of all , a firm anchoring of the tendon is provided thanks to the fact that such tendon , by being arranged between the turns 8 of the female element and the thread 14 of the male element 7 , follows a winding path which offers considerable resistance to traction stresses , which is added to the resistance provided by the clamping between the thread 14 and the turns 8 . secondly , the anchoring of the tendon occurs inside the bone , so that the length of the tendon is reduced significantly , with particular advantages during the step of inclusion of the tendon in the bone , since the slack of the tendon in the tunnel 3 is reduced . in the practical execution of the device according to the invention , the shapes and the dimensions of the components may vary according to requirements . the device can be made of metal ( titanium or steel ) or of composite , absorbable or shape - memory materials . the disclosures in italian patent application no . bo2001a000263 from which this application claims priority are incorporated herein by reference .

US-89903401-A

a method of performing incremental aggregation of dynamically increasing database data sets . an embodiment of the present invention operates within a data mart or data warehouse to aggregate data stored within an operational database corresponding to newly received data to provide current information . initially , a computer server creates an intermediate file which is initialized by the server with an aggregate data set . the aggregate data set consists of data values and count values that each correspond to specific group identifiers . the computer determines if any group identifiers within a new set of inputs data are identical to any group identifiers stored within the intermediate file . if an inputted group identifier matches a stored group identifier , the inputted data value is aggregated with the stored data value and the count value corresponding to the specific stored group identifier is incremented by one . if an inputted group identifier does not match any of the stored group identifiers , the inputted group identifier and corresponding data value are stored within the intermediate file and a count value of one is appended to that specific group identifier . once all the group identifiers within the new set of input data have been determined , the computer stores all the changes that were made to the intermediate file into the aggregate data set .

a method for incremental aggregation of dynamically increasing database data sets are described . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the present invention . it will be obvious , however , to one skilled in the art that the present invention may be practiced without these specific details . in other instances , well - known structures and devices are shown in block diagram form in order to avoid obscuring the present invention . fig1 illustrates a computer system database that the present invention resides within to perform its aggregate operations of inputted data into the database system . this database system is made up of dedicated computer terminals 101 - 105 ( e . g ., personal computers , laptop computers , workstations , terminals , etc .) which are used to access the information accessible to server 110 ( e . g ., unix or nt server computer ). each computer terminals 101 - 105 has its own physical memory system ( e . g ., hard drive , random access memory , read only memory , etc .) for storing and manipulating data . server 110 is connected to mass storage device 112 which allows computer terminals 101 - 105 to access extremely large amounts of data located within mass storage device 112 . server 110 also has its own physical memory system which is accessible by computer terminals 101 - 105 . within the memory system of server 110 is located an in memory representation of the intermediate disk file 114 , which is used during the aggregation operations of the present invention within server 110 for display on computer terminals 101 - 105 . located within mass storage device 112 is operational database 116 , which stores the raw data for a data mart or data warehouse . data marts / warehouses 113 , located within mass storage device 112 , translates the raw data stored within operational database 116 into information that is more meaningful for decision support . either intermediate disk file 115 , located within mass storage memory device 112 , or the in memory representation intermediate disk file 114 can be used by the present invention to perform its aggregation operations . server 110 and mass storage device 112 are representative of a data warehouse , data mart , or any large database . it is important to point out that data marts / warehouses 113 , intermediate disk file 115 , and operational database 116 could each reside within a separate mass storage device and each mass storage device could be connected to a separate server . fig2 illustrates a flowchart of an embodiment of the present invention which performs incremental aggregation comprising of sum , average , or count on dynamically increasing database data sets . fig2 includes process 200 which starts at step 202 . step 204 directs server 110 of fig1 to create and initialize either intermediate disk file 114 or 115 with the aggregated data set currently stored within a target table located within data marts / warehouses 113 . the purpose of step 204 is to prepare either intermediate disk file 114 or 115 to store the aggregation of newly inputted data from operational database 116 with the data that has already been stored within the target table within data marts / warehouses 113 . the present invention can use either intermediate disk file 114 or 115 for its aggregation operations . for clarity during the explanation of the operation of the present invention , intermediate disk file 115 will be used during further description of process 200 . after completing step 204 , step 206 of fig2 directs server 110 to receive the new input row , which contains group identifiers and corresponding data values . the group identifier defines a specific group of items ( e . g ., hamburgers ) while the data value could represent how many of the group were sold . step 207 directs server 110 to examine the input row , which contains the group identifier and its corresponding data value , to determine the type of function that will be performed on the group identifier and corresponding data value during steps 210 or 214 . for example , the functions that could be performed by server 110 on the group identifier and corresponding data value are an insert , update , or delete function . the insert function directs server 110 to add the data of the input row to intermediate file 115 while the delete function directs server 110 to remove the data of the input row from intermediate file 115 . the update function directs server 110 to propagate the change or changes located within the data of the input row into intermediate file 115 . to clarify the explanation of the operation of the present invention , the insert function will be performed on the group identifier and corresponding data value of each input row within the intermediate file 115 . after completing step 207 , step 208 directs server 110 to determine whether a received group identifier of an input row is already located within the stored information of intermediate disk file 115 . if the received group identifier is not located within intermediate disk file 115 , server 110 is directed to step 214 . step 214 directs server 110 to add the new unique group identifier and its corresponding data value to the list of data stored within intermediate disk file 115 . step 216 directs server 110 to store a count value equal to the value of one that corresponds to the new group identifier just added to the stored data within intermediate disk file 115 . if the group identifier of an input row is located within intermediate disk file 115 , step 208 of fig2 directs server 110 to step 210 . step 210 directs server 110 to aggregate the newly received data value with the stored data value , located within intermediate disk file 115 , both data values corresponding to the same group identifier . step 212 directs server 110 to increment the stored count value by one which corresponds to the same group identifier of step 210 . the stored count value , corresponding to a specific group identifier , represents the amount of times that specific group identifier has been received by server 110 . steps 212 and 216 both direct server 110 to step 218 of fig2 . step 218 directs server 110 to determine if the last group identifier and its corresponding data value have been received and processed by process 200 . if the last group identifier and its corresponding data value have not been received and processed , step 218 directs server 110 to step 206 . server 110 repeats steps 206 - 218 until the last group identifier and data value have been received and processed by server 110 . once the last group identifier and data value has been received and processed by server 110 , step 218 directs server 110 to step 220 . step 220 directs server 110 to propagate the changes made within intermediate disk file 115 to the target table stored within data marts / warehouses 113 to update it with the new information . for optimization in speed , only the changes that occurred within intermediate disk file 115 are stored within the target table located within data marts / warehouses 113 . this optimization results in quicker storage and the elimination of unneeded storing procedures . once step 220 is completed , server 110 is directed to step 222 which ends process 200 . once process 200 of fig2 is complete , stored within a target table located within data marts / warehouses 113 of fig1 is each distinctive group identifier along with its corresponding sum of data values and a count corresponding to each specific group identifier indicating the amount of times each specific group identifier was received . with these three variables , the present invention is also able to direct server 110 to determine the average data value for each group identifier as part of its aggregation operations . the average data value , average , for a specific group identifier is computed by server 110 based on the relationship shown below : where sum is equal to the sum of the data values of a group identifier and count is equal to the count corresponding to that particular group identifier . the average data value can be computed for each group identifier and provides important information about the raw stored data . similar to the process described in process 200 of fig2 the present invention is also able to direct server 110 ( fig1 ) to use the data values of the group identifiers to compute the maximum and minimum data values . computing the maximum and minimum data values are each a separate function of the aggregation operations of the present invention . determining the maximum data value of all the groups could be useful in determining , for example , the customer who has spent the most amount of money . computing the minimum data value of all the group identifiers can likewise result in useful information for a decision maker . included within the present invention functions of incremental aggregation operations is the ability to direct server 110 ( fig1 ) to compute the variance of a user defined value or variable x . the variance of a number is computed by server 110 based on the relationship shown below : ## equ1 ## wherein xi is one of the elements of a user defined value x and n is the number of elements in the set of x . if the value of n is equal to 1 , the variance is equal to zero . computing the variance of a user defined value can result in the translating of raw data into meaningful information useful to a decision maker . another function included within the incremental aggregation operations of the present invention is the ability to direct server 110 to compute the standard deviation of a user defined value or variable x . the standard deviation is computed by first computing the variance as described above and then executing the square root of the value that represents the variance . computing the standard deviation of a user defined value can result in the translating of unintelligible data into useful information to be use in making key decisions . moreover , the present invention has the ability within its incremental aggregation operations to direct server 110 to compute the median of a user defined value or variable x . furthermore , the present invention has the ability within its incremental aggregation operations to direct server 110 to compute the rank of a user defined value or variable x . the rank function , for example , may require server 110 to rank the ten largest data values located within intermediate file 115 in a list in descending order . computing the median or rank of a user defined value can result in the translating of unintelligible data into useful information to be use in making key decisions . fig3 a illustrates a block diagram and tables representing how the present invention operates to direct server 110 ( fig1 ) to incrementally aggregate dynamically increasing database data sets . source table 300 represents the newly inputted data of operational database 116 that is received by server 110 for eventual storage within target table 302 , located within data marts / warehouses 113 . located within source table 300 is source fields 304 and 308 which jointly contain specific newly inputted data . source field 308 contains the newly inputted group identifiers while source field 304 contains their corresponding data values . target table 302 contains target fields 306 and 310 which jointly contain the stored aggregated data value for each corresponding group identifier . specifically , target field 310 contains the stored unique group identifiers while target field 306 contains the corresponding aggregated sum data values of each group identifier . source table 300a and target table 302a of fig3 a are provided to illustrate a specific example of how the present invention directs server 110 ( fig1 ) to perform aggregate operations . source table 300a and target table 302a each represent a more detailed depiction of source table 300 and target table 302 , respectively . source field 304a of source table 300a contain the data values while source field 308a contains the corresponding group identifiers . each data value of source field 304a corresponds to the group identifier of source field 308a located within the same row of source table 300a . likewise , each aggregated sum data value of target field 306a corresponds to the group identifier of target field 310a located within the same row of target table 302a . to more fully understand the aggregation operations of the present invention , source table 300a and target table 302a of fig3 a will be used in a specific example . the data value corresponding to the hamburgers group represents the amount of hamburger that were sold within an hour . the data value corresponding to the apple pie group represents the amount of apple pies that were sold within an hour . the data value corresponding to the milk shake group represents the amount of milk shakes that were sold within an hour . source field 308a of fig3 a contains the different group identifiers while source field 304a contains their corresponding data values . it can be observed that the first row within source table 300a represents the fact that 5 hamburgers were sold within an hour , while the second row represents the fact that 6 apple pies were sold within an hour . the third row within source table 300a represents the fact that 3 hamburgers were sold within an hour , while the fourth row represents the fact that 4 milk shakes were sold within an hour . the fifth row located within source table 300a represents the fact that 7 apple pies were sold within an hour . the present invention directs the aggregation of this newly inputted data and then stores this information within target table 302a . as illustrated within target table 302a of fig3 a , the present invention directs server 110 to receive and aggregate all the data values of the hamburger group and store them for a total of 8 hamburgers sold within an hour , which is shown in the first row of target table 302a . the present invention directs server 110 to receive and aggregate all the data values of the apple pie group and store them for a total of 13 apple pies sold within an hour , which is shown in the second row of target table 302a . moreover , the present invention directs server 110 to receive the data value of the milk shake group and store it for a total of 4 milk shakes sold within an hour , which is shown in the third row of target table 302a . this example illustrates the aggregation operation that is performed by server 110 ( fig1 ) under the direction of the present invention . to more fully understand how the present invention performs its aggregation operations , it will be shown within fig3 b how the present operation directs server 110 to receive and perform aggregation on a new source table of information and how changes are made to the values that already exist within target table 302a . fig3 b shows source table 300a &# 39 ; and target table 302a of fig3 a to illustrate more fully how the present invention incrementally aggregates dynamically increasing the database data sets . target table 302a is exactly the same table that is shown in fig3 a , except that it exhibits how the present invention directs server 110 to change the data values and add new group identifiers and their corresponding data values , as they are received . source table 300a &# 39 ; is the same type of table representation as source table 300a of fig3 a , except that source table 300a &# 39 ; represents a new set of input data values along with corresponding group identifiers . the group identifiers located within both source table 300a &# 39 ; and target table 302a represent that same things as described above for fig3 a . the only difference is that there is a new group identifier that has not yet been defined . the data value corresponding to the salad group represents the amount of salads that were sold within an hour . source field 308a &# 39 ; of fig3 b contains the different group identifiers while source field 304a &# 39 ; contains their corresponding data values . it can be observed that the first row within source table 300a &# 39 ; represents the fact that 5 milk shakes were sold within an hour , while the second row represents the fact that 6 salads were sold within an hour . the third row within source table 300a &# 39 ; represents the fact that 4 hamburgers were sold within an hour . the present invention directs server 110 to receive this second set of newly inputted data and then incrementally aggregate it and store it within target table 302a . as illustrated within target table 302a of fig3 b , the present invention directs server 110 ( fig1 ) to receive all the data values of the hamburger group and incrementally aggregate them with the data value that already existed in fig3 a and store them for a new total of 12 hamburgers sold within an hour , which is shown in the first row of target table 302a . the present invention did not receive any data values for the apple pie group , so the data value that already existed within target table 302a for the apple pie group is not modified and remains constant at 13 apple pies sold within an hour . this constant data value of the apple pie group is shown in the second row of target table 302a . the present invention directs server 110 to receive all the data values of milk shake group and aggregate them with the data value that already existed in fig3 a and store them for a new total of 9 milk shakes sold within an hour , which is shown in the third row of target table 302a . moreover , the present invention directs server 110 ( fig1 ) to receive the new salad group and its corresponding data value and store them within target table 302a for a total of 6 salads sold within an hour , which is shown in the fourth row of the table . this example illustrates the incremental aggregation operation that is performed by the present invention on dynamically increasing database data sets . in one embodiment of the present invention , a high speed search mechanism is used to search through intermediate disk file 114 , which resides within server 110 of fig1 or intermediate disk file 115 . one way to implement this high speed search mechanism within the present invention is to use a b - tree , which is well - known to those of ordinary skill in the art . for example , assume there is one million groups stored within intermediate disk file 114 of fig1 . a new group is inputted into server 110 from operational database 116 , which needs to determine if the newly received group is located within the one million stored groups or not . the b - tree methodology is able to quickly determine whether the newly received group is located within the one million stored groups without evaluating each and every stored group . another embodiment of the present invention to quicken the aggregation operations is to move the data stored within either intermediate disk files 114 or 115 into the random access memory ( ram ) of server 110 of fig1 . this allows the aggregation operations of the present invention to be performed much quicker than if it was done from the hard drive of server 110 . in other words , the present invention will cache the b - tree disk file in ram to be utilized . in yet another embodiment of the present invention there is a method for maintaining the integrity of either intermediate files 114 or 115 of fig1 . to accomplish this method , a copy is made of either intermediate files 114 or 115 before and after the new inputted data from operational database 116 is aggregated by the present invention . by making these copies before and after the aggregation of new inputted data , it ensures that the information stored within either intermediate disk files 114 or 115 remain accurate before eliminating the previously saved copy . this copying is also performed to guard against a system failure happening before or after aggregation has taken place . another process that is performed to prevent against the loss of data during a system failure is that either intermediate disk files 114 or 115 have sealed significants of the data bits to ensure data correctness . furthermore , in the present invention , individual intermediate disk files 114 or 115 ( fig1 ) may be created for each target table 302 ( fig3 a ) aggregation . in other words , if there are several target tables and there are different items being aggregated , there will be different intermediate disk files that are saved for each specific target to ensure that the data is proper for that specific target table . a further embodiment of the present invention includes the ability to provide failure recovery support . when constructing the b - tree , a system failure can occur before or after it is constructed . if the failure occurs before the b - tree is constructed , the present invention is able to return to the previously saved point and maintain the data integrity . if the system failure occurs after the b - tree has been successfully constructed but before the target database has been updated , intermediate disk files 114 or 115 contains an accurate copy of the aggregated data but the target data is out of synch . to solve this problem , a specific mechanism is used that is able to load directly from the b - tree into the target table at high speeds without error . the foregoing descriptions of specific embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . the embodiments were chosen and described in order to best explain the principles of the invention and its practical application , to thereby enable others skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents .

US-84693497-A

processing arrangements and methods are provided for the automated decoding or translation of information in healthcare data records , which are coded in a non - standardized or varying formats . a data record which contains information , a portion which is recognized and another portion of which is new , is decoded or translated using a statistical mapping rule . the mapping rule assigns a most likely translation value to the information based on the recognized portion of the information . the statistical mapping rules are established by analysis of a set of previously decoded data records .

the present invention provides solutions for translating or decoding information in health care data records , which is coded in a non - standardized or varying formats . the solutions may be implemented in conventional computer data processing arrangements so that electronic health care data records can be processed automatically . the solutions utilize continuous learning algorithms to decode new information , which at least partially overlaps with the previously mapped or decoded information . the learning algorithms exploit previously validated mappings of information as bridges to decode and establish mapping rules for the partially overlapping new information . the mapping rules for the new information may be validated or verified on a statistical basis . the validated mapping rules are assembled in a bridge table or reference file for convenience in use . for purposes of describing applications of the invention , prescription transaction data records are used as the exemplary health care data records , herein . fig2 shows the format of an exemplary prescription transaction record 200 , which may be prepared by a retail pharmacy in the course of filling a prescription request by a customer . the prescription transaction data record may be part of an electronic data file that is assembled by a data supplier / vendor , and made available for analysis ( e . g ., to market researchers ). prescription transaction data record 200 may include one or more data fields ( e . g ., bin , pcn or group id ) that include coded information on the parties ( e . g ., banks , processors , health insurance plans ) that are involved in authorizing or making payments for the prescription . data record 200 also may include an alternate or additional fourth field (“ ds ”), which includes data supplier specified codes for the payer (“ ds payer codes ”). the ds payer codes in a data record might be payer identification codes that are assigned to payers by independent choice or practice of the data supplier or data record preparer . different suppliers and data record preparers may choose varying formats for the ds payer codes . other data fields in data record 200 also may include other supplier / preparer specified indicia in varying formats . fig1 a and 1 b show the steps of an exemplary learning procedure 100 for mapping non - standardized information in health care records . procedure 100 may be used so that the non - standardized information may be used to categorically identify or associate specific third parties ( e . g ., specific managed health care payers and plans ) with the specific health care records . procedure 100 may be advantageously used by a market researcher or analyst (“ mr ”), for example , to relate specific managed health care payers and plans (“ payer ”) to specific prescription transaction data records . as a preliminary step , the mr may establish a comprehensive identification list of payers . each payer in the list may be uniquely associated with a unique mr code (“ mr payer code ”). the mr payer code may , for example , be a six - character alpha - numeral . at step 110 , mr acquires a file of prescription transactions data records (“ rx file ”) for analysis . the prescription transaction records in the rx file may , for example , include information on retail prescription transactions conducted in any suitable market region or segment of interest . further , the prescription transactions data records in the rx file may span any suitable time interval of interest ( e . g ., a week , month or quarter ). the data records in the rx file may be acquired directly from retailers ( e . g ., independent pharmacies or drug store chains ) by the mr itself or acquired using the services of intermediary commercial data vendors or suppliers . the prescription transaction data records may include one or more data fields ( e . g ., bin , pcn , group id , ds ) that include coded information on the prescription payers . ( see e . g ., fig2 ). the ds data field may include data supplier / preparer specified codes for the payer (“ ds payer codes ”) in varying formats . additional data fields may include other supplier specified indicia . the data supplier may in some instances make available to the mr a glossary of the ds payer codes . the glossary may , for example , indicate that a code “ xxyy ” refers to “ xyz ” health insurance company . the data records in the rx file or similar data records may previously have been processed using procedures other than procedure 100 ( e . g ., manual verification procedures or data supplier glossaries ) to decode the identity of parties responsible for authorizing and / or making payments for at least some of the data records . at step 120 of procedure 100 , the prescription transaction data records in the rx file are processed to retain only those transactions that involve a third party payer ( i . e ., a health care plan ). at this step , all cash transactions , which , for example , are fully paid for by the retail customers , are excluded from the rx file under analysis . prescription transactions that are covered by medicaid or other government initiatives also may be excluded from the rx file . thus , only “ non - cash ” transactions that include information about a third party payer are retained in the rx file . the percentage of non - cash transactions in a typical rx file under present pharmaceutical market conditions may be about 75 %. next at step 130 , a “ populated ” set of prescription transaction records in which both of the bin and group id data fields are populated is identified . optionally in some implementations of process 100 , data transaction records , which alternately or additionally have the pcn data fields populated also may be included in the “ populated ” set of data transaction records . similarly , the populated set of data transaction records may further include data transactions in which the ds field is populated with data supplier specified payer codes . at associated step 130 a , the populated set of data records may be analyzed to identify the number of and to update a list of all unique combinations of bin and group id values found in the data records . in implementations where pcn data fields are also considered , the identification of unique combinations of bin and group id values may be extended to include pcn values as appropriate . at step 140 of procedure 100 , the populated set of prescription transaction records is separated into two subsets a and b . the first subset a includes prescription transaction records whose bin and group id combinations have been previously mapped to corresponding payers ( i . e . mr payer codes ). these prescription transaction records may have been previously mapped using , for example , recognizable ds codes and supplier glossaries . conversely , the second subset b includes prescription transaction data records whose ds codes or other supplier indicia have not been previously mapped to or associated with specific payers . in other words the ds codes or other supplier indicia values are new or not recognized . at optional step 150 , the data records in subset a may be encoded with the mapped mr payer id corresponding to the combinations of bin and group id values in the records . similarly , the data records in subset b may be encoded with the dummy mr payer id values ( e . g ., all 7s , 8s or 9s ) to indicate that the ds codes or other supplier indicia in the records are new and have not yet been mapped to mr payer id values . in learning procedure 100 , the subset a data records and associated mapping information are advantageously used to learn mapping rules that can be applied to the new data field combinations ( e . g ., those found in subset b data records ). the distribution of the number of data records in each subset a and b by data field value may then be computed . first , for example , at step 160 the mapped prescription data records in subset a may be sorted by , or binned or grouped for each unique combination of data field values ( e . g ., combinations of bin and group id values , or combinations of bin , group id and pcn values ) present in subset a . similarly , the unmapped prescription transaction data records in subset b may be sorted , binned or grouped for each unique combination of bin and group id values present in subset b . as part of the learning process , statistical analysis ( e . g ., frequency distribution analysis of data field values in subset a ) is conducted . at step 170 , the number of prescription transaction data records for each unique combination of data field values is counted . this step yields , for example , a frequency distribution of the unique bin and group id combinations across the prescription data records in subset a ( step 170 a ). using the frequency distribution results of step 170 , data field value combinations that have only a few associated prescription transaction data records may be dropped from further consideration in the learning process . for example , data field value combinations that have frequency counts that are less than a suitable cutoff number x , may be dropped from further consideration . the suitable cutoff number x may be selected on the basis of statistical theories of sample size , or empirically by trial and error use of procedure 100 . only data record groups corresponding to data field combinations that have an occurrence frequency greater than the cutoff limit x may be considered to have sample sizes of sufficient statistical significance . at step 180 and 180 a , these remaining data field combinations in subset a are analyzed to determine the frequency distribution of associated prescription data records by mr payer id to which they ( data records ) are mapped . for each unique data field value combination ( e . g ., bin and group id combination ) and each mapped mr payer id , the percentage of prescription data records mapped to the mr payer id is computed . as in the case of the distribution of data field combinations ( steps 170 and 170 a ), mr payer ids that have only a few associated prescription transaction data records may be dropped from further consideration in the learning process . for example , at step 190 prescription data records that are associated with mr payer ids that occur with a frequency of less than cutoff limit y % may be dropped from consideration . like the cutoff number x , the cutoff limit y % may be selected on the basis of statistical theories on sample size or empirically by trial and error . further at step 190 , each combination of unique data field values ( e . g ., bin , group id and / or pcn ) and its mapped mr payer id , which has an occurrence frequency greater than y %, is established as a “ mapping bridge ” these mapping bridges represent the mapping information learnt from subset a . such learnt mapping bridges may be applied to data records with unrecognized ds codes and other supplier indicia to map or associate these data records to mr payer ids . the learnt mapping bridges may , for example , be assembled or listed in a bridge table so that they can utilized in the manner of a lookup table in automated data processing arrangements . the mapping bridges may first be validated at optional step 200 , for example , by manually verifying the correlation of the specific combinations of bin , group id and / or pcn and specific mr payer ids with selected data suppliers . steps 210 - 240 shown in fig1 b , are exemplary steps that show the application of the learnt mapping bridges to address the problem of mapping the prescription transaction data records in subset b ( or other data files ) that have unrecognized ds or other supplier indicia . at step 210 , a determination is made of which bin and group id value combinations in subset b have corresponding mr payer id entries in the mapping bridge table . all the prescription transaction data records associated or binned with a specific bin / group id ( e . g ., step 160 ) may then be assigned the corresponding mr payer id entry shown in the mapping bridge table . at step 220 and 220 a , the remaining bin and group id value combinations , which do not have entries in the mapping bridge table , may be further to extract additional information . the number of prescription transaction data records associated with each of the remaining bin and group id value combinations may be counted . for the each of remaining combinations associated with a large number of prescription transaction data records , the distribution of data records by data supplier may be computed . at step 230 , selected data suppliers may , for example , be requested to assist in decoding or resolving ds codes and other supplier indicia so that these can be correlated to the mr payer ids . at step 240 , newly resolved bin / group id and mr payer id combinations may be added to the mapping bridge table for future use . it will be understood that the particular sequence of steps in learning procedure 100 described above is exemplary . the steps may be performed in any suitable sequence and particular steps may be omitted or modified . alternate or additional steps may be added to procedure 100 as suitable or appropriate , for example , for modifications of procedure 100 which employ alternative statistical or matching models . further , the steps of procedure 100 may be implemented in data processing arrangements using any suitable combination of computer hardware elements and software applications . the foregoing merely illustrates the principles of the invention . various modifications and alterations to the described embodiments will be apparent to those skilled in the art in view of the teachings herein . it will thus be appreciated that those skilled in the art will be able to devise numerous techniques which , although not explicitly described herein , embody the principles of the invention and are thus within the spirit and scope of the invention .

US-78242310-A

in a power converter , the duty cycle of a primary winding circuit causes near continuous flow of power through the primary and secondary winding circuits during normal operation . by providing no regulation during normal operation , a very efficient circuit is obtained with a synchronous rectifier in the secondary operating at all times . however , during certain conditions such as start up or a short - circuit , the duty cycle of the primary may be reduced to cause freewheeling periods . a normally non - regulating isolation stage may be followed by plural non - isolating regulation stages . to simplify the gate drive , the synchronous rectifiers may be allowed to turn off for a portion of the cycle when the duty cycle is reduced . a filter inductance of the secondary winding circuit is sufficient to minimize ripple during normal operation , but allows large ripple when the duty cycle is reduced . by accepting large ripple during other than normal operation , a smaller filter inductance can be used .

fig1 shows a full - bridge , single - transformer , voltage - fed isolation stage that incorporates synchronous rectification and the concepts of the &# 39 ; 417 patent . the operation of this isolation stage is as follows . for the first half of the cycle , mosfets 101 and 103 are turned on while mosfets 102 and 104 are left off , and the voltage vb is applied positively ( according to the “ dot ” convention ) across the transformer &# 39 ; s primary winding 107 . this voltage , modified by the transformer &# 39 ; s turns - ratio , appears across the secondary windings with the appropriate polarity . power flows into the transformer &# 39 ; s primary winding , and out of the first secondary winding 108 to the output . the voltage at node b is approximately twice the output voltage , and it causes the mosfet synchronous rectifier 105 to be turned on . the voltage at node a is therefore slightly below ground , which causes the mosfet synchronous rectifier 106 to be turned off . these states of the rectifier switches are consistent with the power flowing out of the first secondary winding . during the second half of the cycle , mosfets 102 and 104 are turned on while mosfets 101 and 103 are left off , and the voltage vb is applied negatively across the transformer &# 39 ; s primary winding . this negative polarity causes mosfet 106 to be turned on , mosfet 105 to be turned off , and power to flow into the primary winding and out of the second secondary winding 109 to the output across capacitor 110 . the secondary windings are not tightly coupled to each other , as indicated with the parasitic inductances 113 and 114 , to achieve the advantages discussed in the &# 39 ; 417 patent . a similar setup was shown in the topology of fig9 of the &# 39 ; 417 patent since it also used a single transformer . care must be taken in this isolation stage topology to insure that the magnetizing inductance of the transformer does not saturate . one way to do this is to place a large capacitor 215 in series with the primary winding , as shown in fig2 . this capacitor will assume a dc voltage across it that counters any imbalance there may be in the positive and negative volt - seconds of the waveforms created by mosfets 101 - 104 . alternatively , several well - known techniques to sense the magnetizing inductor &# 39 ; s current could be used to modify the durations of the first and second halves of the cycle . the filters at the output of the isolation stages in the &# 39 ; 417 patent are composed of one or more capacitive and inductive elements . when the isolation stage is voltage - fed , it may be desirable to have the output filter begin with an inductor 316 , as shown in fig3 . one benefit this approach provides is that the voltage - fed isolation stages can now be operated with a variable duty cycle control strategy to provide a soft - start capability or to limit current flow in a short - circuit condition . these functions could be provided by the regulation stages in the topologies depicted in the &# 39 ; 417 patent , but if the isolation stage is not combined directly with a regulation stage in a single product , then it may be desirable to include these functional capabilities in the isolation stage , as well . under variable duty cycle control , the percentage of the overall cycle ( the duty cycle ) that mosfets 101 and 103 ( or mosfets 102 and 104 ) conduct is reduced from the 50 % value described above . for the remaining , freewheeling fraction of the half - cycle , either all of the primary - side mosfets are turned off , or at least the two top mosfets 101 and 104 or the two bottom mosfets 102 and 103 are turned off . during the freewheeling part of the cycle , both diodes 111 and 112 conduct the current flowing through inductor 316 , and the voltage across the transformer windings is approximately zero . as is well know , this additional portion of the cycle permits the output voltage to be less than vb divided by the transformer &# 39 ; s turns - ratio . how much less depends on the duty cycle . since during normal operation the isolation stage is operated at a fixed duty cycle in which power is always flowing from input to output ( except during the brief switch transitions ), the value of inductor 316 can be relatively small to achieve an acceptable output ripple . this reduces the size , cost , and power dissipation of this inductor compared to what it might have been . during those times when the isolation stage is operated under a variable duty cycle , the ripple in the inductor current may then become large , but the larger output voltage ripple that results can usually be tolerated for start - up and short - circuit conditions . as mentioned above , during the freewheeling part of the cycle the diodes are carrying the inductor current . this is because the gate drive scheme shown in fig3 would cause the mosfet synchronous rectifiers to be off during this part of the cycle . the additional power dissipation that occurs due to the higher on - state voltage of the diodes compared to that of the mosfets can usually be tolerated for the start - up and short - circuit conditions because they are normally short in duration . if the output voltage is high , then it may be desirable to use a capacitive divider technique described in the &# 39 ; 417 patent to reduce the voltages applied to the gates of the mosfet synchronous rectifiers below that of the voltages appearing at nodes a and b . fig4 a - 4c show a circuit schematic of a product based , in part , on the ideas presented here and in the &# 39 ; 417 patent . the function of the product is to provide isolation and a transformation of the input voltage to the output voltage according to the turns - ratio of the transformer . it does not , in its normal state of operation , provide regulation . as such it is a very efficient product . one example of its use is to convert a 48v input to a 12v output by using a turns - ratio of 4 : 1 . since there is no regulation , if the input voltage varies +/− 10 %, so too will the output voltage vary +/− 10 %. in certain applications , this variation in the output is acceptable , and well worth the very high efficiency of the converter , which is 96 % in this example . in addition , since the converter of fig4 does not provide regulation , its output voltage demonstrates a droop characteristic . by this it is meant that for any given input voltage , the output voltage drops slightly as the output current increases . for instance , the output voltage may drop 5 % as the output current varies from 0 % to 100 % of the rated maximum value . this droop characteristic provides automatic current sharing between two or more such converters that might be place in parallel . note in this schematic that the ic labeled u 100 is a pulse width modulator ( pwm ) control chip that is normally operated such that the gate drive signals that pass through gate drivers u 101 and u 105 give the fixed duty cycle operation of the full - bridge described above . if the current sensing amplifier u 104 - a senses that the current flowing on the primary side of the circuit exceeds a threshold value , it commands the pwm control chip to reduce its duty cycle by an amount determined by how large the current gets above the threshold value . this provides a current limiting scheme for the product that protects against a short - circuit condition . note also that comparator u 106 - a senses the duty cycle output of the pwm control chip , and compares it to a threshold . if the duty cycle falls below this threshold value , the output of the comparator causes the pwm control ic to shut down . the circuitry around this comparator , including transistors q 111 and q 114 , provides a latching mechanism such that the pwm control ic remains off once this condition is observed . as described in the &# 39 ; 417 patent and illustrated in fig5 , in some situations , it may be desirable to place the isolation stage first in the power flow , and to have the regulation stage follow . for example , when there are many outputs sharing the total power , the circuit might be configured as one isolation / step - down ( or step - up ) stage 501 followed by several dc - dc switching or linear regulators 503 . the dc power source to the full bridge primary circuit may provide a voltage that varies over the range of 36 - 75 volts . the output of the isolation stage may be 12 volts , and the regulation stage output may be 5 volts or less . in particular , the regulation stage output may be 3 . 3 volts . typically , the regulation stage output is of a voltage level to drive logic circuitry . because the isolation stage uses synchronous rectifiers , it is possible for the current to flow from the output back to the input if , for a given input voltage and duty cycle , the output voltage is too high . this condition might , for example , occur during start - up where the duty cycle is slowly raised from its minimum value to its maximum value , but the output capacitor is already pre - charged to a high voltage , perhaps because it had not fully discharged from a previous on - state condition . it might also occur when the input voltage suddenly decreases while the output voltage remains high due to the capacitors connected to this node . the negative current that results could cause destructive behavior in the converter or in the system if it is not kept small enough . one way to avoid this condition is to turn off either just the top two primary - side mosfets 101 and 104 , or just the bottom two primary - side mosfets 102 and 103 , during the freewheeling period , as described above . by leaving the other two primary - side mosfets on , the voltage across the primary and secondary windings of the transformer is guaranteed to be essentially zero during the freewheeling period . given the gate drive scheme shown in fig3 , this , in turn , ensures the controlled rectifiers will be off during this part of the cycle . with the controlled rectifiers off , negative current cannot flow during the freewheeling period . negative current can flow during the non - freewheeling part of the cycle , but since it must always start at zero , its value is limited to the ripple that the inductor permits , which is typically small enough to not cause a problem . this negative current will be reset to zero at the start of each freewheeling period , either by providing a clamp circuit , as shown in fig4 d , or by allowing the controlled rectifiers to avalanche and act as their own clamp . since the clamp circuit must only work for a short duration , it need not recover its absorbed energy and so can be simple , such as the one shown in fig4 d . to limit the negative current , the isolation stage could operate in a reduced duty - cycle mode . while the control circuit is typically designed to achieve this mode during start - up and shutdown of the isolation stage , it is not the normal mode of operation . if , during normal operation , the input voltage drops suddenly , a large negative current can flow because there are no freewheeling periods . to avoid this condition , the current flowing through the converter can be sensed , either by sensing the load current directly , or by sensing a signal indicative of the load current . when the load current falls below some threshold , the duty cycle of the isolation stage can be reduced from its maximum value to provide freewheeling periods . given the drive scheme for the primary - side mosfets outlined above , the negative current will then be kept small since the controlled rectifiers will be turned off for a portion of the cycle . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims . for example , whereas the figures show the secondary side rectification circuit arranged in a center tapped configuration with two secondary windings and two synchronous rectifiers , as is well known it could be a full wave rectification configuration . one could use a full - bridge rectification circuit in which there is only one secondary winding and four synchronous rectifiers . such a circuit reduces voltage stress on the synchronous rectifiers when they are off by a factor of two during normal operation of the converter .

US-90124107-A

techniques for efficient storage and retrieval of preferred roaming lists are disclosed . in one aspect , prl entries are stored in two tables . one table contains records that are common to two or more prl entries . another table stores any information that is unique to a prl entry , as well as an indicator of which common record is associated with it . the common record is concatenated with the unique information to generate the uncompressed prl entry . various other aspects of the invention are also presented . these aspects have the benefit of reducing the memory requirements for storing a prl . in addition , time required to download the compressed prl is reduced .

fig1 is a diagram of a wireless communication system 100 according to one embodiment that supports a number of users , and which can implement various aspects of the invention . system 100 may be designed to support one or more cdma standards and / or designs ( e . g ., the w - cdma standard , the is - 95 standard , the cdma2000 standard , the is - 856 standard ). for simplicity , system 100 is shown to include three base stations 104 in communication with two mobile stations 106 . the base station and its coverage area are often collectively referred to as a “ cell ”. in is - 95 systems , a cell may include one or more sectors . in the w - cdma specification , each sector of a base station and the sector &# 39 ; s coverage area is referred to as a cell . as used herein , the term base station can be used interchangeably with the term access point . the term mobile station can be used interchangeably with the terms user equipment ( ue ), subscriber unit , subscriber station , access terminal , remote terminal , or other corresponding terms known in the art . the term mobile station encompasses fixed wireless applications . depending on the cdma system being implemented , each mobile station 106 may communicate with one ( or possibly more ) base stations 104 on the forward link at any given moment , and may communicate with one or more base stations on the reverse link depending on whether or not the mobile station is in soft handoff . the forward link ( i . e ., downlink ) refers to transmission from the base station to the mobile station , and the reverse link ( i . e ., uplink ) refers to transmission from the mobile station to the base station . the word “ exemplary ” is used exclusively herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . fig2 shows an embodiment of mobile unit 106 . for clarity , only a subset of the components is shown . signals are received at antenna 210 , and delivered to receiver 220 where amplification , down - conversion , sampling , and demodulating takes place . various techniques for receiving cdma signals are known in the art . in addition , the principles of the present invention apply with equal force to wireless communication systems deploying air interfaces other than those based on cdma . receiver 220 is in communication with a central processing unit ( cpu ) 230 . cpu 230 may be a microprocessor or digital signal processor ( dsp ), or one of various processors known in the art . cpu 230 communicates with memory 240 , which is shown containing prl 250 . prl 250 can be programmed via over - the - air programming in conjunction with antenna 210 and receiver 220 , or the data for the prl can come in from other inputs to cpu 230 , labeled “ alternate input ” in fig2 . cpu 230 is also connected to transmitter 260 , for transmitting messages , data , voice , etc ., using any of the techniques for transmission known in the art . transmitter 260 is connected to antenna 210 , for transmission to a base station , such as base station 104 . receiver 220 and transmitter 260 , in conjunction with antenna 210 , can be used to communicate with one or more systems identified in prl 250 when the mobile station is roaming . in an is - 856 system , each sector has a unique ipv6 address , which is 128 bits in length . in some instances , a network operator may deploy numerous sectors within a system . the ip addresses of these sectors may differ only slightly ( i . e ., in the least significant bits ) since a large portion of each sector address identifies the carrier . in addition , various parameters associated with each of these sectors may be common among the sectors due to their collocation within the network , such as frequency , pn offset , and the like . as used herein , the term subnet refers to an entry in the prl associated with a group of sectors . the principles of the present invention apply to the concept of a subnet as defined for internet protocol ( ip ) addresses . however , these principles apply more generally to compression of a prl regardless of the exact nature of the information stored in each record of the prl . as such , the term subnet , as used herein , should be construed to refer to any of the myriad possibilities of prl records . fig3 depicts an embodiment of prl 250 . recall that prl 250 is contained in memory 240 . prl 250 contains two tables , system table 310 and subnet table 320 . system table 310 contains entries corresponding to each record of the prl . in each system table 310 entry , information unique to that entry will be stored , along with an indicator for accessing corresponding data in subnet table 320 . subnet table 320 contains records which are shared in common with one or more entries in system table 310 . thus , rather than including duplicate copies of information in various entries of system table 310 , one common copy is stored in subnet table 320 , and an indicator for accessing that common copy will be stored in each corresponding entry in system table 310 . consider the following example as illustrated in fig4 a . the proposed is - 856 system record comprises , among other fields , a network id and a subnet mask length , m . in an exemplary embodiment , prl 250 comprises a plurality of these system records . the network id is a 128 - bit value . a subnet mask can be formed using a subnet mask length m by concatenating m ones with 128 - m zeros . fig1 depicts this example . when network id 1100 is bit - wise anded with subnet mask 1110 , subnet address 1120 ( fig4 a , 440 ) is the result . all the sectors within a subnet will share a common subnet address , and will be distinguished using the 128 - m least significant bits . the size of the subnet is limited by the number of bits assigned to distinguish the sectors within it . performing the operation shown in fig1 on the network id , included in the system record , for all sectors in a subnet will yield an identical result for each subnet address . so , the subnet identifies a group of sectors . it is expected that the most significant k bits of the subnets associated with a particular wireless operator is to be the same . therefore , the upper k bits of the subnet address can be stored once in subnet table 320 , and the lower 128 - k bits can be stored for each record in the system table 310 . note that m is the length of the subnet ( fig4 a , 450 ), whereas k is the length of the common part of the subnet that is to be factored out . system table 310 and subnet table 320 will be detailed more fully below in the descriptions of various embodiments deploying them . note that these tables , and the prl , are shown as discrete entities for clarity only . while , in an alternative embodiment , each table could be housed in a discrete memory , a more common embodiment will have system table 310 and subnet table 320 , which make up prl 250 , as a subspace of a common memory element 240 . fig4 b depicts an embodiment of a method for accessing a prl , such as prl 250 . in step 410 , a record from the system table 310 is retrieved , which corresponds to an entry in the prl 250 . the record will contain any information that is unique to the entry , as well as an indicator of common information , if any . a variety of techniques for indexing , storing , and accessing the common information can be employed , examples of which are detailed in embodiments described below . in step 420 , a common portion of the subnet is retrieved from a subnet table 320 , if there is a common portion corresponding to the record . in step 430 , the common portion is concatenated with the unique portion to form the complete subnet record . the creation of a system table 310 and a subnet table 320 from a prl can be accomplished by reversing the steps depicted in fig4 b . the details of partitioning and indexing will depend on the procedure chosen , examples of which are detailed below . the resultant system table 310 and subnet table 320 form a compressed prl 250 . thus , the time required to transmit the compressed prl to mobile station 106 is reduced , whether the transmission occurs via a wired connection or is updated over the air , as described in is - 683 . an exemplary embodiment of a method for compressing a prl comprises the following steps : first , data that is common to two or more subnets is factored out and stored in a subnet table ( fig4 a , 470 ). the remaining data , not factored out , is stored in the symbol table , with an indicator for accessing the associated common information in the system table ( fig4 a , 480 ). as described in an example above , one convenient way to factor out common information is to look for common characteristics , such as shared subnet address , frequency , and the like . it may be that , in some cases , a larger common portion can be factored out of a first subset of prl records , but a smaller common sub - portion of that common portion can be factored out of a second , larger subset of prl records . one example of this may occur in a system that allows subnets within subnets . in such a system , records corresponding to one subnet within a larger subnet will share a large part of their network address in common . another set of records , corresponding to a different subnet within the same larger subnet , will similarly share a large part of their network address in common . however , all of the records in both subnets , within the larger subnet , will still have in common the portion of the network address identifying the larger subnet , although the common portion will be smaller than the common portion of their individual subnets . a variety of techniques for factoring fall within the scope of the present invention . one technique is to apply a multi - pass factoring step , which calculates and compares various compression results ( accounting for multiple factoring options ), selecting the best compression result . another technique is to extend the two - table example to allow nested tables . for example , if subnets within subnets are available in the system , then subnet tables can be equipped with indicators to locate common elements within a sub - subnet table . yet another technique is to store more than one indicator in a record in the system table , each of the indicators identifying a separate entry in the subnet table . those of skill in the art will recognize how to deploy various combinations of the techniques disclosed herein to accommodate various system configurations . fig5 depicts an exemplary embodiment of compressed prl 250 . it comprises system table 310 and subnet table 320 . each table contains records identified by a system record field and an associated field length , in bits . system table 310 comprises n records , 510 a - 510 n , corresponding to n entries in the prl . subnet table 320 comprises m common records , 550 a - 550 m , which are associated with various of the n system table records , 510 a - 510 n . system table records 510 a - 510 n comprise the fields subnet_tag 520 a - 520 n , subnet_residual_length 530 a - 530 n , and subnet_residual 540 a - 540 n . subnet table records 550 a - 550 m comprise the fields subnet_tag 560 a - 560 m , subnet_common_length 570 a - 570 m , and subnet_common 580 a - 580 m , respectively . in this embodiment , each subnet_tag 520 a - 520 n and 560 a - 560 m is eight bits in length . a system table subnet_tag 520 a - 520 n corresponds to at most one subnet table subnet_tag 560 a - 550 m . a value of zero in a system table subnet_tag indicates that none of the subnet table records 550 a - 550 m correspond with that system table record . for non - zero values , the system table subnet_tag identifies one subnet table record with the corresponding subnet_tag value . the arrows shown in fig5 depict exemplary mappings . for example , system table records 510 a and 510 k both correspond with subnet table record 550 m . thus , subnet_tag 520 a , subnet_tag 520 k , and subnet_tag 560 m are identical . when retrieving the common information for either of system table records 510 a or 510 k , subnet table record 550 m is identified by the subnet_tag value 560 m . then , subnet_common_length 570 m , a seven - bit field in this example , identifies the length of the common information , contained in subnet_common 580 m . the subnet_common_length field 570 m may indicate the length of subnet_common 580 m in any unit of data length — bits or bytes are typically convenient measures . the amount of data contained in subnet_common 580 m as delineated by subnet_common_length 570 m can then be retrieved from subnet table 320 for association with the system table record , in this example 510 a or 510 k . similarly , subnet table record 550 a is associated with system table record 510 n . in this embodiment , subnet_residual_length 530 a - 530 n is a seven - bit field which indicates the length of subnet_residual 540 a - 540 n . subnet_residual is the unique information associated with each system table record 510 a - 510 n . fig6 depicts an exemplary embodiment of a procedure for accessing a prl 250 , such as that shown in fig5 . in step 610 , retrieve subnet_tag from the system table 310 . proceed to decision block 620 to test if subnet_tag is equal to zero . if it is zero , there is no common element to be retrieved from the subnet table 320 . proceed to step 630 , and retrieve subnet_residual from the system table . the subnet is identified completely by subnet_residual . if , in decision block 620 , subnet_tag is not equal to zero , proceed to step 640 and retrieve subnet_common corresponding to subnet_tag from the subnet table 320 . proceed to step 650 and retrieve subnet_residual from system table 310 . proceed to step 660 . concatenate subnet_common with subnet_residual to identify the subnet . fig7 is a more detailed embodiment of step 640 . in step 710 , locate subnet_tag in subnet table 320 . in step 720 , retrieve subnet_common_length to determine how much common data to retrieve . proceed to step 730 to retrieve the amount of data , from subnet table 320 , as specified in subnet_common_length . fig8 depicts another exemplary embodiment of compressed prl 250 . this embodiment uses an index into the subnet table instead of a subnet tag . it also comprises a system table 310 and a subnet table 320 . as before , each table contains records identified by a system record field and an associated field length , in bits . system table 310 comprises n records , 510 a - 510 n , corresponding to n entries in the prl . subnet table 320 comprises m common records , 550 a - 550 m , which are associated with various of the n system table records , 510 - 510 n . however , in this alternative embodiment , system table records 510 a - 510 n comprise the fields subnet_lsb_length 820 a - 820 n , subnet_lsb 830 a - 830 n , and subnet_common_offset 840 a - 840 n . subnet table records 550 a - 550 m comprise the fields subnet_common_length 840 a - 840 m , and subnet_common 850 a - 850 m . in contrast to the embodiment of fig5 , note that subnet_tag is not a field in either system table 310 or subnet table 320 . in this embodiment , subnet_lsb_length 810 a - 810 n performs substantially the same function as subnet_residual_length 530 a - 530 n . it is a seven - bit field which indicates the length of subnet_lsb 820 a - 820 n , a field which performs substantially the same function as subnet_residual 540 a - 540 n . subnet_lsb is the unique information associated with each system table record 510 a - 510 n . in this embodiment , each subnet_common_offset 840 a - 840 n is an index into subnet table 320 , the index in this example is 12 bits in length . each subnet_common_offset 830 a - 830 n corresponds to at most one subnet table record 550 a - 550 m . a value of zero in a subnet_common_offset indicates that none of the subnet table records 550 a - 550 m corresponds with that system table record . the arrows shown in fig8 depict exemplary mappings . for example , system table records 510 a and 510 k both correspond with subnet table record 550 m . thus , subnet_common_offset 830 a and 830 n are identical , and point to subnet table record 550 m . then , subnet_common_length 840 m , a four - bit field in this example , identifies the length , in bytes , of the common information , contained in subnet_common 850 m . the amount of data contained in subnet_common 850 m as delineated by subnet_common_length 840 m can then be retrieved from subnet table 320 for association with the system table record , in this example 510 a or 510 k . similarly , subnet table record 550 a is associated with system table record 510 n . fig9 depicts an exemplary embodiment of a procedure for accessing a prl 250 , such as that shown in fig8 . in step 910 , retrieve a record from system table 310 . proceed to step 920 to retrieve the subnet_common from the subnet table corresponding to subnet_common_offset contained in the system table record . a subnet_common_offset of zero means that no common information is to be retrieved . proceed to step 930 , concatenate subnet_common with subnet_lsb to identify the subnet . fig1 is a more detailed embodiment of step 920 . in step 1010 , the process accesses subnet_common_length from the subnet table with the pointer subnet_common_offset . proceed to step 1020 . in step 1020 , access subnet_common by retrieving a number of bytes specified by the value of subnet_common_length . another alternative , not shown , is to nest both the subnet table and the system table in one table . in this alternative , the first occurrence of a common record is included in the record with which it is associated . a tag and / or common record length field may be inserted prior to the common record . subsequent records in the table , which are associated with the common record , can simply include a pointer or tag , depending on the implementation chosen , to indicate the previously stored common record is to be accessed . it should be noted that in all the embodiments described above , method steps can be interchanged without departing from the scope of the invention . those of skill in the art will understand that information and signals may be represented using any of a variety of different technologies and techniques . for example , data , instructions , commands , information , signals , bits , symbols , and chips that may be referenced throughout the above description may be represented by voltages , currents , electromagnetic waves , magnetic fields or particles , optical fields or particles , or any combination thereof . those of skill will further appreciate that the various illustrative logical blocks , modules , circuits , and algorithm steps described in connection with the embodiments disclosed herein may be implemented as electronic hardware , computer software , or combinations of both . to clearly illustrate this interchangeability of hardware and software , various illustrative components , blocks , modules , circuits , and steps have been described above generally in terms of their functionality . whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system . skilled artisans may implement the described functionality in varying ways for each particular application , but such implementation decisions should not be interpreted as causing a departure from the scope of the present invention . the various illustrative logical blocks , modules , and circuits described in connection with the embodiments disclosed herein may be implemented or performed with a general purpose processor , a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ) or other programmable logic device , discrete gate or transistor logic , discrete hardware components , or any combination thereof designed to perform the functions described herein . a general purpose processor may be a microprocessor , but in the alternative , the processor may be any conventional processor , controller , microcontroller , or state machine . a processor may also be implemented as a combination of computing devices , e . g ., a combination of a dsp and a microprocessor , a plurality of microprocessors , one or more microprocessors in conjunction with a dsp core , or any other such configuration . the steps of a method or algorithm described in connection with the embodiments disclosed herein may be embodied directly in hardware , in a software module executed by a processor , or in a combination of the two . a software module may reside in ram memory , flash memory , rom memory , eprom memory , eeprom memory , registers , hard disk , a removable disk , a cd - rom , or any other form of storage medium known in the art . an exemplary storage medium is coupled to the processor such the processor can read information from , and write information to , the storage medium . in the alternative , the storage medium may be integral to the processor . the processor and the storage medium may reside in an asic . the asic may reside in a user terminal . in the alternative , the processor and the storage medium may reside as discrete components in a user terminal . the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein .

US-58603006-A

6 - phenoxymethyl - 4 - hydroxytetrahydropyran - 2 - ones and 6 - thiophenoxymethyl - 4 - hydroxytetrahydropyran - 2 - ones and the corresponding dihydroxycarboxylic acid derivatives , salts and esters , processes for the preparation of these compounds , their use as pharmaceuticals , pharmaceutical preparations and novel phenols and thiophenols compounds of the general formula i ## str1 ## and the corresponding open - chain dihydroxycarboxylic acids of the formula ii ## str2 ## in which x , y and z have the meanings given , and pharmacologically tolerated salts thereof with bases and pharmacologically tolerated esters thereof , processes for the preparation of these compounds , their use as pharmaceuticals and pharmaceutical preparations are described . novel phenols and thiophenols of the formula iii ## str3 ## in which x , y and z have the meanings given , are also described .

the enzyme 3 - hydroxy - 3 - methylglutaryl - coenzyme a reductase ( hmg - coa - reductase ) plays a central role in the biosynthesis of cholesterol [ a . endo , j . med . chem . 28 , 401 ( 1985 )]. inhibitors of this enzyme , in particular mevinolin [ a . s . pappu et al ., clin . res . 34 , 684 a ( 1986 )], synvinolin [ a . s . olsson et al ., the lancet , 391 ( 1986 ); and m . j . t . m . mol et al ., the lancet , 936 ( 1986 )] and eptastatin [ drugs of the future 12 , 437 ( 1987 ); and n . nakaya et al . atherosclerosis 61 , 125 ( 1986 )] have been clinically tested for the treatment of hypercholesterolemics . structurally simplified completely synthetic analogs of these compounds have been described [ g . e . stokker et al ., j . med . chem . 29 . 170 and 852 ( 1986 ), w . f . hoffman et al ., j . med . chem . 29 , 159 ( 1986 )]. european patent application a - 0 , 216 , 127 ( corresponding to u . s . patent application no . 900 , 848 ) claims compounds of the formula ia ## str4 ## wherein r 1 and r 5 are identical or different and denote a ) hydrogen or halogen , b ) cycloalkyl having 4 - 8 carbon atoms or a phenyl radical which can be substituted in the nucleus by 1 to 3 substituents from the group comprising halogen , trifluoromethyl and / or alkyl or alkoxy having in each case 1 - 4 carbon atoms or c ) a straight - chain or branched alkyl radical having 1 to 18 carbon atoms or a straight - chain or branched alkenyl radical having 2 to 18 carbon atoms , it being possible for the alkyl and alkenyl radicals in turn to be substituted by 1 to 3 substituents from the group comprising α ) straight - chain or branched alkoxy radicals having up to 10 carbon atoms or cycloalkoxy radicals having 3 to 7 carbon atoms or straight - chain or branched alkenyloxy or alkynyloxy radicals having 3 to 6 carbon atoms , β ) halogen , hydroxyl , cycloalkyl having 3 - 7 carbon atoms , and unsubstituted phenyl or α - or β - thienyl radicals , or phenyl α - or β - thienyl radicals which are in turn substituted in the nucleus by 1 to 3 substituents from the group comprising halogen , trifluoromethyl and / or alkyl or alkoxy having 1 - 4 carbon atoms , γ ) unsubstituted phenoxy , benzyloxy or α - or β - thienyloxy radicals , or phenoxy , benzyloxy α - or β - thienyloxy radicals which are in turn substituted in the nucleus by 1 to 3 substituents from the group comprising halogen , trifluoromethyl and / or alkyl or alkoxy having 1 to 4 carbon atoms , and δ ) the group ## str5 ## wherein r 6 denotes : a straight or branched alkyl or alkenyl radical having up to 8 carbon atoms , or a cycloalkyl or cycloalkenyl radical having in each case 3 - 8 carbon atoms , or an unsubstituted phenyl radical , or a phenyl radical which is in turn substituted in the nucleus by 1 to 3 substituents from the group comprising halogen , trifluoromethyl and / or alkyl or alkoxy having 1 - 4 carbon atoms , or a 3 - pyridyl radical , r 2 and r 4 are identical or different and denote hydrogen , alkyl having 1 - 4 carbon atoms , halogen or alkoxy having 1 - 4 carbon atoms , and r 3 is hydrogen , alkyl or alkenyl having up to 4 carbon atoms , halogen or alkoxy having 1 - 4 carbon atoms , and the corresponding open - chain dihydroxycarboxylic acids , pharmacologically tolerated salts thereof with bases and pharmacologically tolerated esters thereof . the compounds described in this application inhibit hmg - coa reductase with ic 50 values in the 10 - 5 to 10 - 8 molar range . according to the data in the description , the most potent compound ia ( r 1 = r 3 = cl , r 2 = r 4 = h , ## str6 ## german offenlegungsschrift 3 , 632 , 893 (= derwent abstract 88 - 99 366 / 15 ) relates inter alia to compounds of the general formula ib ## str7 ## in which b ) a phenyl radical which can be substituted in the nucleus by 1 to 3 substituents from the group comprising halogen , trifluoromethyl , methyl , ethyl , methoxy and ethoxy , c ) an alkyl radical having 1 - 5 carbon atoms , which can be substituted by 1 to 3 substituents from the group comprising α ) c 1 - c 3 - alkoxy radicals or cycloalkoxy radicals having 3 to 7 carbon atoms , β ) phenoxy or benzyloxy radicals which can in turn be substituted in the nucleus by 1 to 3 substituents from the group comprising halogen , trifluoromethyl , methyl , ethyl , methoxy and ethoxy , γ ) halogen cycloalkyl having 3 - carbon atoms or phenyl radicals which can in turn be substituted in the nucleus by 1 to 3 substituents from the group comprising halogen , trifluoromethyl , methyl , ethyl , isopropyl , methoxy and ethoxy , and r 2 and r 4 are identical or different and denote hydrogen , halogen , methyl , ethyl , methoxy , ethoxy or benzyloxy and r 3 is hydrogen , halogen , trifluoromethyl , methyl , ethyl , methoxy or ethoxy , and the corresponding open - chain dihydroxycarboxylic acids , pharmacologically tolerated salts thereof with bases and pharmacologically tolerated ester thereof . according to the data in this application , the compounds of the formula ib described are as a rule slightly less potent than ia for the same substitution pattern r 1 - r 5 . substitution patterns ( r 1 to r 5 ) which are not described by examples in these applications have now been found , surprisingly , which impart to the compounds of the general formulae ia and ib an activity which is up to one power of ten greater than the best examples listed in ep - a - 0 , 216 , 127 and de - a - 3 , 632 , 893 . the substitution patterns in respect of substituents r 1 , r 2 , r 4 and r 5 lie completely within and those with respect of r : lie only partly within the general patent claims of ep - a - 0 , 216 , 127 and de - a - 3 , 632 , 893 , since it has furthermore been found that r 3 can also have meanings which are not described in the two previous applications . the invention relates to novel compounds of the general formula i ## str9 ## and the corresponding open - chain dihydroxycarboxylic acids of the formula ii ## str10 ## pharmacologically tolerated salts thereof with bases and pharmacologically tolerated esters thereof . in the formulae , a ) a straight - chain or branched alkyl radical having 3 to 12 carbon atoms or b ) cycloalkyl having 3 to 8 carbon atoms or a phenyl radical which ca be substituted in the nucleus by 1 to 3 substituents from the group comprising halogen , trifluoromethyl and / or alkyl or alkoxy having in each case 1 to 4 carbon atoms and z denotes hydrogen or a straight - chain or branched alkyl radical having 1 to 4 carbon atoms . the character of a selection invention is asserted for compounds of the formulae i and ii which do not fall within the patent claims of the previous patent applications referred to . the invention furthermore relates to a process for the preparation of the compounds of the formula i and of the corresponding open - chain dihydroxycarboxylic acids of the formula ii , of the pharmacologically tolerated salts thereof with bases and of the pharmacologically tolerated esters thereof . the process comprises a ) converting correspondingly substituted phenols or thiophenols of the formula iii ## str11 ## in which x , y and z have the meanings given in the case of formulae i and ii , with the optically pure iodide of the formula iv ## str12 ## in which r 7 denotes a protective group which is stable towards bases and weak acids , into the lactol ether of the formula v ## str13 ## in which x , y and z have the meanings given in the case of formulae i and ii and r 7 has the meanings given in the case of formula iv , b ) hydrolyzing the lactol ethers of the formula v to give the corresponding lactols of the formula vi ## str14 ## in which x , y and z have the meanings given in the case of formulae i and ii and r 7 has the meanings given in the case of formula iv , c ) oxidizing the lactols of the formula vi to give the corresponding lactones of the formula vii ## str15 ## in which x , y and z have the meanings given in the case of formulae i and ii and r 7 has the meanings given in the case of formula iv , d ) converting the resulting protected lactones of the formula vii into compounds of the formula i in a manner which is known per se and , e ) if appropriate , converting the resulting compounds of the formula i into the corresponding open - chain dihydroxycarboxylic acids of the formula ii , salts thereof or esters thereof , if appropriate converting resulting salts or esters into the free dihydroxycarboxylic acids or , if appropriate , converting the free carboxylic acids into the salts or esters . the process is advantageously carried out under the conditions which have been described in the previous applications referred to . the process conditions can be modified according to the meaning of the substituents ( cf . for example embodiment example 1 . 8 ). the starting compounds of the formula iii are novel . the invention therefore also relates to these compounds . the iodides of the formula iv are described , for example , in ep - a - 0 , 216 , 127 . syntheses of the phenol and thiophenol units iii required are outlined in equation 1 and described below . compounds of the formula iii can be obtained from 2 - isopropylphenol xii or from 2 - isopropylphenols xiii substituted in the 4 - position by y by palladium ( o )- catalyzed aryl - aryl coupling as the key step . reviews of palladium ( o )- catalyzed aryl - aryl coupling are to be found in e . negishi , acc . chem . res . 15 , 340 ( 1982 ) and r . f . heck &# 34 ; palladium reagents in organic synthesis &# 34 ;, academic press ( 1985 ), chapter 6 . according to a recently published strategy ( d . a . widdowson , y .- z . zhang , tetrahedron 42 , 2111 ( 1986 )), aryl grignard compounds have an increased reactivity in respect of pd ( o )- catalyzed coupling with aryl halides if they carry ortho - alkoxy substituents . if xiii is therefore brominated to give xiv , xiv is then protected with a benzyl group to form xv and the grignard reagent xvi is formed in thf , this already reacts with the aryl halide xvii ( hal = br or i ) under mild conditions ( 10 ° to 65 ° c .) and under pd ( o )- catalysis to give the coupling product xviii in outstanding yields ( 90 to 98 %). removal of the protective group by means of catalytic hydrogenation gives iii ( x = o ). in this strategy , the coupling product iii ( x = o ) is obtained in a very high yield and purity . there is the need to protect the phenolic oh group and subsequently remove the protective group in this process . pd ( o )- catalyzed aryl - vinyl couplings in the presence of unprotected phenol groups are known ( r . f . heck , acc . chem . res . 12 , 146 ( 1979 ); c . b . ziegler jr ., r . f . heck , j . org . chem . 43 , 2941 ( 1978 )). this reaction is not completely comparable to aryl - aryl couplings , since no highly basic organometallic reagents ( such as the grignard compound xx ) are used therein . aryl - aryl couplings in the presence of unprotected phenol groups are novel . this reversal of the conventional strategy described above , that is to say pd ( o )- catalyzed reaction of unprotected ortho - iodophenols xix with grignard reagents from p - bromofluorobenzenes xx , has been successfully carried out . one equivalent of xx is consumed for deprotonation of xix and a further equivalent of xx is consumed for the coupling reaction . since oligomerization of the grignard components xx moreover occurs as a side reaction , 2 . 5 to 3 . 0 equivalents of xx must be used in order to achieve complete conversion to iii ( x = o ). it is in this way possible also to carry out quantitative di - couplings on the unprotected diiodide xxi . if 3 equivalents of xx are used , a mixture of the mono - coupling product xix &# 39 ; ## str16 ## and the di - coupling product iii &# 39 ;( y = ## str17 ## is obtained at room temperature . in contrast , if the ≧ 4 equivalents of xx are used , the mono - coupling product detectable in the meantime is in the end converted completely into iii &# 39 ;. since this di - coupling reaction takes place without purification of the quite sensitive * diiodide xxi , iii &# 39 ; ## str18 ## is obtained very directly from xii in an overall yield of 40 to 60 % ( not optimized !). this phenol unit iii &# 39 ; is advantageously prepared by this process , since in the conventional method the compound xix &# 39 ; which is in any case formed would have to be used because aryl di - grignard compounds are unstable [ f . bickelhaupt , angew . chem . 99 , 1020 ( 1987 )]. compared with conventional coupling , direct coupling of unprotected iodophenols xix with aryl grignard compounds saves two synthesis steps and allows the use of the less expensive fluorobromobenzenes . the price which must be paid is a lower yield of the coupling step . tetrakis -( triphenylphosphine ) palladium ( o ), bis ( triphenylphosphine ) palladium dichloride or a mixture of palladium dichloride and triphenylphosphine has been used as the palladium catalysts . it is known that similar catalyses can also be achieved with nickel - phosphine complexes and related transition metal complexes [ see , for example , e . negishi , acc . chem . res . 15 , 340 ( 1982 ); j . k . stille , angew . chem . 98 , 504 ( 1986 ); r . f . heck , acc . chem . res . 12 , 146 ( 1979 ); e . negishi et al ., j . org . chem . 42 , 1821 ( 1977 )]. the thiophenols of the formula iii are obtained by methods analogous to those described in the literature from the corresponding phenols of the formula iii by reaction with a dialkylthiocarbamoyl chloride , subsequent newman - kwart rearrangement by means of heat and reductive cleavage of the s - aryldialkylthiocarbamates formed to give thiophenols of the formula iii ( cf . also de - a - 3 , 632 , 893 ). ## str19 ## synthesis routes for the preparation of compounds of the formula xiii ( reaction scheme 1 ) are outlined in part in reaction scheme 2 and described below . the preparation of the starting compound xiii with certain substituents y depends on the availability of starting materials . xiii ( y = i - pr ) is formed by decarboxylation of commercially obtainable 3 , 5 - diisopropyl - 2 - hydroxybenzoic acid of the formula xi ( janssen ). the decarboxylation can be carried out by heating the pure substance or a solution in an inert solvent ( for example nitrobenzene ) to 210 ° to 220 ° c . a considerably better yield and purity is obtained if a solution in quinoline is heated at about 190 ° c . in the presence of a copper chromite catalyst . xiii ( y = tert .- butyl ) is obtained highly para - selectively according to g . sartori et al ., chem . and industry , 762 ( 1985 ) if isopropylphenol is stirred in ch 2 cl 2 solution with methyl tert .- butyl ether ( mtbe ) and zirconium ( iv ) chloride . a good yield of xiii is obtained if xii ( 1 . 0 equivalent ) is reacted with mtbe ( 1 . 05 equivalents ) and zrcl 4 ( 2 . 4 equivalents in 2 portions ) at 0 ° c . conventional friedel - crafts alkylations of xii with corresponding alkyl halides / aluminum trichloride or with alcohols y - oh / lewis or proton acids can also be used for the preparation of xiii [ see k .- d . bode in houben - weyl &# 34 ; methoden der organischen chemie ( methods of organic chemistry )&# 34 ; volume vi / lc &# 34 ; phenole teil 2 ( phenols part 2 )&# 34 ;, georg thieme verlag , stuttgart ( 1976 ), page 925 et seq .]. obtained from commercially available p - nitrobiphenyl viii by o - alkylation with isopropylmagnesium bromide [ review by g . bartoli , acc . chem . res . 17 , 109 ( 1984 )] to give ix , reduction of ix to the amine x , diazotization and decomposition to the phenol by boiling ( reaction scheme 2 ). catalytic hydrogenation of an ethyl acetate solution of xiii ## str21 ## over 5 % palladium - on - charcoal at 50 ° c . under a hydrogen pressure of 4 to 6 kg cm - 2 gives xiii ## str22 ## in a yield of 85 to 90 %: ## str23 ## the lactones of the formula i can be converted into the corresponding open - chain dihydroxycarboxylic acids of the formula ii , pharmacologically tolerated salts thereof with bases and pharmacologically tolerated esters thereof by a customary method ( cf . for example ep - a - 0 , 216 , 127 and de - a - 3 , 632 , 893 ). the enzyme hmg - coa reductase is widespread in nature . it catalyzes the formation of mevalonic acid from hmg - coa . this reaction is a central step in cholesterol biosynthesis ( i . r . sabine , 3 - hydroxy - 3 - methylglutaryl coenzyme a reductase , crc press , 1983 ). high cholesterol levels are associated with a number of diseases , such as , for example coronary heart disease or atherosclerosis . the reduction of increased cholesterol levels for prevention and treatment of such diseases is therefore a therapeutic aim . one point of attack lies in inhibition or reduction of endogenous cholesterol synthesis . inhibitors of hmg - coa reductase block cholesterol biosynthesis at an early stage . they are therefore suitable for the prevention and treatment of diseases caused by an increased cholesterol level . a reduction or decrease in endogenous synthesis leads to an increased uptake of cholesterol from plasma in the cells . an additional effect can be achieved by simultaneous administration of substances which bind bile acids , such as anion exchangers . the increased secretion of bile acids leads to an increased renewed synthesis and therefore to an increased cholesterol breakdown ( m . s . brown , p . t . kovanen , j . l . goldstein , science 212 , 628 ( 1981 ): m . s . brown , j . l . goldstein spektrum der wissenschaft 1985 ( 1 ), 96 ). the compounds according to the invention are inhibitors of hmg - coa reductase . they are therefore suitable for inhibition or reduction of cholesterol biosynthesis and hence for prevention or treatment of diseases caused by an increased cholesterol level , in particular coronary heart disease , atherosclerosis , hypercholesterolemia , hyperlipoproteinemia and similar diseases . the invention therefore also relates to pharmaceutical preparations based on compounds of the formula i or the corresponding dihydroxycarboxylic acids of the formula ii or salts and esters thereof and the use of these compounds as pharmaceuticals , in particular for the treatment of hypercholesterolemia . the compounds of the formula i and the corresponding acids , salts or esters are administered in various dosage forms , preferably orally in the form of tablets , capsules or liquids . the daily dose varies in the range from 3 mg to 2 , 500 mg , but preferably in the dose range from 10 to 500 mg , depending on the body weight and constitution of the patient . the compounds according to the invention can be used as lactones of the general formula i , in the form of the free acids of the formula ii or in the form of pharmaceutically acceptable salts or esters , and in particular as a solution or suspension in pharmacologically acceptable organic solvents , such as mono - or polyhydric alcohols , such as , for example , ethanol or glycerol , in triacetin , oils , such as , for example , sunflower oil or cod - liver oil , ethers , such as , for example , diethylene glycol dimethyl ether or polyethers , such as , for example , polyethylene glycol , or in the presence of other pharmacologically acceptable polymeric carriers , such as , for example , polyvinylpyrrolidone , or other pharmaceutically acceptable additives , such as starch , cyclodextrin or polysaccharides . the compounds according to the invention can furthermore be combined with additives which bind bile acids , in particular non - toxic basic anion exchanger resins which bind bile acids in a nonresorbable form in the gastrointestinal tract . the salts of the dihydroxycarboxylic acids can also be processed as an aqueous solution . the hmg - coa reductase activity of the sodium salts of the compounds of the formula ii according to the invention has been determined in two test systems inhibition of the hmg - coa reductase activity on solubilized enzyme preparations from rat liver microsomes the hmg - coa . reductase activity was measured on solubilized enzyme preparations from liver microsomes from rats , which were induced with cholestyramine (® cuemid ) after changing into the day / night rhythm . ( s , r ) 14 c - hmg - coa was used as the substrate and the concentration of nadph was maintained during the incubation by means of a regenerating system . 14 c - mevalonate was separated off from the substrate and other products ( for example 14 c - hmg ) via column elution , the elution profile of each individual sample being determined . continuous simultaneous treatment of 3 h - mevalonate was dispensed with , since the determination relates to relative information on the inhibiting action . in each case the enzyme - free control , the enzyme - containing normal batch (= 100 %) and batches containing additions of preparation were treated together in one test series . each individual value was obtained as a mean value from 3 parallel samples . the significance of the differences between the mean values of the preparation - free and preparation - containing samples were evaluated by the t - test . in the method described above , the following inhibiting values on hmg - coa reductase were determined , for example , for the compounds according to the invention ( ic 50 ( mole / 1 ); molar concentration of the compound per liter required for a 50 % inhibition ) table 1______________________________________example ic . sub . 50 ( mole / l ) ______________________________________8a 2 . 3 · 10 . sup .- 98b & gt ; 10 . sup .- 78c 1 . 7 · 10 . sup .- 88d 2 . 3 · 10 . sup .- 88e 5 . 2 · 10 . sup .- 98f 4 . 8 · 10 . sup .- 98g 3 . 6 · 10 . sup .- 8______________________________________ suppression or inhibition of hmg - coa reductase in hep g2 cell cultures ( of a human hepatoma cell line ) the inhibition of the incorporation of 14 c - sodium acetate into cholesterol was determined . monolayers of hep g2 cells in rpmj 1640 medium with 10 % of fetal calf serum freed from lipids were preincubated with various concentrations of the sodium salts of the dihydroxycarboxylic acids of the formula ii for 1 hour . after addition of 14 c - labeled sodium acetate , the incubation was continued for 3 hours . tritium - labeled cholesterol was added as an internal standard and an aliquot of the cells was subjected to alkaline hydrolysis . the lipids were extracted with chloroform / methanol 2 : 1 . after addition of carrier cholesterol , the lipid mixture was separated preparatively on thin - layer chromatography plates with chloroform / acetone 9 : 1 . the cholesterol zone was rendered visible by staining with iodine vapor and was also detected with a thin layer chromatography radioscanner and then scraped off . the amount of 14 c - cholesterol was determined by scintigraphy . in another aliquot of the cell monolayer , the cell protein was measured ( for calculation of the 14 c - cholesterol biosynthesis per mg of cell protein ). the same procedure was performed with cells of the same culture without preincubation with pg , 23 a test compound ( so - called &# 34 ; solvent control &# 34 ;). the potency of the test compounds was determined by comparison of the biosynthesized 14 c - cholesterol in the test runs and in the &# 34 ; solvent control &# 34 ;. the potency was calculated on the basis of mevinolin sodium salt as an external standard . the ic 50 and ic 70 values ( ic 50 or ic 70 ( m ) is the molar concentration of the compound per liter required for 50 or 70 % inhibition respectively ) varied somewhat for different cell batches . the mean values for mevinolin sodium salt were ic 50 = 5 × 10 - 8 m , ic 70 = 1 . 5 × 10 - 7 m . the ic &# 39 ; s measured for test compounds ( sodium salts of the dihydroxycarboxylic acids of the formula ii ) ( table 2 ) were corrected by the deviation of mevinolin sodium from its average value . mevinolin sodium was attributed a relative potency of 100 . table 2______________________________________example ic . sub . 50 ( m ) ic . sub . 70 ( m ) relative potency______________________________________8a 2 . 7 · 10 . sup .- 8 7 · 10 . sup .- 8 185 ( 214 ) 8b ˜ 10 . sup .- 5 & lt ; 18c 9 · 10 . sup .- 8 568d 9 . 5 · 10 . sup .- 8 53______________________________________ the synthesis of the compounds i according to the invention is to be illustrated further . by the following examples . a mixture of 145 g ( 0 . 65 mole ) of 3 , 5 - diisopropyl - 2 - hydroxybenzoic acid ( xi ), 540 ml ( 588 g , 4 . 55 mole ) of quinoline and 7 . 5 g ( 0 . 024 mole ) of copper chromite ( 2cuo . cr 2 o 3 ) is stirred at 190 ° c . ( 225 ° c . external temperature ) for 2 hours . the mixture is cooled to about 10 ° c ., acidified to ph 1 to 2 with about 1 1 of half - concentrated hydrochloric acid , while cooling further , and extracted with toluene and the extract is washed with 2n hydrochloric acid , then with water and subsequently with nahco 3 solution . it is dried , filtered and concentrated and the residue is distilled under a high vacuum . 105 g of the title compound xiii are obtained as a pale yellow , oil , boiling point 81 ° to 84 ° c ./ 0 . 2 mm hg . 1 h - nmr ( cdcl 3 ): δ 1 . 20 ( 6h , d ); 1 . 25 ( 6h , d ); 3 . 00 ( 2h , 2x hept ); 4 . 10 ( 1h , s , br ); 6 . 50 - 7 . 00 ( 3h , m ) 2 , 4 - diisopropyl - 6 - bromophenol ( formula xiv , y = i - pr ) 1 g of iron powder is added to a hot solution , at 95 ° c ., of 102 . 3 g ( 0 . 57 mole ) of 2 , 4 - diisopropylphenol in 900 ml of glacial acetic acid , and 101g ( 32 . 2 ml , 0 . 63 mole ) of bromine are then added dropwise in the course of 90 minutes . the reaction mixture is stirred at 100 ° c for a further hour and partitioned between toluene and water and the toluene phase is washed with nahco 3 solution . it is dried , filtered and concentrated and the residue is distilled under a high vacuum . 125 g of the title compound xiv are obtained as a pale yellow oil , boiling point 85 ° c ./ 0 . 15 mm hg . 1 h - nmr ( cdcl 3 ): δ 1 . 20 ( 6h , d ); 1 . 25 ( 6h , d ); 2 . 80 ( 1h , hept . ); 3 . 25 ( 1h , hept . ); 5 . 33 ( 1h , s ); 6 . 87 - 7 . 20 ( 2h , m ) ms ( 70 ev ): m / e = 256 / 258 ( m + ), 241 / 243 ( m + - ch 3 ) a suspension of 166 . 5 g ( 1 . 2 mole ) of potassium carbonate in 124 g ( 0 . 48 mole ) of the above bromophenol , 91 . 52 g ( 0 . 72 mole ) of benzyl chloride and 2 1 of 2 - butanone is heated under reflux for 24 hours . the suspension is cooled , the inorganic solid is filtered off with suction , the filtrate is concentrated in vacuo and the residue is partitioned between toluene and water . the toluene phase is washed with saturated sodium chloride solution , dried , filtered and concentrated . the residue is chromatographed with cyclohexane / toluene 9 : 1 over silica gel . 155 g of the title compound xv are obtained as a colorless oil . small residual amounts of benzyl chloride are removed under a high vacuum . the purification can also be achieved by distillation ( boiling point 150 ° c ./ 0 . 15 mm hg ). 1 h - nmr ( cdcl 3 ): δ 1 . 18 ( 6h , d ); 1 . 22 ( 6h , d ), 2 . 80 ( 1h , hept . ); 3 . 32 ( 1h , hept . ); 4 . 90 ( 2h , s ); 6 . 93 - 7 . 60 ( 7h , m ) the grignard compound x ( y = i - pr ) is prepared from 48 . 62 g ( 0 . 24 mole ) of the bromide from example 1 . 3 and 3 . 53 g ( 0 . 147 mole ) of mg filings in 120 ml of absolute tetrahydrofuran (˜ 60 ° c ., 1 hour ). this grignard solution is added rapidly to a solution of 31 . 08 g ( 0 . 14 mole ) of 4 - fluoroiodobenzene and 3 . 23 g ( 2 . 8 mmol ) of tetrakis ( trihenylphosphine ) palladium ( o ) in 140 ml of absolute tetrahydrofuran . the internal temperature rises to 55 ° to 60 ° c . within 15 minutes . after 7 minutes , a precipitate forms . the mixture is stirred at 50 ° to 58 ° c . for 1 hour , left to stand overnight at room temperature and partitioned between ether and 1 n hydrochloric acid and the ether phase is washed with 1 n hydrochloric acid , then with water and subsequently with saturated nahco 3 solution . it is dried , filtered and concentrated . if required , the product is purified by chromatography with cyclohexane / toluene 4 : 1 over silica gel or by distillation ( boiling point 180 ° c ./ 0 . 3 mm hg ). 49 . 3 g of the title compound xviii are obtained as a colorless solid , melting point 65 ° to 67 ° c . 1 h - nmr ( cdcl 3 ): δ 1 . 30 ( 12h , d ); 2 . 95 ( 1h , hept . ); 3 . 45 ( 1h , hept . ); 4 . 40 ( 2h , s ); 6 . 90 - 7 . 80 ( 11h , m ) 4 g of 10 % pd - on - charcoal are added to a solution of 49 . 3 g ( 0 . 136 mole ) of the benzyl ether xviii from example 1 . 4 in 1 1 of ethyl acetate and 100 ml of glacial acetic acid and the mixture is shaken in a hydrogen atmosphere for 20 minutes ( vigorous uptake of h 2 ). the catalyst is filtered off , the filtrate is concentrated and the residue is taken up several times in toluene and concentrated in vacuo each time . 34 . 4 g of the title compound iii are obtained as a colorless oil , boiling point 115 ° c ./ 0 . 1 mm hg . 1 h - nmr ( cdcl 3 , 270mhz ): δ 1 . 25 ( 6h , d ); 1 . 29 ( 6h , d ); 2 . 87 ( 1h , hept . ); 3 . 31 ( 1h , hept . ); 4 . 95 ( 1h , s , br ); 6 . 88 ( 1h , d ); 7 . 08 ( 1h , d ) 7 . 18 ( 2h , m ); 7 . 45 ( 2h , m ). ms ( 70 ev ): m / e = 272 ( m + ), 257 ( m + - ch 3 ) 27 . 2 g ( 0 . 1 mole ) of the phenol from example 1 . 5 are added to a suspension of 27 . 6 g ( 0 . 2 mole ) of potassium carbonate and a spatula - tip of hydroquinone in 250 ml of absolute dimethyl sulfoxide . the mixture is stirred at room temperature for 1 hour and a solution of 56 g ( 0 . 11 mole ) of the lactol ether iodide iv ( for the preparation see ep - a 0 , 216 , 127 , r 7 = t - butyldiphenylsilyl ) in 250 ml of absolute dimethyl sulfoxide is then added . the mixture is stirred at an internal temperature of 50 °- 55 ° c . for 4 hours . thin - layer chromatography ( silica gel , 1st development with cyclohexane / ethyl acetate 9 : 1 , 2nd development with cyclohexane / ethyl acetate 15 : 1 ) indicates complete conversion of the iodide iv ( r f 0 . 5 ), a little residual starting phenol ( r f 0 . 7 ) and mainly product of the formula v ( r f 0 . 6 ). the reaction mixture is allowed to cool and is partitioned between ether and half - saturated sodium chloride solution . the aqueous phase is extracted again with ether . the combined organic phases are washed with sodium chloride solution , dried over mgso 4 , filtered and concentrated . the crude product is chromatographed with toluene / cyclohexane 2 : 1 , then 100 % toluene and then toluene / ethyl acetate 30 : 1 over silica gel . 51 g of the title compound are obtained as a colorless resin . 1 h - nmr ( cdcl 3 ): δ 1 . 10 ( 9h , s ); 1 . 28 ( 12h , d ), 1 . 4 - 2 . 2 ( 4h , m ); 2 . 93 ( 2h , 2xhept . ); 3 . 40 ( 2h , m ); 3 . 52 ( 3h , s ); 3 . 97 - 4 . 40 ( 2h , qui + m ); 4 . 87 ( 1h , dd ); 6 . 87 - 7 . 90 ( 16h , m ) ms ( ci ): m / e = 654 ( m 30 ), 597 ( m 30 - tert .- bu ), 539 , 519 , 323 , 283 , 135 , 127 a solution of 40 . 2 g ( 61 . 4 mmol ) of the lactol ether from example 1 . 6 in 3 1 of tetrahydrofuran , 3 1 of water and 4 . 2 1 of glacial acetic acid is stirred at 80 °- 85 ° c . ( external temperature ) for 24 hours . the solvents are removed in vacuo and the residue is evaporated with fuming 3 times with toluene in vacuo . chromatography with cyclohexane / ethyl acetate 12 : 1 through 2 1 of silica gel gives 33 . 4 g ( yield of 85 %) of the title compound as a . colorless amorphous powder . ms ( fab ): m / e = 640 ( m + ), 519 , 367 , 323 , 283 , 271 , 257 46 . 9 g ( 208 . 4 mmol ) of n - iodosuccinimide are added to a solution of 33 . 4 g ( 52 . 1 . mmol ) of the lactol from example 1 . 7 and 19 . 25 g ( 52 . 1 mmol ) of tetrabutylammonium iodide in 2 . 5 1 of absolute methylene chloride , while stirring and cooling . the mixture is stirred under nitrogen with exclusion of light at 10 ° c . for 1 hour and at room temperature for 20 hours . the reaction solution is washed with water , then twice with nahso 3 solution and subsequently with saturated nacl solution , dried , filtered and concentrated . the residue is dissolved in a little methylene chloride and filtered through silica gel with cyclohexane / ethyl acetate 92 : 8 . 32 . 1 g of the title compound are obtained as a colorless resin . 1 h - nmr ( cdcl 3 , 270mhz ): δ 1 . 06 ( 9h , s ); 1 . 23 ( 6h , d ); 1 . 26 ( 6h , d ); 1 . 59 ( 2h , m ); 2 . 41 ( 1h , dd ); 2 . 59 ( 1h , dm ); 2 . 90 ( 1h , hept . ); 3 . 36 ( 1h , hept . ); 3 . 48 ( 2h , ab of abx ); 4 . 29 ( 1h , qui ); 4 . 80 ( 1h , m ); 6 . 96 ( 1h , d ); 7 . 03 ( 2h , m ); 7 . 10 ( 1h , d ); 7 . 36 - 7 . 52 ( 8h , m ); 7 . 58 - 7 . 73 ( 4h , m ) ms ( 70 ev , 70 ° c . ): m / e = 638 ( m + ), 581 ( m + - tert .- bu ), 539 ( 581 - propene ), 283 , 199 11 . 65 g ( 194 mmol ) of glacial acetic acid , followed by 45 . 92 g ( 145 . 5 mmol ) of tetrabutylammonium fluoride trihydrate , are added to a solution of 31 . 0 g ( 48 . 5 mmol ) of the silyl compound from example 1 . 8 in 1 . 5 1 of tetrahydrofuran ( filtered over basic al 2 o 3 ). the mixture is stirred at room temperature for 20 hours . the solvents are removed in vacuo and the residue is immediately partitioned between ether and water . the aqueous phase is extracted twice more with ether . the combined organic phases are washed with saturated . sodium chloride solution , dried over mgso 4 , filtered and concentrated . the residue is taken up in toluene and the mixture is concentrated in vacuo . the crude product is chromatographed with cyclohexane / ethyl acetate 1 : 1 through 2 kg of silica gel . 15 . 7 g ( yield of 81 %) of the title compound are obtained as a colorless solid , melting point 145 °- 147 ° c . 1 h - nmr ( cdcl 3 , 270mhz ): δ 1 . 25 and 1 . 27 ( 12h , 2xd ); 1 . 67 ( 1h , s , br . ); 1 . 76 ( 1h , dtd ); 1 . 87 ( 1h , ddd ); 2 . 58 ( 1h , ddd ); 2 . 69 ( 1h , dd ); 2 . 91 ( 1h , hept ); 3 . 39 ( 1h , hept ), 3 . 54 ( 2h , ab of abx ); 4 . 38 ( 1h , qui ), 4 . 68 ( 1h , m ); 6 . 97 ( 1h , d ); 7 . 10 ( 3h , d + m ); 7 . 51 ( 2h , m ) a solution of 34 g ( 0 . 25 mole ) of o - isopropylphenol ( formula xii ) and 22 g ( 0 . 26 mole ) of tert .- butyl methyl ether in 150 ml of absolute ch 2 cl 2 is slowly added dropwise to a suspension of 70 g ( 0 . 3 mole ) of zirconium tetrachloride in 100 ml of absolute ch 2 cl 2 at - 5 ° to 0 ° c . under nitrogen . the mixture is stirred at 0 ° c . for 1 hour . thin - layer chromatography ( 100 % toluene ) indicates a conversion of about 50 %. a further 70 g ( 0 . 3 mole ) of zrcl 4 are rapidly added all at once and the brown suspension is stirred at 0 ° c . for 15 minutes . thin - layer chromatography now indicates a conversion of & gt ; 95 % and no impurities at all . * 500 ml of saturated nahco 3 solution are slowly added dropwise at - 10 ° to 0 ° c ., under very good cooling ( very exothermic ). a colorless solid which makes mechanical stirring very difficult forms . the organic phase is separated off , dried and concentrated in vacuo . if required , the product is chromatographed with cyclohexane / toluene 1 : 2 through 800 g of silica gel or is distilled in vacuo . 43 . 1 g of the title compound xiii are obtained as a colorless solid , melting point 55 ° to 57 ° c ., boiling point 134 ° to 135 ° c ./ 12 mm hg . 1 h - nmr ( cdcl 3 ): δ 1 . 27 ( 6h , d ); 1 . 28 ( 9h , s ); 3 . 17 ( 1h , hept . ); 4 . 61 ( 1h , s ); 6 . 62 ( 1h , d ); 7 . 05 ( 1h , dd ); 7 . 17 ( 1h , d ) under nitrogen for 10 hours , thin - layer chromatography again indicates about 30 % of starting material and numerous by - products . 18 ml ( 55 . 8 g , 0 . 35 mole ) of bromine are added dropwise to a solution of 65 . 8 g ( 0 . 34 mole ) of the phenol xiii from example 2 . 1 in 375 ml of ccl 4 . complete conversion of the starting material is checked by thin - layer chromatography ( cyclohexane / ethyl acetate 5 : 1 , r f xiii : 0 . 37 , xiv : 0 . 33 ), the product is taken up in ether and the solution is washed twice with na 2 s 2 o 3 solution and once with saturated nacl solution . it is dried , concentrated and distilled under a high vacuum . 86 . 1 g of the title compound xiv are obtained as a pale yellow oil , boiling point 105 ° to 106 ° c ./ 1 mm hg . 1 h - nmr ( cdcl 3 ): δ 1 . 25 ( 6h , d ); 1 . 29 ( 9 , s ); 3 . 47 ( 1h , hept . ); 6 . 17 ( 1h , br . ); 7 . 09 ( 1h , d ); 7 . 24 ( 1h , d ) a solution of 30 . 4 g ( 0 . 12 mole ) of iodine and 40 . 0 g ( 0 . 24 mole ) of potassium iodide in 120 ml of water is added dropwise to a solution of 19 . 2 g ( 0 . 1 mole ) of the phenol xiii from example 2 . 1 in 150 ml of 50 % strength aqueous ethylamine solution and 120 ml of ethanol at 20 ° to 25 ° c . the mixture is stirred at room temperature for 1 hour , the product is taken up in ether , the ether extract is washed twice with na 2 s 2 o 3 solution and then with saturated nacl solution , dried and concentrated in vacuo , the residue is taken up in toluene and the solution is concentrated in vacuo at & lt ; 25 ° c . 26 . 0 g of the title compound xix are obtained as an oil . 1 h - nmr ( cdcl 3 ): δ 1 . 15 - 1 . 50 ( 15h , s + d ); 3 . 06 ( 1h , hept . ); 4 . 60 ( 1h , s , br . ); 6 . 86 ( 1h , s ); 7 . 73 ( 1h , s ) ms ( 70 ev , & lt ; 50 ° c . ): m / e = 318 ( m + ), 303 ( m + - ch 3 ), 275 , 177 , 161 is obtained analogously to example 1 . 3 from the compound xiv , example 2 . 2 . colorless crystals , melting point 47 ° to 49 ° c . 1 h - nmr ( cdcl 3 ): δ1 . 23 ( 6h , d ); 1 . 48 ( 9h , s ); 3 . 33 ( 1h , hept . ); 5 . 12 ( 2h , s ); 7 . 02 ( 1h , s ); 7 . 44 ( 6h , s , br .) is obtained analogously to example 1 . 4 from the corresponding grignard compound xvi . colorless solid , melting point 126 ° to 128 ° c . 1 h - nmr ( cdcl 3 ): δ 1 . 1 - 1 . 3 ( 15h , s + d ); 3 . 38 ( 1h , hept . ); 5 . 16 ( 2h , s ); 6 . 83 ( 1h , s ); 7 . 0 - 7 . 7 ( 10h , m ) is obtained analogously to example 1 . 5 from the compound xviii from example 2 . 5 . colorless solid , melting point 109 ° to 111 ° c . 1 h - nmr ( cdcl 3 ): δ 1 . 15 ( 9h , s ); 1 . 23 ( 6h , d ); 3 . 16 ( 1h , hept . ); 4 . 65 ( 1h , s ); 6 . 80 ( 1h , s ); 6 . 9 - 7 . 4 ( 5h , m ) ms ( 70 ev ): m / e = 286 ( m + ), 271 ( m +- ch 3 ), 229 2 - isopropyl - 4 - tert .- butyl - 6 - p - fluorophenylphenol ( formula iii , y = tert .- bu , z = h ) by direct coupling of the iodide xix with the grignard reagent from p - bromofluorobenzene xx 1 ./ 87 g ( 1 . 6 mmol ) of tetrakis ( triphenylphosphine ) palladium ( o ) are added to a solution of 25 . 7 g ( 81 mmol ) of the iodophenol from example 2 . 3 in 150 ml of absolute tetrahydrofuran and the mixture is stirred at room temperature for 30 minutes . the grignard reagent obtained from 42 . 6 g ( 243 mmol ) of 4 - bromofluorobenzene and 6 . 2 g ( 255 mmol ) of mg filings in 170 ml of tetrahydrofuran is added all at once . during this addition , the internal temperature rises to about 50 ° c . the mixture is kept at 55 ° c . for 3 hours , during which a colorless solid ( magnesium iodide ) separates out . * the reaction mixture is taken up in ether and the ether extract is washed twice with ln hydrochloric acid , once with water and once with saturated sodium bicarbonate solution , dried and concentrated in vacuo . the residue is chromatographed with cyclohexane / ethyl acetate 9 : 1 over 1 kg of silica gel . the fractions containing xiii , xix and iii are concentrated together . the residue is dissolved in the minimum amount of n - pentane . 9 . 8 g of pure iii crystallize in a deep - freeze . the melting point and spectrum of this material were identical to those given in example 2 . 6 . is obtained from the phenol iii ( example 2 . 6 or 2 . 7 ) analogously to examples 1 . 6 to 1 . 9 . colorless solid , melting point 178 °- 179 ° c . 1 h - nmr ( cd 2 cd 2 ): δ 1 . 13 - 1 . 20 ( 15h , m ), 2 . 02 ( 1h , s , br . ), 2 . 10 - 2 . 16 ( 2h , m ), 2 . 71 ( 2h , ab of abx ), 3 . 24 ( 1h , hept . ), 4 . 22 ( 2h , ab of abx ), 4 . 0 ( 1h , s , br . ), 5 . 03 - 5 . 13 ( 1h , m ), 6 . 79 ( 1h , s ), 6 . 98 - 7 . 07 ( 3h , m ), 7 . 19 - 7 . 25 ( 2h , m ) ms ( 70 ev ): m / e = 414 ( m + ), 359 ir ( kbr ): 3560 / 3460 ( oh ), 1745 , ( c = o ), 1500 , 1235 , 1220 cm - 1 a solution of 160 g ( 0 . 63 mole ) of iodine and 209 g ( 1 . 26 mole ) of potassium iodide in 300 ml of water is added dropwise to a solution of 40 . 8 g ( 0 . 3 mole ) of oisopropylphenol in 630 ml of 50 % strength aqueous ethylamine solution and 525 ml of ethanol at 0 °- 15 ° c . in the course of 10 minutes . the reaction mixture is stirred at room temperature for 20 minutes and poured onto 200 ml of saturated na 2 s 2 o 3 solution plus 600 ml of water . the mixture is extracted with 3 × 500 ml of ether and the combined extracts are washed with e ./ 2 n hydrochloric acid and then with water . they are dried over mgso 4 and decanted onto fresh mgso 4 , the mixture is filtered and the filtrate is concentrated in vacuo at & lt ; 20 ° c . 100 ml of toluene are added and the mixture is concentrated in vacuo at & lt ; 20 ° c . this operation of evaporation by fuming with toluene is repeated once under a waterpump vacuum and once under a high vacuum . 99 . 0 g of the title compound are obtained as a red oil . no impurities are detectable by nmr , ms or thin - layer chromatography . 1 h - nmr ( cdcl 3 ): δ 1 . 2 ( 6h , d ), 3 . 2 ( 1h , hept . ), 3 . 5 ( 1h , s ), 7 . 35 ( 1h , d ), 7 . 75 ( 1h , d ) ms ( 70 ev ): m / e 388 ( m + ), 373 ( m + - ch 3 ), 246 ( m + - ch 3 i ) the grignard solution obtained from 219 g ( 1 . 25 mole of p - bromofluorobenzene and 31 . 3 g ( 1 . 3 mole ) of magnesium filings in 600 ml of absolute tetrahydrofuran is added dropwise to a solution of 125 g ( 0 . 32 mole ) of the diiodide xxi from example 3 . 1 and 5 g ( 7 . 1 mmol ) of bis ( triphenylphosphine ) palladium ( ii ) chloride ( aldrich ) in 300 ml of absolute tetrahydrofuran under argon and while cooling with ice ( internal temperature of 25 °- 30 ° c ). the mixture is stirred at 40 °- 50 ° c . for 5 hours , a further 2 . 5 g of ( pph 3 ) 2 pdcl 2 are then added and the mixture is stirred overnight at about 45 ° c . it is cooled to 0 ° c . and 50 ml of water are added dropwise ( exothermic reaction ) at such a rate that the internal temperature remains below 25 ° c . a viscous slimy precipitate forms 300 ml of half - concentrated hydrochloric acid are added dropwise at 25 ° c . ( precipitate dissolves , ph ˜ 1 ). the mixture is extracted several times with ether . the combined extracts are washed with 1n hydrochloric acid , then with saturated nahco 3 solution and subsequently with saturated sodium chloride solution and then dried and concentrated . a black viscous oil is obtained which is chromatographed through 1 kg of silica gel 70 - 200 μm , first with 4 1 of cyclohexane / toluene ( 4 : 1 ), then with 10 1 of cyclohexane / toluene ( 3 : 1 ) and subsequently with cyclohexane / toluene ( 2 . 5 : 1 ). 10 . 2 g of a colorless solid which , according to nmr ( only aromatic protons ) ms : 360 , 342 , 284 , 266 ( base peak ), 248 and analysis ( c + h + f 100 %), is an oligomer mixture formed from the grignard compound xx ( z = h ) are first eluted . m / e = 266 coresponds to ## str25 ## 248 is 266 - f + h , 284 is 266 + f - h , 360 is 266 + csh f - h , 342 is 360 - f + h . 2 . 1 9 of a mono - couplin9 product which is 2 - isopropyl - 4 - p - fluorophenyl - 6 - iodophenol xix , ( y = p - fluorophenyl ) are then eluted . ms ( 70 ev ): m / e = 356 ( m + ), 341 ( m 30 - ch :), 214 finally , 45 . 1 g of the title compound iii , are eluted as a viscous colorless oil which crystallizs on prolonged standing at room temperature . 1 h - nmr ( cdcl 3 ): δ 1 . 35 ( 6h , d ); 3 . 4 ( 1h , hept . ); 5 . 1 ( 1h , s ); 6 8 - 7 . 6 ( 10h , m ) ms ( 70 ev ): m / e = 324 ( m + ), 309 ( m 30 - ch 3 ) thin - layer chromatography ( toluene / cyclohexane 1 : 2 ) r f values : oligomer mixture 0 . 61 , starting material xxi 0 . 53 , monoiodide xix , 0 . 50 , product iii &# 39 ;: 0 . 35 is obtained from the phenol iii , ( example 3 . 2 ) analogously to examples 1 . 6 to 1 . 9 . colorless solid , melting point 190 °- 192 ° c . 1 h - nmr ( cdcl 3 , 270 mhz ): δ 1 . 31 ( 6h , 2xd ), 1 . 72 - 1 . 95 ( 3h , m ), 2 . 66 ( 2h , ab of abx ), 3 . 47 ( 1h , hept . ), 3 . 59 ( 2h , ab of abx ), 4 . 40 ( 1h , m ), 4 . 70 ( 1h , m ), 7 . 12 ( 4h , m ), 7 . 28 ( 1h , d ), 7 . 42 ( 1h , d ), 7 . 55 ( 4h , m ). ms ( dci ): m / e = 452 ( m 30 ), 437 ( m + - ch 3 ), 129 ir ( kbr ): 348 ( oh ), 1715 ( c = o ), 1510 , 1255 , 1220 , 1200 , 1160 , 830 cm - 1 the grignard solution obtained from 30 . 7 g ( 0 . 25 mole ) of 2 - bromopropane and 5 . 85 g ( 0 . 24 mole ) of magnesium filings in 300 ml of absolute tetrahydrofuran is added dropwise to a solution of 20 . 0 g ( 0 . 1 mole ) of 4 - nitrobiphenyl viii in 400 ml of absolute tetrahydrofuran at - 70 ° c . under nitrogen in the course of 3 hours . the mixture is stirred at - 70 ° c . for a further hour ( thin - layer chromatography : viii completely reacted ) and a solution of 22 . 7 g ( 0 . 1 mole ) of 2 , 3 - dichloro - 5 , 6 - dicyano - p - benzoquinone ( ddq ) in 200 ml of absolute tetrahydrofuran is then rapidly added dropwise at - 40 ° c . the mixture is allowed to warm to room temperature and is stirred for a further hour and poured onto 1 . 2 1 of water . the tetrahydrofuran is stripped off in vacuo , the aqueous residue is extracted twice with ethyl acetate and the extracts are washed thoroughly with water , dried and concentrated . chromatography with cyclohexane / ch 2 ch 2 4 : 1 through 1 kg of silica gel gives 8 . 9 g of the title compound ix as a pale red oil . 1 h - nmr ( cdcl 3 ): δ 1 . 37 ( 6h , d ); 3 . 58 ( 1h , hept . ); 7 . 36 - 7 . 97 ( 8h , m ) 13 . 1 g ( 54 . 3 mmol ) of the nitro compound ix from example 4 . 1 are dissolved in a solution of 10 g of ammonia in 400 ml of methanol . 10 g of raney nickel which has been washed three times with methanol are added , under nitrogen . the suspension is shaken at room temperature under normal pressure in a hydrogen atmosphere for 2 hours . the catalyst is filtered off , the filtrate is concentrated and the residue is chromatographed over 400 g of silica gel with 2 1 of cyclohexane / toluene 1 : 2 and then with 5 1 of toluene . 11 . 2 g of the title compound x are obtained as a colorless oil . 1 h - nmr ( cdcl 3 ): δ 1 . 33 ( 6h , d ); 3 . 00 ( 1h , hept . ); 3 . 45 ( 2h , s , br . ); 6 . 80 ( 1h , d ); 7 . 2 - 7 . 7 ( 7h , m ) ms ( 70 ev ): m / e = 211 ( m + ), 196 ( m + - ch 3 ) 2 - isopropyl - 4 - phenylphenol ## str27 ## a solution of 4 . 26 g ( 62 mmol ) of sodium nitrite in 50 ml of water is added to a solution of 11 . 2 g ( 53 . 1 mmol ) of the amine x from example 4 . 2 in 50 ml of glacial acetic acid at 10 ° to 12 ° c . the diazonium salt precipitates . the suspension is difficult to stir . after 5 minutes , the suspension is poured slowly into a boiling solution of 32 ml of concentrated sulfuric acid in 65 ml of water . the mixture is stirred for a further 5 minutes and then cooled and partitioned between toluene / ether and saturated sodium chloride solution . the organic phase is washed twice with saturated nahco 3 solution and once with sodium chloride solution and then dried and concentrated . gel gives 4 . 9 g of the title compound xiii as a yellow oil . 1 h - nmr ( cdcl 3 ): δ 1 . 30 ( 6h , d ); 3 . 25 ( 1h , hept . ); 7 . 1 - 7 . 7 ( 8h , m ) ms ( 70 ev ): m / e = 212 ( m + ), 197 ( m + - ch 3 ), 178 is obtained analogously to example 2 . 2 from the phenol xiii from example 4 . 3 . 1 h - nmr ( cdcl 3 ): δ 1 . 26 ( 6h , d ); 3 . 40 ( 1h , hept . ); 5 . 63 ( 1h , s ); 7 . 2 - 7 . 7 ( 7h , m ) ms ( 70 ev ): m / e = 290 / 292 ( m + ), 275 / 277 ( m + - ch 3 ), 196 , 165 is obtained analogously to example 1 . 3 from the phenol xiv ( example 4 . 4 ) as a colorless oil which slowly crystallizes . 1 h - nmr ( cdcl 3 ): δ 1 . 24 ( 6h , d ); 3 . 45 ( 1h , hept . ); 5 . 05 20 ( 2h , s ); 6 . 95 - 7 . 70 ( 12h , m ) is obtained analogously to example 1 . 4 from the corresponding grignard compound xvi as a colorless oil which slowly crystallizes . 1 h - nmr ( cdcl 3 ): δ 1 . 28 ( 6h , d ); 3 . 52 ( 1h , hept . ); 5 . 00 ( 2h , s ); 6 . 95 - 7 . 70 ( 16h , m ) is obtained analogously to example 1 . 5 from xviii from example 4 . 6 as a colorless solid . 1 h - nmr ( cdcl 3 ): δ 1 . 35 ( 6h , d ); 3 . 40 ( 1h , hept . ); 5 . 10 ( 1h , s , br . ); 6 . 85 - 7 . 45 ( 11h , m ) ms ( 70 ev ): m / e = 306 ( m + ), 291 ( m + - ch 3 ) is obtained from the phenol ( example 4 . 7 ) analogously to examples 1 . 6 to 1 . 9 . colorless solid , melting point 184 °- 187 ° c . 1 h - nmr ( cdcl 3 ): δ 1 . 30 ( 6h , 2xd ), 1 . 7 - 2 . 0 ( 3h , m ), 2 . 65 ( 2h , m ), 3 . 50 ( 1h , hept . ), 3 . 60 ( 2h , m ), 4 . 40 ( 1h , m ), 4 . 70 ( 1h , m ), 7 . 1 - 7 . 6 ( 11h , m ) ms ( dci ): m / e = 434 ( m + ), 4219 ( m + - ch 3 ) 2 . 0 g of 5 % palladium - on - charcoal suspended in 50 ml of ethyl acetate are shaken at room temperature in a hydrogen atmosphere for 30 minutes . a solution of 31 . 2 g ( 0 . 1 mole ) of the phenol xiii from example 4 . 3 in 250 ml of ethyl acetate is added , with exclusion of oxygen , and the mixture is shaken at 50 ° c under a hydrogen pressure of 5 kg / cm 2 for 5 hours . the course of the reaction can be monitored by gas chromatography [ 1 m of sp 1000 on ® chromosorb waw 80 to 100 mesh , 220 ° c ., 1 . 0 kg / cm 2 of n 2 carrier gas , t ret : xiii ## str28 ## starting compound ) 13 . 8 minutes , product xiii ## str29 ## cyclohexyl ): 4 . 6 minutes ]. the gas chromatography analysis shows that about 90 of xiii ( y = cyclohexyl ) and several by - products , no more than 3 % of any , are formed . the catalyst is filtered off and the residue is recrystallized from cyclohexane . 25 . 0 g of the title compound xiii are obtained as a colorless solid . 1 h - nmr ( cdcl 3 ): δ 0 . 8 - 1 . 2 ( 10h , m ); 1 . 25 ( 6h , d ); 3 . 00 ( 1h , m ); 3 . 11 ( 1h , hept . ); 4 . 24 ( 1h , s , br . ); 6 . 50 - 7 . 10 ( 3h , m ) ms ( 70 ev ): m / e = 218 ( m + ), 203 ( m + - ch 3 ) is obtained analogously to example 2 . 3 from the phenol xiii from example 5 . 1 . 1 h - nmr ( cdcl 3 ): δ 0 . 7 - 1 . 4 ( 10 , m ); 1 . 26 ( 6h , d ); 3 . 0 - 3 . 1 ( 2h , m ); 4 . 60 ( 1h , s , br . ); 6 . 88 - 7 . 40 ( 2h , m ) ms ( 70 ev ): m / e = 344 ( m + ), 329 ( m + -- ch 3 ) is obtained analogously to example 2 . 7 from the iodophenol xix from example 5 . 2 . 1 h - nmr ( cdcl 3 ): δ 0 . 7 - 1 . 2 ( 10h , m ); 1 . 25 ( 6h , d ); 3 . 0 - 3 . 2 ( 2h , m ); 4 . 90 ( 1h , s , br . ); 6 . 9 - 7 . 4 ( 6h , m ) ms ( 70 ev ): m / e = 312 ( m + ), 297 ( m + - ch 3 ) is obtained from the phenol iii from example 5 . 3 analogously to examples 1 . 6 to 1 . 9 . colorless solid , melting point 158 ° to 160 ° c . 1 h - nmr ( cdcl 3 ): δ 0 . 8 - 1 . 1 ( 10h , m ); 1 . 2 ( 6h , d ); 1 . 68 ( 1h , s , br . ); 1 . 75 ( 1h , m ); 1 . 90 ( 1h , m ); 2 . 55 - 2 . 70 ( 2h , m ); 3 . 0 - 3 . 2 ( 2h , m ); 3 . 55 ( 2h , m ); 4 . 40 ( 1h , qui ); 4 . 70 ( 1h , m ); 7 . 0 - 7 . 5 ( 6h , m ) 3 . 6 g of 50 % strength sodium hydrdde are suspended in 60 ml of absolute dimethylformamide . 21 . 76 g ( 80 mmol , 1 equivalent ) of 2 , 4 - diisopropyl - 6 - p - fluorophenyl - phenol ( example 1 . 5 ) are introduced , while cooling with ice . the solution is stirred at room temperature for 30 minutes and cooled to 0 ° c . a solution of 12 . 4 g ( 1 . 25 equivalents ) of dimethylthiocarbamoyl chloride ( aldrich ) in 20 ml of dimethylformamide is added and the reaction mixture is stirred at 80 °- 90 ° c . for 5 hours . after cooling , the mixture is diluted with 500 ml of ether , washed twice with water and once with potassium bicarbonate solution and dried over magnesium sulfate and the solvent is stripped off the residue is recrystallized from methanol . 25 . 6 g ( yield of 89 %) of the title compound are obtained as a solid , melting point 182 ° c . ms : m / e = 359 ( m + ) 25 . 0 g of the thiocarbamate from example 6 . 1 were heated at 270 °- 300 ° c . under nitrogen for 1 hour . after cooling , the residue was dissolved in the minimum amount of hot nhexane and after addition of active charcoal the mixture was boiled under reflux for 10 minutes and filtered hot . 20 . 0 g ( 80 % yield ) of the title compound crystallize out of the filtrate as colorless needles during slow cooling . a solution of 19 . 7 g of the thiocarbamate from example 6 . 2 in ether is added dropwise to a suspension of 3 . 2 g of lithium aluminum hydride in absolute ether , while cooling with ice . the mixture is stirred at room temperature for 2 hours and hydrolyzed with 2n sulfuric acid ( to ph 3 ), while cooling with ice . the mixture is extracted several times with ether , the extract is dried over magnesium sulfate and the solvent is stripped off . 16 . 8 g of the title compound are obtained as a viscous oil . 6 ( s ) -- -[( 2 , 4 - diisopropyl - 6 - p - fluorophenyl ) phenylthiomethyl ]- 3 , 4 , 5 , 6 - tetrahydro - 2 ( r , s )- methoxy - 4 ( r )-( t - butyldiphenylsilyloxy )- 2h - pyran ( formula v , x = s , y = i - pr , z = h , r 7 = t - butyl - diphenylsilyl ) a suspension of 13 . 8 g ( 100 mmol ) of potassium carbonate , 14 . 4 g ( 50 mmol ) of the thiophenol from example 6 . 3 and 20 . 4 g ( 40 mmol ) of the lactol ether iodide iv ( r 7 = t - butyl - diphenylsilyl , for the preparation see ep - a 0 , 216 , 127 ) in 300 ml of absolute dimethyl sulfoxide was stirred at 50 ° c . for 1 hour . water was added to the cooled reaction mixture and the mixture was extracted three times with ether . the combined organic phases were washed with water and then with saturated sodium chloride solution , dried over magnesium sulfate and concentrated in vacuo . the residue was chromatographed with toluene / ethyl acetate 95 : 5 over silica gel and gave 21 . 4 g ( 80 % yield ) of the title compound as a colorless viscous oil . a solution of 20 . 1 g ( 30 mmol ) of the lactol ether v from example 6 . 4 in 2 1 of tetrahydrofuran , 1 1 of water and 1 1 of trifluoroacetic acid was stirred at 50 °- 60 ° c . for 1 hour . after cooling to room temperature , 1 . 5 kg of sodium acetate were added . the organic solvent was stripped off in vacuo . 1 1 of saturated sodium chloride solution was added to te aqueous residue and the mixture was extracted several times with ether . the combined organic extracts were washed with water and dried over magnesium sulfate . the ether was stripped off and the residue was chromatographed with cyclohexane / ethyl acetate 4 : 1 over silica gel . 13 . 8 g ( 70 % yield ) of the title compound were obtained as a colorless viscous oil . ms ( ci ): m / e = 656 ( m + ), 638 ( m + -- h 2 o ), 581 ( m + -- t -- bu -- h 2 o ). a solution of 13 . 0 g ( 19 . 8 mmol ) of the lactol vi from example 6 . 5 , 7 . 4 g ( 20 mmol ) of tetrabutylammonium iodide and 22 . 5 g ( 100 mmol ) of n - iodosuccinimide in 200 ml of methylene chloride was stirred at room temperature for 12 hours . 500 ml of toluene were added and the methylene chloride was removed in vacuo . the precipitate was filtered off with suction and washed with toluene . the combined filtrates were washed once each time with aqueous sodium thiosulfate solution and saturated sodium chloride solution , dried over magnesium sulfate , filtered and concentrated in vacuo . the residue was chromatographed with toluene / ethyl acetate 10 : 1 over silica gel . 11 . 6 g ( 90 % yield ) of the title compound were obtained as a colorless viscous oil . ms ( 70 ev , 70 ° c . ): m / e = 654 ( m + ), 597 ( m + -- t -- bu ) 13 analogously to example 1 . 9 , 4 . 9 g ( 70 % yield ) of the title compound are obtained as a viscous colorless oil from 11 . 0 g of the protected lactone ( example 6 . 6 ). 1 h - nmr ( cdcl 3 ): δ 1 . 25 ( 12h ), 2xd ), 1 . 65 ( oh , s , br . ), 1 . 7 - 1 . 9 ( 2h , m ), 2 . 5 - 2 . 6 ( 2h , m ), 2 . 75 ( 2h , m ), 2 . 90 ( 1h , hept . ), 3 . 40 ( 1h , hept . ), 4 . 35 ( 1h , qui ), 4 . 50 ( 1h , m ), 7 . 0 - 7 . 5 ( 6h , m ). the title compound is obtained by converting 2 - isopropyl - 4 , 6 - di - p - fluorophenyl - phenol ( example 3 . 2 ) into 2 - isopropyl - 4 , 6 - di - p - fluorophenyl - thiophenol analogously to examples 6 . 1 to 6 . 3 and reacting this to give the title compound analogously to examples 6 . 4 - 6 . 7 . colorless tacky solid which becomes crystalline when washed with n - hexane , melting point & gt ; 60 ° c . 1 h - nmr ( cdcl 3 ): δ 1 . 3 ( 6h , d ), 1 . 7 - 1 . 95 ( 3h , m ), 2 . 5 - 2 . 7 ( 2h , m ), 2 . 75 ( 2h , m ), 3 . 4 ( 1h , hept . ), 4 . 4 ( 1h , m ), 4 . 6 ( 1h , m ), 7 . 0 - 7 . 5 ( 10h , m ). ms ( fab ): m / e = 468 ( m + ), 453 ( m + -- ch 3 ) preparation of the sodium salts of the open - chain dihydroxycarboxylic acids ( formula ii , sodium salt ) from the lactones of the formula i 17 . 7 ml of ln sodium hydroxide solution are rapidly added dropwise to a solution of 7 . 0 g ( 17 . 5 mmol ) of the lactone from example 1 . 9 in 800 ml of absolute ethanol , while cooling with ice . the mixture is stirred for 5 minutes , while cooling with ice , and then at room temperature for 2 hours . according to thin - layer chromatography , the starting material has reacted completely . the solvents are stripped off in vacuo at a bath temperature of 30 ° c . the residue is twice dissolved in ether and the solution is concentrated to dryness each time , the residue is then dissolved in ether and the solution is concentrated to dryness in vacuo . the residue is suspended in toluene and the suspension is concentrated to dryness in vacuo . the residue is stirred with n - pentane and then filtered off with suction and dried under a high vacuum over phosphorus pentoxide and potassium hydroxide lozenges . 6 . 25 g of the title compound are obtained as a colorless amorphous powder . concentration of the pentanecontaining mother liquor gives a further 0 . 43 g of amorphous product . melting point 240 - 244 ° c . ( decomposition ). the decomposition point depends on the rate of heating up . is obtained analogously to example 8a from the lactone from example 2 . 11 . colorless powder , melting point 256 °- 258 ° c . ( decomposition ) is obtained analogously to example 8a from the lactone from example 3 . 6 . colorless powder , melting point 235 - 237 ° c ( decomposition ) is obtained analogously to example 8a from the lactone from example 4 . 11 . colorless powder , melting point 238 °- 240 ° c . ( decomposition ) is obtained analogously to example 8a from the lactone from example 5 . 7 . colorless powder , melting point 230 °- 233 ° c . ( decomposition ) is obtained analogously to example 8a from the lactone from example 6 . 7 . colorless powder , melting point 230 °- 234 ° c . ( decomposition )

US-68061391-A

housing apparatus for protecting a padlock includes plate elements securable to a door with an aperture in the back of the housing for receiving a fixed hasp plate secured either to a second door or to a door frame . the housing includes a slot in a back plate for receiving the hasp plate and an open bottom for receiving a padlock . a front plate includes an aperture through which a key may be extended into a front opening padlock .

fig1 is a perspective view illustrating the lock box apparatus 10 of the present invention in a use environment . the use environment includes a truck 2 with a side post 4 and a door 8 . the lock box protective apparatus 10 is secured to the door 8 and cooperates with elements secured to the side post 4 . the protective nature is best illustrated in fig2 . fig2 comprises an exploded , perspective view , partially broken away , of the apparatus 10 in the environment illustrated in fig1 . for the following discussion , reference will be made to both fig1 and 2 . the apparatus 10 includes a plate 12 which is appropriately secured , as by welding , to the door 8 . the plate 12 is divided into two portions , a door portion 14 and an housing portion 16 . the door portion 14 is appropriately secured , as by welding , to the door 8 . the housing portion 16 extends beyond the door 8 and overlaps the side post 4 . a padlock housing or box 19 is secured to the housing portion 16 . the housing portion 16 becomes a back wall of the housing or box 19 . extending through the housing portion 16 is an aperture 18 . the purpose of the aperture 18 will be discussed in detail below . extending outwardly from the housing portion 16 is a side plate 20 . the side plate 20 is substantially perpendicular to the housing portion 16 of the plate 12 . spaced apart a relatively short distance from the housing portion 16 is a front plate 22 . the front plate 22 is appropriately secured to the side plate 20 , just as the side plate 20 is appropriately secured to the housing portion 16 of the plate 12 . a slot 24 extends upwardly from the bottom of the front plate 22 . the front plate 22 is substantially parallel to the housing portion 16 of the plate 12 . a second side plate 26 is appropriately secured to the front plate 22 and to the housing portion 16 of the plate 12 . the side plate 26 is generally parallel to the side plate 20 , but obviously spaced apart from it . the housing or box portion is then closed by a top plate 28 . the top plate 28 is secured to both the back plate 12 , the side plates 20 and 26 , and the front plate 22 . thus , the box or housing or enclosure 19 is open only at the bottom . the plates 20 , 22 , 26 , together with the plate portion 16 , comprise walls of the housing or box or enclosure 19 for a padlock , with the plate 28 comprising a top wall . the bottom of the box 19 is open to receive a padlock . a lock plate or fixed hasp plate 30 is appropriately secured , as by welding , to the side post 4 . the plate 30 includes an aperture 32 which extends through the plate . the plate 30 is substantially perpendicular to the side post 4 and , when the door 8 is closed , the lock plate 30 extends through the aperture 18 in the housing portion 16 of the plate 12 and into the interior of the box or housing 19 . in fig2 a padlock 40 is shown spaced apart below the housing 19 . with the door 8 closed , and the fixed hasp plate 30 extending through the aperture 18 , the padlock 40 may be inserted upwardly through the open bottom of the housing 19 and the shackle of the padlock 40 may then be inserted through the aperture 32 in the hasp plate . the slot 24 in the front wall or plate 22 provides access for a key 50 to be inserted into a front key slot 42 of the padlock 40 . with the key 50 removed from the lock , and the lock 40 in place , the padlock 40 is protected by the box apparatus 10 so as to prevent access to the padlock 40 for the use of a bolt cutter , or the like , on the shackle of the padlock 40 . it will be noted that the padlock 40 is of the “ buffalo ” type , in which the padlock 40 is generally circular with a relatively short , curved shackle and a front key slot or keyway 42 . this type of padlock is particularly advantageous in the circumstances in which the apparatus 10 is employed . it will be understood that the apparatus 10 is preferably made of relatively thick steel for maximum protection , thus rendering it very difficult for a would - be thief to interfere with the lock system . it will be noted that a single door has been discussed and illustrated . however , it is obvious that the apparatus 10 may also be employed with double doors . in such case , the plate 12 is secured to one door and the hasp plate 30 is secured to the second door . moreover , while a front keyed padlock is illustrated , it is obvious that a bottom keyed padlock may also be used . in such case , the housing 19 may need to be elongated by lengthening the plate 22 and spacing apart the plate 26 a greater distance from the plate 20 , as shown by the dashed line in fig2 . while the principles of the invention have been made clear in illustrative embodiments , there will be immediately obvious to those skilled in the art many modifications of structure , arrangement , proportions , the elements , materials , and components used in the practice of the invention , and otherwise , which are particularly adapted to specific environments and operative requirements without departing from those principles . the appended claims are intended to cover and embrace any and all such modifications , within the limits only of the true spirit and scope of the invention .

US-61783100-A

the present invention comprises a method for fabricating hafnia film comprising the steps of providing a substrate having a surface that allows formation of a self - assembled monolayer thereon via covalent bonding ; providing an aqueous solution that provides homogeneous hafnium ionic complexes and hafnium nanoclusters wherein the aqueous solution is capable of undergoing homogeneous precipitation under controlled conditions for a desired period of time at a controlled temperature and controlled solution acidity for desired nanocluster nucleation and growth kinetics , desired nanocluster size , desired growth rate of film thickness and desired film surface characteristics . the method further comprising forming the self - assembled monolayer on the surface of the substrate wherein the self - assembled monolayer comprises a plurality of hydrocarbon chains cross - linked together along the surface of the substrate , the hydrocarbon chains being uniformly spaced from one another and wherein each of the hydrocarbon chains having a functional anchoring group at a first end of the chain covalently bonded with the surface of the substrate and each of the hydrocarbon chains having a functional terminating group projected away from the surface wherein the functional terminating group provides a bonding site for the hafnium film to grow ; and exposing the substrate to the aqueous solution for a desired period of time at a controlled temperature wherein the hafnium ionic complexes and the hafnium nanoclusters are deposited on the bonding site of the functional terminating group thereby forming the hafnia film wherein the hafnium bonded to the hydrocarbons and to one another provide a uniform ordered arrangement defined by the uniform arrangement of the hydrocarbons .

applicant &# 39 ; s invention is a method for the uniform deposition of hafnia precursor film on a solid substrate surface such as silicon , silicon wafers , glasses , polymers , ceramics or any other material that carries functional surface groups ( such as — oh ), via self - assembled monolayers ( sams ). hafnium sulfate was used to prepare aqueous solutions , although nitrate or chloride salt or any other salt capable of undergoing particle nucleation and growth when in aqueous solution can also be used . the film deposition method of applicant &# 39 ; s invention comprises synthesis of sam precursor molecules , sam formation on solvent - cleaned wafers , and submerging sam - coated silicon wafer in a solution in which process parameters such as inorganic salt concentration , acidity , temperature and incubation time are controlled . the process parameters affect the film thickness , surface roughness , and the nanocluster size on the film . as with zirconia systems , bulk ( visible ) precipitation , a prerequisite for the formation of hafnia films thicker than a few nanometers , occurs in the liquid phase during the film deposition . homogeneous nucleation and nanocluster adherence to the oxide film surface is a dominant mechanism for hafnia film growth , although the heterogeneous nucleation and growth mechanism seems to be responsible for the formation of the first layer of hafnia on the sam surface . microwave volumetric heating was found to be useful for preparing uniform thin films in a very short time ( a few seconds ). multiple batch deposition and continuous - nanocluster - forming ( flow - through ) processes seem to have the potential to decrease film surface roughness and to enhance the film growth efficiency . hafnia thin films are used in sensors , optical interconnect circuits ( as nanowaveguides ), electronic devices , catalysis , and separation membranes . the basic elements in the film deposition method of applicant &# 39 ; s present invention include a solution ( mostly aqueous ) that provides homogeneous ( hafnia ) ionic nanospecies and / or solid nanoclusters under appropriate induction conditions ( usually by heating ), and a sam - coated substrate . this is illustrated in fig1 as fig1 is a schematic showing the inorganic film deposition on sam - coated substrate wherein the substrate 5 comprises any solid materials on which sam can form , such as silicon , silicon oxide , glass , plastic , metals and other ceramics . metal substrates include ge , al , si , ni and ti or alloys thereof wherein the surface of said substrate includes an oxide . metal substrates can further include platinum or gold . semiconductors can also be used as substrates . the sam precursor molecule is not limited to 1 - thioacetate - 16 -( trichlorosilyl ) hexadecane . other sam molecules such as thio - anchoring ( instead of trichlorosilyl - anchoring group ) molecules will form sam on metal ( gold ) surfaces . fig1 shows the sam layer 10 comprising a bonding or anchoring group 12 ( e . g ., sicl 3 ), a spacer 14 (— ch 2 —) n and a surface or terminal group 16 ( e . g . — so 3 h ). the inorganic ( hfo 2 ) film layer 20 is a mirror - like film and 25 is the aqueous chemical solution which provides homogeneous hafnia ionic nanospecies and / or solid nanoclusters under appropriate induction conditions . the trichlorosilyl groups of sam precursor molecules anchor covalently on the oh - containing surface of a substrate through siloxane bonds . the highly ordered , closely packed molecular arrays in a sam are maintained due to the van der walls forces ( attractive ) and electrostatic forces ( repulsive ) between the long hydrocarbon chain molecules . the thickness of the sam layer (—( ch 2 ) 16 − ) is around 25 å . the distance between two terminal ( thioacetate ) groups is 4 . 3 å . the sam is stable under even harsh deposition conditions (& lt ;˜ 100 ° c ., ph & lt ;˜ 10 ). the chemical conversion of surface terminal group from thioacetate to sulfonate can be done in situ . the deprotonation of the desired sulfonate terminal group (— so 3 h →— so 3 − + h + ) could occur even in strong acid solutions , thus provide high , uniform , negative charge density on the sam surface . the sulfonate terminal groups (— so 3 − ) are active sites on which inorganic nanoclusters nucleate or deposit . depending on the substrate material , covalent coupling of hydrocarbon chain of sam to the solid substrate surface is not limited to an — oh ( hydroxyl ) group via siloxane bonds . such covalent coupling could also be through groups like — nh 2 or substrate ( au )— s —( ch 2 ) n —, etc . depending on the substrate surface chemistry , there exists a flexibility to tailor the bonding functional group in the hydrocarbon chain molecules . the film deposition method comprises solution preparation , substrate surface cleaning by solvents , sam formation on a solvent - cleaned substrate surface , and submerging the sam - coated substrate in the solution in which process parameters ( temperature , concentration of inorganic salt precursor , acidity , and heating / incubation time ) were controlled . the detailed seven steps are described as follows : 1 ) solution preparation . the purpose of the solution is to provide inorganic ionic species and / or nanoclusters ( i . e ., hafnium ionic complexes or hafnium compounds ) that can deposit onto the substrate surface and become intrinsic part of the inorganic film . the solutions needs to satisfy certain criteria such as ( i ) the solution starts as clear dissolved salt solution , ( ii ) the solution undergoes a homogeneous precipitation under controlled conditions such as raising temperature for a certain period of time . generally , process parameters such as concentration salt , solution temperature , solution acidity , and heating / incubation time , need to be controlled for desired nanocluster nucleation and growth kinetics , nanocluster size , growth rate of film thickness , and film surface characteristics . specifically , hafnium salt such as hf ( so 4 ) 2 was used as one example of applicant &# 39 ; s invention . all inorganic salts were used as received . the hafnium sulfate solutions were prepared from hafnium sulfate ( 99 . 9 +%, purity exclude 1 – 2 % zirconium , aldrich chem . co ., wi ). deionized water was used for all preparation steps . 2 ) substrate . the substrate can be any solid containing — oh groups on the surface , such as silicon wafers ( with an intrinsic oxide layer on the surface ), glasses , plastics , and metals / alloys that contains a native oxide layer on the surface . in applicant &# 39 ; s specific example for demonstrating hafnia film growth , p - type single - crystal ( 100 ) silicon wafers were used , polished on one side or both sides . wafers were typically cut into 1 cm by 1 cm or 2 cm by 2 cm squares . 3 ) substrate cleaning . cleanness of the substrate surface is critical to the uniformity of the sam and the inorganic film characteristics . the cleaning for silicon wafers involved ( i ) manual wiping using solvent - soaked low - lint tissues , with chloroform , acetone , and ethanol in sequence , ( ii ) immersion in ethanol , and iii ) blow drying with clean , filtered ( 0 . 45 μm ) argon until the wafer surface was completely mirror - like . typically , the wafers were cleaned four times with solvents . during the cleaning process , the wafer was rotated ninety degrees after each surface wiping . 4 ) surface oxidation / hydroxylation . this step created a thin 1 . 5 – 2 . 0 nm , uniform , hydrolyzed layer of amorphous sio 2 on the silicon wafers . this involved : ( i ) the cleaned wafers were immediately immersed in a 10 - ml “ piranha ” solution ( i . e ., 7 ml concentrated h 2 so 4 ( 95 – 97 %) plus 3 ml chilled , aqueous 30 % h stirred ) contained in a capped glass vial , a teflon container , or a petri dish in an ice bath . ( ii ) the solution was then heated to an elevated temperature ( typically 80 ° c .) on a heating plate and held for at least 30 minutes to one hour . it is important to make sure that the surface is fully wettable by deionized water . the wettibility was checked by a contact angle meter . ( iii ) wafers were rinsed three times in deionized water and blow dried with clean , filtered argon . 5 ) formation of thioacetate - sam on silicon wafer surface . sam precursor surfactant is 1 - thioacetate - 16 -( trichlorosilyl ) hexadecane , which was synthesized with balachander and sukenik &# 39 ; s procedure ( langmuir , 6 , 1621 – 1627 ( 1990 ), incorporated herein by reference ) with slight modification , including ( i ) grignard reaction : to produce ω - hexadecenylbromide : h 2 c ═ ch ( ch 2 ) 9 br + br ( ch 2 ) 5 br → h 2 c ═ ch ( ch 2 ) 14 br . ( ii ) exchange of bromine surface group for thioacetate : h 2 c ═ ch ( ch 2 ) 14 br + kscoch 3 → h 2 c ═ ch ( ch 2 ) 14 scoch 3 separation of thioacetate via hplc . ( iv ) hydrosilylation ( catalyzed by h 2 ptcl 6 ) to attach the trichlorosilane bonding group : h 2 c ═ ch ( ch 2 ) 14 scoch 3 + hsicl 3 → cl 3 si ( ch 2 ) 16 scoch 3 . nmr was used to reactions to completion . ( v ) kugelrohr distillation of the 1 - thioaceto - 16 ( trichlorosilyl ) hexadecane surfactant . ( vi ) the surfactant was stored in a bottle wrapped with aluminum foil , sealed under argon , and kept in a desiccator for extended periods . for the formation of thioacetate - sams on solvent - cleaned silicon wafer surfaces , the following procedure was used : ( i ) several hydroxylated wafers ( 1 cm 2 square each ) were immersed in a slowly stirred solution of surfactant ( 1 . 0 vol . % surfactant in 5 ml of dicyclohexyl solvent ) at room temperature , under an inert atmosphere ( typically argon in a glove box ) for 5 hours . ( ii ) each wafer was thoroughly cleaned twice manually with fresh chloroform - soaked tissues , until the surface was again perfectly mirror - like , then rinsed again with chloroform and blow dried with clean , filtered argon . ( iii ) the thioacetate - sam - coated wafers were stored dry in a desiccator , wrapped in aluminum foils to prevent inadvertent photooxidation of sam . ( iv ) thickness of the thioacetate - sams was determined by ellipsometry , around 2 . 5 nm . typical values of contact angle of water on hydrophobic thioacetate - sam surfaces were 73 °± 3 ° ( advancing ) and 65 °± 3 ° ( receding ). these measurements were consistent with those reported by agarwal et . al . 6 ) oxidation of thioacetate - sams to sulfonate - sams ( i . e ., — scoch 3 → so 3 h ): the hydrophobic thioacetate terminal groups (— scoch 3 ) were converted to hydrophilic sulfonate terminal groups (— so 3 h ) on the surface of the sam layer . the anionic sulfonate groups (— so 3 − ) offered the desired sites for deposition or nucleation / growth of inorganic nanoclusters that later became an intrinsic part of the inorganic film . for terminal group oxidation , the following procedure was used : ( i ) dust particles were removed from the thioactate - sam - coated wafer surface by blowing a stream of nitrogen or argon . ( ii ) a solution of “ oxone ” in deionized water was prepared . plenty of oxone ( 2khso 5 . khso 4 . k 2 so 4 , a monopersulfate oxidizing agent ) were added to have the solution over - saturated i . e . salt on the bottom of the beaker , at room temperature . ( iii ) the thioactate - sam - coated wafer was placed in the oxone solution in a beaker covered with parafilm to keep dust away . this is done in normal atmosphere . ( iv ) oxidation needs a minimum of 4 – 5 hours ( usually overnight ) at room temperature . ( v ) the wafer was rinsed with deionized water and stored in the water until further use . the converted surface of a sam - coated wafer should be fully wetted by deionized water ; otherwise it needs to be oxidized longer . typical contact angle of hydrophilic sulfonated surfaces is ˜ 30 °± 2 ° ( advancing ) and & lt ; 10 ° ( receding ). the so 3 h - sam wafers should be used as soon as possible . it was noticed that the so 3 h surface attracts dust particles easily and thus may cause surface contamination . 7 . inorganic ( hfo 2 ) thin film deposition on sam - coated substrate . the sam - coated wafer was submerged in a clear hafnium salt ( hf ( so 4 ) 2 ) solution , in which the salt concentration , acidity , temperature , and incubation time were controlled . the ranges of experimental conditions are : hafnium salt concentration ( 4 and 10 mm ), ph ( hcl acid concentration 0 . 1 – 0 . 6 n ), temperature ( 70 °, 80 ° and 90 ° c . ), and time ( 0 – 250 minutes ). solutions were prepared by dissolving the appropriate mass of metal salt , depending on the desired concentration , in filtered deionized h 2 o and then adding the appropriate volume of acid . the sulfonate sam - coated wafer was immersed in the hafnium salt solution in an erlenmeyer flask , which was submerged in a constant - temperature water bath . in each experimental condition , a clean , hydrolyzed bare silicon wafer ( with no anchored sam ) was also immersed under identical conditions as a control . after the desired deposition time , the wafer was removed , rinsed three times with filtered deionized water and sonicated for one minute between rinses . the wafer was then blow dried with filtered air and stored in chemwipes for later analysis . one baseline condition for hafnia film deposition is : 4 mm hf ( so 4 ) 2 , 0 . 2 n hcl , 80 ° c . and 6 hours . without sam , no or poor inorganic films were observed on the bare silicon wafer surfaces . with the use of sulfonate - sam interface , colorful mirror - like hfo 2 films ( brown or blue color , depending on the film thickness ) have been grown on the sam surfaces . the tools used to study the film and solution / colloids system include optical ellipsometry to conduct non - destructive , fast measurements of film thickness ( film - growth kinetics ) and refractive index ( typically ranging from 1 . 3 to 1 . 8 for the hafnia film samples ). spectroscopic ellipsometry measurements were taken of the hafnia films using the two - modulator generalize ellipsometer ( 2 - mge ) and analyzed using a simple 3 - medium model consisting of air / hafnia film / crystalline silicon . atomic force microscopy ( afm ) was also used to examine the film surface ( roughness ) and to determine the nanocluster size and morphology on the surface . transmission electron microscope ( tem ) was used to examine the cross - section of films and show the film thickness and internal film microstructure . small - angle x - ray scattering ( saxs ) was further used to observe early - stage evolution ( nucleation and growth ) of small nanoclusters in solutions . in - situ dynamic laser light scattering ( dls ) was used to monitor the solid particle formation and growth in the bulk solutions during heated incubation . the general concept of the dls setup involved the scattering of laser light by the sample particles in a thermally controlled quartz cell . a low - power he — ne laser was used as the incident beam source , and a photomultiplier tube is placed at a 90 ° angle to the incident beam in order to observe the scattering . the scattered light from the particles , which contains information on the brownian motion of the particles , is used by a bi9000 - at ( dos version 6 . 6 ) digital correlator ( brookhavent instruments corp ., holtsville , n . y .) through the application of the stokes - einstein equation to infer the average size ( hydrodynamic diameter ) of the particles . the instrument is capable of measuring particles typically in the range of 5 nm to 1 μm accurately . to study the particle growth , salt solutions were contained in a capped , quartz cuvette cell that was placed in the dls cell holder that is heated at a constant temperature . the particle formation and growth were monitored by collecting autocorrelation curve data at various incubation times . the effects of several parameters such as temperature , concentration of the inorganic salt , and acidity on the characteristics of the particles were studied . scanning electron microscope ( sem ) was used to examine the size and morphology of precipitated particles from bulk solutions . thick suspensions of particles were spread on a carbon conductive tape attached to the surface of a sem brass stub . after the particles had dried , they were coated with palladium - gold by plasma sputtering ( hammer 6 . 2 sputtering system , anatech ltd .) for approximately two minutes in preparation for sem imaging . in the experimental conditions tested for applicant &# 39 ; s invention , a bulk solution precipitation was needed to initiate the film deposition on the surface of the sam - coated substrate . initial experiments were conducted to search for synthesis conditions that allowed reasonable induction period , during which there is no formation of dls - visible precipitate particles ( i . e . greater than a few nanometers ) in bulk solutions of acidified hafnium sulfate . changing parameters such as amount of hydrochloric acid added in the solution , hafnium salt concentration , and temperature can tune the hydrolysis / condensation kinetics and thus the induction period for precipitation of solid hafnia particles in bulk solutions . this induction period was determined by a dynamic light scattering technique . a baseline synthesis condition of 4 mm hf ( so 4 ) 2 , 0 . 2 n hcl and 80 ° c . was first established to give an induction period of approximately 40 minutes . “ control ” tests confirmed that uniform hafnia films could not be obtained by solution deposition onto sam - free , bare silicon wafer surfaces . in contrast , optical quality , mirror - like colorful hafnia films have been grown / deposited onto the sam - coated silicon surfaces . by visual observation of the films , hafnia grew from a gold yellow / brown into a blue color with extended time . afm images of the films obtained under the typical baseline conditions are shown in fig2 a , fig2 b , fig2 c and fig2 d . this is the very first hafnia film that has ever been prepared by the approach of solution deposition on a sam . the film consists of nanoparticles or nanoclusters in the order of magnitude of 10 nanometers , which does not seem to correlate to the large colloidal particle size ( submicrons to microns ) observed in the bulk precipitated solution . from the 3d view of fig2 d , it was estimated that the film surface roughness is less than ± 1 nm . the low roughness explains the mirror - like surface of the film . it is typical to see a few “ large ” colloids adsorbed on the film surface ( for example , the bright spot in fig2 a ). the surface attached particles are much larger than the constitutive nanoparticles in the film , usually loose and can be cleaned off by ultrasonication . a series of single - batch deposition tests were conducted . sulfonate sam - coated silicon wafers ( with surface of interest facing up ) were immersed in solutions of hafnium sulfate at the bottom of the capped flasks . several major process parameters including temperature , concentration of hafnium salt , concentration of hcl acid , and film growth time were studied for their effects on hafnia film thickness growth kinetics , shown in fig3 a , fig3 b , fig3 c and fig3 d . film thickness data was collected by an ellipsometry technique . comparison of the film growth curve of fig3 a and fig3 b shows that with increasing temperature , the film growth rate is increased , particularly in the beginning of the film growth stage ( right after the induction period ). by comparing fig3 a with fig3 c , it can be seen that higher concentration of inorganic salt also results in a higher film growth rate in the initial growth stage . regardless of the concentration and temperature changes , final thicknesses approach around 80 nanometers . comparison between fig3 a and fig3 d indicates that lower hcl acid concentration corresponds to a faster initial film growth rate , however , the final film thickness is thinner . this may be explained by the higher nucleation and nanoparticle formation rate in solutions of lower acidity . more fractions of nanoparticles are consumed for the solid formation in the bulk solution , leaving less fractions of nanoparticles toward film growth . in all cases shown in fig3 a , fig3 b , fig3 c and fig3 d , film growth with time is a nonlinear curve and slows down at longer times , which seems to be due to the gradual depletion of small hafnium ion complexes and / or nanoclusters in the bulk solution phase . in other words , film growth rate is the largest in the early stages immediately after the induction period and this rate decreased with time in the later stage . it was also observed that faster film growth corresponded to faster bulk solution precipitation . therefore , applicant tested a microwave rapid heating process and preliminary studies show that microwave heating is very effective for rapid deposition of thin film on a sam - coated silicon wafer . the film formation occurred on the substrate surface in just a few seconds of microwave heating . tem image of a uniform film cross - section is shown in fig4 and the film thickness determined by the tem (˜ 15 nm ) was agreeable with the ellipsometry measurement . the microstructure of the film consists of homogeneously distributed nanoparticles and crystallinity of the film cannot be observed . it is noted that other parameters such as the ratio of the solution volume over the silicon wafer surface area also affects the film thickness . thus , this volume - to - area ratio was maintained constant through applicant &# 39 ; s studies . effects of the process conditions on surface characteristics of hafnia films were examined by afm . as compared with fig2 c , the surface of a film obtained at a shorter immersion time appears rougher , see fig5 a . higher temperature ( 90 ° c . versus 80 ° c .) and higher hafnium salt concentration ( 10 versus 4 mm hf ) seem to result in rougher film surfaces ( fig5 b and 5 c ) consisting of larger particles , due to higher precipitation , coagulation and deposition rate that tend to lead to loose aggregate structures . at lower acidity ( 0 . 1 versus 0 . 2 n hcl ), the obtained film seems more densely packed with a smoother surface , however , the constitutive primary particles in the film are larger ( fig5 d ). the root - mean - square ( rms ) of the film surface z - distance fluctuation per afm were used as a parameter for roughness analysis . the values of the rms ( thickness ) are measured as 1 . 805 ( 53 . 0 nm ), 1 . 738 ( 75 . 7 nm ) and 1 . 693 ( 83 . 0 nm ), respectively , corresponding to the film obtained by one batch of 4 - hr deposition , two batches of 2 - hr depositions , and four batches of 1 - hr depositions . ( as a control , the rms for a solvent cleaned sam surface is approximately 0 . 365 mm ). in these three film samples , the total immersion time was four hours , and fresh solutions were used in each batch . in a batch deposition , film growth rate ( as well as the hydrolysis / condensation kinetics ) is a function of time , generally high in the beginning and then decreasing with time in the later stage . comparisons of film samples by multiple shorter batch deposition experiments with those by single - batch longer depositions were examined by afm ( fig6 a , fig6 b and fig6 c ), indicating a general trend that multiple depositions produced films with smoother surfaces . based on this observation , it is believed that so - called “ continuous nanocluster supply ” method may minimize the surface roughness and increase the film growth rate . in this method , a stable ( i . e . same size and age ) source of nanoclusters in suspension / sol is continuously flowing over the substrate surface . this avoids formation of large , overgrown particles ( like those produced in the later stage of single - batch bulk precipitation ). thus , during flow - through deposition , the surface of a sam or a later grown film always exposes to the consistent source of uniform , nanosized hafnium clusters / species of the same age , allowing pseudo - steady state deposition . to clarify the film formation mechanism ( i . e ., heterogeneous surface nucleation and growth vs . solid nanoparticle nuclei adsorption / adherence ), two experiments were designed and conducted . in the first experiment , sam - coated wafers were immersed to premade suspensions of nanoparticles ( approximately 10 nm and 40 nm , respectively ) that were adjusted to the level of 0 . 2 n hcl , 80 ° c ., for 6 hours . note that this is the identical condition to what is normally used for film growth from initially clear solutions . after removal from the solution , the wafers were rinsed and sonicated for one minute , and blown dry . it appeared that there were no films formed on the wafer surfaces . this observation supports that colloidal interaction between preexisting nanoparticles ( of 10 nm or greater ) and the sam surfaces is weak under the condition tested , and thus , particle - surface interaction not responsible for the original film deposition . in the second experiment , sam - coated silicon wafers were immersed in the precursor solution ( 4 mm hf ( so 4 ) 2 , 0 . 2 n hcl , 90 ° c ., 4 hr total time ) in four different ways : 1 ) immersed in the starting fresh clear solution , ( 2 ) immersed 10 minutes after the solution turn turbid , ( 3 ) immersed 30 minutes after the solution turn turbid , and ( 4 ) immersed 2 hours after the solution turn turbid . film thicknesses measured by ellipsometry were 70 . 73 , 38 . 43 , 39 . 89 , and 40 . 45 nm , respectively . this result indicates that interaction between in - situ grown nanoparticles and film surface is important and the film thickness gain is mostly contributed by nanoparticle adsorption after the induction period . film thickness increase is also significant around the turbidity point of the bulk solution . based on the above two experimental observations , it is believed that heterogeneous nucleation and in - situ growth of nanoparticles on active surface sites ( e . g ., — so 3 − ) are responsible for the formation of the very initial layer of hafnia film on the sam surface . in fact , the coincidence of initial film formation with the appearance of nanoparticle nucleation at the induction period supports such film formation mechanism . it should be noted that film growth mechanism may be different from the film formation mechanism . once the sam surface was covered with the initial hafnia layer , strong coagulative adherence or adsorption of hafnia nanoparticles / nanoclusters from the bulk solution onto the existing hafnia film surface will take effect as dominant mechanism for the further growth of film thickness . ( this strong interaction between hafnia particles and surfaces , casing rapid colloid growth and colloidal instability in the bulk solutions , is further confirmed by later dynamic light scattering studies of hafnia particle growth and aggregation . hafnia nanoparticles tend to coagulate tightly to each other due to the condition of colloidal instability .) it was further observed that in the beginning of bulk precipitation ( i . e ., immediately after the induction period ), there is nearly no film formation on the sam - coated substrate surface . film thickness increase occurred only after the bulk precipitation and it is a kinetically controlled process . this finding indicates that the early - stage film did not grow rapidly probably due to the slow , continuous nucleation of nanoclusters . film growth depends on the continuous formation of nanoclusters with time , while particle growth and aggregation in bulk solutions occur and also consume some nanoclusters . otherwise , a rapid film deposition immediately after the induction period would be expected . the experimental observations discussed above support that the film formation always co - exists or correlates synergistically with the heat - induced hydrolytic precipitation of solid nanoparticles in bulk solutions . the nanoparticle nucleation , growth and aggregation phenomena in the bulk solution are closely related to the film formation . therefore , saxs , dls and sem are tools that have been used to understand the solid nucleation and particle growth in bulk solutions under the conditions used for film deposition . the process parameters include salt concentration , acidity ( in terms of hcl concentration ), temperature , and immersion / incubation time . saxs results for zirconia film formation show that higher hcl concentration inhibits the nanocluster growth rate in the early stages ( before 100 minutes of incubation ). a higher salt concentration gives a slightly higher nanocluster growth rate . a typical particle solid growth curve monitored by dls for the precipitation in an unstirred cuvette cell ( as shown in fig7 d ) has three stages : ( 1 ) induction period , during which a primary particle ( of a few nanometers in size ) formed by hydrolysis and condensation reactions ; during this period the dls can not detect the appearance of particles when particles are smaller than ˜ 5 nm in size and scattering intensity is less than ˜ 1 kilocounts per second , ( 2 ) particle growth stage , during which there are increases of particle size , mass , and scattering intensity with time , ( 3 ) observed decreases in scattering intensity with time due to sedimentation of large aggregated or agglomerated particles ( so the dls can only “ see ” residual suspended small particles ). it was noticed that changes of averaged effective hydrodynamic diameters of particles in bulk solutions with time follows the same trend as the changes of scattering intensities with time . significant concentration effects on the induction period of solid particle formation ( i . e ., 45 and 15 minutes corresponding to 4 and 10 mm hafnium , respectively ) were found under 0 . 2 n hcl and 80 ° c . film growth conditions ( fig7 d ). in general , with increasing salt concentration , the induction period decreased and the particle growth rate increased . however , such concentration effects are no always true . under other conditions ( such as 0 . 1 n hcl ), the particle growth rate was decreased as the concentration of hafnium sulfate increased from 4 to 10 mm ( fig7 a ). this effect is due to acidic inhibition of the hydrolysis reaction , because the solution of higher salt concentration is expected to be more acidic due to higher sulfate concentration . from fig7 a , fig7 b and fig7 c , it can be seen that higher temperature causes a faster rate of scattering intensity increase with time , indicating a faster formation rate of solid particles . higher acidity ( 0 . 2 n hcl in relative to 0 . 1 n hcl , comparing fig7 d with fig7 b gives a longer induction period and slower scattering intensity increasing rate with time , indicating effect of acid ( hcl ) inhibition to the hydrolysis / condensation and thus solid nucleation rate . further temperature effects are shown in fig8 a , fig8 b , and fig8 c . as the temperature increases , the induction period decreases , and the final particle size and growth rate increase . this temperature effect on size is also supported by sem results as shown in fig9 a and fig9 b . at a certain incubation time , the particles obtained at 90 ° c . are larger in size than those obtained at 80 ° c . the solids from bulk solutions are aggregates and agglomerates of submicrometer , near - round particles that may be assembled from primary nanoparticles . the effect of acidity ( in terms of hcl concentration ) on the particle growth is systematically illustrated in fig1 a , fig1 b , and fig1 c . as the acidity of the solution increases , the hydrolysis reaction and thus the solid particle nucleation / growth are decreased and solid particle formation could be totally inhibited in conditions of high acidity (& gt ; 0 . 2 n hcl ). data for induction periods and initial rate of particle solid growth are summarized in table 1 . * induction periods in minutes and growth rates in nm / minute . particle growth data are shown in parentheses , and film growth rate data are shown in braces . nd = data quality not good enough to determine an acurate rate due to rapid solid formation and aggregation within 1 min in table 1 , the induction period was defined as the time that solid particles ( detectable by dls ) appear in the initially clear solution . the initial growth rate was determined by the slope of the linear section of particle size vs . time data ( before significant agglomeration occurs ). the size was the effective hydrodynamic diameters of solid particles as determined by the dls . for a film - growth condition ( 80 ° c ., 0 . 2 n hcl , 4 mm hf ( so 4 ) 2 ), particle growth and morphology evolution with incubation time were monitored by sem examination of the collected precipitates ( fig1 a and fig1 b ). before 45 minutes , hafnia precipitation did not occur . all particle samples seem agglomerated . in terms of size , particle size generally increases with increasing incubation time ; however , size increase was significant at the early stage . these results are also in agreement with the dls measurements . under the conditions used for film deposition , particles in the bulk solutions tend to aggregate and further form loose agglomerates due to fast coagulation . synthesis conditions need to satisfy certain criteria to produce optimized film , i . e ., reasonably fast film growth kinetics , low film surface roughness , and a final film thickness in the range of 5 to 500 nm . no previous effort has been reported on deposition or growth of hafnia film using a sam - mediated solution deposition approach . solution chemistry and the understanding of hydrolytic condensation processes in solution are important in the controlled formation of solid colloids / particles in solution as well as in the formation of film . for acidic solutions of hafnium sulfate , the following is a schematic description : hf 4 + + hso 4 ! → h + +( hf ( so 4 )) 2 + ( complexation ) the number of h + ions from the hydrolysis reaction is negligible because the hcl concentration is two orders of magnitude larger than the hf ( so 4 ) 2 concentration . there is a strong affinity between hafnium and sulfate . the addition of hcl will inhibit both hydrolysis and complexation reactions . similar to zirconium , hafnium complexes in sulfate solutions may be anionic , polynuclear complexes , hf ( oh ) n ( so 4 ) m x − or ( hf n ( oh ) n + 1 ( so 4 ) 2n ) ( n + 1 )− . hydroxyl groups may replace sulfate groups to form anionic species : 2 ( hf ( so 4 ) 2 ) n + 3nh 2 o → n ( hf 2 ( oh ) 3 ( so 4 ) 4 ) 3 − + 3nh + the complexation capability of sulfate may be a significant factor promoting the growth of solids . further hydrolysis may yield basic sulfate precipitates : ( hf 2 ( oh ) 3 ( so 4 ) 4 ) 3 − + 3oh − → hf 2 ( oh ) 6 so 4 + 3so 4 2 − the hf ( oh ) 3 + species and hafnium sulfate oligomers present in solution may undergo polymerization and condensation to yield hfo 2 . the formation of solid particles of metal hydrous oxides by forced hydrolysis involves the dehydration of hydrated metal cations , which is accelerated by heating the solutions at moderate temperatures (˜& lt ; 100 ° c .). in addition , anion sulfate complexation with the hydrated metal cations will change the behavior of hydrolysis and condensation , as well as the characteristics ( composition and / or morphology ) of the particles precipitated by forced hydrolysis . ocana et al . reported that the kinetics of hydrous hafnia precipitation is retarded in the presence of sulfate anions . sulfate in solutions not only strongly complexes with hafnium but also is a potential bridging ligand and promotes polymerization . in addition , it has been demonstrated in the literature that sulfate ions can be incorporated to form basic salts of well - defined stoichiometry or amorphous compounds of varying composition . therefore , instead of hydrolyzed hafnia , sulfate is incorporated into the films and into the solid particle precipitates in bulk solutions . under film deposition conditions used in applicant &# 39 ; s present invention , solutions containing hafnium ( iv ) cations have a strong tendency to turn cloudy due to hydrolytic precipitate formation . in addition , higher rates of solid formation correspond to higher metal sulfate salt concentration and higher temperatures . an increase in hydrochloric acid ( hcl ) concentration slows or even inhibits solid particle formation and growth . it appears that hafnia film formation requires supersaturation conditions , i . e ., the product of the concentrations of metal and hydroxyl must exceed the solubility product of the formed solid . hydrolysis and condensation kinetics of the dissolved hafnium species seem to be proportional to the film growth rate . this is particularly true in the beginning stage of film growth . process conditions such as higher temperature , higher initial hafnium concentration in solution , and lower hcl concentration clearly correspond to a higher degree of supersaturation and a higher hydrolysis / condensation rate , which in turn , as shown in fig3 , leads to a faster film growth rate . it is reasonable to see that higher temperatures ( 90 ° c . vs . 80 ° c .) change only the film growth rate , not the final film thickness (˜ 80 nm in both temperature conditions ). when the hafnium sulfate concentration changes from 4 and 10 mm , however , a final thicker film at higher concentration conditions was not seen . possibly the system has not reached true equilibrium , or the equilibrium film thickness is not sensitive to the initial hf ( so 4 ) 2 concentration for the range of concentration tested . under conditions of rapid formation of solid particles in bulk solutions , reactants ( i . e ., hafnium ionic species ) are depleted quickly . this explains why the film growth rate is faster at the beginning stage and slows down with time ( fig3 ). however , in the presence of significant precipitation in solutions , the increase in final film thickness is not usually proportional to the increase in starting salt concentration . this is because at a higher salt concentration , solid particle growth / aggregation in the bulk solution competes with film deposition for the consumption of solid nanoparticles or nuclei , and more fractions of solid nanoparticles are consumed for the aggregative growth of submicron particles , since nanparticle - nanoparticle interaction is stronger than the nanoparticle - surface ( hafnia ) interaction . comparison of fig3 a and 3 d also shows that a higher hydrolytic precipitation rate ( at a lower acid concentration ) may cause faster early - stage film growth but does not guarantee growth of thicker film . therefore , there should be an optimal condition that controls the hydrolysis / condensation kinetics and solid particle precipitation in solution phase to maximize the fraction of the “ reactant ” ( i . e ., metal ions and solid nuclei / nanoparticles ) that could be utilized toward increasing film thickness , rather than increasing the solid mass in the bulk solution . in principle , control of the homogeneous precipitation level in solutions also affects the film properties ( surface smoothness , nanocluster size in film , uniformity across film , and film density ). for example , higher solution hydrolysis kinetics led to smoother film with larger constitutive nanoparticles ( fig5 d relative to fig5 a ). in addition to their role in solution chemistry and solid - forming reactions , substrates can play a crucial role in film formation , either by heterogeneous nucleation / growth of solids on the substrate surface or by attracting ( adhering or adsorbing ) solid nanoparticles onto the substrate or film surface . functionalization of the substrate surface with sams is a way of inducing heterogeneous nucleation and growth or promoting surface adherence of initial oxide nanoparticle layer on active sites ( such as sulfonate so 3 − ) of the sam surface and thus enhancing the uniformity of film deposition . understanding the film formation and growth mechanisms can assist in tailoring film deposition process conditions ( and solution / colloidal chemistry of deposition media ) to optimize microstructure or nanostructure in film . there are generally two pathways for film formation or growth : ( a ) ion - by - ion growth , i . e ., heterogeneous nucleation that occurs at the sam surface or a the surface of oxide film that has already grown , followed by further growth of solid nuclei on the surface ; and ( b ) cluster growth , i . e ., first homogeneous nucleation of nanoparticles occurs in the bulk solution phase and then small nanoparticles adhere to the surface of the sams and the surface of oxide films . these two mechanisms ( simply put , ion deposition or nanocluster deposition ) sometimes could occur simultaneously . the selection of film deposition conditions can govern film formation and growth mechanisms . generally speaking , the level of supersaturation and the net solution - particle interfacial energy are key parameters in tuning the mechanisms : at low levels of supersaturation , only a few surfaces induce heterogeneous nucleation , while at high levels of supersaturation , nucleation occurs on most surfaces independently of the solution - particle interfacial energy , and growth kinetics are enhanced . the observation of epitaxial growth ( i . e ., slow , possibly oriented growth of larger particles with larger particle size distribution ) typically presents strong evidence for an ion - by - ion mechanism . on the other hand , homogeneous nucleation results in rapid unoriented growth with narrow particle size distributions in films . in applicant &# 39 ; s present invention , it is pointed out that the mechanism for initial oxide layer formation on sam surface may not be the same as the mechanism for the further growth of the film thickness while the oxide surface exposed to the solution . for hafnia systems , applicant &# 39 ; s results seem to support heterogeneous nucleation and growth of the very first layer of hafnia at active sites of the sam surface . further , some insight into the hafnia film growth mechanism may be obtained by looking at the film surface morphology ( fig2 , fig5 , and fig6 ) as well as the film microstructure ( fig4 ), and by correlating applicant &# 39 ; s experimental results between particle growth in solutions ( fig7 , fig8 and fig1 ) and film growth on substrate surfaces ( fig3 ). like zirconia film , the hafnia film show unoriented microstructure ( fig4 ) with a surface morphology of randomly distributed , uniform nanoclusters ( fig2 , fig5 and fig6 ). in all cases , faster film growth corresponds to faster particle growth in bulk solutions . there is no film formation until solution turns turbid due to solid particle nucleation . also , films can still grow when substrates are placed in the turbid solution after the induction period , indicating that gradual nucleation occurs through the whole deposition process . all these observations tend to conclude that in the conditions studied by applicant , hafnia films grow thicker mainly by a homogeneous nucleation and cluster - growth mechanism . at a stage after the induction period , the bulk amount of solid colloidal particles ( submicrometer - size spheroids and their aggregates , as shown in fig9 and fig1 a , 11 b ) is very different from the constituent nanoparticles in the films ( fig2 , fig5 , and fig6 ). these observations indicate that at the initial nucleation and growth stage , only nanoparticles of a certain small size (& lt ; 10 nm ) have the affinity to bind to the substrate surface ( i . e ., the surface of sam or the surface of already grown oxide film ). this observation is in agreement with earlier reported findings that once the diameters of the colloid particles exceed ˜ 10 nm , the forces that would bind them to the growing film become negligibly small . the driving force for film growth , i . e ., attractive interactions between the substrate surface and nanoparticles ( or nanoclusters ) in the bulk solution , could be described by a coagulation model based on the classical dlvo theory which considers a long - range van der waals interaction force , an electrostatic force , and a short - range born repulsive force . nanoparticle size in the film depends on synthesis conditions and is generally larger when there are faster hydrolysis / condensation conditions ( i . e ., higher salt concentration , higher temperature , lower hcl concentration ), see fig6 . the large colloidal particles present in the bulk solution at longer reaction times are essentially “ inert ” ( although there is incidental adsorption to the film surface ) and thus do not contribute to the growth of the film thickness . experimental results of zirconia film formation show that after the induction period there is still a continuous evolution or nucleation of the transient , metastable “ binding nanoclusters ”, which can either contribute to the film deposition or be consumed by aggregation toward solid particle formation in the bulk solutions . this is supported by the fact that film deposition / growth still occurred when a wafer was immersed in a turbid heated solution long after the induction period . these binding nanoclusters , although short - lived or unstable due to further growth or aggregation with larger colloids in solution , do have a chance to bind or adhere to the substrate surface . such nanocluster evolution was eventually depleted in the later stage of a single batch deposition process , which may explain the data of film growth rate decay with time ( fig3 ). this hypothesis on gradual depletion of nucleation is also supported by applicant &# 39 ; s film thickness data ( with fig6 showing film surfaces ): 82 . 99 nm ( for four 1 hour depositions )& gt ; 75 . 71 nm ( for two 2 - hr depositions )& gt ; 52 . 97 nm ( for one 4 - hr deposition ). this means that faster and more nucleation is preferred for a faster and thicker film growth . the initial growth rates of films ( fig3 and numbers in braces in table 1 ) are almost one order of magnitude less than the initial growth stage of particles in solutions ( numbers in parentheses in table 1 ). such discrepancy in growth rates may be explained in the way : film growth may be mainly due to the aggregation ( or adherence ) between ( nanoparticles ) b and ( nanoparticles ) f , where ( nanoparticles ) b refer to the nanoparticles / nuclei in the bulk solutions and ( nanoparticles ) f to the nanoparticles that are already on the film surface . on the other hand , applicant &# 39 ; s initial particle size increase vs . time data by dls may have included not only the contribution from aggregations of primary nanoparticles / nuclei into the submicron - sized spheroid particles , but also the ion - by - ion growth of primary nanoparticles and the agglomeration of secondary spheroid particles and their aggregates . applicant &# 39 ; s experimental data and observation sufficiently support that nanocluster growth ( homogeneous nucleation ) is dominant mechanism for hafnia film growth because during the period of film growth , it was observed by saxs and dls the continued availability of nanoclusters in bulk solutions . the observation of bulk precipitation is a delayed indicator for homogeneous nucleation . however , this does not necessarily exclude the possibility of ion - by - ion growth ( heterogeneous nucleation ) of nanoclusters / nanoparticles in the already grown film or the continued ion - by - ion growth of the already - adhered particles . the nonporous nature of the films may be attributed in part to the fact that the attached nanoclusters on the substrate surface may continue to grow from the ions in bulk solution and in residual pockets of solution between nanoclusters after attaching in the film . to optimize the film , it is advantageous to select conditions that generate a stable supply of small nanoclusters ( typically & lt ; 10 μm ) in solution during film deposition , preventing the possible physisorption ( weak bonding ) of micron - scale colloids to the film and leading to smoother surfaces and fewer pinhole defects . negatively charged metal ionic complexes , such as ( hf 2 ( oh ) 3 ( so 4 ) 4 ) 3 − , can deposit on the negatively charged surface of deprotonated sulfonate sam possibly because of chemical bond formation due to ligand exchange , i . e ., the sulfonic groups of the sam may replace sulfates in the nanocluster complexes . a direct influence of the sam on film deposition ( via electrostatic and van der waals interaction between the sam and the nanoclusters ) would diminish as the film grow thicker . in a successful biomimetic synthesis of films , heterogeneous nucleation should be promoted and homogeneous nucleation ( or particle growth in bulk solution ) should be suppressed . also , it is known that film preparation in a deposition medium with homogeneous nucleation followed by precipitation is disadvantageous because it leads to defects ( i . e ., physisorbed or trapped large colloids ) in the film . multiple deposition using early - stage solution conditions prevents the formation of relatively large particles in bulk solution and their adsorption on the surface of a growing oxide film . applicant &# 39 ; s multiple deposition experiments have led to a “ liquid flow deposition ” embodiment , in which the “ reactants ” ( i . e ., dissolved metal ions or “ binding nanoclusters ”) of the same age are replenished continuously in a pseudo - steady state , potentially avoiding the depletion of reactants that cause growth to slow down or cease in batch solutions and also avoiding the undesirable formation and physisorption of large particles . it has been suggested by others that the rate of flow of the deposition medium past the substrate can be an additional and easily controlled variable ( to match the average residence time with the time needed to nucleate and grow “ binding nanoparticles ”), besides temperature , acidity , and solution composition . while there has been shown and described what are at present considered the preferred embodiments of the invention , it will be obvious to those skilled in the art that various changes and modifications can be made therein without departing from the scope of the invention defined by the appended claims .

US-91389604-A

a gripper system having a pair of jaws operable in a first plane and having a central closure axis ; each jaw including a finger member and finger tip member disposed on its distal end ; and a gripper drive assembly for moving the jaws toward and away from each other ; each finger member having a shaped inner contour for accommodating an object to be gripped ; each finger tip member including an inner surface which generally aligns with the shaped inner contour for gripping a range of larger objects and an outer surface which generally aligns with the gripper central closure axis upon closure for gripping a range of smaller objects . alternatively , each finger tip member may include a forcep element extending transversely to said plane .

aside from the preferred embodiment or embodiments disclosed below , this invention is capable of other embodiments and of being practiced or being carried out in various ways . thus , it is to be understood that the invention is not limited in its application to the details of construction and the arrangements of components set forth in the following description or illustrated in the drawings . if only one embodiment is described herein , the claims hereof are not to be limited to that embodiment . moreover , the claims hereof are not to be read restrictively unless there is clear and convincing evidence manifesting a certain exclusion , restriction , or disclaimer . fig1 shows a mobile , remotely controlled robot 10 driven by tracks 12 a and 12 b in accordance with one particular example of a robot in accordance with the subject invention . robot 10 includes deployable mast 14 , camera 16 , light 18 , antennas 20 a and 20 b , and arm assembly 22 . arm assembly 22 includes lower arm 24 and upper arm 26 . lower arm 24 is able to pitch up and down but it does not turn . upper arm 26 pitches with respect to lower arm 24 and is driven by chain drive 28 extending along lower arm 24 . microphone 30 is on upper arm 26 as is end effector 32 which rotates via wrist 34 . camera 36 is typically aimed at end effector 32 . operator control unit 40 is used to wirelessly control robot 10 as is known in the art . the various images captured by the cameras of the robot may be displayed on view screen 41 . end effector 32 , fig1 , may be replaced by an improved gripper system according to this invention , such as gripper system 40 , fig2 . gripper system 40 includes two jaws 42 , 44 , each including a finger member , 46 , 48 , and fingertip member 50 , 52 , respectively . each finger member 46 , 48 is formed of a pair of spaced arms 54 , 56 , and 58 , 60 , respectively , which are spaced apart and fixed together by spacers 62 , 64 , and 66 , 68 , respectively . this makes finger members 46 , 48 , strong but extremely light . for further weight reduction finger tip members 50 , 52 may have hollowed out portions as shown at 89 on finger tip member 52 . at the proximal end of each arm 54 , 56 , 58 and 60 are rectangular holes 70 which engage with shouldered portions 72 of drive shafts 74 of gripper drive assembly 75 and may be held in place by screws 76 . each finger tip member 52 is fastened at pins 78 , 80 to the distal ends of arms 54 , 56 and 58 and 60 , respectively . each finger tip member has an inner surface 82 , 84 and an outer surface 86 and 88 . jaws 46 and 48 , fig3 , have a shaped inner contour 90 , 92 for accommodating an object to be gripped , such as object 94 . inner contours 90 , 92 may be fair curves or other shapes or as shown in fig3 they may be circular arcs centered at point 96 at the center of the largest object 94 sough to be gripped . fingertip members 50 , 52 may have their inner surfaces 82 , 84 formed as a curved surface as shown in phantom at 98 or they may , for example , be a dihedral surface defined by dihedral angle 100 which defines two sections 102 and 104 . note that dihedral angles 100 may have their apices aligned with pivot pins 78 , 80 , which may be on a diameter 150 of center 96 . outer surfaces 86 and 88 may also be a curved surface as indicated at 106 or may also be a dihedral as indicated by dihedral angle 108 which defines dihedral sections 110 and 112 . gripper drive assembly 75 drives jaws 42 , 44 to open and close in the directions indicated by arrows 114 and 116 in the plane of operation 118 which may be defined by the plane of the paper . preferably whatever their shape inner surfaces 82 , 84 generally track along with the shapes 90 , 92 or are generally tangential to the object 94 . in fig3 gripper system 40 has its jaws 42 , 44 open for gripping at 66 °. in contrast in fig4 , gripper system 40 has its jaws 42 , 44 closed so that the outer surfaces 86 and 80 of finger tip members 50 , 52 meet at the gripper central axis 120 illustrating the facility for gripping very small objects as well . fig5 is an exploded view of jaw 42 including finger member 46 and finger tip member 50 . the spacers 62 and 64 that hold arms 54 and 56 together actually include spacer sleeves 130 , 132 and mounting screws 134 , 136 and 138 and 140 , respectively . a stop mechanism 141 may include spacer 132 slightly reduced in diameter and a recess 142 which is larger than the diameter of spacer member 132 and pin 78 may be a pivot pin , which pivots and holds 144 and 146 of arms 54 and 56 , respectively . in this way , finger tip member 50 and finger tip member 52 as well may rock slightly to make a more universally compliant surface for gripping a range of large and small objects . spacer 132 thus functions as a stop and recess 142 is in the nature of a fork . the positions of these items , stop and fork , could be switched so that the stop is on finger tip member 50 , 52 and the fork on finger members 46 , 48 . other implementations of stop mechanisms 141 may use other combinations . if it is desired that finger tip members 50 , 52 be not pivotable then recess 142 and spacer bar member 132 will be closely dimensioned to prevent any rotation about pin 78 . pin 78 may be preferably located on a diameter 150 , fig3 , of the largest object 94 anticipated for gripping but it need not be so positioned . referring again to fig5 , the one or both finger tip members 50 , 52 may be provided with serrations , or some sort of improved gripping surface as indicated at 152 . at times it is necessary and desirable to use the finger tip members 50 , 52 to dip into a confined space , for example , an electronic component housing to pull out a wire or two for clipping or other manipulation . presently , in order to accomplish this either the entire upper arm 26 has to be moved in the pitch axis , fig1 , or perhaps gripper system 32 has to be moved in the pitch axis in order to accommodate such tasks . in order to avoid this the finger tip members 50 a , 52 a , may be provided with forcep elements 160 , 162 , fig6 , which extend transversely to the plane of operation , see plane 118 , fig3 , to grip such items with a minimum of pitch rotation required . the forcep elements need not be accompanied by the inner surface and outer surface constructions as shown in fig6 , for as shown in fig7 finger tip members 50 b , 52 b , may have forcep elements 160 b , and 162 b without those outer and inner surfaces shown in fig6 . gripper drive assembly 75 , fig8 , includes housing 180 with cover 182 secured by screws 184 and a collar 186 . worm drive shaft 187 passes through collar 186 to engage worm 188 . worm 188 drives worm gears 190 , 192 which are held on shafts 74 by “ c ” rings 194 and keyed to rotate with shafts 74 by means of key ways 195 on worm gears 192 , 194 which engage with keys 197 on shafts 74 . the facility of gripper system 40 according to this invention to grasp a large range of different size objects and different shaped objects is shown in fig9 a - f and 10 a - f . fig9 a - f show a sequence of applications of gripper system 40 to smaller and smaller circular objects , starting with , for example , a five inch diameter circular object 200 and decreasing through four inch diameter object 202 , three inch diameter object 204 , two inch diameter object 206 , one inch diameter object 208 and a half inch diameter 210 . note that in fig9 a and 9b the object is gripped by the inner surfaces 82 , 84 . in fig9 c and 9d the object is gripped by the inner contours 90 , 92 and in fig9 e and 9f the object is gripped by the outer surfaces 86 , 88 . when the object is a rectangular body , such as shown in fig1 a - f the same transition from gripping with the inner surfaces 82 , 84 in fig1 a and 10b to the gripping by contours 90 , and 92 but in conjunction with outer surfaces 82 , and 84 , in fig1 c and 10d , and with the outer surfaces 86 , 88 in fig1 e and 10f . in this way the improved gripper system according to this invention accommodates not only objects of a wide variety of sizes but also of many different shapes . although specific features of the invention are shown in some drawings and not in others , this is for convenience only as each feature may be combined with any or all of the other features in accordance with the invention . the words “ including ”, “ comprising ”, “ having ”, and “ with ” as used herein are to be interpreted broadly and comprehensively and are not limited to any physical interconnection . moreover , any embodiments disclosed in the subject application are not to be taken as the only possible embodiments . in addition , any amendment presented during the prosecution of the patent application for this patent is not a disclaimer of any claim element presented in the application as filed : those skilled in the art cannot reasonably be expected to draft a claim that would literally encompass all possible equivalents , many equivalents will be unforeseeable at the time of the amendment and are beyond a fair interpretation of what is to be surrendered ( if anything ), the rationale underlying the amendment may bear no more than a tangential relation to many equivalents , and / or there are many other reasons the applicant can not be expected to describe certain insubstantial substitutes for any claim element amended . other embodiments will occur to those skilled in the art and are within the following claims .

US-31774008-A

a method and device for optical teledetection of compounds in a medium includes a detection measurement carried out by emitting into the medium , short pulses of light at least 3 nm wide , and detecting a part of the light back - scattered by the medium by means of a detection unit with temporal resolution . a reference measurement in which the light emitted or the light back - scattered is filtered by virtue of addressable filters , simulating the optical spectrum of the light at the working wavelengths of at least one given compound to be searched for . a comparison of the detection and reference measurements is made to deduce therefrom the possible presence of the compound or compound searched for in the medium . the addressable filters are modified dynamically , and a series of reference measurements and corresponding comparisons are performed for a series of various compounds liable to be present in the medium .

within the scope of the invention , pulses covering a large band of wavelengths are used , which will allow determination of the possible presence of wide range of compounds . the pulses preferably have a width of at least 3 nm , preferably at least 10 nm . preferably these pulses are white light pulses . conventionally , by white light is meant a continuous polychromatic light signal covering a spectrum of wavelengths of at least 100 nm in width . as examples of white light sources , mention may be made of arc lamps , incandescent lamps , or any other analogous device . according to an alternative embodiment , the detection light source and the reference light source comprise a laser delivering light pulses , for which the wavelength spectrum is widened . it is generally possible to use a laser diode . for example , in the case of a monochromatic laser delivering intense pulses , notably with a power above 3 gw , phase self - modulation occurs in the atmosphere according to the principle of the self - guided filament ( j . kasparian et al ., science , 2003 , 301 , 61 ). this filament is produced when ultra - short and high power pulses typically of more than 3 gw in air , modify the refractive index of air on their path , this change in refractive index leading in return to self - focusing and to guiding of the beam on a light filament . a spontaneous widening of the spectrum of wavelengths and of white light pulses from a laser source with intense pulses is thereby obtained . in this case , the light source does not directly deliver white light pulses but monochromatic pulses , which become polychromatic during their propagation , and this before reaching the medium of interest . the white light source may also be an intense laser , the wavelength spectrum of which is widened , for example by phase self - modulation or by the raman effect in a cell such as a gas , water cell or a cell of any other non - linear medium . in this case , the cell may be directly placed at the output of the laser . as an intense laser , mention may be made of solid lasers of the nd : yag type . according to an alternative embodiment , the detection light source and the reference light source deliver pulses with a duration from 20 fs to 10 ps , preferably from 100 fs to 300 fs , and preferably , with a power from 3 gw to 100 tw , preferably from 0 . 5 tw to 5 tw . the detection light source and the reference light source have the same characteristics , in terms of pulse duration , power and spectral range . the detection light source may be distinct from the reference light source . it is also possible that the detection measurement ( s ) and the reference measurement ( s ) be conducted with a single light source , the detection measurement being then conducted without any filtering . in this case , the filtering means may be modified sequentially and rapidly , in order to alternate the detection measurements and the reference measurements , and thus to get rid of errors due to possible fluctuations of the level of the light source and / or of the medium . generally , it is preferable to conduct a new detection measurement for each reference measurement , for example by alternating or conducting simultaneously detection and reference measurements as detailed hereafter , in order to carry out the comparison between two measurements conducted closely in time . the device may then include control means providing alternation of the detection measurement and reference measurement . however , it is not excluded that different reference measurements should be compared with a same detection measurement or else that a new detection measurement used for the comparison should be conducted periodically after a series of reference measurements . the addressable filtering means may comprise an optical spatial phase and / or amplitude modulator , or a reflective or interferential microelectronic system or any other analogous device . the filtering means simulate the optical spectrum of the light at the working wavelengths of at least one given compound . the filtering means are periodically modified automatically so as to successively simulate for different compounds their optical light spectrum at their working wavelengths . in the sense of the invention , when filtering occurs on the emitted light , the optical spectrum of the light at the working wavelengths corresponds to the optical spectrum of the light emitted at the wavelengths which are weakly absorbed or preferably at the wavelengths which are strongly absorbed by one or more given compounds . by weakly absorbed wavelengths , are notably meant , wavelengths for which , for a given compound , an attenuation of at most 10 % of the light intensity , is observed over the whole of the path covered by the light , during the measurement . by strongly absorbed wavelengths , are notably meant wavelengths for which , for a given compound , an attenuation of at least 30 % of the light intensity is observed over the whole of the path covered by the light during the measurement . it is possible that the reference and detection measurements be conducted so as to detect linear or non - linear phenomena . in the case of linear phenomena , there is coincidence between the emitted wavelength in the medium and the back - scattered wavelength . on the other hand , in the case of non - linear phenomena , notably observed in the case of intense pulses , for example with a power of more than 1 gw , modification of the back - scattered wavelength relatively to the emitted wavelength is observed . when filtering occurs on the back - scattered light , there again , in the case of measuring linear phenomena , the optical light spectrum at the working wavelengths may correspond to the spectrum of the back - scattered light at wavelengths which are weakly absorbed or preferably at wavelengths which are strongly absorbed by one or more given compounds to be sought . on the other hand , in the case when non - linear phenomena are detected , the spectrum of the back - scattered light at the working wavelengths corresponds to the spectrum of the back - scattered light at the wavelengths back - scattered by the sought compound which differs from the spectrum of the light emitted at wavelengths which are weakly or strongly absorbed by the sought compound . given that the reference measurement only corresponds to the light signal which is back - scattered at the wavelengths which are weakly or strongly absorbed by one or more given compounds , it is possible to increase the power of the emitted light corresponding to these wavelengths over the medium , in order to increase the sensitivity of the system . as the power of the back - scattered light is limited , it is easier to observe the eye safety standards . the filtering means are modified automatically in order to successively simulate the spectra at working wavelengths of a series of different compounds . the filtering means may for example include different filters positioned on a filter holder . motorized displacement means of the filters ensure selection of the desired filter . it is also possible , and this in a preferred way , that the different spectra characteristic of the compounds be stored in a spectroscopic database , to which are connected the filtering means through control means . it is also possible that the filtering means be adapted for simulating certain conditions such as temperature , pressure , speed , direction of the wind , possessed by the medium into which the pulses are emitted . within the scope of the invention , a detection unit comprises means for detecting at least one portion of the back - scattered photons . collecting means , such as a telescope , may be positioned in front of the detection means . with these collecting means , it is notably possible to increase the signal detected by the detection means from the back - scattered light . the detection means are generally associated with acquisition and processing means which acquire and utilize the signals delivered by the detection means . for example , the received photons are converted into photoelectrons , the corresponding electric signal is in direct relationship with absorption of the radiation and with the gas molecules to be analyzed , by applying the beer - lambert law . given that the emitted light is in the form of pulses and that the detection means detect the signal as a function of time , it is possible to determine at which distance is found the medium which back - scatters the detected photons . it is then possible to calculate the distribution of the concentrations along the shooting axis of the light source , up to a limit defined as being the range of the source . as detection means adapted for applying the invention , mention may be made of photomultipliers , photodiodes or any other analogous device . the detection means used with temporal resolution , allow the evolution of the detected signal to be recorded over time . preferably , the temporal resolution of the detection means if very fine , for example of less than 10 ns . as stated earlier , the detection means integrate means for spatially resolving the signal with which it is possible to determine at which distance is located the medium which backscatters the detected light . spatial resolution is obtained by means of the temporal resolution of the detection means . the detected signal may thus be correlated with the emission distance of the medium which emits it . preferably , the spatial resolution of the detection means is less than 1 meter . the acquisition of the signal is most often carried out over a reduced period of time . at the detection unit , it is possible to select the means for processing the signal , so as to modulate the processing of the signal . for example , the signal obtained during reference measurements , may be adjusted and / or optimized by a closed loop algorithm so as to be adapted to the measured concentration at the previous iteration . adaptation of the transmission for each wavelength section or spectral component , may thus be modulated independently , via a multi - parameter optimization algorithm , such as a genetic algorithm in which the optimum solution , i . e . the synthetic spectrum which is the closest to the species to be detected , is obtained by trial and error , the attempts giving a favorable result being combined in order to produce the optimum solutions ( cf . t . back , h . schwefel , an overview of evolutionary algorithms for parameter optimization , evolutionary computing 1 , 1 ( 1993 ) and r . s . judson and h . rabitz , teaching lasers to control molecules , physical review letters , 68 , 1500 ( 1992 )). it is possible that the detection and reference measurements be conducted with a single detection unit or with two distinct detection units . advantageously , the measurements and the comparison are carried out so as to determine the concentration of the detected present compound . for this , the comparison is carried out with processing means and means for computing the concentration of the detected compound which for example , apply algorithms analogous to those used in lidar or dial techniques or in correlation spectroscopy . for example , the computation methods used are derived from those used for the dial technique ( differential absorption lidar , see for example r . m . measures , laser remote sensing — fundamentals and applications , 1984 , new york : wiley interscience ). if a species or a compound is considered for which the absorption cross - section integrated over the light spectrum of the reference source is σ r , and the absorption cross - section integrated over the light spectrum of the measuring source is σ m , then the concentration ( expressed in molecules per unit volume ) of this species at a distance z is : n ⁡ ( z ) = 1 2 · ( σ m - σ r ) · ⅆ ⅆ z ⁢ ( ln ⁡ ( s r s m ) ) wherein s m ( z ) and s r ( z ) respectively represent the signal measured on the measurement and reference detector respectively . in the case when the comparison is carried out between total light and the weakly absorbed wavelengths , or between the strongly absorbed wavelengths and the weakly absorbed wavelengths , this formula may be directly applied . in the case when the comparison is carried out between the total light s m and the weakly absorbed wavelength s r , the cross - sections σ r and σ m are practically equal . in order to ensure mathematical stability of the method , the auxiliary value s ′ m = s m − s r , will then be used , for which the absorption cross - section is σ ′ r = σ m − σ r ≈ 0 . the concentration of the sought species is then in the case when the filtering means simulate the light spectrum at the working wavelengths of several compounds of interest simultaneously , the calculation of the mixture ratios may be carried out by a closed loop optimization or by any analogous algorithm . according to a first alternative , the addressable filtering means are placed between the light source used for the reference measurement and the medium , so as to filter the emitted light during the reference measurement . the filtering means for example comprise an optical spatial phase and / or amplitude modulator or a reflective or interferential microelectronic system . according to a second alternative , the addressable filtering means are placed between the medium and the detection means used for the reference measurement , so as to filter the back - scattered light , during the reference measurement . in order to carry out such filtering , the filtering means notably comprise means with which the wavelengths which are strongly absorbed by compound ( s ) to be detected may be oriented towards a detection unit and the wavelengths which are weakly absorbed by the compound ( s ) to be detected may be oriented towards another detection unit , the detection and reference measurements then be carried out simultaneously . the first alternative of the invention above is notably illustrated in fig1 . the device i comprises a single light source 1 used for the detection measurement ( s ) and the reference measurements . filtering means 2 are placed at the output of the light source 1 , between the light source used for the reference measurement and the gas medium in order to filter the emitted light during the reference measurement . during a reference measurement , these filtering means 2 filter the light emitted by the source 1 , in order to allow emission of only certain wavelengths which correspond to the wavelengths strongly absorbed by one or more compounds to be detected . during a detection measurement , the filtering means are disabled . the emitted light 3 in the form of short pulses propagates towards the gas medium 4 of interest . a portion of the back - scattered light 5 is detected by a detection unit 6 including detection means with temporal resolution . the intensity difference between detection measurement conducted in the absence of filtering and the reference measurement conducted with filtering is directly proportional to the concentration of the sought compound ( s ). according to an alternative operation , the filtering means allow emission not of strongly absorbed wavelengths but of weakly absorbed wavelengths towards the medium . such an alternative embodiment in which the filtering means are positioned upstream from the gas medium allows a reduction in the power of the emitted light which is then reduced to the wavelengths for which back - scattering is observed with the compound of interest . in this case , it is easier to observe the standards of eye safety . the second alternative of the invention mentioned earlier is , for example illustrated in fig2 . the device ii comprises a single light source 11 used for the detection measurement ( s ) and the reference measurements . the light 12 as short pulses emitted by the light source 11 propagates towards the gas medium 13 of interest . a portion of the back - scattered light 14 is detected by a detection unit 15 including detection means with temporal resolution , upstream from which filtering means 16 are placed . during a reference measurement , these filtering means 16 filter the light back - scattered by the gas medium 13 , so that only certain wavelengths , which correspond to the strongly ( or weakly ) absorbed wavelengths by one or more compounds to be detected , are directed towards the detection unit 15 . during a detection measurement , the filtering means are disabled . the intensity difference between the detection measurement conducted in the absence of filtering and the reference measurement conducted with filtering is directly proportional to the concentration of the sought compound ( s ). in this alternative , the filtering means only receive the light back - scattered by the medium and not the totality of the light emitted by the reference light source . therefore the risks of aging or deterioration of the filter are reduced . fig3 illustrates another alternative in which the addressable filtering means are placed between the gas medium and the detection unit used for the reference measurement and the detection measurement , so as to filter the back - scattered light , upon simultaneous taking of the reference measurement and of the detection measurement . in fig3 , the device iii comprises a single light source 111 used for the detection measurement ( s ) and the reference measurements . the light 112 as short pulses emitted by the light source 111 propagates towards the gas medium 113 of interest . a portion of the back - scattered light 114 is filtered by filtering means 115 placed downstream from the gas medium 113 which comprise means for orienting the wavelengths strongly absorbed by the compound ( s ) to be detected towards a detection unit and orienting the wavelengths weakly absorbed by the compound ( s ) to be detected towards another detection unit . in fig3 , the filtering means 115 comprise light dispersion means 116 such as a prism and means 117 for reflecting the obtained dispersed light which orient the light beam , depending on its wavelength , towards either one of the detection units 118 and 119 . the filtering means 115 have been voluntarily illustrated at a large scale in order to facilitate understanding . in reality , the detection means are located at a distance from the medium of interest which may attain several kilometers . the reflection means 117 may be a micro - electromechanical device such as a network of micro - mirrors mounted on piezo - electric actuators , or any other reflective device , each element of which may be oriented independently and rapidly with a control signal . the detection unit 118 receives the wavelengths which are weakly absorbed by the compound to be measured and allows the detection ( or reference ) measurement to be conducted . the detection unit 119 receives the wavelengths strongly absorbed by the compound to be measured and allows the reference ( or detection respectively ) measurement to be conducted . according to calculation techniques used in the dial differential absorption techniques , it is possible to measure the concentration of the compound of interest . thus , the reference and detection measurements are conducted simultaneously , with which it is possible to get rid of the fluctuations which may occur in the medium between two successive measurements . in this case , the reference measurement and the detection measurement are conducted simultaneously . the detection measurement for example corresponds to the measurement conducted with the detection means which receive the wavelengths which are weakly absorbed ( called λ off ) by the gas compound ( s ) to be detected and the reference measurement corresponds to the one conducted with the detection means which receive the wavelengths which are strongly absorbed ( called λ on ) by the gas compound ( s ) to be detected , or vice versa . the calculation methods with which it is possible to obtain the concentration of the gas compound to be detected are well - known to one skilled in the art , and notably correspond to those used in the dial differential absorption technique . the device iv described in fig4 comprises two light sources 211 and 212 , one used for the detection measurements and the other one for reference measurements . the light 213 alternately emitted by each of these sources , 211 and 212 respectively , follow the same path , the direction of the light beam being modified by means of a device 214 including means for changing the propagation path of the light . such a device 214 for example appears as a mobile mirror , the orientation of which is alternately modified depending on the light source from which originates the light . at the output of the device 214 , the path of the light emitted by the light source 211 coincides with that of the light emitted by the source 212 , so that regardless of the light source , the emitted light 213 propagates towards the gas medium 215 of interest , along the same path . a portion of the back - scattered light 216 is detected by a detection unit 217 including detection means with temporal resolution , upstream from which filtering means 218 are placed . during a reference measurement , the filtering means 218 filter light back - scattered by the gas medium 215 , so that only certain wavelengths , which correspond to the wavelengths strongly ( or weakly ) absorbed by one or more compounds to be detected , are directed towards the detection unit 217 . during a detection measurement , the filtering means are disabled . the intensity difference between the detection measurement conducted in the absence of filtering , and the reference measurement conducted with filtering is directly proportional to the concentration of the sought compound ( s ).

US-60224508-A

a diffraction grating coupled infrared photodetector for providing high performance detection of infrared radiation is described . the photodetector includes a three - dimensional diffractive resonant optical cavity formed by a diffraction grating that resonates over a range of infrared radiation wavelengths . by placing a limited number of p / n junctions throughout the photodetector , the photodetector thermal noise is reduced due to the reduction in junction area . by retaining signal response and reducing the noise , the sensitivity increases at a given operating temperature when compared to traditional photovoltaic and photoconductive infrared photodetectors up to the background limit . the photodetector device design can be used with a number of semiconductor material systems , can form one - and two - dimensional focal plane arrays , and can readily be tuned for operation in the long wavelength infrared and the very long wavelength infrared where sensitivity and noise improvements are most significant .

various embodiments of the present invention are described in detail with reference to the drawings with corresponding elements having corresponding numbers throughout the drawings . fig1 is a top down view of a unit cell 100 of a first embodiment of the present invention ; the unit cell 100 being replicating as required to form a diffraction grating coupled infrared ( ir ) photodetector . depending upon the desired absorption wavelength , the unit cell size will vary . for a very long wavelength ir ( vlwir ) wavelength peak of 18 μm , the unit cell 100 will have a pitch of approximately 12 μm . fig1 includes first elongate elements 102 a , b and second elongate elements 103 a , b for absorbing the incident ir radiation . a typical width for these elongate elements 102 a , b , 103 a , b in a vlwir photodetector is 2 . 5 μm . a collector element 104 is formed at the intersection of the first elongate elements 102 a , b and the second elongate elements 103 a , b . for the vlwir photodetector example , the radius of the collector element 104 is 3 μm . a carrier collector 106 is formed within the collector element 104 . this carrier collector 106 has a radius of 2 μm in the present vlwir photodetector example . as seen in fig2 the carrier collector 106 extends only a portion of the way into the collector element 104 . a first electrical contact 108 is formed on the carrier collector 106 . the first electrical contact 108 of the present vlwir photodetector example has a radius of 1 μm . lastly , fig1 shows a reflector 110 below the previous elements , and is more clearly seen in the cross - sectional view of fig2 . a photodetector having a unit cell 100 as shown in fig1 could be formed from planar starting semiconductor material . the various required layers would be grown on a substrate . continuing the vlwir example , a cdte or cdznte substrate would be used with the appropriate layers of doped hgcdte grown thereon . the photodetector would then be formed in part by removing a significant portion of the hgcdte material via a masked etch process to leave only the elongate elements 102 a , b , 103 a , b and the collector element 104 . fig2 shows placement of a second electrical contact layer 112 between the second elongate elements 103 a , b and the collector element 104 , and the reflector 110 . the top of the first elongate elements 102 a , b and second elongate elements 103 a , b form a first common major surface 107 . the bottom of the first elongate elements 102 a , b and second elongate elements 103 a , b form a second common major surface 109 . the preferred thicknesses of the various elements for a vlwir photodetector are 1 . 6 μm for the elongate elements 102 a , b , 103 a , b and the collector element 104 , 0 . 8 μm for the carrier collector 106 , 0 . 5 μm for both the first electrical contact 108 and the reflector 110 , and 0 . 4 μm for the second electrical contact 112 . please note that while fig2 shows a cross - section along second elongate elements 103 a , b , a cross - section along first elongate elements 102 a , b would be identical . while the photodetector can be formed of a number of materials , its greatest potential is realized using the hgcdte material system . alternative semiconductor material systems include , but are not limited to , insb and ingaas . if the hgcdte material system is used , the elongate elements 102 a , b , 103 a , b would preferably be formed of n - type hgcdte material , the particular alloy of hgcdte depending upon the desired absorption wavelength . the collector element 104 would likewise be formed of the same n - type hgcdte material . the carrier collector 106 would be formed of p - type hgcdte , thereby forming a p / n junction . this carrier collector 106 could be formed by implantation or diffusion . diffusion is preferable by growing a sacrificial p - type layer , patterning and etching away a portion of this sacrificial layer , and then performing a thermal diffusion process . the remaining portion of the sacrificial layer would then be removed after diffusion was complete . this method of forming the p / n junction results in a self - passivated junction as the junction is formed completely within the collector element 104 . the first electrical contact 108 and the reflector 110 are formed of metal , preferably au or a au alloy by an evaporation process . alternatively , the reflector could be a bragg reflector 110 and formed of suitable semiconductor or dielectric material layers . the second electrical contact 112 is a heavily doped wider bandgap n - type hgcdte layer in this example . fig3 a shows a cross - sectional view of a second embodiment of the present invention in which a first electrical contact 108 a and the second electrical contact 112 a , b are on the same side of the second elongate elements 103 a , b of a photodetector 120 . this is in contrast with the first embodiment unit cell 100 in which the first electrical contact 108 and the second electrical contact 112 were on opposing sides of the second elongate elements 103 a , b . fig3 a includes a first passivation layer 114 on the surface of the second elongate elements 103 a , b . this first passivation layer 114 is on the surface and the sides of the elongate elements 102 a , b , 103 a , b . a second passivation layer 116 a , b is disposed between the second electrical contact 112 a , b and the reflector 10 a , b . the thickness of both the first 114 and the second 116 a , b passivation layers is preferably 0 . 2 μm . if the photodetector is formed using the hgcdte material system , the first 114 and second 116 a , b passivation layers are preferably formed of cdte or cdznte lattice matched to the hgcdte used in the elongate elements 102 a , b , 103 a , b . as with fig2 fig3 a and 3 b show a cross - section along second elongate elements 103 a , b , a cross - section along first elongate elements 102 a , b would be identical . fig3 b shows a cross - sectional view of a third embodiment of the present invention utilizing an alternative fabrication method . the photodetector 130 includes a single metal layer 132 that is a combination of the first electrical contact 108 a and the reflector 110 a , b of the second embodiment . a further alternative not illustrated , but similar to fig3 a and 3 b , would not require a separate second electrical contact 112 . in this case , the elongate elements 102 a , b , 103 a , b would be sufficiently doped that their series resistance would be low . by having a low series resistance , the elongate elements 102 a , b , 103 a , b would not need a separate , low resistance second electrical contact 112 , thereby simplifying material and fabrication requirements . this alternative could thus have a second contact formed of metal at the periphery of the photodetector or array of photodetectors . fig4 is a top down view of the second or third embodiment of the present invention and illustrates an entire photodetector 140 . this is in contrast to fig1 in which only the unit cell 100 is illustrated . fig4 illustrates placement of a collector element 104 at each intersection of the first elongate elements 102 and the second elongate elements 103 . the desirability of this configuration will be described below when photodetector operation is examined . note that the first elongate elements 102 form a first one - dimensional diffraction grating and the second elongate elements 103 form a second one - dimensional diffraction grating . the combination of the first and second diffraction gratings thus forms a two - dimensional diffraction grating . fig5 is a top down view of a fourth embodiment of the present invention and like fig4 illustrates an entire photodetector 150 . the photodetector 150 includes five collector elements 104 that are formed at only a few of the intersections of the first elongate elements 102 and the second elongate elements 103 . furthermore , each of the collector elements 104 includes multiple carrier collectors 106 a - d . while four carrier collectors 106 a - d are shown ( which would preferably have a diameter of 1 μm in the vlwir photodetector example ), the number of carrier collectors 106 a - d could be more or less than four . the diameter of the carrier collectors 106 a - d would need to be adjusted according to their number and the size of the collector element 104 . fig6 is a top down view of a fifth embodiment of a photodetector 160 . the fifth embodiment includes two differences in comparison with the previous embodiments . the charge collector element 162 is not circular but of a diamond shape . other shapes for the collector element are possible , including an oval . the second difference is the period between the first elongate elements 102 . the first elongate elements 102 in the x direction form the first one - dimensional diffraction grating having a period of “ a ” while the second elongate elements 103 in the y direction form the second diffraction grating having a period “ b ” that is greater than “ a ”. the advantages of this biperiodic two - dimensional diffraction grating will be further explored below . fig7 is a top down view of a sixth embodiment of a photodetector 170 . the primary difference of this embodiment is placement of the collector elements 106 not at the intersection of the first elongate elements 102 and the second elongate elements 103 , but midway between the intersections on elongate elements 102 , 103 . fig8 is a top down view of a unit cell 180 of a seventh embodiment of a photodetector . the seventh embodiment is a combination of the first and sixth embodiments in that it includes collector elements 106 at both the intersections of the first elongate elements 102 and the second elongate elements 103 , and midway between the intersections on first elongate elements 102 and second elongate elements 103 . the advantages of this embodiment will be further explored below . the operation of the various embodiments of the present invention will now be examined in detail . in each of the embodiments , incident ir radiation is absorbed in the elongate elements 102 , 103 . while the first elongate elements 102 and the second elongate elements 103 form the two - dimensional diffraction grating , due to the thickness of the elongate elements 102 , 103 , a three - dimensional diffractive resonant optical cavity ( 3d - droc ) is formed . by appropriately designing the 3d - droc , a limited range of ir radiation wavelengths will resonate and be absorbed by the elongate elements 102 , 103 . it should be noted that this resonating ir radiation generates the highest electric field regions , and thus absorption , within the portion of the elongate elements 102 , 103 nearest the collector elements 104 , and in the collector elements 104 themselves . due to the 3d - droc , the quantum efficiency in this range of ir wavelengths remains high even though significant ir absorbing material has been removed . in the preferred embodiment , the elongate elements 102 , 103 are n - type hgcdte and the absorbed ir radiation creates electron - hole pairs . the minority carrier holes then drift toward the carrier collector 106 . the carriers drift due to the electric field created between the n - type elongate elements 102 , 103 and the p - type carrier collector 106 , which form a p / n junction . this resultant current flow can be sensed as a voltage or a current in an external circuit via the first electrical contact 108 and the second electrical contact 112 . as maximum sensitivity requires collecting as many of the photogenerated minority carriers as possible , holes in the present example , the carriers must be collected before they recombine . for this reason a carrier collector 106 is preferably located within a diffusion length of the absorption location . as the diffusion length for holes in vlwir hgcdte is approximately 10 μm , a carrier collector 106 should be located at every intersection between the first elongate elements 102 and the second elongate elements 103 for a vlwir photodetector . thus , the embodiments shown in fig4 , and 7 would be preferred over the embodiment shown in fig5 . while the desirable multiple carrier collector 106 per collector element 104 configuration is shown only in fig5 this configuration is compatible with the collector elements 104 illustrated in fig4 and 6 - 8 . while the hole diffusion length is relatively short , as noted above the greatest absorption is near the collector elements 104 and carrier collectors 106 . thus , the holes have only a relatively short distance to drift before being collected . to retain maximum sensitivity , it is desirable to minimize photogenerated carrier recombination at the surface of the elongate elements 102 , 103 . including a first passivation layer 114 over the elongate elements 102 , 103 does this . a second passivation layer 116 a , b is desirable to insulate the carrier collector 106 from the reflector 110 so as not to short the carrier collector 106 . as the sensitivity is further determined by the thermally generated leakage current of the photodetector , it is desirable to minimize this source of noise . one way to minimize the thermal leakage current is by reducing the area of the carrier collector 106 p / n junction . by using four smaller carrier collectors 106 a - d as shown in fig4 as opposed to a single larger carrier collector 106 as shown in fig1 this carrier collector area , and thus thermal leakage current and noise , can be reduced . theoretical modeling indicates the sensitivity of these reduced thermal leakage current photodetector designs can lead to a factor of ten improvement in the sensitivity . traditionally , the exposed high field regions near the corners or surface of a p / n junction generate additional excess leakage current requiring careful passivation of the junction . by forming the carrier collector 106 p / n junctions within the collector elements 104 , the resulting device has no exposed junction , i . e ., the junction is self - passivated . furthermore , the self - passivated junction is passivated by the collector element 104 that is of the same semiconductor material , such as hgcdte , as the junction itself this results in a perfect lattice match for the entire photodetector and does not require any additional processing related to the junction . an added benefit of the smaller carrier collector 106 p / n junction is that the operating temperature can be increased . in particular , the reduced noise allows an increase in the operating temperature before a given noise level threshold is met when compared with ordinary ir photodetectors . alternatively , for a given operating temperature , a diffraction grating coupled ir photodetector will have reduced noise , and thus increased sensitivity , when compared to ordinary ir photodetectors . due to the relatively narrow spectral resonance of the 3d - droc formed by the elongate elements 102 , 103 , some ir radiation is not detected . as this undetected radiation decreases the possible signal magnitude , it is desirable to broaden the spectral resonance of the photodetector . this can be done by at least two methods that will be described next . the first spectral broadening method is to use a biperiodic diffraction grating as shown in fig6 . by having different periods in the x and y directions , the first one - dimensional diffraction grating resonates at a different wavelength than the second one - dimensional diffraction grating within the 3d - droc . a difference in resonant wavelengths of approximately ten percent will broaden the spectral response of the photodetector . however , this method is polarization dependent in the x and y directions , which may be undesirable . an alternative method of broadening the spectral response that is not polarization dependent is shown in fig8 . a photodetector having the unit cell 180 configuration shown in fig8 will benefit from shorter diffusion lengths for the minority carriers . as the diffusion length decreases for longer wavelength photogenerated minority carriers , it is critical to capture these carriers before they recombine . by including additional carrier collectors 106 within the unit cell 180 , these minority carriers are not lost . for this reason , the spectral response for a photodetector having the unit cell 180 configuration is broader on the long wavelength side than that achieved for a photodetector having the unit cell 100 configuration shown in fig1 . the resonant wavelength of the 3d - droc within the photodetector is primarily a function of the material geometry . the simplest variable is the period or unit cell size . in the vlwir example , the period or unit cell size is 12 μm . by decreasing the unit cell size , the resonant wavelength can be decreased for operation in the long wavelength ir ( lwir ) or middle wavelength ir ( mwir ). decreases in either the width or thickness of the elongate elements 102 , 103 will also decrease the resonant wavelength . it must be noted that the absorption ir wavelength band of the elongate elements 102 , 103 must match the resonant wavelength of the photodetector . as an example , if the elongate elements 102 , 103 were formed of hg 0 . 8 cd 0 . 2 te that strongly absorbs at 10 μm , the 3d - droc should be designed to resonate at 10 μm for optimal performance . the preferred configuration of the photodetector is a function of the external sensing circuit . the configurations shown in fig1 and 2 are for a vertical current flow in which the first electrical contact 108 and the second electrical contact 112 are on opposite sides of the photodetector . for applications that require all connections to be on the same side , a usual requirement for ir focal plane arrays , the first electrical contact 108 and the second electrical contact 112 must be on the same side . this results in the lateral current flow configuration as shown in fig3 a and 3 b . an alternative vertical current flow configuration that is not illustrated would incorporate a layout similar to that of fig3 a and 3 b with a change in the second electrical contact layer 112 location . this un - illustrated configuration would place the second electrical contact layer 112 between the first passivation layer 114 and the elongate elements 102 a , b , 103 a , b . in this configuration , the second electrical contact layer 112 would be common to all photodetectors if an ir focal plane array were to be fabricated . while each of the embodiments has been described and illustrated as a unit cell or single photodetector , arrays of photodetectors are envisioned . the arrays of photodetectors can be a one - dimensional line array , or a two - dimensional area array of photodetectors . in an application requiring a one - dimensional or two - dimensional array of photodetectors , the array of photodetectors can be mated to a silicon - based readout integrated circuit for multiplexing the resulting signals . the mating of the array of photodetectors and the readout circuit can include the use of indium bumps to provide electrical , mechanical , and thermal contact between the photodetectors and the readout circuit . although the present invention has been fully described by way of examples with reference to the accompanying drawings , it is to be noted that various changes and modifications will be apparent to those skilled in the art . therefore , such changes and modifications should be construed as being within the scope of the invention .

US-83603601-A

a static hydro - dynamic mixer undulating interior conduit provides a static mixing apparatus which utilizes a spiral , coiled or curved conduit to cause dynamic mixing of its flowing contents while they are pumped through it . the application includes a method of use in separating oil sands . the mixing is caused by the resistance to flow through the undulated conduit and the resistance increases with pitch and conduit diameter .

the following descriptions are of the static undulating conduit hydro - dynamic mixer ( the “ apparatus ”) and the processes involved in the application of the invention . the undulating conduit hydro - dynamic mixer is the physical plant that provides controlled continuous positive dynamic interaction within the transported slurry . the undulating conduit creates the optimum environment for mixing of the oil sands slurry . the action may be described as directional flow changes , twirling , spiraling , gyrating , folding the slurry over on itself and stretching the mixture as it is transported . the above pattern of dynamic flow provides several advantages usually not available in present mixing systems . referring to fig1 and 2 , conjointly , the undulating conduit hydro - dynamic mixer is a static mixing apparatus of a preselected and predetermined length of elongated tubular conduit . it allows for mixing and transporting various substances including highly - abrasive solids contained slurries . as further discussed herein , the conduit member can be interconnected into a transportation and processing separation system . in accordance with the present invention , the undulations may take a variety of serpentine paths or shapes with different pitches ( fig3 ), repetitive or varying waves and differing cross sections , fig4 , 4 a , 5 , 7 . the undulations can be of a spiral type formation ( i . e ., spring wound configuration ) such as used for round pipe cross - sections or a screw type shape for pipes of oval , rectangular , or other geometric cross - sections or combinations thereof . spiral type undulations are defined by geometry , having parameters such as conduit inner radius , and radius and pitch of coil . it will be appreciated that the use of other than round conduit is permissible as well . screw shaped undulations can be defined by a cross - section of the conduit , for instance , oval , rectangular , elliptical or other geometric shape . alternatively , undulations may be formed by indenting the outside of round pipe in a screw type manner or in the case of using slurry including solids , over the top portion only . the indentations can be placed at predetermined intervals . yet another option to prevent stratification is to maintain turbulence in a large diameter pipe which can be done by installing deflectors internally in a screw type fashion . the deflectors are preferably only provided in the upper portion of the conduit inside where there is a smaller amount of suspended coarse abrasive solids than in the lower portion of the conduit . the transportation of slurries of various compositions particularly in large diameter straight pipes ( 10 ″+) tends to give rise to premature separation and / or stratification of elements . the undulating conduit hydro - dynamic mixer lends itself to precise control and therefore management of the flow , while the alternating flow patterns creates a mixing effect which prevents premature separation and stratification of elements transported within the pipeline . the turbulent action in the undulating conduit hydro - dynamic mixer keeps solids in constant suspense , which means that deposition of solids along the base of the pipe would be lower than in a straight pipe ; ergo , considerably lower velocities of slurry travel are feasible . the lower velocity would reduce the abrasive effect of the solids . the entry of screened slurry into the undulating conduit hydro - dynamic mixer , brings with it lumps of oil sand reduced in size for additional digestion . the turbulent flow pattern in the undulating conduit hydro - dynamic mixer is conducive to better abrading and digestion of lumps . the “ folding - over ” mixing action of the undulating conduit hydro - dynamic mixer enhances the context and attachment of air to the oil droplets thus enhancing the conditioning of the slurry . since the undulating conduit hydro - dynamic mixer system is based on principles of hydraulic flow , most of its parameters can be established theoretically and a numerical model developed and proven experimentally within a relatively short time and at a reasonable cost . the undulating conduit hydro - dynamic mixer can be utilized in several phases of mixing and separation the undulating conduit hydro - dynamic mixer lends itself to use in at least three stages of mixing and separation . stage # 1 — undulating conduit hydro - dynamic mixer inserted as hydro - dynamic mixer (“ b ”) between contactor (“ a ”) and sand settler (“ d ”). the oil sand slurry is preconditioned in the contactor (“ a ”) as dense media . after one minute of mixing the slurry is diluted and pumped through the undulating pipe hydro mixer (“ b ”) where it is further conditioned before entering the sand settler (“ d ”) and cyclo distributor (“ c ”) prepared as dense media and after dilution its elements have to stay in suspense to prevent conglomerates forming from the solids , bitumen and fines . the turbulent flow of the undulating conduit hydro - dynamic mixer keeps these in suspense until the slurry reaches the flotation stage . in stage # 2 , the introduction of the undulating conduit hydro - dynamic mixer in transportation of the oil laden middlings from the sand settler to the froth separator (“ f ”) will prevent premature coalescence of aerated oil globules , and solids . the undulating conduit hydro - dynamic mixer keeps the contents in suspension so that they can be evenly distributed across the froth separator area to yield optimum product . in stage # 3 , the undulating conduit hydro - dynamic mixer will transfer middlings from the froth separator to the contactor , to be used as a slurry dilution stream . the working of this system enhances oil recovery by bringing the unaerated oil droplets back into the system , and also recycles fines which enhance transport of the slurry . the undulating conduit hydro - dynamic mixer can be structured to be compact and movable , so that it can be transported about in the mining sites as require . the undulating conduit hydro - dynamic mixer can displace some of the mixing equipment which is in current use at a considerably lower capital cost , lower operational and maintenance cost ; and reduced down time to repair and / or replace worn out equipment . oil sands contain sharp , various sized grains of sand particles , bitumen ( a high viscosity oil ) and connate water containing various amounts of corrosive chlorides . conditioning starts in contactor (“ a ”) with the addition of fresh water , middlings from froth separator and chemicals if required . the next step in preparation of slurry is accomplished in the hydro - dynamic mixer , where it will be gently conditioned by thoroughly mixing while air , chemicals , predetermined energy and set time will be applied . the next function is accomplished in the sand settler (“ d ”). here , the slurry is diluted , mixed with recycled middlings in the cyclo - distributor (“ c ”) followed by settling of the sand and floating of oil and middlings . settled sand , diluted by tailings from secondary oil recovery is removed for disposal while oil and floating middlings are transported by undulating conduit hydro - dynamic mixer , to prevent coalescence of aerated oil droplets with high solids middlings , to the froth separator (“ f ”). in this stage of process , oil is floated off and removed as final froth while middlings containing liquid , some oil and fines ( solid particles usually less than 44 microns ), are recycled to the contactor . status undulating conduit hydro - dynamic mixer management of settling and flotation problems the transport of slurry in straight pipes is subject to the problem of blockage caused by solids . at times of reduced velocities and / or stoppage , heterogeneous slurries , such as oil sand slurry , settle rapidly to form a sandy or hard deposit . similarly , in particular , when processing high oil content ore (+ 12 %), the spontaneous rise of aerated oil droplets form viscous gumbo at top of conduit , which increases in size with time of travel , building up system pressure , thus restricting the flow of slurry . the undulating conduit hydro - dynamic mixer will attempt to overcome the above deteriorating conditions , even at lower flow velocity by keeping the slurry in a state of turbulent flow . the slurry is subjected to continuous flow direction changes , vortexing , and twirling and as a result keeping the elements in motion . by keeping solids in suspension the abrasive aspect of moving sand will be reduced . the velocity can be reduced without loss of mixing benefit ; the sands are evenly distributed within the slurry which also minimizes the abrasive effect on the walls of the conduit . with the sands in continuous suspension there is no settlement to the bottom of the conduit to create uneven wear on its base . in other words , the total wear factor is both reduced and spread out evenly within the pipe . this invention offers a great range of potential applications . it is a mixer and can also serve as a materials transporter which incorporates a controlled mixing function . some uses are oil extraction from alberta oil sands ( water wet sand grains ); usa oil sands ( oil coated sand grains ); and oil sands deposits in other parts of the world . industries uses such as petrochemical industries , various solids transport industries such as transport of potash ore , dredging of harbors and rivers , paint manufacturing , and the food preparation industry . it can enhance and improve existing systems by the principle of the undulating conduit apparatus . the particular use to which this invention is suited is in the extraction of oil from the fort mcmurray oil sands deposits in the vicinity of the athabasca river in northeastern alberta , canada . because of the smaller size of the apparatus , its low capital cost , lower operating expenses and portability , this invention has potential to allow the development of marginal oil sands deposits by small scale operators . this capability may be of benefit to less prosperous countries and smaller economies which have oil sands deposits . explanation of flow diagram ( fig6 ) showing utilization of static undulating conduit hydro - dynamic mixer in the proposed oil extraction process fig6 , is an illustrative flow sheet for a method of separating oil from oil sands . the contactor is a sturdy mixing device , for preconditioning of the oil sand slurry . the contactor accomplishes oil sand lump digestion efficiently with a minimum of emulsification of the bitumen . the contactor can be mounted and operated on mobile trailers , thus increasing mining flexibility . retention time at this stage should be preferably short ( less than one minute ) while holding slurry liquid consistency around 25 % by weight . the temperature of slurry at this stage , should be maintained around 30 - 55 ° c ., to enhance diminution of tar sand lumps , thus liberating bitumen matrix intact . to control the density of the above slurry , a stream ( 4 ), containing fresh water , chemicals and recycled middling from the froth separator (“ f ”) is added . after mixing is completed , this slurry ( 5 ), overflows the lip of the contactor and then falls through the screen into the pump hopper . fresh hot water ( 6 ) or a recycle stream ( 11 ), can be applied to dilute and propel this slurry through the screen openings , as well as to wash off attached oil of the rejected oversize lumps ( 7 ). the size of rejects ( 7 ) is dictated by the handling capability of the follow up equipment , in this case , the diameter of undulating conduit hydro - dynamic mixer . during cold winter months , rejects containing frozen lumps of undigested oil sand might be recycled back to the contactor (“ a ”). the final adjustment of slurry density , the slurry ph , as well as addition of dissolved air , can be made via stream ( 17 ), before it enters the undulating conduit hydro - dynamic mixer . using the undulating conduit ( in contrast to straight pipe ) addition of dissolved air could be tolerated , without increase of possible flow stratification effect . the screened preconditioned slurry with additives ( 17 ), is pumped through the undulating conduit hydro - dynamic mixer . for effective mixing , one to two minutes of retention time would be adequate . the static hydro - dynamic mixer undulating conduit can be used in three different configurations to fulfill three different functions . in fig6 ( shown as “ b ”, “ e ”, and “ h ”), three static hydro - dynamic mixer undulating conduits are utilized . it can be utilized firstly as a pure mixer . secondly , it can be utilized as a transporter mixer . thirdly , it can serve as inserts in a transportation pipe system to revitalize contents in transit . static hydro - dynamic mixer undulating conduit can be used as a mixer only , by applying small length of pipe , having undulation of a short pitch configuration . this static hydro - dynamic mixer undulating conduit unit could be mounted on mobile equipment and operated close to mining area . on the other hand , the static hydro - dynamic mixer undulating conduit could also consist of a combination of mixing and transport system ( combination of straight pipe with insertions of undulating pipes , or long pitch undulations ). the correct design of this unit , establishing length , diameter of pipe , diameter of spool and pitch , could greatly influence the product quality . since sand represents around 80 % of oil sand weight , as much of it as possible needs to be removed from the slurry as early as possible to avoid abrasive wear on downstream equipment . conditioned slurry ( 8 ) is introduced into the sand settler (“ d ”) by means of the cyclo - distributor (“ c ”). here it is dispersed and diluted by recycled middling stream ( 9 ), which also induces an additional rotational momentum . the resulting motion enhances turbulence within the middling in the lower section of the vessel , thus reducing formation of gelling ( pseudo plastic behavior ). the cyclonic action within the cyclo - distributor enhances the separation of sand and aerated oil droplets by means of turbulence and density differential . after exiting the cyclo - distributor , rising aerated oil droplets and some middlings are floated to the top of the vessel and then leave the sand separator by means of a stream ( 10 ) which is a undulating conduit hydro - dynamic mixer (“ e ”) functioning as a transporter / mixer . the sand portion of the slurry is discharged onto the conical deflector , spreading it , thus permitting release of the oil trapped by outflowing stream . this allows the oil to rise to the top , while the sand is distributed uniformly across the lower portion of the sand settler . as the sand settles towards the bottom of the settler , it densifies , releasing middling and bitumen resulting in the creation of an interface . further influx of middling and bitumen , creates an upward flow current , conveying it towards the cone under the cyclone distributor , and joins stream ( 9 ). the density of tailings stream ( 16 ), drawn from bottom of the vessel is controlled by injection of secondary oil recovery tailings ( 15 ). oil enriched middling stream ( 10 ), is transported from the sand settler to the froth separator by means of the undulating conduit hydro - dynamic mixer which prevents coagulation of aerated oil droplets . the stream entering the froth separator via the rotary distributor (“ k ”), is laid down uniformly across the vessel . streams exiting the rotating distributor (“ k ”) are mixed with surrounding liquid , and thus diluted , are the beginning of the actual process of separation . the released aerated oil globules begin to rise to the top of the vessel , where they form a product named froth ( 11 ), while sand particles , some of unaerated bitumen and fines settle to the bottom of the froth separator . fresh ( pretreated ) underwash water is introduced preferably by way of underwash rotary distributor (“ j ”) beneath the froth layer , but above the oil enriched middling distributor (“ k ”). in this way , a highly diluted zone is provided , through which the ascending bitumen passes immediately before joining the froth . this step contributes to formation of higher froth quality by washing rising aerated bitumen droplets and maintaining a mild downward current that depresses the fines to the middling withdrawal pipe ( 11 ). the underwash water rate is usually higher than the ratio of water to oil in the froth product , thus only the excess water is involved in the downward flow . the dilute underwash zone leads not only to clean froth , but also maintains stable operation even when high fines oil sands are being processed . rising to the surface , aerated oil globules , form a froth ( 13 ), on average containing 60 - 70 % oil , 6 - 10 % solids and 20 - 30 % water , which overflow launders and is pumped to froth treatment facilities . an undulating conduit hydro - dynamic mixer may be a suitable apparatus for washing the froth . the middlings for recycle to the contactor ( 11 ), are taken from the froth separator via a collector pipe . by this means a certain percentage of solids , in particular fines , are being removed from the center of the froth separator (“ f ”). this removal ( stream 11 ) creates some turbulence within the center zone of the froth separator which helps prevent the remaining fines from coalescing . this stream should be transferred by undulating conduit hydro - dynamic mixer , to prevent remaining oil and fines conglomeration . froth separator tailings ( 12 ) are withdrawn and introduced into the secondary oil recovery system (“ g ”). the product of secondary oil recovery system ( 14 ), usually a froth , high in solids , is introduced into middling recycle stream ( 9 ) and forwarded to the cyclo - distributor . a low oil content discharge stream ( 15 ) from the secondary oil recovery circuit enters the sand settle (“ d ”) as a sand tailings ( 16 ) dilution and flushing stream ( 80 ). all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . the invention comprises all the embodiments , modifications and variations coming within the scope and spirit of the claims herein .

US-36126703-A

a distance - controlled tunneling transducer comprises a plurality of tunnel tips arranged in an array at a tunneling distance from an electrically conductive surface of a storage medium . each tip is attached to a respective cantilever beam permitting the distance between each tip and the surface to be individually pre - adjusted electrostatically . arranged in juxtaposition with each cantilever beam is an active control circuit for adjusting the tip - to - surface distance during operation of the storage unit , thus preventing crashes of the associated tip into possible asperities on the surface of the recording medium . each control circuit is designed such that its operating voltage concurrently serves to pre - adjust its associated cantilever beam and to maintain the tip - to - surface distance essentially constant .

while the invention will be described in connection with the electrostatic deflection of a cantilever beam as conventionally used in micromechanical arrays , it will be obvious to those skilled in the art that the invention is also applicable to piezoceramic scanners . fig1 and 2 show the contemplated arrangement of the elements of the transducer in accordance with the invention in a semi - schematical way . referring to fig1 there is shown a section of the transducer 1 with three tunnel tips 2 &# 39 ;, 2 &# 34 ;, 2 &# 39 ;&# 34 ; out of a plurality of tunnel tips ( or field - emission tips ) arranged in an array . the tunnel tips are attached to cantilever beams 3 &# 39 ;, 3 &# 34 ;, 3 &# 39 ;&# 34 ; respectively which are formed , e . g . by etching , from body 4 , fig2 of transducer 1 as an integral part thereof . transducer 1 is mounted to a conventional xyz - drive 5 which provides lateral deflection as well as coarse approach and adjustment of the average distance between tunnel tip 2 and the oppositely disposed surface 6 , by keeping the total tunneling current essentially constant . surface 6 may actually be the surface of a sample to be inspected by means of a scanning tunneling microscope . however , since the present invention is intended particularly for use in connection with information storage devices , for the purposes of this description surface 6 will be assumed to be the surface of a recording medium 7 . the medium 7 may comprise , for example , a magnetizable material . since the funnel effect requires the surface opposite by the tunnel tip to be electrically conductive , any non - conductive material used as the recording medium may be provided with a very thin conductive coating . each of the cantilever beams can be deflected electrostatically by application of voltages u 1 and u 2 , respectively , between an electrode 8 &# 39 ;, 8 &# 34 ;, 8 &# 39 ;&# 34 ; on cantilever beam 3 &# 39 ;, 3 &# 34 ;, 3 &# 39 ;&# 34 ; and a counter - electrode 9 at the bottom of the recess 10 etched into body 4 underneath each cantilever beam , and between the electrode 8 and the surface 6 of the recording medium 7 . this deflection is used to control the width of the tip - to - surface gap , in particular during operation in the tunneling mode . arranged on body 4 of transducer 1 are electric circuit elements 11 through 17 which serve to control the deflection of the cantilever beams 3 in the array and to create the tunneling currents across the gaps between the tunnel tips and the surface 6 of the common recording medium 7 . fig3 is an enlargement of a portion of fig2 to better show the relevant z - coordinates , distances and voltages . in its home position , i . e , in a voltageless state , cantilever beam 3 assumes a position designated in fig3 as z cb at a distance z 1 from counter - electrode 9 the surface of the counter - electrode being located at z bot , and at a distance z 2 from the surface 6 of recording medium 7 which is located at z s . in the home position of tunnel tip 2 , and considering that the tip has a height dimension z p , its apex is located at z tip , i . e . a gap width z g away from surface 6 . application of voltages u 1 , u 2 between electrode 8 on cantilever beam 3 and surface 6 causes the cantilever beam 3 to deflect by a distance δz to a new position z cb0 . the voltages required for deflecting cantilever beam 3 are provided by circuitry comprising a field - effect transistor 11 connected between a supply line 12 and electrode 8 on cantilever beam 3 . field - effect transistor 11 acts as a constant current source which is set by means of a gate line 13 . counter - electrode 9 is part of supply line 12 and is at a constant potential u 0 . hence the deflection voltages are u 1 = u 0 - u t , u 2 = u t . when tunnel tip 2 is far from surface 6 , i . e . gap z g is large , then the resistance across the tunnel gap r t →∞, u 1 → 0 , u 2 → u 0 . as cantilever beam 3 becomes most deflected towards surface 6 of recording medium 7 : δz max ≡ b ( u 0 / z p ) 2 , where it is assumed that z g & lt ; z p . the term b will be explained below . when tip 2 gets closer to surface 6 so that tunneling current i t becomes finite , i . e . larger than the unavoidable leakage current of field - effect transistor 11 , which is typically & lt ; 100 pa , then the voltage ratio u 1 / u 2 increases resulting in a retraction of cantilever beam 3 . thus , any increment in z s , that is , for example , some surface roughness , produces a much smaller decrease of z g . fig4 is a circuit diagram a the unit cell , viz . for the electronic circuitry associated with one cantilever beam 3 . the tunneling current i t flowing across the tip - to - surface gap , i . e . through the tunnel resistance r t , is monitored by means of a load resistance 14 ( r l ) which is chosen such that r l & lt ; r t under operating conditions . the signal u sig occurring across load resistance 14 is provided via lines 15 and 16 . a load capacitance 17 ( c l ) introduces some inertia into the compensation process characterized by a time constant τ l = r t c l . hence , information - carrying variations passing tip 2 within a time shorter than the time constant τ l are not compensated , giving rise to a large variation in u sig . the performance of the scheme is described by the z g ( z s ) characteristics under quasi - static conditions ( with reference to τ l ). therefore , r l and c l are ignored in this part of the discussion . further ignored are the stray capacitance c 1 between cantilever beam 3 and supply line 12 , and the stray capacitance c 2 between cantilever beam 3 and counter electrode 9 , because they are negligible compared to load capacitance c l . without loss of generality , it can be assumed that z cb0 ≡ 0 , hence , z s & lt ; 0 . under these conditions , z g ( z s ) can be derived from the following set of relations : with εε 0 = dielectric constant (≃ 0 , 8 pf / m ), e = elastic modulus , l = length and t = thickness of the cantilever beam 3 , respectively , and r t0 ≃ 40 kω , κ ≃ 10 10 m - 1 . equations [ 1 ] through [ 7 ] cannot be solved analytically for z g but the derivative can be determined easily : ## equ1 ## with the parameters chosen below , and at realistic operating conditions in the tunneling mode , z g & lt ; δz & lt ; z 1 , 2 such that z 1 ≃ z bot and z 2 ≃ z p ; further u 1 ≃ u 0 & lt ; u 2 = u t , the quantity a becomes : for a numerical calculation , the following values have proven appropriate : ε = 1 ; ε 0 = 8 × 10 - 12 f / m ; l = 200 μm ; t = 2 μm ; e = 10 11 n / m 2 ( silicon , quartz ); z bot = z p = 3 μm . with these values and a projected width w = 200 μm of the cantilever beam , a spring constant of c *= 4 , 5 n / m results which is sufficient to prevent mechanical instabilities due to interfacial forces . the first elastic resonance of the cantilever beam occurs at & gt ; 100 khz which is much better than in present - day scanning tunneling microscopes . the deflection parameter becomes : assuming operation at u t = 0 . 5 v , then a ≃ 100 . since a & gt ; 1 , one may ignore the 1 in the denominator of equation [ 10 ], hence ## equ2 ## equation [ 13 ] means that a 10 nm variation in surface height results in no more than a 0 . 1 nm change in tunnel gap width . for very small and very large tunnel gap widths , the above - given set of equations is easily solved for z s ( z g ). there is no reduction effect to be expected : ## equ3 ## fig5 depicts the linear and almost linear relations calculated in accordance with equation [ 14 ]. the dashed lines designated a , b , and c , having a slope of - 1 , and being mutually parallel - displaced by the amounts δz max , and 2 δz max , respectively , are the calculated asymptotes to the curve z s ( z g ) represented in a semi - quantitative way by the solid curve d . the operating point is to be chosen on the horizontal plateau ( of the width 2 δz max ) between dashed lines a and b . since the voltage u 1 is generally kept small , the operating point will preferably be chosen near the right - hand end of the plateau . for this purpose , the tunneling current from a few selected cells can be fed into a regular feedback control circuit . this measure assures that the overall system settles approximately at the operating points of the individual elements . the quantitative behavior of the response curve may be obtained by numerical integration of equation [ 13 ]. the initial setting of the parameters may be chosen as follows : z . sub . g = o , r . sub . t = r . sub . t0 , u . sub . 2 = i . sub . t r . sub . t0 & lt ; u . sub . 1 = u . sub . 0 , δz = b ( u . sub . 0 / z . sub . p ). sup . 2 , z . sub . s = δz . the resulting characteristics are shown in fig6 through 8 . fig6 depicts the relevant section of curve d in fig5 namely the relation of tunnel gap width versus sample position , for three values of the tunneling current , viz . 0 . 1 na , 1 na , and 10 na , at a larger scale . fig7 shows the corresponding relation between dz g / dz s versus u t which is independent of i t . it can be seen that dz g / dz s ≃ 0 . 01 in the operating range around u t = 0 . 5 v . fig8 relates the gap width to the tunneling voltage for the three values 0 . 1 na , 1 na and 10 na of the tunneling current i t . it will be apparent from the foregoing description that variations in tunneling current occurring fast as compared to the time constant τ l of the r l - c l circuit are not compensated for by the current stabilizer comprising field - effect transistor 11 . small asperities on the surface 6 of the recording medium 7 ( topography ) as well as local changes in workfunction of the recording material , therefore , will show up in full strength in the tunneling current i t . they create a voltage signal u sig across load resistance r l 14 which can be used for further processing of the stored information . while the present invention is not directed to the storage medium per se , it seems in order to briefly introduce a storage medium capable of recording variations of the tunneling current . a suitable storage medium may , for example , comprise a thin layer of silicon dioxide on top of a silicon substrate . the oxide is prepared to have a plurality of trapping sites of about 2 . 4 ev depth . electrons emitted from a tunnel tip can be stably trapped at such sites at room temperature ( cf . d . j . dimaria in pantelides ( ed .) &# 34 ; the physics of sio2 and its interfaces &# 34 ;, pergamon 1978 , p . 160 et seq .). this mechanism qualifies for write / read applications . on conventional storage disks , the storage locations are arranged in concentric circles or tracks about a single common center . by contrast , on the storage medium proposed for use in connection with the present invention , the storage locations are arranged in a plurality of identical groups , with all storage positions in any one group being arranged in concentric circles or tracks about the group &# 39 ; s own center , and with all centers being arranged in an ordered array on the recording surface of the storage medium . the concentric circles or tracks of storage locations of each group form a &# 34 ; microdisk &# 34 ; with a diameter of less than 0 . 1 mm . even with several hundred &# 34 ; microdisks &# 34 ; per recording surface , the area required for a given storage capacity is much smaller than required in any other known storage devices . the storage medium just described may be attached to the free end of an elongated piezoceramic bendable tube , such as the one known from ep - a - 0 247 219 , the other end of which is rigidly anchored . closely adjacent the recording surface at the free end of the tube is mounted the transducer of the present invention with each tunnel tip of its array of tunnel tips being aligned with one of the microdisks . each tunnel tip faces , and is spaced closely adjacent to , the recording surface on the storage medium . the distance ( in the nanometer range ) between each tunnel tip and the recording surface is at the beginning individually adjusted so that each tip normally is disposed at the same preselected tunneling distance from the recording surface 6 . by successively energizing electrode pairs attached to the tube , the free end of the tube and , hence , the recording surface is forced to move in a circular orbit . the diameter of this orbit will vary according to the potential differential that is selected . thus , the recording surface at the free end of the piezoceramic tube can be caused to move in any one of a plurality of concentric orbits relative to the tunnel tips of the transducer array . as a result , each tip will scan that one of the plurality of concentric circles of tracks of its microdisk corresponding to the selected orbit diameter of the tube . digital information is written into and / or read out of the storage medium by varying the tunneling current flowing across the gap between the tunnel tip and recording surface . recording , therefore , involves addressing and moving a selectable one of the tips 2 in the array of transducer 1 and concurrently energizing the electrode pairs surrounding the tube to a potential corresponding to an orbit diameter that permits access to a desired one of the concentric tracks on the associated microdisk . it will be clear to those skilled in the art that several other recording media , as well as other known schemes for the mutual displacement of transducer and / or tunnel tips and recording medium may be employed to achieve the desired result . the important point is that with all those schemes the control circuitry necessary to compensate the variations in the distance between each individual the tunnel tip and the surface of the recording medium is integrated on the transducer .

US-67426491-A

apparatus and method for concentrating metallic aluminum from dross comprising a system in which dross is repeatedly and continuously passed through an impact type mill to mill the material and to enable the metallic aluminum concentrates to be separated from the non - metallic components of the dross . a portion of the milled material is continuously diverted by a percent divider to a screening zone where it is classified according to particle size . through - put devices regulate the average number of passes that material is circulated through the mill in accordance with particle size to obtain a product of relatively high aluminum concentration and a by - product of a relatively low aluminum content .

referring now to fig1 apparatus 10 operates to mechanically process aluminum dross to separate metallic aluminum from its non - metallic parts . a supply or feed of dross is introduced into the apparatus 10 at a receiving or input hopper 11 . the dross from the input hopper is carried by a conveyor 12 to a bucket elevator 13 that raises the dross up to a zone 14 where , carried by gravity , it can enter the inlet of a percent divider 16 . a majority of the material entering the percent divider 16 , as discussed more fully below , falls by gravity from the main outlet 20 into the inlet 17 of a mill 18 of the impact type in which a rotor impels particles against a stationary target or anvil . the mill 18 , in a continuous operation , mills the material and then discharges it from a port 19 into a chute 21 in turn transporting it to the &# 34 ; return &# 34 ; bucket elevator 13 . a minor portion of the material entering the percent divider 16 is diverted from the main material stream through an auxiliary outlet 22 of the percent divider . material passing through the auxiliary outlet 22 is conveyed by a conveyor 23 , which in the illustrated case is a screw conveyor , to a screening zone 24 . a series of screens 26a , 26b , 26c and 26d receive the divided or diverted material carried by the screw conveyor 23 from the percent divider 16 . the screens 26a - 26d are arranged one over the other in a conventional manner , with the mesh of each successive underlying screen being finer than the screen above it . an upper screen 26a can have a mesh of , for example , 18 std . u . s ., and the lower screen 26d can have a mesh of , for example , 140 std . u . s . in the illustrated case , four screens are used , but this number can be increased or decreased and the mesh sizes can be suitably varied . particulate material that is too large to pass through a particular screen is vibrated or otherwise carried off the top of the screen and directed by an associated chute or guide 27a , 27b , 27c or 27d to an associated metering or through - put device 28a , 28b , 28c and 28d . each of the through - put devices 28 has two discharges 31 and 32 . one of the discharges 31 is connected to a common inlet of the screw conveyor 12 . the other through - put device discharge 32 is connected to a suitable product recovery device which can be a simple , common bin 33 serving all of the discharges 32 or more elaborate structure and apparatus such as a conveyor or conveyors . each through - put device 28 meters the relative flow between its discharges 31 , 32 . a through - put device 28 can , for example , take the form of a simple screw feed conveyor arranged so that material carried by its screw passes through one discharge 31 and any excess material received at the through - put inlet , designated 29 , but exceeding the volume rate capacity of its screw passes through the other discharge 32 . the screw or like element of the through - put device is driven , for example , by a variable speed electric motor or other variable speed driver so that the volume rate capacity of the screw or metering element is adjustable . the bucket elevator or conveyor 13 is enclosed with a housing 36 and the interior of the housing is connected with a vacuum line 37 to a bag house diagrammatically indicated at 38 in which airborne dust from the housing is collected . the environment of the screens 26a - 26d ideally is enclosed with a similar housing which likewise is connected by a vacuum line to the bag house 38 again to collect airborne particulate matter or dust . the percent divider 16 , illustrated somewhat diagrammatically in fig2 comprises a circular enclosure 41 having an upper cylindrical portion 42 and a lower conical portion 43 . the divider 16 has an inlet 44 at its top and two outlets , the main outlet 20 , being its major one , at its bottom and the minor one 22 adjacent its mid - elevation . in the enclosure or housing 41 directly below the inlet 44 is a primary flow divider in the form of a solid sphere 48 . the sphere . 48 is eccentrically mounted on a shaft 49 below its center . the mounting is such that by pivoting the shaft 49 the sphere 48 is positioned off an axis 50 of the inlet 44 . by varying the offset of the sphere 48 from this axis 50 , a stream of material entering the housing 41 through the inlet 44 can be adjustably divided to flow through the main outlet 20 and the diverted flow or secondary outlet 22 . if the sphere 48 is rocked away from the secondary outlet 22 , the flow through the secondary outlet 22 is increased and the flow through the main outlet 20 is decreased . when the sphere 48 is tilted towards the secondary outlet 22 the opposite effect occurs . the shaft 49 is adjusted to a position corresponding to a desired ratio of flow between the main outlet 20 and minor outlet 22 . the mill 18 is preferably an impact - type unit having a rotor or impeller that throws material against a stationary anvil surface to fracture particulate matter into smaller particles . this type of mill has been found to be especially effective in practicing the present invention for reclaiming metallic aluminum from aluminum dross . it has been found that to achieve high recovery of metallic aluminum , dross material should be repeatedly run through the mill 18 and impacted against the anvil . moreover , in accordance with the invention to achieve a high concentration the number of passes of material through the mill 18 should vary in relation to the particle size of the material being processed . in general , it has been found that , surprisingly , the larger the particle size the fewer passes through the mill 18 are required . smaller size particles require a greater number of passes through the mill to achieve a high recovery of metallic aluminum . in operation , dross is milled or crushed in the impact mill 18 . the conveyor or elevator 13 recirculates this milled material for additional passes through the mill 18 . a small percentage of the material passing through the conveyor 13 is diverted by the percent divider or diverter 16 . this percent may typically be in the range of 4 to 5 %, for example . the diverted material is carried to the screens 26a - 26d where it is classified according to particle size . a certain part of the flow off the top of each screen , determined by experimentation , is returned to the mill 18 via the associated through - put device 28 and the conveyor 12 . the residual part of the flow off the top of a screen is finished product discharged by the through - put device 28 through the discharge 32 . each of the through - put devices 28 , which governs the ratio of its returned material flow and its product flow through its respective discharges 31 , 32 , has its metering speed adjusted so that for the particular size of the material it is handling the material is circulated , on average , a desired number of passes through the mill 18 before it eventually is sent through the final discharge 32 . by way of example , the respective through - put devices 28 are adjusted so that on average , the material off the first screen is sent through the mill 18 for about 20 to 30 times , while the material off the fourth screen is sent through the mill about 80 to 150 times as determined by experimentation . the material off of the intermediate screens is sent through the mill a proportionately greater number of times than the first screen and fewer times than the fourth screen . the material passing through the last screen can be collected by vacuum into the bag house 38 or can be otherwise collected , used or discarded . the conveyor 12 , which in the illustrated case is a screw conveyor , automatically adds a volume of new dross material from the input hopper or supply 11 equal to the volume of material generated as product and the volume drawn by the vacuum to the bag house throughout the system and the volume through the last screen whether it is drawn off by vacuum or is otherwise continuously or periodically removed . it will be understood that , for the most part , the non - metallic component of the dross is converted by the mill 18 to dust , i . e . to a particle size where it can be airborne and drawn off at appropriate locations in the system by a vacuum induced air flow to the bag house 38 . excellent recovery of aluminum can be obtained from large chunks of dross by subjecting this material to the same number of passes through the impact mill . in this case , the percent divider 16 can be set to divert a certain percent of material out of the stream of the circulating load going through the mill 18 and simply channel this material for screening as finished product . by way of example , the percent divider 16 , in this dross processing mode can be set to divert about 3 % to produce an average of about 32 passes through the mill . concentrations as high as 85 % aluminum content have been produced by this technique . it should be evident that this disclosure is by way of example and that various changes may be made by adding , modifying or eliminating details without departing from the fair scope of the teaching contained in this disclosure . for example , the input hopper 11 and screw conveyor 12 and bucket elevator 13 can be replaced or augmented by a belt weighing system and belt conveyors where the dross particles are difficult to handle in a screw conveyor and bucket elevator . the invention is therefore not limited to particular details of this disclosure except to the extent that the following claims are necessarily so limited .

US-5708698-A

a silver halide photographic light - sensitive material is disclosed . the material is comprised of a support base having provided thereon a hydrophilic colloid layer and a silver halide emulsion layer . the silver halide emulsion layer contains tubular silver halide grains having a diameter at least 3 times their thickness and also contains a compound represented by general formula or : ## str1 ## the substituents are defined within the specification . the material obtains the advantages of utilizing tabular silver halide grains while having a reduced dependents of its photographic properties on development processing conditions which normally effect materials containing tabular silver halide grains .

examples of the hetero ring nucleus completed by z 1 in the above general formula ( i ) include oxazoles ( e . g ., oxazole , 4 - methyloxazole , 4 , 5 - dimethyloxazole , etc . ), benzoxazoles ( e . g ., benzoxazole , 5 - chlorobenzoxazole , 5 - methylbenzoxazole , 5 - methoxybenzoxazole , 5 - phenylbenzoxazole , 5 , 6 - dimethylbenzoxazole , etc . ), naphthoxazoles ( e . g ., naphtho [ 1 , 2 - d ] oxazole , naphtho [ 2 , 1 - d ] oxazole , naphtho [ 2 , 3 - d ] oxazole , etc . ), and the like . examples of the hetero ring nucleus completed by z 2 in the above general formula ( i ) include oxazoles ( e . g ., oxazole , 4 - methyloxazole , 4 , 5 - dimethyloxazole , etc . ), benzoxazoles ( e . g ., benzoxazole , 5 - chlorobenzoxazole , 5 - methylbenzoxazole , 5 - methoxybenzoxazole , 5 - phenylbenzoxazole , 5 , 6 - dimethylbenzoxazole , etc . ), naphthoxazoles ( e . g ., naphtho [ 1 , 2 - d ] oxazole , naphtho [ 2 , 1 - d ] oxazole , naphtho [ 2 , 3 - d ] oxazole , etc . ), thiazoles ( e . g ., thiazole , 4 - methylthiazole , 4 , 5 - dimethylthiazole , etc . ), benzothiazoles ( e . g ., benzothiazole , 5 - chlorobenzothiazole , 5 - methylbenzothiazole , 6 - methylbenzothiazole , 5 - bromobenzothiazole , 5 - phenylbenzothiazole , 5 - methoxybenzothiazole , 6 - methoxybenzothiazole , 5 - hydroxybenzothiazole , 6 - hydroxybenzothiazole , 5 - ethoxy - 6 - methylbenzothiazole , 5 - hydroxy - 6 - methylbenzothiazole , 5 , 6 - dimethylbenzothiazole , 5 - chloro - 6 - methylbenzothiazole , etc . ), naphthothiazoles ( e . g ., naphtho [ 1 , 2 - d ] thiazole , naphtho [ 2 , 1 - d ] thiazole , naphtho [ 2 , 3 - d ] thiazole , etc . ), and the like . examples of the alkyl group represented by r 1 and r 2 in the general formula ( i ) include a methyl group , an ethyl group , a n - propyl group , a n - butyl group , etc . examples of the substituted alkyl group represented by r 1 and r 2 include a hydroxyalkyl group ( e . g ., a 2 - hydroxyethyl group , a 3 - hydroxypropyl group , a 4 - hydroxybutyl group , etc . ), an acetoxyalkyl group ( e . g ., a β - acetoxyethyl group , a γ - acetoxypropyl group , etc , an alkoxyalkyl group ( e . g ., a β - methoxyethyl group , a γ - methoxypropyl group , etc . ), an alkoxycarbonylalkyl group ( e . g ., a β - methoxycarbonylethyl group , a β - ethoxycarbonylethyl group , a γ - methoxycarbonylpropyl group , a δ - ethoxycarbonylbutyl group , etc . ), a carboxyalkyl group ( e . g ., a carboxymethyl group , a β - carboxyethyl group , a γ - carboxypropyl group , a δcarboxybutyl group , etc . ), a sulfoalkyl group ( e . g ., a β - sulfoethyl group , a γ - sulfopropyl group , a γ - sulfobutyl group , a δ - sulfobutyl group , a 2 -( 3 - sulfopropoxy ) ethyl group , a 2 -[ 2 -( 3 - sulfopropoxy ) ethoxy ] ethyl group , etc . ), an allyl group ( i . e ., a vinylmethyl group ), a cyanoalkyl group ( e . g ., a β - cyanoethyl group , etc . ), a carbamoylalkyl group ( e . g ., a β - carbamoylethyl group , a γ - carbamoylpropyl group , etc . ), an aralkyl group ( e . g ., a benzyl group , a 2 - phenylethyl group , a 2 -( 4 - sulfophenyl ) ethyl group , etc . ), and the like . as the alkyl group , those which contain 1 to 8 carbon atoms are preferable and , as the substituted alkyl group , those which contain 1 to 10 carbon atoms are preferable . as the hereto ring nucleus completed by z 3 in the foregoing general formula ( ii ), there are illustrated those which are the same as are illustrated with respect to z 1 in the general formula ( i ). examples of r 3 are also the same as are illustrated with respect to r 1 and r 2 in the general formula ( i ). examples of the alkyl group represented by r 4 in the general formula ( ii ) include a methyl group , an ethyl group , a n - propyl group , a n - butyl group , etc . examples of the substituted alkyl group represented by r 4 include a sulfoalkyl group ( e . g ., a 2 - sulfoethyl group , a 3 - sulfopropyl group , a 3 - sulfobutyl group , a 4 - sulfobutyl group , etc . ), a carboxyalkyl group ( e . g ., a 2 - carboxyethyl group , a 3 - carboxypropyl group , a 4 - carboxybutyl group , a carboxymethyl group , etc . ), a hydroxyalkyl group ( e . g ., a 2 - hydroxyethyl group , a 3 - hydroxypropyl group , a 4 - hydroxybutyl group , etc . ), an alkoxyalkyl group ( e . g ., a 2 - methoxyethyl group , a 3 - methoxypropyl group , etc . ), an acyloxyalkyl group ( preferably acetoxyalkyl group , e . g ., a 2 - acetoxyethyl group , etc . ), an alkoxycarbonylalkyl group ( e . g ., a methoxycarbonylmethyl group , an ethoxycarbonylmethyl group , a 2 - methoxycarbonylethyl group , a 4 - ethoxycarbonylbutyl group , etc . ), a substituted alkoxyalkyl group ( e . g ., a hydroxymethoxymethyl group , a 2 - hydroxyethoxymethyl group , a 2 -( 2 - hydroxyethoxy ) ethyl group , a 2 -( 2 - acetoxyethoxy ) ethyl group , an acetoxymethoxymethyl group , a methoxyethoxyethyl group , etc . ), a dialkylaminoalkyl group ( e . g ., a 2 - dimethylaminoethyl group , a 2 - diethylaminoethyl group , a 2 - piperidinoethyl group , a 2 - morpholinoethyl group , etc . ), an n -( n , n - dialkylaminoalkyl ) carbamoylalkyl group ( e . g ., an n -[ 3 -( n , n - dimethylamino ) propyl ] carbamoylmethyl group , an n -[ 2 -( n , n - diethylamino ) ethyl ] carbamoylmethyl group , an n -[ 3 -( morpholino ) propyl ] carbamoylmethyl group , an n -[ 3 -( piperidino ) propyl ] carbamoylmethyl group , etc . ), an n -( n , n , n - trialkylammonioalkyl ) carbamoylalkyl group ( e . g ., an n -[ 3 -( n , n , n - trimethylammonio ) propyl ] carbamoylmethyl group , an n -[ 3 -( n , n , n - triethylammonio ) propyl ] carbamoylmethyl group , an n -[ 3 -( n - methylpiperidinio ) propyl ] carbamoylmethyl group , etc . ), an n , n , n - trialkylammonioalkyl group ( e . g ., an n , n - diethyl - n - methylammonioethyl group , an n , n , n - triethylammonioethyl group , etc . ), a cyanoalkyl group ( e . g ., a 2 - cyanoethyl group , a 3 - cyanopropyl group , etc . ), a carbamoylalkyl group ( e . g ., a 2 - carbamoylethyl group , a 3 - carbamoylpropyl group , etc . ), a hetero ring - substituted alkyl group ( e . g ., a tetrahydrofurfuryl group , a furfuryl group , etc . ), an allyl group ( i . e ., a vinylmethyl group ), an aralkyl group ( e . g ., a benzyl group , a 2 - phenylethyl group , etc . ), and the like . examples of the aryl group and the substituted aryl group represented by r 4 include an aryl group ( e . g ., a phenyl group , etc . ), and a substituted aryl group ( e . g ., p - chlorophenyl group , a p - tolyl group , a p - methoxyphenyl group , a p - carboxyphenyl group , a m - carboxyphenyl group , a p - methoxycarbonylphenyl group , a m - acetylaminophenyl group , a p - acetylaminophenyl group , a m - dialkylaminophenyl group ( e . g ., a m - dimethylaminophenyl group ), a p - dialkylaminophenyl group ( e . g ., a p - dimethylaminophenyl group ), etc . ), and the like . as the alkyl group , those which contain 1 to 8 carbon atoms are preferable and , as the substituted alkyl group , those which contain 1 to 10 carbon atoms are preferable . preferable examples of the substituted alkyl group include a hydroxyalkyl group , an acetoxyalkyl group , an alkoxyalkyl group , a substituted alkoxyalkyl group , an alkoxycarbonylalkyl group , a carboxyalkyl group , a sulfoalkyl group , an allyl group , a carbamoylalkyl group , an n -( n , n - dialkylaminoalkyl ) carbamoylalkyl group , an n -( n , n , n - trialkylammonioalkyl ) carbamoylalkyl group , an aralkyl group , a hetero ring - substituted alkyl group . as the aryl group and the substituted aryl groups , those which contain 6 to 10 carbon atoms are preferable . the compound represented by the general formula ( ii ) contain at least one alkyl group substituted with an organic acid group ( for example , a carboxy group , a sulfo group , etc .). examples of the acid anion represented by x include an iodine ion , a p - toluene sulfonate ion , a methylsulfate ion , a bromine ion , and the like . among the compounds represented by the general formula ( i ), these wherein z 1 represents atoms necessary to complete a benzoxazole and z 2 represents atoms necessary to complete a benzoxazole or a benzothiazole are preferable . in such case , more preferred benzoxazole and the benzothiazole completed by z 1 or z 2 are those substituted with a phenyl group or a chlorine atom , particularly preferably substituted with a phenyl group . r 1 or / and r 2 are preferably an alkyl group substituted with an organic acid group ( for example , a carboxy group , a sulfo group , etc .). particularly preferably both r 1 and r 2 are an alkyl group substituted with an organic acid group . among the compounds represented by the general formula ( ii ), r 3 or / and r 4 are preferably an alkyl group substituted with the organic acid group . z 3 preferably represents atoms necessary to complete a benzoxazole , more preferably a benzoxazole substituted with a phenyl group or a chlorine atom , and most preferably a benzoxazole substituted with a phenyl group . typical specific examples of the compounds represented by the general formula ( i ) and ( ii ) are illustrated below . ## str3 ## the compounds represented by the general formulae ( i ) and ( ii ) are known and easily available , or may be easily synthesized according to the descriptions given in the following literatures : f . m . hamer , the chemistry of heterocyclic compounds ; the cyanine dyes and related compounds , p . 58 and p . 536 ( john wiley & amp ; sons ( new york , london , 1964 ). to the silver halide emulsion layer containing the tabular grains are added the compounds represented by the general formula ( i ) or ( ii ) alone or in combination . the compounds represented by the general formula ( i ) or ( ii ) are added in amounts of 0 . 01 to 10 m mols , preferably 0 . 05 to 1 . 0 m mol , per mol of silver halide in the tabular grains - containing silver halide emulsion layer . the compound may be added to the emulsion layer by any generally known method . the compounds may be added thereto in any stage in the process of manufacturing silver halide photographic light - sensitive materials ; for example , during production of a silver halide emulsion ( e . g ., during or after postripening ) or immediately before coating the emulsion . tabular silver halide grains to be used in the present invention will be described below . tabular silver halide grains of the present invention have a diameter - to - thickness ratio of 3 or more , preferably 5 or more , more preferably 5 to 50 , particularly preferably 7 to 20 . by the term &# 34 ; diameter of silver grains &# 34 ; is meant a diameter of a circle having an equal area to the projected area of the grain . in the present invention , the diameters of the tabular silver halide grains range from 0 . 5 to 5 . 0μ , preferably from 1 . 0 to 4 . 0μ . in general , tabular silver halide grains are in a tabular form having two parallel planes . therefore , in the present invention &# 34 ; thickness &# 34 ; of grain is presented as a distance between the two parallel planes constituting the tabular silver halide grain . as to silver halide composition of the tabular silver halide grains , silver bromide and silver bromoiodide are preferable , with silver bromoiodide containing 0 to 10 mol % silver iodide being particularly preferable . processes for preparing the tabular silver halide grains are described below . the tabular silver halide grains can be prepared by properly combining processes known to those skilled in the art ; for example , by forming seed crystals containing 40 % by weight or more tabular grains in an environment of a comparatively high pag value of , for example , not more than 1 . 3 in pbr , then simultaneously adding thereto a silver salt solution and a halide solution with keeping the pbr at about the same level to thereby allow the seed crystals to grow . in the course of the growth of the grains , addition of the silver salt solution and the halide solution are desirable so as not to form new crystal nuclei . the size of tabular silver halide grain can be properly adjusted by adjusting temperature , selecting the proper kind and amount of solvent , and controlling the speed of adding the silver salt and the halide upon growth of the grains . in production of the tabular silver halide grains of the present invention , a silver halide solvent may be used , if desired , for controlling grain size , form of grain ( e . g ., diameter - to - thickness ratio ), particle size distribution of the grains , and the grains - growing rate . such solvent is used in an amount of 10 3 - 3 to 1 . 0 wt %, particularly 10 - 2 to 10 - 1 wt %, based on the reaction solution . for example , particle size distribution can be made monodispersed and the grain growth rate can be accelerated by increasing the amount of the solvent used . on the other hand , the use of an increased amount of the solvent tends to increase the thickness of the resulting grains . silver halide solvents often used include ammonia , thioethers , thioureas , etc . as to thioethers , reference can be made to u . s . pat . nos . 3 , 271 , 157 , 3 , 790 , 387 , 3 , 574 , 628 , etc . upon production of the tabular silver halide grains of the present invention , the silver salt solution ( for example , a silver nitrate aqueous solution ) and the halide solution ( for example , a potassium bromide aqueous solution ) are added preferably in such manner that the adding rate , added amounts and added concentration are increased for accelerating the particle growth . as to the process for producing silver halide grains , reference can be made to british pat . no . 1 , 335 , 925 , u . s . pat . nos . 3 , 672 , 900 , 3 , 650 , 757 and 4 , 242 , 445 , and japanese patent application ( opi ) nos . 142329 / 80 and 158124 / 80 , etc . the tabular silver halide grains of the present invention can be chemically sensitized as the occasion demands . as the chemically sensitizing methods , gold sensitization using a so - called gold compound ( e . g ., u . s . pat . nos . 2 , 448 , 060 and 3 , 320 , 069 , etc . ), metal sensitization using iridium , platinum , rhodium , palladium , etc . ( e . g ., u . s . pat . nos . 2 , 448 , 060 , 2 , 566 , 245 and 2 , 566 , 263 , etc . ), sulfur sensitization using a sulfur - containing compound ( e . g ., u . s . pat . no . 2 , 222 , 264 , etc . ), and reduction sensitization using a tin salt or a polyamine ( e . g ., u . s . pat . nos . 2 , 487 , 850 , 2 , 518 , 698 and 2 , 521 , 925 , etc .) can be employed alone or in a combination of two or more of them . with respect to saving silver , the tabular silver halide grains of the present invention are preferably subjected to gold sensitization , sulfur sensitization or a combination thereof . a layer containing the tabular silver halide grains of the present invention preferably contains 40 % by weight or more , particularly preferably 60 % by weight or more , of the tabular grains based on the whole silver halide grains . the layer containing the tabular silver halide grains preferably has a thickness of 0 . 3 to 5 . 0μ , particularly preferably 0 . 5 to 3 . 0μ . the tabular silver halide grains are preferably coated in an amount of 0 . 5 to 6 g / m 2 , particularly preferably 1 to 4 g / m 2 ( per one side of a support ). other constituents of the layer containing the tabular silver halide grains of the present invention , such as a binder , a hardener , an antifoggant , a silver halide - stabilizing agent , a surfactant , an optically sensitizing agent , a dye , an ultraviolet ray absorbent , a chemically sensitizing agent , etc . are not particularly limited , and referance can be made to , for example , research disclosure , vol . 176 , pp . 22 to 28 ( dec ., 1978 ). ordinary silver halide grains may be incorporated in the emulsion layer of the silver halide light - sensitive material of the present invention in addition to the tabular silver halide grains . such grains can be prepared by processed described in p . grafkides , chimie et physique photographique , ( published by paul montel in 1967 ); g . f . duffin , photographic emulsion chemistry , ( the focal press , 1966 ); and v . l . zelikman et al , making and coating photographic emulsion , ( the focal press , 1964 ), that is , by any of an acidic process , a neutral process , an ammoniacal process , etc . as to the manner of reacting a soluble silver salt with a soluble halide salt , any of one side mixing , simultaneous mixing , and their combination may be employed . a process of forming grains in the presence of excess silver ion ( called reverse mixing process ) can be employed as well . as one type of the simultaneous mixing , a process called controlled double jet process wherein pag in a liquid phase in which silver halide is formed is kept constant can be employed . as silver halide , any of silver bromide , silver bromoiodide , silver chlorobromoiodide , silver chlorobromide , and silver chloride may be used . during formation or physical ripening of silver halide grains , cadmium salts , zinc salts , lead salts , thallium salts , iridium salts or the complex salts thereof , rhodium salts or the complex salts thereof , iron salts or the complex salts thereof , etc . may be allowed to coexist . if desired , the grains may be chemically sensitized in the same manner as with the tabular silver halide grains . various compounds may be incorporated in the photographic emulsion to be used in the present invention for preventing fogging of light - sensitive materials during their production , storage or photographic processing or for stabilizing photographic properties of the materials . that is , known antifoggants or stabilizers can be added , for example , azoles ( e . g ., benzothiazolium salts , nitroindazoles , nitrobenzimidazoles , chlorobenzimidazoles , bromobenzimidazoles , mercaptothiazoles , mercaptobenzothiazoles , mercaptobenzimidazoles , mercaptothiadiazoles , aminotriazoles , benzotriazoles , nitrobenzotriazoles , mercaptotetrazoles ( particularly , 1 - phenyl - 5 - mercaptotetrazole ), etc . ); mercaptopyrimidines ; mercaptotriazines ; thioketo compounds such as oxazolinethione ; azaindenes ( e . g ., triazaindenes , tetrazaindenes ( particularly , 4 - hydroxy - substituted ( 1 , 3 , 3a , 7 ) tetrazaindenes ), pentazaindenes , etc . ); benzenethiosulfonic acid ; benzenesulfinic acid ; benzenesulfonic acid amide ; etc . for example , those described in u . s . pat . nos . 3 , 954 , 474 , and 3 , 982 , 947 , and japanese patent publication no . 28660 / 77 can be used . the photographic emulsion to be used in the present invention may be spectrally sensitized with methine dyes or the like . useful sensitizing dyes are those described in , for example , german pat . no . 929 , 080 , u . s . pat . nos . 2 , 493 , 748 , 2 , 503 , 776 , 2 , 519 , 001 , 2 , 912 , 329 , 3 , 656 , 959 , 3 , 672 , 897 , 3 , 694 , 217 , 4 , 025 , 349 and 4 , 046 , 572 , british pat . no . 1 , 242 , 588 and japanese patent publication nos . 14030 / 69 and 24844 / 77 . these sensitizing dyes may be used alone or in a combination . combinations of sensitizing dyes are often employed particularly for the purpose of supersensitization . typical examples thereof are described in u . s . pat . nos . 2 , 688 , 545 , 2 , 977 , 229 , 3 , 397 , 060 , 3 , 522 , 052 , 3 , 527 , 641 , 3 , 617 , 293 , 3 , 628 , 964 , 3 , 666 , 480 , 3 , 672 , 898 , 3 , 679 , 428 , 3 , 703 , 377 , 3 , 814 , 609 , 3 , 837 , 862 and 4 , 026 , 707 , british pat . nos . 1 , 344 , 281 and 1 , 507 , 803 , japanese patent publication nos . 4936 / 68 , 12375 / 78 and japanese patent application ( opi ) nos . 110618 / 77 and 109925 / 77 . a dye which itself does not have a spectrally sensitizing effect or a substance which substantially does not absorb visible light and which shows a supersensitizing effect may be incorporated together with the sensitizing dye . for example , aminostilbene compounds substituted by a nitrogen - containing hetero ring group ( e . g ., those described in u . s . pat . nos . 2 , 933 , 390 and 3 , 635 , 721 ), aromatic organic acid - formaldehyde condensates ( for example , those described in u . s . pat . no . 3 , 743 , 510 ), cadmium salts , azaindene compounds , etc . may be incorporated . combinations described in u . s . pat . nos . 3 , 615 , 613 , 3 , 615 , 641 , 3 , 617 , 295 , and 3 , 635 , 721 are particularly useful . the photographic light - sensitive material of the present invention can contain in its photographic emulsion layer color - forming couplers capable of forming color by oxidative coupling with an aromatic primary amine developing agent ( for example , a phenylenediamine derivative or an aminophenol derivative ) in color development processing . for example , magenta couplers include 5 - pyrazolone couplers , pyrazolobenzimidazole couplers , cyanoacetylcoumarone couplers , open - chain acylacetonitrile couplers , etc ., yellow couplers include acylacetamide couplers ( e . g ., benzoylacetanilide couplers , pyvaloylacetanilide couplers , etc . ), and cyan couplers include naphthol couplers and phenol couplers . of these couplers , non - diffusible couplers having a hydrophobic group called ballast group are desirable . the couplers may be of either 4 - equivalent type or 2 - equivalent type with respect to silver ion . colored couplers having color - correcting effect or couplers capable of releasing a development inhibitor upon development ( called dir couplers ) may also be used . in addition to dir couplers , dir coupling compounds capable of forming a colorless coupling reaction product and releasing a development inhibitor may also be incorporated . other constitutions of the emulsion layer of the silver halide photographic light - sensitive material in accordance with the present invention are not particularly limited , and various additives may be used as the occasion demands . for example , binders , surfactants , uv ray absorbents , hardeners , coating aids , thickening agents , etc . described in research disclosure , 176 , pp . 22 - 28 ( dec . 1978 ) may be used . the photographic material of the present invention preferably has on its surface a surface - protecting layer containing as a major component a synthetic or natural high polymer substance such as gelatin , water - soluble polyvinyl compound or acrylamide polymer ( see , for example , u . s . pat . nos . 3 , 142 , 568 , 3 , 193 , 386 , and 3 , 062 , 674 ). the surface - protecting layer may contain , in addition to gelatin or other high molecular substance , a surfactant , antistatic agent , a matting agent , a slipping agent , a hardener , a thickening agent , etc . the photographic material of the present invention may also include an interlayer , a filter layer , an antihalation layer , etc . the photographic emulsion layers and other layers of the photographic light - sensitive material of the present invention are coated on a flexible support such as plastic film , paper or cloth or on a rigid support such as glass , porcelain or metal , usually used for photographic light - sensitive materials . useful flexible supports include films composed of semi - synthetic or synthetic high polymers such as cellulose nitrate , cellulose acetate , cellulose acetate butyrate , polystyrene , polyvinyl chloride , polyethylene terephthalate , polycarbonate , etc . and papers coated or laminated with a baryta layer or an α - olefin polymer ( for example , polyethylene , polypropylene , ethylene / butene copolymer , etc .). the support may be colored with a dye or a pigment , or may be blackened for intercepting light . the surface of the support is generally subbed for improving adhesion to a photographic emulsion layer or the like . the support surface may be subjected to corona discharge treatment , uv ray irradiation , or flame treatment before or after the subbing treatment . in the present invention , processes for coating a tabular grains - containing layer , an emulsion layer , and a surface - protecting layer on a support are not particularly limited , and processes of simultaneously coating multilayers described in , for example , u . s . pat . nos . 2 , 761 , 418 , 3 , 508 , 947 , 2 , 761 , 791 , etc . can be preferably used . as to the stratum structure of the photographic material of the present invention , various structures are possible . for example , there are : ( 1 ) a stratum structure wherein a layer containing tabular silver halide grains in accordance with the present invention is provided on a support , a silver halide emulsion layer containing high speed silver halide grains of comparatively large particle size ( 0 . 5 to 3 . 0μ ) having a spherical form or having a diameter - to - thickness ratio of less than 3 is provided thereon , and a surface - protecting layer of gelatin or the like is further coated on the silver halide emulsion layer ; ( 2 ) a stratum structure wherein a tabular silver halide grains - containing layer is provided on a support , a plurality of silver halide emulsion layers are provided thereon , and a surface - protecting gelatin layer is further provided thereon ; ( 3 ) a stratum structure wherein one silver halide emulsion layer is provided on a support , a tubular silver halide grains - containing layer is provided thereon , a high - speed silver halide emulsion layer is provided thereon , and a surface - protecting gelatin layer on the high - speed silver halide emulsion layer ; ( 4 ) a stratum structure wherein a layer containing an ultraviolet ray absorbent or a dye , a tabular silver halide grains - containing layer , a silver halide emulsion layer , and a surface - protecting gelatin layer are provided in this order on a support ; and ( 5 ) a stratum structure wherein a layer containing tabular silver halide grains and an ultraviolet ray absorbent or a dye , a silver halide emulsion layer , and a surface - protecting gelatin layer are provided in this order on a support . in these embodiments , the silver halide emulsion layer is not necessarily a single layer and may be composed of a plurality of silver halide emulsion layers spectrally sensitized to different wavelength regions . the silver halide photographic light - sensitive material of the present invention specifically includes color photographic light - sensitive materials such as color negative films , color reversal films , color papers , etc . as well as black - and - white photographic light - sensitive materials such as x - ray light - sensitive materials ( for indirect x - ray or direct x - ray irradiation ), lithographic light - sensitive materials , black - and - white photographic printing papers , black - and - white negative films , etc . x - ray light - sensitive materials which are to be subjected to high - temperature , accelerated development processing obtain the most remarkable effects . in photographic processing of the light - sensitive materials of the present invention , any of known processes and known processing solutions described in , for example , research disclosure , no . 176 , pages 28 - 30 may be employed . such processing may be a black - and - white photographic processing for forming a silver image or a color photographic processing for forming a dye image depending upon the purpose . processing temperature is usually selected between 18 ° to 50 ° c . however , temperatures lower than 18 ° c . or higher than 50 ° c . may be employed . the developing solution for conducting black - and - white photographic processing can contain known developing agents . as the developing agents , dihydroxybenzenes ( e . g ., hydroquinone ), 3 - pyrazolidones ( e . g ., 1 - phenyl - 3 - pyrazolidone ), aminophenols ( e . g ., n - methyl - p - aminophenol ), etc . can be used alone or in combination . generally , the developing solution further contains known preservatives , alkali agents , ph buffers , antifogging agents , etc . and , if desired , may further contain dissolving aids , toning agents , development accelerators ( e . g ., quaternary salts , hydrazine , benzyl alcohol , etc . ), surfactants , defoaming agents , water - softening agents , hardeners ( e . g ., glutaraldehyde ), viscosity - imparting agents , etc . so - called &# 34 ; lith - type &# 34 ; development processing may be applied to the photographic emulsion of the present invention . &# 34 ; lith - type &# 34 ; development processing means a development processing of using usually a dihydroxybenzene as a developing agent and conducting development in an infectious manner at a low sulfite ion concentration for photographically reproducing line images or halftone dot images . ( detailed descriptions are given in mason , photographic processing chemistry , ( 1966 ), pp . 163 - 165 . as a special type development processing , a developing agent may be incorporated in a light - sensitive material , for example , in an emulsion layer , the resulting light - sensitive material being processed in an alkaline aqueous solution to develop . of the developing agents , hydrophobic ones can be incorporated in an emulsion according to various techniques described in research disclosure , no . 169 , u . s . pat . no . 2 , 739 , 890 , british pat . no . 813 , 253 and west german pat . no . 1 , 547 , 763 , etc . such development processing may be combined with a processing of stabilizing silver salt with a thiocyanate . as a fixing solution , those which have the same formulation as are ordinarily employed can be used . as a fixing agent , organic sulfur compounds can be used as well as thiosulfates and thiocyanates . the fixing solution may contain an aqueous aluminum salt as a hardener . in forming dye images , ordinary processes can be employed . for example , there may be employed a negative - positive process ( described in , for example , journal of the society of motion picture and television engineers , vol . 61 , pp . 667 - 701 ( 1953 ); a color reversal process of forming a negative silver image by developing with a developing solution containing , a black - and - white developing agent , conducting at least once uniform exposure or other proper fogging processing , and subsequently conducting color development to thereby obtain positive dye images ; a silver dye - bleaching process of developing a silver image by developing a dye - containing photographic emulsion layer after imagewise exposure to thereby form a silver image , and bleaching the dye using the silver image as a bleaching catalyst . a color developing solution generally comprises an alkaline aqueous solution containing a color - developing agent . as the color - developing agent , known primary aromatic amine developing agents such as phenylenediamines ( e . g ., 4 - amino - n , n - diethylaniline , 3 - methyl - 4 - amino - n , n - diethylaniline , 4 - amino - n - ethyl - n - β - hydroxyethylaniline , 3 - methyl - 4 - amino - n - ethyl - n - β - hydroxyethylaniline , 3 - methyl - 4 - amino - n - ethyl - n - β - methanesulfamidoethylaniline , 4 - amino - 3 - methyl - n - ethyl - n - β - methoxyethylaniline , etc .) can be used . in addition , those described in l . f . a . mason , photographic processing chemistry , ( focal press , 1966 ), pp . 226 - 229 , u . s . pat . nos . 2 , 193 , 015 and 2 , 592 , 364 and japanese patent application ( opi ) no . 64933 / 73 , etc . can be used . to the color developing solution may further be added , if desired , a ph buffer , a development restrainer , an antifogging agent , a water softener , a preservative , an organic solvent , a development accelerating agent , an carboxylic acid type chelating agent , etc . specific examples of these additives are described in research disclosure , u . s . pat . no . 4 , 083 , 723 and west german patent application ( ols ) no . 2 , 622 , 950 , etc . the present invention remarkably reduces fluctuation in photographic properties caused by change in development processing conditions , without concurrent reduction in sensitivity , by adding a compound represented by the general formula ( i ) or ( ii ) to a silver halide emulsion layer containing the aforementioned tabular silver halide grains . this effect is conspicous with high temperature , accelerated processing ( for example , at 28 ° c . or above for 30 seconds or shorter ). in particular , the present invention is effective for high - temperature , accelerated processing conducted by adding an aldehyde type hardener ( glutaraldehyde or the like ) to a developing solution . the present invention will now be described in more detail by referring to following non - limiting examples of preferred embodiments of the present invention . 30 g of gelatin , 10 . 3 g of potassium bromide , and 10 cc of a 0 . 5 wt % thioether ( ho ( ch 2 ) 2 -- s --( ch 2 ) 2 -- s --( ch 2 ) 2 oh ) aqueous solution were added to 1 liter of water , and the resulting solution was kept in a vessel at 70 ° c . under stirring . to the vessel , solutions shown in table 1 below were added with keeping pag of 9 . 1 and ph of 6 . 5 . that is , the following solutions i and ii were simultaneously added thereto in 15 seconds , followed by simultaneously adding thereto solutions iii and iv in 65 minutes according to a double jet method . in addition , during the addition of the solutions iii and iv , solution v was simultaneously added thereto in 15 minutes . table 1__________________________________________________________________________ solution solution solution solution solution i ii iii iv v__________________________________________________________________________agno . sub . 3 ( g ) 4 . 5 -- 95 . 5 -- -- h . sub . 2 o ( cc ) 17 16 . 7 561 542 100kbr ( g ) -- 3 . 15 -- 69 . 6 -- ki ( g ) -- -- -- -- 1 . 55 wt % aq . soln . of -- 0 . 45 -- 15 . 0 -- ho ( ch . sub . 2 ). sub . 2 s ( ch . sub . 2 ). sub . 2 s ( ch . sub . 2 ). sub . 2 oh ( cc ) __________________________________________________________________________ the tabular silver halide grains thus obtained had a mean diameter of 2 . 3μ and an average diameter - to - thickness ratio of 10 and contained 1 . 5 mol % of agi . then , an antifogging agent ( 4 - hydroxy - 6 - methyl - 1 , 3 , 3a , 7 - tetrazaindene ), a coating aid ( dodecylbenzenesulfonate ), and a thickening agent ( polypotassium p - vinylbenzene - sulfonate ) were added thereto to prepare a coating solution . this solution had a silver - to - gelatin ratio of 1 . 55 by weight . then , a 10 wt % gelatin aqueous solution containing gelatin , sodium polystyrenesulfonate , polymethyl methacrylate fine particles ( mean particle size : 3 . 0μ ), saponin , and 2 , 4 - dichloro - 6 - hydroxy - s - triazine was prepared as a coating solution for forming a surface - protecting layer . next , on a polyethylene terephthalate film support were coated in sequence a silver halide emulsion layer composed of the above - described former coating solution and a surface - protecting layer composed of the above - described latter coating solution , then dried to prepare photographic material ( 1 ). in this occasion , the silver halide emulsion layer was coated in a silver amount of 2 . 8 g / m 2 , and the surface - protecting layer in a gelatin amount of 1 . 3 g / m 2 . photographic materials ( 2 ) to ( 6 ) were prepared by adding compounds i - 6 , i - 7 , and i - 10 and comparative compounds a and b , respectively , to the coating solution used for preparing the above - described photographic material ( 1 ). each of the thus - prepared photographic materials ( 1 ) to ( 6 ) was exposed using hi standard screen ( made by fuji photo film co ., ltd . ; using calcium tungstate ), then subjected to the following processing a or b . developing the photographic material at 35 ° c . for 25 seconds with a color developing solution designed for x - ray automatic developing machines , fuji rd - iii ( made by fuji photo film co ., ltd . ), fixing it at 35 ° c . for 25 seconds with a fixing solution designed for x - ray automatic developing machines , fuji f ( made by fuji photo film co ., ltd . ), then washing and drying it . the same as the above - described processing a except for additionally adding 11 . 4 g / liter of kbr to the developing solution , rd - iii . the sensitivity of each of the thus - processed photographic materials was measured to obtain the results given in table 2 . in table 2 , sensitivity was presented as a logarithm of a reciprocal of an exposure amount necessary for attaining an effective density of 1 . 0 excluding fog . table 2__________________________________________________________________________ sensitivity difference between processing a and processing sensitivity difference b / sensitivity differencephotographic compound amount added based on ( 1 ) processed by between processing amaterial added ( mmol / mol - ag ) processing a ( δlog e ) and processing b with__________________________________________________________________________ ( 1 )( 1 ) none -- 0 1 . 0 ( 2 ) comparative 0 . 2 - 0 . 10 0 . 98 compound a ( 3 ) comparative 0 . 2 - 0 . 07 0 . 95 compound b ( 4 ) compound 0 . 2 - 0 . 02 0 . 20 i - 6 ( 5 ) compound 0 . 4 + 0 . 00 0 . 20 i - 7 ( 6 ) compound 0 . 2 - 0 . 05 0 . 19 i - 10__________________________________________________________________________ comparative compound a : 1phenyl - 5 - mercaptotetrazole comparative compound b : 5nitrobenzotriazole as is clear from the results given in table 2 , addition of 1 - phenyl - 5 - mercaptotetrazole or 5 - nitrobenzotriazole , conventionally known as a stabilizing agent , scarcely served to reduce dependence of photographic sensitivity on kbr concentration of the processing solution , but addition of the compound of the present invention ( photographic materials ( 4 ), ( 5 ), and ( 6 )) served to remarkably reduce dependence of sensitivity on kbr concentration . x - ray photographic material ( 11 ) was prepared as follows . spherical grains ( mean particle size : 1 . 35 μm ) of silver bromoiodide ( silver iodide : 1 . 5 mol %) were formed according to a double jet process in the presence of ammonia , then chemically sensitized with a chloroaurate and sodium thiosulfate . after completion of the chemical sensitization , anti - foggants of 1 - phenyl - 5 - mercaptotetrazole and 4 - hydroxy - 6 - methyl - 1 , 3 , 3a , 7 - tetrazaindene , a coating aid of dodecylbenzenesulfonate , and a thickening agent of polypotassium p - vinylbenzene - sulfonate were added thereto to prepare a coating solution . this coating solution had a silver - to - gelatin weight ratio of 1 . 05 . a 10 wt % gelatin aqueous solution containing gelatin , sodium polystyrenesulfonate , polymethyl methacrylate fine particles ( mean particle size : 3 . 0μ ), saponin , and 2 , 4 - dichloro - 6 - hydroxy - s - triazine was prepared as a solution for forming a surface - protecting layer . then , on a subbed , 180 μm thick polyethylene terephthalate film support were coated the silver halide emulsion layer composed of the above - described former coating solution and the surface - protecting layer composed of the above - described latter coating solution by a simultaneous extrusion coating technique , then dried to prepare comparative photographic material ( 11 ). in this occasion , the silver halide emulsion layer was coated in a silver amount of 4 . 0 g / m 2 , and the surface - protecting layer in a gelatin amount of 1 . 3 g / m 2 and in a thickness of 1 . 0μ . photographic materials ( 12 ) to ( 16 ) were prepared in the same manner as with photographic material ( 11 ) except for additionally adding compounds i - 7 , i - 10 , i - 11 , i - 6 and ii - 1 shown in table 2 , respectively , to the silver halide emulsion of the photographic material ( 11 ). 30 g of gelatin , 10 . 3 g of potassium bromide , and 10 cc of a 0 . 5 wt % thioether ( ho ( ch 2 ) 2 -- s --( ch 2 ) 2 -- s --( ch 2 ) 2 oh ) aqueous solution were added to 1 liter of water , and the resulting solution was kept in a vessel at 70 ° c . under stirring . to the vessel , solutions shown in table 3 below were added with keeping pag of 9 . 1 and ph of 6 . 6 . that is , the following solutions i and ii were simultaneously added thereto in 15 minutes , followed by simultaneously adding thereto solutions iii and iv &# 39 ; in 65 minutes according to a double jet method . in addition , during the addition of the solution iii and solution iv &# 39 ;, solution v was simultanously added thereto in 15 minutes ., after completion of the addition , the resulting emulsion was chemically sensitized with a chloroaurate and sodium thiosulfate . table 3__________________________________________________________________________ solution solution solution solution solution i ii iii iv &# 39 ; v__________________________________________________________________________agno . sub . 3 ( g ) 4 . 5 -- 95 . 5 -- -- h . sub . 2 o ( cc ) 17 16 . 7 561 542 100kbr ( g ) -- 3 . 15 -- 69 . 6 -- ki ( g ) -- -- -- -- 1 . 55 wt % aq . soln . of -- 0 . 45 -- 9 . 6 -- ho ( ch . sub . 2 ). sub . 2 s ( ch . sub . 2 ). sub . 2 s ( ch . sub . 2 ) oh ( cc ) __________________________________________________________________________ the tabular silver halide grains thus obtained had a mean diameter of 2 . 8μ and an average diameter - to - thickness ratio of 13 . then , an antifoggant , a coating aid , and a thickening agent were added to the resulting emulsion similarly with photographic material ( 11 ) to prepare a coating solution . this solution had a silver - to - gelatin weight ratio of 1 . 05 . then , this coating solution and the same coating solution for forming surface - protecting layer as used for photographic material ( 11 ) were used in the same manner as with photographic material ( 11 ) and coated to prepare photographic material ( 17 ). in this occasion , the silver halide emulsion layer was coated in a silver amount of 2 . 8 g / m 2 , and the surface - protecting layer in a gelatin amount of 1 . 3 g / m 2 . photographic materials ( 18 ) to ( 22 ) were prepared by adding compounds i - 7 , i - 10 , i - 11 , i - 6 and ii - 1 shown in table 4 , respectively , to the silver halide emulsion for preparing the photographic material ( 17 ). each of the thus - prepared photographic materials ( 11 ) to ( 22 ) was exposed using hi standard screen ( made by fuji photo film co ., ltd ., using calcium tungstate ), then subjected to the following processing a &# 39 ; or b &# 39 ;. developing the photographic material at 35 ° c . for 25 seconds with a developing solution of the following formulation , fixing it at 35 ° c . for 25 seconds with a fixing solution of the following formulation , then washing and drying it . ______________________________________developing solution a &# 39 ; 1 - phenyl - 3 - pyrazolidone 1 . 5 ghydroquinone 30 g5 - nitroindazole 0 . 25 gkbr 3 . 7 ganhydrous sodium sulfite 50 gpotassium hydroxide 20 gboric acid 10 g25 % glutaraldehyde aq . soln . 20 mlwater to make 1 liter ( ph : adjusted to 10 . 20 ) fixing solutionammonium thiosulfate 200 . 0 gsodium sulfite ( anhydrous ) 20 . 0 gboric acid 8 . 0 gdisodium ethylenediaminetetraacetate 0 . 1 galuminum sulfate 15 . 0 gsulfuric acid 2 . 0 gglacial acetic acid 22 . 0 gwater to make 1 . 0 liter ( ph : adjusted to 4 . 20 ) ______________________________________ the same as the above - described processing a &# 39 ; except for additionally adding 11 . 4 g / liter of kbr to the above - described developing solution a &# 39 ;. the sensitivity of each of the thus - processed photographic materials was measured to obtain the results given in table 4 . in table 4 , sensitivity was presented as a logarithm of a reciprocal of an exposure amount necessary for attaining an effective density of 1 . 0 excluding fog . table 4__________________________________________________________________________ sensitivity difference between processing a &# 39 ; and processing sensitivity difference b &# 39 ;/ sensitivity differencephotographic compound amount added based on ( 11 ) processed by between processing a &# 39 ; material added ( mmol / mol - ag ) processing a &# 39 ; ( δlog e ) and processing b &# 39 ; with__________________________________________________________________________ ( 11 )( 11 ) none -- 0 1 . 0 ( 12 ) i - 7 0 . 4 - 0 . 14 0 . 53 ( 13 ) i - 10 0 . 2 - 0 . 35 0 . 48 ( 14 ) i - 11 0 . 4 - 0 . 22 0 . 60 ( 15 ) i - 6 0 . 2 - 0 . 24 0 . 50 ( 16 ) ii - 1 0 . 33 - 0 . 21 0 . 62__________________________________________________________________________ sensitivity difference between processing a &# 39 ; and processing sensitivity difference b &# 39 ;/ sensitivity differencephotographic compound amount added based on ( 21 ) processed by between processing a &# 39 ; material added ( mmol / mol - ag ) processing a &# 39 ; ( δlog e ) and processing b &# 39 ; with__________________________________________________________________________ ( 21 )( 17 ) none -- 0 1 . 0 ( 18 ) i - 7 0 . 4 + 0 . 01 0 . 18 ( 19 ) i - 10 0 . 2 - 0 . 05 0 . 18 ( 20 ) i - 11 0 . 4 0 0 . 27 ( 21 ) i - 6 0 . 2 - 0 . 01 0 . 18 ( 22 ) ii - 1 0 . 33 + 0 . 03 0 . 36__________________________________________________________________________ as is clear from the results given in table 2 , the combination of the tabular grains - containing emulsion and the compound of the present invention ( see , table 4 ( b )) can remarkably reduce dependence of sensitivity on kbr concentration of the processing solution as compared with the case of adding the compound of the present invention to an ordinary emulsion ( containing spherical grains ) ( see , table 4 ( a )). in addition , with the comparative ordinary emulsion ( see , table 4 ( a )), serious desensitization took place , though dependence of sensitivity on kbr concentration was reduced to some extent , whereas the tabular grains - containing emulsion ( see , table 4 ( b )) underwent almost no fluctuation in sensitivity . on both sides of a subbed , 180 μm thick polyethylene terephthalate were coated the same tabular silver halide grains - containing emulsion layer as used in photographic material ( 17 ) in example 2 ( for u layer ), the same spherical silver halide - containing emulsion as used in photographic material ( 11 ) in example 2 ( for o layer ), and the same coating solution for forming surfaceprotecting layer as used in example 2 in this order according to a simultaneous extrusion coating method , and dried to prepare x - ray photographic material ( 23 ). additionally , the coating solution for forming surfaceprotecting layer further contained polyethylene oxide , c 16 h 33 o --( ch 2 ch 2 o ) 10 -- h . the resulting x - ray photographic material contained 2 . 0 g / m 2 of silver in the o layer and 1 . 4 g / m 2 of silver in the u layer . in addition , the surface - protecting layer contained 1 . 3 g / m 2 of gelatin and had a thickness of 1 . 0μ . photographic materials ( 24 ) to ( 28 ) of stratum structure were prepared in the same manner as with photographic material ( 23 ) using tabular silver halide grains - containing emulsions containing the compounds of the present invention as shown in table 5 like photographic materials ( 18 ) to ( 22 ) in example 2 . each of the thus prepared photographic materials ( 23 ) to ( 28 ) was exposed to x - rays using hi standard screen ( made by fuji photo film co ., ltd . ; using calcium tungstate ), then subjected to the following processings . the same as processing a &# 39 ; except for changing the developing temperature to 31 ° c . the same as processing a &# 39 ; except for changing the developing temperature to 38 ° c . sensitivity of each processed photographic material was measured to obtain the results shown in table 5 . in table 5 , sensitivity was presented as a logarithm of a reciprocal of an exposure amount necessary for attaining an effective density of 1 . 0 excluding fog . as is clear from table 5 , addition of the compounds of the present invention can remarkably reduce dependence of sensitivity on kbr concentration and on processing temperature . table 5______________________________________ sensitivity sensitivity com - added difference differencephoto - pound amount between betweengraphic added to ( mmol / processing a &# 39 ; processing cmaterial layer u mol - ag ) and b &# 39 ; ( δlog e ) and d ( δlog e ) ______________________________________ ( 23 ) none -- - 0 . 35 - 0 . 55 ( 24 ) i - 7 0 . 4 - 0 . 03 - 0 . 35 ( 25 ) i - 10 0 . 2 - 0 . 04 - 0 . 34 ( 26 ) i - 11 0 . 4 - 0 . 03 - 0 . 33 ( 27 ) i - 6 0 . 2 - 0 . 03 - 0 . 44 ( 28 ) ii - 1 0 . 33 - 0 . 09 - 0 . 30______________________________________ photographic materials ( 41 ) to ( 52 ) were prepared in the same manner as example 1 except that the amount of ki used in the solution v for preparing the tabular silver halide grains was changed from 1 . 5 g to 3 . 0 g and that compounds shown in table 5 below were used . the results are shown in table 5 . table 5______________________________________ sensitivity difference sensitivity based on difference photographic between amount material ( 41 ) processingphoto - added processed by a andgraphic compound ( mmol / processing a processingmaterial added mol - ag ) ( δlog e ) b ( δlog e ) ______________________________________ ( 41 ) none -- 0 ( control ) 0 . 19 ( 42 ) compound 0 . 4 - 0 . 02 0 . 05 i - 6 *( 43 ) compound &# 34 ; 0 0 . 05 i - 7 *( 44 ) compound &# 34 ; - 0 . 02 0 ii - 1 *( 45 ) comparative &# 34 ; - 0 . 07 0 . 09 compound c ( 46 ) comparative &# 34 ; - 0 . 10 0 . 13 compound d ( 47 ) comparative &# 34 ; - 0 . 05 0 . 10 compound e ( 48 ) comparative &# 34 ; - 0 . 31 0 . 09 compound f ( 49 ) comparative &# 34 ; - 0 . 04 0 . 12 compound g ( 50 ) comparative &# 34 ; - 0 . 46 0 . 05 compound h ( 51 ) comparative &# 34 ; - 0 . 06 0 . 10 compound i ( 52 ) comparative &# 34 ; - 0 . 03 0 . 11 compound j______________________________________ * inventioncomparative compound c : ( compound 1 in table iii of u . s . pat . no . 4 , 439 , 520 , described at column 32 line 20 thereof ) ## str4 ## comparative compound d : ( compound 1 in table v of u . s . pat . no . 4 , 439 , 520 , described at column 34 line 5 thereof ) ## str5 ## comparative compound e : ( compound 5 in table ii of u . s . pat . no . 4 , 439 , 520 , described at column 31 line 45 thereof ) ## str6 ## comparative compound f : ( compound 4 in table ii of u . s . pat . no . 4 , 439 , 520 , described at column 31 line 35 thereof ) ## str7 ## comparative compound g : ( being within the scope of u . s . pat . no . 4 , 439 , 520 ) ## str8 ## comparative compound h : ( being within the scope of u . s . pat . no . 4 , 439 , 520 ) ## str9 ## comparative compound i : ( being within the scope of u . s . pat . no . 4 , 439 , 520 ) ## str10 ## comparative compound j : ( being within the scope of u . s . pat . no . 4 , 439 , 520 ) ## str11 ## as is clear from the results given in table 5 , addition of the compoundof the present invention ( photographic materials ( 42 ), ( 43 ) and ( 44 )) served to remarkably reduce dependency of sensitivity on kbrconcentration ( i . e ., very small sensitivity difference between processinga and processing b ) and , the desensitization scarcely took place ( i . e ., none or very small sensitivity difference based on photographic material on the other hand , addition of the comparative compound which are the compound being practically described at or within the scope of columns 24 - 34 of u . s . pat . no . 4 , 439 , 520 , does not satisfy both the dependence of photographic properties on development processing condition and the prevention of desensitization at once . x - ray photographic materials ( 61 ) to ( 71 ) were prepared in the same manner as example 1 except for using the compounds shown in table 6 below in place of the compounds shown in table 2 of example 1 . the photographic materials ( 61 ) to ( 71 ) were subjected to the same processing as processing a in example 1 except that water washing was carried out at 20 ° c . for 30 seconds . the results are shown in table 6 below . in table 6 , degree of stain was evaluated in the following 5 stages ; 3 . . . small stain was observed ( but within practically usable range ), table 6______________________________________ amount addedphotographic compound ( mmol / material added mol - ag ) stain remarks______________________________________ ( 61 ) none -- 5 control ( 62 ) k * 0 . 1 4 comparison ( 63 ) &# 34 ; 0 . 2 3 &# 34 ;( 64 ) &# 34 ; 0 . 3 2 &# 34 ;( 65 ) &# 34 ; 0 . 4 1 &# 34 ;( 66 ) f ** &# 34 ; 1 ˜ 2 &# 34 ;( 67 ) l *** &# 34 ; & lt ; 1 &# 34 ;( 68 ) i - 6 &# 34 ; 4 ˜ 5 invention ( 69 ) i - 7 &# 34 ; 3 ˜ 4 &# 34 ;( 70 ) ii - 1 &# 34 ; 3 ˜ 4 &# 34 ;( 71 ) ii - 4 &# 34 ; 3 &# 34 ; ______________________________________ * comparative compound k : ## str12 ##** comparative compound f : ## str13 ##*** comparative compound l : ## str14 ## further , photographic materials ( 61 ), ( 62 ), ( 63 ) and ( 65 ) were subjectedto the same processing as example 4 to evaluate the dependency ofsensitivity on kbr concentration and the desensitization . the results areshown in table 7 below . table 7______________________________________ sensitivity difference based on sensitivity photographic difference amount material ( 61 ) betweenphoto - com - added processed by processing agraphic pound ( mmol / processing a and processing bmaterial added mol - ag ) ( δlog e ) ( δlog e ) ______________________________________ ( 61 ) none -- 0 ( control ) 0 . 19 ( 62 ) k 0 . 1 0 0 . 15 ( 63 ) &# 34 ; 0 . 2 - 0 . 01 0 . 10 ( 65 ) &# 34 ; 0 . 4 - 0 . 03 0 . 04______________________________________ it is apparent from the results in tables 6 and 7 that when the comparative compound k was used in an amount of 0 . 3 or 0 . 4 mmol / mol - ag , stain problem occured ( see , photographic materials ( 64 ) and ( 65 ) in table 6 ). when the comparative compound k was used in an amount of 0 . 1 or 0 . 2 mmol / mol - ag , stain problem did not occured ( see , photographic materials ( 62 ) and ( 63 ) in table 6 ), but the dependency of sensitivity on kbr concentration occured ( see , photographic materials ( 62 ) and ( 63 ) in table 7 ). on the other hand , the compound of the present invention improved the dependency of sensitivity on kbr concentration without stain problem . each x - ray photographic materials ( 61 ) and ( 65 ) to ( 69 ) prepared in example 5 was exposed through a screen , i . e ., hi - standard screen ( made by fuji photo film co ., ltd .) or x - omatic regular screen ( made by eastman kodak company ). the resulting materials were subjected to the same processing as processing a in example 1 . thereby , the dependence of sensitivity on the screen was evaluated by the following formula : ## equ1 ## the sensitivity ratio is a relative value when the sensitivity ratio of photographic material ( 61 ) is taken as 1 . table 8______________________________________photographic compound sensitivitymaterial added ratio remarks______________________________________ ( 61 ) -- 1 control ( 65 ) k 1 . 10 comparison ( 66 ) f 1 . 12 &# 34 ;( 67 ) l 1 . 15 &# 34 ;( 68 ) i - 6 1 . 02 invention ( 69 ) i - 7 1 . 05 &# 34 ; ______________________________________ it is apparent from the above that addition of comparative compounds scarcely served to reduce dependence of sensitivity on screen used , that is , sensitivity obtained by using hi - standard screen was good but the sensitivity obtained by using x - omatic regular screen was relatively decreased . thus , the comparative compounds are not practically preferred . on the other hand , addition of the compound of the present invention served to reduce dependence of sensitivity on screen , which is practically very advantageous . while the invention has been described in detail and with reference to specific embodiment thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .

US-71441585-A

a system for filling a prescription order for a patient includes a plurality of trays each having an rfid tag for storing a unique identifier corresponding to the prescription order , and a plurality of workstations operatively linked to one another , each workstation having an antenna for detecting the unique identifier in one of the plurality of trays , where the detecting is operative to trigger displaying of a profile of at least one prescription item for the corresponding prescription order .

fig1 - 2 show a prescription order fulfillment system 1 according to an exemplary embodiment of the invention . a workstation 10 obtains order entry information from an order entry location 50 . the structure and orientation of order entry location 50 may vary and may comprise any number of alternate sources of prescription information . for example , the order entry location 50 may be at a same location as the workstation 10 , so that a process of order filling may be performed at the same site as a process of obtaining the prescription order . accordingly , an order entry technician may also perform the duties of a pharmacy technician , or work from the same workstation . another example of an order entry location 50 is a dedicated computer terminal at which an order entry technician receives a paper prescription from a patient , nurse , etc . the paper prescription contains information regarding individual prescription items of the prescription order . the order entry technician enters the prescription order information and related information , such as that regarding insurance , method of payment , etc . an adjudication of the prescription order may be performed at the order entry location 50 in cooperation with a pharmacy information system ( pis ). a properly adjudicated prescription order is then released by the pis to a database , such as a database cooperating with a central computer . queueing and associated functions of order filling may be implemented using such a system . additional control may be provided by designating particular workstations for receipt of prescription order information from the database . another variation of an order entry configuration includes an interface between the workstation 10 and a telephone network ( not shown ), so that a nurse at a doctor &# 39 ; s office , a doctor , or a patient is able to phone in her prescription order via a known automated system . a given workstation 10 has a computer 11 with a number of standard input and / or output devices including a keyboard 12 , a mouse 13 , and a display 14 . the display 14 may be either a touchscreen or non - touchscreen type . in addition , the workstation 10 includes an rfid reader 15 for reading a unique identifier in an rfid tag 81 located in a tray 80 ( see , e . g ., fig8 a - b ). rfid reader 15 is able to read and / or write data from / to rfid tag 81 without contacting rfid tag 81 . by placing the rfid tag 81 within tray 80 , rfid tag 81 is resistant to damage from dirt , water , abrasion , chemicals , reflected lights , etc . the size of the rfid tag 81 may be very small and have a thin shape since rfid tag 81 does not require a battery . for example , electric power may be transmitted by electromagnetic induction from a flat read / write antenna element in rpid reader 15 to rfid tag 81 . rfid tag 81 may be an inductive , capacitive , or other rpid type , and the cost of rfid tag 81 is preferably minimized since the requirements for rfid tag 81 may be minimal compared with some rfid applications . for example , an rfid tag generally contains integrated non - volatile memory that allows data to be written to and read from individual tags , but a system and method of the invention does not require user programming of rfid tag 81 , and rfid tag 81 may be factory programmed with a unique identification number so that the tray 80 may be uniquely identified . therefore , the rfid reader 15 need not program rfid tag 81 , and rfid tag 81 need not be reprogrammable . rfid tag 81 has a memory of 44 bytes , 96 bytes , 128 bytes , or other similar size , being large enough to provide trillions of possible unique identifiers . accordingly , if desired for a particular application , trays 80 may be recycled by reprogramming that always uses a new unique identifier . for example , security reasons and accounting software may dictate that a new number be assigned for each new prescription order . rfid reader 15 preferably has a flat upper surface adapted for securely holding a tray 80 while a prescription order is being filled . the face of the read antenna of rfid reader 15 is preferably disposed in parallel with such upper surface , and the face of the antenna of rfid tag 81 is also disposed in parallel with the upper surface when tray 80 is placed on rfid reader 15 . the communication range for reading an rfid tag 81 is designed to prevent detection of the rfid tag 81 at any time other than when tray 80 is in the reading position on rfid reader 15 . by controlling the communication range , premature or unintended detections are prevented . suitable read / write antenna elements and rfid tags 81 are available from omron . a system 1 may include such a controller for interfacing computer 11 with the antenna of rfid reader 15 . such a controller is also available from omron . fig3 shows an exemplary computer network 60 used for implementing a system according to the invention . various workstations 10 , 30 , and central computer 55 may be configured respectively as clients and server in a known manner . for example , workstations 10 , 30 may obtain prescription information as clients connected to central server computer 55 . a small workgroup network ( e . g ., ethernet ) having standard cabling between computers may be used . any suitable computer networking system 56 such as a lan or wan may be implemented for exchanging prescription order and other related information such as insurance , billing , inventory , etc . between computers ( e . g ., including a use of the pis ). various devices such as printers , automated dispensing machines , barcode readers , order entry terminals , checkout registers , telephone networks , other local or wide area networks , and other equipment may also be a part of computer network 60 . in a simple form , one or more trays 80 indicate a patient &# 39 ; s prescription order , so that a workstation 10 , 30 reading the rfid information of a tray 80 only needs to associate the rfid information with the prescription order by accessing the database of the central computer 55 . an exemplary multiple workstation pharmacy 2 is shown in fig4 . a pharmacy or other prescription fulfillment center may have a tray programmer 25 that communicates with central computer 55 and / or a workstation 10 , 30 for initiating the filling process for a prescription order . tray programmer 25 may include a tray feed station 21 , a conveyor transport mechanism 23 , an rfid programmer 20 , and an output station 22 . an exemplary tray feed station is disclosed , for example , in u . s . pat . no . 6 , 370 , 841 granted to chudy , et al ., herein incorporated by reference . tray programmer 25 adds rfid programmer 20 along with associated control systems . when the filling of a prescription order is initiated , the prescription order is associated with a unique identifier and the identifier is programmed by the tray programmer 25 into rfid tag 81 in a tray 80 . for example , central computer 55 assigns unique numbers and then programs the trays 80 , or tray programmer 25 reads a pre - programmed unique identifier of a tray 80 being fed to output station 22 and central computer 55 associates this read number with a prescription order being initiated . an order filler such as a pharmacy technician retrieves the associated tray 80 from output station 22 and carries the tray 80 to a first workstation 10 . workstations 10 , 30 may be used at intervals in a pharmacy as order - filling stations , the intervals being designed so that work flow achieves a desired goal such as efficiency , optimum use of floorspace , maximum throughput , adapting to a particular configuration of storage locations , etc . for example , workstation 10 is located proximate tablet dispensing station 26 and ampule dispensing station 27 . when the technician places tray 80 on rfid reader 15 , individual items of the associated prescription order are displayed on touchscreen 14 of workstation 10 . the prescription items in the area proximate workstation 10 may be highlighted on display screen 61 of touchscreen 14 . the technician may press a graphical user interface ( gui ) icon on touchscreen 14 , which activates the corresponding automated dispenser 26 , 27 , or other , causing the dispenser 26 , 27 , or other to proceed to fill the selected prescription item . a selection of a particular item of the prescription order activates a display of an image 318 of the individual prescription item . when tray 80 is placed on rfid reader 15 , the display screen 61 may include images 318 for any and / or all of the individual prescription items of a prescription order . in addition , pressing a gill icon 62 may place information regarding filling the respective prescription item into a queue . the &# 39 ; 529 application cited above details a workpath ™ software that may be adapted for use with the present system 1 , 2 , such as in a client - server architecture . workstations 10 , 30 may include a label printer 17 ( e . g ., fig2 ) that automatically prints a label , when required , for a prescription item being filled , the particular automated dispensing machine 19 may have its own intemallabel printer ( not shown ), the prescription item may have its label already attached , or the particular label may be printed at a stand - alone printer ( not shown ) for attachment to the prescription item at a separate location . in addition , workpath has a checksheet function , whereby a checksheet 269 ( fig9 ) may be displayed and / or printed for all or part of a prescription order . the checksheet 269 may include displaying images 318 for any or all of the listed prescription items 307 , and may include the name 301 of a patient , a prescription number 309 , a quantity 316 , special instructions 273 , barcode ( s ) 271 , descriptive text information 311 , storage location information 313 , storage location icon 315 , and other information . when all the prescription items for the prescription order to be filled by tablet dispensing station 26 and by ampule dispensing station 27 have been processed , the technician picks up tray 80 , proceeds to workstation 30 , and places tray 80 onto rfid reader 15 of workstation 30 . upon placing tray 80 onto rfid reader 15 , the prescription items to be filled from storage locations proximate workstation 30 are displayed on touchscreen 14 of workstation 30 . in this example , workstation 30 is proximate automatic unit - of - use article dispenser 28 and storage shelves 41 . when the technician presses a gill icon 62 corresponding to a prescription item to be filled from unit - of - use dispenser 28 , the prescription item is automatically filled . when the prescription item selected by the technician is located on a storage shelf 41 , the touchscreen display screen 201 indicates the exact shelf location where a quantity of the respective prescription item may be found , as shown in fig6 . the technician may activate a printing of a corresponding label for the prescription item by touching a separate icon on the touchscreen 14 , or the workstation 30 may automatically print such label when the corresponding prescription item is selected on the touchscreen 14 . when a given prescription order has been filled , the technician places the filled tray 80 onto a nurse &# 39 ; s cart , onto a will - call shelflocation , or in an other filled prescription area . alternatively , the technician may place tray 80 onto an intermediate shelf ( not shown ), such as when she has partially filled a prescription order and desires to take a lunch break and fill the remainder of the prescription order at a later time . the intermediate shelf may also be used when a particular prescription item of a prescription order is back - ordered and the prescription order remains incomplete . similarly , since the tray 80 automatically activates a display of the individual items in a prescription order whenever the tray 80 is placed onto an rfid reader 15 , the technician may fill the order in any manner she deems appropriate , such as by first proceeding to a remote workstation if a nearby workstation is busy . the sequence of filling is independent of the movement of tray 80 so that , for example , in an emergency , a partially - filled tray 80 maybe placed aside while the emergency ( e . g ., stat ) prescription order is being filled . when tray 80 resumes the process of being filled , a placement of tray 80 onto an rfid reader 15 at a workstation displays any remaining unfilled prescription items of the order . fig5 shows an exemplary touchscreen display 61 having a list 67 , 68 of prescription items to be filled at a given workstation . in this example , the display screen 61 contains gill icon 62 representing a storage location that is in an automated dispensing machine . a manual type gill icon 63 represents that the respective prescription item is at a particular shelf location . when the technician presses her finger on gill icon 63 , a label is automatically printed for the prescription item and , as shown in fig6 , screen display 201 is provided with a popup box 301 requesting that the technician scan verify the filled prescription item by scanning the label with a barcode reader 18 and by visually comparing the displayed image 318 of a representative pill with the contents of the filled vial . any number of automated medication dispensing machines may be used in conjunction with a workstation 10 , 30 , including but not limited to dispensers of oral solids , units - of - use , injectables , ivs , ampules , vials , syringes , etc . the form of an automated dispensing machine may include a vending , cassette , vibration feed , roll packetizing , robotic , conveyor feed , automated line filling , and / or other type of automated machine . shelving and machines may be semi - automated , such as by using a carousel or similar rotating storage and retrieval structure where access to a prescription item storage location is simplified and / or storage capacity is increased . individual workstations 10 , 30 communicate with the various devices to send them commands or receive status , such as by a hard - wired serial interface . any suitable interface between workstations 10 , 30 and automated dispensing machines may be used , including wireless , rs 232 / 485 , usb , etc . programs in workstations 10 , 30 update a central database on central computer 55 ( e . g ., server ). the database is accessed by all client computers and the server to communicate progress of the prescription order from entry to checking and filling . in addition , a wireless handheld computer ( not shown ) may be used for tracking replenishment of storage locations , for locating stock in the drawers and shelves , etc . the information exchanged with automated dispensing machines may differ according to a number of processes being performed by the particular machine . at a minimum , the serial information transmitted to automated dispensing machines includes the location of the particular medication and the quantity . additional serial communication information between a workstation 10 , 30 and an automated dispensing machine 19 may be required for implementing processes such as label printing , sequencing of roll packetizing , refrigeration of compartments in a dispenser , etc . in addition , a tote transfer conveyor system ( not shown ) may be used to accommodate a particular site &# 39 ; s requirements . in such a system , a number of conveyors may be placed end - to - end to move trays / totes from one station to another . such a system may include corner conveyors that facilitate a change in direction ( e . g ., ninety degree turn in tote direction ), straight conveyors , conveyor tote elevator ( s ) that change a position of a given tote from a floor level conveyor for automated machine dispensing to a raised level for manual pick and filling operations . such a system may also include a conveyor queue tower that receives totes / trays , for example , from the conveyor tote elevator and retains them for a subsequent checking or bagging process , or for queueing during a sequenced or similar order filling process . an example of such a system is the autofill system , available from automed technologies , inc ., of vernon hills , ill . it is noted that a large prescription order may be assigned to more than one tray 80 . in such a case , each tray 80 may be assigned to specific items of the prescription order . a multiple position rfid reader ( not shown ) maybe used at a final quality control station for determining whether all of the individual prescription items for the prescription order are present in the multiple trays 80 . different colored trays 80 may be used , for example to differentiate a stat order , an order for a particular nursing cart , an order for a particular destination , etc . workstation 10 , 30 may include a printer 17 adapted for printing a checksheet along with labels for identifying the particular patient corresponding to the prescription order . such a checksheet and labels may be placed in the tray 80 , and may be in the form of a printed bag into which all or some of the individual prescription items of an order may be placed . in addition , workstations 10 , 30 may be used at any time by a pharmacy technician , nurse , doctor , pharmacist , etc . for checking a filled tray for accuracy , for example , prior to releasing the prescription order to a patient , nursing cart , etc . an exemplary prescription order filling process is now described with reference to fig7 a - b . at step 100 , a prescription order is input to a computer . for example , a patient takes her prescription to a pharmacy and hands the prescription to a pharmacy technician and the technician types the individual prescription information 10 on a computer keyboard . the prescription information becomes an order entry in a database ( e . g ., pis ) that is in communication with an order entry computer , either locally or at a remote location . the order entry may be obtained by the database in a variety of ways . for example , a group of one or more individual prescription orders may be transferred between locations using intranets , internets , the internet , etc . at step 105 the order entry is checked for accuracy , such as by the order entry technician or by the pharmacy technician who retrieves the order . many methods may be concurrently implemented for checking order accuracy , including but not limited to use of charts such as computer algorithms that match a profile of the patient with a dosage , type of medication , quantity , interaction information , etc ., algorithms that perform spell checking or similar evaluation of entered text , etc . in step 107 , when it is determined that order entry has been performed correctly , the prescription order may be forwarded to a database for subsequent retrieval and processing . if it is determined that the order has been incorrectly entered , the order is kicked back to an order entry station for re - entry or correction . an example of step 107 is a spell checker . when a prescription order is retrieved by a pharmacy technician at step 110 , she validates the prescription order , for example , by telephoning the doctor &# 39 ; s office indicated on the prescription slip , by accessing validation information from a central computer such as by retrieving a patient &# 39 ; s date of birth , mother &# 39 ; s maiden name , or other personal information . adjudication and validation of the prescription order may include a use of a pis , and may include a combination of automated and manual processes , including obtaining a release of the prescription order from a pis , placing prescription order information in a queue , etc . the technician may ask the patient to validate / verify such personal information or provide health insurance information . at step 113 , when it is determined that the prescription order has been validated , the technician proceeds to fill the order . if the prescription order is not able to be validated , the technician may put the prescription order on hold pending receipt of the validation , or may cancel the order for processing until the order is able to be validated . the processes of order entry , order retrieval , and validation may be combined or kept separate depending on a particular application . at step 115 , the technician matches a chosen validated prescription order to a tray . she may activate a tray programmer or assigner to do such matching , for example by assigning a unique identifier contained in an rfid tag located in the tray to the chosen prescription order . the unique identifier may be programmed into the rfid tag at the time the technician selects the particular prescription order for fulfillment , by activating a programmer to enter a new unique identifier into a tray . such a tray programmer may automatically dispense the tray to a separate location for order filling , or the tray programmer may be proximate the technician &# 39 ; s workstation . alternatively , the pharmacy technician may first retrieve a prescription order , then pick up a new tray from a stack , place the tray onto an rfid reader , and assign a unique identifier that is preloaded in the tray to the prescription order on her display screen . at step 120 , the technician picks up the tray and proceeds to a prescription filling workstation 10 at step 125 . workstation 10 may be connected to automated dispensing machines , it may be a workstation in a pharmacy location proximate shelves and other storage locations , or workstation 10 may be intended to service both a manual filling of prescription items from shelves as well as automatically filling prescription items by use of automated dispensers . at step 130 , the technician places the tray onto a tray reader located at the chosen workstation . the tray reader detects the unique identifier in the rfid tag and presents information concerning this unique identifier to a retrieve_order routine running on the workstation . the retrieve_order routine formats this information into a request for order information . the request for order information is then presented to the database manager for retrieving the stored order information from the database . the request for order information may be included in a data stream over a network , either via a locally managed operating system or via an engine cooperating with a standard system configuration such as unix . the database may in fact reside locally in the workstation , as a result of the workstation being connected with the order entry device , by the workstation previously receiving a batch of orders , and by other methods . the request for order information may alternatively be transmitted via a wireless communication path , processed in a batch manner , or may be communicated by any suitable process and structure to a database manager . at step 135 , the workstation receives the requested order information from the database manager and processes the order information for displaying the information to the technician on a display device connected to the workstation . fig5 shows an exemplary order screen display 61 . at step 140 , the technician views the displayed order screen 61 and determines which individual prescription items she wants to fill next . the technician may , at step 145 , select order items and may initiate processes by , for example , pressing her finger against a graphical user interface ( gui ) symbol located on a touchscreen display , by positioning a pointer on a screen symbol and then click - selecting the screen symbol , by entering keystrokes on a keyboard , by voice activation , etc . the gui symbol may represent a location where an individual prescription item is located . for example , the gill may represent an automatic unit - of - use dispensing machine , an automatic oral solids dispensing machine , an automatic ampule dispensing machine , an automated medication packetizing machine , a storage shelf location , or any other location for the particular selected individual prescription item . at step 150 , the technician determines whether the selected prescription is located at a storage location requiring manual retrieval or at an automated storage location . when the selected prescription item is at a shelf location requiring manual retrieval , the display at step 155 indicates the shelf number and shelflocation of the item so that the technician may proceed directly to the item in step 160 . preferably , the shelves are located in an area where the desired medication may be easily obtained from a bulk container , counted , and packaged while reducing the risk of spillage or other mishap . the shelved prescription item may alternatively be pre - packaged in convenient quantities such as in quantities favored by doctors when writing the prescription orders . when the selected prescription item is located at an automated location , the workstation at step 165 communicates information regarding the prescription item to the automated dispensing machine for subsequent automated filling of the prescription item . the workstation translates information concerning the desired item into machine language for communication to the given automated dispensing machine . the automated dispensing machine receives the machine code and dispenses the prescription item , either directly into the tray or to a convenient location for retrieval by the technician . at step 170 , a label is printed for the prescription item . the automated dispensing machine may have a self - contained label printer structured for formatting information concerning a prescription item being filled and then printing such information on a label to be affixed to a vial or other container for holding the medication or related prescription item . the automated dispensing machine may apply the label to the vial automatically , may separately dispense the label , may communicate print machine code to an external printer , etc . a label for the selected prescription may be separately printed by the technician selecting a label print routine at the workstation . the label print routine may be integrated into a workstation algorithm , for example , associated with a selection of a next item . the printed label may be manually or automatically placed onto a container , such as a vial . it may be desirable to add redundancy to quality assurance procedures such as by preventing the selection , filling , or label printing of a subsequent prescription item until a label has been removed from a printer , until a label has been attached to a vial , scanned by a barcode reader , and verified , until a handshaking signal is received from an automated dispensing machine , etc . the label information may include a text description of the prescription item , the quantity information , a barcode , an address and phone number of the pharmacy , doctor information , patient information , a graphic showing the particular tablet , capsule , or other form of the particular medication , etc . the label information may be displayed on the display device of the workstation so that the technician may verify that the prescription item on the screen matches an actual filled item in her hand or in the tray . alternatively , the technician may pass the affixed label across a barcode reader connected to the workstation . the barcode information thereby obtained is then automatically compared with the items of the particular prescription order to verify that the information matches a previously selected item . when the technician is satisfied that the selected prescription item has been filled correctly , she places the filled prescription item into the tray at step 180 . at step 185 , it is determined whether the filled prescription item is the last item of the prescription order to be filled at the present workstation . if not , the technician proceeds to step 145 and repeats the order filling process by selecting a next prescription item on the workstation display . if the just - filled prescription item is the last prescription item to be filled at the present workstation , the screen may indicate a next workstation or other location for subsequent placement of the tray containing filled prescription items . the display may indicate a next workstation based on efficiency and reduction of cost , proximity , availability , etc . determined by an efficiency routine in software . at step 190 , the technician carries the tray to another workstation and places the tray onto the rfid reader of the new workstation , whereupon the reader detects the unique identifier of the rfid tag of the tray and displays a list of prescription items to be filled at that workstation . subsequently , the technician performs filling of additional prescription items at the new workstation , in a manner as just described beginning at step 125 . as noted above , a person desiring to perform additional quality control or checking of the contents of a tray 80 may pick up the tray 80 and place it on an rfid reader 15 of a given workstation 10 , 30 . a system may include a separate workstation dedicated to checking and verification of prescription orders , for example prior to packing and shipping , at a nursing station , etc . when the person places the tray 80 onto the rfid reader 15 , a list of the individual prescription items of a prescription order are displayed . the person may then visually inspect the items in the tray 80 , may scan barcodes on labels of the items , may match a displayed image of a particular medication with a filled order , etc . after verifying the items for a prescription order , the person may proceed to a subsequent process such as forwarding the prescription order to a patient or healthcare facility , receiving payment for the order , communicating verification information with a pis , etc . many variations in a workflow method are envisaged and it is intended that the invention be adaptable for order filling that includes any type of computer network and any type of computer , such as computers integrated with other aspects of a pharmacy , including those responsive to relative movements of a technician . in addition , the invention may incorporate additional writing of information to rfid tags and other media for effecting additional control of prescription order processing . for example , a system may be structured for using an rfid antenna to store updated filling information in an rfid tag 81 . while the principles of the invention have been shown and described in connection with specific embodiments , it is to be understood that such embodiments are by way of example and are not limiting .

US-201313839127-A

the invention relates to an apparatus for injection molding the shells of a mini - disk cartridge or the like . more particularly , the device includes a main cavity having a shape of mini - disk shell . the mold contains various projections and indentations on the first and second surfaces , respectively , which are adapted to form a shutter recess near a first edge of the lower shell , a read / write port for a media disk in a vicinity of the first edge within the shutter recess , a shutter guide track on the outer surface of the lower shell close to and parallel to the first edge , a drive port for rotating a media disk , and various fastening bosses for fastening the upper and lower shells of the mini - disk cartridge together . a single hot - runner valve gate is placed in the mold close to one corner such that small cavities within the cavity are filled with polymer melt first . this valve gate position assures that the mold is completely and rapidly filled to facilitate even heat transfer from the polymer melt so as to prevent warpage of the lower shell after removal from the molds .

fig2 and 3 illustrate each of the features that are incorporated into a lower shell 50 of the mini - disk cartridge . sidewalls 180 , 190 , 200 , and 220 extend from outer surface 65 . outer surface 65 has a recess 70 that is adapted to receive a shutter ( not shown ), which protects a media disk ( not shown ) within the mini - disk cartridge . a shutter guide 80 is adapted to receive an edge of the shutter ( not shown ) and allows the shutter to slide parallel to wall = 200 , exposing a read / write port 90 after the mini - disk cartridge has been inserted into an appropriate reading / writing device . various apertures 100 , 170 and 120 as well as notches 130 , 140 , and 150 are incorporated into outer surface 65 . these apertures and notches are used for both positioning the mini - disk within the reading device ( not shown ) and for opening the shutter ( not shown ) via appropriate mechanical means . drive port 75 is located on a center portion of surface 65 and is adapted to allow access for appropriate mechanical means to drive a media disk within the mini - disk cartridge . also visible on outer surface 65 of lower shell 50 are gate marks 95 and 160 . according to the present invention a single hot - runner valve gate is used to injection mold lower shell 50 ; therefore one gate is actually a dummy gate ( i . e ., a plug ) and the other is used as a location for a single hot - runner valve gate . fig3 illustrates in detail various features on an inside surface 66 of lower shell 50 . a plurality of bosses 270 , 280 , 290 , 300 , 310 , 320 , 330 , 340 , 350 , 360 , 370 , 380 , 390 , 400 and 410 are incorporated onto inside surface 66 . the aforementioned bosses are used for attaching lower shell 50 to upper shell 60 and for attaching internal mechanical components within the mini - disk shell . bosses 300 and 400 also serve as walls for apertures 120 and 100 , respectively , so that debris may not enter the shell therethrough and damage a media disk therein . other noteworthy structures incorporated onto surface 66 include arcuate guide walls 240 , 250 , 260 , and 270 are adapted which form a substantially circular guide for the media disk within shells 50 . an annular support 230 is centered within the arcuate guide walls , which serves to support and center the media disk . side walls 180 , 190 , 200 and 220 also extend from inside surface 66 . the side walls are adapted to form a protective closure for the media disk when the shell halves are assembled . wall 220 is slightly recessed from an outer edge of surface 166 leaving surface 210 exposed so that appropriate mechanical means within the reading device can retract the shutter ( not shown ) along shutter guide 80 within recess 70 . fig4 and 5 illustrate inner and outer surfaces 441 and 440 of upper shell 60 , respectively . in a manner similar to lower shell 50 , upper shell 60 has gate indentations 420 and 430 incorporated within recessed portion of surface 440 . also , as in lower shell 50 , only one hot - runner valve gate is used to injection mold upper shell 60 ; therefore one gate is a dummy gate ( i . e . a plug ) and the other is used as an actual location for a single hot - runner valve gate . wall 450 is also incorporated into upper shell 60 and is adapted to meet beveled edge 449 of lower shell 50 as shown in fig3 completing the outer wall structure for the mini - disk shell halves . fig5 illustrates inside surface 441 of upper shell 60 in detail . incorporated into surface 441 is a plurality of bosses 281 , 291 , 301 , 311 , 321 , 331 , 341 , 351 , 361 , 381 , 391 , 401 , and 411 . the bosses attach upper shell 60 to lower shell 50 , and attach mechanical components to internal portions of the mini - disk shell . other noteworthy structures incorporated onto inside surface 66 include arcuate guide walls 241 , 251 , 261 , and 271 which are adapted to form a substantially circular guide for the media disk within shells 50 and 60 . an annular support 231 is centered within the arcuate guide walls , which serves to support and center the media disk . side walls 181 , 191 , 221 and 450 also extend from inside surface 441 . the side walls are adapted to form a protective closure for the media disk when the shell halves are assembled . wall 221 is slightly recessed from an outer edge of surface 441 leaving surface 211 exposed so that appropriate mechanical means within the reading device can retract the shutter ( not shown ). lower shell 50 matingly engages upper shell 60 to form a protective cartridge in the following manner . boss 290 from lower shell 50 is adapted to fit within boss 291 of upper shell 60 ; similarly , 340 within 341 , 410 within 411 , 390 within 391 , and 360 within 361 . also , boss 400 rests against boss 401 , boss 380 against 381 , 280 against 281 , 300 against 301 , and 310 against 311 . mating pairs of bosses can be fastened together by any known means . usually , mating pairs of bosses are welded together ultrasonically after internal components are placed within the mini - disk shells . arcuate guide walls 241 , 251 , 261 , and 271 of upper shell 60 are adapted to meet with arcuate guide walls 240 , 250 , 260 , and 270 , respectively , of lower shell 60 to form a substantially circular chamber for the media disk after the shell halves are assembled . similarly , sidewalls 181 , 191 , 221 and 450 of upper shell 60 are adapted to engage side walls 180 , 190 , 220 and edge 449 , respectively , of lower shell 50 . the arcuate guide walls and sidewalls may be fastened together by any known means . the bosses formed onto the inner surfaces 66 and 441 correspond to a plurality of cavities and tight corners on mold surfaces that form the inner surfaces 66 and 441 of shells 50 and 60 , respectively . these cavities and tight corners offer a higher resistance to polymer melt flow during injection than a volume defined by the space between surfaces 65 and 66 of the lower shell 50 and a space between surfaces 440 and 441 of upper shell 60 . the structure within the mold adapted to form shutter recess 70 on lower shell 50 also represents a portion of the mold having a higher resistance to polymer melt flow than the volume defined by the space between surfaces 65 and 66 of the lower shell 50 and the space between surfaces 440 and 441 of upper shell 60 . portions of the mold which offer a low resistance to polymer melt flow also include channels in the mold surface which correspond to sidewalls 180 and 190 of lower shell 50 and sidewalls 181 , 191 , and 451 of upper shell 60 . polymer melt flow throughout the mold is illustrated in greater detail in fig7 - 10 . the cavities of high polymer melt flow resistance must be filled nearly as quickly the areas of lower polymer melt flow resistance to promote even cooling time throughout the mold . a hot - runner valve gate allows the above - mentioned areas of higher polymer melt flow resistance to be filled more quickly due to the low viscosity of the high temperature melt . this offers a significant advantage over the use of cold - runner pinpoint gates for several reasons . since a single cold - runner pinpoint gate does not contain heating elements , the melt has a higher viscosity at the gate . this leads to excessive resistance to the flow of melt and clogging of the mold . furthermore , volumetric flow through a hot - runner valve gate is significantly greater than the flow rate through a pinpoint gate , thus decreasing the time required to fill the mold and promoting even cooling of the mold . fig6 illustrates a single hot - runner valve gate to mold for upper and lower shells . in a preferred embodiment , hot - runner valves 205 and 215 are inserted into the mold ( not shown ) at gate locations 160 and 430 . gate locations 95 and 420 are plugged . alternatively , hot - runner valves 205 and 215 may be placed at gate locations 95 and 420 , respectively , while gates 160 and 430 are plugged to mold the upper and lower shells . the valves 205 and 215 are located near the corners of the upper and lower shells for several reasons . as is shown in fig3 and 5 , a plurality of bosses exist in each of corner on inside surfaces 66 and 441 of lower and lapper shells 50 and 60 , respectively . each boss represents a portion which provides a higher flow resistance due to the tortuous path which the polymer must follow . these portions must be filled relatively quickly to assure that cooling time throughout the mold remains relatively uniform to prevent excessive warpage . other structures such as arcuate guide walls 240 , 250 , 260 , and 270 represent other portions which must also be filled quickly so that they may have the same cooling time as the rest of the shell . furthermore , shutter recess 70 also represents a portion within the mold which offers a greater resistance to flow due to its decreased cross sectional area . this portion must also be filled quickly before a polymer &# 34 ; skin &# 34 ; is formed during cooling which can clog the mold , thus producing a shell which may have voids in areas that offer a greater resistance to flow . one hot - runner valve gate per shell is used ; therefore the viscosity of the polymer melt is lower than that of melt injected from a cold - runner pinpoint gate , thus allowing the polymer melt to flow more freely as compared to several cold - runner valve gates . each shell structure within the mold contributes to the flow patterns within the mold . fig7 a , 7b , 8a , and 8b illustrate the polymer melt flow pattern in the mold during injection when gate locations 160 and 430 are used . fig7 a illustrates a mold surface 501 which forms the inner surface 66 of the lower shell 50 . hot - runner valve 205 injects polymer melt into the mold . arrows indicate the general direction of flow throughout the mold to various structures which include depressions and channels which form bosses and sidewalls , respectively , for each shell . depressions 322 , 332 , and 342 are first exposed to the melt . the melt flows along channel - like structures 182 , 192 , and 202 so that remote portions which offer a greater resistance to flow may be quickly filled . thus , melt can fill depressions 282 , 292 , 302 , and 312 as well as depressions 372 , 362 , and 352 . furthermore , depressions 382 , 392 , and 412 can also be filled quickly from melt flow over the center portion of the mold as well as along channel 202 . similarly , the arrows in fig7 b indicate the general direction of melt flow from hot - runner valve , over mold surface 502 to form the inner surface of upper shell 60 . in a manner similar to the lower shell 50 , depressions 353 , 363 , and 373 are first filled . channels 183 and 453 , which form walls 181 and 450 , allow depressions 323 , 333 , 343 , 383 , 393 , 403 , and 413 to be quickly filled . also as indicated by the flow arrows of fig7 b , depressions 283 , 293 , 303 , and 313 may be filled via flow from channels 183 and 193 as well as from flow over the center portion of the mold . fig8 a and 8b illustrate polymer melt flow across surfaces 503 and 504 , respectively , of the mold which form the outer surfaces of the lower and upper shells . as indicated by the flow arrows in fig8 a , melt flows along the mold edges and across the center portions to fill the area of decreased cross - sectional area indicated by a structure 73 which forms the shutter recess 70 . a similar flow pattern is illustrated in fig8 b from valve gate 210 . fig9 a , 9b , 10a , and 10b illustrate the polymer melt flow pattern in the mold during injection when gate locations 95 and 420 are used . fig9 a illustrates a mold surface 501 which forms the inner surface of the lower shell 50 . hot - runner valve 205 allows polymer melt to be injected into the mold . arrows indicate the general direction of flow throughout the mold to various structures . these - structures include depressions and channels which form bosses and sidewalls , respectively for each shell . depressions 382 , 392 , 402 and 412 are first exposed to the melt . the melt flows along channel - like structures 202 , 192 , and 182 so that remote portions which offer a greater resistance to flow may be quickly filled . thus , melt can fill depressions 282 , 292 , 302 , and 312 as well as depressions 372 , 362 , and 352 . furthermore , depressions 322 , 332 , and 342 can also be filled quickly from melt flow over the center portion of the mold as well as along channel 192 . similarly , the arrows in fig9 b indicate the general direction of melt flow [ from ] hot - runner valve gate 210 , over mold surface 502 to form the inner surface of upper shell 60 . in a manner similar to the lower shell 50 , depressions 283 , 293 , 303 , 311 are first filled . channels 223 and 193 , which form walls 221 and 191 , allow depressions 323 , 333 , 343 , and depressions 383 , 393 , 403 , and 413 to be quickly filled . also as indicated by the flow arrows of fig9 b , depressions 353 , 363 , and 373 may be filled via flow from channels 223 and 193 as well as from flow over the center portion of the mold . fig1 a and 10b illustrate polymer melt flow across mold surfaces 503 and 504 , respectively , which form the outer surfaces of the lower and upper shells . as indicated by the flow arrows in fig1 a , melt flows along the mold edges and across the center portions to fill the area of decreased cross - sectional area indicated by structure 73 which forms the shutter recess . a similar flow pattern is illustrated in fig1 b from valve gate 215 . it should be understood that various changes to the present invention may be made by the ordinarily skilled artisan , without departing from the spirit and scope of the present invention which is presented in the claims below . the ordinarily skilled artisan will understand that this disclosure presents an example of the invention and is not meant to limit the invention , as presented in the claims , in any way whatsoever .

US-11421893-A

a seal assembly for reception of an elongated surgical instrument is provided which includes a body having at least one opening configured and dimensioned to permit entry of an elongated surgical instrument and defining a central longitudinal axis ; a seal member formed of a resilient material and defining an aperture therein , the aperture being configured and dimensioned such that insertion of the surgical instrument into the aperture causes the resilient material defining the aperture to resiliently contact the outer surface of the surgical instrument in a substantially fluid tight manner ; and a fabric layer juxtaposed relative to the resilient material . a coating may be applied to the seal member to reduce friction between the seal member and surgical instrumentation inserted therein . the coating is preferably a hydrocyclosiloxane membrane prepared by plasma polymerization process .

referring now in detail to the drawing figures in which like reference numerals identify similar or identical elements , a first embodiment of the seal assembly of the present disclosure is illustrated in fig1 - 9 , and is designated generally as seal assembly 100 . the presently disclosed seal assembly embodiments contemplate the introduction of various types of surgical instruments adapted for insertion through an elongated trocar assembly . examples of such instruments include clip appliers , graspers , dissectors , retractors , staplers , laser fibers , photographic devices , endoscopes and laparoscopes , tubes , and the like . such instruments are collectively referred to herein as “ instruments ”. referring to fig2 , seal assembly 100 includes a seal member 118 disposed within the seal assembly body or housing components 114 and 116 which snap fit together by way of flexible tab portions 114 a being deflected upon insertion into receiving openings ( not shown ) formed in housing component 116 . seal member 118 has a circular array of holes formed therethrough around the periphery of an inner section 118 b . a two part ring assembly which includes ring members 120 and 122 are snap fitted together on either side of seal member 118 . ring member 120 is disposed adjacent the distally facing surface of seal member 118 and ring member 122 is disposed on the proximally facing side of seal member 118 . ring 120 is provided with holes 120 a and posts 120 b which are alternately disposed around the ring and are aligned with holes 118 a on seal member 118 . ring 122 is provided with posts 122 a and holes 122 b which mate with holes 120 a and posts 120 b of ring member 120 , respectively by snap fitting together thereby surrounding inner section 118 b . although rings 120 and 122 are shown having alternating holes and posts , one of the rings could have all holes formed therein while the other ring could have all posts aligned with the holes of the other ring . additionally , greater or fewer holes and posts may be utilized to secure the two rings together . a seal clamp 124 is provided within the housing component 114 and 116 and serves to secure the outer periphery of seal member 118 within seal assembly 100 ( as best shown in fig7 ). seal clamp 124 is provided with four projecting posts 124 a which fit within openings ( fig7 ) formed on the proximal side of lower housing 116 . seal clamp 124 also serves to secure a proximal flange of a lower seal 126 which is provided at the distal end of lower housing member 116 . lower seal 126 assists in the securement of seal assembly 100 to cannula assembly 110 . referring now to fig3 - 6 , seal member 118 includes a fabric disc - shaped portion 128 formed from a plurality of individual strands “ s ” of fabric , which is preferably disposed on both the proximal and distal sides of inner section 118 b of seal member 118 . alternatively , fabric section 128 may be disposed on just one of either the proximally facing surface or the distally facing surface of inner portion 118 b , as desired . fabric portion 128 may be of any suitable fabric , for example , a spandex material containing 20 % lycra available from milliken . in one method of forming the composite seal member 118 with fabric portion 128 a raw , i . e ., uncured polyisoprene plug is first compressed into a flat state , e . g ., a flat sheet of polyisoprene . a single layer of fabric is positioned on top of the flattened polyisoprene sheet and compressed into the uncured rubber by any suitable compression process such as , for example , calendering . if it is desired to have fabric on both sides of seal member 118 , this process is repeated on the other side of the polyisoprene sheet . the fabric polyisoprene composite is die cut into circular slugs having an outer diameter and an inner diameter which forms a central aperture . the slugs are placed in a hot compression mold to cure the polyisoprene . this step also serves to extrude the outer portions of seal member 118 which extend outwardly from inner section 118 b . during the above - described process the bleed - through of the polyisoprene material into and / or through the fabric layers is regulated by the density of the fabric selected . a greater degree of bleed - through of polyisoprene provides greater resistance to fraying of the fabric upon repeated insertion of instruments through the seal . however , too much bleed - through of the polyisoprene through the fabric will increase friction forces upon instruments being inserted through seal member 118 . referring to fig6 a , an alternative embodiment of seal member 118 is shown as seal member 418 . seal member 418 is the same as seal member 118 in most aspects except that inner section 418 b is formed to have fabric layer 428 enveloped between upper and lower polyisoprene layers 418 c and 418 d . in order to reduce friction between instruments and the seal member , e . g . seal member 118 or seal member 418 , as instruments are inserted through seal assembly 100 , a coating may be applied to the seal member . one coating which has been found particularly effective is a hydrocyclosiloxane membrane prepared by plasma polymerization process . such a coating is available from innerdyne , inc . of salt lake city , utah , u . s . a ., and is disclosed in u . s . pat . no . 5 , 463 , 010 which issued to hu , et al . on oct . 31 , 1995 , the entire contents of which are hereby incorporated by reference . referring to fig7 and 8 , seal assembly 100 is used in combination with a conventional trocar assembly which includes a cannula assembly 110 and a trocar obturator 112 . examples of trocar assemblies in which the present seal assembly may be utilized are disclosed in u . s . pat . no . 5 , 603 , 702 which issued on feb . 18 , 1997 to smith et al . and u . s . application ser . no . 08 / 546 , 009 filed oct . 20 , 1995 by smith et al ., the entire contents of each of these disclosures are hereby incorporated by reference . seal assembly 100 , either alone or in combination with a seal unit / seal assembly internal to cannula assembly 110 , provides a substantial seal between a body cavity of a patient and the outside atmosphere both during and subsequent to insertion of an instrument through the cannula . in this manner , insufflation gases are prevented from escaping through the trocar assembly to the outside environment . seal assembly 100 is capable of accommodating instruments of varying diameter , e . g ., from about 5 mm to about 12 mm , while providing a fluid tight seal with the outer diameter of each instrument . the versatility of the presently disclosed seal assembly embodiments greatly facilitate endoscopic surgery , wherein a variety of instruments having different diameters are often needed during a single surgical procedure . seal assembly 100 is preferably detachably mountable to the proximal end of cannula assembly 110 . thus , the surgeon can remove the seal assembly 100 from the cannula assembly 110 at any time during the surgical procedure and , similarly , mount the seal assembly 100 to the cannula when desired in order to provide a sealing engagement with an instrument to be inserted through the cannula . in addition , seal assembly 100 may be readily adapted for mounting to conventional cannulas of differing structures . the detachability of seal assembly 100 from cannula assembly 110 facilitates specimen removal through cannula assembly 110 . seal assembly 100 includes a housing which is formed by the snap fitting together of end cap 114 and lower housing member 116 . a flexible member “ b ” ( fig6 , 6 a , 7 ) formed from the same resilient material “ m ” ( fig6 , 6 a ) comprising the seal member 118 extends outwardly from the seal member 118 such that the flexible member “ b ” is positioned between the housing and the seal member 118 . as seen in fig6 , 6 a , and 7 , for example , the flexible member “ b ” may be integrally , e . g ., monolithically , formed with the seal member 118 , and may be sinusoidal in configuration . preferably the housing components of seal assembly 100 are formed of a polycarbonate material such as abs available from the general electric company . fig9 shows an instrument having a shaft 130 inserted through seal assembly 100 and a duck bill valve or “ zero ” seal valve 132 which prevents the escape of insufflation gases in the absence of an instrument in the trocar assembly . as shown in fig9 , seal member 118 provides a seal about the periphery of shaft 130 . referring to fig1 , an alternate embodiment of seal assembly 100 is designated generally as seal assembly 150 . seal assembly 150 is the same as seal assembly 100 except that an inner planar seal member 152 is disposed in the distal end of seal assembly 100 to provide additional sealing capability for instruments having larger diameters . seal element 152 has an aperture 154 which has a diameter larger than the diameter of aperture 156 of seal member 118 . a further feature illustrated in fig1 is a dampening member such as pad 158 which is secured to the proximal surface of ring 122 to dampen the sound created by the impact of the proximal surface of ring 122 with the inner distal facing surface of housing component 114 . other dampening member configurations are also contemplated . for example , ring 122 may be over - molded with material such as polyisoprene so as to envelope part or all of the ring thereby forming a bumper between the ring and the housing component . referring to fig1 - 13 , a further embodiment of a seal assembly generally designated as seal assembly 200 is shown throughout the several views . seal member 218 is configured in an hourglass shape and preferably includes the fabric portion 228 formed as part of seal member 218 in a similar manner as described above . the friction reducing coating of a hydrocyclosiloxane membrane prepared by plasma polymerization process noted above may also be utilized to coat the surfaces of seal member 218 . referring now to fig1 and 15 , a further embodiment of the seal assembly generally designated as seal assembly 300 is shown . seal member 318 is similar to seal member 118 except that inner portion 318 b is formed in a conical shape with a wider opening directed towards a proximal end of seal assembly 300 and a narrower opening directed towards distal end of seal assembly 300 . the friction reducing coating of a hydrocyclosiloxane membrane prepared by plasma polymerization process noted above may also be utilized to coat the surfaces of seal member 318 . it will be understood that various modifications may be made to the embodiments shown herein . therefore , the above description should not be construed as limiting , but merely as exemplifications of preferred embodiments . those skilled in the art will envision other modifications within the scope and spirit of the presently disclosed seal assemblies .

US-201213403008-A

this invention relates to a method for producing - malic acid comprising contacting , in a reaction medium , maleic acid with a microbial maleate hydratase capable of hydrating maleic acid to form - malic acid or a microorganism containing the maleate hydratase , microbial maleate hydratase and a method for producing same . in accordance with the present invention - malic acid with high optical purity is supplied efficiently and economically .

the microorganisms which can be used in the present invention contain maleate hydratase which hydrates maleic acid to form ( r )- malic acid . the enzyme used in the method of the present invention is an enzyme capable of hydrating maleic acid to produce ( r )- malic acid and is named maleate hydratase . the enzyme is classified as class 4 . 2 . 1 . 31 according to the nomenclature of the international enzyme classification . microorganisms which produce an enzyme capable of converting maleic acid into ( r )- malic acid can be selectively isolated based on the capability of producing ( r )- malic acid from maleic acid and distributed ubiquitously in microorganisms including bacteria , fungi and yeast . examples of such microorganisms include bacteria belonging to the genera , arthrobacter , brevibacterium , corynebacterium , bacillus , acinetobacter , pseudomonas , microbacterium , aeromonas , escherichia , alcaligenes , proteus , providencia , paracoccus , protaminobacter , serratia , xanthomonas , amycoplatopsis , streptomyces , rhodococcus , cellulomonas , hafnia , cytophaga , flavobacterium , klebsiella , micrococcus , ancylobacter , morganella , planococcus , kluyvera , kurthia , achromobacter , and citrobacter . examples of the yeast to be used include saccharomyces , saccharomycopsis , yarrowia , candida , debaryomyces , hansenula , kloeckera , kluyveromyces , lipomyces , rhodotorula , schizosaccharomyces , torulopsis , trichosporon , and trigonopsis . examples of the fungi to be used include the microorganisms of the genera , aspergillus , penicillium , rhizopus , and trichoderma . particular examples of the microbial strains to be used are those shown in examples . these microbial strains are available from type culture collections ( atcc : american type culture collection , rockville , md ., u . s . a ., ifo : institute for fermentation , osaka , japan ). these microorganisms can be wild strain or mutants . strains containing genes for maleate hydratase obtainable by dna recombination technique can also be used in the present invention . the microbial maleate hydratase can be those extracted from the above described microorganisms cells or the cultured broth . immobilized enzymes and immobilized microorganisms containing the enzymes can also be employed as long as they exhibit maleate hydratase activity . in order to obtain a culture containing a maleate hydratase activity by cultivating microorganism capable of producing this enzyme , usual cultivation methods can be used ; namely cultivating in a nutrient medium containing organic compounds as a carbon source , organic and / or inorganic compounds as a nitrogen source , and mineral salts , at ph 4 to 10 , at 10 ° to 40 ° c . it is preferred to add at least one compound selected from the group consisting of maleic acid and citraconic acid since a culture having high maleate hydratase activity can be obtained by the addition of such compound . the concentration of these compounds to be added in a medium is generally from about 0 . 1 to 3 % by weight , preferably from about 0 . 5 to 2 % by weight . the effect of these compounds is shown in table 1 hereinbelow and examples 1 and 2 . from these data , it can be seen that the medium containing at least one such compound increases the yield of the enzyme remarkably . table 1______________________________________induction of maleate hydratase by citraconic acid andmaleic acid in brevibacterium helvolum atcc 11822addition to growth at 68 hours specific inductionbasal medium * o . d . ( 660 nm ) activity ** fold______________________________________none 1 . 5 0 . 65 1 . 0citraconic 4 . 1 3 . 13 4 . 8acid ( 1 %) maleic acid 4 . 5 2 . 56 3 . 9 ( 1 %) ______________________________________ * basal medium : nh . sub . 4 cl 0 . 1 %, kh . sub . 2 po . sub . 4 0 . 14 %, na . sub . 2 hpo . sub . 4 . 12h . sub . 2 o 0 . 31 %, mgso . sub . 4 . 7h . sub . 2 o 0 . 025 %, meat extract 5 . 0 % (%: w / v ). ** determined by the amount of ( r ) malic acid formed when reaction mixture ( total volume 2 , 000 μl , ph 7 . 2 ) containing 50 mm trishcl buffer ( 1 , 700 μl ), 100 mm maleate ( 200 μl ), and crude enzyme preparation ( cells sonicate supernatant , 100 μl ) was reacted at 30 ° c . for 60 minutes . furthermore , both solid medium and liquid medium can be used in the present invention . other conditions of cultivation of the enzyme producing microorganisms can be selected appropriately such that the strains can grow well according to the knowledge of those skilled in the art . although upon prolonged cultivation or addition of a releasing agent the enzyme is usually released from the cells and is obtainable by centrifugation of the broth , the malate hydratase contained in the cells can be released as a crude enzyme solution by destructing the cells by grinding or ultrasonication and extracting the enzyme therefrom . of course , the cells as they are can be used as an enzyme preparation . purified maleate hydratase can be obtained from the crude enzyme solution by conventional enzyme purification methods such as an organic solvent fractionation method , an ammonium sulfate differential precipitation method , dialysis , isoelectric point precipitation method , and column chromatography alone or in combination . when a solid medium is used , water is added to the solid medium containing microbial cells , and the mixture as it is or after collecting the cells is subjected to the above - described ultrasonication or the like treatment to obtain a crude enzyme solution . of course , the maleic acid as a substrate can be used in the form of a physiolgically acceptable salt thereof , e . g ., sodium salt or potassium salt , and the resulting ( r )- malic acid can be also obtained in the form of salt thereof , e . g ., sodium salt or potassium salt . the microorganism cells having maleate hydratase activity or enzyme preparation derived therefrom thus obtained can be contacted with the substrate by adding the enzyme preparation in a solution containing the substrate and incubating the reaction mixture until the reaction proceeds or by adding the substrate in a culture broth of the microorganism followed by incubation for reaction . alternatively , the enzyme can be contacted with the substrate in the form of enzyme preparations or cells separated from a culture broth of the microorganism of the present invention , physicochemically or biochemically treated cells such as washed cells , lyophilized cells and acetone - dried cells , extract solution , purified preparations , immobilized preparations , etc . the concentration of the substrate varies depending on whether a batch system or a continuous system is used . in the batch system , it ranges generally from about 0 . 1 to 30 %, preferably from about 0 . 5 to 10 % by weight based on the weight of the reaction medium . in the continuous system , slightly lower ranges of the concentration , namely 0 . 05 to 20 % by weight , is preferred . the reaction can be carried out usually at about 5 ° to 50 ° c ., preferably at about 20 ° to 45 ° c ., at a ph of about 4 to 10 , preferably at a ph of about 6 to 9 . the reaction time varies depending on the means of standing , stirring , flowing down through the column containing the immobilized enzyme , etc ., or the form or activity of the enzyme but usually it ranges from about 1 to 100 hours . the process of the reaction can be monitored by monitoring the generation of malic acid using thin layer chromatography or high performance liquid chromatography . the malate concentration in a reaction mixture can be determined also by colorimetrically after reaction with the mixture of sulfuric acid and 2 , 7 - naphthalenediol according to the method of goodban , a . e . and stark , j . b ., anal . chem ., vol . 29 , p . 283 ( 1957 ). ( r )- malic acid in the reaction mixture is monitored by the method of krebs , h . a . and egglestone , l . v ., biochem . j ., vol . 37 , p . 334 ( 1943 )] based on these values ( malic acid and ( r )- malic acid ), optical purity of the ( r )- malic acid in the reaction mixture can be estimated . the value of the optical purity is not exactly correct but the method is conveniently applicable for tracing the reaction . exact optical purity of the reaction mixture and isolated ( r )- malic acid is determined by high performance liquid chromatography which enables the resolution of dl - malic acid into ( r )- malic acid and ( s )- malic acid . the conditions of the chromatography are as follows : column , mci gel crs 10w ( 4 . 6 × 50 mm ) ( made by mitsubishi kasei , japan ); eluent , 0 . 5 mm cuso 4 / 10 % ( v / v ) acetonitrile ; velocity , 1 . 3 ml / min . ; temperature , 25 ° to 26 ° c . ; detection , at 258 nm . specific rotation of the product is also determined for the determination of the optical purity of the isolated product . hereinafter , the enzymological characteristics of microbial maleate hydratase of the present invention will be explained . the enzyme catalyzes a reaction in which maleic acid is hydrated to form ( r )- malic acid . it does not act on fumaric acid . the enzyme is active at ph 6 . 0 to 9 . 0 and most active at 7 . 0 to 8 . 0 . the enzyme is stable generally at ph 6 . 0 to 9 . 0 and particularly at ph 7 . 0 to 8 . 0 . the enzyme acts well at 20 ° to 50 ° c . and its optimum temperature is about 40 ° c . the enzyme is stable below 35 ° c . at 45 ° c . or more it inactivates rapidly . the molecular weight of the enzyme estimated by the gel filtration method ( using sepharose 4b ) is about 13 . 5 × 10 4 . using sephacryl s - 200 , the value is about 6 × 10 4 . in a concentration of 1 mm , pcmb ( p - chloromercuribenzoic acid ) inhibits 100 % activity , but edta and pmsf ( phenylmethylsulfonylfluoride ) shows no inhibition . iaa ( iodoacetic acid ) and naio 4 ( sodium metaperiodate ) inhibits 12 % and 17 %, respectively . nem ( n - ethylmaleimide ) shows 33 % inhibition at 10 mm . thus , the enzyme seems to contain sh group in its active site . for the recovery of ( r )- malic acid from the reaction mixture , known method for ( s )- malic acid can be applied . thus , ion - exchange treatment , concentration and crystallization process are applied after removal of solids such as cells from the reaction mixture by centrifugation or filtration . hereinafter , the present invention will be described in greater detail with reference to examples which should by no means construed as limiting the present invention thereto . in the following examples all percentages are by weight unless otherwise indicated . a large test tube ( 2 . 4 × 19 . 5 mm ) containing 5 ml of a seed culture medium was sterilized and arthrobacter globiformis ifo 12137 was inoculated and shake cultured at 26 ° c . for 24 hours . one and a half ml of the seed culture prepared as described above was inoculated into an erlenmeyer flask containing 30 ml of a growth medium . the inoculated flask was shake cultured at 26 ° c ., 220 r . p . m ., for 24 hour . cells were collected from 120 ml of the cultured broth by centrifugation and after washing 2 times with 50 mm phosphate buffer ( ph 7 . 0 ), resuspended into 20 ml of 100 mm phosphate buffer ( ph 7 . 0 ) containing 1 . 0 % maleic acid , and 0 . 1 % nacl . the reaction mixture thus prepared was incubated in a large test tube with shaking ( 195 r . p . m .) at 26 ° c . the composition of the seed medium was : glucose 1 %, peptone 0 . 5 %, meat extract 0 . 3 %, yeast extract 0 . 3 %, nacl 0 . 25 %, ph 7 . 0 . the composition of the growth medium was : glucose 1 %, nh 4 cl 0 . 1 %, kh 2 po 4 0 . 14 %, na 2 hpo 4 . 12h 2 o 0 . 31 %, mgso 0 . 025 %, meat extract 0 . 5 %, citraconic acid as indicated in table 2 , ph 7 . 0 . after incubation of the reaction mixture for 19 . 5 to 48 hours , malic acid was produced and its optical purity ( expressed as enantiomer excess , e . e .%) was determined . as shown in table 2 , after 48 hour incubation 4 . 7 g / liter of ( r )- malic acid ( e . e . 73 %) was produced even with the cells grown in a medium containing no citraconic acid . the cells grown in a medium containing citraconic acid produced ( r )- malic acid more rapidly . table 2______________________________________malic acid production ( g / liter ) and opticalpurity ( e . e . %) of the produced ( r )- malic acidincubation time citraconic acid added into growth medium ( hours ) 0 % 0 . 5 % 1 . 0 % 2 . 0 % ______________________________________19 . 5 0 . 3 g / l 5 . 2 g / l 5 . 2 g / l 5 . 0 g / l ( 73 )* ( 71 ) ( 81 ) 24 . 0 0 . 3 g / l 7 . 2 g / l 6 . 4 g / l 3 . 9 g / l ( 80 ) ( 79 ) ( 78 ) 28 . 0 0 . 4 g / l 4 . 6 g / l 6 . 2 g / l 3 . 2 g / l ( 79 ) ( 81 ) ( 61 ) 48 . 0 4 . 7 g / l 0 . 5 g / l 0 . 2 g / l 3 . 0 g / l ( 73 ) ( 58 ) ______________________________________ * the values in parentheses are e . e . %. the same procedures as in examples 1 were repeated except that pseudomonas fragi ifo 3458 , pseudomonas putida ifo 3738 and arthrobacter oxydans ifo 12138 were used as the microorganism . ( r )- malic acid was produced as shown in table 3 . the result shown in table 3 also shows the effect of citraconic acid in the growth medium . table 3______________________________________malic acid production ( g / liter ) and opticalpurity ( e . e . %) of the produced ( r )- malic acid strain ifo 3458 ifo 3738 ifo 12138incubation time citraconic acid added ( g / liter )( hours ) 0 10 0 10 0______________________________________19 . 5 0 . 2 g / l 2 . 3 g / l 0 . 2 g / l 0 . 7 g / l 0 . 2 g / l ( 100 )* 28 0 . 3 g / l 3 . 4 g / l 0 . 3 g / l 0 . 3 g / l 2 . 2 g / l ( 88 ) ( 57 ) 48 0 . 3 g / l 0 . 9 g / l 0 . 2 g / l 0 . 2 g / l 0 . 4 g / l______________________________________ * the values in parentheses are e . e . %. the same procedures as in example 1 were repeated except that brevibacterium helvolum atcc 11822 was used as the microorganism and a medium supplemented with 1 % citraconic acid was used as the growth medium . in this case , 4 . 4 g / liter of ( r )- malic acid was produced after 48 hours incubation and the optical purity ( e . e .) of the ( r )- malic acid was 100 %. after centrifugation of the reaction mixture , the clear supernatant was passed through a column of strongly acidic cation exchange resin ( dowex 50 , h + form ) and then loaded on a column of strongly basic anion exchange resin ( dowex - 1x8 , formate form ). the column was washed with water and then the acids were eluted stepwise with increasing strength of aqueous formic acid . fractions of the effluent containing malic acid ( eluted between 0 . 5 n and 1 n formic acid ) was collected and concentrated to syrup . the syrup was cooled and crystals appeared was washed with small amount of cold acetonitrile and dried . the yield of the ( r )- malic acid isolated was 2 . 5 g from 1 liter of the reaction mixture and its optical purity ( e . e .) was 100 %. the same procedures as in example 3 were repeated except that the microorganisms as shown in table 4 were used . the concentration of the malic acid produced and the optical purity ( e . e .) of the ( r )- malic acid produced were shown in table 4 . table 4______________________________________ malic acid optical purity produced [( r )- malic ( g / liter ) acid , e . e . %] 24 48 24 48microorganism hours hours hours hours______________________________________pseudomonas fluorescence 2 . 8 89ifo 3081pseudomonas pseudoalcaligenes 3 . 2 4 . 8 83 81atcc 12815corynebacterium 2 . 3 93acetoacidophilum atcc 13870corynebacterium callunae 2 . 7 90atcc 15991corynebacterium glutamicum 2 . 0 83atcc 31808corynebacterium vitarumen 5 . 9 85atcc 10234arthrobacter nicotianae 1 . 6 52atcc 21279arthrobacter citreus 1 . 2 100aicc 17775arthrobacter ureafaciens 3 . 2 85atcc 7562bacillus alvei atcc 6344 2 . 7 88bacillus brevis atcc 8185 5 . 7 88acinetobacter calcoaceticus 4 . 6 81atcc 14987______________________________________ the same procedures as in example 1 were repeated except that arthrobacter globiformis ifo 12137 was used as microorganism and growth medium was supplemented with 0 . 5 % citraconic acid and the reaction mixture was incubated statically . after reaction for 24 hours , 6 . 3 g / liter of ( r )- malic acid ( e . e . 99 %) was produced , and after 48 hour reaction , 9 . 1 g / liter of ( r )- malic acid ( e . e . 91 %) was produced . cell - free extract was prepared by sonic treatment of the cells of the microorganisms used in example 3 and example 4 . except that the cell - free extract as above prepared was used in place of the cells in reaction mixture , the same procedures as in example 3 and example 4 were repeated . about 1 . 0 g / liter of ( r )- malic acid was produced with each microorganism . brevibacterium helvolum atcc 11822 was shake cultured in a 300 ml erlenmeyer flask containing 30 ml of a sterilized medium consisting of 3 % glucose , 0 . 5 % k 2 hpo 4 , 0 . 5 % kh 2 po 4 , 0 . 025 % mgso 4 . 7h 2 o , 0 . 001 % feso 4 . 4h 2 o , 0 . 001 % mnso 4 . 4h 2 o , 0 . 5 % meat extract , 0 . 3 % yeast extract , 0 . 5 % peptone , 0 . 5 % citraconic acid ( ph 7 . 0 ) at 26 ° c . for 24 hours . cells were collected from the culture by centrifugation and suspended into 30 ml of 4 % maleic acid solution ( ph of the solution was adjusted to 7 . 0 with naoh ). the reaction mixture thus prepared was incubated statically at 35 ° c . for 72 hours . ( r )- malic acid was produced at a concentration of 4 . 44 % in the reaction mixture and the optical purity ( e . e .) of the ( r )- malic acid was 98 . 0 %. brevibacterium helvolum atcc 11822 was shake cultured in a 300 ml erlenmeyer flask containing 3u ml of a sterilized medium consisting of 2 % glucose , 0 . 5 % nh 4 cl , 0 . 5 % k 2 hpo 4 , 0 . 5 % kh 2 po 4 , 0 . 025 % mgso 4 . 7h 2 o , 0 . 001 % feso 4 . 7h 2 o , 0 . 001 % mnso 4 . 4h 2 o , 0 . 5 % meat extract , 0 . 3 % yeast extract , 0 . 5 % peptone and the balance water ( ph 7 . 0 ) at 26 ° c . for 24 hours . cells were collected by centrifugation and treated with cold acetone . thus prepared acetone - dried cells were suspended in 4 % maleic acid solution ( ph 7 . 0 with naoh ) to produce 30 ml of reaction mixture . the reaction mixture was incubated statically at 35 ° c . for 72 hours . ( r )- malic acid was produced at a concentration of 3 . 03 % in the reaction mixture and the optical purity ( e . e .) of the ( r )- malic acid was 87 . 1 %. brevibacterium ketoglutamicum atcc 15587 was shake cultured in a 300 ml erlenmeyer flask containing 30 ml of a sterilized medium consisting of 1 % glucose , 0 . 1 % nh 4 cl , 0 . 14 % kh 2 po 4 , 0 . 3 % na 2 hpo 4 . 12h 2 o , 0 . 025 % mgso 4 . 7h20 , 0 . 5 % meat extract , 1 % citraconic acid and the balance water ( ph 7 . 0 ) at 26 ° c . for 24 hours . cells were collected by centrifugation and suspended into 5 ml of 100 mm phosphate buffer ( ph 7 . 0 ) containing 1 % maleic acid in a large test tube and shake cultured at 26 ° c . for 48 hours . ( r )- malic acid was produced at a concentration of 1 . 09 g / liter in the reaction mixture and the optical purity ( e . e .) of the ( r )- malic acid was 85 %. the same procedures as in example 5 were repeated except that arthrobacter globiformis ifo 12137 was used as the microorganism . after 20 hour reaction , ( r )- malic acid was produced at a concentration of 4 . 3 g / liter and the optical purity ( e . e .) of the ( r )- malic acid was 79 . 8 %. the reaction mixture was centrifuged to obtain supernatant . the supernatant ( 255 ml ) was adjusted to ph 4 . 5 and boiled 10 minutes at 100 ° c . after the boiling , the formed precipitate was removed and the clear supernatant obtained was passed through a column of strongly acidic cation exchange resin ( diaion sk - 1b , 20 to 50 mesh , h + form ) 50 ml and then loaded on a column of strongly basic anion exchange resin ( dowex 1x8 , 50 to 100 mesh , formate form ) 50 ml . the latter column was washed twice with 100 ml distilled water and the malic acid was eluted with 1 n formic acid . the fraction containing malic acid was collected and concentrated in vaccuo to syrup . the crystal appeared after cooling the syrup was washed with small amount of cold acetonitrile and dried to obtain 0 . 276 g ( r )- malic acid . the chemical purity and optical purity ( e . e . ( of the crystal was 92 . 2 % and 98 . 5 %, respectively . mother liquor of the crystal and the acetonitrile - washed crystal solution were mixed and concentrated under reduced pressure , and 0 . 266 g of ( r )- malic acid was obtained by repeating crystallization and washing . the chemical purity and optical purity of the second crystal were 89 . 3 % and 100 %, respectively . cells of brevibacterium helvolum atcc 11822 grown on a medium containing 2 % citraconic acid , 5 % meat extract , 0 . 1 % nh 4 cl , 0 . 14 % kh , 0 . 31 % na 2 hpo 4 . 12h 2 o , 0 . 025 % mgso 4 . 7h 2 o ( ph 7 . 0 ) was disrupted by sonication . proteins precipitated with ammonium sulfate ( 43 to 60 % saturation ) was further purified by chromatography on sepharose 4b gel . thus , the activity of the maleate hydratase increased 16 - fold compared with that of cell - free extract by the procedures described above . microorganisms shown in table 5 were shake cultured in a 300 ml erlenmeyer flask which contains a sterilized medium consisting of 1 % glucose , 0 . 5 % nh 4 cl , 0 . 5 % k 2 hpo 4 , 0 . 5 % kh 2 po 4 , 0 . 025 % mgso 4 . 7h 2 o , 0 . 001 % mnso 4 . 4h 2 o , 0 . 5 % meat extract , 0 . 5 % peptone , 0 . 3 % yeast extract , 0 . 5 % citraconic acid and the balance water ( ph 7 . 0 ) at 26 ° c ., 220 r . p . m . for 24 hours . cells were collected from the culture by centrifugation and after 2 - times washing with 50 mm phosphate buffer ( ph 7 . 0 ) suspended into 5 ml of 50 mm phosphate buffer ( ph 7 . 0 ) containing 1 % maleic acid and 0 . 1 % nacl . the reaction mixture thus prepared was incubated statically at 26 ° c . for 72 hours . malic acid concentration in the reaction mixture at 24 hour incubation , 48 hour incubation and 72 hour incubation were shown in table 5 . optical purity of the malic acid produced as the percentage of ( r )- malic acid was also shown in table 5 . table 5______________________________________ malic acid produced and optical purity [% of ( r )- form ] microorganism 24 hours 48 hours 72 hours______________________________________aeromonas punctata 2 . 2 g / l 7 . 0 g / l 8 . 2 g / latcc 11163 (& gt ; 95 %) (& gt ; 95 %) aeromonas sp . 3 . 7 g / l 8 . 7 g / l 3 . 2 g / latcc 21763 (& gt ; 95 %) (& gt ; 95 %) (& gt ; 95 %) alcaligenes faecalis 7 . 4 g / l 7 . 6 g / l 8 . 5 g / lifo 3160 (& gt ; 95 %) (& gt ; 95 %) (& gt ; 95 %) escherichia coli 2 . 1 g / l 5 . 7 g / l 8 . 9 g / latcc 4157 (& gt ; 95 %) (& gt ; 95 %) escherichia coli 1 . 7 g / l 6 . 1 g / l 9 . 3 g / latcc 10798 (& gt ; 95 %) (& gt ; 95 %) microbacterium ammoniaphilum 4 . 4 g / l 4 . 6 g / l 6 . 5 g / latcc 15354 (& gt ; 95 %) proteus mirabilis 4 . 9 g / l 7 . 9 g / l 8 . 7 g / latcc 15290 (& gt ; 95 %) (& gt ; 95 %) providencia stuarti 3 . 7 g / l 7 . 8 g / l 9 . 1 g / latcc 25825 (& gt ; 95 %) (& gt ; 95 %) ______________________________________ microorganisms shown in table 6 were shake cultured in a 300 ml erlenmeyer flask which contains a sterilized medium at 26 ° c ., 220 r . p . m . for 24 hours ( bacteria ) or 48 hours ( yeast and fungi ). cells were collected from the culture by centrifugation and after 2 - times washing with 50 mm phosphate buffer ( ph 7 . 0 ) suspended into 5 ml of 50 mm phosphate buffer ( ph 7 . 0 ) containing 1 % maleic acid and 0 . 1 % nacl . the reaction mixture thus prepared was incubated statically at 26 ° c . for 96 hours . the composition of the medium for bacteria consisted of 1 % glucose , 0 . 5 % nh 4 cl , 0 . 5 % k 2 hpo 4 , 0 . 5 % kh 2 po 4 , 0 . 025 % mgso 4 . 7h 2 o , 0 . 001 % mnso 4 . 4h 2 o , 0 . 5 % meat extract , 0 . 5 % citraconic acid and the balance water ( ph 7 . 0 ). for the growth of yeast , yeast extract ( 0 . 2 %) was supplemented to the above - described medium for bacteria and the concentration of meat extract in the medium was changed to 0 . 3 %. the ph of the medium for yeast was adjusted to 6 . 0 . for the growth of fungi , yeast extract ( 0 . 2 %) and meat extract ( 0 . 2 %) were supplemented to the medium for bacteria and the concentration of meat extract in the medium was changed to 0 . 1 %. the ph of the medium for fungi was adjusted to ph 5 . 5 . malic acid concentration in the reaction mixture at 24 hour incubation , 48 hour incubation and 96 hour incubation were shown in table 6 . optical purity of the malic acid produced as the percentage of ( r )- malic acid was also shown in table 6 . table 6______________________________________ malic acid produced and optical purity [% of ( r )- form ] microorganism 24 hours 48 hours 96 hours______________________________________paracoccus denitrificans 6 . 0 g / l 9 . 4 g / l 8 . 7 g / latcc 19367 ( 99 . 9 %) protaminobacter ruber 0 . 5 g / l 0 . 8 g / l 1 . 4 g / lifo 3708 ( 99 . 9 %) serratia rubidae 2 . 3 g / l 6 . 0 g / l 7 . 0 g / latcc 11634 ( 99 . 8 %) xanthomonas translucens 6 . 0 g / l 9 . 5 g / l 7 . 7 g / lifo 13558 ( 99 . 9 %) amycoplatopsis orientalis 6 . 2 g / l 7 . 1 g / l 7 . 2 g / latcc 19795 ( 99 . 9 %) streptomyces coelicolor 4 . 3 g / l 9 . 6 g / l 10 . 4 g / latcc 10147 ( 99 . 9 %) rhodococcus erythropolis 4 . 4 g / l 6 . 5 g / l 9 . 4 g / lifo 12320 ( 99 . 9 %) cellulomonas cellasea 4 . 7 g / l 7 . 7 g / l 10 . 3 g / latcc 487 ( 99 . 9 %) hafnia alvei atcc 9760 3 . 8 g / l 9 . 4 g / l 7 . 6 g / l ( 99 . 9 %) cytophaga sp . atcc 9760 0 . 4 g / l 0 . 6 g / l 1 . 3 g / l ( 99 . 9 %) flavobacterium aquatile 2 . 3 g / l 4 . 0 g / l 5 . 7 g / latcc 8375 ( 99 . 8 %) klebsiella pneumoniae 2 . 5 g / l 4 . 1 g / l 6 . 0 g / latcc 8308 ( 99 . 9 %) micrococcus aurantiacus 1 . 4 g / l 2 . 5 g / l 4 . 4 g / latcc 11731 ( 99 . 6 %) ancylobacter sp . 1 . 7 g / l 3 . 8 g / l 6 . 2 g / latcc 21373 ( 99 . 6 %) morganella morganii 0 . 3 g / l 0 . 6 g / l 1 . 3 g / latcc 25830 ( 99 . 9 %) planococcus citreus 0 . 7 g / l 1 . 2 g / l 1 . 6 g / latcc 14404 ( 99 . 9 %) kluyvera cryocrescens 2 . 1 g / l 4 . 9 g / l 7 . 8 g / latcc 14238 ( 100 . 0 %) kurthia zopfii 0 . 3 g / l 0 . 5 g / l 1 . 3 g / latcc l0538 ( 99 . 9 %) achromobacter cycloclastes 10 . 4 g / latcc 2i921 ( 99 . 9 %) citrobacter freundii 6 . 6 g / latcc 6750 ( 99 . 8 %) saccharomyces cerevisiae 3 . 7 g / latcc 18824 ( 99 . 9 %) saccharomycopsis lipolytica 0 . 88 g / lifo 0746 ( 98 . 6 %) yarrowia lipolytica 1 . 1 g / latcc 16617 (& gt ; 99 . 9 %) candida utilis atcc 9950 0 . 43 g / l ( 81 . 8 %) candida utilis ifo 1086 0 . 40 g / l ( 79 . 0 %) debaryomyces polymorphus 0 . 71 g / lifo 1189 ( 95 . 5 %) hansenula subpelliculosa 0 . 67 g / lifo 0808 ( 97 . 0 %) kloeckera apiculata ifo 0175 1 . 95 g / l ( 98 . 6 %) hansenula wickerhamii 0 . 71 g / latcc 16767 ( 96 . 5 %) kloeckera javanica ifo 1094 3 . 83 g / l (& gt ; 99 . 9 %) kluyveromyces wickerhamii 0 . 32 g / lifo 1675 ( 75 . 5 %) lipomyces starkeyi 0 . 87 g / latcc 20147 ( 96 . 0 %) rhodotorula glutinis 3 . 64 g / latcc 20147 ( 99 . 9 %) schizosaccharomyces pombe 0 . 68 g / latcc 2476 ( 93 . 4 %) torulopsis pinus atcc 22996 4 . 31 g / l ( 99 . 6 %) torulopsis spherica 0 . 26 g / latcc 8549 ( 80 . 3 %) trichosporon cutaneum 0 . 54 g / lifo 0173 ( 87 . 3 %) trigonopsis variabilis 0 . 52 g / lifo 0755 ( 93 . 4 %) aspergillus niger atcc 6275 8 . 11 g / l ( 99 . 9 %) aspergillus oryzae var . 5 . 85 g / lviridis atcc 22788 ( 98 . 5 %) penicillium chrysogenum 5 . 98 g / latcc 9480 ( 99 . 1 %) penicillium citrinum 4 . 15 g / latcc 14994 ( 91 . 4 %) rhizopus chinensis var . 1 . 96 g / lliquefaciens ifo 4737 ( 96 . 7 %) trichoderma reesei 5 . 03 g / latcc 13631 ( 98 . 8 %) trichoderma longibrachiatum 5 . 02 g / lifo 4847 ( 99 . 3 %) ______________________________________ while the invention has been described in detail and with reference to specific embodiments thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .

US-82119792-A

a rotary feeder includes a housing in which a rotary member is supported between two lateral bearing caps , with one journal fixedly supported in one bearing cap and the other journal loosely supported in the other bearing cap . for facilitating maintenance and cleaning of the rotary feeder , a carriage is securely mounted to the one bearing cap accommodating the fixed bearing . the carriage is movable and suitably guided in axial direction of the rotary member by at least the axial length of the rotary member so as to allow removal and return of the rotary member from and back into the housing in an accurate and safe manner .

referring now to the drawing , and in particular to fig1 there is shown a perspective view of a rotary feeder or cellular wheel sluice including a housing 1 provided with an inlet 5 and an outlet 5a . the rotary feeder is provided with a rotary member 4 being disassembled or removed from the housing 1 to allow access thereto . the rotary member 4 is mounted on a shaft ( not shown ) which is rotatably supported in lateral bearing caps 2 , 3 of the housing 1 via respective journals 4a . in the assembled state of the rotary feeder , the journal 4a is loosely supported in the bearing cap 2 by means of a suitable bearing which is not shown in fig1 while the other journal 4a is supported in the bearing cap 3 by means of a fixed bearing 3a . for transporting material such as bulk material from the inlet 5 to the outlet 5a , the rotary member 4 includes a plurality of blades 4b . although not shown in the drawing , the rotary member 4 is operatively connected to a drive which is suitably accommodated at the side of the bearing cap 2 . connected to the outside of the bearing cap 3 is a u - shaped handle 10 as well as a transverse shank 6 . 1 which is part of a u - shaped carriage or frame generally designated by reference numeral 6 . the carriage 6 is further provided with longitudinal shanks 6 . 2 extending at each side of the rotary member 4 in axial direction thereof attached to each longitudinal shank 6 . 2 is a pair of spaced fishplates 7 which project upwardly and support short axles 7 . 1 at their ends distant to the longitudinal shanks 6 . 2 . supported on the axles 7 . 1 are concave - shaped rollers 8 which run along guide rods 9 extending parallel to the center axis of the rotary member 4 at each side of the housing 1 and fixedly connected to the housing 1 by means of bolts 9 . 1 . as shown in fig1 the guide rods 9 are of circular section so as to complement the concave profile of the rollers 8 and extend unsupported beyond the housing 1 , at least by the axial length of the rotary member 4 to allow the rotary member 4 to be pulled out to a sufficient degree . when removing the rotary member 4 from the housing , the operator grasps the handle 10 and moves the carriage 6 and thus the rotary member 4 outwardly , with the rollers 8 running along the guide rods 9 for accurate guidance . it will be appreciated that adjusting screws ( not shown ) may be provided for ensuring accurate parallelism of the guide rods 9 . for the same reason , it may be suitable to have one pair of rollers 8 which is assigned to the same guide rod 9 to be fixedly supported on its axles 7 . 1 in axial direction while the other pair of rollers 8 is loosely supported on its axles 7 . 1 in axial direction . although not shown in the fig1 suitable end stops are provided in order to limit the advancement of the carriage 6 in axial direction . turning now to fig2 there is shown a perspective view of a second embodiment of a rotary feeder according to the invention , with the rotary member 4 being moved into the housing 1 . in the rotary feeder according to fig2 same reference numerals are used for identical parts as shown in fig1 . in the rotary feeder according to fig2 the guide rods 9 are connected to the housing 1 via brackets 16 . running along the guide rods 9 are the rollers 8 which are supported on the axles 7 . 1 mounted to the fishplates 7 . in contrast to the first embodiment of the rotary feeder , the fishplates 7 of the u - shaped carriage 6 are arranged at the inside of the guide rods 9 to allow assembly of an additional support unit for the rotary member 4 . the support unit includes opposing bearing plates 11 mounted externally to the guide rods 9 at a suitable distance to the side face of the housing 1 and projecting downwardly . supported by each bearing plate 11 is a two - armed lever 12 which is mounted to the bearing plate 11 at pivot 11 . 1 so as to swing about an axis perpendicular to the center axis of the rotary member 4 . at their lower ends , the levers 12 are connected to each other via a crossbar 13 which rotatably supports a bearing block in form of a roller 14 . the arrangement of the levers 12 is such that they extend in axial elongation of the carriage 6 which is mounted to the bearing cap 3 . in vicinity of its junction with the transverse shank 6 . 1 , each longitudinal shank 6 . 2 is provided at its underside with a small roller 15 . when disassembling the rotary feeder , the operator grasps the handle 10 to pull out the carriage 6 with the rotary member 4 . upon movement in axial direction , the carriage 6 abuts the levers 12 to thereby swing them about the pivots 11 . 1 from a vertical orientation as shown in fig2 to a horizontal orientation as shown in fig3 . simultaneous with the swinging of the levers 12 , the rollers 15 run on the upper side of the levers 12 to accurately guide the movement of the carriage 6 , and the roller 14 swings to the raised position as sown in fig3 in which the roller 4 supports the rotary member 4 . the second embodiment is thus especially suitable for rotary feeders of considerable weight . when sliding the bearing cap 3 and the rotary member 4 back into the housing 1 , the levers 12 return to the position as shown in fig2 by the weight of the roller 14 . it will be appreciated that the rotary feeder according to fig2 also may include suitable end stops in order to limit the advancement of the carriage 6 in axial direction . turning now to fig4 there is shown a third embodiment of a rotary feeder in accordance with the present invention . same reference numerals have been used for identical parts as shown in fig2 . the rotary feeder of fig4 is also equipped with a support unit which in contrast to the automatically actuated design of the second embodiment is now manually operated . the support unit according to fig4 includes a u - shaped bracket generally designated by reference numeral 18 and including a transverse shank 18 . 1 provided at a central position thereof with a supporting plate 19 , and two longitudinal shanks 18 . 2 which are each swingably mounted at pivot 18 . 3 to the lower section of a link 20 . the links 20 are securely connected to the guide rods 9 at a distance to the side faces of the housing 1 . attached to one longitudinal shank 18 . 3 is a handle 21 which extends outwardly in axial direction to allow easy actuation by an operator . projecting inwardly from one of the longitudinal shanks 18 . 2 is a catch 22 which cooperates with a stop member 23 mounted to the pertaining link 20 . after pulling the carriage 6 to move the rotary member 4 into the respective end position which may be defined by suitably located end stops ( not shown ), the bracket 18 swings counterclockwise by 90 ° by means of the handle 21 , with the catch 22 latching behind the stop member 23 which is suitably attached to the link 20 so as to retract when being passed by the catch 22 . once , the catch 22 moves past the stop member 23 , the latter automatically returns to its illustrated locking position so as to lock the bracket 18 . by swinging the bracket 18 counterclockwise in the described manner , the supporting plate 19 bears against the underside of the rotary member 14 to provide additional support thereof . for releasing the bracket 18 , the stop member 23 is retracted by means of a grip 23 . 1 which is indicated in fig4 and suitably connected to the stop member 23 . then , the handle 21 is actuated in clockwise direction to return the bracket 18 into its initial position . while the invention has been illustrated and described as embodied in a rotary feeder , it is not intended to be limited to the details shown since various modifications and structural changes may be made without departing in any way from the spirit of the present invention .

US-35617889-A

a process for the drying of woven glass fabric to be used in a reinforcing laminate in sensitive electronic equipment is disclosed . the process adopts a drying technique of utilizing dielectric or radio frequency heating which results in a cleaner product .

fig1 represents a schematic drawing of the method of the present invention . all equipment is preferably enclosed within a plexiglas or other suitable enclosure with a positive air pressure filtered atmosphere maintained . woven glass fabric 10 is supported on a mandrel 12 . the fabric 10 preferably is initially placed in a batch oven ( not shown ) for heat cleaning . the fabric 10 is seamed by a thermal splicer 14 . a draw roll assembly 16 pulls the fabric 10 and controls the tension in the unit . thereafter , the fabric 10 is immersed in an application pad box 18 where it is completely saturated in an aqueous based finish solution . although different types of finish solution may be used , preferably the finish solution is a silane coupling agent of less than 1 % concentration . the fabric 10 is then subjected to squeeze rolls 20 to remove the excess finish solution . the wet fabric 10 , which is approximately about 40 % wet pick up , is subjected to dielectric heating in an rf dryer 22 where it is “ completely dried .” the term “ completely dried ” as used herein means fabrics having less than 0 . 2 % moisture content . depending on the fabric style , the wet pick tip may be between about 20 % to 50 %. during the drying process the fabric is preferably substantially vertical because of the close clearance between the electrodes . thus , if tension is lost in the fabric as it travels vertically , the fabric will not sag onto the electrodes . the dielectric heater preferably is a rfc macrowave ™ model 952 vertical single pass web dryer distributed by radio frequency co ., of millis , mass . although other dryers and frequencies may be used , the rfc macrowave ™ model 952 system includes a generator with a nominal operating frequency of about 40 . 68 mhz with a tolerance of ± 0 . 05 %. the generator requires 460 v , 3 ω , 60 hz , and 90 kva input at full output power . the water - cooler oscillator tube with a capacity of 180 , 000 btu is rated for 120 kw maximum power . further , the generator operates with self - contained dust - tight cool air circulation to maintain component ratings and reliability . the system also includes a vertical single pass staggered through - field applicator for the generator . the drying zone is configured to accept a 63 ″ ( 1600 mm ) wide web with a ± 1 ″ tracking wander . after drying , the fabric 10 is subjected to a vacuum unit 24 that removes remaining lint and fibers from the dried fabric 10 . preferably , an inspection is completed on - line with automatic inspection equipment 26 . the clean , dried fabric 10 is then taken up in a finished roll 28 . the term clean is used to define fabric that has undergone the lamination process and passes magnified optical inspection . for example , the fabric is subjected to an epoxy resin and copper clad . thereafter , a circuit pattern is etched onto the laminate . the board is then optically inspected under magnification . if particulate matter is detected the laminate is marked . a clean laminate , therefore , is one substantially free of particulate matter . to test the rf system , a web drying system was used with a 1 ¼ inch staggered through - filed electrode system . samples of product were secured to a paddle and oscillated while the rf is applied for the required dwell time . a rail system supports the paddle . the following table represents arbitrary production specifications chosen to simulate the rf drying procedure . to calculate moisture loss , the samples were weighed before drying , after drying , and also after left in a kiln for ten minutes . the kiln drying allows for the measurement and determination of the bone - dry weight . the plate current was recorded before and during testing . table 2 shows the results of 5 samples of rf - dried fiberglass mat . the effective dwell time , as shown above in table 2 , is dependent upon the desired production speed and the array length . moreover , the speed required for stimulation is dependent upon the dwell time and the array length in the test unit . all samples showed acceptable levels of non - contamination . to determine the level of foreign particles on woven glass fabrics dried with hot air , 10 samples were tested using a teknek dcr 12 dust cleaning roller and teknek dcr pads . the dcr roller was cleaned by rolling over the dcr pad before each use . the cleaned dcr roller was held against moving woven glass fabric either on a take - up roll or opposite a steel roller on a finishing unit or inspection frame . the dcr roller ran in contact with the fabric for approximately 30 linear feet , calculated by a timed interval ( seconds required 600 / yards per minute ). immediately thereafter , a new dcr pad was uncovered and the dcr roller was rolled over the new pad . the pad was then covered with a sheet of overhead transparency film . using a 5 ″ diameter fluorescent magnifier work lamp at a distance of approximately 12 ″ to 14 ″ the dcr pad was inspected with all visible particles being circled . the number of circles were counted and recorded as particles per 30 sq ./ ft / of glass fabric surface . using hot air as the method for drying the fabric , levels from 25 to 84 particles per 30 sq . ft . remained on the fabric . this level of particulate matter is unacceptable for sensitive electronic equipment laminates . we estimate that rf drying will result in at least a 70 % reduction in foreign particles as compared to previous methods of drying , such as hot air . the foregoing has described a substrate material and its method of manufacture by which the quality of woven glass fabric and , thus , the quality of circuit boards themselves can be significantly improved . drying the woven glass substrate fabric by dielectric heating results in a significantly cleaner fabric . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention .

US-71758300-A

disclosed is a medical sanitary multifunctional system bed for nursing having necessary functions which can be added optionally according to clinical conditions of users and hence , it can be supplied at a lower cost . the optional addition of functions allows the medical sanitary multifunctional system bed to perform necessary functions case by case thereby minimizing economical burdens on patients . ordinarily , it is provided with a lower capsule supported by a metallic supporting frame , an upper capsule mounted on the lower capsule , a movable and rotatable portion , which is supported by the metallic supporting frame and a plurality of removable cushions placed on the movable portion . on a optional basis , the bed includes a stool , bath tub , shower and washers .

preferred embodiments according to the present invention will be described in detail with reference to accompanying drawings . referring first to fig1 , fig2 and fig3 , two each of hinge holes 34 for rotatably supporting a rotation support shaft 2 are formed vertically at the center parts on both sides of a bed base 1 , a hinge 34 a is mounted on the hinge holes 34 and with a rotation controller 4 on the hinge 34 a , the body 3 of the bed is mounted on the bed base 1 . in the form of the embodiments , the rotation controller 4 comprising a motor , a reduction gear and the like is provided to accomplish the rotation of the body 3 of the bed without requiring so large forces and the position of the rotation controller 4 mounted on the hinge 34 a can be selected vertically to allow the selection of the height positions of the body 3 of the bed freely . for example , the position is lowered in the normal operation and during the use of the flush toilet , it is raised for the user confined to the bed thereby significantly improving the handling of the body 3 of the bed . the bed base 1 in the embodiments is provided with a string - hoisting bed 5 , a waist bed 6 , an upper half body support bed 7 and the like and the waist bed 6 and the string - hoisting bed 5 are made foldable mutually to be connected with a bed connection cover 8 , which prevents a danger of getting the user &# 39 ; s body caught in the folded portion when the string - hoisting bed 5 is lifted or lowered . in fig1 , the string - hoisting bed 5 and the waist bed 6 shown as a zone p are divided to let the lower half body of the user be washed as illustrated by a side view of fig2 and include a lower water tank 21 , an upper 11 d body 22 , a string 23 for hoisting , a motor 24 for hoisting with a string for lifting or lowering the string - hoisting bed 5 and the like . several draining holes 5 a are formed in the string - hoisting bed 5 . as shown in fig2 , a cord heater 25 is arranged for the cushion 60 part of the waist bed 6 to keep the user 10 warm moderately so that the body of the user 10 wetted under washing can be dried completely . an air heater 220 is mounted on an upper lid body 22 to get the wetted body under the use of an upper hot water washer 26 dried . the cushion 60 part of the bed also can be dried by the above - mentioned methods and for example , the cushion 60 part may be made detachable freely through a velcro thereby enabling quick replacement of the wet one with dry one 60 . the upper hot water washer 26 is mounted on the upper lid body 22 and a lower hot water washer 27 is mounted below the position of the hip of the user 10 . in the form of the embodiments , an example shows one - side opened arrangement of the cushion . the body of the user 10 is washed by hot water discharged to the user 10 in a shower from the upper and lower hot water washers 26 and 27 . a water shielding cover 28 is mounted at an end part of the upper lid body 22 to prevent washing hot water from scattering over the upper half body of the user 10 while his lower half body is being washed . the water shielding cover 28 is formed out of a rubber or a vinyl - based synthetic resin . in fig2 , there is shown an example that a cord heater - applied belly band 11 is mounted on the belly part of the user 10 to keep the user 10 warm while shielding the part from water . in order to support the body of the user 10 with the lower portion thereof opened as seen therein , a waist support belt 29 is disposed on the waist bed 6 . to drain the water accumulated on the bottom part of the lower water tank 21 , an underwater pump 21 a is disposed and when the hot water discharged to the user 10 from the upper hot water washer 26 is accumulated within the lower water tank 21 , it is pumped up and drained with the underwater pump 21 a to eliminate such a trouble as an overflow of the lower water tank 21 , eventually getting the inside of a room wetted where the bed is placed . as shown in fig1 , a plurality of upper bed washing nozzles 9 are arranged to wash portions between the user 10 and the waist bed 6 and so , none of them is used except when the user 10 becomes so feeble to be confined to the bed . both on the left and right sides of the upper half body support bed 7 , upper half body supporting bodies 12 and 13 are disposed and made slidable approaching each other to match the size of the user 10 . when the upper half body support bodies 12 and 13 thus arranged according to the embodiments are used , the upper half body support bodies 12 and 13 are fixed at specified positions determined to match the width of the body and then , with a blanket or the like thereon , the user 10 is fastened on the bed with a belt so that the user 10 is supported and kept from falling down from the bed when the bed is inclined so as to prevent possible bedsore . various types of beds are considerable . one example is shown in fig3 . as illustrated in fig3 , the bed base 1 in the form of the embodiments has casters 31 for moving mounted at a lower part thereof . as previously stated , upper and lower vertical plates 32 and 33 are provided respectively with hinge holes 34 which are used for moving the rotating support shaft 2 vertically when the bed is rotated . a lock hole 35 for fixing the bed is formed in the upper vertical plate 32 . an auxiliary bed 36 is attached on one side along the length of the bed base 1 to increase the effective bed width for the bed not rotated . referring to fig4 , a lower flush toilet 400 is described . the lower flush toilet 400 is disposed under the waist bed 6 in fig1 as required and at the lower end part thereof , a rotary roller 400 a is disposed within an engaging part 6 a provided on the waist bed 6 to guide the lower flush toilet 400 to a specified position under the waist bed 6 . on the other hand , casters 401 for moving are disposed on the underside of a base plate 402 provided at a lower part of the lower flush toilet 400 to allow it to be pulled out from under the waist bed 6 simply in the cleaning or the repairing thereof . a support base 403 is mounted on the base plate 402 through an air support mechanism 404 , which is provided to support the weight of above washing water tank 405 when it is filled with water . in the form of the embodiments , an example shows the air support mechanism constituted of a bellows 404 a and a compressor 404 b . a ball tap 406 is mounted in the washing water tank 405 and moves vertically depending on washing water stored in the washing water tank 405 so that water is supplied into the washing water tank 405 from a water supplying pipe according to the position thereof . the washing water stored in the washing water tank 405 is pumped up with the underwater pump 407 to be supplied to the lower hot water washer 27 . on the other hand , a crushing chamber 408 is provided to receive hot water discharged from the lower hot water washer 27 and excrement discharged from the user 10 and a crushing cutter 409 is disposed to crush solid matters being rotated with the motor 410 of the crushing chamber 408 . the filth crushed by the crushing cutter 409 is accumulated in a sewage chamber 412 through a dirt filter 411 disposed at the lower end part of the crushing chamber 408 and when the liquid in the sewage chamber 412 reaches a specified level , the level is detected with a float switch 413 . when the float switch 413 detects the level reaching the specified level , it activates an underwater pump 414 to discharge the sewage outside . referring to fig5 , a water tank 500 is described . the water tank 500 in the form of the embodiments is built up of a resin or steel and has a cold water layer 501 and a hot water layer 502 . ball taps 503 and 504 are arranged respectively in the cold water layer 501 and the hot water layer 502 and restrict water and hot water to be supplied through water resistant hoses 505 and 506 to reach specified levels . underwater pumps 507 and 508 are arranged respectively in the cold water layer 501 and the hot water layer 502 and the underwater pump 507 in the cold water layer 501 supplies cold water to the lower flush toilet 400 through a hose 509 to be used for washing the filth . the hot water pumped up with the underwater pump 508 is supplied to the hot water washers 26 and 27 through a hose 510 for the supply of hot water . as in the form of the embodiments , this can separate the utilization of the hot water from the utilization of the cold water to prevent useless consumption of the hot water thereby reducing required expenses . the underwater pump 508 disposed in the hot water layer 502 supplies hot water to the upper and lower hot water washers 26 and 27 through the hose 510 for the supply of hot water wound with the cord heater . in the form of the embodiments , a heat insulating material is arranged in the wall surface of the hot water layer 502 while the hot water is supplied through the hose 510 for the supply of hot water wound with the cord heater so that the hot water is prevented from being cooled in the hose 510 for the supply of hot water . thus , the hot water can be supplied being kept hot constantly in the operation to prevent a possible trouble of cooling the hot water down in the hose 510 for the supply of hot water when it is supplied to the user 10 . referring to fig6 , the example of the waist bed 6 properly changed in form is described . a waist bed 600 in the form of the embodiments is so arranged that cushions 601 and 602 are opened both to the left and right . the opening or closing of the cushions 601 and 602 is done by an opening - closing control string 603 , which is pulled by the rotation of a motor not illustrated to move the cushions to the normal positions at which the user lies on his side or the positions at which the cushions serve as a toilet seat for discharging excrement . to wash on the surfaces of the cushions 601 and 602 , hot water pipes 604 are arranged along both left and right sides thereof and hot water flowing out of the hot water pipes 604 runs on the surfaces of the left and right cushions 601 and 602 as indicated by the dotted line in fig6 . the cushions 601 and 602 can be built by placing the cushions containing a heater for warming on a stainless plate or a hard synthetic resin . in the example shown in fig6 , a lower washer 606 is arranged being divided on the left and the right of a crushing chamber 605 and the hot water which is discharged from the lower washer 606 and washes the user is guided to the crushing chamber 605 . fig7 shows the example of the waist bed 6 properly changed in form . a waist bed 700 has left and right cushions 701 and 702 arranged on the left and right areas thereof and a body waist / hip cushion 703 is disposed between the left and right cushions 701 and 702 . the body waist / hip cushion 703 is formed into a shape that allows the supporting of the hip part of the user 10 when he sits thereon and is cut off at the central part thereof to facilitate the washing of the local part of the user 10 by the hot water discharged from the lower hot water washer 27 . referring to fig8 , the example of the upper lid body 22 properly changed in form is described . an upper lid body 800 shown in fig8 is an example in which a capsule formed in a semicircle surrounding the waist part of the user 10 is arranged on a bed 802 . the bed 802 is built higher on both sides thereof than the central part thereof so that water dropped on the bed is gathered to the central part to run downward from the central part . fig9 shows an example of the lower part of the string - hoisting bed 5 properly changed in form . as in fig9 , in the example , curtains 901 and 902 for preventing the scattering of water are disposed both on left and right sides on the underside of a bed 900 . the curtains 901 and 902 for preventing the scattering of water are detachably mounted on protruded pieces 903 and 904 arranged projecting downward from both left and right sides on the underside of the bed 900 through fasteners 905 and 906 and can be removed freely for cleaning under the bed 900 . strings 907 are mounted respectively at lower end parts of the curtains 901 and 902 for preventing the scattering of water to regulate the interval therebetween 901 and 902 with the strings 907 while preventing the curtains 901 and 902 from being stuck on the lower water tank 21 . fig1 shows an example of the connection changed in form between a bed 1000 and the lower water tank 21 ( not illustrated ). in the example , a bellows type curtain 1001 for preventing the scattering of water is disposed on the underside of the bed 1000 . in the case of the example , water dropping from the bed 1000 is prevented from scattering into the room to be gathered into the lower water tank 21 accurately . referring to fig1 , the example of the upper lid body 22 properly changed in form is described . in an upper lid body 1100 in the example , a box - like framework 1101 is built up of steel or the like and a transparent body 1102 made of a synthetic resin is disposed thereon 1101 and one side end thereof is mounted on the bed through a hinge mechanism ( not illustrated ) while a knob 1103 is mounted on the other side end part thereof and held to open or close the transparent body . fig1 is a perspective view showing the example of the upper half body support bed . in the example shown in fig1 , rails 1201 for moving are installed respectively on the front and rear sides of a bed 1200 across the width thereof and sliders 1202 are slidably disposed on the respective rails 1201 . body support frames 1203 are mounted on the sliders 1202 while an upper washer 1204 is mounted on the bed 1200 . fig1 is a view for describing how the body supporting frames 1203 are used . as shown in fig1 , the body supporting frames 1203 are slid to contact the user 10 sufficiently . as mentioned above , the body supporting frames 1203 sufficiently contacting the user 10 firmly support the user 10 when the bed 1200 is inclined to help the user turn on his side in bed . in fig1 , the numeral 1205 indicates a blanket and 1206 a body supporting belt . fig1 is a perspective view of another arrangement of the upper lid body 22 . an upper lid body 1400 is constituted of first and second upper lid bodies 1401 and 1403 which are openably mounted separately on the side parts of a bed 1403 . in this manner , the division of the upper lid body simplifies the handling thereof as compared with the integral formation thereof . based on fig1 and 16 , the example of a handy bed type is described . as illustrated , in the example , a handy bed type 1500 is housed into a water tank 1600 . the handy bed type 1500 comprises a bed 1501 for the upper half body , a bed 1502 for the waist part and a bed 1503 for leg parts which are foldable freely individually . the water tank 1600 is rotatably supported on a support base 1700 and a turning mechanism 1701 ( motor 1701 is shown representing the turning mechanism in fig1 ) is actuated to turn the water tank by arbitrary angles . a lower flush toilet 1504 as mentioned above is disposed below the bed 1502 for the waist part . the bed 1503 can be set at arbitrary angles with a hoisting mechanism 1505 . in addition , an underwater pump 1601 is arranged within the water tank 1600 to discharge the sewage accumulated in the water tank 1600 outside . in the medical sanitary multifunctional system bed , as previously stated , the present invention provides a unique structure of adding various functions separately onto the body of the bed and so , the user can select necessary functions to build a bed in which functions truly required are arranged systematically . this can eliminate the disadvantage for the user due to extra payments for unreasonably higher prices as a result of unnecessary functions included . for example , when the user becomes too feeble to walk to toilets down from the bed , the lower flush toilet 400 is attached under the bed . if this is possible , the users who are able to walk to toilets can obtain system beds at prices which can be lowered just by the cost equivalent to that of the lower flush toilet 400 . in order to be attached additionally , the flush toilet under the bed is detachably built , hence offering an advantage of facilitating cleaning and maintenance thereof . in addition to the flush toilet under the bed , additional functions available as required according to the present invention are an upper body washer , a bed rotation aid for preventing possible bedsore , shower and bath sets and the like . the system bed provided integrally with all of the functions may be very costly . but selective addition of the necessary functions as seen in the system bed in the form of the embodiments makes it possible to obtain a system bed having the necessary functions at as lower costs as possible . ( a ), ( b ), ( c ), ( d ), ( e ) and ( f ) of fig1 show an example of the invention for a bath and how to take a bath . description is made in the order of ( a ) to ( f ). the numeral 53 in the drawing ( a ) indicates the cushion part of the bed on the outside of which a frame ( not illustrated ) made from wood , aluminum , steel or the like is applied . the bed ( cushion parts ) is turned with a hinge 52 and automatically controlled . rails , indicated at 51 , are arranged parallel side by side on the front and rear sides of the frame on the cushion of a rotary bed and a gear and a lock mechanism are provided within a rotation fixing device , indicated at 50 . a bath tray , indicated at 55 , for bathing is normally folded under the body of the bed so as not to disturb the use of the body 53 of the bed and is moved only when the patient takes a bath . the bath tray 55 in the drawing ( a ) is moved to the position as indicated in the drawing ( b ) when turned by 225 with the rotation fixing device 50 . when the bath tray at the position as indicated in the drawing ( b ) is pushed manually by an attending person with a knob , indicated at 56 , it is shifted to the position as indicated in the drawing ( c ). the rotation fixing device is locked , a cushion such as japanese cushion is placed beneath the patient 63 being kept lifting a bit to let belts 61 and 62 pass and then , the body of the patient is fixed with a belt winding device , indicated at 59 , which is operable manually or electrically . when the rotation fixing device 50 in the drawing ( d ) is unlocked and the bath tray is transferred to the tip of the rails , the body of the user and the bath tray reach the position as indicated in the drawing ( e ). as the bed is turned slowly by 90 with a bed rotation controller 65 in the drawing ( f ), the bath tray enters into a bath tub and hot water flows thereinto through numerous holes ( 50 or the like ) to cover the bath tray . then , the belts are taken off to make the patient take a bath . thus , the present invention facilitates the taking care of the patient in a bath . the patient is transferred back onto an upper part of the bed by following the reverse prodecure relative to the one as metioned above . in the present invention , the body of the bed is constituted of the bed for supporting the lower half body of the user , the waist - bed for supporting the central part of the user and the upper half body of the user and is rotatably mounted on the bed base while being so arranged to allow the mounting of the upper hot water washer at an upper part of the bed , of the lower hot water washer and the lower flush toilet under the waist bed and of the upper half support body used for changing the position of the user on the upper half body support bed , which makes it possible to provide a bed with functions alone necessary for the user . as a result , a medical sanitary multifunctional system bed with required functions only can be supplied at lower costs . the optional addition of the necessary functions allows the building of medical sanitary multifunctional system beds to match the clinical conditions of the user . this enables the providing of beds for nursing which have the functions necessary to the minimum but sufficient for the nursing of patients and fairly aged persons unavoidably confined to the beds . furthermore , in the present invention , the cord heater is wound on the hose for the supply of hot water for supplying hot water stored in the water tank to prevent possible trouble of supplying the hot water chilled , namely cooled water to the user early in the operation thereby allowing the user to be supplied with comfortable hot water constantly .

US-73933503-A

a portable or stationary apparatus incorporating a reel for storage of the swimming pool vacuum hose and a means for submerging the hose as it is unwound into the pool , assuring thereby the filling of the hose with water coincident with its being dispensed into the pool . the evacuation of air from the hose permits the immediate connection of the hose to the vacuum pump without causing the pump to lose its prime .

referring more particularly to the drawing by characters of reference , fig1 - 3 disclose the vacuum hose storage and dispensing device or apparatus 10 of the invention . the apparatus 10 comprises a frame 11 , a reel 12 , a swinging arm 13 , a submerging roller 14 , and wheels 15 . the frame 11 has a horizontal rectangular base 16 , having a length approximately three times its width . attached to the longer two edges of the base 16 are two vertical side plates 17 and 18 . the side plates approximate upright isosceles triangles . joining the top ends of the two side plates 17 and 18 is a slotted cross - member 19 which stiffens the frame 11 and serves as a handle for moving the apparatus 10 . the reel 12 in the embodiment of fig1 - 3 comprises two parallel coaxial circular side members 21 and 22 joined by a number of transverse rods 23 . the rods 23 are uniformly spaced about the circumference of a circle 24 which is centered relative to the common axis of the side members 21 and 22 . the diameter of the circle 24 is approximately one - half the diameter of one of the side members 21 or 22 . the ends of the rods 23 may be cemented or welded to the inner surfaces of the side members 21 and 22 . for enhanced rigidity and strength , their ends may extend into blind holes provided in the inner surfaces of the side members 21 and 22 . as an alternate construction , the rods 23 may be replaced by hollow pipes or tubes . bolts or threaded studs passing through the pipes and through aligned holes in the side members 21 and 22 may then be utilized to clamp the side members 21 and 22 against the opposite ends of the pipes to form a rigid structure for the reel 12 . a shaft 25 passed through the center of reel 12 and through centered , oppositely positioned holes in the plates 17 and 18 of frame 11 is secured by a nut 26 . the shaft 25 serves as the rotational axis for the reel 12 . attached to one of the rods 23 is a hose gripper 27 . as shown most clearly in fig1 and 2 , the initial implementation of the gripper 27 utilized a plastic bottle 28 . the conical or cone - shaped configuration such as the neck of bottle 28 is appropriately dimensioned and tapered to fit inside the end of a vacuum hose 29 so that when the end of hose 29 is thrust over the neck of bottle 28 , a gripping action is realized between the two parts . a machine screw 30 is passed through a hole in the bottom of the plastic bottle 28 and edgewise through one of the rods 23 . in this case rod 23 is in the form of a hollow tube which is free to rotate about its own axis so that a pivotal mounting is thereby afforded for gripper 27 . because of the pivotal freedom of gripper 27 , the attached hose is free to assume an unstressed position as it is wound onto reel 12 during a storage operation . wheels 15 are mounted at the ends of an axle 31 which passes through two aligned holes located opposite each other in the lower rear corners of plates 17 and 18 of frame 11 . in the rest position of frame 11 , as shown in fig1 and 3 , the vertical position of axle 31 is just high enough from surface 32 , on which apparatus 10 rests , so that the outer diameters of the wheels do not touch surface 32 . apparatus 10 is thus prevented from rolling or moving out of its rest position . as the apparatus 10 is tilted backward , however , wheels 15 come into contact with surface 32 and support the weight of the apparatus 10 so that it may be conveniently moved about . the swinging arm 13 has a generally rectangular picture - frame configuration comprising two long parallel side members 34 , joined at or near their ends by two shorter transverse members 35a and 35b . members 34 are approximately equal in length to the diameter of reel 12 , and members 35a and 35b are somewhat longer than the width of frame 11 . member 35a passes through two opposing aligned holes 36 and 37 located near the lower front corners of the side plates 17 and 18 of frame 11 , and it forms therewith a pivotal mounting means for arm 13 . member 35b serves as the axle for roller 14 . members 34 extend somewhat beyond the points at which member 35b is attached , and then bend outward at right angles to form two guide bars , 38 and 39 . in the utilization of apparatus 10 during the vacuuming operation , apparatus 10 with the hose 29 wound on reel 12 is first moved into position at the edge of the swimming pool , as shown in fig1 and 3 . the free end of hose 29 extends downward toward the pool from the top of reel 12 . after attaching the free end of hose 29 to the vacuum head and after also attaching a pole or handle to the vacuum head , the operator lowers the vacuum head to the bottom of the pool at the edge of the pool adjacent apparatus 10 . as this is done a portion of hose 29 is unwound from reel 12 and extends downwardly into water 40 . the swinging arm 13 is then pivoted forward in the direction 41 and the roller 14 comes to rest against the upper surface of hose 29 , the weight of the roller 14 causing hose 29 to be submerged in water 40 . the operator then again takes up the handle attached to the vacuum head and drags the vacuum head toward the opposite end of the pool while keeping the vacuum head submerged . as this is done , hose 29 unwinds from reel 12 which freely rotates about its own axis 25 . during the unwinding of hose 29 , guide bars 38 and 39 keep the hose 29 in position under roller 14 . also during this time , water enters the vacuum head and flows into hose 29 , filling it to the point of submersion 42 . the air 43 which is displaced during the filling with water of hose 29 is exhausted through air holes 44 in the base of hose gripper 27 . the weight of roller 14 all the while holds the unwinding portion of hose 29 under water causing the hose to be submerged and filled with water as it is drawn off of reel 12 . when the total length of the hose 29 has been drawn off reel 12 , its end is pulled free from gripper 27 and is manually submerged beneath the surface of the water to complete the filling of the hose and the evacuation of the last quantity of air . the end of the hose is then thrust into the vacuum hose connection inside the pool skimmer in readiness for the initiation of the vacuuming operation . after the completion of the vacuuming operation , the end of hose 29 is withdrawn from its connection at the skimmer and is again attached to the hose gripper 27 in reel 12 . the other end of the hose is then disconnected from the vacuum head and the hose is rewound onto reel 12 by rotating the reel in the direction opposite to that in which it had rotated as the hose was unwound into the pool . in this manner hose 29 is restored to its original position on reel 12 . the arm 13 is then pivoted upward to the position shown in fig1 . finally the operator grips the slotted cross - member 19 , tilts the apparatus 10 in the direction 33 until it is supported by wheels 15 . he then moves the apparatus 10 with the aid of wheels 15 to a convenient storage location . while the apparatus 10 is being moved from one location to another there is a tendency for the reel 12 to rotate about its axis with the result that the hose 29 may unwind from reel 12 . to prevent this from happening , a brake member 45 may be attached to member 35a of arm 13 as shown in fig1 and 3 . member 45 may be a flexible plastic or rubber flap having one edge rigidly attached to member 35a , its free edge extending therefrom in the direction of reel 12 when arm 13 is in the stored position of fig1 . in this position of arm 13 the free edge of member 45 is brought to bear against reel 12 or against hose 29 when hose 29 is stored on reel 12 . the pressure of member 45 against reel 12 or against hose 29 prevents the rotation of reel 12 and the unwinding of hose 29 . when arm 13 is lowered to the dispensing position of fig3 member 45 is rotated away from hose 29 and the braking action is released . while the apparatus 10 is complete and totally functional relative to its intended use as shown in fig1 - 3 , other means of construction will be found which may prove to afford various advantages related to convenience of use , reduced weight or cost . one such variation as shown in fig4 comprises a modified vacuum hose storage and dispensing apparatus 50 , again comprising a frame 51 , a reel 52 , a swinging arm 53 and a roller 54 . in this case the apparatus 50 has no wheels and is intended to be carried from one location to another or permanently located at the edge of the pool . the reel 12 has a cylindrical core 55 instead of the transverse tubular members 23 employed in the construction of reel 12 . furthermore , the axle 56 is attached at only one end in cantilever fashion to frame 51 . the opposite end of the reel 52 is thus clear of the frame and is free to be rotated by means of a handle 57 during the rewinding of hose 29 . instead of the guide bars 38 and 39 as the means for maintaining the position of the hose 29 relative to the roller 54 , circular end plates 58 are provided at the ends of the roller 54 , the diameters of the plates 58 being at least two hose diameters greater than the diameter of the roller 54 . the swinging arm 53 has only one long extending member 59 pivotally attached at one end to the lower forward part of the frame 51 , preferably by means of a perpendicularly extending rod 60 which passes through oppositely aligned holes in the vertical sides of the frame 51 . the frame 51 is of a lightweight construction to facilitate carrying of the apparatus 50 . it comprises a channel - shaped base 61 and a vertical support arm 62 which extends upward from the center of one side of the base 61 . the axle 56 of reel 52 is attached just below the center of support arm 62 and a carrying handle 63 is attached at the top of arm 62 . with the exception that apparatus 50 is intended to be carried from place to place rather than being moved about on wheels , it functions in a manner identical to that described for apparatus 10 . fig5 and 6 illustrate an alternative to the use of a roller 14 or 54 as the means for causing the hose 29 to be submerged as it is drawn off of reel 12 or 52 into the water . a curved concave or arcuate guide plate 64 is shown attached to the end of the swinging arm 13 &# 39 ;. the curvature of plate 64 and its angle of attachment to the horizontal end member 35 &# 39 ; of the arm 13 &# 39 ; conforms to the curvature of the hose 29 as it is drawn into the pool . perpendicularly extending flanges 65 at both sides of the plate 64 keep hose 29 centered under plate 64 . fig7 and 8 illustrate a hose storage and dispensing apparatus 70 which is identical to the apparatus 10 of fig1 - 3 except that it utilizes a sliding arm 71 instead of the swinging arm 13 of fig1 and 2 to support the submerging roller 14 . the sliding arm 71 has the form of a long flat strip . it is slideably attached to one side of frame 11 by means of two capped pins 72 and 73 , the bodies of which pass through a centered longitudinal slot 74 in arm 71 . pins 72 and 73 are aligned at an inclination relative to the horizontal so that arm 71 is appropriately directed outward and downward toward the water 40 when the apparatus 70 is positioned at the edge of the pool as shown in fig7 . at the outer end of arm 71 the roller 14 is attached to arm 71 by means of a perpendicularly extending axle 75 . the axle 75 is preferably rigidly mounted at one end to arm 71 . the roller 14 rotates on axle 75 . at the end of axle 75 opposite its attachment to arm 71 a retaining plate 76 is provided . plate 76 holds roller 14 on axle 75 and it also prevents the hose 29 from slipping off roller 14 during the dispensing operation . at the upper end of arm 71 a grip 77 is provided which is useful for the withdrawal of arm 71 from its extended position . in the implementation shown , grip 77 is simply a tab formed by a perpendicular bend at the end of arm 71 . by taking hold of grip 77 , the operator may readily move the arm 71 between the dispensing position shown in solid lines and the withdrawn or storage position shown by the broken line image 78 in fig7 . fig9 - 11 illustrate a storage and dispensing apparatus 80 which is another variation of the apparatus 10 of fig1 - 3 and which is even more closely similar to the apparatus 70 of fig7 and 8 . the apparatus 80 differs from the apparatus 70 only in the construction of the arm which carries the submerging roller 14 . apparatus 80 utilizes a telescoping arm 81 having a substantially square cross - section as might be fabricated from bar stock or from a tubular material of square or rectangular form . arm 81 passes through a long collar 82 having an internal longitudinal opening which mates with the outer contour of arm 71 ( as shown in fig1 ) with sufficient clearance to permit a longitudinal sliding action between the mating parts while preventing relative rotational motion . collar 82 is attached to one side of frame 11 , again at an inclined angle directed toward the water 40 . the roller 14 is mounted to the lower end of arm 81 in a manner identical to the mounting described for arm 71 of fig7 and 8 . a grip 77 is again provided for moving the arm 81 between the storage and dispensing positions . the storage and dispensing apparatus 90 of fig1 and 13 represents a somewhat more radical departure from the construction of the apparatus 10 . the apparatus 90 utilizes a fixed arm 91 which is rigidly attached to the frame 92 . the frame 92 again carries the reel 12 rotatably mounted from a shaft 25 . in the position of the apparatus 90 at the edge of the pool deck 93 as shown in fig1 , the arm 91 extends horizontally past the edge of the pool and then bends downward toward the water . at the lower termination of arm 91 the submerging roller 14 is rotatably mounted as in the case of the embodiments of the invention already described . the roller 14 again causes the hose 29 to be deflected beneath the surface of the water 40 as it is drawn off the reel 12 during the dispensing operation . when the hose 29 has been restored to its postion on reel 12 the apparatus 90 is simply withdrawn from the pool as shown in fig1 . the roller 14 then serves as a wheel in cooperation with additional wheels 95 mounted at the rear of frame 92 , the wheels thus provide facilitating the moving of the apparatus 90 from one position to another . a handle 96 attached to the frame 92 may also be provided as an aid in moving the apparatus 90 . a practical and effective apparatus is thus provided for use in the storage and dispensing of a swimming pool vacuum hose . the apparatus as herein described meets the stated objects of the invention , and although but a few embodiments of the invention have been illustrated and described , it will be apparent to those skilled in the art that various changes and modifications may be made therein without departing from the spirit of the invention or from the scope of the appended claims .

US-95789978-A

a carburetor with a manual priming pump having an integrated fuel drain which provides both the engine manufacturer and end user with an easy way to drain fuel from a fuel chamber of the carburetor . the priming pump has a pump chamber defined by a resilient priming bulb . the pump chamber generally communicates between the fuel chamber and a fuel - and - air mixing passage of the carburetor body and is preferably positioned above the fuel chamber . the dual function of the manual priming pump , prime or drain , is switched by a valve with a rotatable selector member received between a seat and the resilient priming bulb of the pump . the selector member moves between a drain position and a priming position thus enabling draining of the fuel chamber or priming of the carburetor via successive manual depressions of the priming bulb .

referring in more detail to the drawings , fig1 and 3 illustrate a carburetor 10 for a combustion engine ( not shown ) embodying this invention . in operation , air enters an inlet 22 of a fuel - and - air mixing passage 14 defined by a carburetor body 16 of the carburetor 10 . fuel enters the fuel - and - air mixing passage 14 via a main fuel feed passage 18 having a nozzle disposed in the region of a venturi 20 within the passage 14 . the fuel mixes with the air and exits the carburetor 10 at an outlet 12 of the fuel - and - air mixing passage 14 where the mixture then flows into an engine combustion chamber ( not shown ). fuel enters the main fuel feed passage 18 from a fuel chamber 26 of the carburetor 10 defined by a fuel bowl 24 engaged sealably to the underside of the carburetor body 16 , and preferably with a sealing gasket there - between . during normal running conditions of the combustion engine , the fuel - and - air mixing passage is at sub - atmospheric pressure and the fuel chamber 26 is near atmospheric pressure . fuel is thus forced to flow up through the nozzle of the main fuel feed passage 18 and into the fuel - and - air mixing passage 14 . when the engine is not running , for example , before attempting to start the engine , a vacuum does not exist within the fuel - and - air mixing passage 14 and an alternative means must be provided to supply fuel to the combustion chamber . a manual priming pump 28 is one such alternative means and is engaged to the carburetor body 16 via a plurality of threaded fasteners 30 . the priming pump 28 has a resilient priming bulb 32 which defines a pump chamber 34 . in preparation for starting of the engine , manual operation of the priming pump 28 is achieved by depressing the priming bulb 32 with a force greater than its own resilience . release of the bulb 32 will cause it to return , or unflex , to its natural state , causing fuel and / or air to flow through a series of passages and check valves . this flow assures that necessary fuel enters the fuel - and - air mixing passage 14 for starting of the engine . to induce flow , a sub - atmospheric pressure or suction is applied to these passages via the bulb 32 which is leak tight relative to the carburetor body 16 , as best shown in fig3 . to accomplish this seal , a circumferential lip 36 of the bulb 32 substantially projects laterally outward along the bulb &# 39 ; s perimeter or distal edge , and is sealably press fitted into a circumferential groove 37 of an encasement 38 which engages the carburetor body 16 . the groove 37 is defined by the encasement 38 and communicates radially inward toward the pump chamber 34 . the encasement 38 is secured to the carburetor body 16 by the threaded fasteners or bolts 30 . referring to fig2 integrated into the priming pump 28 is the ability to drain the fuel bowl 24 of fuel without the utilization of a local gravity drain valve or the use of external siphoning equipment . sandwiched between the encasement 38 and the carburetor body 16 is a planar member or selector disc 40 . disc 40 has a tab 42 which projects through a slot 44 defined by the encasement 38 . the disc 40 is moved rotatably , or positioned , via manually grasping the protruding tab 42 . a series of orifices communicating axially through the disc 40 align or mis - align with various passages depending on the position of the disc 40 . one such passage and orifice alignment will function to prime the carburetor 10 for engine starting when bulb 32 is repeatably depressed and is identified as the prime position 48 , as best shown in fig6 . and , another passage and orifice alignment will function to drain the fuel chamber 26 by depressing the same bulb 32 and is identified as the drain position 46 , as best shown in fig7 . referring to fig1 when tab 42 is in the lower position , or nearest the fuel bowl 24 , the disc 40 is in the drain position 46 , and when the tab 42 is positioned upward , it is in the prime position 48 . the encasement 38 has a substantially planar midsection 50 disposed parallel to an exterior mating surface or seat 52 of the priming pump 28 and defined by the carburetor body 16 . the planar member or disc 40 is substantially of a consistent thickness and is disposed between the seat 52 of the priming pump 28 and the planar midsection 50 of the encasement 38 . projecting axially inward from the midsection 50 of the encasement 38 is a cylindrical or circumferential wall 54 which has a distal edge 56 that engages the perimeter of the seat 52 defined by the carburetor body 16 . projecting axially outwardly is a second cylindrical or circumferential wall 58 wherein the groove 37 which receives the lip 36 of the priming bulb 32 is formed . the pump chamber 34 is ultimately defined by the priming bulb 32 , the second circumferential wall 58 and an outward surface of the planar midsection 50 . to stabilize or enhance rotation of the disc 40 , a pin or shaft 62 concentrically extends through and unitarily engages the disc 40 . the shaft 62 rotatably fits within a bore 64 defined by the seat 52 or the carburetor body 16 at one end , and a bore 66 defined by the encasement 38 on the outward side of the disc 40 at the other end . the disc 40 has an inward side 68 and an opposite outward side 70 . the inward side 68 slideably and sealably engages against an inward gasket 72 disposed between the seat 52 and the disc 40 . likewise , an outward gasket 74 reduces friction and seals between the outward side 70 of the disc 40 and the encasement 38 . the inward and outward gaskets 72 , 74 are disposed radially inward from the circumferential wall 54 of the encasement 38 . the inward and outward gaskets 72 , 74 are substantially identical to one - another , both being annular in shape and having a pattern of holes 75 which align with various passages communicating through the seat 52 defined by the carburetor 16 . likewise , the planar midsection 50 of the encasement 38 will have the same pattern of holes 75 . as the disc 40 rotates relative to the adjacent gaskets 72 , 74 , a series of orifices 77 , axially penetrating the disc 40 , will align or misalign with the designated holes 75 thereby allowing the associated passages to communicate with the pump chamber 34 or be obstructed from doing so . referring to fig2 and 7 , when disc 40 is rotated to the drain position 46 , a drain fuel - in orifice 76 , extending axially through the disc 40 , aligns with a fuel draw passage 78 defined by the carburetor body 16 . the fuel draw passage 78 extends from a lower portion 80 of the fuel chamber 26 to and through the seat 52 . similarly , a drain fuel - out orifice 82 through the disc 40 communicates with a drain passage 84 defined by the carburetor body 16 which extends between a tube or nozzle 86 disposed externally to the carburetor body 16 and through the seat 52 . when operating the priming pump 28 in drain position 46 , the resilient priming bulb 32 is manually depressed or flexed , causing fuel to flow through a check valve 87 disposed in the drain passage 84 and located near or flush with the seat 52 of the carburetor body 16 . the fuel then flows out of the carburetor 10 through the external tube 86 . when the priming bulb 32 is released , the resilience of the bulb 32 causes it to return outwardly , or unflex , to a natural or preformed state , thereby producing a vacuum within the pump chamber 34 causing fuel to flow through the fuel draw passage 78 and through a check valve 88 disposed therein . this manual process must be repeated until the fuel bowl 24 is completely drained of fuel unless the tube 86 extends below the lower portion 80 of the fuel chamber 26 . if tube 86 does so extend below the bottom 80 , a desirable siphoning action will be created by the initial depression ( s ) of bulb 32 causing the fuel to drain continuously until depleted . referring to fig6 when the priming pump 28 is in the priming position 48 , the drain fuel - in orifice 76 and the drain fuel - out orifice 82 in the disc 40 are misaligned to the respective fuel draw passage 78 and drain passage 84 . consequently , the drain passage 84 is cut - off , obstructed , or isolated from the pump chamber 34 by the disk 40 . however , the fuel draw passage 78 is not obstructed when the priming pump 28 is in the priming position 18 because a second or prime fuel - in orifice 90 , communicating axially through the disc 40 , becomes aligned with the fuel draw passage 78 . likewise , a fuel prime orifice 92 in the disc 40 is aligned with a fuel prime passage 94 defined by the carburetor body 16 . referring to fig4 the fuel prime passage 94 is in communication with the fuel - and - air mixing passage 14 via a port 97 disposed substantially near the venturi 20 and between the inlet 12 and venturi 20 . so that fuel may only flow from the pump chamber 34 to the fuel - and - air mixing passage 14 , a spring loaded check valve 96 is disposed within the fuel prime passage 94 substantially flush to the seat 52 . depressing the bulb 32 will cause fuel located within the pump chamber 34 to flow out past the check valve 96 through the fuel prime passage 94 and into the fuel - and - air mixing passage 14 , thereby priming the carburetor 10 . release of the bulb 32 will cause the bulb to expand , or unflex , and return to its preformed shape creating a vacuum which causes fuel to flow from the fuel chamber 26 , through the fuel draw passage 78 , and into the pump chamber 34 . referring to fig8 - 11 , a second embodiment of the carburetor 10 ′ of the present invention is shown . in this embodiment , the disc 40 ′ has a drain position 46 ′ oriented similarly to the first embodiment , however , a priming position 48 ′ has an orientation different than the first embodiment . in the second embodiment , when the disc 40 ′ is in the priming position 48 ′, fuel no longer flows through the fuel passage 94 of the first embodiment , instead , the fuel flows through a main feed passage 18 ′, as best shown in fig5 by pressurizing an upper air dome portion 100 of the fuel chamber 26 ′. under normal running conditions , the fuel chamber 26 ′ is under near atmospheric pressure conditions via a vent passage 102 which extends from the upper air dome portion 100 of the fuel chamber 26 ′ to a biased normally closed vent check valve 104 disposed near the inlet 22 ′ of the fuel - and - air mixing passage 14 ′. during running conditions of the engine , fuel flows out of the fuel chamber 26 ′ via the main feed passage 18 ′. also , when the engine is running , the vibration or shaking forces produced by the operating engine cause a ball 109 of the vent check valve 104 to dance or move in a counterbore 114 and away from a ball seat 110 against a biasing force of coil spring 112 so that the passage 102 communicates with the atmosphere through the orifice 117 . the ball seat 110 is slideably received in the open end of a tubular body 113 with a closed end 116 having a port 115 communicating with the vent passage 102 . preferably the body 113 is press fit in a counterbore 114 in the carburetor body at the end of the vent passage 102 . the bore 114 of the tubular body has a larger inside diameter than the outside diameter of the ball to permit fluid to pass between them . the ball seat 110 is press fit in the body 13 and has a vent orifice 117 . when the vent check valve ball 109 moves away from the seat 110 within the bore 114 , the spring 112 compresses axially against the end 116 . when the engine is not running , the ball 109 of the vent check valve 104 is forced back against the ball seat 110 by the spring 112 , thereby closing or blocking off the vent orifice 117 . an air prime passage 106 communicates between the vent passage 102 and the pump chamber 34 ′, and through the seat 52 ′. when the disc 40 ′ is in the priming position 48 ′, as best shown in fig9 an air prime orifice 108 of the disc 40 ′ aligns with the air prime passage 106 , and amounts to the only communication from the pump chamber 34 ′ through the disc 40 ′ when in the priming position 48 ′. in operation , depressing the bulb 32 ′ will cause air to flow through the air prime passage 106 and into the vent passage 102 with all of the air flowing into the upper air dome portion 100 of the fuel chamber 26 ′ because the vent check valve 104 is closed . this creates a sufficient pressure surge , within the fuel chamber 26 ′ so that fuel flows upward through the fuel feed passage 18 ′ and into the fuel - and - air mixing passage 14 ′, as best shown in fig5 . if the cross section of the vent orifice 117 is substantially smaller than the flow cross section of the vent passage 102 and smaller than the flow cross section of the air prime passage 106 , the ball 109 and the spring 112 of the vent check valve 104 are not absolutely necessary for the priming pump 28 ′ to work . this is so because only a small amount of air will escape through the vent orifice 117 while the majority enters and pressurizes the air dome portion 100 of the fuel chamber 26 ′. fig1 illustrates an alternative check valve 104 ′ which may be used in lieu of check valve 104 . the ball 109 of the check valve 104 ′ is freely movable between the seat 110 and the end wall 116 ′ of its body 113 ′ and the end wall has a plurality of radially and circumferentially spaced - apart ports 115 ′ which communicate with the vent passage 102 when the body 113 ′ is press fit therein . the clearance between the bore 114 ′ and the ball 109 and the mass of the ball is sized and calibrated so that regardless of the orientation of the check valve 104 ′, the pressure pulses produced in the passage 102 by pressing the pump bulb 32 force the ball 109 onto its seat 110 to close the vent passage 117 and the sub - atmospheric pressure produced by release of the bulb 32 produces an in - rush of air through the orifice 117 which unseats the ball 109 so that incoming air flows around the ball and into the passage 102 . when the engine starts , the vibration or shaking forces produced by the operating engine cause the ball 109 to dance or move in the bore 114 ′ away from the seat 110 so that the passage 102 communicates with the atmosphere through the orifice 117 . the construction of check valve 104 ′ eliminates the need for any compression spring 112 and ensures that the ball 109 will be unseated so that the vent passage 102 communicates with the atmosphere while the engine is operating . the clearance between the ball 109 and the bore 114 , and the mass or weight of the ball can be readily designed so that even if the valve assembly 104 ′ is oriented with its axis extending vertically and the seat 110 is at the upper end , the ball 109 will be moved upward and bear on its seat 110 due to the force of air acting on and moving past the ball produced by depressing the pump bulb 32 . conversely , even if the valve assembly 104 ′ is oriented with its axis extending vertically and the seat 110 at the lower end with the ball resting thereon , the ball will be moved upward away from the seat to open the valve by the force of incoming air through the vent 117 produced by release of the pump bulb 32 . in all orientations , when the engine is running , the vibration or shaking forces of the engine will keep the ball 109 unseated so that it will not inhibit communication of the passage 102 with the external atmosphere and the normal function of the bowl drain . preferably , the valve assembly 104 ′ is oriented so that in the normal resting orientation of the carburetor , when the engine is not operating , the ball 109 will bear on the seat 110 to further reduce diurnal vapor emission . as best shown in fig1 , a modification of the present invention has the priming pump 28 ″ mounted , remote from the carburetor body 16 ″, and onto an air cleaner housing 120 . depending upon the engine application , this orientation may be preferred if the carburetor body 16 ″ is not readily accessible to the end user . a series of tubes 122 are supported between the air cleaner housing 120 and a flange 124 which fasten to the carburetor body 16 ″. the seat 52 ″ ( not shown ) is not defined by the carburetor body 16 ″ as it is for the first and second embodiments . instead , the seat 52 ″ is defined by the air cleaner housing 120 or an additional section of the encasement 38 ″. while the forms of the invention herein disclosed constitute presently preferred embodiments , many others are possible . for instance , the carburetor body 16 may include all the features of the first and second embodiments . that is , a carburetor body can include the air prime passage 106 specific to the second embodiment and the fuel prime passage 94 specific to the first embodiment . the priming pump 28 ′ can be provided as a kit assembly wherein the disc 40 of the first embodiment and the disc 40 ′ of the second embodiment along with the associated gaskets are both provided within the kit . the choice of an air priming pump 28 ′ or a fuel priming pump 28 is then left to the end carburetor assembler who is supplied with the generic carburetor body and the kit . alternatively , the end carburetor assembler may be supplied with the generic carburetor body , and either the disc 40 or 40 ′ depending on the desired end use of the carburetor . it is not intended herein to mention all the possible equivalent forms or ramification of the invention . it is understood that terms used herein are merely descriptive , rather than limiting , and that various changes may be made without departing from the spirit or scope of the invention .

US-97022801-A

a novel collapsible aeration system is retrofitted into a grain bin with a discharge opening in the bottom . this grain bin may have a sloped or conical hopper or a flat bottom . the aeration system is formed from a set of connected duct sections that define a round or multi - sided duct having a minimum of three sides or faces . the sides may be flat , curved or corrugated . the collapsible aeration system is folded , inserted into the bin via a hole , and then unfolded inside the bin . an air duct is connected to the aeration system to enable the aeration system to dry the grain in the grain bin . this technology enables existing grain bins to be retrofitted with a dryer in an easy and efficient manner .

the present invention is directed to a novel collapsible aeration system or grain dryer for retrofitting an existing grain bin that lacks an aeration system ( dryer ). this collapsible or foldable aeration system ( dryer ) may be folded for inserting through an opening in the bin . once inside the hopper , the aeration system can be easily unfolded for use in drying the grain inside the grain bin . embodiments of this invention will now be described with reference to the appended figures . fig1 is a front cross - sectional view of a collapsible aeration system , which is generally designated by reference numeral 10 , in accordance with one embodiment of the present invention . this collapsible aeration system 10 is installed within a hopper 20 of a grain bin . the hopper is supported by a plurality of struts or legs 22 . a fan 30 is connected to the aeration system 10 by an air duct 32 . fig2 is a perspective view of the collapsible aeration system 10 introduced in fig1 . in this particular embodiment , the outer surfaces of the duct sections 12 are corrugated . as will be appreciated , other duct shapes such as curved or rounded may be employed . the duct sections 12 are capped by an air manifold 14 for circulating the air through the duct sections . a plurality of legs 40 support the collapsible aeration system above the discharge chute 24 ( through which the grain exits from the hopper 20 ). the legs 40 may include , as shown by way of example in this figure , pivotally connected feet for resting on the sloped inner surface of the hopper 20 . fig3 is a perspective view of the collapsible aeration system 10 having flat ( non - corrugated ) outer surfaces or panels in accordance with another embodiment of the present invention . the duct sections 12 ( also referred to herein as ducts or channels ) have multiple surfaces ( sides ) that together define an internal airspace . these may be , for example , trapezoidal duct sections with the outer and inner faces being parallel . in such an embodiment , the outer surface is wider than the inner surface . the two side surfaces slope at the same angle in the exemplary embodiments shown in this application . as will be explained in greater detail below , the ducts are pivotally connected or hinged alternately at the inner and outer edges so that the entire structure can be folded ( collapsed ) into a very compact configuration that can be inserted through a manhole or other access hole in the hopper . folding the structure enables it to be inserted through a small hole through which it would otherwise not fit . fig4 is a perspective view of the partially folded collapsible aeration system 10 of fig3 . the collapsible aeration system can be folded and unfolded easily and quickly because it is not use any threaded fasteners to hold it together . fig5 is a perspective view of the fully folded collapsible aeration system 10 of fig3 . the fully folded aeration system 10 is compact enough to be fitted through a manhole or other access hole in the hopper . fig6 is a partial cutaway view depicting how the folded collapsible aeration system 10 is easily inserted through a manhole 21 or other access hole in the hopper 20 for subsequent unfolding and installation inside the hopper . inserting the collapsible aeration system 10 the manhole is much easier , quicker and safer than attempting to lower an aeration system from the top of the grain bin , as has been done conventionally . grain bins typically have a wall height of over 10 feet ( 3 m ) which requires a hoist or winch system to raise and lower the retrofit aeration system into the grain bin . fig7 is a partial cutaway perspective view of the collapsible aeration system 10 installed inside the hopper 20 after it has been inserted through the manhole 21 . above the hopper is a grain bin 25 . the arrangement of the hopper and grain bin is well known in the art and thus will not be described . fig7 shows by way of example how the feet 42 of the supporting legs 40 pivot to rest on the sloped inner surface of the hopper 20 . fig8 is a top plan view of a six - sided collapsible aeration system 10 in accordance with one embodiment of the present invention . the aeration system 10 has six ducts ( or duct sections ) 12 . the outer surfaces of the duct sections may be corrugated 12 a or flat 12 b . in the embodiment where the duct sections are corrugated , the duct sections form trapezoidal ducts or channels . in this particular embodiment , there are three legs and three feet 42 for supporting the aeration system in the hopper . one of the duct sections has , or is adapted to receive , an air duct 32 , as shown by way of example in this figure . fig9 a is a top plan view of the six - sided collapsible aeration system , depicting exemplary angles , dimensions and hinge axes . in this particular exemplary embodiment , the outer surfaces of adjacent duct sections form 60 - degree angles as shown in the figure . in this particular example , the outer surfaces are 1 ′- 6 ″ ( 45 . 7 cm ) wide and the inner surfaces are 1 ′- 3 ″ ( 38 . 1 cm ) wide . these dimensions are solely presented by way of example and it will be understood the dimensions may be varied without departing from the inventive concept . with these example dimensions , the outer diameter ( major diameter ) is 3 ′ ( 91 . 4 cm ). this would be too large to fit into an ordinary manhole on most conventional hoppers . however , the novel collapsible aeration system may be folded into a folded configuration such as the one depicted by way of example in fig9 b which is a side view of the fully folded six - section collapsible aeration system of fig9 a . when folded , the diameter of the particular embodiment of the aeration system shown in fig9 b is only 1 ′- 6 ″ ( 45 . 7 cm ), which then fits through a conventional 19 ″ ( 48 . 3 cm ) manhole found on most grain bins . it bears emphasizing that these dimensions are only presented for the purposes of illustration . as will be appreciated , these dimensions may be varied without departing from the inventive concept . fig9 a and fig9 b also depict the hinge points or pivot axes of the aerations system &# 39 ; s articulated structure . in this example , there are six duct sections 12 and five hinges 13 ( i . e . articulating edges or pivotal connections linking the adjoining sections 12 ). as will be observed , the hinges ( articulating edges ) alternate between an outer edge and an inner edge . in other words , as depicted in fig9 a and fig9 b , an edge 13 a - b of the outer surface of a first duct ( a ) is pivotally connected to the common edge 13 a - b of the outer surface of a second duct ( b ). an edge 13 b - c of the inner surface of the second duct ( b ) is pivotally connected to the common edge 13 b - c of the inner surface of a third duct ( c ). an edge 13 c - d of the outer surface of the third duct ( c ) is pivotally connected to the common edge 13 c - d of the outer surface of a fourth duct ( d ). an edge 13 d - e of the inner surface of the fourth duct ( d ) is pivotally connected to the common edge 13 d - e of the inner surface of a fifth duct ( e ). an edge 13 e - f of the outer surface of the fifth duct ( e ) is pivotally connected to the common edge 13 e - f of the outer surface of a sixth duct ( f ). fig9 b shows how the edges alternate between inner and outer edges when the aeration system is folded ( collapsed ) into a stacked configuration . in this example , edges 13 a - b , 13 c - d and 13 e - f are inner edges ( because the common edge is along two inner surfaces ) whereas edges 13 b - c and 13 d - e are outer edges ( because the common edge is along two outer surfaces ). fig1 a , fig1 b and fig1 c depict the unfolding of the articulated structure of the collapsible aeration system 10 . the unfolding process commences at fig1 a which shows the stacked ( fully folded ) six - duct collapsible aeration system 10 . fig1 b depicts how the collapsible aeration system is unfolded , i . e . how each duct section pivots relative to its adjoining neighbour . the duct sections pivot about each of the edges 13 ( which act as hinges or pivots ). once completely unfolded , the collapsible aeration system takes on a hexagonal structure as shown in fig1 c in a top plan view . the articulated structure may be folded by reversing this steps , i . e . by pivoting the duct sections 12 about the edges 13 such that the sections are stacked as shown in fig1 a . fig1 a is a top plan view of a five - section collapsible aeration system 10 in accordance with another embodiment of the present invention . as shown by way of example in fig1 a , the unfolded ( operative ) configuration of the collapsible aeration system 10 is a pentagon ( i . e . an articulated structure with five sides ). this five - sided aeration system operates analogously to the six - sided version . in other words , it also folds into a stacked configuration shown for example in fig1 b . some dimensions are presented solely by way of example . for example , in the particular embodiment shown in fig1 a , the outer surfaces are 1 ′- 6 ″ ( 45 . 7 cm ) wide . when folded ( stacked ), as shown by way of example in fig1 b , the width of the stacked structure is only 1 ′- 6 ″ ( 45 . 7 cm ) which thus fits through most conventional manholes in typical grain bins . for this five - sided aeration system ( five - ducted dryer ), there are four pivots ( edges 13 ). as was the case with the six - sided version , the edges 13 alternate between outer and inner edges . this is apparent from the location of the edges 13 in fig1 b . fig1 is a top plan view of a four - sided collapsible aeration system 10 in accordance with yet another embodiment of the present invention . in this particular embodiment , there are four ducts 12 that form a square as shown by way of example in fig1 . the angled surfaces are at 45 - degrees . again , the articulated structure may be folded into a compact stacked configuration for insertion through a manhole of a grain bin . another aspect of the invention is a novel method for retrofitting a hopper of a grain bin with an aeration system . this method entails folding a collapsible aeration system into a compact configuration , e . g . a stacked configuration . the compact configuration is small enough to fit through a manhole or other access hole in the hopper or grain bin . once the aeration system has been folded , it is inserted in a folded condition into the hopper via a hole in the hopper . once the aeration system is inside the hopper , the aeration system is unfolded inside the hopper . in main embodiments , the articulated duct sections of the aeration system are unfolded until angled surfaces of one duct abut the angled surfaces of an adjoining duct . the method may then include a step of connecting an air duct to the collapsible aeration system . from the foregoing , it will be appreciated that a multi - sided structure having flat duct surfaces can be folded in a space - efficient manner for insertion through an opening in a grain bin or equivalent storage structure . depending on the number of duct sections , when unfolded , these structures may be square , hexagonal , octagonal , etc . in cross - section . the aeration system may also be constructed of multiple curved ( rounded ) duct sections . while the aeration system is primarily intended to be folded or collapsed for insertion through a small hole , it should be appreciated that in other embodiments , the aeration system may be inserted as two or more folded subassemblies . for unusually small holes , it may be necessary to insert the duct sections individually and to assemble the system from its constituent duct sections inside the bin or hopper . assembly of the duct sections may be accomplished using pin connectors , hinges , fasteners , e . g . screws or bolts , or other suitable mechanical connectors . while the duct sections may be permanent connected to one another by riveting , welding , soldering , glue , adhesive , bonding agents , etc ., the use of non - permanent fasteners is preferred since this permits the system to be disassembled and removed for servicing , maintenance , overhaul or replacement . while the above description and accompanying figures disclose how the embodiments of the invention may be used in a hopper or other conically shaped structure , it should be appreciated that the embodiments of the invention may also be used in a flat - bottomed bin or silo . in other words , it should be understood that this invention may be used in any other structure that has a small opening and that requires retrofitting . although this invention is primarily intended for retrofitting a grain bin , it should be understood that the same collapsible aeration system can be installed when the grain bin is first manufactured , i . e . a new grain bin can be built with this novel collapsible dryer . after a period of usage , if the collapsible aeration system requires maintenance , repair or replacement , it can easily be folded ( collapsed ) and removed from the bin ( by extricating the folded aeration system through an opening in the bin ). after maintenance or repair , the aeration system is re - inserted into the grain bin . similarly , if a new system is required because the existing one is broken or defective , the old system is simply folded and removed and the new system , in its collapsed state , is inserted into the bin , unfolded and installed . the embodiments of the invention described above are intended to be exemplary only . as will be appreciated by those of ordinary skill in the art , to whom this specification is addressed , many obvious variations , modifications , and refinements can be made to the embodiments presented herein without departing from the spirit and scope of the invention . the scope of the exclusive right sought by the applicant ( s ) is therefore intended to be limited solely by the appended claims .

US-93894010-A

a method is provided for treating a hypersensitivity disease comprising parenterally administering to a human afflicted with such a disease an amount of an anionic polymer effective to counteract the symptoms of a disease selected from the group consisting of bronchial asthma , eosinophil - associated nasal inflammation and vernal conjunctivitis , by counteracting the effect of at least one cationic toxin released by the eosinophils of said human .

a wide variety of nontoxic anionic polymers , including the preferred polyamino acid salts are effective when administered in accord with the present method . of these salts , the alkali metal salts ( e . g ., na + , k + , li + ), ammonium or amine salts of homo - or hetero - anionic ( random copolymers ) polyamino acids such as polyglutamic acid , polyaspartic acid , poly ( aspartic acid , glutamic acid ) and the like are preferred , and may include optically active or racemic peptidyl subunits . for example , the sodium salt of poly -( α , β )- dl - aspartic acid ( m . w . 2 , 000 - 10 , 000 ) is available from sigma chem . co ., as is the sodium salt of poly - l - aspartic acid ( m . w . 5 , 000 - 15 , 000 and 15 , 000 - 50 , 000 ). the sodium salt of poly - d - glutamic acid is available in a number of m . w . ranges ( 2 , 000 - 15 , 000 , 15 kd - 50 kd , 50 kd - 100 kd ) as is the sodium salt of poly - l - glutamic acid ( 2 - 15 kd , 15 - 50 kd , 50 - 100 kd ). other nontoxic anionic polymers and their salts can also be used effectively in the present method , including polycarboxylates , polysulfates and polyphosphates . preferably , the molecular weight of these polymers is greater than 1 , 000 daltons , preferably , it is greater than about 5000 daltons , i . e ., about 10 , 000 - 100 , 000 daltons . preferred polycarboxylic acids include those nontoxic acidic polymers which can adhere to mucus membranes and which can thereby exhibit prolonged bioactivity at the sites of mbp activity . these include solid water - swellable , preferably cross - linked carboxy - functional polymers and the salts thereof . the polymers contain ( a ) a plurality of repeating units of which at least about 80 percent contain at least one carboxyl functionality , and can comprise ( b ) about 0 . 05 to about 1 . 5 percent cross - linking agent , with the percentages being based upon the weights of unpolymerized repeating unit and cross - linking agent , respectively . in more preferred practice , at least about 90 percent of the repeating units contain at least one carboxyl functionality , and in still more preferred practice , at least 95 percent of those repeating units contain at least one carboxyl functionality . most preferably , the polymer is a reaction product of the polymerization of only a carboxyl - functional monomer and , optionally , the cross - linking agent , although co - monomers , such as ethylene and other alkenes , can be used in minor amounts . as noted previously , at least about 80 percent of the repeating units of the bioadhesive contain at least one carboxyl functionality . exemplary monomers that provide these repeating units are monoethylenically unsaturated and include acrylic acid , methacrylic acid , fumaric acid , maleic acid , maleic anhydride which may be hydrolyzed into its acid form during or after polymerization , itaconic acid , crotonic acid , and the like . each of these acids may be used alone or in combination with other such acids or with one or more pharmaceutically acceptable salts of those acids . acrylic acid , maleic anhydride and methacrylic acid are particularly preferred monomers for providing the repeating units of the bioadhesive polymer . the polyanions of this invention are optionally cross - linked by known cross - linking agents . exemplary of useful cross - linking agents are divinylether , divinylbenzene , n , n - diallylacrylamide , 3 , 4 - dihydroxy - 1 , 5 - hexadiene , 2 , 5 - dimethyl - 1 , 5 - hexadiene , polyalkenyl polyethers ( carbopol ® 934 ) and the like . the amount of cross - linking of the polyacid is of some import . when less than about 0 . 05 weight percent of an appropriate cross - linking agent is present , the polycarboxylate tends to become water - soluble , or water - dispersible . when greater than about 1 percent cross - linking agent is present , the water - swellability of the polycarboxylate begins to decrease appreciably . for exemplary materials of both types , see u . s . pat . nos . 4 , 795 , 436 , 3 , 074 , 852 , 3 , 330 , 729 , 3 , 608 , 063 , 4 , 226 , 848 and 3 , 202 , 577 . one commercially available cross - linked polyacrylic acid useful in the present invention is polycarbophil ( a . h . robbins co .). other useful organic polymers containing carboxylic acid or carboxylate groups include pyran copolymer , chlorite oxidized oxyamylose , the copolymer of acrylic acid and allyl sucrose ( carbopol ), carboxy - methylcellulose , starch glycolic acid , and other polymeric derivatives of acrylic acid such as poly ( acrylic acid - isobutyl vinyl ether and the copolymers of acrylic acid and dimethylaminoethylacrylate ). useful polysulfates include poly vinylsulfate !, chondroitin sulfate , dextran sulfate , polyethylene sulfonate and polystyrene sulfonic acid . useful polyphosphates include dextran phosphate and certain polynucleotides , such as polyinosinicpolycytidylic acid , polyxenyl phosphate . for other polyanions that may be useful in the practice of the invention , see anionic polymeric drugs , l . g . donaruma et al ., eds . wiley - interscience ( 1980 ). while it is possible that , for use in therapy , the anionic polymer salts may be administered as the pure chemicals , as by inhalation of a fine powder via an insufflator , it is preferable to present the active ingredient as a pharmaceutical formulation . the invention thus further provides a pharmaceutical formulation comprising one or more anionic polymer salts , or a pharmaceutically acceptable derivative thereof , together with one or more pharmaceutically acceptable carriers therefor and , optionally , other therapeutic and / or prophylactic ingredients . the carrier ( s ) must be ` acceptable ` in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof . pharmaceutical formulations include those suitable for parenteral administration by injection , infusion , inhalation or insufflation or for nasal , or topical ( including buccal and sub - lingual ) administration . the formulations may , where appropriate , be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy . all methods include the step of bringing into association the active compound with liquid carriers , such as isotonic saline or pbs , or finely divided solid carriers or both . it is well - known that mbp is found within the submucosa of the bronchi during asthmatic attacks , and here the mbp presumably triggers bronchial constriction and the sensitivity of the bronchi to inhaled methacholine . it is also known that pharmaceutical compositions administered intravenously can reach the submucosa and reverse bronchospasm , for example , intravenous isoproterenol is utilized to treat bronchial asthma . fryer et al . have shown in the guinea pig that parenterally administered polyglutamate diffuses to the muscarinic receptors in the epithelium ( a . d . fryer et al ., j . clin . invest ., 90 , 2292 ( 1992 )). mbp has been shown to be an endogenous allosteric inhibitor of the m2 receptor ( d . b . jacoby et al ., j . clin . invest ., 91 , 1314 ( 1993 )). pharmaceutical formulations intended for parenteral administration by intravenous injection or infusion or by enteral injection or infusion are particularly useful in cases of severe status asthmaticus , in which the patient may be comatose or unable to inhale deeply enough to draw the polyanion into the lung by inhalation . in other cases , the patient may be too young or mentally impaired so that the patient cannot follow verbal instructions on inhalation . additionally , areas of the lung may be blocked mucus plugs or inaccessible to a drug administered via inhalation . for administration to the respiratory tract by inhalation , the compounds according to the invention are conveniently delivered from an insufflator , nebulizer or a pressurized pack or other convenient means of delivering an aerosol spray . pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane , trichlorofluoromethane , dichlorotetrafluoroethane , carbon dioxide or other suitable gas . in the case of a pressurized aerosol , the dosage unit may be determined by providing a valve to deliver a metered amount . alternatively , for administration by inhalation or insufflation , the compounds according to the invention may take the form of a dry powder composition , for example , a powder mix of the compound and a suitable powder base such as lactose or starch . the powder composition may be presented in unit dosage form in , for example , capsules or cartridges or , e . g ., gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflator . for intra - nasal administration , the compounds of the invention may be administered via a liquid spray , such as via a plastic bottle atomizer . typical of these are the mistometer ( wintrop ) and the medihaler ( riker ). drops , such as eye drops , may be formulated with an aqueous or non - aqueous base also comprising one or more dispersing agents , solubilizing agents or suspending agents . liquid sprays are conveniently delivered from pressurized packs . for topical administration to the eye or epidermis , the compounds according to the invention may be formulated as ointments , creams or lotions , or as a transdermal patch . ointments and creams may , for example , be formulated with an aqueous or oily base with the addition of suitable thickening and / or gelling agents . lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents , stabilizing agents , dispersing agents , suspending agents , thickening agents , or coloring agents . formulations suitable for topical administration in the mouth include lozenges comprising active ingredient in a flavored base , usually sucrose and acacia or tragacanth ; pastilles comprising the active ingredient in an inert base such as gelatin and glycerin or sucrose and acacia ; and mouthwashes comprising the active ingredient in a suitable liquid carrier . when desired , the above - described formulations adapted to give sustained release of the active ingredient may be employed , e . g ., by combination with certain hydrophilic polymer matrices . such formulations can be used for the delivery of the active ingredient transdermally , as from a patch adhered to the skin , or by iontophoresis . the pharmaceutical compositions according to the invention may also contain other active ingredients such as antimicrobial agents , or preservatives . the compounds of the invention may also be used in combination with other therapeutic agents , for example , other broncodilators or anti - inflammatory agents . it will be further appreciated that the amount of a compound of the invention required for use in treatment will vary not only with the particular compound selected but also with the route of administration , the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or veterinarian . in general , however , a suitable unit dose for counteracting respiratory tract symptomology will deliver from about 0 . 05 to about 5 mg / kg , e . g ., from about 1 to about 2 . 5 mg / kg of body weight per day . the total dose of polyanion administered , however , may be less critical than the concentration achieved in situ in comparison to the known highest concentration of mbp in the affected physiological fluid . for example , the concentration of mbp in sputum can be as high as 7 . 1 × 10 - 6 m . in this case , a solution of polyglutamic acid , 50 mg / ml at 6 . 4 × 10 - 4 m for the 77 . 8 kd polyment , would provide a 90 - fold greater concentration than the highest sputum mbp measured in an asthma patient . the desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals , for example , as two , three , four or more sub - doses per day . the sub - dose itself may be further divided , e . g . into a number of discrete loosely spaced administrations ; such as multiple inhalations from an insufflator , multiple injections , or by application of a plurality of drops into the eye . the invention will be further described by reference to the following detailed example . sodium salts of amino acids , sodium salts of amino acid polymers ( table i ), rpmi - 1640 medium containing l - glutamine and methacholine were purchased from sigma chemical co . ( st . louis , mo .). defined calf serum ( dcs ) was obtained from hyclone laboratories , inc . ( logan , utah ). ketamine ( ketaset ) and xylazine ( rompun ) were purchased from bristol laboratories ( evansville , ind .) and miles inc . ( west haven , conn . ), respectively . table i______________________________________properties of amino acid salts degree of concentration polymeri - charge ( e ) for balanced mol wt zation * at ph 7 . 0 . sup .‡ charge . sup . 190______________________________________l - aspartic acid 155 1 - 1 . 1 ( a ) 7 . 5 × 10 . sup .- 5 m ( a - 0651 ). sup .≠ l - glutamic acid salt 169 1 - 1 . 1 ( a ) 7 . 5 × 10 . sup .- 5 m ( g - 1626 ) poly -( α , β )- dl - 6 , 800 50 - 50 . 1 ( a ) 1 . 6 × 10 . sup .- 6 maspartic acid ( p - 3418 ) poly ( aspartic acid , 9 , 000 60 - 60 . 0 ( a ) 1 . 5 × 10 . sup .- 6 mglutamic acid ) 1 : 1 ( p - 1408 ) poly - l - aspartic acid 11 , 500 84 - 84 . 0 ( a ) 9 . 7 × 10 . sup .- 7 m ( p - 5387 ) poly - l - glutamic 13 , 600 90 - 89 . 9 ( a ) 9 . 1 × 10 . sup .- 7 macid ( p - 4636 ) ( b ) 3 . 3 × 10 . sup .- 6 m ( c ) 8 . 1 × 10 . sup .- 7 mpolyglutamic acid 36 , 240 240 - 239 . 0 ( a ) 3 . 4 × 10 . sup .- 7 m ( p - 4761 ) poly - d - glutamic 41 , 000 272 - 271 . 0 ( a ) 3 . 0 × 10 . sup .- 7 macid ( p - 4033 ) poly - l - aspartic acid 42 , 500 310 - 310 . 00 ( a ) 2 . 6 × 10 . sup .- 7 m ( p - 6762 ) poly - d - glutamic 66 , 000 437 - 436 . 0 ( a ) 1 . 9 × 10 . sup .- 7 macid ( p - 4637 ) poly - l - glutamic 77 , 800 515 - 514 . 0 ( a ) 1 . 6 × 10 . sup .- 7 macid ( p - 4886 ) ( b ) 5 . 9 × 10 . sup .- 7 m ( c ) 1 . 4 × 10 . sup .- 7 mpoly - l - asparagine 10 , 400 91 - 0 . 1 ( p - 8137 ) native mbp 13 , 801 117 16 . 3poly - l - arginine 12 , 000 62 60 . 9hydrochloride ( p - 4663 ) ecp 16 , 000 133 14 . 5______________________________________ * degree of polymerization indicates number of amino acid ( aa ) residues pe molecule . . sup .‡ charge ( e ) calculated by titrate program ( dnastar , inc . madison , wi ). . sup .# concentration of acidic aa necessary to balance charge of cationic ( a ) mbp at 5 × 10 . sup .- 6 m , ( b ) polyl - arginine hydrochloride at 5 × 10 . sup .- 6 m , or ( c ) ecp at 5 × 10 . sup .- 6 m . . sup .≠ all acids used were purchased as sodium salts unless otherwise noted ; sigma product code appears in parentheses after the product name . eosinophils from patients with the hyper - eosinophilic syndrome were obtained and after thorough washing to remove plasma proteins , erythrocytes were lysed by exposure to hypotonic saline . after additional washing , the resulting preparations of eosinophils ( greater than 85 % pure ) were lysed by exposure to 0 . 25m sucrose and mechanical agitation , as well as addition of heparin ( needed on some occasions to induce eosinophil lysis ). the broken cell preparations were centrifuged to remove cell debris and unbroken cells , and granule - containing supernatants were pooled and were centrifuged . granule pellets were solubilized in 0 . 01m hcl ( final ph 3 . 0 ) with brief sonication and centrifuged at 40 , 000 × g for 5 minutes . the supernatant was fractionated at 4 ° c . on a sephadex g - 50 column equilibrated with 0 . 025m sodium acetate buffer ( ph 4 . 2 ) containing 0 . 15m nacl ( column buffer ). fractions from the second protein peak containing ecp were pooled , dialyzed , lyophilized and further purified as described below . fractions from the third protein peak , containing only eosinophil major basic protein ( mbp ), were pooled . mbp concentrations were determined by absorbance at 277 nm using the extinction coefficient e 1 % 1 cm = 26 . 3 . eosinophil cationic protein ( ecp ) was further purified by affinity chromatography on a heparin sepharose cl - 6b column equilibrated with phosphate buffered saline ( pbs ) at ph 7 . 4 . fractions containing ecp eluted from the heparin - sepharose at high salt concentrations ( 0 . 15m - 1 . 5m nacl gradient used ) and were pooled , dialyzed against pbs and concentrated by lyophilization . ecp concentrations were determined by absorbance at 277 nm using the extinction coefficient e 1 % 1 cm = 15 . 6 . k562 cell cultures ( atcc ccl 243 ) were maintained in the tissue culture medium rpmi - 1640 supplemented with l - glutamine and 10 % defined calf serum ( dcs ) by twice weekly passage . two days prior to assay , cells were resuspended at 4 × 10 4 cells / ml of fresh rpmi - 1640 with 10 % dcs , ph 7 . 4 , in 50 ml flasks . by the day of assay , cell numbers had reached 1 . 5 - 2 . 0 × 10 5 / ml . these cells were washed three times in rpmi - 1640 without dcs , resuspended to 5 × 10 5 cells / ml and duplicate 100 μl aliquots were dispensed to flat - bottomed 96 - well microtiter plates . fifty microliters of various concentrations of amino acid salts dissolved in rpmi - 1640 or rpmi - 1640 alone were added followed at the appropriate time by 50 μl of mbp in column buffer , poly - l - arginine in rpmi - 1640 , ecp in rpmi - 1640 or appropriate controls . mbp , poly - l - arginine and ecp were used at a final concentration of 5 × 10 - 6 m . cells were incubated for 4 hr at 37 ° c . in a 5 % co 2 atmosphere in a humidified chamber . cell viability was determined by microscopic observation using trypan blue exclusion , and mean percent viability ± 1 sd of duplicates from one or more experiments was calculated . differences in viability between nontoxic controls and test concentrations were evaluated statistically using student &# 39 ; s t - test . after initial experiments using several polyamino acid salts , the sodium salt of poly - l - glutamic acid ( 13 , 600 mol wt ) and the sodium salt of poly - l - glutamic acid ( 77 , 800 mol wt ), the lowest and highest molecular weight polyglutamic acid homopolymers available , were used as typical representatives of this class of compounds . tracheal rings were prepared from hartley guinea pigs ( mayo institute hills farm , rochester , minn .). immediately following co 2 euthanasia , tracheas were removed and placed in rpmi - 1640 . adherent connective tissue was trimmed and each trachea was cut transversely into a series of 1 mm thick rings using a slicing device . after overnight equilibration , each ring was carefully examined to determine that the mucosa was intact and actively beating cilia were present . rings with damaged mucosa were not used for experimentation . for testing , rings were transferred to 96 - well microtiter plates containing 100 μl rpmi - 1640 / well . fifty microliters of the sodium salts of polyamino acids at a final concentration of 1 . 4 × 10 - 5 m or rpmi - 1640 alone were added to the wells , followed within 5 minutes by addition of 50 μl of mbp at a final concentration of 1 . 4 × 10 - 5 m , or of controls ( column buffer or rpmi - 1640 ). an observer , unaware of the substance or combination being tested , examined the ring cultures at 24 hr and 48 hr , using an inverted microscope . after final observations , specimens were fixed in 10 % buffered formalin , embedded in paraffin , sectioned and stained with hematoxylin and eosin . ciliostasis was used to describe the complete cessation of ciliary motion throughout the entire tracheal ring ; &# 34 ; normal &# 34 ; tracheal rings had active , intact ciliary epithelium . at the time intervals when damage was assessed , ciliostasis was almost always accompanied by partial or complete exfoliation or &# 34 ; stripping &# 34 ; of the ciliated epithelial cells from the basement membrane of the mucosa with precipitates of mbp on or around the cells . a ) animals . the animals used in this study were wild - caught adult male cynomolgus monkeys ( macaca fascicularis ) weighing 3 . 5 to 7 . 5 kg . each animal was housed individually in a specially designed open mesh cage and provided with food twice daily and water ad libitum . animals were fasted for approximately 18 hr prior to study . b ) study protocol . each animal was anesthetized with an intramuscular injection of ketamine ( 4 mg / kg ) and xylazine ( 1 mg / kg ), intubated with a cuffed endotracheal tube and seated in an upright position in a specially designed support chair . ketamine ( 4 mg / kg , i . m .) was used to supplement anesthesia when needed . the baseline respiratory system resistance ( rrs ) was monitored for 15 minutes followed by methacholine dose - response determinations . the broncho - constrictor response to inhaled methacholine was used to determine airway responsiveness by the methodology c . d . wegner et al ., respir . physiol ., 55 , 47 ( 1984 ) and r . h . gundel et al ., j . appl . physiol ., 68 , 779 ( 1990 ). after completion of the methacholine dose - response , each animal received an aerosol treatment of either vehicle or polyglutamic acid salt ( p - 4886 , 61 , 200 mol wt ). rrs was monitored for an additional 10 minutes after which each animal received an intratracheal injection of native mbp . rrs was then monitored for one hour postinstillation after which the animals were allowed to recover from anesthesia . at 2 hr postinstillation , each animal was anesthetized ( ketamine / xylazine ), intubated and methacholine dose - response determinations were performed . the study was designed so that the sodium polyglutamate treatment experiments were bracketed by control ( vehicle ) treatment studies to ensure no change in mbp - induced effects over time . c ) intratracheal mbp instillation . native mbp was diluted in ph 4 . 3 0 . 025m sodium acetate buffer containing 0 . 15m nacl to a concentration of 200 μg / ml immediately prior to instillation . a total of 5 ml ( 1 mg mbp ) was slowly infused directly into the trachea through the endotracheal tube via a 20 cm long piece of polyethylene 240 tubing attached to a 5 ml syringe . as control fluids , pbs and column buffer were tested and produced no effect on rrs or methacholine sensitivity . d ) rrs measurements . respiratory system impedance ( zrs ) was measured as reported by c . d . wegner et al ., cited above , by discrete frequency sinusoidal forced oscillations superimposed on tidal breathing . the frequency range was computed to provide a single value representation of respiratory system resistance ( rrs ). e ) aerosol delivery system . aerosol inhalation treatments of vehicle or polyglutamic acid salt were administered by intermittent positive pressure breathing with a bird mark 7a respirator and micronebulizer ( model 8158 , bird corporation , palm springs , calif .). each treatment consisted of 15 breaths per minute ( maximum inspiratory pressure 20 cm h 2 o ) for 6 minutes . sodium polyglutamate was dissolved in pbs at a concentration of 25 mg / ml just prior to use . aerosol treatment delivered approximately 1 . 5 mg of polyglutamic acid salt to the lungs . f ) methacholine dose - response determinations . bronchial responsiveness was assessed by performing cumulative methacholine dose - response determinations ( r . h . gundel et al ., j . appl . physiol ., 68 , 779 ( 1990 )). after an initial aerosol challenge with vehicle ( pbs ), increasing concentrations of methacholine were administered until increases in rrs of 100 to 200 percent were obtained . aerosol challenges were separated by 5 - 8 minutes or until rrs returned to baseline values . linear interpolation on a logarithmic scale was used to estimate the dose of methacholine at which a 100 percent increase in rrs would have occurred ( methacholine pc 100 ). to determine whether polyamino acid salts inhibit blood clotting , stock concentrations of heparin , poly - l - glutamic acid sodium salt ( 13 , 600 mol wt ) and poly - l - glutamic acid sodium salt ( 77 , 800 mol wt ) were added to 500 μl whole blood from a normal human volunteer to final concentrations of 10 - 4 m to 10 - 6 m in 10 × 75 mm glass tubes and mixed . pbs and column buffer were used as controls . the tubes were checked at one - minute intervals and clotting time for each sample was recorded . after 30 minutes , samples were checked every 30 minutes to a maximum of 15 hr . 1 . inhibition of mbp toxicity to k562 cells by acidic polyamino acid salts various polyglutamic and polyaspartic acid salts were added to k562 cells followed by addition of mbp and cell viability was determined after 4 hr . the results of these experiments are summarized on table ii , below . table ii__________________________________________________________________________inhibition of mbp toxicity by acidic amino acid salts percent viability of k562 cells * native mbp ( 5 × 10 . sup .- 6 m ) added to aa concentration mol wt controls . sup . 1 × 10 . sup .- 3 m 5 × 10 . sup .- 6 m 1 × 10 . sup .- 6 m 5 × 10 . sup .- 7 m 1 × 10 . sup .- 7 m__________________________________________________________________________l - aspartic acid ** 155 98 . 5 ± 0 . 2 3 . 4 ± 4 . 7 . sup .# nd nd nd ndl - glutamic acid 169 98 . 8 ± 0 . 2 0 . 0 ± 0 . 0 . sup .# nd nd nd ndpoly -( α , β )- dl - 6 , 800 97 . 0 ± 2 . 7 nd 90 . 1 ± 6 . 7 . sup .≠ 1 . 6 ± 1 . 5 6 . 0 ± 3 . 9 . sup .# 2 . 9 ± 0 . 4 . sup .# aspartic acidpoly ( aspartic acid , 9 , 000 98 . 4 ± 1 . 4 nd 95 . 5 ± 0 . 9 22 . 0 ± 19 . 7 . sup .# 4 . 9 ± 2 . 3 . sup .# 0 . 0 ± 0 . 0 . sup .# glutamic acid ) 1 : 1poly - l - aspartic acid 11 , 500 98 . 0 ± 2 . 4 nd 87 . 5 ± 7 . 9 84 . 3 ± 1 . 6 . sup .# 22 . 7 ± 7 . 2 . sup .# 2 . 7 ± 3 . 8 . sup .# poly - l - glutamic acid 13 , 600 98 . 9 ± 1 . 0 nd 89 . 5 ± 2 . 0 72 . 9 ± 0 . 7 . sup .# 4 . 9 ± 5 . 9 . sup .# 0 . 0 ± 0 . 0 . sup .# poly - l - glutamic acid 36 , 240 94 . 7 ± 2 . 6 nd 96 . 2 ± 6 . 5 96 . 9 ± 1 . 8 67 . 5 ± 20 . 4 1 . 3 ± 1 . 8 . sup .# poly - d - glutamic acid 41 , 000 100 . 0 ± 0 . 0 nd 98 . 0 ± 1 . 8 99 . 0 ± 1 . 7 96 . 2 ± 1 . 4 11 . 2 ± 0 . 9 . sup .# poly - l - aspartic acid 42 , 500 97 . 4 ± 2 . 3 nd 100 . 0 ± 0 . 0 99 . 4 ± 0 . 9 100 . 0 ± 0 . 0 8 . 7 ± 1 . 4 . sup .# poly - d - glutamic acid 66 , 000 93 . 4 ± 6 . 1 nd 96 . 4 ± 1 . 7 97 . 3 ± 1 . 0 90 . 6 ± 3 . 4 0 . 0 ± 0 . 0 . sup .# poly - l - glutamic acid 77 , 800 95 . 1 ± 3 . 8 nd 93 . 9 ± 8 . 0 95 . 5 ± 6 . 4 95 . 4 ± 3 . 2 2 . 6 ± 3 . 5 . sup .# poly - l - asparagine 10 , 400 85 . 3 ± 5 . 1 nd 5 . 9 ± 9 . 5 . sup .# 1 . 2 ± 2 . 1 . sup .# 0 . 0 ± 0 . 0 0 . 0 ± 0 . 0 . sup .# native mbp 13 , 801 1 . 0 ± 3 . 2column buffer 96 . 7 ± 1 . 6medium 96 . 5 ± 3 . 7__________________________________________________________________________ ** all acids were used as sodium salts . * values are mean percent viability ± 1 sd of 1 - 3 4 hr experiments , eac consisting of duplicate wells . . sup . controls consists of aa , acidic poly aa , polyl - asparagine , native mbp , column buffer or medium tested alone . all controls at 5 × 10 . sup .- 6 m except laspartic and lglutamic acid monomers which were tsete at 1 × 10 . sup .- 3 m . . sup .# indicates p & lt ; 0 . 001 for values tested against appropriate nontoxic aa control using student ` s ttest ; mbp added within five minutes after addition of acidic aa . . sup .≠ values underlined are from acidic polyamino acid test concentrations closest to but not less than concentration for balanced charge ( table i ) for a particular acidic polyamino acid . the polyamino acid salts ranged from 6 , 800 to 77 , 800 in mol wt ( table i ) and were tested at concentrations from 1 × 10 - 7 m to 5 × 10 - 6 m for their ability to inhibit mbp toxicity at 5 × 10 - 6 m . as shown on table ii , all of the polyamino acid salts inhibited mbp toxicity at equimolar mbp concentrations . this inhibition was related to the acidic or anionic nature of the polymers because poly - l - asparagine at 5 × 10 - 6 m did not inhibit . mbp toxicity . also , some degree of polymerization was necessary for this effect because amino acid monomers did not inhibit mbp toxicity . the amino acid salts , themselves , were not toxic to the k562 cells at the concentrations tested . as the concentration of the polyamino acid salt was lowered below that of mbp , inhibition of mbp toxicity to the k562 cells was reduced ( table ii ). this reduction was not due to the type of amino acid present ( glutamic acid versus aspartic acid , or d versus l isomers ) but was dependent upon the molecular weight and thus the degree of polymerization of the polyamino acid . because the degree of polymerization directly affects the total charge ( e ) of the polymer salts , a comparison between the polyamino acid salt concentrations necessary to balance the e of mbp at 5 × 10 - 6 m and the reduction in polyamino acid salt inhibition of mbp toxicity to k562 cells was made ( tables i and ii ). at polymer salt concentrations greater than or equal to those necessary to balance the cationic charge of mbp , only the sodium salt of poly - l - aspartic acid ( 11 , 500 mol wt ) and the sodium salt of poly - l - glutamic acid ( 13 , 600 mol wt ), both at 1 × 10 - 6 m , were significantly different from controls ; however , at polymer salt concentrations less than those necessary to balance the cationic charge of mbp , all polymers exhibited a drastic reduction in their ability to inhibit mbp toxicity . these data suggest that the anionic charge of a polyamino acid salt is a critical determinant of its ability to inhibit mbp toxicity . to better define the point at which polyamino acid salts begin to effectively inhibit mbp toxicity , several of the polymer salts were tested at 2 . 0 , 1 . 0 and 0 . 5 times the concentration necessary to balance cationic charge of mbp at 5 × 10 - 6 m . as shown in fig1 all four amino acid polymer salts tested inhibited mbp toxicity to k562 cells at a concentration of 2 . 0 times the cationic charge of mbp 2 ×( 5 × 10 - 6 m )!. at a concentration of 1 . 0 times the cationic charge of mbp , the polyaspartic acid salts partially lost their ability to inhibit mbp whereas the polyglutamic acid salts did not . all of the polymers lost their ability to inhibit mbp at a concentration of 0 . 5 times the cationic charge of mbp and afforded little protection against mbp . thus , polyamino acid salts begin to effectively protect k562 cells against mbp toxicity at concentrations between 1 . 0 to 2 . 0 times those required to balance the cationic charge of mbp . in experiments described above , the polyamino acid salts were added to the k562 cells before addition of mbp . the ability of the polyamino acid salt to inhibit mbp toxicity after mbp had already been added to the cells was also tested . as shown by fig2 concentrations of polyamino acid salts which were effective in inhibiting mbp toxicity when added to cells before mbp were not as effective in inhibiting mbp toxicity when added to the cells after mbp exposure . some protection was afforded when the polyamino acid salts were added within 15 minutes after mbp addition , but little protection was seen when the polymers are added one or more hours after mbp addition . only the sodium salt of poly - l - glutamic acid ( 77 , 800 mol wt ) at equimolar mbp concentration of 5 × 10 - 6 m added 15 minutes after mbp significantly protected against mbp toxicity . thus , the polyamino acid salts have little effect on k562 viability unless they are added before or very shortly after addition of 5 × 10 - 6 m mbp . 2 . inhibition of poly - l - arginine and ecp toxicity to k562 cells by acidic polyamino acid salts to determine if this toxic inhibition by polyamino acid salts is limited only to mbp or may apply to other cationic toxins , polyamino acid salts were tested for their ability to inhibit a cationic polyamino acid salt , sodium poly - l - arginine and to inhibit ecp toxicity to k562 cells . both sodium poly - l - arginine and ecp toxicity were inhibited by acidic polyamino acid salts as shown by the data presented on table iii , below . table iii__________________________________________________________________________inhibition of ecp and poly - l - arginine toxicity by acidic polyamino acidsalts percent viability of k562 cells * poly - l - arginine or ecp ( both at 5 × 10 . sup .- 6 m ) controls . sup . added to acidic poly aa concentrations of mol wt 5 × 10 . sup .- 6 m 5 × 10 . sup .- 6 m 1 × 10 . sup .- 6 m 5 × 10 . sup .- 7 m 1 × 10 . sup .- 7 m__________________________________________________________________________poly - l - glutamic acid ** 13 , 600 96 . 9 ± 4 . 5 99 . 1 ± 1 . 3 . sup .≠ 4 . 9 ± 0 . 3 . sup .# 0 . 0 ± 0 . 0 . sup .# 0 . 0 ± 0 . 0 . sup .# poly - l - glutamic acid 77 , 800 97 . 2 ± 2 . 5 97 . 9 ± 3 . 0 97 . 2 ± 4 . 0 22 . 9 ± 3 . 0 . sup .# 2 . 0 ± 2 . 9 . sup .# poly - l - arginine 12 , 000 0 . 0 ± 0 . 0hydrochloridemedium 97 . 8 ± 1 . 0poly - l - glutamic acid 13 , 600 100 . 0 ± 0 . 0 77 . 2 ± 4 . 9 . sup .# 73 . 7 ± 5 . 8 . sup .# 50 . 2 ± 1 . 3 . sup .# 59 . 8 ± 20 . 6poly - l - glutamic acid 77 , 800 100 . 0 ± 0 . 0 98 . 3 ± 0 . 5 96 . 4 ± 5 . 2 91 . 2 ± 3 . 3 58 . 4 ± 11 . 8 . sup .# ecp 16 , 000 35 . 7 ± 6 . 2medium 86 . 8 ± 2 . 1__________________________________________________________________________ * values are mean percent viability ± 1 sd of one 4 hr experiment consisting of duplicate wells for polyl - arginine hydrochloride and a second experiment consisting of duplicate wells for ecp . . sup . controls consist of acidic polyamino acids , polyl - arginine , ecp or medium tested alone . . sup .≠ values underlined are from acidic polyamino acid test concentrations closest to but not less than concentration for balanced charge ( table i ) for a particular acidic polyamino acid . . sup .# indicates p & lt ; 0 . 05 for values tested against appropriate acidic polyamino acid controls using student &# 39 ; s ttest ; polyl - arginine hydrochloride or ecp added within five minutes after addition of acidic polyamino acid . ** all polyamino acids were used as the sodium salts unless otherwise noted . generally , there were no significant differences between test concentrations and controls when polyamino acid test concentrations were at least equal to the concentration needed for a balanced charge for poly - l - arginine . hcl or ecp . below polyamino acid salt concentrations necessary for a balanced charge , inhibition of toxicity was greatly reduced for all polyamino acid salts tested . because these polyamino acid salts inhibit poly - l - arginine and ecp toxicity , this mechanism is not specific to mbp and may apply to a wide variety of cationic toxins . 3 . inhibition of mbp toxicity to tracheal ring epithelium by polyamino acid salts polyamino acid salts were used as antagonists of mbp toxicity to guinea pig tracheal epithelium as a model for their role as an inhibitor of mbp toxicity in bronchial asthma . the polyglutamic acid salts inhibited mbp toxicity to the tracheal epithelium . tracheal rings incubated with mbp alone exhibited gross morphologic damage at 24 hr . the damage included ciliostasis and exfoliation of mucosal cells . precipitates of mbp were apparent on and around the cells . after 48 hr of incubation , only the mbp - alone - treated tracheal rings showed damage . in contrast , the tracheal rings treated with acidic polyglutamic acid salts or a combination of polyglutamic acid salts and mbp appeared normal with actively beating cilia . 4 . inhibition of mbp - induced effects on the airway by polyglutamic acid sodium salt mbp instillation into the monkeys resulted in an immediate increase in rrs that peaked between 5 to 10 minutes postinstillation and resolved by 1 hr . pretreatment with the sodium salt of polyglutamic acid significantly inhibited the mbp - induced increase in rrs . polyglutamic acid salt treatment by itself did not alter rrs ( data not shown ). the effects of mbp instillation on airway responsiveness to inhaled methacholine during control and polyglutamic acid salt treatment studies were also tested . mbp administration alone resulted in a dramatic increase in airway responsiveness as indicated by a 10 - fold decrease in the calculated dose of methacholine required to cause a 100 % increase in rrs (&# 34 ; the methacholine pc 100 value &# 34 ;). polyglutamic acid salt pretreatment significantly inhibited the mbp - induced increase in airway responsiveness in each animal studied . 5 . inhibition of mbp effects on the airway by parenteral administration of polyglutamic acid sodium salt as noted above in 4 , the effects of mbp on the airways of rhesus monkeys can be blocked by pretreatment with the sodium salt of polyglutamic acid . one could also demonstrate the effectiveness of parenteral administration of polyglutamate by demonstrating its ability to counteract the effect of inhaled mbp on airway responsiveness in monkeys . in this experiment ( as in 4 above ), mbp will be instilled into the monkeys &# 39 ; airway to cause an immediate increase in rrs and increased airway responsiveness to inhaled methacholine . monkeys will be pretreated with the sodium salt of polyglutamic acid to demonstrate that the parenteral administration of polyglutamic acid inhibits the mbp - induced increase in rrs . to demonstrate the effectiveness of injected polyglutamic acid , 0 . 1 % weight / volume solution of polyglutamic acid sodium salt in phosphate - buffered saline ( pbs ) will be perfused intravenously at the rate of 20 ml / hr for 2 hours prior to challenge with mbp . the results will show that parenteral infusion with mbp is as effective as topical administration by significantly inhibiting the mbp - induced increases in rrs and airway responsiveness in the monkeys studied . although heparin is an effective antagonist of mbp toxicity , its possible clinical use could be limited by its ability to inhibit blood clotting . to determine if polyamino acid salts inhibit blood clotting , whole blood was incubated with heparin or polyglutamic acid salts , and the clotting time was observed . as shown in fig3 at a concentration of 1 × 10 - 5 m , twice the highest polyamino acid salt concentration used in the k562 assays and comparable to that used in the tracheal ring assays , there was no significant difference between polyglutamic acid salts when compared to controls in their ability to inhibit clotting . the present invention has been exemplified with respect to the neutralization of the toxic effect of mbp on cells , on respiratory epithelium , on causing increases in rrs and finally on causing bronchial hyperreactivity in monkeys . however , due to the discovery that not only polyglutamic acid salts , but also polyaspartic acid salts , can neutralize the effect of mbp on monkey lung and ecp on tissue culture cells , it is believed that other polyanions can be employed in the present method . the invention has been described with reference to very specific and preferred embodiments and techniques . however , it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention .

US-12012593-A

a method , system , and machine - readable storage medium for diagnosing operation in a turbocharged engine having an engine control module operable to control engine operation in response to data received from a plurality of sensors is disclosed . in operation , the method , system , and machine - readable storage medium store data corresponding to a compressor map defining a region of compressor efficiency and compressor speeds during operation , and a turbine map defining a region of turbine efficiency and turbine speeds during operation . next , the method , system and apparatus determine a predicted value for an operating parameter using data received from selected ones of the plurality of sensors and the data stored in memory , determine an actual value for the operating parameter using data received from selected ones of the plurality of sensors , and generate an abnormal operation signal if a difference between actual and predicted values is greater than a predetermined amount .

for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended . the invention includes any alterations and further modifications in the illustrated devices and described methods and further applications of the principles of the invention that would normally occur to one skilled in the art to which the invention relates . with reference to fig1 the present invention is adapted to monitor and control an engine 102 . as shown in fig1 engine 102 includes an air intake system 114 , an exhaust system 116 , a combustion system 117 , and a turbocharger 118 . the air intake system 114 typically includes an air filter or cleaner 128 , an aftercooler 126 , and an air intake manifold 122 . the exhaust system 116 typically includes an exhaust manifold 120 and a muffler 124 . the combustion system 117 typically includes elements such as a piston and combustion chamber as is known in the art , including free piston and rotary engine designs . the turbocharger 118 includes a compressor 130 , a turbine 132 , and a shaft 134 . the compressor 130 is connected into the air intake system 114 between the aftercooler 126 and the air filter 128 . the turbine 132 is connected into the exhaust system 116 between the exhaust manifold 120 and the muffler 124 . the shaft 134 connects the compressor 130 to the turbine 132 . air is drawn into the compressor 130 through air intake system 114 and provided to combustion system 117 by way of an air intake manifold 122 . exhaust gas from the engine passes through exhaust manifold 120 to drive the turbine 132 , as is well known to those skilled in the art . engine 102 typically includes a plurality of sensors ( not shown ) operable for sensing a variety of operating parameters of the engine , such as , but not limited to ; barometric pressure , inlet ambient temperature , intake manifold temperature / pressure , pilot quantity , injection duration , engine speed , rate of fuel delivery to the engine , ratio of air to fuel delivery to the engine , fuel quantity , the oil pressure , oil temperature , engine speed and exhaust temperature . turbocharger 118 may include sensors for sensing the compressor outlet temperature / pressure , turbine inlet temperature / pressure , and the boost pressure . all of the sensors can be of a variety of designs known in the industry . the operation of engine 102 is governed by an engine control module ( ecm ) 202 , as shown in fig2 . sensor output signals 210 are transmitted to ecm 202 from engine 102 . ecm 202 then generates control signals 220 in response to the sensor output signals . once generated , control signal 220 is then passed from ecm 202 to engine 102 to control engine operation . referring now to fig3 there is shown a high - level flow chart of the steps performed in one exemplary embodiment . as shown , system 300 first conducts rationality tests to determine whether the sensor data received by ecm 202 is accurate ( step 305 ). examples of the rationality test are discussed in more detail below . if at least one rationality test fails ( step 310 ), processing flows to step 315 , and a diagnostic message is outputted . if the rationality tests pass , processing flows to step 320 where the present system monitors turbocharger 118 . if the turbocharger is operating properly ( step 325 ), processing continues ( step 335 ). if the turbocharger is not operating properly , a diagnostic message is outputted ( step 330 ). referring to fig4 there is shown a more detailed flow chart of the steps for performing exemplary rationality tests depicted in step 305 of fig3 . as shown , the first rationality test performed is a turbine delta temperature rationality test ( step 410 ). if that test is successful , processing flows to step 420 . otherwise , a diagnostic routine or error message is invoked . in step 420 , the present invention performs a compressor delta temperature rationality test . if that test is successful , processing flows to step 430 . otherwise , a diagnostic routine or error message is invoked . step 430 performs a combined turbine / compressor delta speed rationality test . since turbine 130 and compressor 132 share a common shaft 134 , their relative speeds should fall within a predetermined error limit . if the values from step 430 are not within acceptable limits , a diagnostic routine is invoked . if the values are within the predetermined error limit , processing flows to step 440 where a combined turbine / compressor delta power rationality test is performed . if the combined turbine / compressor delta power rationality test is not successful ( step 440 ), a diagnostic routine or error message is invoked . the software flow , as described above , is for illustration purposes only . the flow may continue serially from the first rationality test to the last rationality test , and the order of the rationality tests may be altered . in some cases , later tests may rely on values obtained in earlier tests . consequently , if a test fails , meaning that the sensor has failed or its data is suspect , control exits the normal flow and proceeds on a “ fail ” loop ( not shown ) to an error / diagnostic message step . it is contemplated that the order of certain described rationality tests may be changed , tests may be omitted and additional rationality tests may be added in alternative embodiments . referring now to fig5 there is shown a detailed flow chart of the steps of an exemplary method for performing the turbine delta temperature rationality test as depicted in step 410 of fig4 according to one exemplary embodiment of the invention . although specific engines with environmental characteristics are disclosed for determining various operating characteristics ( e . g ., boost pressure , engine speed , inlet manifold temperature and fuel quantity are used to determine volumetric efficiency ) other appropriate ways known to those of skill in the art may also be used . to evaluate turbine delta temperatures , boost pressure , inlet restriction and measured atmospheric pressure may be used to determine the compressor pressure ratio ( step 505 ). in one exemplary embodiment compressor pressure ratio may be calculated from the various values , and in another exemplary embodiment , compressor pressure ratio may be determined from a lookup table . processing then flows to step 510 where boost pressure , engine speed , inlet manifold temperature , and fuel quantity are used to calculate volumetric efficiency . in step 515 , volumetric efficiency , engine speed , inlet manifold temperature , and boost pressure are used to calculate mass flow rate of air , which can then be used with inlet ambient temperature and atmospheric pressure to calculate a value for corrected mass flow rate of air ( step 520 ). processing then flows to step 525 where the corrected mass flow rate of air and the compressor pressure ratio are used to calculate a predicted compressor speed and compressor efficiency . in one exemplary embodiment , a predicted compressor speed and predicted compressor efficiency are determined by utilizing a compressor map stored in a memory , using the previously calculated values for compressor pressure ratio and corrected mass flow rate of air , and retrieving the empirical values for compressor speed and compressor efficiency from the memory . in step 530 , atmospheric pressure , exhaust restrictions , and exhaust manifold pressure are used to calculate a turbine pressure ratio . processing then flows to step 535 where the corrected mass flow rate of air and the fuel quantity are used to calculate the mass flow rate of the exhaust . the mass flow rate of the exhaust is used in combination with the exhaust manifold temperature and the exhaust manifold pressure to calculate a corrected mass flow rate of the exhaust ( step 540 ). the corrected mass flow rate of exhaust is then used with the pressure ratio to calculate turbine efficiency and turbine speed ( step 545 ). in one exemplary embodiment , a predicted turbine efficiency and a predicted turbine speed are determined by utilizing a turbine map stored in memory using the previously calculated values for turbine pressure ratio and corrected mass flow rate of the exhaust , and retrieving the empirical values for turbine speed and turbine efficiency from the memory . next , in step 550 , the isentropic stack temperature and the turbine expansion ratio are used to calculate a predicted exhaust manifold temperature , which is then used with turbine efficiency and the isentropic stack temperature to calculate a predicted stack temperature ( step 555 ). the predicted stack temperature and the predicted exhaust manifold temperature are used to assess the turbine delta temperature in step 560 . processing next flows to step 565 where the engine speed , fuel quantity , boost pressure and inlet manifold temperature are used to calculate a second assessed turbine delta temperature . the absolute difference of the assessed turbine delta temperatures is then calculated in step 570 . processing then flows to step 575 where the absolute value is compared to a turbine delta temperature error limit . if the absolute value exceeds the limit , an error is declared and / or a diagnostic routine is invoked ( step 580 ). if the absolute value does not exceed the limit , processing continues . referring to fig6 there is shown a detailed flow chart of the steps of an exemplary method for performing a compressor delta temperature rationality test as depicted in step 420 of fig4 . in this test , the inlet ambient temperature and compressor pressure ratio are used to calculate an isentropic compressor outlet temperature ( step 610 ). processing then flows to step 620 where the isentropic compressor outlet temperature , the inlet ambient temperature , and the compressor efficiency are used to determine a predicted compressor outlet temperature , which is used with the inlet ambient temperature to assess compressor delta temperature ( step 630 ). the engine speed , fuel quantity , boost pressure and inlet manifold temperature are used for a second assessment of compressor delta temperature in step 640 . in step 650 , the absolute value of the difference in assessed compressor delta temperature is calculated . that absolute value is compared to a compressor delta temperature error limit in step 660 . if the absolute value exceeds the limit , an error is declared and / or a diagnostic routine is invoked ( step 670 ). if the absolute value does not exceed the limit , processing continues . the next rationality test performed by the disclosed embodiment is the speed rationality test . the calculated compressor and turbine speeds must be within an acceptable margin of each other , as the wheels share a common shaft 134 . referring now to fig7 there is shown a detailed flow chart of the steps of an exemplary method for performing a turbine / compressor delta speed rationality test as depicted in step 430 of fig4 . in fig7 an absolute value for the difference between the previously calculated values for compressor speed and turbine speed is first computed ( step 710 ). processing then flows to step 720 where it is determined whether the absolute value exceeds a delta turbocharger speed error limit . if it does not exceed the limit , no fault exists . if the value does exceed the limit , processing flows to step 730 where a test is performed to determine if a hardware turbocharger speed sensor is being utilized . this information can be used to determine which speed sensor ( s ) is ( are ) in error . if a hardware turbocharger speed sensor is used , a diagnostic routine on the hardware sensor is performed ( step 740 ). if not , processing flows to step 750 where compressor and turbine diagnostics are performed . after the first three diagnostic tests are completed , the exemplary method then tests compressor power and turbine power to determine whether a problem exists with one of the associated sensors . referring to fig8 there is shown a detailed flow chart depicting the steps for performing an exemplary turbine / compressor delta power rationality test as depicted in step 440 of fig4 . in step 810 , the mass flow rate of air , compressor outlet temperature , inlet ambient temperature , and the specific heat of air are used to compute compressor power . processing then flows to step 815 where the mass flow rate of air and the fuel are used to calculate the specific heat of the exhaust . next , mass flow rate of exhaust , exhaust manifold temperature , stack temperature , and the specific heat of the exhaust are used to calculate turbine power ( step 820 ). speed and fuel are used in step 825 to determine whether engine 102 is operating in transient or a steady state . if engine 102 is in a steady state , processing flows to step 830 where an absolute value of the difference between turbine power and compressor power is calculated . if the absolute value exceeds a power error limit ( step 835 ), processing flows to step 855 and a diagnostic is invoked . if the absolute value does not exceed the limit , no fault is determined ( step 850 ) and processing terminates . if engine 102 is in a transient state ( step 825 ), processing flows to step 840 where inertia , compressor and turbine power history are used to determine whether current values match projected values . if they do not , a diagnostic is invoked ( step 845 ). if the current values match projected values , within an error limit , no fault is determined ( step 850 ) and processing terminates . engine 102 may include one or more hardware sensors ( e . g ., mass air flow , inlet ambient temperature ( iat ), turbo speed , inlet manifold pressure / temperature , compressor outlet pressure / temperature , compressor delta pressure , inlet restriction , turbine delta pressure , exhaust restriction , exhaust stack temperature , and exhaust manifold temperature , etc .) such that the predicted or calculated values can be compared with output values from the hardware sensors as a further test of sensor rationality . more specifically , if engine 102 includes a hardware differential pressure sensor , its feedback can be compared with the predicted differential pressure . if the two values are within a predetermined margin of error , the hardware sensor value may used . if the two values are not within some predetermined margin of error , the predicted differential pressure value may used , and the hardware sensor will be further scrutinized to determine whether it is faulty . this same example applies with other sensors as well . for example , if an inlet ambient air temperature ( iat ) hardware sensor is present in engine 102 , its feedback is used to more accurately calculate turbo speed , compressor power , etc . in another embodiment , an artificial neural network ( ann ) model is used to reverse calculate one or more values computed in the described methods . more specifically , an ann is used to compute values for engine torque , exhaust temperature , turbo speed , etc . when sufficient training data is available . those computations are compared to calculations previously described to confirm the values or to isolate a faulty sensor . in those operating scenarios in which no training data is available , a comparison of the performed calculations together with output from an ann may prove to be more accurate than either system alone . when each of the described rationality tests is passed , control in the system 300 flows to step 320 ( fig3 ) for evaluation of the turbocharger operation . the operating behavior of a compressor within a turbocharger is graphically illustrated by a “ compressor map ” associated with the turbocharger in which the pressure ratio ( compression outlet pressure divided by the inlet pressure ) is plotted on the vertical axis and the flow is plotted on the horizontal axis . referring to fig9 there is shown a map 900 depicting the performance of the compressor element of a turbocharger represented by a pressure ratio versus air flow graph with compressor efficiency values and compressor speeds superimposed . a similar map depicting the performance of the turbine element of a typical turbocharger will also exist and may be utilized . as shown , map 900 is comprised of a surge line 910 , choke line 920 , speed lines 930 and efficiency lines 940 . surge line 910 basically represents “ stalling ” of the air flow at the compressor inlet . with too small a volume flow and too high a pressure ratio , the flow will separate from the suction side of the blades on the compressor wheel , with the result that the discharge process is interrupted . the air flow through the compressor is reversed until a stable pressure ratio by positive volumetric flow rate is established , the pressure builds up again and the cycle repeats . this flow instability continues at a substantially fixed frequency and the resulting behavior is known as “ surging ”. choke line 920 represents the maximum centrifugal compressor volumetric flow rate , which is limited for instance by the cross - section at the compressor inlet . when the flow rate at the compressor inlet or other location reaches sonic velocity , no further flow rate increase is possible and choking results . within the boundaries of surge line 910 and choke line 920 , compressor 130 may operate at any one of a plurality of speeds ( represented by speed lines 930 ) and efficiencies ( represented by efficiency lines 940 ). as shown , compressor efficiency ranges are depicted as oval - shaped regions that extend across a plurality of speed lines 930 . when a given power output is required of the engine , changing fueling or airflow is not a direct option , but will result from changing other control parameters . if an electronic wastegate is present , the wastegate setting can be adjusted ( example : close the wastegate if airflow is so low the compressor is near surge , or open the wastegate if the compressor is operating too near the choke line ). proper compressor and turbine selection for the engine application should be such that operating near surge or choke means something in the engine system has failed , and controlling the engine away from such conditions should not be necessary consideration . vane positions of variable geometry turbochargers can be adjusted to control how the turbocharger operates as well . the disclosed thermodynamic analysis of engine sensor arrays using computer - based models in combination with a neural network has utility for a wide variety of engine analysis applications wherein real time diagnosis of general operating conditions , individual fault conditions and multiple fault conditions , are desired . one aspect of the described system is the capability to predict exhaust manifold ( turbine inlet ) and exhaust stack ( turbine outlet ) temperatures using thermodynamic modeling and compressor and turbine map information stored in the ecm . these quantities are difficult to measure with low - cost / high - reliability / fast - response sensors , thereby making virtual sensors more appealing . the described concept also eliminates the apprehension caused by placing sensors upstream of the turbine since a sensor failure that results in particles breaking off the sensor will likely result in this material passing through and damaging the turbine . another aspect of the described system is the capability to evaluate hardware sensors based on the output of one or more virtual sensors . if the two values are within a predetermined margin of error , the hardware sensor feedback may used . if the two values are not within the predetermined margin of error , the predicted value may used and the hardware sensor is further scrutinized to determine whether it is faulty . the hardware sensor is disabled if the difference between the actual and predicted values has exceeded a predetermined amount , a predetermined amount of times or has occurred continuously over a predetermined period of time . operation of the engine may then be controlled based on the predicted value . yet another aspect of the described system is the capability to sense operating conditions , compare sensed values with empirical values , and then update the initial values and neural network weights based on the comparison . possible benefits of the described system are warranty reduction and emissions compliance . more accurate monitoring of the engine system may allow narrower development margins for emissions , thereby allowing for better fuel economy for the end user . moreover , effective implementation of the disclosed system could promptly identify potential damage that could occur , thereby reducing significant warranty claims against the engine manufacturer . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character . it should be understood that only exemplary embodiments have been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .

US-14473802-A

a foam is provided for use in a subterranean oil - bearing formation for reducing and controlling the mobility of a gaseous drive fluid . the foam is generated using an inert gas and a fluorocarbon surfactant solution in admixture with an amphoteric or anionic hydrocarbon surfactant solution . a relatively small amount of the fluorocarbon surfactant is operative , when mixed with the hydrocarbon surfactant and foamed , to generate a foam that has better stability when in contact with oil than a foam made with hydrocarbon surfactant alone .

foaming tests were conducted in an osterizer ™ blender at 21 ° c . a 6 × 60 cm transparent graduated column was fitted with a 1 / 8 inch stainless steel cooling coil and a calibrated thermocouple and the assembly was fitted onto the blender base . temperature was controlled by water flow to the cooling coil . two hundred and fifty ml of 0 . 5 wt . % surfactant in a 2 . 1 % brine solution was added to the graduated column and the solution was foamed for 5 - minutes at the &# 34 ; liquify &# 34 ; setting . the foam height was measured . the experiment was repeated wherein the total surfactant was made up of a mixture of varion cas ™ sulfobetaine amphoteric surfactant ( sherex chemical co . inc .) and fluorad fc - 751 ™ perfluoro - surfactant supplied by the 3 - m corporation . the foam height measurements were conducted both in the absence of petroleum crude oil and in the presence of various amounts of oil . an alberta crude oil from the kaybob field ( 40 degree api gravity ) was employed . the results are shown in fig3 where normalized foam height is : ## equ1 ## the addition of 2 % oil reduced the foam height of varion cas by 33 %, but the surfactant mixture 95 % varion cas / 5 % fluorad fc - 751 showed only a 5 % reduction . this result was totally unexpected as the perfluor - surfactant concentration was only 250 parts per million . a very strong synergistic benefit is obtained from the combination of surfactants . the foaming experiments of example 1 were conducted using dowfax 2a1 ™ alkyldiphenyloxide sulfonate surfactant ( dow chemical ) alone and in a mixture of 90 % dowfax 2a1 / 10 % fluorad fc - 751 . the petroleum oil was from the cynthia field ( texaco canada , api 36 degrees ) and 4 ml of oil was added . in the presence of oil the dowfax 2a1 normalized foam height was 0 . 20 ; the mixture foam height was 0 . 75 . the foaming experiments of example 2 were conducted using varion cadg - hs ™ betaine amphoteric surfactant ( sherex chemical co . ltd .) alone and in a mixture 90 % varion cadg - hs / 10 % fluorad fc - 751 . in the presence of oil the varion cadg - hs normalized foam height was 0 . 13 ; the mixture cam height was 0 . 49 . the foaming experiments of example 2 were conducted using sterling aos ™ α - olefin sulfonate surfactant ( canada packers ltd .) alone and in a mixture 90 % sterling aos / 10 % fluorad fc - 751 . in the presence of oil the sterling aos normalized foam height was 0 . 13 ; the mixture foam height was 0 . 49 . the foaming experiments of example 2 were conducted using a sterling aos / dowfax 2a1 50 / 50 ( wt .) mixture . in the presence of oil the normalized foam height was 0 . 11 ; in a mixture 40 % sterling aos / 40 % dowfax 2a1 / 10 % fluorad fc - 751 , the normalized foam height was 0 . 33 . the foaming experiments of example 2 were conducted using reed lignin 254 - 4 ™ petroleum sulfonate surfactant alone and in a mixture 90 % reed lignin 254 - 4 / 10 % fluorad fc - 751 . in the presence of oil , the reed lignin 254 - 4 normalized foam height was 0 . 60 ; the mixture foam height was 2 . 95 . the foaming experiments of example 2 were conducted using varion cas sulfobetaine amphoteric surfactant ( sherex chemical co . ltd .) alone and in a mixture 90 % varion cas / 10 % fluorad fc - 751 . in the presence of oil , the varion cas normalized foam height was zero ; the mixture foam height was 0 . 60 . the foaming experiments of example 2 were conducted using empigen bt ™ carboxylate betaine amphoteric surfactant ( albright & amp ; wilson ) alone and in a mixture 90 % empigen bt / 10 % fluorad fc - 751 . in the presence of oil , the empigen bt normalized foam height was 0 . 18 ; the mixture foam height was 0 . 57 . empigen bt and fluorad fc - 751 was tested in low pressure ambient temperature corefloods in oil free cores and in cores containing oil from the judy creek field , beaverhill lake pool having a density of 0 . 8296 g / ml and a viscosity of 4 . 6 mpa . s at 23 . 0 °+/- 0 . 5 ° c . the porous medium used was a berea sandstone cut into 2 . 5 × 2 . 5 × 20 cm blocks that had been wrapped in fiberglass tape and cast in epoxy resin . the coreflooding apparatus is shown in fig1 . the cores were flooded with oil and then a 2 . 1 % total dissolved solid brine . residual oil saturation at this point s or ,= 28 % of pore volume . the cores were then flooded with a mixture of 96 % nitrogen + 4 % brine on a volume basis and the pressure drop across the core was recorded . volumetric flow rate was 19 ml / hr . surfactant was added at 0 . 5 wt . % to the brine and the pressure drop across the core was again recorded . the mobility reduction factor ( mrf ) was calculated as ## equ2 ## if no foam is generated within the core , the mrf will be equal to 1 ( one ). robust foams are represented by large mrf values . the results using various surfactant mixtures are shown in table 1 . the betaine hydrocarbon surfactant showed a severe sensitivity to the presence of residual oil ; mrf fell from 14 to 2 . however , the replacement of only 2 % of the hydrocarbon betaine with perfluoro surfactant restored the mrf to 10 in the presence of 28 % oil . these results are also shown graphically in fig2 . table i______________________________________mobility reduction factors for average 96 % foam at19 ml / h in berea sandstone corefloods at ambienttemperature and low pressuresurfactant surfactant mobility reduction factorsclass tested oil - free core core at s . sub . cr______________________________________amine oxide atlas cd - 413 17 3betaine empigen bt 14 2mixture of 98 % varion 12 10betaine with cas + perfluorobetaine 2 % fluorad fc - 751perfluorobetaine fluorad fc - 751 34 30______________________________________ a mixture of sulfonated anionic surfactants were evaluated in the same manner as example 9 , except that the core was held within a lead sleeve inside a high pressure steel coreholder . kaybob crude oil was used ( 40 degree api ) and pressure was maintained at 6 . 9 mpa within the core . the base hydrocarbon surfactant was a 50 / 50 mixture of dowfax 2a1 alkyldiphenyloxide sulfonate and sterling aos alfa olefin sulfonate anionic surfactants . this material will be designated blend a . core floods were conducted using blend a and various mixtures of blend a with fluorad fc - 751 perfluoro surfactant in the absence of residual oil and in the presence of residual oil . the results are given in table 2 and in fig2 . again a strong and unexpected synergism is demonstrated at low levels of perfluoro - surfactant addition . 10 % fluorad fc - 751 produces an mrf increase of almost threefold . table ii______________________________________mobility reduction factors at high pressure ( 6 . 9 mpa ) in the presence of residual oil______________________________________anionic 50 % dowfax 2a1 + 12blend a 50 % sterling aosblend a + 10 % 45 % dowfax 2a1 + 33perfluorobetaine 45 % sterling aos 10 % fluorad fc - 751blend a + 25 % 37 . 5 % dowfax 2a1 + 31perfluorobetaine 37 . 5 % sterling aos 25 % fluorad fc - 751blend a + 50 % 25 % dowfax 2a1 + 40perfluorobetaine 25 % sterling aos 50 % fluorad fc - 751______________________________________

US-54727890-A

a push nut and a male member are disclosed having cooperating buttress threads . the push nut is divided into sectors , each of which has multiple segments that comprise the nut &# 39 ; s thread . the adjacent edges of the successive sectors are connected to each other by a resilient corrugation arranged to distribute the stress equally between the ends of each thread segment and equally among the thread segments of each sector .

in fig1 a hollow fuse holder 10 is shown mounted on a panel 12 . a spacer 14 above the panel causes the top of the fuse holder to project prominently from panel 12 . spacer 14 may be omitted , and then head 10a of the fuse holder would bear directly against panel 12 . nut 16 is threaded onto fuse holder 10 , holding panel 12 tightly against spacer 14 and head 10a of the fuse holder . the holes through panel 12 and spacer 14 are slightly larger in diameter than the threaded portion 10c of the fuse holder . fuse holder 10 has projecting terminals 18 . it is generally hollow and thin - walled and made of molded plastic . parts 10 and 16 form a push - on fastener shown in some detail in fig2 - 5 . buttress threads are formed along a substantial length 10c of part 10 , so that nut 16 -- of much shorter length -- can be used either to grip both panel 12 and spacer 14 or ( omitting spacer 14 ) to grip panel 12 alone . the cross - section of the threads of part 10 have a shoulder that faces head 10a and is essentially perpendicular to the axis ; and the cross - section of the thread has a prominently slanted cam side opposite the thread &# 39 ; s shoulder . lines 10d and 10e in fig2 represent the relationship of the thread &# 39 ; s shoulder and cam side , respectively , to each other and to the axis of part 10 . as seen in fig3 and 4 , nut 16 is divided into four sectors 16a distributed around the passage which extends through the nut . each sector 16a has a series of thread segments 16b distributed along the axis of the nut ; the thread segments 16b of all the sectors 16a collectively form a female thread that mates with the male thread of part 10 . each thread segment 16b extends most of the way across its sector 16a . each sector 16a has opposite sides that are adjacent to sides of neighboring sectors 16a . the adjacent sides of two successive neighboring sectors 16a are connected to each other by a resilient corrugation 16c . thus , in the illustrated example there are four sectors 16a and four resilient corrugations that flexibly connect each sector 16a to the next . the cross - section of each corrugation is u - shaped . each corrugation is resilient , and it is of a form that can flex and expand so as to accommodate forcible displacement of sectors 16a outward , enlarging the passage through the nut . the extremities 16f of the corrugations ( the junctions of each resilient corrugation with the sides of adjoining sectors 16a ) become spread as thread segments 16b ratchet past threads 10c . the resilience of the flexible corrugations imposes a reverse constraint on the segments 16a . that reaction is distributed with essential uniformity along and among the series of thread segments 16b on each sector 16a . moreover , since the constraint of the resilient corrugations 16c acts on both sides of each sector 16a , the constraint acts equally on both ends of each thread segment 16b . the overall effect is that the entire complement of thread segments are all active alike , and from end to end , in performing their functions . this represents effective and efficient utilization of all the thread segments , and of the material that forms those thread segments . as will be seen , the described full - fledged participation of all the thread segments 16b enhances the resistance of the described fastener to disassembly forces without corresponding increase in the required push - on effort . the thread segments 16b are complementary to the male thread along portion 10c of part 10 . accordingly , shoulder 16d is approximately perpendicular to the thread &# 39 ; s axis , and cam side 16e of the female thread &# 39 ; s cross - section slants prominently to the nut &# 39 ; s axis . thread surfaces 16d and 16e in this example do not form a sharp intersection ; rather the thread has a blunted edge 16g . a sharp edge would add very little to the thrust resistance provided by the thread &# 39 ; s shoulder . the illustrative male thread on part 10 has an angle of 45 ° between its cam side 10e and its shoulder side 10d in this example . the same 45 ° angle ( represented by lines 16d &# 39 ; and 16e &# 39 ;, fig4 and 5 ) is provided between the shoulder and the slant or cam side of thread segments 16b . in addition , there is a wide space at the root of each thread ( male and female ) to accommodate the blunted extremity ( e . g . 16g ) of the mating thread . in forming the assembly of fig1 part 10 is inserted through spacer 14 and panel 12 ( or spacer 14 may be omitted ) and , while part 10 is held in place , nut 16 is pushed onto part 10 . as nut 16 moves over male threaded portion 10c , the thread segments 16b on each of the sectors 16a ratchet past the male threads . as thread segments 16b move from one convolution of the male thread to the next , sectors 16a are forced outward as cam sides 16e of the nut &# 39 ; s thread segments are pushed along cam sides 10e of the male thread . the resulting outward spreading of sectors 16a is accommodated by resilient corrugations 16c . ultimately nut 16 is pressed against panel 10 . the nut is then turned to tighten the assembly . in this operation , shoulders 10d and 16d of the threads abut each other . firm tightening is possible because shoulders 10d and 16d do not develop forces tending to spread sectors 16a so long as the tightening force does not distort the material and thereby force the transverse shoulders to tilt . the buttress thread form of the male and female threads as described , together with the resilient connection of sectors 16a to each other , imparts an easy - on , strong retention characteristic . however , the described nut has distinctive properties . the stresses ( and the reactions ) developed at the ends of any thread segment 16b are equal when an effort is made to pull part 10 out of the nut . also , the stresses and strains developed at each of the thread segments are essentially equal . this signifies that all the thread segments contribute alike to the retention of the nut , that none of the thread segments are being over - stressed while others are underutilized . the external shape of nut 16 provides for a good grasp . a wrench can grip nut 16 at flats 16h , and corrugations 16c provide a good hand grip , when the nut is forcibly turned . in the illustrative apparatus of fig1 part 10 is a hollow fuse holder made of a molded , plastic part , providing electrical insulation . threaded push nut 16 is also manufactured of a molded plastic . it is easily pushed into place and tightened , and easily unscrewed , yet it is capable of providing enormous resistance against being released unintentionally by random force against part 10 . unlike conventional push nuts of stamped sheet - metal , having spaced - apart teeth to grip a forcibly inserted part , the forces applied by nut 16 to part 10 are distributed almost uniformly , with no appreciable force that might distort tube 10 . in an example , the extent of thread segments 16b along the axis of nut 16 is 1 / 4 inch ; the diameter of nut 16 , measured to the thread &# 39 ; s root , is 1 / 2 inch ; thread segment 16b ( fig5 ) is 0 . 046 inch , peak to root , and its pitch is 0 . 0417 inch ; thread segments 16b extend around roughly 70 % of the nut &# 39 ; s inner circumference ; corrugation 16c has a groove 1 / 16 inch deep by 3 / 64 inch wide and a wall thickness of 0 . 024 inch at the end and at the sides ; and the minimum wall thickness of the nut ( halfway between corrugations 16c ) is 0 . 028 inch ; all these dimensions being subject tolerance deviations . in rough preliminary tests of a nylon push nut with these dimensions , the push - on force was four - to - five pounds and the pull - apart force was 60 pounds . of course , these values can be varied widely by changes in the kind of plastic used , in the nut &# 39 ; s several dimensions , in the number and form of corrugations 16c , and so on . the illustrative push nut , as well as the illustrative fastener that includes the male threaded part and the push nut , are subject to many modifications . thus ( as already noted ) the form of corrugations 16c can be varied , retaining the properties of resilient and flexible connections between adjoining sectors 16a . this and other changes will be apparent to those skilled in the art . consequently , the claims should be construed broadly in accordance with the spirit and scope of the invention .

US-15649088-A

a dynamic scattering liquid crystal cell can be filled from a single fill port by evacuating the cell , filling with a solution of an ionic dopant in a volatile solvent , evaporating the solvent and refilling under vacuum with the dynamic scattering liquid crystal composition . ion hang - up is avoided and only a single volume of the liquid crystal composition is required to fill the cell .

a typical liquid crystal cell is shown in the figure and comprises two glass plates 12 and 14 each coated with a thin , transparent , conductive layer 16 and 18 , respectively , as of tin oxide , which make up the electrodes . the electrodes can be patterned for digital or other display . a glass frit seal 20 extends around the periphery of the glass plates except for a single opening or port 22 . a layer of liquid crystal material 24 , typically about 0 . 5 micron thick , fills the space defined between the plates . according to the present process , the unfilled liquid crystal cell as above is placed in a vacuum chamber and the pressure reduced to the vapor pressure of the solvent for the dopant . the fill port of the cell is lowered into a reservoir of a solution in a volatile solvent of a dopant for the liquid crystal composition . a suitable solution comprises hexadecylpyridinium tetraphenyl borate in ethanol or isopropanol at a concentration of about 0 . 3 gram per liter . the cell , now filled with the dopant solution , is then placed in an oven at a temperature sufficiently high to evaporate the solvent , but not so high as to adversely affect the dopant . a temperature of about 85 °- 90 ° c . is generally suitable . when the solvent is evaporated , the cell is returned to the vacuum chamber , evacuated and immersed in the desired dynamic scattering liquid crystal composition . after the cell is filled , the fill port is closed in known manner . an effective sealing technique is disclosed in a copending application of horsting et al ., ser . no . 638 , 849 filed dec . 8 , 1975 . many ionic dopants for dynamic scattering liquid crystal compositions are known to those skilled in the art and the above example is merely illustrative . these dopants reduce the resistivity of liquid crystal compositions . generally , the resistivity in dynamic scattering liquid crystal cells should be in a range of about 1 × 10 8 to about 5 × 10 10 ohm - cm . various ionic dopants include , for example , ionizable organic salts such as bromides , borates , phosphates , quartenary ammonium halide salts , carboxylate or sulfamate salts , phosphonium salts and the like . suitable compounds include , for example , hexadecylamino ammonium bromide , 1 - hexadecyl pyridinium chloride , dodecylisoquinolinium bromide , dibenzyldimethyl ammonium chloride , 10 - methylacridinium bromide and the like ; organic carboxylate or sulfamate salts such as dioctadecyldimethyl - 2 - chloro - 3 , 5 - dinitrobenzene sulfamate and the like ; quarternary ammonium salts of carboxylic acids such as the tetrabutyl ammonium salt of p - aminobenzoic acid , the ammonium hydroxide salts of carboxylic acids such as benzyltrimethylammonium hydroxide and the like ; ammonium tetraborate compounds such as dioctadecyldimethyl ammonium tetraphenyl and the like ; p - toluenesulfonic acid ; phosphonium salts such as triphenylheptyl phosphonium bromide and the like ; and pyridinium tetraphenyl borate salts such as hexadecylpyridinium tetraphenyl borate and the like . the ionic dopants must be soluble in the liquid crystal composition employed and must ionize in solution in the presence of an electric field . various homeotropic aligning agents are also well known to those skilled in the art and include for example esters such as alkoxyphenylalkanoates , alkoxybenzoates and the like ; hydroxy - substituted esters such as p - hydroxybenzylidene - p &# 39 ;- aminophenyl acetate and the like ; phenols such as p - methoxybenzylidene - p &# 39 ;- aminophenol and the like ; long chain carboxylic acids such as p - octyloxybenzoic acid and the like ; long chain alcohols such as dodecanol and the like ; and long chain silanes such as dodecyltriethoxysilane and the like . the homeotropic aligning agents are generally added in amounts of from about 0 . 3 to about 2 . 0 % by weight of the liquid crystal material . the above process produces dynamic scattering liquid crystal cells of uniform appearance both in and out of operation . the predoping step saturates the surface of the glass plates with the dopants and prevents ion hang - up during the fill step . the liquid crystal composition remains uniform throughout the cell and is not depleted of dopants . the slight excess of dopant present in the cell can be compensated for if desired when making up the original liquid crystal composition . the present process uses a minimum of excess dopant and liquid crystal material and requires only a single fill port . the present process deposits a very thin , uniform layer of the dopant in the cell which can be readily redissolved by the liquid crystal composition without unwanted visual interference due to local thick precipitation of the dopant . the invention will be further described in the following example , but the invention is not meant to be limited to the details disclosed therein . an ethanol solution containing 0 . 3 gram per liter of hexadecylpyridinium tetraphenyl borate was prepared and charged to a vacuum chamber . a liquid crystal cell as in the figure , having a single fill port , was suspended in the chamber , fill port side down , above the solution . the chamber was evacuated and the fill port immersed in the solution to fill the cell . the cell was then dried in an oven at about 85 °- 90 ° c . until the solvent was evaporated , leaving a film of the dopant on the inside walls of the cell . a stock liquid crystal mixture was prepared by admixing 165 . 4 grams of p - methoxybenzylidene - p &# 39 ;- n - butylaniline , 105 grams of p - ethoxybenzylidene - p &# 39 ;- aminophenylbutyrate and 105 grams of p - butoxybenzylidene - p &# 39 ;- aminophenylhexanoate . this mixture had a mesomorphic temperature range of from - 26 ° to 87 ° c . a dopant solution was prepared by adding 100 milligrams of hexadecylpyridinium tetraphenyl borate to 20 grams of the above stock solution . the dopant solution was added dropwise to the remainder of the stock liquid crystal solution until the resistivity reached 2 × 10 8 ohm - cm . one percent by weight of p - methoxybenzylidene - p &# 39 ;- aminophenol was added as a homeotropic aligning agent . the cell as prepared above was again suspended in the vacuum chamber , this time above a reservoir of the doped stock solution . the chamber was evacuated and the cell fill port immersed in the liquid crystal solution to fill the cell .

US-74412876-A

a rotary valve adapted for use in utility scale fluidic systems improves over conventional valving schemes by affording reductions in weight , pressure drop , cost , and actuation time , as well as providing improvements in decompression performance , higher pressure capability , and longer operational life . one embodiment of a three way valve assembly utilizes electric actuation to adjust decompression in real time and facilitate port shaping . the valve assembly utilizes a pressure balanced rotor and seals to reduce actuation and bearing loads , as well as increase seal life .

described herein are various embodiments of a rotary logic valve usable in hydraulic , pneumatic , and other fluidic systems that accommodates various actuation techniques ( including non - hydraulic actuation ), and that includes a rotor that is pressure balanced irrespective of system operating pressure . in one embodiment , the valve may be electrically actuated , thereby requiring less actuation energy and enabling tailored actuation profile changes for adjusting decompression in real - time . the electric actuator may further contribute to design flexibility in port shaping and configuration of decompression actuation profiles independent of other parameters associated with the fluidic system . referring to fig1 , depicted is a schematic perspective view of an electrically actuated rotary valve , in accordance with one embodiment of the invention . in this particular embodiment , the valve assembly is a three - way , 100 mm full port rotary valve . the valve assembly includes a cylindrical housing 1 forming an interior chamber for receiving a valve rotor . the housing 1 includes a gearbox 14 , gearbox - to - valve adapter 27 , and servo motor 13 at the top end for electrically actuating the valve rotor and a rotary encoder at the bottom end . in one embodiment , the housing 1 is approximately 480 mm in diameter and 660 mm in height and the overall assembly is about 1060 mm in height and weighs approximately 630 kg . the housing 1 may be constructed of steel , cast iron , or any suitable material . the assembly includes upper and lower end caps 2 affixed to the cylindrical housing 1 with cap screws 18 , threaded rods and nuts , or any suitable fastening mechanism . the rotary valve includes two or more circular valve ports 30 having bolt flanges 17 . the ports 30 are arranged around the periphery of the housing 1 , with at least one of the ports 30 adapted to act as an inlet port for accepting liquids and / or gases . one or all of the valve ports 30 may act as inlet and / or outlet ports . although the valve is depicted as having a cylindrical body with three circular ports , it is to be appreciated that the housing may take any suitable form and size , and any number of ports of any suitable shape and size may be arranged in various positions on the housing while still accomplishing various objects of the invention . for example , the valve may include a four - walled , rectangular box housing with four square ports , one on each wall . in some embodiments , some of the ports are circular and have diameters in the range of about 50 mm to about 250 mm . in other embodiments , one or more ports are located on an upper and / or lower end cap 2 of the housing 1 . fig2 is a schematic side view of the rotary valve of fig1 aligned with one of the radial ports 30 and fig3 is a schematic longitudinal cross - section of the rotary valve taken along line a - a of fig2 . in the depicted embodiment , the rotor 4 is disposed within the interior chamber of the housing 1 and rotates about its longitudinal axis by means of the electric motor 13 and gearbox 14 . the rotor 4 has generally cylindrical upper and lower end portions , bounding a substantially spherical center portion 62 aligned with the valve ports 30 . the spherical portion 62 of the rotor 4 includes a flow passageway 40 adapted to block flow and also selectively to direct flow between housing ports 30 , for example from an inlet port to an outlet port , based on the circumferential orientation of the rotor 4 relative to the housing 1 . in one embodiment , the flow passageway 40 redirects the inlet flow through a 135 ° bend , to minimize flow losses and resultant pressure drop , while using a relatively small diameter rotor 4 . for example , fig4 is a schematic radial cross - section of the rotary valve assembly taken along line b - b of fig2 . as shown in this cross - section , there are three ports 30 formed in the housing 1 and the flow passageway 40 extending through the rotor 4 includes a 45 ° bend ( 135 ° from port a ) to accommodate the three valve ports 30 positioned at 0 ° ( port a ), 135 ° ( port b ), and 225 ° ( port c ) on the periphery of the cylindrical housing 1 . it is to be appreciated , however , that any number of ports 30 and any bend angle value for the flow passageway 40 may be accommodated to accommodate a particular application . for example , the bend angle may be selected in the range of 0 ° ( i . e ., no bend ) to 90 ° or more , if desired . if three coplanar ports are used and port a is fixed at 0 °, port b may be positioned in the range of less than 90 ° to 180 ° and port c in the range of 180 ° to 270 ° or more . in embodiments where the valve ports 30 are not coplanar ( e . g ., port a is disposed on an end cap 2 ), the flow passageway 40 may extend in any suitable dimension and angle to direct flow between the ports 30 . in the three port configuration , the motor 13 rotates the rotor 4 , such that the flow passageway 40 is aligned with one valve port , a pair of valve ports , or no valve ports ( i . e ., when the surface of the spherical portion of the rotor 4 is in sealing contact simultaneously with all of the valve ports 30 ). to maintain fluid pressure in the flow passing through the valve assembly and prevent leakage , the rotary valve assembly advantageously includes a sealing interface between the rotor 4 and the end caps 2 of the cylindrical housing 1 , such as a rotary seal 12 , which may be one or more standard rotary or o - ring seals disposed in grooves formed in the cylindrical end portions of the rotor 4 . when the rotor 4 is turned to pass pressurized fluid from an inlet port 30 through the flow path 40 in the rotor 4 to an outlet port 30 at a lower pressure , a violent ( uncontrolled ) decompression event may occur , depending on the factors such as the volumetric flow rate and the differential pressure between the high pressure source and the low pressure sink . due to the violence of the decompression , high velocity flows occur around sharp edges and the like within the rotary valve , potentially causing significant erosion over repeated valve opening and closing cycles . mechanical shaping of the rotor may be used advantageously to reduce the effects of erosion on the edges of the valve ports . for instance , the mouths of the ports ( i . e ., where the ports meet the spherical portion of the rotor 4 ) may be non - spherical or notched to gradually shape the decompression curve , avoiding erosion and dramatic pressure waves in the low pressure sink region . to further reduce erosion , an overlap may be included in the rotor and seal area . the valve ports 30 may have slightly oversized seals , thereby providing a sacrificial portion of the rotor 4 that can erode before the erosion extends beyond the seal line . this erosion may be significantly larger than that permitted in linear valves , on the order of 6 mm or greater . in addition , sharp edges in the rotor 4 may be hardened and / or coated with ceramic to provide additional protection against wear and premature seal leakage . to facilitate rotation of the rotor 4 , dual bearings 5 ( e . g ., taper roller bearings , spherical bearings , toroidal bearings , and the like ) may be positioned around trunnions extending from the longitudinal cylindrical end portions of the rotor 4 . in a traditional configuration of a rotary valve , the rotor bearings 5 have to withstand and react a radial force equal to the port pressure multiplied by the port area . for applications of the hydraulic valve assembly in a utility scale caes system , this force could easily be on the order of approximately 442 kn ( 44 tons ) or greater , necessitating a massive rotor and valve housing , along with extremely large bearings and exceedingly high actuation torques to rotate the rotor 4 . to obviate the substantial forces on the rotor 4 required to be reacted by the dual bearings 5 , the radial force on the rotor 4 at the inlet port can be counterbalanced by a pair of counter pressure zones on an opposite side of the rotor 4 , each with half the area of the inlet port , resulting in a substantially zero net force . it is to be appreciated , however , that the linear forces and torques on the rotor 4 need not result in a zero net force . instead , the balancing forces described herein may reduce forces on the rotor to levels that allow for reductions in the size of and strength of the motor and rotor bearings as well extend the operating life thereof . accordingly , references made herein to substantially zero net forces , total required balancing forces and the like contemplate these levels of forces . fig5 is a schematic free body diagram of such a pressure balanced rotor 4 in accordance with one embodiment of the invention . the counter pressure zones 95 may be positioned symmetrically above and below the inlet port pressure zone 98 , diametrically opposed from the inlet port pressure zone 98 . see pressure ports 35 in fig3 . pressurized fluid ( e . g ., hydraulic fluid ) from the inlet port 30 at the inlet port pressure zone 98 is plumbed to the opposing side of the housing 1 to the pressure ports 35 to provide counterbalancing radial forces against the rotor 4 to counteract most or substantially all of the radial force on the rotor 4 and bearings 5 from fluid / gas entering the inlet valve port 30 . depending on the configuration of the rotor , the housing and number of inlet / outlet ports , there are one or more countering pressure ports 35 to provide , alone or in combination , an interface for fluid to react the total required balancing force against the rotor 4 . the pressure ports 35 may be of various shapes and / or sizes and may be positioned at any point along the rotor 4 and / or at any angle to a valve port 30 in order to provide the desired counterbalancing force to the rotor 4 . accordingly , referring to fig6 and 7 , in an embodiment having three valve ports 30 a , 30 b , 30 c usable as inlet ports , the assembly may be adapted to apply rotor - balancing forces in three locations ( e . g ., three pairs of upper and lower pressure ports 35 a , 35 b , 35 c , each pair positioned opposite one of the three valve ports 30 a , 30 b , 30 c , respectively ). in other instances , the rotary valve assembly may be configured to apply balancing forces normal to the surface of the spherical portion 62 of the rotor 4 , axially to the cylindrical ends of the rotor 4 , axially to the trunnions of the rotor 4 , or at any other angle or position suitable for balancing the rotor 4 . to avoid leakage of fluid and / or gas to and from the valve ports 30 and pressure ports 35 , the valve assembly includes sealing components between the rotor 4 and the ports 30 , 35 , such as valve port seals 70 and countering pressure port seals 90 . more specifically , fig6 depicts a perspective view of the rotor and associated port seals 70 and pressure balance countering seals 90 in accordance with the three port embodiment of the invention , including schematic perspective and cross - sectional views of the port and countering seals 70 , 90 . fig7 is a schematic radial cross - section of the rotary valve taken along line c - c of fig2 through the plane of the lower pressure ports 35 a , 35 b , 35 c and associated countering seals 90 . fig8 depicts enlarged schematic partial cross - sectional views of one of the port seals 70 and one of the countering seals 90 installed in the valve of fig3 . the seals 70 , 90 and rotor 4 may be hardened to minimize wear due to rubbing and / or oil jet erosion . for example , the rotor 4 and the seals 70 , 90 may be coated with a layer of extremely hard tungsten carbide or ceramic , and the seals 70 , 90 may be laser - hardened or nitrided . to ensure a close tolerance fit between the hardened rotor 4 and the seals 70 , 90 , the seals can be match lapped to the rotor 4 . as the seals 70 , 90 and rotor 4 wear , they continue to mate against each other , providing a long - term reliable sealing effect . wave springs 8 , 11 react respectively against the seals 70 , 90 to provide a desirable preload to keep the seals 70 , 90 against the rotor 4 ; however , any appropriate means of biasing the seals 70 , 90 against the rotor 4 may be used . the seals 70 , 90 feature a pressure balanced configuration , that results in substantially zero net force from pressure inside or outside of the seals 70 , 90 . without such a pressure balanced design , the seals 70 , 90 would have a tendency to either be forced away from the rotor 4 and leak , or dig into the rotor 4 , locking the rotor 4 in place and accelerating component wear and failure . fig9 is a schematic free body diagram of one of the port seals 70 in accordance with one embodiment of the invention , illustrating the forces acting on the port seal 70 when there is high pressure within the valve port 30 and lower pressure external to the port 30 within the housing 1 . the port seal 70 is generally annular . because the annular sealing surface of the seal 70 is match fit to the spherical curvature of the rotor 4 , the pressure gradient across the seal 70 surface causes an imbalance in forces acting on the seal 70 . to resolve the imbalance , the port seal 70 is geometrically configured such that the seal 70 remains balanced irrespective of the pressure distribution , and the forces applied over the surface of the seal 70 result in a substantially net zero force . in the illustrated embodiment , the radial faces of the seal 70 are dimensioned and an o - ring 110 around the port seal 70 is sized and positioned so as to ensure opposing axial forces on the seal 70 are balanced , regardless of the differential pressure across the seal 70 . similarly , fig1 is a schematic free body diagram of one of the countering seals 90 in accordance with one embodiment of the invention . the countering seal 90 is generally cylindrical and may include one or more apertures extending from a rear face to a contoured face generally matching the contour of the proximate rotor portion . the apertures provide flow paths of the balancing fluid to the rotor surface . here again , the countering pressure port seal 90 is sized and configured to maintain a balanced distribution of forces acting on the seal 90 , regardless of whether the pressure within the countering pressure port 35 is higher or lower than the pressure in the housing 1 . as with the valve port seals 70 , the radial faces of the countering seal 90 are dimensioned and a sealing element , such as o - ring 120 around the counter seal 90 , is sized and positioned so as to ensure opposing axial forces on the seal 90 are balanced , regardless of the pressure differential across the seal 90 . in one embodiment , the rotary valve is electrically actuated via a dc electric motor 13 , a 7 : 1 ratio gearbox 14 , and a rotor adapter 27 subassembly . the subassembly may further include a flexible bellows coupler that connects the gearbox 14 output to the rotor 4 . the motor and gearbox are sized to provide fast actuation and long life . the electric actuator and / or a motor driver that controls the flow of power to the motor may also contain an energy storage device , such as a battery or capacitor . the energy storage device enables the valve to be actuated in the event of a power outage or other electrical interruption , and further allows for regenerative braking of the valve rotor 4 . this may reduce energy consumption by more than 50 % relative to that used by a typical resistance load , depending on actuation speed , friction , and other factors . in other embodiments , the rotary valve may include other actuation mechanisms , such as those relying on hydraulic , pneumatic , mechanical , electro - mechanical , or other systems . electric actuation is a reliable and commercially viable mode of actuation , when used in combination with the pressure balanced rotor valve described herein . heretofore unknown benefits can be realized . for example , electric actuation provides for greater control of valve actuation than traditional valves that use other actuation schemes or cost - prohibitive components . moreover , this method of actuation facilitates port shaping and configuration of the decompression actuation profile independent of other system parameters ( e . g ., in a hydraulic system , such parameters may include oil viscosity and pressure ). fig1 is a simulation of electric actuation for the electrically actuated valve depicted in fig1 . in accordance with one embodiment of the invention , the early portion of a valve actuation cycle may be shaped according to the needs of decompression , by applying a varying tailored amount of current to the motor according to any of a variety of selectable control schemes , allowing for a finely adjustable opening / closing of the valve . electric actuation further provides a method of counteracting flow path erosion and controlling pressure impulses due to decompression , based on the ability to dwell or tailor any of a variety of port open / close states in combination with sub - millisecond control resolution . electric actuation allows the rotary valve to be deterministically controlled , as opposed to hydraulically actuated valves and other valve designs that may behave unpredictably when the various ports experience different pressures . to this effect , the valve may include a rotary encoder 75 mounted to the lower end of the rotor 4 ( fig3 ) to track angular position and / or speed of the rotor 4 relative to the housing 1 . deterministic control of the valve refers to having knowledge of the position and the behavior of the valve in all states . accordingly , the ability to actuate the valve is not impacted by the state of the system . in contrast , in a hydraulic actuated valve , the ability to actuate the valve depends on various factors , including hydraulic fluid quality , viscosity ( temperature ), contamination , wear on the pilot surfaces in the actuation system , the pressure state of the system against which the valve is actuating , etc . in various embodiments , the rotary valve may operate in a switching mode , in which the ability to actuate the valve is maintained , regardless of the pressure differential across the valve ports 30 and independently of the operating state of the connected system . for example , in a caes system , the valve needs to actuate regardless of whether the cylinder of the caes system is in a compression mode or in an expansion mode . further , a minimum acceptable response time should be maintained irrespective of pressure and pressure differential . referring then to the three port valve embodiment depicted in fig1 - 17 , the valve may actuate to the following states : ( 1 ) connect high pressure ( hp ) port and cylinder ( c ) port ; ( 2 ) connect low pressure ( lp ) port and c port ; and ( 3 ) full shutoff . in some embodiments , the valve may be configured to allow open transition among all three hp , lc and c ports . fig1 - 15 illustrate exemplary actuation scenarios of the rotary valve as used in a caes system , including actuation to connect either the lp or hp port with the c port that is coupled to the caes hydraulic cylinder , in both expansion and compression modes . fig1 - 17 depict the valve transitioning to and from a lock state . exemplary relative pressures are provided for illustrative purposes and should not be considered limiting , but rather descriptive of one particular application . in addition to the switching ( actuation ) mode , the rotary valve may also operate in idle , emergency shutdown , and shutdown modes . in idle mode , a lock on the piston position is maintained at all times , irrespective of the power state of the actuator and any pressure acting on the valve ports . in emergency shutdown ( failsafe ) mode , the valve is able to shut all valve ports irrespective of the aforementioned conditions ; however , leakage during port shutoff may be permitted , such that any piston droop does not cause significant acceleration or velocity . in the shutdown mode , the position of the valve may advantageously be made available to the operator when the connected system ( hydraulic or otherwise ) is in a shutdown state . further , the valve should be able to be actuated when the system drivetrain and all other sources of hydraulic or non - hydraulic energy are shut down . in yet other embodiments , the rotary valve assembly includes valve ports 30 that are not aligned in a single plane , for example a radial plane perpendicular to the rotational axis of the rotor 4 . in these configurations , the flow passageway 40 in the rotor 4 is adapted to connect inlet and outlet valve ports 30 on various planes , and pressure ports 35 may be disposed at any suitable location to provide an interface for fluid to react the total required balancing force against the rotor 4 . when the flow passageway 40 is arcuate or curved , torque is induced in the rotor 4 by pressurized fluid entering the passageway 40 . if the valve ports 30 are aligned in the radial plane , the torque occurs around the rotational axis of the rotor 4 and the electric motor 13 may operate to react the flow - induced rotor torque . however , when valve ports are disposed outside that plane , torque is induced around other axes of the rotor , which may be reacted by a combination of the motor 13 and pressure balancing seals aligned to provide opposing forces at the desired pressure balance zones on the rotor 4 . for example , referring to fig1 a - b , one embodiment of the assembly includes one or more valve ports 30 disposed on an end cap 2 and entering the inner chamber of the housing 1 substantially parallel with the rotational axis of the rotor 4 . the valve port 30 on the end cap 2 penetrates the end of rotor 4 , and the opposing end of the rotor 4 may be used to accommodate a pressure zone and balance seal . the port and balance areas are eccentric with respect to the axis of rotation , thereby providing space for the concentric attachment of the electric actuator . to react the force 181 of fluid entering the flow passageway 40 of the rotor 4 , various configurations of counterbalancing pressure zones are possible . for example , in fig1 a , an axial counterbalancing force is applied to a pressure zone 185 on the end face of the rotor 4 directly opposing the inlet pressure port ; whereas , in fig1 b , the pressure zone 187 for applying an axial reacting force is located centrally on the end of the rotor 4 . other forces may also be applied in various magnitudes to pressure zones on various surfaces of the rotor 4 to react torque induced by the entering fluid and / or offset pressure zones . referring now to fig1 c - d , another embodiment of the assembly includes one or more valve ports 30 not parallel with the rotational axis of the rotor 4 . in fig1 c , the force 191 applied to the rotor 4 by fluid entering the passageway 40 is met by a counterbalancing force 193 applied to the spherical portion of the rotor 4 and diametrically opposed to the valve inlet port . in fig1 d , the reaction forces are instead divided into axial and perpendicular component force directions . the perpendicular force 197 is reacted on the cylindrical face of the rotor 4 , whereas the axial force 199 is reacted on the end face of the rotor 4 . depending on the out - of - plane angle , balancing for the inlet valve port may not be necessary , as each individual force may be reduced by up to 30 % ( e . g ., for a 45 ° out - of - plane port ) and can be accommodated by the bearings and / or the capacity of the electric actuator . balancing may occur for none , one , two , or more of component force directions depending on the ability of the rotor bearings to react the load . for example , thrust bearings may have a higher load carrying capacity , and therefore forces parallel to the axis of rotation may not need to be balanced . conversely , at high out - of - plane angles the force perpendicular to the axis of rotation may become small enough to not require balancing , while the force parallel to the axis of rotation could be balanced . in either case , the balancing of the out - of - plane port is an optimization problem , with the out - of - plane angle at the core of the optimization . in some embodiments , the rotary valve operates in a pressure range of 0 to 600 bar , and is able to operate continuously at maximum pressures in the range of 420 to 600 bar . the valve may support flow rates of 2500 to 60 , 000 liters per minute when operating on slurry , water or other fluids , and may support a flow rate of up to 225 , 000 liters per minute when operating on air or other gases . the valve may have a pressure drop of less than 0 . 25 bar and operate in a temperature range of − 30 ° to 70 ° c . ( ambient ) and − 30 ° to 120 ° ( media ); however , the temperature ranges may be significantly higher depending on the construction and materials used . the valve may actuate from 10 % to 90 % open in less than 75 ms with less than 1 ms resolution . further , the valve may generate torque ranging from 100 to 3000 n - m . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . various aspects and features of the various embodiments of the invention may be used in various combinations and permutations and all such variants are considered to be within the scope of the invention .

US-201213626659-A

disclosed are apparatus for a block and tackle window balance including a terminal clip to be incorporated in single and double hung window assemblies . in one embodiment the terminal clip includes a first end portion defining an opening for passing a terminal end of a cord therethrough , a second end portion disposed remotely from the first end portion , and an intermediate portion including a hook and extending between the first and second end portions .

referring to fig1 shown is a double hung window assembly 100 in which a block and tackle window balance including a terminal clip constructed in accordance with the teachings of the present invention can be used . the double hung window assembly 100 includes a window frame 102 , a lower window sash 104 , an upper window sash 106 , and a pair of window jambs 107 . within each window jamb 107 , jamb pockets 108 are defined . the lower window sash 104 and upper window sash 106 slide vertically within the jamb pockets 108 . generally , window balances are attached to the lower and upper window sashes 104 , 106 to balance the weight of the window sashes at any vertical position within the jamb pockets 108 . [ 0034 ] fig2 a , 2b , and 3 show perspective views of a block and tackle window balance 200 including a prior art terminal clip 245 . fig2 a shows the block and tackle window balance 200 in full , whereas fig2 b shows the block and tackle window balance 200 with one side wall of a rigid u - shaped channel 205 cut away so that components within the window balance 200 are more visible . fig3 shows a rear view of the window balance 200 . the block and tackle window balance 200 includes a spring 220 , a translatable pulley unit 230 , a fixed pulley unit 235 , a roller 239 , and a cord 240 all housed with the rigid u - shaped channel 205 . attached to the two ends of the rigid u - shaped channel 205 with fasteners 212 , 216 are a top guide 210 and a bottom guide 215 that are used to connect the window balance 200 to either the upper or lower window sashes 104 , 106 and to help guide the vertical motion of the window balance 200 within the jamb pockets 108 . the bottom guide 215 includes a back portion 213 , best seen in fig3 that encases a portion of the rigid u - shaped channel 205 . within the back portion 213 of the bottom guide 215 is a channel 214 sized to receive a portion of a window sash . the rigid u - shaped channel 205 has a back wall 206 and two side walls 207 , 208 that in combination form the u - shape . the rigid u - shaped channel 205 serves as an external frame to which the components of the window balance 200 can be secured . the rigid u - shaped channel 205 also keeps components located within the rigid u - shaped channel 205 free of debris and particulate matter . the spring 220 , the translatable pulley unit 230 , the fixed pulley unit 235 , and the roller 239 are located inside the rigid u - shaped channel 205 . both of the translatable pulley unit 230 and the fixed pulley unit 235 include one or more pulleys rotatable around respective axles . components within the rigid u - shaped channel 205 work in combination to create a force to counterbalance the weight of the attached sash at any vertical position within the window frame 102 . these components are attached to each other such that a first end 219 of the spring 220 is connected to the translatable pulley unit 230 , and the translatable pulley unit 230 is connected to the fixed pulley unit 235 and the roller 239 via the cord 240 . a pulley in the fixed pulley unit 235 and the roller 239 may be contained in a frame 236 . to secure the components within the rigid u - shaped channel 205 , the second end 221 of the spring 220 and the frame 236 are fixed to opposite ends of the rigid u - shaped channel 205 via respective fasteners 218 , 243 . the frame 236 is also used to secure a pulley axle 237 and a roller axle 238 , around which the pulley in the fixed pulley unit 235 and the roller 239 respectively rotate . the spring 220 and the translatable pulley unit 230 are connected together by hooking the first end 219 of the spring 220 through an upper slot opening 229 in a frame 225 . the frame 225 houses the translatable pulley unit 230 and a pulley axle 232 around which a pulley in the translatable pulley unit 230 rotates . the cord 240 , which can be a rope , string , or cable , has a first end 241 and a second end 242 . the first end 241 of the cord 240 is secured to the frame 225 and the second end 242 , which is a free cord end , is threaded through the translatable pulley unit 230 , the fixed pulley unit 235 , and the roller 239 , thereby connecting all three components together . after the cord 240 connects the three components together , the prior art terminal clip 245 is secured to the second end ( terminal end ) 242 of the cord 240 . when the block and tackle window balance 200 is located in the jamb pocket 108 , the prior art terminal clip 245 engages an aperture 430 ( fig4 a ) and the second end 242 sits within aperture 435 of one of the jamb pockets 108 . once installed within the window assembly , the block and tackle window balance 200 is connected to both the window jamb 107 and to either the lower window sash 104 or the upper window sash 106 . referring to fig4 a , the block and tackle window balance 200 is attached to the window jamb 107 via the prior art terminal clip 245 . the prior art terminal clip 245 is secured within aperture 430 within the jamb pocket 108 , as shown in fig4 b . the second end 242 of the cord 240 which is knotted fits within aperture 435 such that the prior art terminal clip 245 is substantially flush with the window jamb 107 . one example of the prior art terminal clip 245 including cord 240 has a thickness of about 0 . 120 inches to about 0 . 140 inches in a direction labeled w , 500 from the window jamb 107 . the block and tackle window balance 200 is then connected to a window sash by inserting a portion of the window sash into the channel 314 of the bottom guide 315 and connecting the top of the window sash to the top guide 310 . fig5 a - 5 d and 6 a - 6 d show embodiments of terminal clips 345 , 445 in accordance with the teachings of the present invention . terminal clips 345 , 445 transfer force from a cord of a block and tackle window balance to a window jamb to hold up a window sash , while protecting the cord from cutting and abrasion during operation of the block and tackle window balance . referring to fig5 a the terminal clip 345 includes a first end portion 350 , a second end portion 360 , and an intermediate portion 365 . the first end portion 350 defines an opening 352 for passing a second ( terminal ) end 342 of a cord 340 through , as shown in fig6 a . to secure the cord 340 to the terminal clip 345 , the second end 342 is knotted proximate to opening 352 above intermediate portion 365 . the terminal clip 345 may be made of unitary construction , for example , cut and formed from a single piece of material . in some embodiments , the terminal clip 345 is formed from stainless steel . the cord 340 may be further secured to the terminal clip 345 by including additional openings in the second end portion 360 . for example , as shown in fig5 b and 6b , the second end portion 360 includes an opening 370 for the cord 340 to pass through prior to being knotted proximate to opening 352 above the intermediate portion 365 . as depicted in fig6 b , the cord 340 extends longitudinally from the first end portion 350 to and beyond the second end portion 360 . in another embodiment of the terminal clip 345 , shown in fig5 c and 6c , the second end portion 360 includes two openings 370 , 374 for the cord to pass through and a bend 372 that protects the cord from being cut or frayed by components of the block and tackle window balance 300 , such as , for example the spring 320 . when the cord 340 passes through opening 370 , 374 and 352 , the cord extends longitudinally from the first end portion 350 to and beyond the second end portion 360 . [ 0041 ] fig5 d and 6d show another embodiment of a terminal clip 445 in accordance with the teachings of the present invention . terminal clip 445 includes a first end 460 and a hooked end 465 . the hooked end defines an opening 467 for the cord 340 to pass through . the second end 342 of the cord is knotted after passing through opening 467 to secure the cord 340 to the terminal clip 445 . the first end 460 of the terminal clip 445 can include one or more openings 470 for the cord to pass through prior to being knotted above opening 467 . in addition , the first end 460 may include a bend ( not shown ) similar to bend 372 of terminal clip 345 shown in fig5 c and 6c . as shown in fig7 and 8 , a block and tackle window balance 300 in accordance with the teachings of the present invention includes a rigid u - shaped channel 305 , a top guide 310 , a bottom guide 315 , a spring 320 , a translatable pulley unit 330 , a fixed pulley unit 335 , a roller 339 , the cord 340 , and one terminal clip 345 , 445 . ( fig7 includes terminal clip 345 , whereas fig8 includes terminal clip 445 ). the top guide 310 and the bottom guide 315 are fixed to the rigid u - shaped channel 305 by fasteners 312 , 316 . the top guide 310 is used to help connect the block and tackle window balance 300 to the window sash 104 , 106 and to help guide the movement of the block and tackle window balance 300 within the jamb pocket 108 . the bottom guide 315 is also used for connection and guidance purposes . a back portion 313 of the bottom guide 315 may include a channel 314 for receiving a portion of the window sash , as depicted in fig9 . to install the block and tackle window balance 300 within a window frame 102 , the terminal clip 345 , 445 is attached to the window jamb 107 . the intermediate portion 365 or the hooked portion 465 is inserted and secured within aperture 430 of the window jamb 107 , as depicted in fig9 and 10 . because the second end 342 of the cord 340 forms a knot above the intermediate portion 365 ( or the hooked portion 465 ) the second end 342 of the cord 340 is also inserted into aperture 430 . accordingly , there is no need for a second separate opening to be formed within window jamb 107 . thus , one of the advantages of terminal clips 345 , 445 of the present invention over prior art terminal clips 245 is that the window frame 102 requires less processing because both the intermediate portion 365 ( or hooked portion 465 ) and the knotted second end 342 fit within aperture 430 . as such , a manufacturer of the window frame 102 needs to cut only one aperture 430 in the windowjamb 107 instead of two apertures 430 , 435 as required by the prior art terminal clip 245 shown in fig4 b . the additional aperture 435 may cause additional air infiltration and may lead to weakening the window frame 102 . thus , it is advantageous to have fewer apertures cut within the window jamb 107 . another advantage of the terminal clips 345 , 445 is cord 340 protection during operation of the block and tackle window balance 300 . if a cord and / or a terminal clip of a block and tackle window balance extends too great a distance ( e . g ., beyond about 0 . 120 inches ) in the direction labeled w , 500 shown in fig9 from the window jamb 107 , the cord may be cut or damaged by the components within the block and tackle window balance . additionally , a terminal clip that extends out further than about 0 . 120 inches , for example , in the w direction , 500 may interfere with the vertical motion of the block and tackle window balance within jamb pockets 108 . typically , prior art terminal clips 245 have a thickness of about 0 . 120 inches to about 0 . 140 inches in the w direction , 500 . also , due to the connection between the prior art terminal clips 245 and the cord 240 , the highest projection point in the w - direction , 500 is the cord 240 , as shown in fig4 b . thus , prior art terminal clips 245 expose the cord 240 to possible damage by the block and tackle window balance 200 . alternatively , terminal clips 345 , 445 constructed in accordance to the teachings of the present invention are designed such that the maximum thickness in the w - direction , 500 is about 0 . 100 inches , thereby preventing both the cord 340 and the terminal clip 345 , 445 from interfering during operation of the block and tackle window balance 300 . to provide additional cord 340 protection , the terminal clips 345 , 445 may include a bend 372 , as shown in fig1 , that projects out a greater distance in the w - direction 500 than the cord 340 . as such , the bend 372 defines an uppermost extent of the terminal clip 345 and shields the cord 340 from being cut or frayed during operation of the block and tackle window balance 300 . variations , modifications , and other implementations of what is described herein will occur to those of ordinary skill in the art without departing from the spirit and the scope of the invention as claimed . accordingly , the invention is to be defined not by the preceding illustrative description but instead by the spirit and scope of the following claims .

US-22689302-A

an electronic faucet has a housing adapted to seat against a support surface and defining an internal barrel having a bottom wall , a side wall and an open top . there is at least one fluid inlet extending through the bottom wall into the barrel , a fluid outlet in the side wall of the barrel , and a valve cartridge seated in the barrel . the cartridge includes a main valve for controlling fluid flow between the at least one inlet and the outlet , a pilot valve and a solenoid operator for opening and closing the pilot valve . a faucet head removably mounted to the housing covers the open top of the barrel , the faucet head including an activator which produces an output signal of a selected duration when approached by a user , and a control circuit which responds to the signal by activating the solenoid operator so as to open the pilot valve which thereupon opens the main valve . the valve cartridge is removable from the barrel while the housing remains seated against the support surface by separating the faucet head from the housing .

referring to fig1 the subject faucet 10 is shown mounted to countertop 12 . the faucet includes a housing or encasement 14 having a more or less semicircular flange 14 a at its lower end . fasteners 16 inserted through holes 18 in countertop 12 are threaded into holes 22 in flange 14 a to secure the faucet to the countertop . faucet 10 also includes flexible hot and cold water lines 24 a and 24 b which extend from the lower end of housing 14 through a large opening 26 in countertop 12 . these water lines adapted to be coupled to hot and cold water mains . as shown in fig1 and 2 , the faucet housing 14 actually consists of a shell - like part 32 forms an upright main body portion 32 a ( including flanges 14 a ) and the upper portion 32 b of a spout extending out from the main body portion 32 a . the open front of main body portion 32 a and the underside of the spout portion 32 b are normally closed by a removable cover plate 36 clipped or otherwise secured to the edges of portions 34 a and 34 b . faucet 10 also has a stationary head or up 38 mounted to the top of housing 14 . head 38 incorporates a touch sensor shown generally at 42 which , when touched , activates faucet 10 so that a stream of tempered water issues from an outlet 44 centered in an opening 46 provided in the cover plate 36 near the end of spout 34 . as best seen in fig2 the upper end segment of the main body portion 32 a has a thickened internally threaded wall forming a circular ledge 46 which functions as a stop for a cylindrical cartridge shown generally at 48 . cartridge 48 includes a side wall 52 a , a bottom wall 52 b , the top of the cartridge being open . a circular flange 54 extends out from side wall 52 a and that flange is adapted to seat against ledge 46 . the cartridge is held in place within the shell portion 32 a by a bushing 56 which is screwed down into the open top of main body portion 32 a . an opening 58 is provided in the side wall 52 a of cartridge 48 and an exterior collar 62 surrounds that opening into which is press fit one end of a conduit 64 which extends within the upper spout portion 32 b . the other end of that conduit constitutes the faucet outlet 44 . preferably , there is sufficient clearance between the outlet 44 and the edge of opening 46 in the cover plate 36 to permit a conventional aerator ( not shown ) to be installed at outlet 44 . referring to fig2 and 3 , cartridge 48 includes a pair of side by side inlet conduits 72 a and 72 b which extend down from the cartridge bottom wall 52 b . formed midway along each such conduit is an annular valve seat 74 for seating vertically moveable valve member 76 . each valve member is biased against its seat by a coil spring 78 seated within a sleeve 82 extending up from a cartridge bottom wall 52 b within the cartridge . each spring 78 is compressed between the upper end of the corresponding valve member 76 and a stop 82 a provided at the upper end of each sleeve 82 . the lower end segment of the cartridge conduit 72 a forms a female connector 84 which is arranged to receive a corresponding male connector 86 provided at the upper end of the water line 24 a . the illustrated connector 86 is a conventional quick release connector which is held in place by a c - clip 88 whose arms extend through slots 92 in the opposite sides of connector 84 and engage in a groove 86 a in male connector 86 . the cold water line 24 b is connected in a similar fashion to conduit 72 b of cartridge 48 . it is thus apparent from fig3 that each of the hot and cold water lines 24 a , 24 b conducts water into cartridge 48 via a check valve so that water can flow into , but not out of , cartridge 48 via conduits 72 a and 72 b . the cartridge 48 contains an electromechanical valve assembly shown generally at 96 which controls the flow of hot and cold water from lines 24 a and 24 b to the faucet outlet 44 . as shown in fig2 to 4 , assembly 96 sits on the two sleeves 82 projecting up from the cartridge bottom wall 52 b . as specified in fig4 the valve assembly 96 comprises lower filter housing shown generally at 98 , an upper valve housing in 102 , the two housings being releasably connected together by coupling 104 . the housing 98 is shaped generally like an inverted cup . it has a side wall 106 and a top wall 106 b . the open bottom of the housing is substantially closed by a circular metering plate 108 which is the part of the valve assembly that actually sits on the sleeves 82 extending up from the cartridge bottom wall 52 a . the metering plate 108 does have metering holes 110 which are aligned with sleeves 82 so that hot and cold water is conducted via those holes from the water lines 24 a and 24 b to the interior of housing 98 . as shown in fig4 housing 98 contains a vertically oriented filter element 112 whose opposite ends are captured by an upstanding wall 114 formed in plate 108 and a second wall 116 which extend down from the housing top wall 106 b . there is also an opening 118 near the housing top wall 106 b that is ?? to limitation with the interior of the tubular neck 122 extending up around the housing top wall 106 b . the interior of housing 98 is configured so that hot and cold water entering the housing is conducted to the periphery of the filter element 112 whereupon the water flows into the interior of the filter element and out of the filter element through the large opening 118 and neck 122 . the flow rates of the hot and cold water into the housing is controlled by the relative sizes of the metering holes 110 and the metering plate 108 . the hot and cold water are mixed within housing 98 so that the water leaving the housing through the neck 122 has a selected temperature . that temperature may be changed by substituting different meter in plates 108 in the valve assembly . sown in fig4 the upper end of neck 122 is shaped leftwardly extending circular valve seat 124 . when housing 98 is connection to housing 102 by coupling 104 , a valve member 126 in the form of a diaphragm is adapted to move and down with respect to valve seat 124 to control the flow of water out of the neck 122 . a valve member 126 is supported within the valve housing 102 as we will describe in further detail presently . still referring to fig4 the upper valve housing 102 has a cylindrical side wall 102 a and a relatively thick bottom wall 102 b the top of the housing being open . a flange 104 encircles side wall 102 a about a third of the way down on that wall . also an upper end segment of the side wall is threaded as shown at 106 . housing 102 is arranged to contain a cylinder solenoid 110 having a exterially threaded neck 110 a which is threaded into a collar 112 which extends up from the housing bottom wall 102 b . solenoid 110 has an armature 120 b which extends down through the housing bottom wall 102 b and is connected to the valve member 126 which is part of a more or less conventional pilot valve assembly , e . g . of the type described in u . s . pat . no . 5 , 125 , 621 , the contents of which is hereby incorporated herein by references . when solenoid 110 is energized , its armature 110 b is retracted thereby moving the valve member 126 away from valve seat 124 allowing water to flow from the filter housing 98 past the valve seat to the opening 58 ( fig3 ) in cartridge 48 and thence via conduit 64 to the faucet outlet 44 shown in fig2 . on the other hand , when the valve member 126 is seated against valve seat 124 , no water flows from the faucet . as shown in fig2 the valve assembly 96 is positioned in cartridge 48 so that the meter in plate 108 sits on the sleeves 82 with the metering holes 110 in that plate is aligned with those sleeves . in this position of the cartridge , the flange 104 of the valve housing 102 seats on the upper edge of the cartridge . to retain the valve assembly in this position , an exterially threaded bushing 180 is screwed down into the upper end segment of the main body portion 32 of housing 32 . bushing 180 has a radially inwardly extending flange 180 a which bears down against the flange 104 of the valve housing 102 to hold the valve assembly in place within the cartridge 48 . as shown in fig2 when seated , the upper end of bushing 108 is flush with the upper end of the housing main body portion 32 a and the threaded upper end 106 of the valve housing 102 extends appreciably above the bushing . referring now to fig2 and 5 , the faucet head or cap 38 is secured to the upper end of the valve housing 32 . head 38 comprises a lower housing portion 184 comprising a bottom wall 184 a and a side wall 184 b which flares out and up above the faucet spout 34 . a large hole 186 is provided in bottom wall 184 a so that the housing portion 184 can be seated on the top of the main body portion 32 a and bushing 180 . a collar 108 surrounding opening 186 extends down between the side wall 102 a of valve housing 102 and bushing 108 with the bottom of that collar resting on the flange 180 a to help stabilize head 38 . the housing portion 184 b is held in place by an internally threaded ring 192 which is turned down onto the threaded upper end 106 of the valve assembly housing 102 a . faucet head 38 also includes an upper housing portion 194 in the form of a cap . portion 194 includes a top wall 194 a and an all - around side wall 194 b whose lower edge interfits with the upper edge of housing portion 184 so that the head form a hollow enclosure . housing portion 194 is releasably secured to housing portion 84 by a set screw 196 which is screwed into a threaded hole 198 in the housing portion side wall 194 b at the rear of the faucet . when tightened , the set screw 196 engages a detent 202 formed at the rear of the housing portion 184 as shown in fig2 . as noted above , the faucet head 38 contains the electrical components necessary to operate the faucet &# 39 ; s valve assembly 96 . more particularly , as shown in fig2 and 5 , a printed circuit board 206 is secured by threaded fasteners 208 to a pair of posts 210 extending down from the top wall 194 a of the upper housing section 194 . secured to the underside of the printed circuit board 206 is a battery holder 212 which supports a plurality of batteries b and electrically connects those batteries to terminals on the printed circuit board 206 so as to power the various electrical components on the printed circuit board to be described later . the batteries b may be releasably secured to the battery holder 212 by a strap 214 or other suitable means . as best seen in fig2 an electrically lead 216 extends up from circuit board 206 to a metal pad 218 incorporated into a top wall 194 a of the upper housing section 194 . pad 218 is surrounded by an electrically insulating ring 222 which electrically isolates the pad from the remainder of top wall 194 a . that pad 218 constitutes the faucet &# 39 ; s touch sensor 42 described at the outset . it will be apparent from fig2 that all of the electrical components in head 38 may be accessed simply by loosening the set screw 196 and separating the upper housing 194 from section 184 . referring now to fig6 which shows the major electrical components on printed circuit board 206 which control the operation of faucet 10 . as shown there , a microcontroller 332 operates a driver 334 which powers the solenoid 110 of the valve assembly 96 . in some faucet embodiments , the microcontroller 332 may also receive an input from an object sensor 336 which is part of a proximity transceiver 338 mounted to the faucet spout cover plate 336 just above opening 46 therein as shown in phantom in fig1 . transceiver 338 may be of a known infrared type commonly found on automatic faucets and consisting of a light emitting diode which directs a beam of infrared light downward from the spout , and an infrared sensor which detects light reflected from a hand or other object positioned under the faucet spout . the circuit in fig6 also includes a d - type flip - flop 242 whose d input receives pulses from microcontroller 332 by way of a resistor 344 . that d input of the flip - flop is also connected via a capacitor 346 to the metal pad 218 comprising touch sensor 242 . the q output of a d - type flip - flop is the value that it &# 39 ; s d input had at the time of the last leading edge of a pulse train applied to the flip - flops &# 39 ; clock ( clk ) input terminal . normally , when a user has placed his hand or finger in the vicinity of the touch sensor 42 , the q output of flip - flop 342 remains asserted continuously for the following reasons . the microcontroller 332 produces a rectangular - wave clock signal which is applied via resistor 334 to the d input terminal of flip - flop 342 . that same signal is applied to a resistor 348 and an inverter 352 to the clk input terminal of flip - flop 342 . however there is a delay in the transmission of that pulse from microcontroller 332 to the clk input terminal of flip - flop 342 because of the presence of a plurality of capacitors 354 a to 354 e which capacitively load the input circuit of converter 352 as will be described in more detail below . the value at the d input port of flip - flop 342 therefor stabilizes at the higher level before the rising leading edge of the clock pulses from inverter 352 reach the flip - flop &# 39 ; s clk input terminal . therefore , the q output of the flip - flop is high . however this situation changes when a user &# 39 ; s hand is very close to the touch sensor 42 or actually touches it . this hand contact or proximity has the effect of capacitively loading the d input terminal of flip - flop 342 ; it may typically result in a capacitance on the order of 300 pf between sensor 42 and ground . the inverter input is also connected via a diode 356 and a resistor 358 to the d input terminal of flip - flop 342 . this imposes a delay at the d input 342 of flip flop affecting the pulse level to the extent that the edge of the clock signal applied to the clock input of the flip - flop now occurs before the d input has reached the high level . therefore , the flip - flip &# 39 ; s q output remains low . the microcontroller receives the compliment of that q output at its input 362 and thereby infers that a user has touched the sensor 42 . however , various environmental factors can also load the touch sensor 42 . therefore , in a preferred embodiment of the invention , the micorcontroller 332 so adjusts the circuit &# 39 ; s sensitivity as to minimize the likelihood of erroneous human - contact indications . as does this by employing lines 364 a to 364 e to ground selected one of the capacitors 354 a to 354 e , while allowing the others to float . by selectively grounding these capacitors , the microcontroller can choose among 16 different sensitivity levels . as will be seen presently , this sensitivity adjustment is done dynamically to account for changing environmental conditions or a user &# 39 ; s nervousness or hesitancy for being considered as multiple inputs to the faucet &# 39 ; s touch sensing circuitry . the microconrtoller 332 monitors the output of flip - flop 342 and changes the sensitivity level of the sensing circuit according to an adapting or dynamic sensing algorithm to be discussed in connection with fig7 . the microcontroller 332 operates , as many battery - operated do , in a sleep / wake sequence . most of the time , the controller is “ asleep ”: it receives only enough power to maintain the state of certain volatile registers , but it is not being clocked or executing instructions . this sleep state is interrupted periodically , say , every 120 ms , with a “ wake ” state , in which it executes various subroutines before returning to its sleep state . the duration of the wake state is typically a very small fraction of the controller &# 39 ; s sleep state duration . one of the routines performed by the microcontroller 332 when it awakens is the sensitivity adjustment routine depicted in the fig7 flow chart . in fig7 block 400 represents the start of that routine and block 402 represents sampling the value of the signal applied to the microcontroller sense input 362 shown in fig6 . if because of the operation just described , that input &# 39 ; s level indicates that a user is touching the touch sensor 42 , the controller sets to zero a non - touch timer representing how long it has been since the faucet detected a person &# 39 ; s touch at touch sensor 42 . blocks 404 and 406 represent this subroutine . as will be explained presently , the non - touch timer is used to determine when to make a sensitivity adjustment . although a touch detection is usually the basis for causing the faucet valve to open , the system is sometimes in a mode in which it is used instead to determine when to adjust sensitivity . block 408 represents reading a flag to determine whether a sensitivity adjustment or a touch cycle is currently in progress . if it is not , the routine proceeds to increment a touch timer if that timer has not already reached a maximum value . blocks 410 and 412 represent that incrementing operation . the touch timer indicates how long a touch detection has been reported more or less continuously . as will be seen presently , an excessive touch duration will cause the system to infer that the touch detection resulted from something other than a human user and that the system &# 39 ; s sensitivity should therefore be reduced to avoid such erroneous detections . before the system test that duration for that purpose , however , it first performs a de - bounce operation , represented by blocks 414 and 416 , in which it determines whether the number of successive touch detections exceeds three . if it has , then at block 418 , the system resets the touch count to zero and sets a flag that will tell other routines , not discussed here , to open the valve . if these three detections have not occurred in a row , on the other hand , the system does not yet consider the touch valid and that flag is not set . the system then performs a test , represented by block 420 to determine whether it should reduce the system &# 39 ; s sensitivity . if the touch timer represents a duration less than seconds , the routine simply ends at block 421 . otherwise , it resets the flag that would otherwise cause other routines to open the valve . it also sets a flag to indicate that the system is in its sensitivity or adjustment mode and causes a decrease in sensitivity by one step . that is , it so changes the combination of capacitors 354 a to 354 e in the circuit of fig6 that are connected to ground that the signal applied to the clk input of flip - flop 342 is increased . resultantly , a greater loading of the touch sensor 42 will be required for the flip - flop 342 to indicate that a touch has occurred . block 422 represents taking those actions . it may occur in some situations that the sensitivity was already as low as it could go . if that happens , the system is in an error condition , and subsequent circuitry should take appropriate action . this is determined at block 424 . if it has , then the routine sets an error flag as indicated at block 426 and the routine ends at block 421 . if the system is not in that error condition , the routine performs the steps at blocks 406 and 408 as before . this time , however , the sensitivity - adjustment flag is set so that the test at block 408 results in the routines jumping to the step at block 422 to repeat the sensitivity - reduction sequence just described . referring to the right hand side of fig7 if the block 404 step yields an indication that no touch has been detected by the touch sensor 42 , the routine resets the touch counter to zero as indicated at block 432 . as was described previously , an extended period of touch detection will cause the system to reduce its sensitivity , on the theory that detection for so long a period could not have been the result of a legitimate human contact . if contact absence has been indicated for an extended period , on the other hand , it is logical to conclude that the current capacitive loading provided by capacitors 354 a to 354 e ( fig6 ) is consistent with contact absence but that any greater capacitance is likely to be an indication of legitimate contact of the touch sensor 42 . the system therefore responds to an extended period of detection absence by increasing the sensitivity to a value just below one that would cause touch detection with the currently prevailing capacitance loading by capacitors 354 a to 354 e ( fig6 ). to this end , the routine in fig7 increments the non - touch timer if that timer has not exceeded a selective maximum value , e . g . 6 seconds . blocks 434 and 436 represent that operation . since this point in the routine is reached as a result of the indication of block 404 that no touch has been detected , it would seem logical to reset the touch timer to zero . however , to make the illustrated system more robust to noise that could cause a non - contact indication to occur momentarily in the midst of an extending contact , the illustrated arrangement instead merely decrements the touch timer towards zero if it has not yet reached that value . blocks 438 and 440 represent the decrementing of that timer . now if such touch - timer decrementing has occurred enough times for that timer &# 39 ; s value to have been reduced by a selected value , say , two seconds , the system can rule out the possibility that the lack of touch detection was simply caused by noise . therefore , since the system has assumed the sensitivity - adjustment mode as a result of that timer having reached 15 seconds , its count having been decremented to 13 seconds , can be considered as an indication that contact with the touch sensor 42 has actually ended . the touch timer is therefore set to zero and the system leaves the sensitivity - adjustment mode as indicated by blocks 442 , 444 and 446 . at block 448 , the routine then tests the non - touch timer to determine whether the absence of touch detection has lasted long enough to justify trying a sensitivity increase . if not , the routine ends at block 421 . otherwise , the routine makes a back - up - copy of the current sensitivity at block 450 and then proceeds to determine whether an increase in sensitivity will cause a touch detection . of course , the sensitivity cannot be increased if it is already at its maximum value so at block 452 , the routine goes to end block 421 . however if the sensitivity is not yet at its maximum value , it is increased by one step as indicated at block 458 . this is part of the sensitivity - adjustment so that that step includes setting the sensitivity - adjustment mode flag . the microcontroller 332 ( fig6 ) then samples the output of flip - flop 342 again , as indicated at block 454 and , as block 456 indicates branches on the result . in particular , if a sensitivity increase has not resulted in an apparent touch detection , then the sensitivity is increased again ( because it has not reached a maximum ), and the output of flip - flop 342 is sensed again . this continues until an apparent touch is detected . since the sensitivity adjustment scheme is based on the assumption that there really is no valid contact at touch sensor 42 , the sensitivity is thus reduced back by one step so that it is at the highest level that yields no touch indication . block 458 represents this operation . now that a sensitivity - adjustment has been made , the non - touch timer is reset to zero as indicate at block 460 so that the sensitivity will not be reset again on the next controller wake cycle . the routine then ends at block 421 .

US-1142301-A

a roof comprises a solar radiation heat recovery device that is invisible from the outside . the roof is made up of supports receiving a heat transfer network which has a longitudinal groove designed to receive the male profile of the protrusion of the heat recovery modules . the supports comprise arms which exert a lateral pressure on the flexible network . the resilient deformation of the network permits the sliding thereof between the arms to the clamped position . the groove of the network closes around the protrusion , immobilizing the module and holding the assembly in the support fixed to the roof frame . the roof is particularly intended to recover solar radiation heat in a way that is aesthetically pleasing , economical , simple and easy to install .

with reference to these drawings , i have shown in fig1 a roof surface on which heat recovery modules ( 4 ) which have the appearance of standard plain tiles are arranged . on this drawing , the external appearance of the roof is identical to that of a roof made of commercial plain tiles . as the roof surface is shown in the manner of a cutaway this permits different constituent elements of the invention to become apparent . the support ( 2 ) is fixed to the roof frame ( 5 ) in the usual manner by a fixing such as a nail and receives the heat transfer network ( 3 ). the roof module ( 4 ) is positioned on the batten ( 1 ) in the manner of standard plain tiles and the profile located on the underside and invisible in this figure transmits the heat from the solar radiation to the heat transfer network ( 3 ). fig2 shows the section of the roof surface according to fig1 and permits different constituent elements of the invention to be distinguished . the heat recovery modules ( 4 ) have the male heat recovery protrusion ( 6 ) which transmits by conduction the heat captured by the heat recovery modules ( 4 ) from solar radiation to the heat transfer network ( 3 ). an opening in this network or longitudinal groove having a shape which is identical to that of the protrusion ( 6 ) of the module ( 4 ) remains in full contact due to the lateral tension exerted by the support ( 2 ). further conventional elements of the roof are shown in this figure : firstly , the roof frame ( 5 ), the different constituent parts thereof not being limiting and not constituting the subject of the invention . secondly , the batten ( 1 ) for fixing at the top of the tile . the standard fixing ( 7 ) which connects the support to the roof frame is not visible in this drawing ; it is shown in the other figures . fig3 constitutes an interesting variant of the invention . the protrusion ( 6 ), constituent element of the heat recovery module ( 4 ), is located in the upper part . thus , the support ( 2 ) is substituted for the batten for fixing to the roof frame ( 5 ). as in the case of fig2 , the heat transfer network ( 3 ) is held in close contact with the protrusion ( 6 ) of the module ( 4 ) located on the underside due to the pressure exerted by the support ( 2 ). fig4 shows the section of the network , in particular the important features of the invention . the network ( 3 ) is not a simple tubular conduit but has a specific profile . more specifically , its cylindrical appearance comprises an opening ( 17 ) of identical shape to the male part of the protrusion ( 6 ) located below the roof modules ( 4 ) of the other figures . the dimension may differ slightly , in particular to facilitate the insertion of the male profile therein . the contact is produced by the lateral external pressure exerted during mounting of this network inside the support ( 2 ) ( see figures seven and ten ). the female profile ( 17 ) then closes around the protrusion of the module in the manner of a clamp . the clamping corresponds to the reduction of the opening angle ( α ) of the groove of the network . this figure also shows two lateral grooves ( 18 ) designed to hold the tube ( 3 ) on the support , awaiting the installation of the heat recovery modules . these grooves ( 18 ) permit the pivoting of the tubular network ( 3 ) to be avoided during its installation . the network ( 3 ) may be integrally positioned , awaiting the positioning of the recovery modules from above . the grooves ( 18 ) interlock with the profile of the arms . inside the female profile ( 17 ) are shown devices ( 20 ) which permit improved locking of the tile in position after it has been pushed in . this system which does not act against the tile being pushed in , operates as a genuine anti - return device . fig5 shows all of the basic components of the invention before mounting . thus , the heat recovery modules ( 4 ) extended by the male part ( 15 ), merged in this case with the protrusion ( 6 ) on the underside , are shown . more specifically , the protrusion ( 6 ) located below the roof module ( 4 ) is fully protruding . also , the heat transfer network ( 3 ) is visible , with the minimum features of the areas for receiving the protrusion ( 6 ). the support ( 2 ) which is fixed to the roof frame by means of a nail or a screw ( 7 ) consists of arms ( 8 ) positioned on both sides of the base ( 16 ). in the base are drilled one or more venting orifices ( 14 ), designed to meet the requirements of renewing air on the underside of roofs according to current building regulations . in the embodiment according to fig5 , the support ( 2 ) may consist of wood , the profile thereof being simple to produce by means of a spindle molder and the conventional tools of the carpenter ; the network ( 3 ) may be produced in reticulated polyethylene from an extrusion mold which is specific to the innovation . according to this particular embodiment , it is possible to use glycol - water as the heat transfer fluid , currently used to avoid the risk of ice in winter . the roof modules or tiles ( 4 ) may be produced by casting from the same constituents as standard tiles , namely clay , possibly comprising additives designed to modify the characteristics thereof . fig6 shows the installation of the roof module ( 4 ) by being pushed in . it presses on the network ( 3 ) by means of its protrusion ( 6 ). the network ( 3 ) bears against the sliding face ( 12 ). the network ( 3 ) has resilient characteristics , which permits its temporary deformation and its passage inside the arms ( 8 ) located on both sides of the base ( 16 ) of the support ( 2 ). the resilient qualities of the network ( 3 ) are sufficient for its insertion for final positioning in spite of the presence of fixed arms ( 8 ). according to a variant , the arms ( 8 ) located on both sides of the support ( 2 ) may facilitate the insertion of the tube ( 3 ) by lateral flexion . the relatively thick arms in this drawing may also be reduced in thickness at their bases to permit or improve their flexion and the positioning of the tube . the lever arm which is greater at the top of the arms ( 8 ) facilitates the separation on both sides of the network ( 3 ) and the sliding of the network may be carried out so that it adopts its final position , as shown in the following figure . fig7 repeats , with a variant , the elements described in the preceding figure . the tile ( 4 ), the network ( 3 ), and the support ( 2 ) are shown in the final position . the support replaces the batten usually located at the top of the tiles . a standard fixing ( 9 ) such as a nail immobilizes the tile ( 4 ) permanently , which is already held due to its protrusion as a result of the lateral pressure exerted by the heat transfer network ( 3 ). this network in turn is held by the clamping faces ( 13 ) located between the arms of the support ( 2 ). the width of the clamping faces on both sides of the arms provides clamping over their upper part which holds the network ( 3 ) in the support ( 2 ). fig8 shows a further advantageous variant of the invention . the basic features are repeated and comprise improvements to facilitate the positioning and to increase the contact surface area between the roof module and its network . this figure shows the first step of installation on the roof . the support ( 2 ) is fixed to the roof frame ( 5 ) by a standard fixing such as a nail ( 7 ). the network ( 3 ) and the tile ( 4 ) are not yet positioned . the protrusion ( 6 ) of the module ( 4 ) has an additional contact zone ( 21 ) in addition to the male protruding part ( 15 ). this zone ( 21 ), when the heat recovery module ( 4 ) is pushed in , is positioned in contact with the heat transfer network ( 3 ) around the tubular periphery of the network and permits the contact surface area to be increased . this feature is particularly advantageous , on the one hand , to distribute the bearing pressure widely in order to push in the module ( 4 ) without breakage inside the support ( 2 ) and , on the other hand , to increase the heat exchange surface between the network ( 3 ) and the tile ( 4 ). the two arms ( 8 ) located on both sides of the base comprise profiles ( 10 ). said profiles permit , when positioned , the retention of the heat transfer network ( 3 ) awaiting the reception of the roof modules ( 4 ), as the following figure shows . fig9 repeats the previous view and shows the heat transfer network in its waiting position . the heat transfer network ( 3 ) is pushed in manually by the installer as indicated by the double arrow . this forces the arms ( 8 ) to separate by flexion , in the direction indicated by the two arrows ( a ). the resilience of the network also contributes to this positioning . the network ( 3 ) comprises grooves ( 18 ) which enable it to be kept locked in an intermediate position without permitting the rotation thereof . the profile ( 10 ) located on the arm ( 8 ) complements the sliding faces ( 12 ) and clamping faces ( 13 ). the profile ( 10 ) interlocks with the grooves ( 18 ) of the heat transfer network ( 3 ). the installer could use a wooden wedge arranged in the groove ( not shown ) to push the network ( 3 ) into its waiting position . the groove ( 17 ) is awaiting the reception of the male profile ( 15 ) located on the protrusion ( 6 ) of the module ( 4 ) which will complete the positioning as indicated in fig1 . the roofer is able to carry out the full positioning of the heat transfer network ( 3 ) before the arrival of the heat recovery modules ( 4 ) on site . fig1 shows the section of the mounted assembly of the invention . the heat recovery module ( 4 ) has been pushed into the heat transfer network ( 3 ). the two arms ( 8 ) located on both sides of the support are tightened and maintain a lateral clamping force exerted by the clamping face ( 13 ) on the heat transfer network ( 3 ). the heat conduction is implemented inside the network ( 3 ) itself by the perimeter of the protrusion being in contact with the network when the module ( 15 ) is pushed in . added to this heat transmission is that implemented outside the network by contact with the heat recovery protrusion ( 21 ). the support ( 2 ) also has a base ( 16 ) extended outside the arms ( 8 ). the standard fixing ( 7 ) may thus be placed in a different manner from that in the two preceding views . this advantageous feature permits , amongst other things , to facilitate the installation of the support on the roof frame and , in particular , to avoid damaging the arms ( 9 ) when installing the fixing by a tool , such as a hammer . fig1 shows the specific profile of the protrusion for heat recovery ( 6 ) located below the roof module ( 4 ). this protrusion for heat recovery comprises a male part ( 15 ) designed to be inserted into the heat transfer network . in fig1 b , this protrusion also comprises a perimeter for external transmission ( 21 ) as a complement to the heat recovery carried out inside the heat recovery network ( 15 ). this permits the contact surface between the module and the network to be increased , and as a result the heat exchange . fig1 shows the partial section of the support in this particularly advantageous embodiment designed to receive the assembly for heat recovery . this section makes it possible to detail different functions of the support . the sliding face ( 12 ) permits the arms of the support ( 8 ) to be separated during the insertion of the network . the sliding face ( 12 ) also permits the resilient compression of the heat transfer network during its installation . the profile ( 10 ) permits said heat transfer network waiting for the installation of tiles to be retained . said profile ( 10 ) is designed to be interlocked in the groove ( 18 ) of the heat transfer network ( 3 ) ( see fig4 ). finally , during the definitive insertion of the tiles in their support , the arm of the support ( 8 ) flexes again to permit the heat transfer network ( 3 ) to be detached from the profile ( 10 ) and to be lowered into the final position . the clamping face ( 13 ) carries out the tensioning of the heat transfer network when the module is pushed in . a cradle ( 19 ) located in the base ( 16 ) of the support receives the network and permits the lateral dimensions of the support ( 2 ) to be optimized . insulating materials , not shown , may also be inserted at this position ( 19 ), in order to ensure an effective rupture of the thermal bridge toward the roof frame . according to a variant , not shown , the cradle may consist of an attached part protruding on the base of the support ( 2 ). fig1 illustrates a variant of the innovation . the supports ( 2 ) are produced using a stamped metal sheet . the supports of the modules are fixed and form a roof deck ( 11 ). the illustration shows these supports produced using the same stamped metal sheet positioned on the roof frame ( 5 ). a standard fixing ( 7 ) fixes the assembly to the roof frame . the invention is particularly intended for producing attractive roofs including the recovery of heat from solar radiation . the invention makes it possible to facilitate its implementation and increase heat output . moreover , this invention is also used to implement the recovery of heat from solar radiation in a cost - effective manner , reducing the use of additional materials when producing roofs . the invention is in accordance with the duty of citizens to reduce the consumption of fossil fuels and to act responsibly regarding natural resources .

US-201314402307-A

the invention relates to a belt conveyor which comprises a conveyor belt that is guided around at least one return shaft , thereby forming an upper run and a lower run , and a drive device for moving the conveyor belt , characterized in that the drive device is preferably arranged in a separate manner from the return shaft and drives the conveyor belt in the area of a deflection between upper run and lower run . the drive device preferably comprises a toothed belt or v - belt arranged at an edge section of the conveyor belt and a rotationally drivable toothed wheel or a v - belt disk . the toothed belt or v - belt is connected or connectable , preferably in a releasable manner , to the conveyor belt .

the curved belt conveyor shown in fig1 comprises a frame 10 that is formed by a pair of longitudinal beams or double - t beams 12 . a return shaft 30 for returning a conveyor belt ( not shown ) is each arranged at the ends of the double - t beam 12 . the return shaft 30 is hung in the frame 10 , wherein at least one of the two return shafts 30 is shiftable in a longitudinal direction or a movement direction of the not - shown conveyor belt in order to be able to clamp the conveyor belt after mounting thereof . in addition , the return shaft 30 comprises a plurality of roll bodies 32 that can be rotated independently from each other . since the conveyor belt has a lower cycle speed on an inner side , i . e . on a side with a smaller bending radius , than on an outer side or a side with a large bending radius , a roll body 32 arranged on the inner side needs to have a correspondingly lower cycle speed than a roll body 32 arranged on the outer side . in addition , there is mounted to the frame 10 an electric motor 70 with a gear 60 for driving a toothed belt not shown in fig1 . preferably , the gear 60 is arranged directly on an output shaft of the electric motor 70 . the unit consisting of the electric motor 70 with the gear 60 can be mounted or demounted to the frame 10 independently from the return shaft 30 . on the other hand , the return shaft 30 can be mounted or demounted independently from the drive unit consisting of the electric motor 70 and the gear 60 . the drive device with the gear 60 is preferably positioned or positionable such that an axis or rotational axis of the gear 60 lies substantially on an axis or rotational axis of the return shaft 30 . in addition , the belt conveyor comprises a plurality of idler rollers 80 for guiding the toothed belt ( not shown ). preferably , the height of these idler rollers 80 is adapted to the thickness of the toothed belt . alternatively , the idler rollers 80 may also be arranged in a vertically shiftable manner to facilitate mounting of the toothed belt and to be able to adjust their height according to the thickness of the toothed belt . moreover , on the frame side there is arranged a plurality of clamping members formed as clamping rollers 81 , which according to the illustrated embodiment are arranged on the other side of the conveyor belt , not shown in this figure , with respect to the idler rollers 80 . fig2 shows a detailed view of the belt conveyor of fig1 , a conveyor belt 20 and a toothed belt 40 being mounted in fig2 though . the toothed belt 40 is placed onto the gear 60 with the toothing 46 thereof in order to be engaged therewith . thus , the toothed belt 40 is driven by driving the gear 60 due to the engagement of the teeth of the gear 60 with the toothing 46 . thereby , the toothed belt 40 moves along the double - t beam 12 of the frame 10 . this movement of the toothed belt 40 is transferred to the conveyor belt 20 via the tabs 48 ( extension ) and rivets 50 , so that the conveyor belt 20 is also moved along the pair of double - t beams 12 . the toothed belt 40 is provided with at least one first tension - bearing member 42 , preferably with a pair of tension - bearing members 42 , in order to be able to transfer high driving forces without extensively lengthening or extensively loading the toothed belt . when two or more tension - bearing members 42 are arranged , they are preferably arranged next to each other to bend around the gear 60 in a smooth manner . these first tension - bearing members 42 are preferably formed as a regular lay or lang &# 39 ; s lay rope , while the toothed belt 40 is preferably made of polyurethane . preferably , in the extension or tab 48 there is arranged a plurality of second tension - bearing members , which can form a second tension - bearing member layer 43 to transfer the driving force from the toothed belt 40 to the conveyor belt 20 . these second tension - bearing members of the second tension - bearing member layer 43 preferably comprise at least one layer of woven warp and weft threads and are preferably arranged at an angle with respect to the movement direction of the toothed belt , preferably at an angle of 30 to 50 degrees , most preferably at an angle of 40 to 45 degrees . preferably , the direction of the angularly arranged second tension - bearing members 43 substantially corresponds to a line of force for inducing the movement force from the toothed belt 40 to the conveyor belt 20 . moreover , further second tension - bearing members can preferably be arranged perpendicularly to the second tension - bearing members in the force - inducing direction . in other words , there are second tension - bearing members 43 that are arranged at an angle of 30 to 50 degrees , i . e . at an angle substantially in correspondence with a force - inducing direction , and further second tension - bearing members 43 that are displaced by 90 degrees with respect to the first - mentioned second tension - bearing members . this has the advantage that when the movement direction of the belt conveyor is reversed , the further last - mentioned second tension - bearing members 43 now substantially correspond to the force - inducing direction from the toothed belt 40 to the conveyor belt 20 . in summary , one can say that second tension - bearing member layers 43 are arranged such that a plurality of second tension - bearing members 43 is each arranged in the force - inducing direction both in the one movement direction of the belt conveyor and in the opposite movement direction of the belt conveyor . the tabs or extensions 48 of the toothed belt 40 are connected to the conveyor belt 20 preferably by rivets 50 . in this way , a simple and cost - efficient connection between the toothed belt 40 and the conveyor belt 20 is provided . if the conveyor belt 20 or the toothed belt 40 is replaced , this connection can be released and reestablished in a simple manner . alternatively , this connection may also be established by another connection method , such as screwing , splints , gluing , vulcanizing , etc . the invention particularly relates to a belt conveyor having a conveyor belt 20 , which is guided around at least one return shaft 30 , and a drive device for moving the conveyor belt 20 , wherein the drive device is preferably arranged separately from the return shaft 30 . the drive device preferably comprises a toothed belt 40 , which is arranged or arrangeable on an edge portion of the conveyor belt 20 , and a rotatably drivable gear 60 . the toothed belt 40 is preferably connected or connectable to the conveyor belt 20 in a releasable manner . objects can be conveyed at an arbitrary angle with the curved belt conveyor shown in the figures . preferably , clamping means ( not shown ), such as a curved guide , can act on the radially inward flank of the toothed belt to guide the toothed belt around the curve . however , the invention is not limited to the curved belt conveyor as shown , but can also be applied to a straight belt conveyor . in addition , the drive device with the gear 60 and the toothed belt 40 can also be arranged on the inner side or on both sides of the conveyor belt 20 in the case of a curved belt conveyor . furthermore , instead of the electric motor 70 , an other drive device , such as a hydraulic motor , a servo motor , an internal combustion engine , etc ., can be used for driving the belt conveyor as well . the frame 10 does not need to exhibit the double - t beam 12 , but any other kind of frame , such as a simple t - beam , an l - beam , a rod , or a tube , can be used for forming the frame as well . optionally , the belt conveyor can be provided with guide plates 90 , which are to be connected to the frame 30 in an easy to release manner as well . although a toothed belt placed around a gear is used as a drive according to the embodiment , a v - belt with a corresponding v - belt pulley can be used as well . fig3 shows a sectional view of the belt conveyor with a further embodiment of a placed conveyor belt 20 with a toothed belt 40 and a clamping element 47 . in this embodiment , the clamping element 47 and the toothed belt 40 are arranged on the inner side of the continuous conveyor belt 20 , i . e . on the side of the return shaft not shown in fig3 . in this embodiment , the clamping element 47 is formed with the toothing 46 in addition to the toothed belt and separated therefrom by a gap , which extends between the toothing 46 and the clamping element 47 in the direction of the extension fixed to the conveyor belt 20 . in this embodiment , the gap does not divide the toothed belt and the clamping element 47 completely , so that the two elements are formed integrally in the present case , so that only one integral component needs to be fixed on the extension of the conveyor belt 20 . furthermore , a first tension - bearing member 42 is shown in this embodiment as well . it is also conceivable that the toothed belt or a v - belt provided instead of the toothed belt is provided in a fully separated manner from the clamping element 47 , i . e . with a multi - part design . in this case , the toothing may be arranged on the outer side of the conveyor belt . due to the toothing , tensile stress in the toothed belt 40 could also be kept low for an arrangement on the outer side . however , it is advantageous that at least the clamping element 47 , which should have a certain uniform constructional height to be able to provide a sufficiently large clamping surface 45 , is arranged on the inner side of the conveyor belt 20 . in the case of an arrangement on the inner side , the clamping element 47 lies within the continuous neutral fibre of the conveyor belt , i . e . the fibre of the conveyor belt that — upon passing of the belt around the return shaft — is neither loaded with a tensile stress nor with a compressive stress . preferably , neither a clamping element 47 nor a toothed belt 40 is provided on the outer side of the conveyor belt in order to be able to fully use the width of the belt for objects to be conveyed . according to yet a further embodiment ( not illustrated ), the clamping surface 45 can also be formed as a flank of the toothed belt 40 , so that a widthwise extension of the component part can be reduced . as can be seen in fig3 , the clamping surface 45 of the illustrated embodiment is in contact with a frame - side clamping member . the frame - side clamping member is formed as a clamping roller 81 , which is designed similar to or identical with the idler rollers 81 in this embodiment . the clamping rollers 81 are slightly inclined to apply a radially outward or obliquely upward clamping force to the clamping surface 45 of the clamping element 47 . in this way , the clamping element 47 can tension the conveyor belt 20 radially outwardly . in addition , the backside of the toothed belt 40 or a second tension - bearing member layer 43 arranged between the toothed belt 40 and the idler roller 81 is pressed against the idler roller 80 and thus guided safely between the idler roller 80 and the clamping roller 81 . the idler roller 80 is substantially perpendicular to the conveyor belt plane . thus , clamping forces are almost exclusively applied via the clamping rollers 81 , disregarding frictional forces on the idler rollers 80 . the width of the conveyor belt can be used optimally due to the perpendicular posture of the idler rollers 80 . in fig3 , below the described clamping roller 81 there is provided an optional second clamping roller 81 , which can serve to tension and guide the returning lower run in the same manner .

US-99609709-A

a cable rack arm and support system suitable for underground power and communication service is made from a non - metallic polymer that will not rust or corrode . the cable rack arm is adapted for mounting to existing underground stanchions or for stanchions of a more modern design . each cable rack arm is securely mounted to the stanchion . each cable rack arm then supports one or more cables in cable rests or saddles molded atop the arm , thus keeping the cables accessibly organized in a manhole , tunnel or vault . plastic cable ties may be used to secure the cables to the cable rack arms . nonmetallic pins may also be used to secure the cable rack arms to the stanchions . the stanchions may be made of nonmetallic composite material that includes a fiberglass cross - layered knitted apertured mat for increased strength .

embodiments of the cable arm described herein are preferably molded from plastic materials . in this context , “ plastic ” materials include any resinous , thermoset , or thermoplastic materials , including materials that are reinforced or otherwise altered , and which are formed by molding . thus , in one embodiment , nylon with short glass fibers is used to make strong , stiff , and environmentally - resistant rack arms . in the present context , short glass fibers intends glass fibers from about ⅛ ″ ( about 3 mm ) long to about ¼ ″ ( about 6 mm ) long . long glass fibers , from about 3 / 16 ″ ( about 5 mm ) to about ⅜ ″ ( about 10 mm ) may be used instead . other embodiments may use less costly materials , such as polyethylene or polypropylene , for applications in which not as much strength is required . the plastic materials may also include particulate fillers , such as aluminum oxide or calcium carbonate , or any other filler useful in plastics molding . glass fibers with diameters from about 0 . 009 mm ( 0 . 00035 in ) to about 0 . 011 mm ( 0 . 00043 in ) may be used for reinforcement . fibers with other diameters may also be used . in addition to cable arms , the stanchions may also be molded from non - metallic materials . stanchions may be injection molded , thermoformed , transfer molded , compression molded , or even pultruded . typical polymers or resins include polyester , such as standard polyester , fire - retardant polyester , vinyl ester and fire - retardant vinyl ester . in addition to a thermoplastic or thermoset resin , the stanchions may include a reinforcement , such as glass fibers . parts that are discretely molded , one at a time , may include chopped or short glass fibers , as mentioned above . these parts or parts that are pultruded may also be made with unidirectional fiberglass roving , continuous strand multidirectional glass fiber mat and stitched woven fiberglass roving . the reinforcements add longitudinal and transverse strength and stiffness . an outer surface veil mat may also be used to add uv resistance and hand - friendliness to the resin - rich surface . if greater strength or stiffness is desired , carbon fiber reinforcement may also be used in addition to or in lieu of glass . in one embodiment , pultruded c - channels are made with about from about 30 to about 40 weight %, e . g ., 33 %, unidirectional fiberglass roving and about 10 to about 25 weight %, e . g ., 17 %, continuous multidirectional glass fiber mat . higher or lower loadings of reinforcement may be used . the mat is believed to especially increase the strength and stiffness of the corners of the pultrusion . in other embodiments , unidirectional roving is stitched together with transverse glass or cotton fibers to form a stitched woven fiberglass roving . the stitching helps to orient and control the roving and make it easier to pull into the tooling . the proportion of the reinforcements may vary within reasonable limits consistent with the desired strength and stiffness , e . g ., from about 35 % to 65 %, or even higher . in other embodiments , only the continuous multidirectional glass fiber mat may be used . in still other embodiments , other forms and orientations of reinforcement may be used . all are intended to be within the scope of the present disclosure . a few specific embodiments are discussed below with reference to fig1 - 21a . the pins used to mount the cable rack arms to stanchions may also be molded from plastic materials . the pins are desirably injection molded , but they may also be compression molded , pultruded and / or machined . it will be clear to those with ordinary skill in the art that the pins support a shear load caused by the cable rack arm and the cables loaded onto the arm . accordingly , reinforcements , such as glass fibers , that are longitudinally oriented will be helpful in supporting the load and resisting deformation . this may be achieved by using glass - reinforced plastic materials . the desired orientation may also be achieved by using wider gates in injection molding the pins . it has also been found during experiments that molding the pin with a reservoir , attached to the end of the pin opposite the gate with a small orifice , causes additional plastic flow and helps to orient the fibers during the injection molding process . underground cable racks face several constraints for successful service . one of these constraints is that the stanchions or posts generally include penetrations in both the stanchions and the arms so that the stanchions or posts may be attached to the walls or surfaces of the manholes or other underground installations in which they are placed . if cable rack arms are not integral with the stanchions , there are then more penetrations so that the rack arms may be installed , to hold cables for power or communications . each such penetration may be considered as a stress concentrator , a point in the structure at which stresses will be more likely to cause failure . in molded posts or stanchions , the effects of the stress concentrators may at least be minimized by molding in the penetrations or holes , so that the well - known “ skin - effect ” of plastic materials will apply , lessening the effect of the stress concentration . the skin - effect of as - molded plastics means simply that there is a barrier layer of resin on the surface , resistant to infiltration of water and other contaminants . embodiments of the present invention mold in a number of important features to take advantage of the skin effect and to make the stanchions as useful as possible . embodiments are depicted in fig1 , which depicts an underground cable installation 10 with two stanchions 12 , 14 secured to concrete wall 18 via bolts 16 ( not all bolts visible in fig1 ). the stanchions may be existing metallic stanchions , such as single flange steel stanchion 12 . alternatively , the stanchions may be non - metallic , such as non - metallic c - channel stanchion 14 . in this instance , stanchion 12 is used to mount two cable rack arms 20 and three cable rack arms 30 . cable rack arms 20 have two position places or saddles on the top portion of the rack arm for mounting power or communications cables 19 . cable rack arms 30 each have three position places or saddles on top for mounting the cables . of course , other embodiments may have only a single mount or may have additional mounts , such as an arm with four or five mounts or saddles . further , some applications may require that the top surface of the arm be flat . one advantage of the embodiments depicted herein is that the mounts or saddles are formed integrally with the rack arms themselves . thus , no adapters or additional parts need to be assembled before installing and using the rack arms . as noted , the pins 21 may also be made of plastic material . as also shown in fig1 , stanchion 14 is used to mount two cable rack arms 20 and three cable rack arms 30 . the cable rack arms 20 , 30 used for stanchion 12 are the same cable rack arms 20 , 30 used for stanchion 14 . the cable rack arms are adapted for use with both types of stanchions because they include an interface or mounting adapter portion designed for such multi - stanchion mounting . thus , the cable racks arms described herein are suitable for use in existing facilities with single flange steel stanchions . the single flange steel stanchions have a protruding plane of material that fits into a hollow or interface of the cable rack arm . the cable rack arms are also suitable for use with c - channel - type stanchions , which do not have a flange that protrudes into the cable rack arm . the cable rack arms in these applications mount between the channel flanges , which provide mounting holes for the pins that support the arms . the stanchions may be metallic , e . g ., steel , or may be made from newer , non - metallic materials . the cable rack arms are mounted with pins 21 that are secured with cotter pins 23 . a closer perspective view of the installation is depicted in fig2 , showing cable rack arms 30 . rack arm 30 , on the left , mounted to wall 18 via double - flanged stanchion 12 and wall mount portions 13 , which wall mount portions include holes ( not shown ) for mounting bolts 16 and washers 17 . stanchion 12 itself protrudes into a slot in the back or interface portion of the rack arm , as explained below . an identical rack arm 30 , shown on the right portion of fig2 , is mounted to channel stanchion 14 , which is also bolted to wall 18 in a manner similar to stanchion 12 . channel stanchion 14 has a c - shaped cross section formed by web 14 a and flanges 14 b on either side of web 14 a . rack arm 30 on the right is mounted to channel stanchion 14 via mounting pin 21 , secured with cotter pin 23 . the back or interface portion of both rack arms 30 include mounting holes or orifices for mounting pin 21 so the pin can secure the rack arms to the either of stanchions 12 or 14 . the exploded view of fig3 provides details of the configuration of identical mount arms 30 , enabling mounting to two very different stanchions . cable rack arms 30 each have an upper portion 32 and a lower portion 38 , the upper and lower portions acting as flanges that are connected via central web 31 . the cable rack arm thus has a cross section with a web and flanges , akin to an i - beam or an h - beam , and has increased section modulus and strength . this increased stiffness or strength makes cable installations more stable and reliable . upper portion 32 in this embodiment includes three cable rack saddles or mounts 34 , the mounts separated by upper flat surfaces 36 . lower portion 38 , further described below , is mounted at an acute angle a , less than 90 °, and desirably less than 60 °, to upper portion 32 . the imaginary apex of the angle will be to the left of the mount arms , as also shown in fig3 . in practice , angle a may range from about 10 degrees to about 50 degrees , and desirably from about 15 degrees to about 47 degrees . fig3 also depicts the proximal portion 35 of the rack arms , the proximal portion being the end for use near the stanchion . the distal portion 40 is the end of the arm away from the stanchion . the proximal portion includes a rear surface 37 , a portion of which is flat and may be formed at an obtuse angle b to flats on the top portion , an obtuse angle being an angle greater than 90 °. the obtuse angle of these flats on the rear or proximal surface prevents downward rotation of arm 30 past the point where the material of the rear surface meets the inner surface of the channel 14 . the obtuse angle b in one embodiment is about 91 . 5 degrees and may range from about 90 . 5 degrees to about 95 degrees in practice , although other angles may be used , such as a right angle or an acute angle . having angle b at 91 . 5 ° results in the flats 36 and the saddles 34 having an upward tilt of 1 . 5 °. this upward tilt compensates for the deformation of the arm when it is under load by very heavy power and communication cables . thus , rack arm 30 will be biased to some extent for upward tilting of the rack arm on its distal end , near angle a . in other embodiments , it may be desirable for the rack arm top surface 36 and saddles 34 to be at a nominal angle different from horizontal ( 90 °). thus , other embodiments may include cable rack arms designed for an orientation of 30 °, 45 °, 60 ° or other angle from horizontal . these angles may be useful for maintenance of the cable after installation . proximal portion 35 also includes slot 41 , separating the proximal portion into two halves . slot 41 provides space that allows cable rack arm 30 to accommodate double - flanged stanchion 12 for easy mounting . the halves on either side of slot 41 each includes a mounting hole 39 . the holes thus allow insertion of a pin , such as pin 21 , and its securing cotter pin 23 , through mounting holes 25 of the stanchions 12 , 14 , as well as the cable rack arm 30 itself . horizontal mounting holes 39 in this embodiment are below the top surface of the rack arm 30 . in other embodiments , the mounting holes 39 of interface 35 may be molded above the top surface 36 . in yet other embodiments , mounting holes 39 may be molded such that the center of the horizontal orifices 39 are above the top surface 36 of upper portion 32 . the mounting holes 39 are used in all types of stanchions , while the slot 41 is needed only in a double - flange steel stanchion , a tee - bar stanchion , an l - angle stanchion and an e - channel stanchion , but not a c - channel stanchion . the e - channel stanchion , tee - bar stanchion and l - angle stanchion are shown in fig1 , 17 and 18 respectively and are described in more detail below . the single flange steel stanchion 12 is well - established in the industry , and the cable rack arms depicted herein include a slot 41 , thus enabling retrofit of the cable rack arms depicted herein to replace older cable rack arms . the cable rack arm embodiments described herein can be used for existing single flange steel stanchions as described and may also be used for new non - metallic c - channel , l - angle , tee - bar or e - channel stanchions . each slot 41 or interface also includes a void or relief 49 , the relief in the shape of about a 45 degree angle to the top of the rack arm . thus , in one embodiment , the interface includes contiguous mounting holes 39 , slot 41 and relief 49 . when the arm 30 is attached to a single flanged stanchion , a tee - angle stanchion , an l - angle stanchion , or an e - channel stanchion , relief 49 allows upward rotation of the rack arms from their deployed horizontal position as depicted in fig2 - 3 . in other embodiments , the angle between the top surface and the rear or side may be close to 90 °, that is , a right angle . in these embodiments , the cable rack arm may be viewed as a three - dimensional right triangle , with the long side or hypotenuse being the angled side on the bottom , that is , the bottom or lower portion . the top or longer portion is the major cathetus of the triangle and the side or shorter portion forms the minor cathetus of the triangle . the sides of the triangle may be connected by a web , a web with ribs , or a gusset . in this patent , the terms major cathetus and minor cathetus intend the top and side of a cable rack arm , whether or not the angle between them is a right angle . a closer , bottom view of the cable rack arm 30 is depicted in fig4 . cable rack arm 30 and lower portion 38 includes a proximal portion 35 , for placement nearer the mounting stanchion and a distal portion 40 , for placement away from the stanchion . as noted above , slot 41 separates the proximal portion 35 and rear surface 37 into left and right halves 37 a , 37 b and allows insertion of the rectangular bar portion of a single flange stanchion into the slot . in fig4 , rhomboid sections 37 c and 37 d may be molded flat to fit snugly against c - channel , tee bar , l - angle and e - channel stanchions on which the cable arm is mounted . these are the flat sections discussed above that may be oriented from about 90 . 5 to 95 degrees to the plane of the top surface of the cable arm . in addition , the cable arm may include two bottom flat portions 37 e and 37 f that are about 91 ° from surfaces 37 c , 37 d . flats 37 e , 37 f may be oriented at about 1 ° more than a right angle from surfaces 37 c , 37 d as a convenience in removal of the arm from the mold used for manufacturing . 1 ° is a conventional draft angle . further , since surfaces 37 e , 37 f have 1 ° taper it is possible to mold rounds 37 h on the same core pull as slot 41 . other functions that surfaces 37 e , 37 f permit include reducing the arm profile , resulting in less part weight . slot 41 is extended on both sides by additional side reliefs 43 a , 43 b adjacent the left and right halves . side reliefs 43 a , 43 b allow use of the adjustable cable rack arms in existing single flange stanchions having substantial weld formations that would otherwise interfere with their installation . the lower or bottom portion 38 of the cable rack arm is narrower than upper portion 32 , especially near the distal end 40 . downward rotation of the arm 30 is stopped by surfaces 37 c , 37 d , heel stops , when the arm is attached to a c - channel stanchion . when arm 30 is attached to a single flange stanchion , downward rotation is stopped when surface 37 g , a slot stop , contacts the front - most face of the single flange stanchion . consider now the l - angle , tee - bar and e - channel stanchions . the l - angle , tee - bar , or e - channel stanchion may have no nearby bolt heads and washers for attaching the stanchion to the concrete wall , and thus there may be no bolt heads or washers between the arm and the stanchion . in this case , either or both surfaces 37 c , 37 d , heel stops , as well as surface 37 g , the slot stop , may be used to stop downward arm rotation . of course , in the case of the l - angle stanchion , either or both 37 c and 37 g , or 37 d and 37 g , could be used to stop the downward rotation of the arm since there is only one leg on the l - angle stanchion for surface 37 c or 37 d to contact . if the l - angle , tee - bar or e - channel stanchion has a nearby bolt head and washer for attaching the stanchion to the wall , then only slot stop 37 g is used to stop downward rotation of the arm . on a side note , there are two types of single flange steel stanchions in wide use . one is fabricated by welding two flanges to a perpendicular bar as shown in fig7 . the second single flange stanchion is made from a single bar and flanges are formed by twisting 90 ° approximately the last 3 ″ on both ends of the bar . the single flange stanchion is in wide use and is only made from steel . the l - angle , tee - bar , e - channel and c - channel stanchions described herein are only nonmetallic and only made using the pultrusion process . these could possibly be made by transfer molding or compression molding or even the rim molding process , but this has not been done to our knowledge . to date there has been limited deployment of l - angle and tee - bar nonmetallic stanchions . the assignee of the present patent has just started to manufacture c - channel nonmetallic stanchions . there is no prior art of any kind for the e - channel nonmetallic stanchion . this stanchion has advantages of increased stability and support from the extra , middle flange . those having skill in the art will recognize that the upper portion 32 , with one or more cable mounts or saddles 34 , needs to be somewhat wider in order to mount the cables . the load is supported by the web 31 and ribs 33 and is transferred to the stanchion . bottom 38 portion needs only to transfer a part of the load through its length to the stanchion and does not need to be wide , it simply must be thick enough to resist buckling . as better seen in fig1 - 3 , ribs 33 need not be perpendicular to the top or bottom portion , although they may be . in these embodiments , the ribs are from about 30 ° to about 60 ° to the top or bottom portions . it will be recognized that the web 31 acts more or less as a gusset , that is , as a reinforcement supporting the top portion and transferring the load on top to the side portion and then to the stanchion . thus , a gusset , even a plain gusset without ribs , may be used with a top portion , a side portion and an interface to support cables in other embodiments . in some embodiments , a flanged gusset is used . fig5 and 5a depict the deployed or horizontal position of the cable rack arm mounted to a stanchion . in the partial cross - sectional view of fig5 , 3 - saddle cable rack arm 30 has been pinned to a single flange stanchion 12 with pin 21 through the orifices described above . stanchion 12 is mounted to concrete wall 18 via wall mounts 13 , anchors 28 and bolts 16 . cable - tie orifices or holes 45 are visible in cable rack arm 30 in this cross - sectional view . in fig5 , top relief 49 is visible as an angled gap between the metal of stanchion 12 and the top of the cable rack arm . the close - up perspective view of fig5 a depicts , as a user would see it , gap or relief 49 in the top of the cable rack arm 30 . upwardly - rotatable cable rack arms also accommodate faults in power lines . for example , when a short occurs even at a long distance in a power line , the cable will actually “ jump ,” or try to jump , as much as several inches . in older cable arms , such faults may break the arm in the area between the mounting orifices and the top of the arm . a broken arm cannot support the cables , placing additional loading on the adjacent arms and leading to additional failures . allowing some rotation as in the embodiments described herein , typically from about 40 degrees to about 50 degrees , relieves the stress without breaking the arm . fig7 depicts a closer view of a single flange stanchion 12 , supported by wall mounts 13 . stanchion 12 itself has an orifice 25 for mounting a cable rack arm . wall mounts 13 have slots 27 so that the structure can be bolted to a support wall . stanchion 12 has been formed by welding the central portion to wall mounts or end portions 13 , with resulting weld build - up 29 on both the top and bottom of the stanchion . in other embodiments , a single flange stanchion may be made in one piece by twisting the ends 90 ° instead of welding on additional end mount 13 . as mentioned above , one advantage of the adjustable cable rack arms described herein is that they may be used to retrofit existing stanchions , such as stanchion 12 . however , the retrofit will not go smoothly if the new arm does not include space to accommodate the weld build - up in situations where the stanchion is a welded assembly . accordingly , as shown in the bottom view of fig8 and the closer , partial cross - sectional view of fig9 , the adjustable cable rack arm 30 slot 41 includes side reliefs 43 a , 43 b to accommodate weld build - up 29 . this makes the retrofit easier and prevents additional damage to the new arms 30 which do not have to be forced into place . fig1 depicts c - channel stanchion 51 bolted to wall 50 with bolts 59 and washers 61 . the stanchion is made from glass - reinforced plastic , such as glass - reinforced nylon or pultruded glass fiber and polyester or vinyl ester resin . stanchion 51 includes a central web 55 with side flanges 57 formed at about 90 ° to the central web . flanges 57 include orifices 53 for pins for mounting cable rack arms to the stanchion . fig1 depicts a two - position rack arm 20 and two three - position rack arms 30 mounted to stanchion 51 with pins 21 . in this type of installation , relief 49 is not used but is available if the cable rack arms are used with the older - type , double - flange steel stanchions . fig1 and 11 depict the multiple orifices or pin holes 53 in the flanges 57 for cable rack arms . c - channel stanchion mounts to wall 50 via multiple bolts 59 through multiple orifices or holes ( not shown ) in web 55 . using multiple mounting bolts improves stanchion load capacity , but the additional bolts pose a problem in that the heel or backside of the arm may interfere with a bolt head when the arm is installed and tilted into place . side reliefs 43 a , 43 b , also shown in fig1 and 15 , overcome this problem by providing space in the arm to accommodate the bolt heads . fig1 depicts a partial cross - sectional view of the embodiment of fig1 . this view includes concrete wall 50 , anchor 28 , bolt 59 , web slot orifice 60 , c - channel stanchion 51 with web 55 , flanges 57 and orifices 53 . fig1 also depicts arm 30 with cable tie orifices 45 and top relief 49 . in the closer view of fig1 , which is also a partial cross - sectional view , washer 61 is visible under the head of bolt 59 . in addition , side relief 43 a is also visible between the bolt 59 and the rear material of arm 30 . thus , side reliefs 43 a , 43 b are useful in c - channel stanchions to provide clearance for mounting bolts . as noted above , side reliefs 43 a , 43 b are also useful in double - flange stanchions , allowing clearance of the cable rack arm around weldments . fig1 depicts a partial bottom cross - sectional view of fig1 , with a closer view in fig1 . cable arm 30 is pinned to stanchion 51 with pin 21 and cotter pin 23 . the stanchion is bolted to concrete wall 50 with bolt 59 through slot orifice 60 and anchor 28 . washer 61 is visible in closer view fig1 , which also depicts how side reliefs 43 a , 43 b allow clearance of the head 63 of bolt 59 . fig1 - 18 depict installation of three additional and different non - metallic stanchions as described herein . fig1 depicts an e - channel stanchion installation 70 , with a non - metallic e - channel stanchion 71 . e - channel stanchion 71 includes a central web 73 with two outer flanges 75 and an inner , central flange 77 , the flanges perpendicular or about 90 ° to the web . a plurality of pin - mounting orifices 79 are provided on each of the inner and outer flanges . in addition , the central web 73 has a plurality of orifices ( not shown ) for bolts to mount the stanchion 71 to a concrete wall 18 . in this installation , two two - saddle arms 20 and two three - saddle arms 30 are mounted to stanchion 71 . note that in fig1 , the flanges 75 , 77 of e - channel stanchion 70 face in the same direction as cable rack arms 20 , 30 , in the same manner as cable rack arm 30 and flanges 14 b of c - channel stanchion 14 in fig2 . this configuration saves space in the installation while preserving the higher section modulus and strength of the e - channel and c - channel stanchions . fig1 depicts a stanchion installation 80 with a tee - bar non - metallic stanchion 81 having a cross section in the shape of a t . tee - bar stanchion 81 includes a central web 83 and a flange 85 formed at a right angle to web 83 . pin - mounting orifices 89 are provided on flange 85 . in addition , the central web 83 has a plurality of orifices ( not shown ) for bolts to mount the stanchion 81 to a concrete wall 18 . in this installation , two two - saddle arms 20 and one three - saddle arm 30 are mounted to stanchion 81 . fig1 depicts a stanchion installation 90 with an l - angle non - metallic stanchion 91 having a cross section in the shape of an l . angled stanchion 91 includes a web 93 and a flange 95 formed at a right angle to web 93 . pin - mounting orifices 99 are provided on flange 95 . in addition , web 93 has a plurality of orifices ( not shown ) for bolts to mount the stanchion 91 to a concrete wall 18 . in this installation , three two - saddle arms 20 are mounted to stanchion 91 . as discussed above , a useful embodiment disclosed herein is a nonmetallic stanchion that is pultruded with a cross section in the general shape of a capital “ c .” fig2 - 21a depict a cross - sectional view of the “ c ” channel stanchion . this embodiment of the “ c ” channel stanchion is nonmetallic . after the basic “ c ” channel has been pultruded , it is sawed to length and the holes for mounting it to a wall and the holes for attaching the arms are machine routed and / or drilled as required . in one embodiment , the nonmetallic material used in fabricating the “ c ” channel , by weight , is 44 . 5 % polyester resin and 55 . 5 % glass fiber . the glass fiber includes 33 % unidirectional fiberglass roving ( roving ), 17 % continuous filament glass fiber mat ( cfm ), 5 % fiberglass cross layered knitted apertured mat ( clkm ) and 0 . 5 % synthetic surfacing veil ( veil ). the type of glass filament used in the roving , cfm , and clkm is commonly known as e - glass . other proportions may be used . the cfm is similar to a spun - bonded , non - woven reinforcement . in other embodiments , a standard woven ( warp and weft ) reinforcement mat may be used . during the pultrusion operation , the roving , cfm , clkm , and veil are completely wetted and saturated with the polyester resin . the polyester resin is the component that binds the fiberglass together forming a strong nonmetallic reinforced composite “ c ” channel stanchion . it is understood that other resins and other reinforcement fibers may be used . the roving is similar to owens corning fiberglas product number 399 - 113 yield and the cfm is similar to owens corning product number m - 8643 - 2 oz / sq . ft and m - 8643 - 3 oz / sq . ft . from owens corning , granville , ohio , u . s . a . the veil is similar to “ nexus ” veil from precision fabrics group , inc ., greensboro , n . c ., u . s . a . the roving contributes longitudinal tensile strength and flexural strength . the cfm contributes strength in both the longitudinal and transverse directions . the veil provides a resin - rich surface for uv resistance and hand - friendliness . the polyester , roving , cfm , and veil components described above have been used to pultrude and deploy a relatively small quantity of nonmetallic tee - bar and “ l ” stanchions in recent years . these stanchions had insufficient strength and during the course of the work described herein , it was determined that a stanchion with higher load capacity was needed . in particular it was noted that the distribution of the roving and the mat throughout the resulting structure was not well controlled . accordingly , the inventor developed a fiberglass cross - layered polyester yarn knitted apertured mat ( clkm ) for placement in the stanchion during the pultrusion operation . since the mat is cross - layered , one layer is oriented in the direction of the pultrusion , while the opposite layer is oriented transverse , about 90 °, to the direction of pultrusion . in other embodiments , the transverse layer may be oriented up to plus or minus 15 degrees to the transverse direction . fig1 is the top view of a swatch of clkm fabric 100 . the clkm fabric has 6 . 5 longitudinal tows 101 of fiberglass per inch and 6 . 5 transverse tows 102 of fiberglass per inch . the tows 101 , 102 are knitted together with polyester yarn 103 . fig1 , 19 a , 20 and 20 a reveal in detail that the transverse tows 102 form one layer and the longitudinal tows 101 form a distinct second layer . each tow 101 , 102 is an untwisted bundle of 2 , 000 each ( 450 yield ) 0 . 0166 mm ( 0 . 000654 in ) diameter continuous glass filaments . the open channels 104 between the longitudinal tows and the open channels 105 between the transverse tows combined with the apertures 106 that penetrate through the clkm fabric permit the polyester resin to wet - out and flow through the clkm fabric . the clkm fabric is pulled through the pultrusion die in the direction shown by the arrow 107 . while not being bound by any particular theory , it is believed that the layered structure allows greater penetration of the resin between layers and between and within tows in each layer , as well as within the discrete “ windows ” or apertures of the knitted reinforcement between each tow of each layer . a cross - section of the “ c ” channel stanchion showing the reinforced polyester composite after it exits the pultrusion die is shown in fig2 and 21a . in one embodiment , the structure is as follows . two overlapping veils 108 , 109 cover the outer surface . two pieces of cfm 111 , 112 are placed immediately inside the veil . one piece of clkm 114 is placed at the center of the “ c ” channel thickness . one piece of cfm 115 , 116 is placed on each side of the “ c ” channel thickness half way between an outer surface of the clkm 114 and inner surface of the outer cfm 111 , 112 . in one embodiment , the tows of roving , respectively 62 ea , 65 ea , 67 ea and 70 ea tows , are evenly distributed in compartments 117 , 118 , 119 and 120 respectively . as stated previously the veil 108 , 109 constitutes 0 . 5 % by weight of the “ c ” channel composite , the cfm 111 , 112 , 115 , 116 is 17 %, the clkm is 5 % and the roving is 33 %. the 44 . 5 % balance is the polyester resin which completely wets - out , saturates and adheres to all surfaces of the veil , cfm , clkm , and roving . the fiberglass - reinforced polyester composite pultrusion thus fabricated has increased transverse strength in the corners 121 , 122 because the knitted yarn controls the distribution of the glass fiber tows . while the above has been described for a c - channel stanchion , other pultruded structures with this configuration will also have increased strength , whether they have the form of a tee , an “ l ” or an “ e ” shaped cross section . a non - metallic cable rack arm made with the described corner reinforcements will have increased rigidity and strength , and because the position of the glass reinforcement is controlled , will also have a more reliable strength and stiffness . one novel feature in the above described pultrusions that results in the increased transverse strength of the cable arm support stanchion is the inclusion of at least one fiberglass cross layered knitted apertured mat ( clkm ) in which the tows and layers are restrained by a knit mesh . clkm is the preferred fabric . the fiber or yarn used for the knit mesh may be polyester , cotton or other fiber . while a knitted holding structure is useful , other forms may be used , such as a stitched , purled , or even a woven form , so long as the additional fibers constrain the individual tows and layers into an integral structure . other variations of the clkm may also be used , in which the fiberglass fabric itself is woven , knitted or stitched . the “ c ” channel stanchion described in detail above and the “ e ” channel stanchion are new innovations in underground cable support and have advantages in their strength and rigidity . the tee - bar stanchion and l - angle stanchion have been previously deployed as nonmetallic structures . the tee - bar and l - angle stanchions cost less but also have less strength and stiffness , particularly when it is desired to use fewer mounting bolts , which is usually the situation . there are many possible embodiments of the present invention , of which only a few have been described herein . it is intended that the foregoing detailed description be regarded as illustrative rather than limiting , and that it be understood that it is the following claims , including all equivalents , that are intended to define the spirit and scope of this invention .

US-58486409-A

a processing apparatus and method includes a housing , including : a motor , and a drive shaft rotatable by a motor about a drive axis , including a drive engagement device movable along the drive axis , a bowl , the drive shaft extending into the bowl when the bowl is secured to the housing in a working position , a bowl lid including a chute , a lid shaft including a lid engagement device axially aligned with the drive shaft when the bowl and bowl lid are in the working position , and a pusher including a pusher engagement portion for causing the lid engagement device to move the drive engagement device into the retracted position when the bowl and bowl lid are in the working position , wherein , when the drive engagement device is in the retracted position , the drive shaft is rotatable by the motor .

in the following detailed description , reference is made to the accompanying drawings , which form a part hereof and show by way of illustration specific embodiments in which the invention may be practiced . these embodiments are described in sufficient detail to enable those skilled in the art to practice them , and it is to be understood that other embodiments may be utilized , and that structural , logical , processing , and electrical changes may be made . the progression of processing steps described is an example ; however , the sequence of steps is not limited to that set forth herein and may be changed as is known in the art , with the exception of steps necessarily occurring in a certain order . the invention will now be described with reference to the drawing figures in which like reference numerals refer to like parts throughout . referring now to fig1 , a processing apparatus 100 includes a motor housing 102 which may include a control panel 104 for controlling functions of the apparatus 100 . the control panel 104 may include buttons , e . g ., buttons 105 - 110 , as a user interface to select the apparatus functions . such functions may include , without limitation , speed , processing time , pulse , operation type , and power . the control panel 104 may further include a visual indicator ( not shown ), which may be , for example , a light ( e . g ., an led ) or a screen ( e . g ., lcd ) for providing information to a user . a bowl 112 may be placed over the motor housing 102 . a bowl lid 114 may be placed over the mouth 115 of the bowl 112 . the bowl 112 may include a handle 116 , first and second level indicators 118 , 119 for indicating levels of processed material , and first and second lock indicators 120 , 121 for indicating whether the bowl 112 is secured to the motor housing 102 and to the bowl lid 114 . a third lock indicator 122 may be located on the motor housing 102 such that , when aligned with a portion of the first lock indicator 120 , may inform the user that the bowl 112 is secured to the motor housing 102 and in a working position . a fourth lock indicator 123 may be located on the bowl lid 114 such that , when aligned with a portion of the second lock indicator 121 , may inform the user that the bowl lid 114 is secured to the bowl 112 and in a working position . the bowl lid 114 may further include a handle lock 124 for assisting the user in aligning the bowl lid 114 properly on the bowl 112 and a pusher chute 126 for receiving a pusher 128 . there may also be a first locking mechanism ( not shown ) for securing the bowl 112 to the motor housing 102 , and a second locking mechanism ( not shown ) for securing the bowl lid 114 to the bowl 112 . the apparatus 100 may further include feet 130 which may be formed of a material , for example , rubber , which may provide a non - marking base for the apparatus 100 . the feet 130 may further be formed to provide a gripping function , e . g ., as suction cups , such that the apparatus 100 does not move on its working surface during operation . a cord wrap 132 may be provided to allow an electrical cord 210 ( fig2 ) to be wrapped up when the apparatus 100 is not in use or to shorten the cord 210 when in use . alternatively , a retractable cord assembly ( not shown ) may be provided . decorative items , e . g ., logo 134 , may be provided for additional information and / or for aesthetic purposes . fig2 is an exploded view of a first portion of the processing apparatus 100 . the motor housing 102 further includes a motor having a drive axis , e . g ., a motor assembly 202 , and related parts that generate the desired mechanical action . the motor housing 102 can have a base 204 and a body 206 . the motor housing 102 may also incorporate electric and / or electronic motor control devices such as a first printed circuit board 208 that , in this example , regulates and interfaces electrical power between a power cord 210 and the motor assembly 202 . also , the fig1 control panel 104 may include user interface and operation elements such as a membrane switch surface 212 which could include operational markings such as labels , embossments , etchings , or equivalent . these markings can correspond with individual controls , buttons and / or indicators contributing to the user interface system , e . g ., the buttons 105 - 110 . if desired , information could flow to and from the user through various intermediating elements , such as buttons and lights that in this example are attached to control plate 214 and light cover 216 . signals could flow between the various controls and indicators and a device such as a second printed circuit board 218 , which , in this example , creates the appropriate signals for the first printed circuit board 208 , causing the desired activity to occur . the motor housing 102 could also employ at least one suction cups , e . g . a foot 130 , that can help secure the apparatus to a work surface . the motor housing 102 could also include supporting hardware such as wire cover 220 that may constrain the power cord 210 in a fixed position inside the motor housing 102 . a motor supporter 222 , formed of , e . g ., rubber , could contain the motor assembly 202 which could rotate a motor axle gear 224 . the motor axle gear 224 , in turn , may mesh with a drivetrain assembly that may include at least one gear 226 ( e . g ., a star gear ), a gear bracket 228 , a first bushing 230 attached to the gear bracket 228 , and a second and third bushing 232 , 233 that may be attached to a bushing mount 234 . the bushings 230 , 232 , 233 may be formed of , e . g ., bronze . the drivetrain assembly can rotate a drive shaft 236 that could be positioned to be exposed to the exterior of the motor housing 102 , and can be supported by a drive shaft mount 238 . one or more parts of the drivetrain assembly may be enclosed or supported by a base gear cover 240 , a top gear case 242 , and a first washer 244 , e . g ., a bakelite washer . various components of the motor housing 102 may also be supported and protected by a sealing ring 246 , and a shock circle 248 . there can also be included optional trim elements such as a decorative cover 250 , a decorative ring 252 , and other decorative items , e . g ., the logo 134 . the apparatus 100 may be manufactured in an economical and reliable manner , for example , by using various assembly and fastening strategies that could include hardware such as fasteners 254 and screws 256 - 264 . at least some screws , for example , those visible to the user or subject to debris , may be covered by screw covers 265 . the motor housing 102 may also incorporate an interlock system that can permit the apparatus to operate only when it is properly configured . typically , the interlock system would detect the presence or absence of items necessary for operation . the interlock system may include a motor engagement device , e . g ., a microswitch 266 , that can restrict electrical power from flowing to the motor assembly 202 . alternatively , a mechanism such as a clutch could also be used for the motor engagement device to disrupt the flow of mechanical energy through the drivetrain assembly . the microswitch 266 within the interlock system may be actuated by a switch lever 268 that can be supported by a fulcrum bar 270 . the switch lever 268 may interface with an action bar 272 that can ordinarily be maintained in a default extended position as a result of pressure applied to the action bar 272 by a first spring 274 supported by a spring mount 276 . the action bar 272 may glide against a pin 278 connected to a first lever 280 , both of which may be contained within the drive shaft 236 . the first lever 280 may be a drive engagement device , and may be located in the drive shaft 236 . these items may then convey a common motion between an extended default position and a retracted position , the retracted position only being achievable against the pressure applied by the first spring 274 . the first lever 280 may interface with the exterior of the motor housing 102 , through the center of the drive shaft 236 . this arrangement allows the first lever 280 to convey its extended or retracted position to the microswitch 266 . the interlock system may be arranged so the presence of items deemed necessary for the operation of the apparatus causes the first lever 280 to assume its retracted position , allowing the machine to be activated . the proper orientation of the drive shaft 236 and the interlock mechanism may be maintained by additional hardware such as a fastening collar 282 , additional washers 284 , 285 and a securing gasket 286 . also , a drive shaft protector 288 may be introduced to ensure that the first lever 280 is only retracted by proper the installation of the items intended to be detected . the drive shaft protector 288 will be described in more detail below with respect to fig5 . now turning to fig3 , a second portion of the apparatus 100 is illustrated . the motor housing 102 ( fig1 and 2 ) may interface with a container assembly 300 that may include the bowl 112 and a bowl lid 114 . the bowl 112 may include the handle 116 that may further include a bowl handle cover 302 . the bowl 112 may be constructed so it can fit over the drive shaft 236 ( fig2 ). the bowl lid 114 may include a lid shaft 303 that may house a second lever 304 that retracts the first lever 280 ( fig2 ) only as a result of the proper installation of the bowl 112 , bowl lid 114 , and any other items required for operation . the apparatus 100 may further include blade tools 306 , 308 , 310 that can be positioned inside the bowl 112 on the drive shaft 236 and be rotated as a result of the mechanical action created by the motor housing 102 . the blade tools 306 , 308 , 310 may be reconfigurable and can be selected by the user based on the properties of the material to be processed by the apparatus and the intended results . the blade tools 306 , 308 , 310 may include a chopping blade 306 , a dough blade 308 , and a cutter disc 310 . one or more of the blade tools 306 , 308 , 310 may be secured to a blade shaft 312 that may be inserted into the bowl 112 and interfaced with the drive shaft 236 . some of these items may be stabilized by additional hardware such as a fox cap 314 . the blade shaft 312 may include one or more of an active region that can convey mechanical rotation to the inserted blade tools . the blade shaft 312 may also include one or more of an inactive region that could retain a blade tool without rotating it while the machine is otherwise operating or for storage when the apparatus 100 is not in use . this configuration could avoid having to provide exterior storage for unused blades or losing blades that are not in use . in addition , if the apparatus 100 is stored with the bowl lid 114 on the bowl 112 with the blades blade tools 306 , 308 , 310 in the bowl , accumulation of dust and debris may be averted . the user may add additional material into the container assembly while the apparatus 100 is operating . the pusher chute 126 may be included with the bowl lid 114 , to accept the additional material and the pusher 128 . also , to help the user insert the material , an outer pusher 316 may be provided for use as a tool that the user may insert into the pusher chute 126 to complete the introduction and processing of newly added material . the installation of the outer pusher 316 may ensure operation of the apparatus , and may protect the user from suffering direct contact with the rotating blade assembly . therefore , it may be desirable for the interlock to monitor and require the installation of the outer pusher 316 . the bowl lid 114 may include an engagement sensor 318 that may be secured by a bracket 320 and that may be maintained in a default extended position through mechanical pressure exerted by a second spring 322 . the engagement sensor 318 may be configured so the proper installation of the outer pusher 316 could cause the engagement sensor 318 to interact with a pusher engagement portion 602 ( fig6 ) and an optional pusher engagement portion ramp 604 ( fig6 ) included as part of the outer pusher 316 . this action causes the engagement sensor 318 to assume its retracted position against the force of the second spring 322 . the engagement sensor 318 also interacts with the second lever 304 that is similarly maintained in a default position through force applied by a lid spring , e . g ., a third spring 324 , located in the lid shaft 303 . as a result , the movements of the engagement sensor 318 and the second lever 304 can be related to the installation of the outer pusher 316 . through motion of the engagement sensor 318 and lid spring ( e . g ., third spring 324 ), the lid engagement device ( e . g ., the second lever 304 ) may be pushed down , which can move and engage the drive engagement device ( e . g ., the first lever 280 ) into the retracted , working , or operable position . when the outer pusher 316 is inserted into the pusher chute 126 , the bowl lid 114 is secured to the bowl 112 , and the bowl 112 is secured to the motor housing 102 , the apparatus 100 may be in a operable , or working , position . in this position , the lid engagement device ( e . g ., second lever 304 ), drive engagement device ( e . g ., first lever 280 ), and drive shaft 236 may be axially aligned . the drive engagement device ( e . g ., first lever 280 ) may be moved into the retracted position . one or more of these elements may be protected by a shelter 326 over the engagement sensor 318 and bracket 320 . also , a portion of the engagement sensor 318 may protrude into a lid shaft guide 328 located on the chute 126 to avoid actuation of the engagement sensor 318 by any object other than the pusher engagement portion 602 . the pusher engagement portion 602 may move through the lid shaft guide 328 , for example , as a rail . the second lever 304 may be positioned to interact with the first lever 280 . this configuration causes the interlock mechanism to only allow the machine to operate as a result of the proper installation of critical elements , such as one or more of the bowl 112 , the blade shaft 312 , the bowl lid 114 , and the outer pusher 316 . the outer pusher 316 may include an inner chute 606 ( fig6 ) that may accept additional material and may accept an inner pusher 330 that may be used as a tool to complete the insertion of material into the inner chute 606 . the inner pusher 330 may include a liquid intake port 332 to allow the user to pour fluid , e . g ., water , into the container assembly while the apparatus is operating without the need to remove parts and without the risk of the additional fluid splashing out of the machine upon contact with the rotating blade assembly . the inner pusher 330 and the outer pusher 316 may be joined by a pusher locking mechanism 334 , 336 so the plurality of pushers may be operated as a single assembly , e . g ., the pusher 128 shown in fig1 . fig4 shows a cross - section of the apparatus 100 such that elements of fig1 - 3 are illustrated in their assembled positions . it should be appreciated that , in the configuration shown , the apparatus 100 would be in an operative position , such that the interlock is engaged . fig5 shows a drive shaft protector 288 for use with the apparatus 100 . the drive shaft protector 288 includes a body 505 that fits over an end of the first lever 280 . the end of the end of the first lever 280 ( fig2 ) may protrude into the body and be accessible at a hole 515 such that the second lever 304 ( fig3 ) may contact and depress the first lever 280 when the outer pusher 316 is inserted into the chute 126 . an optional slot 510 may allow the side of the end of the first lever 280 to be visible inside the drive shaft protector 288 , which may in proper placement of the drive shaft protector 288 during assembly . fig6 depicts the outer pusher 316 , which includes the aforementioned part of the pusher locking mechanism 334 , the pusher engagement portion 602 , the optional pusher engagement portion ramp 604 , and the inner chute 606 . the outer pusher 316 also has a bottom surface 608 that includes an angled portion 610 . the angle of the angled portion 610 may be nonperpendicular to the drive axis . a nonlimiting example of an angle of the angled portion 610 may be 30 - 40 ° from a horizontal axis , or 50 - 60 ° from the drive axis . the angled portion 610 may also have an angle where it meets the remainder of the bottom surface 608 , e . g ., 30 °. during operation of the apparatus 100 , when the outer pusher 316 is inserted into the pusher chute 126 , the angled portion 610 generates an effect to force material that may stick to the outer pusher 316 or to the side of the pusher chute 126 through the blade tool in use ( e . g ., any of blade tools 306 , 308 , 310 ) and into the bowl 112 . embodiments of the a processing apparatus may include other functions . for example , a temperature control system , such as an ice vessel or heating device , may be provided . such a temperature control system may help to maintain food . an overflow switch may shut off machine , e . g ., in case of foaming or pressure buildup . in one embodiment , the switch may be attached to the engagement sensor 318 . an overflow spout can direct the exit path of material that exceeds the capacity of the container . embodiments may also include an automatic cleaning capability that allows the user to operate the machine while intentionally overfilling the container assembly with water or other cleaning material , causing it to exit through the overflow spout , thereby cleaning the parts of the apparatus that ordinarily interact with the material it is processing . an automatic drying capability , possibly used after the automatic cleaning cycle , may eliminate or expel most of the remaining water or cleaning material from the machine , such as by centrifugal action , airflow , heat , or similar activity involved with the apparatus &# 39 ; s operation an air intake control port can affect the results of the material being processed . this could be used for achieve specific results , such as in making whipped cream , shaving cream , or to condition dough or batter to control the fluffiness of the subsequently baked or cooked product . a serving or portioning mode may be provided in which the apparatus is operated in conjunction with the air intake , causing the air to displace contained material and a controlled amount of material to intentionally be discharged through the overflow spout . this could be used , for example , to allow the material within the apparatus to be distributed for individual consumption . embodiments include color coding of various parts , e . g ., the blade tools 306 , 308 , 310 , for easy reconfiguration and identification . additional embodiments of the invention may include an inverted design such that the motor housing 102 is located at the top of the apparatus and is installed suspended , for example , from under a kitchen counter or cabinet . further embodiments include an ice cream cycle , which may be a program mode to make ice cream and other frozen desserts . a power cord adapter may be provided which may include , for example , a specially flattened region to allow the entire unit to be placed inside an ordinary freezer such that the flattened region of the power cord may be positioned across the existing freezer door seal gasket to allow the freezer door to close and the freezer operate normally . embodiments may include a temperature sensor ( e . g ., a thermometer , thermocouple , or thermistor ) for measuring the temperature of processed material for use as part of the some modes of the control algorithm . the temperature sensor may be used with the aforementioned temperature control system or for processes and recipes requiring the real - time temperature to be considered when making control decisions . it should be appreciated that , although the material to be processed is often discussed as “ food ,” other materials may be processed . further , the materials described herein for forming various items of the apparatus 100 are not intended to be limiting , and are only provided as examples . the processes and devices in the above description and drawings illustrate examples of only some of the methods and devices that could be used and produced to achieve the objects , features , and advantages of embodiments described herein . thus , they are not to be seen as limited by the foregoing description of the embodiments , but only limited by the appended claims . any claim or feature may be combined with any other claim or feature within the scope of the invention . the many features and advantages of the invention are apparent from the detailed specification , and , thus , it is intended by the appended claims to cover all such features and advantages of the invention which fall within the true spirit and scope of the invention . further , since numerous modifications and variations will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation illustrated and described , and , accordingly , all suitable modifications and equivalents may be resorted to that fall within the scope of the invention .

US-87034610-A

waterproof , breathable gloves and a method of making the gloves are disclosed herein . the gloves are preferably used in cold weather applications such as fishing or hunting . the glove includes a laminate of a porous elastomeric material , a fabric layer , and a waterproof breathable film . a nonporous textured gripping surface provide feel and grip so that the gloves need not be removed when doing activities such as hunting .

fig1 shows the palm side of a glove 10 of the present invention . the glove 10 includes an elastomeric grip surface 20 for offering the user a good feel and grip , as well as providing adequate insulation when using the glove . the elastomeric grip surface 20 is nonporous such that water may not enter into the interior of the glove 10 and the grip surface 20 retains its waterproof characteristics . surrounding the nonporous elastomeric grip surface 20 is a fabric exterior 22 , preferably made from a thermoplastic polyamide ( nylon ). the fabric exterior 22 is laminated to a waterproof , breathable film 25 , preferably vapex , a monolithic hydrophilic polyurethane copolymer . the laminate comprising exterior 22 and film 25 is then laminated to a porous elastomeric core 24 , preferably neoprene , and a fabric interior 30 , preferably made from a thermoplastic polyamide ( nylon ). on the wrist portion 27 of the glove 10 is a flexible wrist band 28 made of elastic material for giving a tight insulating conformance around the user &# 39 ; s wrist . proximate the flexible wrist band 28 is a velcro ® hook and loop fastener wrist strap 26 . the wrist strap 26 provides further conformance of the wrist portion of the glove 27 to the user &# 39 ; s wrist . the wrist strap 26 is used to tighten the wrist portion of the glove 10 to the user such that insulating properties will not be lost or material such as snow or dirt may not enter into the interior of the glove 10 . fig2 shows the back 12 of the glove 10 . the back includes the laminate described in fig . i which comprises a fabric exterior 22 , a waterproof , breathable material 25 , a porous elastomeric material 24 , and a fabric interior 30 . the back of the glove 10 offers the maximum breathing of the hand because a grip surface 20 is not required . an interior 14 of the glove 10 is shown in fig3 . the interior 14 includes stitches 32 for the grip surface 20 . the stitches 32 do not extend entirely through the the laminates 40 , 50 of the glove 10 . if the stitches 32 did extend through to the laminates 40 , 50 , the stitches 32 would have holes therethrough which would allow the passage of water . a porous laminate portion 40 is shown in fig4 . the porous laminate portion 40 of the glove 10 includes an outer layer 43 of fabric material , preferably a thermoplastic polyamide . the outer layer 43 is laminated to a waterproof , breathable material 45 , preferably vapex , by a dry adhesive 48 . the vapex material was selected because it can stretch with the porous elastomeric core 44 without loosing its waterproof or windproof characteristics . the porous elastomeric core 44 is preferably made of a neoprene rubber and is adhered to the waterproof , breathable material 45 by dry adhesive 48 . the porous elastomeric core 44 has 1 / 16 inch holes 68 punched therethrough by a die press at 1 / 4 inch spacings . the interior layer 46 is a fabric material is attached by dry adhesive 48 . fig5 discloses a nonporous laminate portion 50 . the nonporous laminate portion 50 does not include outer layer 43 or waterproof , breathable material 45 . the nonporous laminate portion 50 has a textured outer surface 52 to offer a good grip to the user . the inner layer 46 is attached to the elastomeric core 54 by a dry adhesive 48 . with reference to fig6 the process of forming the porous laminate portion 40 is shown . dry adhesive 48 ( not shown ) is applied between outer fabric layer 22 and a waterproof , breathable material or film 25 . the dry adhesive between layers 22 and film 25 are then activated by pressure and friction from pressure rollers 61 , 60 . next , a porous elastomeric material 24 and a fabric layer 30 are provided . the porous elastomeric material 24 includes 1 / 16 inch holes punched therein . a dry adhesive 48 is applied between both film 25 and the porous elastomeric material 24 as well as between porous elastomeric material 24 and fabric layer 30 . the dry adhesive 48 between layers 25 , 24 , 30 is then activated by pressure rollers 62 , 63 to form porous laminate 40 . a wet adhesive is not used because it tends to clog the laminate . the porous laminate 40 and the nonporous laminate 50 are then cut in patterns and sewn together at seam 32 ( see fig3 ). seam 32 only penetrates part way through the material and a quick bonding adhesive is used to fill the seam 32 . the embodiments disclosed herein have been discussed for the purpose of familiarizing the reader with the novel aspects of the invention . although preferred embodiments of the invention have been shown , many changes , modifications and substitutions may be made by one having ordinary skill in the art without necessarily departing from the spirit and scope of the invention as described in the following claims .

US-27995894-A

one or more embodiments of the present invention disclose a system and method for enhancing the communication capabilities of a personal electronic device by modifying its existing battery module , adding communication circuitry to the modified module , and providing for the personal device to communicate in a wireless wide area network via this modified battery module . the system and method consists of a personal device &# 39 ; s existing battery pack modified to contain one or more wireless communication circuits , the wireless communication circuitry included in the modified battery module , and the method by which the personal device will communicate to the wwan using the modified battery module . the system can also be used to re - distribute wwan communication from the modified battery module , to one or more external personal devices , using near - field communications .

one or more embodiments of the present invention provide a way to update or extend the communication capability of the personal device without the user or carrier having to purchase an entirely new personal device . using one or more embodiments , a user may purchase , or be provided by a carrier , a modified battery pack containing the additional communication method . the personal device then uses the circuitry contained in the modified battery pack to communicate to the wwan , instead of or in addition to its current capability . for instance , when a new communication method such as 4 th - generation ( 4 g ) wireless is fielded by the carrier , the existing personal device containing only 2 nd - generation or 3 rd - gen wireless capability need not be rendered obsolete . instead , a modified battery pack containing 4 g wireless communication circuitry may be inserted in the existing personal device , such that the personal device now can utilize 4 g wireless communication capability . the same method can be used to provide a 4 g wireless device with second generation or third generation wwan capabilities , where the wwan modem in the battery pack adds to the wwan capabilities of the device . fig1 depicts a high - level functional block diagram of a personal device 100 in which an embodiment of the present invention may be incorporated . the personal device is portable , meaning it is powered by a battery module 104 containing control and charging circuitry 105 , with the majority of the battery volume of the assembly taken up by energy storage cells 106 using chemical technology such as lithium - ion or nickel - cadmium , for example . in portable personal devices , the battery assembly usually forms a removable module 104 contained within a distinct battery compartment 102 . the battery module usually can be removed either by hand manipulation , or using simple tools . the reason for this modularity is that the battery assembly sometimes requires replacement . the storage cells or control circuitry may fail , may need updating to increase capacity , or may need replacing to reduce weight and size through technology improvements . the personal device may have been manufactured containing a set of one or more methods of communication 103 with the internet , wireless wwan , or other personal devices . examples of communication methods built into the personal device at time of manufacture include ( 1 ) telecommunications industry association ( tia ) standard ev - do , revisions 0 , a , and b ; ( 2 ) third - generation partnership project ( 3gpp ) standard umts and its variations high - speed packet data ( hspa ); ( 3 ) 3rd generation partnership project 2 ( 3gpp2 ) standard is - 2000 ; ( 4 ) groupe special mobile standard global system for mobile communications ( gsm ) and its variation enhanced data rates for gsm evolution ( edge ); ( 5 ) bluetooth ; and ( 6 ) institute of electrical and electronics engineers ( ieee ) 802 . 11 wireless lan ( aka “ wifi ”). the set of communication capabilities 103 built into the personal device during manufacture and at time of sale , are usually fixed , that is , the electronics implementing these communication capabilities are not removable and cannot be replaced or upgraded easily . after time of sale , the user may require an additional or newly - fielded communication method which was beyond the capability of the personal device at the time of sale . or , it may be found that the existing communication capability 103 of the personal device does not provide adequate connectivity , or subjects the user or network carrier to roaming charges or other expensive fees . to overcome these limitations without the invention described in one or more embodiments of this disclosure , the user currently must purchase an entirely new personal device containing the required additional communication methods . for instance , if an owner of a personal device containing only evdo ( a “ 3rd - generation ” wireless internet access technology ) needs to access the internet using the newly - fielded long - term - evolution ( lte ) standard , there is currently no easy way for the owner of the personal device to accomplish this , unless an entirely - new personal device containing hardware which implements the lte standard is purchased . this can be costly for the user , and wasteful of otherwise useful personal device hardware . the personal device may contain a high - cost and high - performance display , keypad , memory , audio and video camera hardware , and be in perfect working order for some communication uses . but for want of the set of newly - required communication capabilities , the entire device may be rendered obsolete and in need of replacement . fig2 depicts a high - level functional block diagram of a personal device 200 as in fig1 , but in which an embodiment of the present invention has been incorporated . in fig2 , the removable battery assembly 204 has been modified to incorporate an additional set of communication methods ( 207 , 208 ) using circuitry ( 207 , 208 , 209 , 210 ) designed to fit within the volume footprint of the battery assembly . the additional communication circuitry ( 207 , 208 ) inserted into the battery assembly may include radio frequency ( rf ) power amplifiers ( pa ), low - noise receiver amplifiers ( lna ), frequency down - converters and digitizing hardware , baseband processing microprocessors and other discrete circuitry , and antennas ( 209 , 210 ). in the embodiment shown in fig2 , the set of communication methods ( 207 , 208 ) include circuits designed to implement near - field communication 208 between the modified battery module and hosting personal device , as well as circuits designed to implement various wwan standards 209 . examples of wwan standards implemented by the modified battery 200 may include 3gpp long - term evolution ( lte ) and tia standard evdo . examples of near - field communication implemented by the modified battery 200 may include bluetooth or 802 . 11 wireless lan . the additional communication circuitry ( 207 , 208 , 209 , 210 ) inserted into the battery assembly is powered by the battery cells 206 and control circuitry 205 , as is the hosting personal device . to accommodate the additional communication circuitry ( 207 , 208 , 209 , 210 ), the battery &# 39 ; s chemical cell 206 size has been reduced , resulting in somewhat reduced battery capacity and resulting increased frequency of charging the personal device required . fig3 depicts a high - level functional block diagram of a personal device 300 as in fig1 and 2 , but illustrating how one embodiment of the present invention has been incorporated and is used by the hosting personal device . following fig3 , in one example embodiment , the personal device connects to the modified battery module using ieee 802 . 11 wireless lan 320 . the modified battery module communicates to the wwan 310 using long - term evolution ( lte ), which in this example the personal device 300 did not support at time of manufacture . in this embodiment , the modified battery effectively presents a wifi “ hotspot ” for the personal device to initiate and continue a tcp / ip data connection to the internet using the lte wwan . also following fig3 , in another example embodiment , the personal device connects to the modified battery module using bluetooth near field communication ( nfc ) 300 . the modified battery module communicates to the wwan 310 using 1x - cdma2000 . in this example , the personal station only supports gsm circuit - switched calls . in this embodiment , the modified battery effectively presents a way for the personal device to initiate and continue a circuit - switched telephone connection . in this example , the personal station avoids expensive roaming charges over a non - home gsm network when there is a home cdma2000 network available to use . fig4 depicts a high - level decision - tree diagram 400 illustrating how , in one embodiment of the present invention , the personal device and modified battery pair as shown in fig1 , 2 and 3 , may decide when to use either the host device &# 39 ; s communication circuitry , or the modified battery &# 39 ; s communication circuitry , to provide service to the user . following fig4 , in one example embodiment , when the personal device is powered on 401 , the personal device and modified battery both attempt to acquire service 402 . subsequently , the personal device acquires service a , while the modified battery acquires service b . service a and b may be one of a set of communication methods such as , but not limited to : no service , cdma - 2000 , gsm / edge , evdo , umts / hspa , lte , or other wireless communication technology . after both personal device and modified battery acquire service , software implementing decision criteria ( 404 , 405 ), contained within either the personal device , or modified battery , or both , makes note of the signal strength and roam status of both service a and service b . in the first decision criteria evaluation 404 , if service a &# 39 ; s roam status is true ( roaming on non - home system ) or signal strength is weak , a further decision criteria 405 is evaluated , that is , if service b &# 39 ; s roam status is true ( roaming on non - home system ) signal strength is weak . in the embodiment of fig4 , if roam status of service a is false ( in home system not roaming ), and if service a &# 39 ; s signal strength is strong ( not weak ), the personal device will use service a to provide service to the user ( action block 407 ). also in the embodiment of fig4 , if roam status of service b is true ( roaming on non - home system ), or if service b &# 39 ; s signal strength is weak ( not strong ), the personal device will still use service a to provide service to the user ( action block 407 ). finally , in the embodiment of fig4 , if roam status of service a is true ( roaming on non - home system ) or if service a &# 39 ; s signal strength is weak ( not strong ), and , if the roam status of service b is false ( in home system not roaming ), and if service b &# 39 ; s signal strength is strong ( not weak ), the personal device will use service b to provide service to the user ( action block 406 ). fig5 depicts a high - level decision - tree diagram 500 illustrating , in another embodiment of the present invention , how a personal device and modified battery pair as shown in fig1 , 2 and 3 , may decide when to use either the host device &# 39 ; s communication circuitry , or the modified battery &# 39 ; s communication circuitry , to provide service to the user . following fig5 , in another example embodiment , when the personal device is powered on 501 , the personal device and modified battery both attempt to acquire service . subsequently , the personal device acquires service a , while the modified battery acquires service b ( 502 ). service a and b may be one of a set of communication methods such as , but not limited to : no service , cdma - 2000 , gsm / edge , evdo , umts / hspa , lte , or other wireless communication technology . after both personal device and modified battery acquire service 502 , software implementing decision criteria ( 504 , 505 ), contained within either the personal device , or modified battery , or both , makes note of the relative preference ( to user or carrier ), and instantaneous data performance inherent in both service a and service b ( 503 ). then , in a first decision criterion 504 if service b uses a technology which is preferred to service a , a further decision criteria 505 is evaluated , that is , the instantaneous data service performance adequacy ( such as serving data rate capability for example ) of service b relative to some minimum performance criterion . fig6 depicts a high - level functional block diagram of a personal device 600 as in fig1 and 2 , but illustrating one method by which the modified battery in the hosting personal device , may be used to redistribute the communication with the wwan , to one or multiple external devices , using near - field communication . following fig6 , in one example embodiment , the personal device connects to the modified battery module using ieee 802 . 11 wireless lan or bluetooth 620 . the modified battery module communicates to the wwan 610 using long - term evolution ( lte ), which in this example the personal device 600 did not support at time of manufacture . in this embodiment , the modified battery effectively presents a wifi or bluetooth “ hotspot ” for both the hosting personal device 600 , and one or multiple external personal devices 630 , to initiate and continue a tcp / ip data connection to the internet using the lte wwan .

US-201113217457-A

a method of fabricating a high - performance planar back - gate cmos structure having superior short - channel characteristics and reduced capacitance using processing steps that are not too lengthy or costly is provided . also provided is a high - performance planar back - gate cmos structure that is formed utilizing the method of the present invention . the method includes forming an opening in an upper surface of a substrate . thereafter , a dopant region is formed in the substrate through the opening . in accordance with the inventive method , the dopant region defines a back - gate conductor of the inventive structure . next , a front gate conductor having at least a portion thereof is formed within the opening .

the present invention , which provides a method for forming a high - performance planar back - gate cmos and the resultant back - gate structure , will now be described in greater detail by referring to the drawings that accompany the present application . it is noted that the drawings of the present application are provided for illustrative purposes and thus the structures shown therein are not drawn to scale . also , it is observed that although the description that follows shows the formation of a single planar back - gate cmos structure , the inventive method can be used to form a plurality of said planar back - gate cmos structures on a surface of a single substrate . the following description is made using a semiconductor - on - insulator substrate including either a top si layer , or a top sige layer . although the detailed discussion that follows employs a semiconductor - on - insulator substrate , the present invention is not limited to using such a substrate . instead , bulk semiconductor substrates including , si , sige , sigec , sic , inas , inp , gaas and other iii / v or ii / iv compound semiconductors may be used in place of the semiconductor - on - insulator . in a preferable embodiment of the present invention , the initial substrate is a si - containing substrate such as a si - on - insulator ( soi ). reference is first made to fig1 which illustrates one type of substrate 10 that can be employed in the present invention . as shown , substrate 10 is a semiconductor - on - insulator that includes a bottom semiconductor layer 12 , a buried insulating layer 14 and a top semiconductor layer 16 . typically , the top and bottom semiconductor layers are comprised of a si - containing semiconductor such as , for example , si , sige , sic , sigec , si / si , si / sic , or si / sigec . typically , the top and bottom semiconductor layers are comprised of si or sige , with si being most preferred . the buried insulating layer 14 , which electrically isolates the top semiconductor layer 16 from the bottom semiconductor layer 12 , may comprise a crystalline or non - crystalline oxide , or nitride . preferably , the buried insulating layer 14 is comprised of an oxide . the buried insulating layer 14 may be continuous , as shown , or it may be non - continuous , e . g ., the buried insulating layer 14 may comprise discrete and isolated regions or islands of insulating material surrounded by a semiconductor . the semiconductor - on - insulator substrate 10 shown in fig1 is fabricated using techniques well known to those skilled in the art . for example , the semiconductor - on - insulator may be formed by ion implantation and annealing , or by a layer transfer process . alternatively , the substrate 10 can be formed by deposition of the various layers onto a bulk semiconductor substrate . the thickness of the various layers of the initial semiconductor - on - insulator substrate 10 may vary depending on the process used in making the substrate . typically , however , the top semiconductor layer 16 has a thickness from about 20 to about 200 nm , with a thickness from about 40 to about 70 nm being even more typical . the buried insulating layer 14 typically has a thickness from about 1 to about 100 nm , with a thickness from about 5 to about 20 nm being even more typical . the thickness of the bottom semiconductor layer 12 is inconsequential to the present invention . it is observed that the thicknesses provided above are typical ranges for each of the layers , which in no way limits the scope of the present application . it is noted that if the initial semiconductor - on - insulator substrate 10 includes a top semiconductor layer 16 that is too thick , beyond the ranges specified above , the top semiconductor layer 16 can be subjected to a thinning process such as chemical mechanical polishing ( cmp ), grinding or oxidation and etching . after providing a substrate such as the substrate 10 shown in fig1 , trench isolation regions 18 are formed into the substrate utilizing techniques well known in the art . specifically , the trench isolation regions 18 are formed by lithography , etching a trench into the substrate and filling the trench with a trench dielectric material such as an oxide . the lithography step includes applying a photoresist ( not shown ) to the substrate , exposing the photoresist to a pattern , i . e ., trench pattern , of radiation and developing the exposed resist using a conventional resist developer . the etching step may include a dry etching process such as , for example , reactive ion etching ( rie ), ion beam etching , plasma etching or laser ablation . alternatively , a chemical wet etch process may be used in forming the trench opening in the substrate . the trench isolation regions 18 can extend down into the buried insulating layer 14 , as shown , or they can have a bottom surface that is above the uppermost surface of the buried insulating layer 14 . it is observed that a pair of neighboring trench isolation regions 18 can be used to form an isolated top semiconductor island 16 such as shown in fig2 . next , a trench contact 20 is formed by lithography , etching and trench fill , so as to provide an electrical contact from the top surface of the substrate to the bottom semiconductor layer 12 . the trench contact 20 is filled with a conductive material such as , for example , doped polysilicon . the trench contact 20 will be used as an electrical pathway to the back - gate conductor to be subsequently formed in the substrate . it is observed that a planarization process can follow the formation of both the trench isolation regions 18 and the trench contact 20 , as desired . the planarization process includes cmp , grinding or a combination thereof . a material stack 22 is then formed on the upper surface of the substrate 10 providing the structure shown , for example , in fig3 . the material stack 22 may comprise any number of layers . illustratively , the material stack 22 comprises a lower insulator 24 , a polysilicon layer 26 , and an upper insulator 28 . the lower insulator 24 and the upper insulator 28 are comprised of different insulating materials . typically , the lower insulator 24 of the material stack 22 is comprised of an oxide such as sio 2 and the upper insulator 28 is comprised of a nitride such as si 3 n 4 . the material stack 22 is formed utilizing a combination of processes such as , for example , deposition and / or thermal growth . suitable deposition processes that can be used in forming the various layers of the material stack 22 include chemical vapor deposition ( cvd ), plasma enhanced chemical vapor deposition ( pecvd ), atomic layer deposition , evaporation , chemical solution deposition or other like deposition processes . epitaxy can be used in forming the polysilicon layer 26 of the material stack 22 . the overall thickness of material stack 22 may vary depending on the number of layers within the stack . typically , the material stack 22 has a total thickness from about 15 to about 100 nm , with a thickness from about 20 to about 50 nm being even more typical . for the specific embodiment illustrated in which the material stack 22 comprises the lower insulator 24 , the polysilicon layer 26 , and the upper insulator 28 , the following thickness ranges can be employed : lower insulator 24 having a thickness from about 4 to about 25 nm , polysilicon layer 26 having a thickness from about 3 to about 15 nm , and upper insulator 28 having a thickness from about 7 to about 60 nm . after providing the material stack 22 on the substrate , an opening 30 is the formed into the material stack 22 and , optionally an upper surface of the substrate 10 , e . g ., an upper surface of top semiconductor layer 16 , utilizing conventional lithography and etching . one or more etching processes ( dry , wet or a combination thereof ) can be used in forming the opening 30 . the structure including the opening 30 is shown , for example , in fig4 . next , and as shown in fig5 , the structure shown in fig4 is subjected to a thinning process that includes a series of oxidation and etching steps wherein the etching is a selective etch that removes oxide . this step serves to thin the exposed top semiconductor layer 16 of the initial substrate 10 to provide a region of top semiconductor 16 ′ having a thickness from about 5 to about 25 nm . after performing the thinning step shown in fig5 , a sacrificial oxide 32 is formed within the opening 30 on all exposed surfaces ( including sidewalls and bottom wall ) of the top semiconductor layer 16 . the structure including the sacrificial oxide 32 is shown , for example , in fig6 . the sacrificial oxide 32 is formed utilizing a thermal oxidation process and it typically has a thickness of less than about 5 nm , with a thickness from about 1 to about 2 nm being even more typical . after sacrificial oxide 32 growth , a patterned mask 34 is formed on the upper surface of the material stack 22 utilizing conventional deposition and lithography . the patterned mask 34 , which has an opening that has a lateral width greater than the opening 30 , is used in forming well regions within the substrate 10 . fig7 shows the structure during implantation of a first well region . reference numeral 36 is used to denote ions being implanted into the substrate , while reference numeral 38 denotes the first well region that is formed . in accordance with the present invention , the first well region 38 serves as the back - gate conductor of the inventive structure . the ions 36 used in this step of the present invention are of a second conductivity type that is different from the first conductivity type present in the initial substrate . typically , the ions 36 are implanted to provide a first well region 38 that is heavily doped . by “ heavily doped ” it is meant a concentration of said second conductivity type ion from about 1 × 10 19 to about 1 × 10 21 atoms / cm 3 . the ions 26 are implanted utilizing conditions , e . g ., energy , that are sufficient to penetrate through the top semiconductor layer 16 and 16 ′; and the buried insulating layer 14 into the bottom semiconductor layer 12 . a typical implant energy that can be used in the present invention includes a range from about 0 . 2 to about 2 kev . following the formation of the first well region 38 and with the patterned mask 34 in place , exposed portions of the material stack 22 , e . g ., the upper insulator 28 and the polysilicon layer 26 , not protected by the patterned mask 34 , are removed utilizing an etching process such as reactive ion etching . next , and as shown in fig8 , a second well region 42 is formed by implanting ions 40 into the substrate though opening 30 . the second well region 42 has a doping concentration of second conductivity type ions that is less than the concentration of second conductivity ions in the first well region 38 . typically , the second well region 42 has a dopant concentration of about 5 × 10 18 atoms / cm 3 or less . the energy used in this implant step is sufficiently great so as to penetrate the entire film stack comprising layers 28 , 26 , and 24 , thereby reaching the top semiconductor layer 16 that is beneath this stack . thus , energies for this step may range from 40 kev to above 200 kev , depending on the exact thickness employed for the stack . following the formation of both well regions 38 and 42 , the patterned mask 36 is removed from the structure utilizing a conventional stripping process and thereafter the upper insulator 28 and the polysilicon layer 26 of the material stack 22 are removed stopping atop the lower insulator 24 . layers 28 and 26 are removed utilizing a conventional planarization process such as , for example , cmp . next , a spacer 44 , as shown in fig9 , is formed within the opening 30 atop the sacrificial oxide 32 . the spacer 44 is formed by deposition and etching . the spacer 44 is comprised of an insulating material including , for example , an oxide , nitride , oxynitride or any combination thereof . preferably , the spacer 44 is comprised of a nitride such as si 3 n 4 . following spacer 44 formation , the exposed portions of the sacrificial oxide 32 are removed to expose the underlying surface of the thinned top semiconductor layer 16 ′. this step of the present invention comprises a wet etching process that selectively removes oxide . the resultant structure formed after removing the exposed portion of sacrificial oxide 32 within opening 30 that are not protected by spacer 44 is shown in fig1 . fig1 shows the structure after formation of gate dielectric 46 and front gate conductor 48 on the structure of fig1 . as shown , both the gate dielectric 46 and the front gate conductor 48 are formed within the opening 30 and a portion of the front gate conductor 48 is also formed outside of the opening 30 . the gate dielectric 46 can be formed by a thermal growing process or , alternatively , by a conventional deposition process such as cvd or pecvd . the gate dielectric 46 is a thin layer having a thickness that is from about 1 to about 5 nm . the gate dielectric 46 may be composed of a conventional oxide such as , but not limited to : sio 2 , sio x n y , al 2 o 3 , ta 2 o tio 2 or a mixed metal oxide , e . g ., a perovskite - type oxide . the gate dielectric 46 may also comprise a stack of more that one of the aforementioned dielectric materials . the front gate conductor 48 is formed on the gate dielectric 46 utilizing a conventional deposition process such as , for example , cvd or pecvd . the front gate conductor 48 may comprise a doped si - containing layer , i . e ., doped polysi or doped sige , a conductive metal , an alloy including a conductive metal , a conductive metal silicide , a conventional metal nitride or any combination thereof . typically , the front gate conductor 48 is comprised of polysilicon . when si - containing layers are used , the si - containing layer can be doped in - situ or following deposition utilizing ion implantation and annealing . after forming the gate dielectric 46 and the front gate conductor 48 , the structure shown in fig1 is planarized by cmp or another like planarization process such as an etch back process , to provide the structure shown in fig1 . it is observed that both the gate dielectric 46 and the front gate conductor 48 are located only within the opening 30 after this planarization step . next , the lower insulator 24 is removed from the structure utilizing a conventional etching process that selectively removes the lower insulator 24 and thereafter a recess etch is performed to recess at least the front gate conductor 38 and optionally a portion of the top semiconductor layer 16 from the planarized structure . the structure that is formed after these steps have been performed is shown in fig1 . a second patterned mask 50 is then formed on the surface of the structure utilizing conventional deposition , lithography and thereafter source / drain regions 54 are formed by implanting ions 52 into the exposed top semiconductor layer 16 . the structure during the step of the present invention is shown in fig1 . the steps can be repeated to form source / drain regions for nfets or pfets , if both are present . fig1 shows the structure after removing the patterned mask 50 , and after performing an activation anneal . the conditions for the activation anneal are well known in the art and can vary depending on whether a furnace anneal , a laser anneal , a spike anneal or a rapid thermal anneal is used . typically , the dopants within the source / drain regions 54 are activated by a rapid thermal anneal that is performed at a temperature of greater than 900 ° c . for a time period of about 10 seconds or less . fig1 shows the structure after silicide 56 formation . the silicide 56 forms on all exposed surfaces that contain silicon . the silicide 56 is formed utilizing a conventional silicidation process in which a silicide metal such as , for example , ti , co , w , or ni , is formed on the surface of the structure by a conventional deposition process . following the deposition of the silicide metal , a single anneal step that is capable of causing a metal silicide to form is performed . remaining metal not reacted with silicon is then removed by a selective etching process and a second optional anneal can be performed . the first anneal is typically performed at a lower temperature than the optional second anneal . in embodiments in which the front gate conductor 48 is not comprised of a si - containing material , silicide 56 does not form thereon unless a source of silicon is first provided . fig1 shows the structure after interconnect 58 formation . the interconnect 58 is formed utilizing conventional techniques well known to those skilled in the art . this includes deposition of an interlevel dielectric 60 , providing lines 62 and vias 64 within the interlevel dielectric and filling said lines and vias with a conductive metal such as , for example , doped polysilicon , w , al , or cu . in fig1 , the labels drain , gate , source , and back - gate refer to the contacts formed to each of those regions . it is observed that fig1 - 17 include the planar back - gate cmos structure of the present invention . in broad terms and as stated above , the planar back - gate structure includes a substrate 10 having a back - gate conductor 38 whose lateral dimension is substantially defined , e . g ., self - aligned , by an opening 30 located in an upper surface of said substrate ; a front gate conductor 48 having a portion thereof that is located within the opening 30 ; and source / drain regions 54 located adjacent to opposite sides of the front gate conductor 48 . while the present invention has been has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in forms and details may be made without departing from the scope and spirit of the present invention . it is therefore intended that the present invention not be limited to the exact forms and details described and illustrated , but fall within the scope of the appended claims .

US-16153405-A