Datasets:

tharindu

/

patents

like 0

a hospital garment for preventing removal of incontinent briefs , diapers or wound dressings including a main body that defines a front , back , top and bottom . a neck opening is formed in the top of the main body . also , the main body forms a left arm opening and a right arm opening one each side of the neck opening . a crotch flap extends from the front of the main body . the crotch flap defines a distal end that is removably attachable to the back of the main body to establish a left leg opening and a right leg opening . in one embodiment , the bottom edge of the back of the main body is fastened to the proximal end of the crotch flap in addition to the attachment of the distal end of the crotch flap to the back of the main body .

referring more specifically to the drawings , for illustrative purposes the present invention is embodied in the apparatus generally shown in fig1 through fig5 . it will be appreciated that the apparatus may vary as to configuration and as to details of the parts without departing from the basic concepts as disclosed herein . referring first to fig1 fig2 and fig3 an embodiment of a hospital garment 10 is shown . preferably garment 10 is manufactured from a soft , pre - shrunk cotton material that will maintain its dimensions after multiple washings . in the front view of garment 10 in fig1 it can be seen that garment 10 includes a main body portion 12 that is preferably of a pullover type construction having a front panel f and a rear panel r that are open at the bottom b , as well as a crotch flap portion 14 that extends from the bottom of front panel f in a downward direction when in the unfastened or open position . main body portion 12 also includes a neck opening 16 at the top of main body portion 12 through which a wearer &# 39 ; s head can extend , and left 18 and right 20 arm openings through which the wearer &# 39 ; s arms can extend . main body portion 12 is supported on the wearer by a pair of shoulder straps 22 , 24 . as shown , left 18 and right 20 arm openings are separated from neck opening 16 by left shoulder strap 22 and right shoulder strap 24 , respectively . preferably , neck opening 16 is scoop - shaped , as shown , but it is to be appreciated that neck opening 16 can be v - shaped or any other desired shape in order to promote comfort and proper fit of the garment to the user . arm openings 18 , 20 are preferably sized and shaped to allow the arms of the wearer to pass therethrough when initially placed upon the wearer as described below . [ 0028 ] fig1 also shows that crotch flap portion 14 defines a proximal end 26 and a distal end 28 . as shown , proximal end 26 extends from the bottom of front panel f of main body portion 12 . it is to be appreciated that main body portion 12 and crotch flap portion 14 can be manufactured separately and then attached to each other , e . g ., by sewing . or , in the alternative , main body portion 12 and crotch flap portion 14 may be manufactured as one integral unit . as shown in fig1 and fig2 at least one fastener 30 is attached to the inside face of crotch flap portion 14 at distal end 28 . additionally , at least one opposing fastener 32 is attached to the rear panel r of the main body 12 of the garment 10 . thus , crotch flap portion 14 can be pulled between a wearer &# 39 ; s legs and fastened to rear panel r as shown in fig3 . fastener 32 is preferably positioned at a height on rear panel r that impedes the wear from reaching behind and unfastening crotch flap portion 14 . in fig1 through fig3 fastener 32 is shown positioned slightly below the midpoint of rear panel r ( e . g ., midpoint of the wearer &# 39 ; s back ) as an example . it will be appreciated that the position can vary , but that higher positions are preferred over lower positions to thwart the wearer &# 39 ; s ability to unfasten crotch flap portion 14 . fasteners 30 , 32 are preferably strips of hook and loop fasteners such as velcro ®. the size of the fasteners can vary , but typical sizes are on the order of approximately one inch to four inches in height and approximately 6 inches in length . while strips of hook and loop fasteners 30 , 32 are preferred , it will be understood that other types of fasteners indicated as fasteners 30 ′, 32 ′ could be used instead , such as snaps , buttons and buttonholes , circular hook - and - loop fasteners or any other similar fasteners known in the art . referring more particularly to fig3 garment 10 is shown with crotch flap portion 14 fastened in place , i . e ., fastener 30 on crotch flap portion 14 is engaged with the opposing fastener 32 on rear panel r . as shown , when crotch flap portion 14 is fastened in place , left 34 and a right 36 leg openings are established to the left and right sides of crotch flap portion 14 , respectively . referring again to fig2 rear panel r preferably includes a fastener 38 attached to the inside face of a tab 40 of garment material that extends downward from the bottom edge b of rear panel r . for example , rear panel r would be patterned for tab 40 when cut . a corresponding fastener 42 is attached to the inside face of crotch flap portion 14 near proximal end 26 as shown in fig1 and fig2 . these opposing fasteners , which are also preferably hook and loop type fastener strips , but which could also be other types of fasteners , are preferably vertically and horizontally aligned . in this way , after the garment is placed over the head , arms and torso of the wearer , fastener strip 38 is fastened with corresponding fastener strip 42 by simply pressing the fasteners together . this results in the formation of a crotch for the garment as well as defines leg openings 34 , 36 . as an alternative to attaching fastener 38 on the inside of tab 40 , the tab could be made longer and the fastener attached to the outside face of the tab . the tab would then be folded or rolled under rear panel r so that the fasteners are aligned for engagement . once fasteners 38 , 42 are engaged and the crotch area formed , the distal end 28 of crotch flap portion 14 is drawn through the legs of the wearer and pulled up the wearer &# 39 ; s back to a final position where fasteners 30 , 32 can be fastened together . thus , two sets of fasteners 30 , 32 and 38 , 42 keep garment 10 positioned snugly over the incontinent brief of the wearer , and denies them access to the brief so as to prevent removal of the brief . turning now to fig4 an alternative embodiment of garment 10 with crotch flap portion 14 in the secured position is shown . this figure corresponds to fig3 except that in this embodiment rear panel r includes a back slit 44 extending downwardly from neck opening 16 at the top to a point preferably below the position of the shoulders . slit 44 will allow greater ease in the donning of garment 10 on a patient by the caregiver . the portions of rear panel r defined by slit 44 can be drawn together and secured with at least one back slit fastener 46 adjacent one edge of slit 44 that engages a corresponding fastener 48 adjacent the second edge of slit 44 . fasteners 46 , 48 can be snaps , buttons , hook - and - loop fasteners or any other similar fasteners well known in the art . it will be appreciated that the portions of rear panel r defined by back slit 44 can be fastened in place in order to hold the garment snugly on the wearer &# 39 ; s body . in the embodiment shown , one side of the back slit 44 has a back flap 50 that holds one set of fasteners 48 that are configured to fasten with opposing fastener 46 on the second side of the back slit 44 . lastly , referring fig5 a rear view of the garment corresponding to the view in fig2 is shown except that fasteners 30 , 32 are larger strips of hook and loop type fasteners . using a larger square or rectangular strip of hook and loop type fastener for fastener 32 , preferably approximately four inches in height and approximately six inches in length , allows the caregiver to fasten crotch flap portion 14 in place with less concern about aligning fasteners 30 , 32 . this is particularly useful when the care giver is having difficulty with dressing a patient with the garment . it is to be understood that in a preferred manner garment 10 is donned while fasteners 30 , 32 and fasteners 38 , 42 , and fasteners 46 , 48 ( if used as in the embodiment of fig4 ) are unfastened . garment 10 can be placed over the wearer &# 39 ; s torso so that his or her head protrudes through neck opening 16 and his or her arms extend through arm openings 18 , 20 . once the garment is over the torso of the wearer , fasteners 38 , 40 are fastened together to join proximal end 26 of crotch flap portion 14 to tab 40 , thereby forming a crotch and leg openings . then , crotch flap portion 14 can be pulled between the wearer &# 39 ; s legs and fastened to rear panel r by engaging fasteners 30 , 32 . additionally , if present , the sides of back slit 44 can be brought together to tighten the main body 12 of the garment 10 to the wearer by engaging fasteners 46 , 48 . as can be seen , therefore , garment 10 is worn like a body suit over an incontinent brief and any dressings over wounds such as bedsores . since fasteners 30 , 32 , and 46 , 48 are on the back of the garment , and because fasteners 38 , 42 are covered by crotch flap portion 14 , the garment cannot be easily removed and a wearer will be unable to remove an incontinent garment underneath . also , garment 10 will prevent or minimize the likelihood of a wearer removing any dressings . it is also to be understood that garment 10 can be manufactured in various sizes , e . g ., small , medium , large , extra - large , etc ., in order to accommodate men , women , and children of all sizes . also , neck opening 16 , arm openings 18 , 20 , and leg openings 34 , 36 are established as to maximize the comfort of the wearer . further , it is to be understood that back slit 44 can be omitted in embodiments that have an oversized neck opening 16 . accordingly , it will be seen that this invention provides a garment that can effectively restrict the removal of incontinent briefs or diapers by an invalid patient that is easy to put on and comfortable to wear . although the description above contains many specificities , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . therefore , it will be appreciated that the scope of the present invention fully encompasses other embodiments which may become obvious to those skilled in the art , and that the scope of the present invention is accordingly to be limited by nothing other than the appended claims , in which reference to an element in the singular is not intended to mean “ one and only one ” unless explicitly so stated , but rather “ one or more .” all structural , chemical , and functional equivalents to the elements of the above - described preferred embodiment that are known to those of ordinary skill in the art are expressly incorporated herein by reference and are intended to be encompassed by the present claims . moreover , it is not necessary for a device or method to address each and every problem sought to be solved by the present invention , for it to be encompassed by the present claims . furthermore , no element , component , or method step in the present disclosure is intended to be dedicated to the public regardless of whether the element , component , or method step is explicitly recited in the claims . no claim element herein is to be construed under the provisions of 35 u . s . c . 112 , sixth paragraph , unless the element is expressly recited using the phrase “ means for .”

US-99256501-A

a test controller and method to operate a rotary motor of a pump are provided . the test controller includes a test speed circuit electrically coupled to , but detachable from , the pump and being configured to apply at least one signal to the pump motor to cause the pump motor to rotate at a predetermined test speed and / or for a predetermined test time . an actuator selectively activates the test speed circuit to operate the pump motor at the predetermined test speed and / or for the predetermined test time . the method includes electrically coupling the test controller to the pump and , in response to selective activation of the actuator , selectively activating the test speed circuit to apply at least one signal to the pump motor to operate the pump motor at a predetermined test speed and / or for a predetermined test time . the method further includes detaching the test controller from the pump .

turning to the drawings , wherein like notations denote like parts , fig1 illustrates one embodiment of an implantable rotary pump device 10 ( hereinafter , “ pump ” 10 ) having a rotary pump motor 12 ( hereinafter , “ pump motor ” 12 ) and impeller 14 . the implantable pump 10 includes an input port 16 to which a flexible input cannula body 18 may be connected to input fluid to the pump 10 , as well as an output port 20 to which a flexible output cannula body 22 may be connected to output fluid from the pump 10 . a cable 24 extends from the pump 10 to supply power to the pump from either a pump power supply 26 or a pump test controller 28 . as illustrated in fig1 , the pump 10 receives power through the cable 24 from the pump test controller 28 , which in turn receives power from the power supply 26 through a cable 30 . when implanted into a patient &# 39 ; s body and receiving power directly from the power supply 26 , the pump motor 12 is configured to operate from about 20 , 000 rotations per minute to about 28 , 000 rotations per minute . as such , and in some embodiments , the pump 10 is a synergy ® pocket micro - pump commercially available from circulite , inc ., of saddle brook , n . j . the pump test controller 28 ( hereinafter , “ controller ” 28 ) is configured to selectively activate the pump 10 and rotate the pump motor 12 at a low speed and / or for limited time intervals such that a user can visually confirm operation of the pump 10 prior to implantation . thus , the controller 28 includes an actuator 32 to actuate the operation of the pump 10 as well as a controller power indicator 34 to indicate when the controller 28 receives power and a pump power indicator 36 to indicate when the controller 28 is providing power to the pump 10 . fig2 is a diagrammatic illustration of one embodiment of internal components of the controller 28 . the controller 28 includes a power circuit 38 that conditions power from the power supply 26 and converts at least a portion of the power to a direct current power signal to operate the circuitry of the controller 28 . fig3 is an illustration of one embodiment of the power circuit 38 that includes an inductor 40 that filters artifacts in power signals from the power supply 26 and that is coupled to a capacitor 42 and fuse 44 . the capacitor 42 is coupled to ground and configured to allow alternating current signals from the power supply 26 to proceed to ground , while the fuse 44 is configured to prevent damage to the controller 28 in response to over - voltage or over - current power signals from the power supply 26 . at the output of fuse 44 , the power circuit 38 provides direct current power ( illustrated as , and hereinafter , “ dc +”) for the controller 28 and is tied to a diode 46 as well as capacitors 48 and 50 , capacitors 48 and 50 being configured in parallel and coupled to ground . diode 46 is a voltage regulation diode , while capacitors 48 and 50 are configured to allow alternating current signals from the fuse 44 to proceed to ground . in specific embodiments , the inductor 40 has a resistance value of about 33 ω at 100 mhz ( about 0 . 008 ω at zero hz ) and a current limit of about 4 a , the capacitor 42 has a value of about 100 nf , the capacitors 48 and 50 have a value of about 1 μf , the fuse 44 is a resettable fuse having a trip value of about 1 . 3 a , and the diode 44 has a value of about 22v and power limit of about 3 w . in further specific embodiments , the inductor 40 is a wide - band smd ferrite bead , such as a we - cbf 0805 4a 0r008 chip - inductor commercially available from wurth elektronik of waldenburg , germany . returning to fig2 , the power circuit 38 is configured to provide power to a power indicator circuit 52 that , in turn , is configured to activate the controller power indicator 34 when the controller 28 receives power from the power supply 26 . fig4 is an illustration of one embodiment of the power indicator circuit 52 . as illustrated in fig4 , the power indicator circuit 52 receives the dc + signal from the power circuit 38 and couples that signal to a capacitor 54 and a voltage regulator 56 . the voltage regulator 56 , in turn , regulates the dc + signal and provide an output of 5v ( illustrated as , and hereinafter , “+ 5v ”). the output of the voltage regulator 56 is further coupled to another capacitor 57 and the controller power indicator 34 . in specific embodiments , the voltage regulator 56 is an lm7b05 positive voltage regulator commercially available from fairchild semiconductor corporation of south portland , me ., and each of the capacitors 54 and 57 have a value of about 100 nf . as such , when power is provided to the controller 28 from the power supply 26 , the power indicator circuit 52 is configured to activate the controller power indicator 34 . returning to fig2 , the power indicator circuit 52 is further coupled to an activation circuit 58 that activates the pump power indicator 36 in response to actuation of the actuator 32 . fig5 is an illustration of one embodiment of the activation circuit 58 . specifically , the activation circuit 58 is configured with a monostable multivibrator 60 that receives a + 5v signal from the power indicator circuit 52 on a positive edge trigger input of the multivibrator 60 ( e . g ., pin 2 ) and an inverted ground signal on a negative edge trigger input of the multivibrator 60 ( e . g ., pin 1 ). additionally , a + 5v signal is coupled to a capacitor 62 and a resistor 64 . one output from resistor 64 is coupled to a capacitor 66 , while another output from the resistor 64 is coupled directly to an external resistor input of the multivibrator 60 ( e . g ., pin 15 ). the output of capacitor 66 is coupled to an external capacitor input of the multivibrator 60 ( e . g ., pin 14 ). the multivibrator 60 is further coupled to the actuator 32 through a first n - channel emfet 68 ( illustrated as , and hereinafter , “ n - emfet 1 ” 68 ). in particular , the output of the actuator 32 is coupled to the drain of n - emfet 1 68 , while the source is coupled to ground . the gate of n - emfet 1 68 is coupled to a capacitor 70 , a resistor 72 , and a resistor 74 , all of which are in parallel . the gate of the n - emfet 1 68 is further coupled to an inverted reset low input of the multivibrator 60 ( e . g ., pin 3 ) and the drain of a p - channel emfet 76 ( illustrated as , and hereinafter , “ p - emfet ” 76 ). in turn , the source of p - emfet 76 is coupled to a + 5v signal and the gate is coupled to a resistor 78 and capacitor 80 . the resistor 78 is coupled between the source of p - emfet 76 and the gate of p - emfet 76 , while the capacitor 80 is coupled to ground . thus , the multivibrator 60 is configured to detect actuation of the actuator 32 and provide a power signal to the pump power indicator 36 , as well as selectively activate the pump motor 12 for a period of time from about four to about six seconds . as such , an active high output of the multivibrator 60 ( e . g ., pin 13 ) is coupled to the gate of a second n - channel emfet 82 ( illustrated as , and hereinafter , “ n - emfet 2 ” 82 ). the source of n - emfet 2 82 is coupled to ground , while the drain of n - emfet 2 82 is configured to be coupled to a voltage regulation circuit 84 . an inverted active low output of the multivibrator 60 ( e . g ., pin 4 ) is configured to provide power to the pump power indicator 36 when the pump motor 12 is supplied power through a resistor 86 . referring to fig5 , in specific embodiments , the monostable multivibrator 60 is a 74ahc123 dual retriggerable monostable multivibrator with reset as manufactured by nxp semiconductor of the netherlands . also in specific embodiments n - emfet 1 68 and n - emfet 2 82 are each bss 123 n - channel emfets commercially available from fairchild semiconductor , while p - emfet 76 is a bss 84 p - channel emfet also commercially available from fairchild semiconductor . in further specific embodiments , the resistor 64 has a value of about 121 kω , the resistors 72 and 74 each have a value of about 21 kω , the resistor 78 has a value of about 10 kω , the resistor 86 has a value of about 1 kω , the capacitor 62 has a value of about 100 nf , the capacitors 66 and 70 each have a value of about 22 μf , and the capacitor 80 has a value of about 10 nf referring back to fig2 , the power circuit 38 is coupled to the voltage regulation circuit 84 , which is in turn coupled to the activation circuit 58 and the actuator 32 . fig6 is an illustration of one embodiment of the voltage regulation circuit 84 . specifically , the voltage regulation circuit 84 is configured with a pair of p - channel mosfets 88 and 90 ( illustrated as , and hereinafter , “ p - mosfet 1 ” 88 and “ p - mosfet 2 ” 90 ). the dc + from the power circuit 38 is coupled to a resistor 92 and a diode 94 in parallel . the dc + is further coupled , through three parallel leads , to the source of p - mosfet 1 88 . additionally , the output from the actuator 32 is coupled , through a resistor 96 , to the other end of the resistor 92 , the input of diode 94 , and the gate of p - mosfeti 88 . in turn , the drain of p - mosfet 1 88 is coupled to resistor 98 and diode 100 in parallel . the drain of p - mosfet 1 88 is further coupled , through three parallel leads , to the source of p - mosfet 2 90 . additionally , the signal from the activation circuit 58 is coupled , through resistor 102 , to the other end of the resistor 98 , the input of diode 100 , and the gate of p - mosfet 2 90 . the drain of p - mosfet 2 90 is then coupled to a capacitor 104 , then output to a switching circuit 106 . in specific embodiments , each resistor 92 and 98 has a value of about 22kω , each resistor 96 and 102 has a value of about 3kω , each diode 94 and 100 is a bzx 284 series diode such as those commercially available from nxp , and each p - mosfet 88 and 90 is an si 7415 dn series p - channel 60 - v mosfet commercially available from vishay americas of shelton , conn . returning to fig2 , the switching circuit 106 is configured to transform a signal received from the voltage regulation circuit 84 into a signal appropriate for a controller motor 108 . fig7 is an illustration of one embodiment of the switching circuit 106 that includes a switching regulator 110 configured as a boost , or step - up regulator . focusing on the inputs to the switching regulator , a voltage input of the switching regulator 110 ( e . g ., pin 8 ) is coupled to the voltage regulation circuit 84 . additionally , a corrective input of the switching regulator 110 ( e . g ., pin 1 ) is coupled to a resistor 112 configured as a feedback resistor from a collector output of the switching regulator 110 ( e . g ., pin 6 ) in parallel with a resistor 114 . an oscillator input of the switching regulator 110 ( e . g ., pin 3 ) is connected to a capacitor 116 in parallel with a series combination of a capacitor 118 and a resistor 120 . the capacitor 116 and series combination of capacitor 118 and resistor 120 are further in parallel with a capacitor 122 connected to ground . furthermore , the opposite ends of the capacitor 116 and series combination of capacitor 118 and 120 are coupled to the parallel resistors 112 and 114 . a ground input of the switching regulator 110 ( e . g ., pin 4 ) is connected to a ground . focusing on the outputs of the switching regulator 110 , the collector output of the switching regulator 110 ( e . g ., pin 6 ) is coupled to an inductor 124 and a diode 126 . the output of the inductor 124 is in turn coupled to the dc_dc_in input . with regard to the emitter and current limit of the switching regulator 118 ( e . g ., pins 5 and 7 , respectively ), these are tied together as well as to a resister 127 , which in turn is tied to ground . the output of 126 is coupled to a capacitor 128 in parallel with a capacitor 130 , both of which are tied to ground . the output of diode 126 is also coupled to the output of a diode 132 ( whose input is tied to ground ) as well as the resistor 112 that is coupled to the corrective input of the switching regulator 110 ( e . g ., pin 1 ). in addition , the output of diode 132 is coupled to two resistors 134 and 136 configured in series . the output of the resistors 134 and 136 is coupled to an inductor 138 and a capacitor tied 140 tied to ground . the output of the inductor 138 is in turn tied to another capacitor 142 as well as to the controller motor 108 . in specific embodiments , the switching regulator 110 is an lm3578a series switching regulator commercially available from national semiconductor of santa clara , calif ., the resistors 112 and 120 each have a value of about 200 kω , the resistor 114 has a value of about , the resistor 127 has a value of about 0 ω , the resistors 134 and 136 each have a value of about 120 ω , the capacitor 116 has a value of about 22 pf , the capacitor 118 has a value of about 33 nf , the capacitor 122 has a value of about 1 nf , the capacitor 128 has a value of about 10 μf , the capacitor 130 has a value of about 10 nf , the capacitor 140 has a value of about 100 nf , the capacitor 142 has a value of about 470 pf , the inductor 124 has a value of about 330 μh , the inductor 138 has a resistance value of about 33 ω at 100 mhz ( about 0 . 008 ω at zero hz ) and a current limit of about 4 a , the diode 126 is a bzx284 series diode , and the diode 132 has a value of about 22v and power limit of about 3 w . in further specific embodiments , the inductor 138 is a we - cbf 0805 4a 0r008 chip - inductor similarly to inductor 40 of fig3 . referring back to fig2 , an output 144 from the switching circuit 106 is coupled to the controller motor 108 . the controller motor 108 , in turn , is coupled to a first gearbox 146 which is mechanically coupled to a second gearbox 148 in turn coupled to a generator 150 . the generator 150 is configured to provide three output lines 152 , 154 , and 156 to the pump motor 12 to provide respective “ u ,” “ v ,” and “ w ” phases for the pump motor 12 . in specific embodiments , the controller motor 108 is an f 2140 series 40 mm graphite brushless dc motor commercially available from maxon precision motors , inc ., of fall river , mass . in further specific embodiments , each of the gearboxes 146 and 148 are planetary gearheads series 16 a , 16 mm , also commercially available from maxon , while the generator 150 is an ec 16 series 16 mm brushless ec motor , also commercially available from maxon . in the controller 28 , each of the phases for the pump motor 12 on the output lines 152 , 154 , and 156 is conditioned by a respective conditioning circuit 158 a - c . fig8 is an illustration of one embodiment of a conditioning circuit 158 that is used to condition a signal to the pump motor 12 . specifically , the input to the conditioning circuit 158 is a phase from the generator 150 , which is coupled to a capacitor 160 . the capacitor 160 , in turn , is coupled to one resistor 162 coupled to the dc_dc_in signal and one resistor 164 coupled to ground . the conditioning circuit 158 includes an operational amplifier 166 , the positive input of which is coupled to the output of capacitor 160 , the resistor 162 coupled to the dc_dc_in signal , and the resistor 162 coupled to ground . the negative input of the amplifier 166 is coupled to the output of a series combination of a resistor 168 and a capacitor 170 . the negative input of the amplifier 166 is further coupled to a capacitor 172 in parallel with a resistor 174 . the output of the amplifier 166 is coupled to the input of a first diode 176 , whose output is coupled to the input of a second diode 178 . the output of the second diode 178 is , in turn , coupled to a resistor 180 tied to ground . returning to the output of the amplifier 166 , the output is also tied to a resistor 182 which is configured in parallel to a resistor 184 coupled to the output of the second diode 178 . in turn , the resistors 182 and 184 are connected in parallel to the base of a first pnp transistor 186 . the emitter of the first pnp transistor 186 is coupled to a resistor 188 , which in turn is coupled to the parallel combination of the capacitor 172 and resistor 174 coupled to the negative input of the amplifier 166 . the collector of the first pnp transistor 186 , however , is tied to the base of a second pnp transistor 190 . the emitter of the second pnp transistor 190 is coupled to a resistor 192 , the resistor 192 being further coupled to the parallel combination of the capacitor 172 and resistor 174 coupled to the negative input of the amplifier 166 . the output of the amplifier 166 is also coupled to a resistor 194 that is coupled to the base of a first npn transistor 196 . the collector of the first npn transistor 196 is coupled to a resistor 198 . the resistor 198 is in turn coupled to the dc_dc_in signal and the collector of a second npn transistor 200 . returning to the first npn transistor 196 , the emitter of the first npn transistor 196 is coupled to the base of the second npn transistor 200 . the emitter of the second npn transistor 200 is coupled , through a resistor 202 , to the parallel combination of capacitor 172 and resistor 174 coupled to the negative input of the amplifier 166 . as illustrated in fig8 , the parallel combination of capacitor 172 and resistor 174 coupled to the negative input of the amplifier 166 is further coupled to two resistors 204 and 206 in series . the output of the resistors 204 and 206 , in turn , is coupled to a capacitor 208 tied to ground and an inductor 210 . the inductor 210 is coupled , in parallel , to capacitor 212 tied to ground and the output of a diode 214 ( the input being tied to ground ). the inductor 210 is further tied to the u , v , or w phase of the pump motor 12 . in specific embodiments , the amplifier 166 is an ad824 series single supply , low power , fet - input op - amp commercially available from analog devices of norwood , mass . in further specific embodiments , the resistors 162 , 164 , and 174 each have a value of about 100 kω , the resistors 168 , 188 , and 198 each have a value of about 21 kω , the resistor 180 has a value of about 4 kω , the resistors 182 , 184 , and 194 each have a value of about 100 ω , the resistors 192 and 202 each have a value of about 0 ω , and the resistors 204 and 206 are each 4r7 - 5w series axial wirewound resistors . in specific embodiments , the capacitor 160 has a value of about 10 μf , the capacitor 170 has a value of about 4 μf , the capacitor 172 has a value of about 1 nf , the capacitor 208 has a value of about 47 μf , and the capacitor 212 has a value of about 100 nf . in specific embodiments , the ferrite bead 210 is a we - cbf 0805 4a 0r008 chip - inductor similarly to inductor 40 of fig3 and inductor 138 of fig7 , while the diodes 176 and 178 are each bav 99 series diodes commercially available from fairchild semiconductor and the diode 214 is a d402 series zener diode . when in use , an operator coupled the controller 28 to the pump 10 as well as to the power supply 26 . when the controller 28 is supplied power , the controller power indicator 52 will be activated . when the user actuates the actuator 32 , the controller transforms a power signal from the power supply 26 into a plurality of signals for the pump motor 12 . specifically , the controller 28 is configured to operate the pump motor 12 from a speed of about 780 rpm to about 1 , 180 rpm , whereas during normal operation the pump motor 12 is configured to operate at a speed from about 20 , 000 rpm to a speed of about 28 , 000 rpm . moreover , the controller 28 is configured to provide enough power to the pump motor 12 such that the pump motor 12 can utilize back - emf control methodologies without causing the pump motor 12 to stop or suffer from overspeed . thus , the user can visually verify the operation of the pump 10 without utilizing a sterile bath . the controller 28 is configured to transform power from the power supply 26 for the pump 10 for a period of time from about four to about six seconds . specifically , the controller 28 is configured to provide power to the pump 10 when the actuator 32 is continuously actuated , but for no more than that period of time . alternatively , the controller 28 can be configured to provide power to the pump 10 for that period of time in response to a momentary actuation of the actuator 32 . when the controller 28 provides power to the pump 10 , the pump power indicator 34 is activated . after the user has completed their inspection , the user can detach the controller 28 from the pump 10 and the power supply 26 . while embodiments of the present invention has been illustrated by a description of the various embodiments and the examples , and while these embodiments have been described in considerable detail , it is not the intention of the applicants to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . thus , embodiments of the present invention in broader aspects are therefore not limited to the specific details , representative apparatus and method , and illustrative example shown and described . accordingly , departures may be made from such details without departing from the spirit or scope of applicants &# 39 ; general inventive concept .

US-201113017205-A

the present invention provides personal wash compositions where blends of triglyceride oils are specifically formulated to provide functional benefits . specifically when formulated to have specific blend of saturated to unsaturated oils , perfect balance between , on the one hand , spreadability and deposition and , on the other hand , retention of excellent framing , is achieved .

the present invention relates to surfactant - containing liquid personal wash compositions ( preferably aqueous based compositions having & gt ; 30 %, preferably 35 % water ) comprising specific blends of fully saturated ( hydrogenated ) to not fully saturated ( non or partially hydrogenated ) triglyceride oils . specifically , when a blend is specifically formulated such that the amount of saturated oil is in a defined range , and the amount of unsaturated oil is in a defined range ( ranges correspond also to a specific iodine value for the blend ), the blend will have precisely the right characteristics such that it will have the optimal shear viscosity and spreadability required to deposit in the superior way petrolatum deposits relative to unsaturated triglyceride ( e . g . it will have enough hydrogenated triglyceride , about 20 - 30 %, to increase viscosity of unsaturated triglyceride oils thus deposit analogously to petrolatum , see fig4 ); and yet the blend will not have so much hydrogenated triglyceride ( about 35 % preferably no more than 30 % upper level that will have flattened thermal phase transition peak over broad range of temperatures , see fig1 and 2 ) that it will depress foam value to the point where it is not at least 70 % of the foam value of the same composition when no triglyceride oil is used . that is , only blends having about 15 - 35 %, preferably 20 - 30 % of blend fully hydrogenated oil will provide the required rheological and foaming characteristics when used in compositions of the invention . ( 1 ) 1 % by wt . to 40 wt %, preferably 5 to 40 wt %, more preferably 10 to 35 wt % by wt . of a surfactant selected from the group consisting of anionic surfactant , nonionic surfactant , amphoteric / zwitterionic surfactant , cationic surfactant and mixtures thereof ; ( 2 ) 1 to 40 % wt ., preferably below 30 wt %, preferably 5 to 30 wt % of a blend of saturated ( i . e ., hydrogenated ) and of liquid triglyceride oils ( unsaturated ), wherein the blend comprises 15 to 35 wt %, preferably 20 - 30 wt % fully saturated oil and 85 to 65 wt %, preferably 80 to 70 wt % unsaturated oil ( e . g ., mix of natural unsaturated oil and fully hydrogenated oil to form partially saturated oil ). the blend may be further characterized ( 1 ) by an iodine value which corresponds to that specific value for a particular oil ; ( 2 ) by the phase transition enthalpy of the compositions in which they are used ( correlating with the rheology and hence ability to deposit relative to , for example , petrolatum ); and ( 3 ) by the foam value of the compositions in which the blends are used . the invention is described in greater detail below . the compositions in which the blends of the invention may be used comprise 1 % by wt . to 40 % by wt ., preferably 5 to 40 %, more preferably 10 - 35 % by wt . surfactant . surfactants may be anionic , nonionic amphoteric / zwitterionic , cationic or mixtures thereof . examples of the many surfactants which may be used are set forth , for example , in u . s . pat . no . 6 , 395 , 690 to tsaur . anionic may be aliphatic sulfonate ( e . g ., c 8 - c 22 alkane or alkene sulfonate or aromatic sulfonate ); alkyl sulfate ( including alkyl and alkyl ether sulfate ); sulfosuccinate ; taurate ; sarcosinates ; sulfoacetate ; alkyl phosphate . anionics may also be carboxylates and ether carboxylates . another preferred class is c 8 to c 22 acyl isethionates . these esters are prepared by reacting alkali metal isethionate with mixed aliphatic fatty acids . in a preferred embodiment , the isethionate surfactant comprises 5 to 25 wt %, preferably 8 to 20 wt % of the composition . zwitterionic surfactants are broadly derivates of aliphatic quaternary ammonium , phosphonium and sulfonium compound in which aliphatic radicals are straight or branched chain , and wherein one of the aliphatic substituents contains 8 to 18 carbons and one contains an anionic group , e . g ., carboxy , sulfonate , sulfate , phosphate or phosphonate . amphoteric surfactants include at least one acid group ( e . g ., carboxylic or sulphonic acid group ). they include quaternary nitrogen and are quaternary amido acid . they typically include c 7 to c 18 alkyl or alkenyl group . examples include betaines , amido betaines , sulphobetaines . the nonionic which may be used includes in particular the reaction products of compounds having a hydrophobic group and a reactive hydrogen atom , for example aliphatic alcohols , acids , amides or alkyl phenols with alkylene oxides , especially ethylene oxide either alone or with propylene oxide . specific nonionic detergent compounds are alkyl ( c 6 - c 22 ) phenols - ethylene oxide condensates , the condensation products of aliphatic ( c 8 - c 18 ) primary or secondary linear or branched alcohols with ethylene oxide , and products made by condensation of ethylene oxide with the reaction products of propylene oxide and ethylenediamine . other so - called nonionic detergent compounds include long chain tertiary amine oxides , long chain tertiary phosphine oxides and dialkyl sulphoxides . the nonionic may also be a sugar amide , such as a polysaccharide amide . specifically , the surfactant may be one of the lactobionamides described in u . s . pat . no . 5 , 389 , 279 to au et al . which is hereby incorporated by reference or it may be one of the sugar amides described in u . s . pat . no . 5 , 009 , 814 to kelkenberg , hereby incorporated into the subject application by reference . other surfactants which may be used are described in u . s . pat . no . 3 , 723 , 325 to parran jr . and alkyl polysaccharide nonionic surfactants as disclosed in u . s . pat . no . 4 , 565 , 647 to llenado , both of which are also incorporated into the subject application by reference . preferred alkyl polysaccharides are alkylpolyglycosides . cationic surfactants are selected from the group consisting of : alkyl trimonnium chloride and methosulfate , and dialkyldimonnium chloride and methyl sulphate , and alkyl alkonium chloride and methyl sulphate and mixtures thereof . these surfactants contain c 12 to c 24 carbon atoms per alkyl chain . the most preferred cationic is selected from the group consisting of stearylalkonium chloride , stearyltrimonium chloride . di - stearyl - dimonium chloride , and mixtures thereof . a particularly preferred composition in which triglyceride blends of the invention may be used comprises 5 - 20 wt %, preferably 8 to 15 wt % defi ( directly esterified fatty acid isethionate ) and 5 - 15 wt % amphoteric , especially betaine . a second component of the invention is the blend of saturated ( hydrogenated ); and unsaturated ( non or partially hydrogenated ) triglycerides . the blend typically comprises 1 - 40 %, preferably 20 - 30 % of the composition in which the blend is used . according to the invention , the saturated ( fully hydrogenated ) triglyceride should comprise 15 % to 35 %, preferably 20 to 30 % of the blend and unsaturated should comprise 85 to 65 %, preferably 80 to 70 % of blend . the blend should not contain more or less than the defined limit . if too many saturated triglycerides are used , applicants have found that this will depress the foam values relative to a blend which has only unsaturated oils . on the other hand , if too few saturated triglycerides are used , the composition will not have requisite rheology ( spreadability ) needed to allow the oil to deposit . the critical amounts of saturated and unsaturated triglycerides may be characterized also by iodine value of the blend which defines the critical range . in the specific cases of soybean oil , for example , blends which have the required ranges of saturated to unsaturated oil ( 15 to 35 % saturated and 85 % to 65 % unsaturated ) have iodine value ( iv ), where iv is defined in the average measure of unsaturated bonds , of 81 to 120 . in addition , compositions of the invention may be defined by phase transition enthalpy ( i . e ., compounds or blends with similarly defined thermal property at the in - use temperature range have a comparable rheology and antifoaming effect ). thus , for example , if range of upper and lower limit of phase transition enthalpy of the blends of the invention is about the same as for petrolatum , the rheology of the blends and the petrolatum ( relating to how they would be expected to deposit ) would be about the same . the “ iodine value ” ( iv ) represents the number of grams of iodine that an unsaturated compound or blend will absorb in a given time under arbitrary conditions . low iodine value implies a high level of saturation ( hydrogenation ) degree , and visa versa . iodine value can be determined by the wujs method of the american oil chemists society ( aocs cd 1 - 25 ). as noted above , when the vegetable oil is soybean oil , iv number of the blend should be above 70 , preferably above 80 , preferably 81 to 120 , more preferably 90 to 110 . these numbers reflect when the blends would have about 15 - 35 wt % saturated sbo and 85 - 65 wt % unsaturated sbo . when the blend of the invention is used in compositions of the invention and when phase transition enthalpy ( melting / cooling ) is measured to fall within the defined criticality , the rheology of the composition will be such as to obtain optimal deposition . specifically , compositions with the blend , when measured at a temperature range of − 20 to 100 ° c ., will have enthalpy of phase transition , measured in joule / gram ( j / g ) of from 20 to 65 , preferably 30 to 55 . these enthalpy values represent a flattening of the peaks which indicate the composition will have ideal rheology for deposition . compositions of the invention are preferably aqueous based liquid cleanser compositions and contain , for example , at lest 30 %, preferably at least 40 % water . measured using the protocol 3 as described in protocol section , the composition will have typically viscosities of between 10 - 1000 poise measured at 0 . 1 s − 1 , preferably 100 - 500 poise . in one embodiment , the personal wash composition comprising the oil blends of the invention ( which have claimed saturate / unsaturated ratios ) has a minimal amount or is substantially free of petrolatum . the composition has excellent oil deposition efficiency while maintaining good foaming property . in a second embodiment , the invention provides a method of formulating liquid compositions comprising triglyceride blends which compositions deposit said triglycerides in an amount comparable to the amount of petrolatum which would be deposited from the same composition , and which compositions simultaneously have foaming value at least 70 %, preferably at lest 75 % as high than if the composition comprised unsaturated ( non or partially hydrogenated ) triglyceride . this method comprises selecting about 1 - 40 %, preferably 30 % or less triglyceride blends wherein 15 - 35 % of the blend comprises saturated ( hydrogenated ) triglyceride and 85 - 65 % of the blend comprises unsaturated triglyceride , and formulating such blends into liquid compositions comprising said blends . a preferred composition is one comprising 5 to 25 % defi and 5 to 15 % amphoteric ( e . g ., betaine ). the phase transition profile of oil blends in this invention was characterized by differential scanning calorimetry ( dsc ) using ta instruments q - 1000 . typically a 5 - 10 mg of oil blend was heated from room temperature up to 100 ° c . and cooled down to room temperature or lower at ramp rate of 3 ° c ./ minute . the phase transition energy was calculated by integrating the exotherm and endotherm curves using software universal analysis 2000 and averaged . lather performance of personal wash samples and the anti - foaming effect of containing oil blends have been evaluated by cylinder shaking method . in the method , a 5 . 0 ml of 5 × diluted body wash samples was added into a 25 . 0 ml volumetric cylinder with cap . the foam was generated by hand shaking 10 times with same shaking speed and amplitude . the foam volume heights were read 20 seconds after shaking that allows the flash foam to be stabilized . the comparison of personal wash formulations with and without oil blends is used to illustrate the anti - foaming effect of oil blends . the shear viscosity of oil blends was measured by strain controlled rheometer from rheometric scientific ares ( sr - 5 , rheometric scientific , piscataway , nj ). the rheometer was set up with parallel plates 25 mm in diameter typically with 0 . 5 to 1 . 0 mm gaps between the top and bottom plates . test temperature was at 23 ° c . programmed steady shear rate sweeps were performed where the shear rates were logarithmically varied from 0 . 1 to 100 seconds − 1 , with 5 points recorded per decade ( i . e . per factor of ten increases in the shear rate ). the output is viscosity as a function of shear rate . in order to show that there is significant difference in phase transition between a fully hydrogenated oil and the invention , for example , a system comprising mixture of 25 % fully saturated ( fully hydrogenated ) soybean oil and 75 % unsaturated soybean oil , applicants conducted differential scanning calorimetric studies ( fig1 ) on the two . as seen in fig1 , fully hydrogenated soybean oil ( hsbo ) has sharp phase transition peak ( crystallization , measured in heat flow ) with the maximum heat flow rate , for example , at about 2 . 6 watt / gram , and narrow distribution ( measured in half peak temperature δt ) for example , about 3 ° c . by contrast , the mixture of 25 % fully hydrogenated and 75 % unsaturated oil yields significantly lowered ( heat flow is less than 0 . 5 w / g ) and broadened ( δt is about 12 ° c .) phase transition peak . unexpectedly , the phase transition temperature of the said blend was shifted from about 48 ° c . to as low as 30 ° c . at body temperature ( 37 ° c . ), which is higher than this crystal transition temperature , said blends quite unpredictably behave like petrolatum in liquid personal wash formulation . as indicated , this is a surprising and unpredictable mechanism relative to the art . to further indicate the significance of this lower , broadened and shifted phase transition peak , applicants also compared the heating / cooling cycle from the 25 %/ 75 % blend noted to the heat flow data of petrolatum . this comparison is seen in fig2 . as seen , the heat flow peaks for both are measured between 0 . 2 to 0 . 4 watts / g and the two are in the comparable range . more precisely , the phase transition energy , index by enthalpy , from heating and cooling cycles of the invention is comparable to petrolatum as seen in fig3 . applicants believe these values explain why the specific blends of the invention have rheology and deposition substantially similar to that of petrolatum . that is , the blends now behave like petrolatum and yet , because this “ structuring ” involves only a mixing of defined ratio of oils as noted , there is no associated defoaming . another way to show that the rheology between petrolatum and the specific blends of the invention ( e . g ., blends wherein about 15 to 35 %, preferably 20 - 30 % of blend is fully saturated ) is similar is to compare the shear profiles . this is done by plotting shear rate ( measured in reciprocal seconds ) versus viscosity ( measured in pascal - second ) as shown in fig4 . once again , fig4 shows that the viscosity for specific blends of the invention ( i . e ., with specific ratio of saturated to unsaturated triglyceride oil ) has similar profile to that of petrolatum . this may also be important when using blends to meet possible requirements in liquid cleansing applications . to achieve the blends having about 15 - 35 % of blend being fully hydrogenated , it is possible , rather than using a controlled hydrogenation process starting from triglyceride oils ( which hydrogenation may be difficult to control ), to simply mix vegetable oil with fully hydrogenated vegetable fats ( at temperature above melting point of either component ) at a ratio required to yield the desired rheological and thermal properties . this , in turn , can be controlled by noting the strong linear correlation which applicants measured between iodine value ( measure of lipid saturation ) and the blend ratio of fully hydrogenated oils in the partially hydrogenated oil mixture . the measurement was conducted and plotted as seen in fig5 . specifically , from fig5 , it can be seen that , at level of blend comprising above 30 % fully hydrogenated oil , the iodine value is below 91 . thus , by selecting blends where iodine value is above 81 , preferably above 91 , it is possible to select precisely the blends which will have the desired rheological and heat flow values required . as indicated , the blends of the invention are selected not only so that they will have rheology which will allow enhanced deposition , but also so that they will retain a foam volume at lest about 70 % of the volume of compositions comprising unsaturated triglyceride oil ( e . g ., soybean oil ). to show where foaming criticality lies , applicants proceeded as follows : 20 % and 30 % by weight of vegetable oils having varying amounts of saturated to unsaturated oils were formulated in defi liquid base ( composition comprising directly esterified fatty acyl isethionate ) and their lather performance was assessed by cylinder hand shaking method at room temperature . the foamability and the antifoaming effects from the structured oils could be compared from the foam volume as shown in fig6 . clearly , the defi liquid composition containing 20 % wt . or 30 % wt . of partially hydrogenated soybean oils will not dramatically reduce the foam volume until the fully hydrogenated oils comprises & gt ; 30 % of the blend ( i . e ., when iv for soybean oil at least , falls below 91 ). that is , iv must be above 81 , preferably below 105 until 91 when apparent antifoaming effect appears . at lower oils content (& lt ; 20 %) in liquid composition , the applicable lower limit of iv number could be below 91 until 81 as noted because of proportionally lower antifoaming effect . the formulation below is a typical formulation in which triglyceride blend of the invention may be used .

US-37105009-A

an apparatus and method for collecting whole blood and then separating it into components for subsequent use or storage . a self - contained bag set is used to collect the sample , which may then be placed into container adapted to fit into a centrifuge for separation of components . each component is then sequentially extracted according to density , with a sensor present in the container to control the operation of valves directing the collection of each component . each component may then be separated into its own storage container .

considering the drawings , wherein like reference numerals denote like parts throughout the various drawing figures , reference numeral 10 as shown in fig1 is directed to the bag set according to the present invention . referring to fig1 , the bag set 10 includes a whole blood collection bag 2 , a red blood cell ( rbc ) bag 4 , and a freezing bag 6 for the collection and storage of white blood cells . the collection bag 2 is supplied through an inlet line 12 , preferably through a phlebotomy needle 8 . the collection bag 2 has an outlet 26 , which directs output into a three - way metering valve 20 through a spike 30 ( which is inserted into outlet 26 ) which is connected to an outlet line 32 . the operation positions of the metering valve 20 are shown in fig9 a – 9c . two supply lines 24 a , 24 b lead from the metering valve 20 to the rbc bag 4 and the freezing bag 6 , respectively . rbc supply line 24 a has an optional hes inlet 14 for the introduction of a sedimenting agent , such as hydroxyethyl starch ( hes ) into the system . the freezing bag supply line 24 b has an optional cryoprotectant inlet 16 for the introduction of cryoprotectant into the system . the hes inlet 14 and the cryoprotectant inlet 16 are each equipped with a filter 18 , preferably a 0 . 2μ filter , to , inter alia , prevent contamination from pathogens in the outside air and to allow venting of air from the freezing bag and tubing . the supply lines 24 a , 24 b and the inlet line 12 may each be heat sealed and separated from the bag set 10 . all lines are equipped with line clamps 22 that may be closed to prevent fluid passage when desired . if other components are to be separated , the bag set 10 may include additional bags 200 , and the metering valve 20 may be modified to accommodate the additional bags 200 . initially , the collection bag 2 is filled with an anticoagulant , such as cpd ( citrate , phosphate , and dextrose ). the metering valve 20 begins in the closed position ( fig9 a ). all clamps 22 are closed , with the exception of the clamp 22 on the inlet line 12 . blood , preferably whole , placental , or umbilical cord blood , is obtained from a source through the phlebotomy needle 8 or other appropriate inlet , which feeds into the collection bag 2 through the inlet line 12 . the inlet line 12 is then clamped , heat sealed , and separated from the bag set 10 . the clamps 22 on the hes inlet line 14 are opened , and hes is introduced through the hes inlet 14 into bag 2 . the line leading to the hes inlet 14 is then clamped , heat sealed , and removed . alternatively , the hes can be introduced into the bag 2 earlier , as , for example , during manufacture . at this point , the bag set 10 is placed in a clamshell bag holder 50 , shown in fig3 a – 3c . referring to fig2 a , 2 b , the bag holder 50 includes hooks 60 that engage the loops 28 on the collection bag 2 . the interior of the bag holder 50 is shaped to receive the collection bag 2 , having a bag holding wall 152 , a bag - supporting wall 154 , and straight sidewalls 156 near the top of the bag holder 50 , which intersect with angled walls 156 at the bottom of the collection bag 2 . the angled walls 156 terminate at the bottom of the bag - holding wall 152 in an outport 160 dimensioned to receive the outlet 26 of the collection bag 2 . on the bag - supporting wall 154 , the angled walls 158 terminate at an angled point 162 . the sidewalls 156 , 158 help to cradle the collection bag 2 loosely at the top ( near the loops 28 ) and more tightly at the bottom ( near the outlet 26 ). closer tolerance near the bottom of bag 2 is desired to minimize disturbing the contents of the bag after sedimentation . the metering valve 20 is connected to a motor driver 56 in the bag holder 50 . the motor driver 56 is connected to a software - controlled wireless control chip module 54 powered by a rechargeable battery 52 . a port 64 is provided to utilize a battery charger . the motor driver 56 controls the operation of the metering valve 20 while the bag set 10 is mounted in the bag holder 50 . one or more optical sensors 58 ( e . g ., fig2 a , 2 b ) positioned near the collection bag outlet 26 and / or located on the bag holder 50 triggers the proper time for the motor driver 56 to close the metering valve 20 after each fraction is harvested . alternatively , an optical sensor 58 ( fig1 ) may be located just upstream of the metering valve 20 to allow greater control over the harvest of each component by “ reading ” strata change closest to the metering valve 20 . the bag holder 50 , when closed , is adapted to fit into a centrifuge cup 66 dimensioned to reside within a conventional centrifuge 100 ( fig4 a ). the rbc bag 4 and the freezing bag 6 are cradled in the bottom of the bag holder 50 in separate recesses 62 a , 62 b ( fig2 a , 2 b ) of the bag holder 50 . the bag set 10 in the centrifuge cup 66 may be subjected to more than one g - force in order to achieve the optimum stratification of components ( fig5 a , 5 b ). the motor driver 56 then operates the metering valve 20 to open and allow access to supply line 24 a for the harvest of red blood cells , at an optimum g - force , into bag 4 . the motor driver 56 closes the metering valve 20 when the optical sensor 58 indicates that the red blood cells are harvested ( fig6 a , 6 b ). the next fraction , which includes white cells and / or platelets , is then harvested from the collection bag 2 ; the motor driver 56 opens the metering valve 20 to allow access to supply line 24 b ( fig9 c ) leading to bag 6 for the next harvest . as shown in fig7 a , 7 b , during the harvest ( wbc ) into the freezing bag 6 , air in the supply line adds to air already in the freezing bag 6 , producing an air bubble 70 , which is useful to assist the proper mixing of the wbc and / or platelets with the cryoprotectant . the motor driver 56 then closes the metering valve 20 , as shown in fig9 a , and the centrifuge 100 is allowed to stop . the bag holder 50 is removed from the centrifuge cup 66 and opened , and the bag set 10 is removed , with the motor driver disconnected from the metering valve 20 . each supply line 24 a , 24 b is clamped , heat sealed , and removed from the collection bag 2 ( fig8 a , 8 b ). any additional bags 200 ( fig1 ) may be similarly removed . after the supply line 24 b connected to the freezing bag 6 is disconnected , a cryoprotectant may be introduced into the component in the freezing bag 6 through cryoprotectant inlet 16 . the air bubble 70 in the freezing bag 6 allows the cryoprotectant to be thoroughly mixed with the collected component . after mixing , the air bubble 70 is expelled through the filter 18 of the cryoprotectant inlet 16 . the component is then prepared for storage by heat - sealing the tubing and removing the bag 6 downstream of the cryoprotectant inlet 16 . preferably , each line ( the inlet line 12 and the supply lines 24 a , 24 b ) is oriented to allow access to a sampling site 34 near the collection or storage bags . thus , a sample of the blood or fluid in the line may be taken without disturbing the bulk of the collected component . fig1 depicts the separation of whole blood components as a function of time . under centrifugation , each fraction stratifies in the collection bag 2 as a function of its density . the overlapping areas 205 indicate the area in the separation along each strata line in the collection bag 2 . as centrifugation continues , the boundary of each fraction becomes more clearly defined ; thus , the area 205 decreases and each fraction is more completely harvested . thus , the centrifugation strategy combines separation by density , the time involved for stratification , centrifuge force , and boundary layer clarity . decisions on harvesting will vary based on these tradeoffs as a function of the constituent of greatest value and its desired purity . it is appreciated that while the instant invention is preferably used in the separation of blood components , the separation techniques and apparatus are suitable for separation of other fluids . the software programmed into the control chip module may cause the motor driver to open and close the valve many times , thereby throttling the valve during strata delivery . also by varying time increments during a harvest procedure , precise cut - offs between the cell components can be achieved in order to reduce the mixing between cell types that may occur as a result of the “ toroidal ” ( coriolis ) effect during removal of the blood component from bag 2 and may be modified for the separation of other fluids or to compensate for various hardware conditions , such as uneven centrifuge loading . moreover , having thus described the invention , it should be apparent that numerous structural modifications and adaptations may be resorted to without departing from the scope and fair meaning of the instant invention as set forth hereinabove and as described hereinbelow by the claims .

US-11829102-A

an endodontic file comprising an elongated , flexible metal , the file having a working portion for cutting or abrading biological material , the working portion comprising a proximal portion and a distal portion , the proximal and distal portions having different cross - sectional flute or core patterns and associated cutting edges .

certain representative embodiments of the present invention are shown in fig3 - 9 , wherein similar features share common reference numerals . fig3 shows one embodiment of an endodontic file 30 of the present invention . file 30 may include a handle 32 located at a proximal end 34 , a shaft 36 , and a working portion 38 extending to a distal end 40 . working portion 38 may be formed of a plurality cutting segments 41 formed of helical or spiral flutes 42 that form cutting edges 44 and separated by non - cutting segments 46 . cutting segments 41 may be of any desired shape but are shown in this embodiment as being tapered in a direction from proximal end 34 toward distal end 40 . non - cutting segments 46 are shown in this embodiment to have a smooth circular cross - section having a diameter that is less than the diameter of the adjacent cutting segments 41 . the relationship between cutting segments 41 and non - cutting segments 46 provide flexibility to file 30 to eliminate or reduce the chance of breakage as working portion 38 follows any curved and / or twisted portions of the root canal . in addition to providing flexibility , file 30 provides control over which portion or portions of the root canal are shaped and / or prepared . this is accomplished by the location of cutting segments 41 along working portion 38 . cutting segments 41 may be located along working portion 38 at selected locations depending on which areas of the root canal are to be shaped and / or prepared . for example , in the embodiment of fig3 , only the portions of the root canal adjacent cutting segments 41 are shaped and / or prepared . the embodiment of file 30 shown in fig3 shows cutting segments 41 located along working portion 38 in a spaced arrangement in which a cutting segment 41 is located at distal end 40 . fig4 shows another embodiment of an endodontic file similar to file 30 of fig3 in which like parts will be given like reference numbers indicated with a prime (′). thus , file 30 ′ includes cutting segments 41 ′ located and arranged along working portion 38 ′ so that a non - cutting segment 46 ′ is located at distal end 40 ′. it should be further noted that other aspects of working portion 38 , 38 ′ may vary . for example , although only three cutting segments 41 , 41 ′ are shown in fig3 and 4 , the number of cutting segments 41 , 41 ′ may vary . additionally , the length 48 , 48 ′ of cutting segments 41 , 41 ′ and / or the length 50 , 50 ′ of non - cutting segments 46 , 46 ′ may vary . fig5 and 6 show another embodiment of a file 52 that includes a handle 54 located at a proximal end 56 , a shaft portion 58 , and a working portion 60 extending to a distal end 62 . working portion 60 may be formed of a plurality cutting segments 64 each having a geometrical shape that forms a cutting edge 66 and separated by non - cutting segments 68 . in this embodiment , cutting segments 64 may have a non - circular shape and are shown as being triangular in cross section , which core structure is shown in fig6 . however , it should be understood by those skilled in the art that the invention is not limited to cutting segments having a triangular shape and that other geometric shapes may be contemplated . preferably , the geometric shape of cutting segments 64 form cutting edges 66 that are substantially parallel to the long axis 70 of file 52 . non - cutting segments 68 are shown in this embodiment to have a smooth circular cross - section having a diameter that is less than the cross - sectional shape of the adjacent cutting segments 64 . cutting segments 64 have a length 72 and non - cutting segments 68 have a length 74 both of which may vary . the relationship between cutting segments 64 and non - cutting segments 68 provide flexibility to file 30 to eliminate or reduce the chance of breakage as working portion 60 follows any curved and / or twisted portions of the root canal . fig7 shows a file system 76 that includes a series of individual files 78 , 80 , and 82 being of substantially equal length , each file having cutting segments and non - cutting segments strategically located along the file to allow each file to shape and / or prepare a different region of the root canal and to divide the workload of shaping and / or preparing the root canal among the files in the file system 76 . for example , in the embodiment shown in fig7 , file 78 may include multiple cutting segments 84 separated by non - cutting segments 86 located along working portion 88 . file 80 may include cutting segments 90 and non - cutting segments 92 located along working portion 94 . working portion 94 extends over a greater portion of file 80 than working portion 88 of file 78 . additionally , the lengths of cutting segments 90 and non - cutting segments 92 may vary so that they may overlap with cutting segments 84 and non - cutting segments 86 of file 78 . file 82 may have cutting segments 96 and non - cutting segments 98 located along working portion 100 , which extends over a greater portion of file 82 than working portion 94 of file 80 or working portion 88 of file 78 . in a manner similar to files 78 and 80 , the length of cutting segments 96 and non - cutting segments 98 may vary so that they may overlap with cutting segments 90 and non - cutting segments 92 of file 80 and cutting segments 84 and non - cutting segments 86 of file 78 . the cutting segments 84 , 90 , 96 of individual files 78 , 80 , 82 are arranged so that , when taken together , they effectively form one continuous cutting segment covering the entire working portion 100 . fig8 shows an alternative file system 102 that includes a series of individual files 104 , 106 , and 108 being of substantially equal length . similar to files 78 , 80 , 82 in fig7 , each file 104 , 106 , 108 have cutting segments and non - cutting segments strategically located along the file to allow each file to shape and / or prepare a different region of the root canal and to divide the workload of shaping and / or preparing the root canal among the files in the file system 102 . however , the cutting segments and non - cutting segments of files 104 , 106 , 108 are arranged in an alternative manner . for example , file 104 may include multiple cutting segments 110 separated by non - cutting segments 112 located along working portion 1 14 . file 106 may include cutting segments 116 and non - cutting segments 118 located along working portion 120 so that a non - cutting segment 118 is located at distal end 121 . working portion 120 extends over a greater portion of file 106 than working portion 114 of file 104 . additionally , the lengths of cutting segments 116 and non - cutting segments 118 may vary so that they may overlap with cutting segments 110 and non - cutting segments 112 of file 104 . file 108 may have cutting segments 122 and non - cutting segments 124 located along working portion 126 , which extends over a greater portion of file 108 than working portion 120 of file 106 or working portion 114 of file 104 . a non - cutting segment 124 is located at a distal end 128 . in a manner similar to files 104 and 106 , the length of cutting segments 122 and non - cutting segments 124 may vary so that they may overlap with cutting segments 116 and non - cutting segments 118 of file 106 and cutting segments 110 and non - cutting segments 112 of file 104 . the cutting segments 110 , 116 , 122 of individual files 104 , 106 , 108 are arranged so that , when taken together , they effectively form one continuous cutting segment covering the entire working portion 126 . the staggered cutting segments and non - cutting segments of the files of each system 76 , 102 have been described as overlapping . however , it is within the scope of this invention that the staggered cutting segments of the related files in each system 76 , 102 do not overlap . regardless of whether or not the cutting segments overlap the files in both systems 76 , 102 , when taken together , form a cutting segment along the entire working portion . fig9 shows an alternative embodiment for a file 130 having variable tapered cutting segments for added flexibility . in this embodiment , the percentage taper of one cutting segment may be different from the percentage taper of the other cutting segments . for example , first cutting segment 132 may have an 8 % taper , second cutting segment 134 may have a 6 % taper , and third cutting segment 136 may have a 4 % cutting taper . it should be understood by those skilled in the art that either file system 76 , 102 may be comprised of files having tapered cutting segments , variable tapered cutting segments , or geometrically shaped cutting segments . fig1 - 20 illustrate still further how at least two different cross - sectional flute patterns of any shape may exist on the working portion . fig1 shows the present inventive file 221 with two different cross - sectional flute or core patterns ( 222 a and 222 b ) located contiguously along long axis of the working portion of the file . proximal working portion 214 has a different cross - sectional flute pattern than the distal working portion 212 . the cross - sectional flute pattern for distal working portion 212 is shown in fig1 , which is taken through line b - b . the cross - sectional flute pattern for working portion 214 is shown in fig1 , which is taken through line c - c . ( in these and other cross - sectional views in the figures , the circle drawn around the illustrated structure is not intended to represent additional structure , but rather illustrates the radial area capable of being cut by the encircled core structure , consistent with how those in the art illustrate endodontic file cross - sections .) the cross - sectional flute pattern through line b - b is different than the cross - sectional flute pattern through line c - c . fig1 shows a cross - sectional flute pattern with a cutting flute 215 . the cutting flute 215 defines a core having generally a tri - spoke configuration . each of the spoke like sections of the core extends from a central portion of the core and supports cutting edges 217 b . the outer surfaces 219 between the cutting edges on a spoke extend generally are known as “ radial - lands .” it is noted that in some configurations , only one of the edges 219 need be a cutting edge . the flute pattern 215 defines a core section 222 a or 222 b , respectively for the proximal and distal working portions , and the flute pattern may vary from one section other or generally be the same pattern . fig1 shows a cross - sectional flute pattern defined by cutting flute 215 and a cutting edges 217 a . in this embodiment , the radial lands have been reduced to apices on a triangular core , which are the cutting edges 217 a , and therefore do not extend circumferentially to any substantial degree . accordingly , this configuration provides a core without radial lands the helical flutes 215 in the embodiment shown provide helical cutting edges that extend along the long axis of the working portion continuously from one cross - sectional region 212 into another . although the figures show only two different portions defining the working portion , there may be a third portion or any number of additional portions wherein such additional portions differ from an adjacent or contiguous proximal or distal portion . therefore the use of the terms “ proximal portion ” and “ distal portion ” are not meant to imply that there are only two portions in any given file or that the portions are located at the most proximal or distal portions of a file . the advantage to multiple cross - sectional flute patterns allows for an endodontic instrument to have more strength in certain areas of the file where it is needed most and to have a more aggressive cutting flute in other areas , as persons skilled in the art will recognize from the teachings herein . fig1 - 20 show many examples of cross - sectional flute patterns that persons skilled in the art will recognize to provide various properties , such as more aggressive cutting , lower torque , higher strength etc . some are with radial lands , and some without radial lands . fig1 , 15 , 17 , 18 , and 19 show flute patterns with radial lands ; fig1 , 16 , and 20 show flute patterns without radial lands . the cross - sectional flute patterns shown in fig1 - 20 are for example only and the inventive subject matter is not restricted to the cross - sectional flute patterns shown . from the teachings herein persons skilled in the art will appreciate that the inventive files may by manufactured by using or adapting file manufacturing techniques . for example , grinding methods and machinery are disclosed in u . s . pat . no . 5 , 464 , 362 ( heath et al .). an abrasive grinding wheel is used to remove the desired amount of material from the alloy wire stock and produces the desired cross - sectional flute shape as described in u . s . pat . no . 5 , 464 , 362 . other manufacturing techniques , such as chemical milling and torsioning , which may be used to create certain geometries , are disclosed in u . s . pat . no . 6 , 968 , 619 , which is hereby incorporated by reference as if recited in full herein for all purposes . persons skilled in the art will recognize that many modifications and variations are possible in the details , materials , and arrangements of the parts and actions which have been described and illustrated in order to explain the nature of this invention and that such modifications and variations do not depart from the spirit and scope of the teachings and claims contained therein .

US-42257706-A

an apparatus and method for aerosolizing and dispensing powders utilizing the forces of pressurizing and depressurizing gas loaded into powder agglomerates located in an enclosed powder chamber . methods include administering peptides , genes , vitamins , and polymers into the peripheral lung . also describes powder supply apparatus and method for single dose and repetitive applications .

the present invention provides a method and an apparatus to effectively aerosolize small batches of cohesive or non - cohesive powders to micron - sized aerosols by converting energy stored in pressurized gas into power for fractionating a powder . as used throughout the specification and claims , the term &# 34 ; aerosol &# 34 ; means any product of ejection of a powder . the energy stored in a pressurized gas is efficiently used to break up agglomerates of powder and eject a plume of fine particles at comparatively low air speeds . as used throughout the specification and claims , the term &# 34 ; agglomerates &# 34 ; means aggregates , agglomerates or particles held by any binding force , e . g . chemical or physical binding . as used throughout the specification and claims , the term &# 34 ; plane &# 34 ; means a tangent . the present invention has a unique means of aerosol formation . pressurized gas is released suddenly into a chamber where the powder is located . this causes the powder to mix turbulently , which breaks up large particles and &# 34 ; loads &# 34 ; them with pressurized gas . when they are broken down small enough in size , they move through an ejecting conduit , and quickly into an exit nozzle of sudden increase in diameter . this causes the pressurized gas stored in the particles to depressurize suddenly , which breaks the pressurized agglomerates into a fine aerosol . fig1 - 5 show the preferred embodiment of the present invention . in fig1 the preferred embodiment of aerosol generator 10 , powder chamber 12 is preferably spherical to minimize the wall surface area per unit volume , although other configurations ( e . g . half - sphere , ovoid , cylinder ) may also be used . pressure chamber 14 , fast releasing valve 16 , pressure conduit 18 , and ejecting conduit 20 are part of the upper section of aerosol generator 10 . in this embodiment , a single pressure conduit 18 enters powder chamber 12 along a tilted polar axis of chamber 12 . alternatively , more than one pressure conduit 18 can be used . ejecting conduit 20 begins abruptly in powder chamber 12 and ends abruptly in exit nozzle 22 . fig2 - 3 show preferred placements of pressure conduits 18 . pressure conduits 18 are arranged to induce a highly turbulent , but not a rotating , flow during the pressurizing phase . a strong rotation would increase residual deposition of powder on powder chamber walls due to the strong centrifugal forces imposed on the particle agglomerates by the rotating carrier gas . in a preferred embodiment , one pressure conduit is used . an alternative preferred embodiment of aerosol generator 10 utilizes two pressure conduits . alternatively , three or more pressure conduits can be used . a turbulent , non - rotating flow can be induced by the following means : fig2 shows one pressure conduit 18 -- the gas enters the powder chamber along a polar axis through chamber 12 . the flow splits symmetrically at the opposite wall . fig3 shows two pressure conduits 18 -- conduits 18 are arranged to induce maximum turbulence by allowing injected or deflected gas streams to collide in powder chamber 12 . the cross - sectional area of pressure conduit ( s ) 18 is optimized so as to add as little volume to the system as possible , yet create as little friction losses as possible to the pressurizing gas . another important variable in aerosol generator 10 is the ratio of the volumes of pressure chamber 14 to powder chamber 12 . the volume of pressure chamber 14 is related to the volume of powder chamber 12 so as to provide a suitable relationship between the pressure range at which agglomerates are formed and the pressure range at which the aerosol is generated . applying boyles law gives poej = po * vpr /( vpr + vpw ), wherein poej is the initial pressure at which the aerosol is generated , po is the initial pressure of the pressure chamber , vpr is the volume of the pressure chamber , and vpw is the volume of the powder chamber and pressure conduits . for example , at 50 atm feeding pressure and volumes of vpr = 2 and vpw = 1ml , the pressure will be 33 atm when the aerosol begins to be generated . the volume ratios of vpr to vpw can be from 1 : 1 to 10 : 1 , depending on the driving pressure . because the powder chamber during ejection can be regarded as a well - mixed tank , a total of at least ten powder chamber - volumes of air / gas is sufficient to extract most suspended particles from the powder chamber . too little gas may not extract all the powder , and too much gas dilutes the ejected aerosol bolus to lower particle concentrations and pushes the aerosol cloud too far away from the aerosol generator . fig4 - 5 illustrate the two - step mechanism of aerosol generator 10 . fig4 shows the preferred embodiment after powder has been loaded into chamber 12 , but before valve 16 release . in fig5 when valve 16 is released , powder chamber 12 is pressurized under intense turbulent mixing . during this phase the powder is fractionated into agglomerates small enough to pass through ejecting conduit 20 . concurrently , the powder agglomerates are loaded with pressurized gas , which serves as the principal force behind aerosolization during the subsequent step of decompression . in the second step the suspended particle agglomerates are ejected through ejecting conduit 20 . ejecting conduit 20 has a substantially constant cross - sectional area and begins abruptly in powder chamber 12 , without any tapered inlet end . it is preferably cylindrical in shape , although other cross - sectional shapes , such as square or triangular can be used as long as substantially constant throughout the cross - section of ejecting conduit 20 . ejecting conduit 20 has two functions : to constitute the overall critical orifice that regulates the ejection time of the carrier gas at the required driving pressures , and to maintain the static pressure of the aerosol dispersion as high as possible before it enters exit nozzle 22 . in order to keep the static pressure high until decompression , the gas speed should be kept as low as possible . the abrupt inlet end creates an equally abrupt transfer of powder agglomerates from the highly turbulent flow field in powder chamber 12 to a very small inlet flow pattern at ejecting conduit 20 . the result is a very high acceleration of particle agglomerates immediately before entering the critical orifice of ejecting conduit 20 . therefore , ejecting conduit 20 is never blocked -- larger unbreakable particles settle to the bottom of powder chamber 12 , while the agglomerates are ejected . fig6 shows the angle necessary to maintain the high acceleration . angle α 24 between tangent 26 of the wall of powder chamber 12 in the immediate vicinity of ejecting conduit 20 and axial extension 28 of ejecting conduit 20 should be greater than 60 °, and preferably greater than 85 °. the sudden widening where ejecting conduit 20 reaches exit nozzle 22 allows for the fastest possible explosive expansion of the carrier gas to ambient pressure . the carrier gas trapped within the particle agglomerates creates an isotropic outward - directed fractionating force powerful enough to generate micron - sized aerosols even of cohesive powders such as albumin , all - trans retinoic acid , carbon black or diesel soot . the higher the static pressure and faster the decompression , the higher the de - agglomerating power of generator 10 . exit nozzle 22 itself is designed to fan out the aerosol at a desired speed and plume shape . to optimize these , angle β 30 between axial extension 28 and the plane 32 along a conical surface where exit nozzle 22 meets ejecting conduit 20 should be greater than 45 °, preferably greater than 70 °, and preferably greater than 90 °. the mechanism of micronization of powders utilized by this invention involves predominately divergent forces , whereas devices relying upon turbulent or mechanical shear forces for micronization have distinctive convergent force components likely to cause some reagglomeration . because decompression in the present device occurs only in a minute fraction of the gas volume at any particular moment , the high - energy output is perceived only as distinctive hissing sound . typically , the volume of the exit conduit , where decompression occurs , is only on the order of 1 / 10 , 000 th of the volume of the powder chamber . the smaller this ratio , the gentler the aerosol formation is in terms of noise and downstream speed of aerosol plume . this ratio is much smaller than in existing devices . fig7 shows an alternative preferred embodiment of aerosol generator 10 . pressurized gas , preferably in the range of 5 - 100 atm , is preloaded into pressure chamber 14 , which is sealed with fast - releasing valve 16 . preferably three symmetrical pressure conduits 18 transfer the pressurized gas to powder chamber 12 . alternatively , one or two pressure conduits can be used . powder chamber 12 is divided preferably along the equatorial plane ( although it can be divided above or below this ), and powder is loaded . the powder ejects through a cylindrical ejection conduit 20 . ( alternatively , ejection conduits 20 of other cross - sectional shapes , such as square or triangular , can be used , as long as substantially uniform in cross - section .) when used for involuntary exposures in laboratory animals , a syringe 34 is mounted on top of aerosol generator 10 . when generator 10 is triggered aerosol outlet 36 is closed , and the generated bolus pushes up plunger 38 . immediately after plunger 38 has reached its top position , aerosol outlet 36 is opened and the aerosol can be ejected from syringe 34 . fig8 - 11 illustrate alternative embodiments for powder supply . fig8 shows one such embodiment . in fig8 powders are prepackaged into sealed cups 40 ( preferably hemispheric shaped cups ) that fit snugly within indentation 42 of base 44 of powder chamber 12 . these can be inserted one at a time , or supplied on a cartridge containing multiple cups for repeated dosing . in fig9 and 10 , powder medicaments are supplied in airtight capsules ( preferably spheres ) 46 , which fit snugly inside powder chamber 12 . rotational orientation is thus irrelevant . fig9 illustrates lid 48 of powder chamber 12 with piercing mechanisms 50 located on the ends of ejecting conduit 20 and pressure conduits 18 . piercing mechanisms 50 pierce through the surface of sphere 46 when lid 48 is lowered , as shown in fig1 . this results in much less contamination of interior surfaces of aerosol generator 10 . fig1 shows another embodiment of powder supply . powder is transferred from reservoir 52 located in lid 48 next to powder chamber 12 . the powder is transferred by means of dowel 54 that stretches from reservoir 52 . the end of dowel 54 completes the spherical shape of powder chamber 12 in its non - dosing position . dowel 54 has cup 56 that fills with powder when dowel 54 is first pulled back under reservoir 52 . it is then pushed forward into powder chamber 12 , where dowel 54 is rotated , thus turning cup 56 over and emptying its contents into powder chamber 12 . dowel 54 is then pulled back to seal powder chamber 12 . in addition , there are several peripheral components , as illustrated in the alternative preferred embodiment in fig7 . pressure chamber 14 is sealed with fast - releasing valve 16 preferably comprising rod 58 of circular cross - section with two sets of o - rings 60 , 62 sealing against shaft 64 upstream and downstream of conduit 66 leading to powder chamber 12 . upstream o - rings 60 are slightly smaller than downstream o - rings 62 to prevent damage when rod 58 is released . other sealing mechanisms ( e . g . plastic gaskets ) can be used . rod 58 is released when trigger 68 settled in notch 70 is depressed raising triger 68 out of notch 70 and rod 58 is pushed by the gas pressure to stop against stopper 72 . a spring around rod 58 may be included to be compressed against stopper 72 when valve 16 is released , and decompressed to push rod 58 back into a cocked position when the pressure has dropped within pressure chamber 14 . this provides a means to reduce the volume of the air / gas to be ejected with the aerosol bolus while maintaining initial driving pressure . seals are also preferably included in aerosol generator 10 at other locations . for example , in fig7 lid 48 of powder chamber 12 is sealed both with o - ring 74 and with circular square - profile ridge 76 , and closed with three bolts 78 . ( see also fig3 ) other types of seals ( e . g . plastic gaskets ) can be used alone or in combination , or alternatively powder chamber 12 can be fitted without supplemental seals . also , syringe 34 in fig7 is sealed against lid 48 of aerosol generator 10 with o - ring 80 . the following non - limiting examples illustrate effectiveness of two preferred embodiments of the invention . in the first experiment , bottled nitrogen of pressures up to 100 atm served as the pressure source . powders were weighed on a cahn microbalance ( model 31 , cahn instruments , cerritos , calif .). particle size distribution was measured with a quartz crystal microbalance cascade impactor ( california measurements inc .). a steel syringe of 250 ml volume was mounted directly on top of the aerosol generator . with the aerosol exit from the syringe closed , a vacuum was applied to the syringe with the plunger fixed at a 100 ml volume . this procedure reduced the amount of particles depositing on the plunger . different amounts of particulates were loaded to the device , and the pressure chamber was brought up to the desired driving pressure . immediately after the generator was triggered , and the plunger of the syringe was elevated to its full volume , the aerosol bolus was pushed into a 25 mm glass fiber filter ( gelman series , ann arbor , mich .). amounts of particles on the filter were determined by rinsing the equipment in a known volume of ethanol , then comparing the light extinction in a spectrophotometer ( perkins elmer lambda 6 uv / vis ) with known standard curves for the same powders . the fraction calculated to be retained in the syringe was assumed to complete the mass balance between the amount loaded into the powder chamber , and the amount collected on the filter plus the amount retained in the powder chamber . results showed that , with diesel soot and carbon black , the 1 ml generator ejected from 25 % to 65 % of the loaded amounts of dust when the amount loaded was increased from 0 . 05 to 0 . 5 mg . over the same range of particle amounts the fraction collected from the exposure syringe on filter paper increased from 6 % to 15 %. when the dusts were ejected at 90 atm driving pressure , the mean mass aerodynamic diameter ( mmad ) was in the range of 0 . 2 - 4 μm , with a range of 1 - 3 μm . the generator can aerosolize amounts of powder of up to at least 5 mg . the second embodiment consisted of a 0 . 3 ml powder chamber , where the pressurizing gas was conducted directly from the pressure chamber into the powder chamber along a polar axis in a single conduit . the generator ejected the aerosol directly into a fixed volume holding chamber of 400 ml volume . the aerosol ejected into the holding chamber was sampled directly into the quartz crystal microbalance cascade impactor for determining the particle size distribution . depending on the properties of the aerosolized particles , the device generated micron - sized aerosols using driving pressures ranging from 20 - 100 atm . carbon black and diesel soot , porous yet highly adhesive dusts , were aerosolized to 2 - 5 μm with only 20 - 30 atm driving pressure . with pure albumin ( sigma a - 7888 ), an aerosol with a mmad of 1 . 9 -± 0 . 2 μm was generated by the device at 80 atm driving pressure in loaded amounts of up to 1 . 0 mg , and the same amounts of all - trans retinoic acid ( aldrich chemical company 22 , 301 - 8 ) were fractionated into particles around 2 - 3 micrometer mmad over a wide range of driving pressures . the preceding examples can be repeated with similar success by substituting the generically or specifically described reactants and / or operating conditions of this invention for those used in the preceding examples . they showed the effectiveness of using the invention to aerosolize adhesive powders , and demonstrated the lack of clogging from repeated use . although the invention has been described in detail with particular reference to these preferred embodiments , other embodiments can achieve the same results . variations and modifications of the present invention will be obvious to those skilled in the art and it is intended to cover in the appended claims all such modifications and equivalents . the entire disclosures of all references , applications , patents , and publications cited above are hereby incorporated by reference .

US-19099098-A

methods and compositions for treating pulmonary fibrosis are presented . methods comprise administering compositions comprising dna and streptolysin o to a subject in a manner so as not to effect gene transfer .

the present invention provides methods for treating respiratory illness . specifically , the invention provides methods for treating pulmonary fibrosis by administering a composition comprising streptolysin o and dna in an amount effective to treat pulmonary fibrosis . a preferred route of administration is sublingual , but other routes , such as subcutaneous , intravenous , intramuscular , and intrathecal are expected to work . dna for use in the present invention may be prokaryotic dna or eukaryotic dna such as salmon testicle dna or calf thymus dna ( sigma , st . louis ) and may be formulated in a number of pharmaceutically - acceptable vehicles , including water , saline , albumin , and dextrose . pulmonary function tests may be employed to detect physiological changes associated with the presence of pulmonary disease . pulmonary function tests performed in a clinical setting may be used to evaluate lung mechanics , gas exchange , pulmonary blood flow , and blood gases and ph . they are used to evaluate patients in the diagnosis of pulmonary disease , assessment of disease development , or evaluation of the risk of pulmonary complications from surgery . the term “ pulmonary function tests ” is used to indicate a battery of studies or maneuvers that may be performed using standardized equipment to measure lung function . pulmonary function tests include simple screening spirometry , formal lung volume measurement , diffusing capacity for carbon monoxide , and arterial blood gases . the pulmonary function tests may obtain such values as fev ( forced expiratory volume ), fvc ( forced vital capacity ), fef 25 %- 75 % ( forced expiratory flow rate ), pefr ( peak expiratory flow rate ), frc ( functional residual capacity ), rv ( residual volume ), tlc ( total lung capacity ), and / or flow / volume loops . fev measures the volume of air exhaled over a predetermined period of time by a forced expiration immediately after a full inspiration . fvc measures the total volume of air exhaled immediately after a full inspiration . fef 25 %- 75 % measures the rate of air flow during a forced expiration divided by the time in seconds for the middle half of expired volume . pefr measures the maximum flow rate during a forced exhale starting from full inspiration . frc is the volume of air remaining in the lungs after a full expiration . rv is the frc minus the expiratory reserve volume . tlc is the total volume in the lungs at the end of a full inspiration . flow / volume loops are graphical presentations of the percent of total volume expired ( on the independent axis ) versus the flow rate during a forced expiratory maneuver . normal values and lower limits of normal can be determined as defined by hankinson et al ( the national health and nutrition examination survey [ nhanes ] iii predicted set ). the following example illustrates the preferred embodiments of the invention and provides evidence of the effectiveness of claimed treatment methods . according to this example , human subjects diagnosed with pulmonary fibrosis were treated with compositions comprising dna and streptolysin o according to the invention numerous improvements and further aspects of the invention are apparent to the skilled artisan upon consideration of the example which follows . according to this example , a 72 - year old male , diagnosed with idiopathic pulmonary fibrosis and showing marked progression of disease as evidenced by compromised pulmonary function tests , ability to carry out the normal routines of daily life , and cardiac changes associated with compromised lungs , began therapy with the composition of the invention . specifically , the composition comprising 2 units of streptolysin o and 0 . 3 μg of salmon testicle dna ( sigma / aldrich ) was administered sublingually four times daily in dosages of one drop ( 0 . 05 ml ). every six months the patient was subjected to a variety of tests including spirometry , lung volume and diffusion capacity tests in order to evaluate the progression of the disease . each test provided results within the normal limits . thus , the subject observed stable or improved pulmonary function tests and an improved quality of life and did not exhibit any signs of disease progression . numerous modifications and variations in the practice of the invention are expected to occur to those skilled in the art upon consideration of the presently preferred embodiments thereof . consequently , the only limitations which should be placed upon the scope of the invention are those which appear in the appended claims .

US-96648707-A

a game racket with a gripping handle having an end with a forwardly extending radial enlargement disposed substantially on one side of a plane defined by strings or an equivalent striking surface of the racket . the upper surface and at least a portion of the rear surface of the handle end are substantially smooth and non - enlarged to avoid jamming into the palm or heel of the hand which would interfere with wrist - snap movement desirable in many racket strokes , and the enlarged front portion of the handle end prevents the handle from slipping out of the player &# 39 ; s grasp .

referring to fig1 - 3 , a tennis racket 10 constructed according to the invention includes a stringed head 11 , an elongated butt or handle 12 , and a shank or throat section 13 joining the head and handle . the improvement of this invention is confined to the structure at the terminal end of handle 12 , and the other parts of the racket are conventional . it is to be understood that the invention can be applied to any type of game racket , and the concept is not restricted to any particular style of racket for tennis or the other sports previously mentioned . handle 12 may be circular or oval in cross section , but most modern rackets are provided with a handle which has an elongated or irregular octagonal shape in cross section as shown in fig3 . the side surfaces of the main body of the handle are designated 1 - 8 in fig3 and these numbers are arranged in counter - clockwise ascending order when viewing the handle in section toward its free or terminal end as shown in fig3 . the octagonal configuration is preferred for many styles of rackets because it enables rapid indexing of the handle within the player &# 39 ; s grip to slightly different rotational positions for different types of strokes . surfaces 1 and 5 are at the top and bottom respectively of the handle when the racket is held for a normal relatively level forehand stroke against a ball 16 ( fig1 ). that is , these surfaces are perpendicular to a plane 15 defined by the stringed striking surface of the racket head . the front and rear faces of the racket handle are surfaces 7 and 3 respectively , and these surfaces are generally parallel to plane 15 . remaining surfaces 2 , 4 , 6 and 8 are oriented at approximately 45 degrees to surfaces 1 , 3 , 5 and 7 to complete the generally octagonal configuration of the handle when seen in cross section . as is conventional in rackets of this type , rear surface 3 and front surface 7 are shown as being slightly wider than the other faces of the handle to provide a slightly oval or elongated octagonal handle configuration which fits the hand comfortably . beginning approximately one - half inch from a free end 18 of the handle , side surfaces 5 , 6 , 7 and 8 are outwardly flared to define an outwardly extending shoulder or bulge 20 which extends around about one - half of the periphery of the handle . as best seen in fig3 bulge 20 is a smooth radial extension of surfaces 5 - 8 , with the exception that the opposite ends of the bulge are formed to be in the same planes as defined by surfaces 1 and 4 . in a typical configuration , the narrower side surfaces of the racket handle are conventionally about one - half inch in width , and wider surfaces 3 and 7 are approximately 3 / 4 inch in width . the radial extension of bulge 20 ( taken with reference to the axial center line of the elongated handle ) is preferably approximately 1 / 5 to 1 / 4 inch beyond surfaces 5 , 6 , 7 and 8 . the material used for handle 12 is not critical , and may be wood , metal or a composition material configured to be conventionally joined with shank 13 of the racket . preferably , the exterior of the handle is usually covered with a leather wrapping ( not shown ), and a cap ( not shown ) may be provided at end 18 to enable a neat termination of the leather wrapping as is conventional in tennis rackets . the end portion of the handle may also be formed as a separate slip - on cap which is useful to modify a conventional racket . incorporation of the modified handle give the racket head a definite front surface ( facing in the same direction as handle surface 7 ) used in forehand strokes , and a rear surface ( facing in the same direction as handle surface 3 ) used in backhand strokes . the modified racket is also allochiral in that slightly different configurations are needed for right - handed and left - handed players . a left - handed racket 10l is shown in fig4 - 5 , and the foregoing description applies equally to the left - handed version of the racket . it should be noted , however , that the numbered surfaces ( which carry an &# 34 ; l &# 34 ; suffix in the left - handed version ) ascend numerically in the opposite direction ( clockwise ) from those shown in fig3 . both the right - handed and left - handed versions of the tennis racket are characterized by a handle which terminates in outwardly flared faces on the bottom and forwardly facing surfaces of the handle . in both rackets , the bottom surface is surface 5 , and the forwardly facing surfaces are surfaces 6 , 7 and 8 . the term &# 34 ; forwardly facing &# 34 ; is meant to designate the general direction of forehand stroke , and also those surfaces which face away from the palm of the hand when the racket is normally gripped . top surface 1 and at least rearwardly facing surfaces 2 and 3 ( which are against the palm and heel of the hand in a normal grip ) lack the outward flare of surfaces 5 - 8 , and the end of the handle is substantially a smooth continuationof the general planes defined by surfaces 1 - 3 . elimination of the outward flare for surfaces 1 - 3 is adequate for certain grips , but the additional elimination of the flare of surface 4 is preferred as it enables rotation of the handle into a position referred to as a &# 34 ; western forehand &# 34 ; which is used by many players . the skewed terminal ends of the bulge or shoulder defined by extending the planes of surfaces 1 and 4 insure an adequate range of handle rotation within the player &# 39 ; s grip to execute different types of strokes while still avoiding jamming of the shoulder into the hand . substantially all of the shoulder ( with the exception of a portion of the radial extension of surface 5 ) is forward of plane 15 defined by the racket striking surface , leaving the rear surfaces of the handle end free of a radial extension . a possible disadvantage of the handle configurations described above is that different handles are required for right - and left - handed players . we have found that this problem can be eliminated without significant impairment of the advantages of the invention by forming the bulge 20 only on forwardly facing handle surfaces 6 , 7 , and 8 , and by eliminating the radial enlargement of surface 5 as illustrated in fig7 . in this modified &# 34 ; universal &# 34 ; configuration , bulge or shoulder 20 has opposite ends which are in the planes defined by surfaces 1 and 5 . that is , side surface 5 as seen in fig3 is flattened to have the same configuration as side surface 1 . we have found that elimination of approximately one - half or more of the continuously outwardly flared shoulder at the end of a conventional racket handle is effective in achieving better racket control for both increased power and improved execution of shots which impart spin to the ball . any shot requiring wrist snap is capable of far better execution with the improved racket because the end of the handle does not jam into the palm or heel of the player &# 39 ; s hand to interfere with the grip and overall racket control . the invention accordingly permits production of more effective and satisfactory rackets with substantially no increase in manufacturing cost .

US-19907280-A

a rack step tool for use , for example , in a warehouse which houses a plurality of storage racks which support equipment , merchandise , or other items which are stored on the shelves of the storage racks and from which the equipment , merchandise , or other items are periodically removed . the rack step tool generally includes a step member which is attached to a base plate . a pair of lugs is attached to the base plate for insertion into openings in a vertical support member of the storage rack . the rack step tool can be attached to the vertical support member at various heights and can be readily disengaged therefrom . the rack step tool may further have a securing element such as a hook for insertion into another hole in the support member for further securing the rack step tool thereto .

the present invention is a device which provides an adjustable step which can be adjustably secured to the vertical support member of a storage rack . the user can insert lugs of the device into openings of the vertical support member of the storage rack , wherein the user can then step on the device for reaching cartons or boxes placed at various locations on the shelves of the storage rack . the position of the step tool can be adjusted upwardly or downwardly on the vertical support member of the storage rack to match the particular height or need of the user . turning now to fig1 – 4 , a rack step tool 10 is shown . the rack step tool 10 comprises a base plate 12 having a front surface 14 , a back surface 16 , an outer perimeter 18 , an upper end 20 and a lower end 22 . the base plate 12 is preferably constructed of metal such as steel or aluminum . the base plate 12 has a vertical axis 24 represented on the back surface 16 , thereof . the vertical axis 24 separates the back surface 16 into a right side 26 and a left side 28 . a step member 30 is attached to the base plate 12 , generally to the front surface 14 thereof , and is preferably welded thereto or attached in any other manner known to those of ordinary skill in the art . the step member 30 is preferably constructed from a tubular metal pipe and preferably extends laterally in both directions perpendicular to the vertical axis 24 of the base plate 12 . the support member 30 preferably extends 4 inches to 10 inches beyond the outer perimeter 18 , and more preferably extends 6 inches to 8 inches beyond the outer perimeter 18 . the step member 30 has a front surface 32 , a back surface 34 to which the base plate 12 is generally attached , an upper surface 36 and a lower surface 38 . the step member 30 has a first end 40 and a second end 42 and a lumen 44 therein when the step member 30 is a pipe . preferably the step member 30 has a non - slip or anti - skid surface 46 on at least a portion of the upper surface 36 . materials for forming such anti - skid surfaces 46 are well known in the art . a first end plug 48 preferably covers the first end 40 and a second end plug 50 preferably covers the second end 42 . the rack step tool 10 further comprises a pair of lugs comprising an upper lug 52 which is attached to the base plate 12 and extends outwardly from the back surface 16 thereof and a lower lug 62 which is attached to the base plate 12 and extends outwardly from the back surface 16 thereof . the upper lug 52 and lower lug 62 preferably are offset in relation to the vertical axis 24 . in particular , one of the upper lug 52 and the lower lug 62 extends from the right side 26 of the back surface 16 and the other of the upper lug 52 and the lower lug 62 extends from the left side 28 of the back surface 16 . in the embodiment of fig1 – 4 , the upper lug 52 is on the right side 26 and the lower lug 62 is on the left side 28 . the offset nature of the upper lug 52 and lower lug 62 serves to help stabilize the rack step tool 10 on the storage rack during use . the upper lug 52 has a right side 54 , a left side 56 and a lower side 58 . preferably , the upper lug 52 has a notch 60 therein , and in fig1 – 4 the notch 60 is shown as being positioned in the lower side 58 of the upper lug 52 , preferably in a position directly adjacent the back surface 16 of the base plate 12 . the lower lug 62 has a right side 64 , a left side 66 , and a lower side 68 . preferably the lower lug 62 has a notch 70 therein and in fig1 – 4 is shown as being in the lower side 68 , preferably in a position adjacent the back surface 16 of the base plate 12 . the upper lug 52 and lower lug 62 preferably extend at least slightly downwardly from the back surface 16 of the base plate 16 . upper lug 52 extends from the back surface 16 at a first angle 72 while the lower lug extends from the back surface 16 at a second angle 74 . preferably first angle 72 and second angle 74 are 60 ° to 90 °, more preferably from 75 ° to 90 °, still more preferably from 85 ° to 90 ° and most preferably from 86 ° to 88 °. as noted above , the upper lug 52 and lower lug 62 are positioned on opposite sides of the vertical axis 24 wherein a diagonal line 76 which extends between the upper lug 52 and the lower lug 62 transects the vertical axis 24 at a transection angle 78 . the transection angle is generally from about 7 . 5 to 75 °, is more preferably from 10 ° to 60 °, more preferably from 12 . 5 ° to 45 ° and most preferably from 15 ° to 30 °. the rack step tool of the present invention preferably further comprises a securing element 80 as shown in the rack step tool 10 of fig1 – 4 . preferably the securing element 80 comprises a hook or a similar mechanism for hooking into a portion of a storage rack . the rack step tool 10 , as noted above , is constructed to engage a vertical support member 82 of a standard storage rack ( not shown ). the vertical support member 82 as represented in fig1 typically has a plurality of pairs of openings in a front surface 84 thereof . the plurality of pairs of openings may include for example a first pair of openings 86 which comprise a left opening 88 and a right opening 90 , a second pair of openings 92 which comprise a left opening 94 and a right opening 96 , and a third pair of openings 98 , which comprises a left opening 100 and a right opening 102 . as shown in fig3 , the rack step tool 10 , when in use , engages the vertical support member 82 of the storage rack . the upper lug 52 is inserted into the right opening 90 of the first pair of openings 86 , the lower lug 62 is inserted into the left opening of the second pair of openings 92 , and the securing element 80 , is inserted into the right opening 102 of the third pair of openings 98 which is positioned above the right opening 90 . the back surface 16 of the base plate 12 rests more or less against the front surface 84 of the vertical support member 82 . the notch 60 of the upper lug 52 slides over a lower edge in the right opening 90 and the notch 70 of the lower lug 62 slides over a lower edge in the left opening 94 . the user is then able to step on a left hand or right hand portion of the step member 30 to ascend or climb the storage rack to retrieve an item disposed thereon . although the upper lug 52 and lower lug 62 are shown as being offset in a preferred embodiment , the upper lug 52 and lower lug 62 may be vertically oriented on the base plate 12 such that a line drawn between them is parallel or congruent to the vertical axis 24 of the base plate 12 . in a preferred embodiment ( though the invention is explicitly not to be limited as such ) the step member 30 is about 18 inches long and has a 1 inch diameter . the base plate 12 has a width of about 3 inches and a height between the upper end 20 and lower end 22 of about 6 inches . the upper lug 52 and lower lug 62 extend about 1 to 4 inches from the back surface 16 . the centers of the left opening and right opening of each pair of openings in the vertical support member 82 are about 1 . 5 inches apart and the centers of adjacent right openings are about 4 inches apart . the rack step tool 10 is preferably constructed of a metal , but may be constructed of any suitable material such as a thermoplastic polymer or a composite resin , in all or in part . as noted above , the upper lug 52 of rack step tool 10 is positioned on the left side 28 of the back surface 16 while the lower lug 62 is positioned on the right side 26 . in any of the embodiments of the present invention described herein , the positions of the pair of lugs may be switched . for example , shown in fig5 is a rack step tool 10 a having a base plate 12 a , having a back surface 16 a , an outer perimeter 18 a , a vertical axis 24 a , a right side 24 a , a left side 28 a , a step member 30 a , an upper lug 52 a , a lower lug 62 a and a securing element 80 a . the upper lug 52 a is positioned on the right side 26 a and the lower lug 62 a is positioned on the left side 28 a . the rack step tool 10 a functions the same as rack step tool 10 in all regards . other embodiments of the present invention come readily to mind . for example , shown in fig6 is a rack step tool 10 b having a base plate 12 b , a step member 30 b , an upper lug 52 b , a lower lug 62 b , and a securing element 80 b . rack step tool 10 b is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that the upper lug 52 b has a hook configuration , rather than a rod - like configuration , for hooking into an opening of the vertical support member 82 . shown in fig7 is a rack step tool 10 c having a base plate 12 c , a step member 30 c , an upper lug 52 c , a lower lug 62 c , and a securing element 80 c . the rack step tool 10 c is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that lower lug 62 has a hook configuration . shown in fig8 is a rack step tool 10 d having a base plate 12 d , a step member 30 d , an upper lug 52 d , a lower lug 62 d , and a securing element 80 d . rack step tool 10 d is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that both the upper lug 52 d and lower lug 62 d have hook configurations rather than rod - like configurations . shown in fig9 and 10 is a rack step tool 10 e having a base plate 12 e , a step member 30 e , an upper lug 52 e , a lower lug 62 e , and a securing element 80 e . rack step tool 10 e is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that the step member 30 e is not a tubular pipe but rather has a flat configuration which extends perpendicularly a distance from a front surface 14 e of the base plate 12 e . shown in fig1 is a rack step tool 10 f having a base plate 12 f , a step member 30 f , an upper lug 52 f , a lower lug 62 f , and a securing element 80 f . rack step tool 10 f is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that the step member 30 f has a “ v ” configuration rather than a tubular configuration . shown in fig1 is a rack step tool 10 g having a base plate 12 g , a step member 30 g , an upper lug 52 g , a lower lug 62 g , and a securing element 80 g . rack step tool log is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that step member 30 g is hollow and has a square cross - section . shown in fig1 and 14 is a rack step tool 10 h having a base plate 12 h , a step member 30 h , an upper lug 52 h , a lower lug 62 h , and a securing element 80 h . rack step tool 10 h is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that a notch 60 h is positioned in a right side 54 h of upper lug 52 h and a notch 70 h is positioned in a left side 66 h of lower lug 62 h . notch 60 h and notch 70 h are configured in the right side 54 h and left side 66 h , respectively , for engaging a tapered lower edge of “ keyhole ”- shaped openings in a typical vertical support element 82 of a storage rack , for example such as those seen in u . s . pat . no . 3 , 303 , 937 . shown in fig1 is a rack step tool 10 i having a base plate 12 i , a step member 30 i , an upper lug 52 i , a lower lug 62 i , and a securing element 80 i . rack step tool 10 i is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that a notch 60 i is positioned in a left side 56 i of upper lug 52 i and a notch 70 i is positioned in a right side 64 i of lower lug 62 i . notch 60 i and notch 70 i are configured in the left side 56 i and right side 64 i , respectively , for engaging a lower edge of “ keyhole ”- shaped openings in a typical vertical support element 82 of a storage rack as noted above . any of the rack step tools 10 – 10 i may have additional notches in the lower side or left or right sides thereof for additional effectiveness in engaging to a lower edge of an opening of the vertical support element 82 . shown in fig1 and 17 is a rack step tool 10 j having a base plate 12 j , a step member 30 j , an upper lug 52 j , a lower lug 104 j , and a securing element 80 j . rack step tool 10 j is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that the lower lug 104 is a flange , rather than a rod or hook , and is attached to and extends from or near to a lower edge of the base plate 12 j . the lower lug 104 preferably sits astride an outer edge of the vertical support element 82 rather than inside an opening thereof when the rack step tool 10 j is secured to the vertical support element 82 . shown in fig1 is a rack step tool 10 k having a base plate 12 k , a step member 30 k , an upper lug 52 k , a lower lug 62 k , and a securing element 80 k . rack step tool 10 k is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that rack step tool 10 k has a hook extension 106 which can telescopically extend from and back into the step member 30 k . preferably the hook extension 106 can be locked into place via a locking device 108 in the step member 30 k . the hook extension 106 can be used by a user of the rack step tool 10 k to hook and retrieve boxes or items on the storage rack . shown in fig1 and 20 is a rack step tool 10 m having a base plate 12 m , a step member 30 m , an upper lug 52 m , a lower lug 62 m , and a securing element 80 m . rack step tool 10 m is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that the base plate 12 m is constructed of an upper portion 110 and a lower portion 112 . the upper portion 110 is connected to and extends from an upper portion of the step member 30 m and the lower portion 112 is connected to and extends from a lower portion of the step member 30 m . it will be understood by a person of ordinary skill in the art that the step member 30 in any embodiment herein may be constructed to the base plate at an upper , middle , or lower portion thereof . shown in fig2 is a rack step tool 10 n having a base plate 12 n , a step member 30 n , an upper lug 52 n , a lower lug 62 n , and a securing element 80 n . rack step tool 10 n is the same as either of rack step tools 10 or 10 a , or any other rack step tool embodied herein except that the securing element 80 n is a chain , wire or other tying mechanism which is designed to loop around a back of the vertical support member 82 and reattach to a portion of the base plate 12 n thereby securing the base plate 12 n to the vertical support member 82 . shown in fig2 is an alternate embodiment of the present invention . rack step tool 10 p has a step member 30 p , a securing element 80 p , and a pair of lugs 114 and 116 which are attached directly to the step member 30 p . shown in fig2 is another embodiment of the invention and is similar to rack step tool 10 p . rack step tool 10 q of fig2 has a step member 30 q , a securing element 80 q , and four lugs , 118 , 120 , 122 , and 124 , which are designed to fit into four parallel openings in a vertical support member having openings in such a configuration . shown in fig2 is a rack step tool referred to by the general reference numeral 10 r which is similar to the other embodiments herein in having a base plate 12 r and a step member 30 except the rack step tool 10 r has two pairs of lugs , including an upper pair comprising a left upper lug 126 and a right upper lug 128 , and a lower pair comprising a left lower lug 130 and a right lower lug 132 . rack step tool 10 r functions in a manner similar to rack step tool 10 or any other rack step tool embodiment herein , except when rack step tool 10 r is engaged with the vertical support member 82 , left upper lug 126 and right upper lug 128 fit into openings 90 and 88 , and left lower lug 130 and right lower lug 132 fit into openings 96 and 94 of the vertical support element 82 . the present invention comprises not only devices such as rack step tools 10 – 10 r described herein , and variations thereof , but also includes methods of using the tool in conjunction with a storage rack and includes the rack step tool 10 – 10 r in combination with a storage rack or any portion thereof to which the tool may be attached . when the rack step tool 10 – 10 r is being attached to the vertical support member 82 of the storage rack , the rack step tool 10 – 10 r is not twisted or rotated more than a few degrees to be secured to the vertical support member 82 , and then only to be snugly seated in the openings of the vertical support member 82 . the step member 30 – 30 r of the rack step tool 10 – 10 r extends perpendicularly from the vertical support member 82 either from the front surface of the vertical support member 82 or from a side edge thereof . changes may be made in the construction and the operation of the various components , elements and assemblies described herein or in the steps or the sequence of steps of the methods described herein without departing from the spirit and scope of the invention as defined in the following claims .

US-75408004-A

a pet toy includes a handle , a wire composed of a metallic material , a wire attachment apparatus coupled with a first end of the wire , an attachment mechanism coupled to a second end of the wire and structured to releasably couple to an object , and a telescoping pole having a first end coupled to the handle and a second end coupled to the wire attachment apparatus .

directional phrases used herein , such as , for example , left , right , front , back , top , bottom and derivatives thereof , relate to the orientation of the elements shown in the drawings and are not limiting upon the claims unless expressly recited therein . fig1 a and 1b include isometric views of a pet toy 1 in an extended ( fig1 a ) and a retracted ( fig1 b ) position . the pet toy 1 includes a telescoping wand 2 . a handle 4 is attached to one end of the telescoping wand 2 and a wire attachment apparatus 6 is attached to the other end of the telescoping wand 2 . a metallic wire 7 extends from the wire attachment apparatus 6 and its distal end is attached to an object via an attachment mechanism , as will be described in more detail in the description related to fig5 . the telescoping wand 2 includes several segments that are able to retract into each other when the pet toy 1 is in the retracted position . the telescoping wand 2 can be made from any suitable material . for example and without limitation , in some embodiments of the disclosed concept the telescoping wand 2 is made from a metallic material such as stainless steel . in other embodiments of the disclosed concept , the telescoping wand 2 is made from a plastic material . as shown in fig1 b , when the telescoping wand is retracted , the size of the pet toy 1 is considerably reduced . when the telescoping wand 2 is retracted , the majority of it fits within the handle 4 . this reduction in size makes it much easier to ship or travel with the pet toy 1 . fig2 is a view of a handle 4 that is used in conjunction with the pet toy 1 . the handle 4 is generally hollow so that the telescoping wand 2 can fit inside of it . the handle 4 can be made of any material , but it is preferable that the handle 4 is made of a material that is comfortable and easy to grip . fig3 a - 3d are views of the wire attachment apparatus 6 . fig3 a is an isometric view of the wire attachment apparatus 6 , fig3 b is a front view of the wire attachment apparatus 6 , fig3 c is a side view of the wire attachment apparatus 6 , and fig3 d is a rear view of the wire attachment apparatus 6 . as shown in fig3 a - 3d , the wire attachment apparatus 6 is attached to the end of the telescoping wand 2 . one end of the metallic wire 7 is attached to the wire attachment apparatus 6 . the metallic wire 7 extends from the wire attachment apparatus 6 . it is contemplated that the wire attachment apparatus 6 may be made of any suitable material such as , without limitation , a plastic material . the metallic wire 7 is made of a metallic material . in some exemplary embodiments of the disclosed concept , the metallic wire 7 is made of stainless steel . the metallic material provides the metallic wire 7 with a degree of rigidity and elasticity , unlike a string or a cord . thus , unlike a string or a cord , when an object attached to the metallic wire 7 is batted , the object will move in an unpredictable fashion as the rigidity and elasticity of the metallic wire 7 in response to the weight of the object and the force it is batted with . in some exemplary embodiments of the disclosed concept , the metallic wire 7 has a length within a range of about 25 to 35 inches and a thickness within a range of about 0 . 015 to 0 . 030 inches . these lengths and thicknesses of the metallic wire 7 result in an object attached to the metallic wire 7 to exhibit particularly unpredictable movement when batted . in another exemplary embodiment of the disclosed concept , the metallic wire 7 has a length of about 31 . 5 inches and a thickness of about 0 . 022 inches . in this exemplary embodiment of the disclosed concept , an object attached to the end of the metallic wire 7 also exhibits particularly unpredictable movement when batted . in some exemplary embodiments of the disclosed concept , a metallic wire used in the catfisher ® whipper snapper ™ wand is employed as the metallic wire 7 . referring to fig4 , an attachment mechanism 10 is shown . the attachment mechanism 10 is structured to releasably attach the metallic wire 7 to an object such as a ground squirrel toy . the attachment mechanism 10 shown in fig4 has two primary parts , a swivel attachment 11 and a releasable hook 12 . the swivel attachment 11 is coupled to the metallic wire 7 on one end and the releasable hook 12 on the other end . the swivel mechanism 11 is structured to be capable of swiveling . that is , when the object attached to the releasable hook 12 spins , the swivel mechanism 11 will swivel so that the metallic wire 7 does not also spin . referring to fig5 , the pet toy 1 including a squirrel ground toy 50 is shown . as shown in fig5 , one end of the swivel mechanism 11 is coupled to the releasable hook 12 . the other end of the releaseable hook 12 is releasably attached to the squirrel ground toy 50 via an attachment point 15 included on the squirrel ground toy 50 . the attachment point 15 may be a loop , as shown in fig5 , or any other structure suitable to attach to . in some embodiments of the disclosed concept , a cord extends a short distance from the object and the attachment point is disposed at the end of the cord . the releaseable hook 12 can be easily operated to detach the ground squirrel toy 50 from the releaseable hook 12 . the squirrel ground toy 50 can then be easily reattached or another object can be easily attached to the releaseable hook 12 . thus , the attachment mechanism 10 makes it easy to detach an attached object when it becomes worn out and to attach a new object without discarding the other components of the pet toy 1 such as the telescoping wand 2 and wire attachment apparatus 6 . fig6 - 9 are examples of objects that can be attached to the distal end of the metallic wire 7 and used in conjunction with the telescoping wand 2 and the wire attachment apparatus 6 . for example , referring to fig6 , a spider ground toy 20 is an example of an object that can be attached to the metallic wire 7 . the spider ground toy 20 includes a body 21 . the body 21 is preferably made of a soft rubber material . the body 21 includes openings in which fur inserts 22 are placed . the spider ground toy 20 also three sets of legs . each set of legs includes a pair of leg supports 23 that are made of a rigid material such as plastic . the leg supports 23 fit into the openings in the body 21 . the sets of legs also include ribbon feet 24 that extend from each of the leg supports 23 . referring to fig7 , a mouse ground toy 30 is shown . the mouse ground toy 30 includes a head section 31 . the head section 31 is preferably made of a rigid material such as plastic or a soft rubber material . the head section 31 may also be partially fur covered . the mouse ground toy 30 also includes a body section 32 . the body section 32 is preferably fur covered . the head section 31 and the body section 32 are connected together by a pivot mechanism 33 . the pivot mechanism 33 is structured to allow the head section 31 and the body section 32 to pivot from side to side . the mouse ground toy 30 further includes a tail 34 . the tail 34 is preferably made of string and includes a knotted end . referring to fig8 , an octopus ground toy 40 is shown . the octopus ground toy 40 includes a head section 41 . the head section 41 is preferably made of a rigid material such as plastic . the head section 41 is at least partially hollow and at least partially transparent so that the inside of the head section 41 can be seen . a ball 42 is disposed inside the hollow area of the head section 41 . the head section 41 further includes a pair of eyes 43 . the eyes 43 are moveable such as , for example and without limitation , opening and closing eyelids or moving pupils . the octopus ground toy 40 further includes a number of legs 44 attached to the head section 41 . the exterior of the legs 44 is preferably made of a soft material such as fabric . the inside of the legs 44 may include a noisemaking material such as crinkle plastic . referring to fig9 , the squirrel ground toy 50 is shown . the squirrel ground toy 50 includes a head 51 and a body 52 . the head 51 and the body 52 are connected to each other . the head 51 and the body 52 are preferably made of a soft rubber material . the squirrel ground toy 50 further includes a tail section 53 . the tail section 53 is preferably made to look furry like a squirrel &# 39 ; s tail . the tail section 53 may be made to look furry by covering in with a soft material such as fabric . the tail section 53 may be attached to the body 52 or a string may be used to pull the tail section 53 into the body 52 . the squirrel ground toy 50 further includes an interior tail section . the interior tail section fits inside the tail section 53 . the interior tail section is preferably made of a noisemaking material such as crinkle plastic . while some example of objects that can be attached to the metallic wire 7 have been described with respect to fig6 - 9 , it will be appreciated that any suitable object may be attached to the metallic wire 7 without departing from the scope of the disclosed concept . the spider ground toy 20 , the mouse ground toy 30 , the octopus ground toy 40 , and the squirrel ground toy 50 are all ground toys which are particularly suitable for use with the telescoping wand 2 and the metallic wire 7 . the metallic wire 7 causes the attached object to slide and bounce in an unpredictable manner as through it were an animal scurrying along the ground . although the foregoing discussion has presented specific embodiments , persons skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the embodiments to achieve similar functionality and utility to the exemplary embodiments disclosed herein . moreover , it should be appreciated that features from a particular embodiment may be implemented in another embodiment disclosed herein to achieve a desired functionality . accordingly , the specific embodiments described herein should be understood as examples and not limiting the scope of the disclosure .

US-201514641794-A

a method of separating two articulating surfaces of a joint is provided . the method includes providing a distractor having a series of generally spheroidal members . the method also includes inserting the distractor into the joint , and moving the distractor to separate the two articulating surfaces .

the following description of the various embodiments concerning a joint distraction apparatus are merely exemplary in nature and not intended to limit the present disclosure , its application , or uses . moreover , while the present disclosure is described in detail with respect to a hip joint , it will be appreciated by those skilled in the art that the present disclosure is clearly not limited to use in distracting a hip joint and may be applied to various other types of joints or body structures , as further discussed herein . referring to fig1 and 2 , there is shown a joint distractor 20 according to the teachings of the various embodiments . the joint distractor 20 is composed of a pair of generally planar non - elastic polymer members 23 and 24 . these polymer members 23 and 24 are coupled together along the inside 19 and outside edges 26 to form a hollow toroid . formed on the toroid is the series of hollow fluidly coupled generally spheroid members 21 . each of the fluid containing bodies 21 is joined by the tube regions 22 . prior to inflation , the distractor 20 is flat and the planar members 23 and 24 lie in contact with each other . the fluid in the fluid containing bodies 21 functions to apply pressure to the generally planar elastic or non - elastic members 23 and 24 . the members 23 and 24 then in turn apply forces to the articulating surfaces 25 of the joint to separate them . this force is in direct opposition to the forces generated by the ligaments of the joint . the inside edge 19 of the distractor defines a generally circular area 27 that generates the exposed joint surface 25 . these exposed surfaces can then be accessed by the many orthopedic instruments which can enter the generally circular area 27 by passing adjacent the tube regions 22 . as shown in fig3 , uninflated distractor 20 ′ is positioned adjacent to the surfaces to be separated by insertion through a small incision . the femoral component 28 of the hip joint is partially distracted from the pelvis 29 only enough to position the uninflated distractor 20 ′ between the joint surfaces 25 . after insertion between the joint surfaces 25 , sterile fluid is injected under pressure by a pressurized fluid source such as a syringe into the sealed distractor 20 , filling the generally spheroid members 21 . once the pressurized fluid fills the generally spheroid members 21 , access to the articular cartilage surfaces 25 of the joint is available in the circular region 27 , by passing the orthopedic instruments between the inflated spheroids 21 via an appropriate incision . as best seen in fig3 , orthopedic instruments 37 can access the articular surface 25 adjacent to the tube region 22 . each fluid distractor 20 preferably includes a valve 30 that regulates the fluid in and out of the spheroids 21 . the valve 30 functions to allow fluid into the distractor 20 while it is being pressurized . the sterile fluid can be removed from the distractor 20 by puncturing the surface 23 of the distractor or by releasing fluid through the valve 30 . fig4 and 5 represent views of an alternative embodiment of the present disclosure . shown is the toroidal joint distractor 31 which is formed by a pair of generally crescent shaped fluid filled spheroids 32 and 33 . coupling the crescent shaped spheroids 32 and 33 are a pair of adjoining fluidly filled tube regions 22 . although the toroidal distractor 31 has fewer tube regions 22 to insert orthopedic instruments 37 , the crescent shaped spheroids 32 and 33 provide a larger surface area which impart force on the articular surface 25 . the polymer members 23 and 24 forming the crescent shaped spheroids 27 and 28 can be coupled so as to form an angled wedge structure should a particular use call for one . with reference to fig6 , there is shown a joint distractor 20 according to the teachings of a second alternative embodiment of the present disclosure . the joint distractor 20 is composed of two fluidly isolated chambers 53 and 54 . these chambers 53 and 54 are each formed by at least one generally spheroid member 21 . each of the chambers 53 and 54 are capable of being filled by separate fluid sources through the tube regions 22 a and 22 b . additionally , the separate regions are non - fluidly coupled at regions 55 and 56 . as is depicted in fig6 , any of the distractors of the present disclosure can have radio opaque materials 57 such as the wire shown in fig6 . these radio opaque materials 57 can take the form of particulate incorporated within the distractor devices 20 . when placed within a joint the joint distractor as depicted in fig6 can be used to vary the angle of the joint by increasing or decreasing the amount of fluids in the chambers 53 and 54 . by modifying the amount of fluid within the chamber , access to the joint can be obtained adjacent to tube regions 22 . fig7 and 8 show side views of the third and fourth alternative embodiments of the present disclosure . shown in fig7 is the connected tube region 22 disposed on the top surface of the distractor . this allows for access of the joint area under the tube region 22 and the spaces defined . fig8 shows a plurality of generally spheroidal members 21 coupled by tube members 22 located on the top and bottom surface of the joint distractor . the tube members define openings 58 between the tube members and the generally spheroidal bodies 21 . access to the joint surfaces by medical instruments can be obtained adjacent the tube regions 22 . with reference to fig9 , a fifth alternative embodiment of the present disclosure is shown . shown is a distractor 36 having a series of generally spherical elements 38 on a cord 40 having handle elements 50 . the string of spherical elements 36 , which is pulled through a joint region , functions to separate and hold the joint articular cartilage surfaces 25 apart . the joint is first distracted slightly to separate the surfaces enough to allow passage of the distractor &# 39 ; s cord 40 . the cord 40 is then pulled through the region from smallest diameter spherical element 42 to a point along the distractor that there is sufficient access space created ( see fig1 ). access to the joint can be obtained by the use of instruments placed in regions between the spherical elements 38 . the spherical elements 38 can be used to hold the surfaces apart after the joint has been distracted by applying forces to separate the members . it is envisioned that the spherical elements 38 be solid or fluid filled . the series of adjacent spheres 38 are mounted onto a cord or articulating member 40 , which is made of fibers or wire by being integrally molded thereon . the spherical elements 38 have an increasing diameter from about 2 mm to about 10 mm , each spherical element 38 increasing in size by about 0 . 2 mm . the spherical elements 38 can be adjacent one another or can be spaced apart , leaving room between for access by orthopedic instruments 37 . in another embodiment of the present disclosure , shown in fig1 is a top view of a segmented distractor 46 according to the teachings of a sixth alternative embodiment of the present disclosure . as can be seen , the distractor 46 has a series of generally circular distractor components 48 , each having the same diameter . also shown are the handle members 50 which are used to pull the through the joint . fig1 shows a side view of the distractor 46 as shown in fig1 . as can be seen , the circular distractor components 48 have varying thicknesses . the thickness of the distractor components 48 increases from about 2 mm to about 10 mm . each of these segments has a pair of generally parallel planar regions 51 and 52 with each adjoining distractor component 48 defining a slightly larger thickness . the planar regions optionally can have a slightly angled surface to assist in the facilitation of the separation of the joint . a wide variety of features can be utilized in the various material disclosed and described above . the foregoing discussion discloses and describes the various embodiments of the present disclosure . one skilled in the art will readily recognize from such discussion , and from the accompanying drawings that various changes , modifications , and variations can be made therein without departing from the true spirit and fair scope of the present disclosure .

US-50249806-A

a system for treating or providing prophylaxus against a pulmonary infection is disclosed comprising : a ) a pharmaceutical formulation comprising a mixture of free antiinfective and antiinfective encapsulated in a lipid - based composition , and b ) an inhalation delivery device . a method for providing prophylaxis against a pulmonary infection in a patient and a method of reducing the loss of antiinfective encapsulated in a lipid - based composition upon nebulization comprising administering an aerosolized pharmaceutical formulation comprising a mixture of free antiinfective and antiinfective encapsulated in a lipid - based composition is also disclosed .

for convenience , before further description of the present invention , certain terms employed in the specification , examples and appended claims are collected here . these definitions should be read in light of the remainder of the disclosure and understood as by a person of skill in the art . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art . the articles “ a ” and “ an ” are used herein to refer to one or to more than one ( i . e . to at least one ) of the grammatical object of the article . by way of example , “ an element ” means one element or more than one element . the term “ antibacterial ” is art - recognized and refers to the ability of the compounds of the present invention so prevent , inhibit or destroy the growth of microbes of bacteria . the terms “ antiinfective ” and “ anti - infective agent ” are used interchangeably throughout the specification to describe a biologically active agent which can kill or inhibit the growth of certain other harmful pathogenic organisms , including but not limited to bacteria , yeasts and fungi , viruses , protozoa or parasites , and which can be administered to living organisms , especially animals such as mammals , particularly humans . the term “ antimicrobial ” is art - recognized and refers to the ability of the compounds of the present invention to prevent , inhibit or destroy the growth of microbes such as bacteria , fungi , protozoa and viruses . the term “ bioavailable ” is art - recognized and refers to a form of the subject invention that allows for it , or a portion of the amount administered , to be absorbed by , incorporated to , or otherwise physiologically available to a subject or patient to whom it is administered . the terms “ comprise ” and “ comprising ” are used in the inclusive , open sense , meaning that additional elements may be included . the term “ illness ” as used herein refers to any illness caused by or related to infection by an organism . the term “ including ” is used herein to mean “ including but not limited to ”. “ including ” and “ including but not limited to ” are used interchangeably . the term “ lipid - based composition ” as used herein refers to compositions that primarily comprise lipids . non - limiting examples of lipid - based compositions may take the form of coated lipid particles , liposomes , emulsions , micelles , and the like . the term “ mammal ” is known in the art , and exemplary mammals include humans , primates , bovines , porcines , canines , felines , and rodents ( e . g ., mice and rats ). the term “ microbe ” is art - recognized and refers to a microscopic organism . in certain embodiments the term microbe is applied to bacteria . in other embodiments the term refers to pathogenic forms of a microscopic organism . a “ patient ,” “ subject ” or “ host ” to be treated by the subject method may mean either a human or non - human animal . the term “ pharmaceutically - acceptable salts ” is art - recognized and refers to the relatively non - toxic , inorganic and organic acid addition salts of compounds , including , for example , those contained in compositions of the present invention . the term “ prodrug ” is art - recognized and is intended to encompass compounds which , under physiological conditions , are converted into the antibacterial agents of the present invention . a common method for making a prodrug is to select moieties which are hydrolyzed under physiological conditions to provide the desired compound . in other embodiments , the prodrug is converted by an enzymatic activity of the host animal or the target bacteria . the term “ treating ” is art - recognized and refers to curing as well as ameliorating at least one symptom of any condition or disease . the lipids used in the pharmaceutical formulations of the present invention can be synthetic , semi - synthetic or naturally - occurring lipids , including phospholipids , tocopherols , sterols , fatty acids , glycoproteins such as albumin , negatively - charged lipids and cationic lipids , in terms of phosholipids , they could include such lipids as egg phosphatidylcholine ( epc ), egg phosphatidylglycerol ( epg ), egg phosphatidylinositol ( epi ), egg phosphatidylserine ( isps ), phosphatidylethanolamine ( epe ), and phosphatide acid ( hpa ); the soya counterparts , soy phosphatidylcholine ( spc ); spg , sps , spi , spe , and spa ; the hydrogenaied egg and soya counterparts ( e . g ., hepc , hspc ), other phospholipids made up of ester linkages of fatty acids in the 2 and 3 of glycerol positions containing chains of 12 to 26 carbon atoms and different head groups in the i position of glycerol that include choline , glycerol , inositol , serine , ethanolarninc , as well as the corresponding phosphatide acids . the chains on these fatty acids can be saturated or unsaturated , and the phospholipid may foe made up of fatty acids of different chain lengths and different degrees of unsaturation . in particular , the compositions of the formulations can include dipalmitoylphosphatidylcholine ( dppc ), a major constituent of naturally - occurring lung surfactant . other examples include dimyristoylphosphatidycholine ( dmpc ) and dimyristoylphosphatidylglycerol ( dmpg ) dipaimitoylphosphatidcholine ( dppq and dipalmitoyiphosphatidylglycerol ( dppg ) dissearoylphosphatidylcholine ( dspq and distearoylphosphatidylglycerol ( dspg ), dioleylphosphatidyl - ethanolamine ( dope ) and mixed phospholipids like palmitoylstearoylphosphatidyl - choline ( fspc ) and palmitoylstearolphosphatidylglycerol ( pspg ), and single acylated phospholipids like mono - oleoyl - phosphatidylethanolamine ( mope ). the sterols can include , cholesterol , esters of cholesterol including cholesterol hemi - succinate , salts of cholesterol including cholesterol hydrogen sulfate and cholesterol sulfate , ergosterol , esters of ergosterol including ergosterol hemi - succinate , salts of ergosterol including ergosterol hydrogen sulfate and ergosterol sulfate , lanostsrol , esters of lanosterol including lanosterol hemi - succinate , salts of lanosterol including lanosterol hydrogen sulfate and lanosterol sulfate . the tocopherols can include tocopherols , esters of tocopherols including tocopherol hemi - succinates , salts of tocopherols including tocopherol hydrogen sulfates and tocopherol sulfates . the term “ sterol compound ” includes sterols , tocopherols and the like . the cationic lipids used can include ammonium salts of fatty acids , phospholids and glycerides . the fatty acids include fatty acids of carbon chain lengths of 12 to 26 carbon atoms that are either saturated or unsaturated . some specific examples include : myristylamine , palmitylamine , laurylamine and stearylamine , dilauroyl ethylphosphocholine ( dlep ), dimyristoyl ethylphosphocholine ( dmep ), dipalmitoyl ethylphosphocholine ( dpep ) and distearoyl ethylphosphocholine ( dsep ), n -( 2 , 3 - di -( 9 -( z )- octadecenyloxy )- prop - 1 - yl - n , n , n - trimethylammonium chloride ( dotma ) and 1 , 2 - bis ( oleoyloxy )- 3 -( trimethylammonio ) propane ( dotap ). the negatively - charged lipids which can be used include phosphatidyl - glycerols ( pgs ), phbsphatidic acids ( pas ), phosphatidylinositols ( pls ) and the phosphatidyl serines ( pss ). examples include dmpg , dppg , dspg , dmpa , dppa , dspa , dmpi , dppi , dspi , dmps , dpps and dsps . phosphatidylcholines , such as dppc , aid in the uptake by the cells in the lung ( e . g ., the alveolar macrophages ) and helps to sustain release of the bioactive agent in the lung . the negatively charged lipids such as the pgs , pas , pss and pls , in addition to reducing particle aggregation , are believed to play a role in the sustained release characteristics of the inhalation formulation as well as in the transport of the formulation across the long ( transcytosis ) for systemic uptake . the sterol compounds are believed to affect the release characteristics of the formulation . liposomes are completely closed lipid bilayer membranes containing an entrapped aqueous volume . liposomes may be unilamellar vesicles ( possessing a single membrane bilayer ) or multilamellar vesicles ( onion - like structures characterized by multiple membrane bilayers , each separated from the next by an aqueous layer ). the bilayer is composed of two lipid monolayers having a hydrophobic “ tail ” region and a hydrophilic “ head ” region . the structure of the membrane bilayer is such that the hydrophobic ( nonpolar ) “ tails ” of the lipid monolayers orient toward the center of the bilayer while the hydrophihc “ heads ” orient towards the aqueous phase . liposomes can be produced by a variety of methods ( for a review , see , e . g ., cullis et al . ( 1987 )). bangham &# 39 ; s procedure ( j . mol . biol . ( 1965 )) produces ordinary multilamellar vesicles ( mlvs ), lenk et at ( u . s . pat . nos . 4 , 522 , 803 , 5 , 030 , 453 and 5 , 169 , 637 ), fountain et al , ( u . s . pat . no . 4 , 588 , 578 ) and cullis et al . ( u . s . pat . no . 4 , 975 , 282 ) disclose methods for producing multilamellar liposomes having substantially equal interlamellar solute distribution in each of their aqueous compartments . paphadjopoulos et al . u . s . pat . no . 4 , 235 , 871 , discloses preparation of oligolamellar liposomes by reverse chase evaporation . unilamellar vesicles can be produced from mlvs by a number of techniques , for example , the extrusion of cullis et al . ( u . s . pat . no . 5 , 008 , 050 ) and loughrey et al . ( u . s . pat . no . 5 , 059 , 421 )). sonication and homogenination can be so used to produce smaller unilamellar liposomes from larger liposomes ( see , for example , paphadjopoulos et al . ( 1968 ); deamer and uster ( 1983 ); and chapman et al . ( 1968 )). the original liposome preparation of bangham et al , ( j . mol . biol ., 1965 , 13 : 238 - 252 ) involves suspending phospholipids in an organic solvent which is then evaporated to dryness leaving a phospholipid film on the reaction vessel . next , an appropriate amount of aqueous phase is added , the 60 mixture is allowed to “ swell ”, and the resulting liposomes which consist of multilamellar vesicles ( mlvs ) are dispersed by mechanical means . this preparation provides the basis for the development of the small sonicated unilamellar vesicles described by papahadjopoulos et al . ( biochim . biophysl acta ., 1967 , 135 : 624 - 638 ), and large unilamellar vesicles . techniques for producing large unilamellar vesicles ( luvs ), such as , reverse phase evaporation , infusion procedures , and detergent dilution , can be used to produce liposomes . a review of these and other methods for producing liposomes may be found in the text liposomes , marc ostro , ed . marcel dekker , inc ., new york , 1983 , chapter 1 , the pertinent portions of which are incorporated herein by reference . see also szoka , jr . et al ., ( 1980 , ann . rev . biophys . bioeng ., 9 : 467 ), the pertinent portions of which are also incorporated herein by reference . other techniques that are used to prepare vesicles include those that form reverse - phase evaporation vesicles ( rev ), papahadjopoulos el al ., u . s . pat . no . 4 , 235 , 871 another class of liposomes that may be used are those characterized as having substantially equal lamellar solute distribution . this class of liposomes is denominated as stable plurilamellar vesicles ( splv ) as defined in u . s . pat . no . 4 , 522 , 803 to lenk , et al , and includes monophasic vesicles as described in u . s . pat . no . 4 , 588 , 578 to fountain , et al . and frozen and thawed multilamellar vesicles ( fatmlv ) as described above . a variety of sterols and their water soluble derivatives such as cholesterol hemisuccinate have been used to form liposomes ; see specifically janoff et al ., u . s . pat . no , 4 , 721 , 612 , issued jan . 26 , 1988 , entitled “ steroidal liposomes .” mayhew et al , pct publication no . wo 85 / 00968 , published mar . 14 , 1985 , described a method for reducing the toxicity of drugs by encapsulating them in liposomes comprising alpha - tocopherol and certain derivatives thereof . also , a variety of tocopherols and their water soluble derivatives have been used to form liposomes , see janoff et al ,, pct publication no . 87 / 02219 , published apr . 23 , 1987 , entitled “ alpha tocopherol - based vesicles ”. the liposomes are comprised of particles with a mean diameter of approximately 0 . 01 microns to approximately 3 . 0 microns , preferably in the range about 0 , 2 to 1 . 0 microns . the sustained release property of the liposomal product can be regulated by the nature of the lipid membrane and by inclusion of other excipients ( e . g ., sterols ) in the composition . the infective agent included in the scope of the present invention may be a bacteria . the bacteria can be selected from : pseudomonas aeruginosa , bacillus anthracis , listeria monocytogenes , staphylococcus aureus , salmenellosis , yersina pestis , mycobacterium leprae , m . africanum , m , asiaticum , m . avium - intracellulaire , m . chelonei abscessus , m . fallax , m . fortuitum , m . kansasii , m . leprae , m . malmoense , m . shimoidei , m simiae , m , szulgai , m , xenopi , m , tuberculosis . brucella melitensis , brucella suis , brucella abortus , brucella canis , legionella pneumonophilia , francisella tularensis , pneumocystis carinii , mycoplasma , and burkholderia cepacia . the infective agent included in the scope of the present invention can be a virus . the virus can be selected from hantavirus , respiratory syncytial virus , influenza , and viral pneumonia . the infective agent included in the scope of the present invention can be a fungus . fungal diseases of note include ; aspergillosis , disseminated candidiasis , blastomycosis , coccidioidomycosis , cryptococcosis , histoplasmosis , mucormycosis , and sporotrichosis . the term antiinfective agent is used throughout the specification to describe a biologically active agent which can kill or inhibit the growth of certain other harmful pathogenic organisms , including but not limited to bacteria , yeasts and fungi , viruses , protozoa or parasites , and which can be administered to living organisms , especially animals such as mammals , particularly humans . non - limiting examples of antibiotic agents that may be used in the antiinfective compositions of the present invention include cephalosporins , quinolones and fluoroquinolones , penicillins , and beta lactamase inhibitors , carbepenems , monobactams , macrolides and licosamines , glycopeptides , rifampin , oxazolidonones , tetracyclines , aminoglycosides , streptogramins , sulfonamides , and others . each family comprises many members . cephalosporins are further categorized by generation . non - limiting examples of cephalosporins by generation include the following . examples of cephalosporins i generation include cefadroxil , cefazolin , cephalexin , cephalothm , cephapirin , and cephradine . examples of cephalosporins ii generation include cefaclor , cefamandol , cefonicid , cefotetan , cefoxitin , cefproxil , ceftmetazole , cefuroxime , cefuroxime axetil , and loracarbef . examples of cephalosporins iii generation include cefdinir , ceftibuten , cefditoren , cefetarnet , cefpodoxime , cefprozil , cefuroxime ( axetil ), cefuroxime ( sodium ), cefoperazooe , cefixime , cefotaxime , cefpodoxime proxetil , ceftazidime , ceftizoxime , and ceftriaxone . examples of cephalosporins iv generation include cefepime . non - limiting examples of quinolones and fluoroquinolones include cinoxacin , ciprofloxacin , enoxaein , gatifloxacin , grepafloxacin , levofloxacin , lomefloxacin , moxlfloxacin , nalidixic acid , norfloxacin , ofloxacin , sparfloxacin , trovafloxacin , oxolfoic acid , gemifloxacin , and perfloxacin . non - limiting examples of penicillins include amoxicillin , ampicillin , bacampicillin , carbenicillin indanyl , mezlocillin , piperacillin , sod ticarcillin . non - limiting examples of penicillins and beta lactamase inhibitors include amoxicillin - clavuianic acid , ampicillin - sulbactam , sulfactam , tazobactam , benzylpenicillin , cloxacillin dicloxacillin , methicillin , oxacillin , penicillin g ( benzathine , potassium , procaine ), penicillin v , penicillinase - resistant penicillins , isoxazoylpenicillins , aminopenicillins , ureidopenicillins , piperacillin + tazobactam , ticarcillin + clavulanic acid , and nafcillin . non - limiting examples of macrolides and lincosamines include azithromycin , clarithromycin , clindamycin , dirithromycin , erythromycin , lineomycin , and troleandomycin . non - limiting examples of tetracyclines include demeclocycline , doxycycilne , methaeycline , minocycline , oxytetracycline , tetracycline , and chlortetracycline . non - limiting examples of aminoglycosides include amikacin , gentamicin , kanamycin , neomycin , netilmicin , streptomycin , tobramycin , and paromomycin . non - limiting examples of sulfonamides include mafenide , silver sulfadiazine , sulfacetamide , sulfadiazine , sulfamethoxazole , sulfasalazine , sulfisoxazole , trimethoprim - sulfamethoxazole , and sulfamethizole . non - limiting examples of other antibiotic agents include bacitracin , chloramphenicol , colistemetate , fosfomycin , isoniazid , methenamine , metrenidazol , mupirocin , nitrofurantoin , nitroturasone , novobiocin , polymyxin b , spectinomycin , trimethoprine , trimethoprine / sulfamethoxazole , cationic peptides , colistin , iseganan , cycloserine , capreomycin , pyrazinamide , para - aminosalicyclic acid , and erythromycin ethylsuccinate + sulfisoxazole . antiviral agents include , but are not limited to : zidovudine , acyclovir , ganciclovir , vidarabine , idoxuridine , trifioridine , ribavirin , interferon aipha - 2a , interferon alpha - 2b , interferon beta , interferon gamma ). anifungal agents include , but are not limited to : amphotericin b , nystatin , hamycin , natamycin , pimaricin , ambruticin , itraconazole , terconazole , ketoconazole , voriconazole , miconazole , nikkomycin z , griseofulvin , candicidin , cilofungin , chlotrimazole , clioquinol , caspufungin , tolnaflate . the dosage of any compositions of the present invention will vary depending on the symptoms , age and body weight of the patient , the nature and severity of the disorder to be treated or prevented , the route of administration , and the form of the subject composition . any of the subject formulations may be administered in a single dose or in divided doses . dosages for the compositions of the present invention may be readily determined by techniques known to those of skill in the art or as taught herein . in certain embodiments , the dosage of the subject compounds will generally be in the range of about 0 . 01 ng to about 10 g per kg body weight , specifically in the range of about 1 ng to about 0 . 1 g per kg , and more specifically in the range of about 100 ng to about 10 mg per kg . an effective dose or amount , and any possible affects on the timing of administration of the formulation , may need to be identified for any particular composition of the present invention . this may be accomplished by routine experiment as described herein , using one or more groups of animals ( preferably at least 5 animals per group ), or in human trials if appropriate . the effectiveness of any subject composition and method of treatment or prevention may be assessed by administering the composition and assessing the effect of the administration by measuring one or more applicable indices , and comparing the post - treatment values of these indices to the values of the same indices prior to treatment . the precise time of administration and amount of any particular subject composition that will yield the most effective treatment in a given patient will depend upon the activity , pharmacokinetics , and bioavailability of a subject composition , physiological condition of the patient ( including age , sex , disease type and stage , general physical condition , responsiveness to a given dosage and type of medication ), route of administration , and the like . the guidelines presented herein may be used to optimize the treatment , e . g ., determining the optimum time and / or amount of administration , which will require no more than routine experimentation consisting of monitoring the subject and adjusting the dosage and / or timing . while the subject is being treated , the health of the patient may be monitored by measuring one or more of the relevant indices at predetermined times during the treatment period . treatment , including composition , amounts , times of administration and formulation , may be optimized according to the results of such monitoring . the patient may be periodically reevaluated to determine the extent of improvement by measuring the same parameters . adjustments to the amount ( s ) of subject composition administered and possibly to the time of administration may be made based on these revaluations . treatment may be initiated with smaller dosages which are less than the optimum dose of the compound . thereafter , the dosage may be increased by small increments until the optimum therapeutic effect is attained . the use of the subject compositions may reduce the required dosage for any individual agent contained in the compositions ( e . g ., the fabi inhibitor ) because the onset and duration of effect of the different agents may be complimentary . toxicity and therapeutic efficacy of subject compositions may be determined by standard pharmaceutical procedures in cell cultures or experimental animals , e . g ., tor determining the ld 50 and the ed 50 . the data obtained from the cell culture assays and animal studies may be used in formulating a range of dosage for use in humans . the dosage of any subject composition lies preferably within a range of circulating concentrations that include the ed 50 with little or no toxicity . the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized . for compositions of the present invention , the therapeutically effective dose may be estimated initially from ceil culture assays . the pharmaceutical formulation of the antiinfective may be comprised of either an aqueous dispersion of liposomes and free antiinfective , or a dehydrated powder containing liposomes and free antiinfective . the formulation may contain lipid excipients to form the liposomes , and salts / buffers to provide the appropriate osmolarity and ph . the dry powder formulations may contain additional excipients to prevent the leakage of encapsulated antiinfective during the drying and potential milling steps needed to create a suitable particle size for inhalation ( i . e ., 1 - 5 μm ). such excipients are designed to increase the glass transition temperature of the antiinfective formulation . the pharmaceutical excipient may be a liquid or solid filler , diluent , solvent or encapsulating material , involved in carrying or transporting any subject composition or component thereof from one organ , or portion of the body , to another organ , or portion of the body . each excipient must be “ acceptable ” in the sense of being compatible with the subject composition and its components and not injurious to the patient . suitable excipients include trehalose , raffinose , mannitol , sucrose , leucine , trileucine , and calcium chloride , examples of other suitable excipients include ( 1 ) sugars , such as lactose , and glucose ; ( 2 ) starches , such as corn starch and potato starch ; ( 3 ) cellulose , and its derivatives , such as sodium carboxymethyl cellulose , ethyl cellulose and cellulose acetate ; ( 4 ) powdered tragacanth ; ( 5 ) malt ; ( 6 ) gelatin ; ( 7 ) talc ; ( 8 ) excipients , such as cocoa butter and suppository waxes ; ( 9 ) oils , such as peanut oil , cottonseed oil , safflower oil , sesame oil , olive oil , corn oil and soybean oil ; ( 10 ) glycols , such as propylene glycol ; ( 11 ) polyols , such as glycerin , sorbitol , and polyethylene glycol ; ( 12 ) esters , such as ethyl oleate and ethyl laurate ; ( 13 ) agar ; ( 14 ) buffering agents , such as magnesium hydroxide and aluminum hydroxide : ( 15 ) alginic acid ; ( 16 ) pyrogen - free water ; ( 17 ) isotonic saline ; ( 18 ) ringer &# 39 ; s solution ; ( 19 ) ethyl alcohol ; ( 20 ) phosphate buffer solutions ; and ( 21 ) other non - toxic compatible substances employed in pharmaceutical formulations . the pharmaceutical formulations of the present invention may fee used in any dosage dispensing device adapted for intranasal administration . the device should be constructed with a view to ascertaining optimum metering accuracy and compatibility of its constructive elements , such as container , valve and actuator with the nasal formulation and could be based on a mechanical pump system , e . g ., that of a metered - dose nebulizer , dry powder inhaler , soft mist inhaler , or a nebulizer . due to the large administered dose , preferred devices include jet nebulizers ( e . g ., pari lc star , akita ), soft mist inhalers ( e . g ., pari e - flow ), and capsule - based dry powder inhalers ( e . g ., ph & amp ; t turbospin ). suitable propellasts may be selected among such gases as fluorocarbons , hydrocarbons , nitrogen and dinitrogen oxide or mixtures thereof . the inhalation delivery device can be a nebulizer or a metered dose inhaler ( mdi ), or any other suitable inhalation delivery device known to one of ordinary skill in the art . the device can contain and be used to deliver a single dose of the antiinfective compositions or the device can contain and be used to deliver multi - doses of the compositions of the present invention . a nebulizer type inhalation delivery device can contain the compositions of the present invention as a solution , usually aqueous , or a suspension . in generating the nebulized spray of the compositions for inhalation , the nebulizer type delivery device may be driven ultrasonically , by compressed air , by other gases , electronically or mechanically . the ultrasonic nebulizer device usually works by imposing a rapidly oscillating waveform onto the liquid film of the formulation via an electrochemical vibrating surface . at a given amplitude the waveform becomes unstable , whereby it disintegrates the liquids film , and it produces small droplets of the formulation . the nebulizer device driven by air or other gases operates on the basis that a high pressure gas stream produces a local pressure drop that draws the liquid formulation into the stream of gases via capillary action . this fine liquid stream is then disintegrated by shear forces . the nebulizer may be portable and hand held in design , and may be equipped with a self contained electrical unit . the nebulizer device may comprise a nozzle that has two coincident outlet channels of defined aperture size through which the liquid formulation can be accelerated . this results in impaction of the two streams and atomization of the formulation . the nebulizer may use a mechanical actuator to force the liquid formulation through a multiorifice nozzle of defined aperture size ( s ) to produce an aerosol of the formulation for inhalation . in the design of single dose nebulizers , blister packs containing single doses of the formulation may be employed . in the present invention , the nebulizer may be employed to ensure the sizing of particles is optimal for positioning of the particle within , for example , the pulmonary membrane . a metered dose inhaiator ( mdi ) may be employed as the inhalation delivery device for the compositions of the present invention . this device is pressurized ( pmdi ) and its basic structure comprises a metering valve , an actuator and a container . a propellant is used to discharge the formulation from the device . the composition may consist of particles of a defined size suspended in the pressurized propellant ( s ) liquid , or the composition can be in a solution or suspension of pressurized liquid propellant ( s ). the propellants used are primarily atmospheric friendly hydroflourocarbons ( hfcs ) such as 134a and 227 . traditional chlorofluorocarbons like cfc - 11 , 12 and 114 are used only when essential . the device of the inhalation system may deliver a single dose via , e . g ., a blister pack , or it may be multi dose in design . the pressurized metered dose inhaiator of the inhalation system can be breath actuated to deliver an accurate dose of the lipid - containitng formulation . to insure accuracy of dosing , the delivery of the formulation may be programmed via a microprocessor to occur at a certain point in the inhalation cycle . the mdi may be portable and hand held . pharmacokinetics of amikacin delivered as both free and encapsulated amikacin in healthy volunteers . the nebulized liposomal amikacin contains a mixture of encapsulated ( ca ., 60 %) and free amikacin ( ca ., 40 %). following inhalation in healthy volunteers the corrected nominal dose was 100 mg as determined by gamma scintigraphy . fig1 depicts the lung concentration of amikacin and tobi ® ( administered 100 % free ), based on pharmacokinetic modeling of serum concentrations over time . both curves assume a volume of distribution for aminoglycosides in the lung of 200 ml . interestingly , the peak levels of antiinfective in the lung are approximately equivalent for the 100 mg dose of liposomal amikacin , and the 300 mg dose of tobi ®. this is a consequence of the rapid clearance of the free tobramycin from the lung by absorption into the systemic circulation with a half - life of about 1 . 5 hr . these results serve as a demonstration of the improved lung targeting afforded by liposomal encapsulation . the presence of free and encapsulated antiinfective in the amikacin formulation is demonstrated by the two component pharmacokinetic profile observed . free amikacin is rapidly absorbed into the systemic circulation ( with a half - life similar to tobi ), while the encapsulated drug has a lung half - life of approximately 45 hr . the free amikacin is available to provide bactericidal activity , while the encapsulated drug provides sustained levels of drug in the lung , enabling improved killing of resistant bacterial strains . the measured lung concentrations for the liposomal compartment are significantly above the mic 50 of 1240 clinical isolates of pseudomonas aeruginosa , potentially reducing the development of resistance . impact of free amikacin on the percentage of amikacin encapsulated in liposomes following nebulization . liposomal preparations of amikacin may exhibit significant leakage of encapsulated drug during nebuimation . as detailed in table 1 below , the presence of free amikacin in solution was shown to surprisingly decrease the leakage of antiinfective by about four - fold from the liposome . while not wishing to be limited to any particular theory , it is hypothesized that liposomes break - up and re - form during nebulization , losing encapsulated antiinfective in the process . alternatively , encapsulated antiinfective is lost during nebulization because the liposome membrane becomes leaky . when an excess of free antiinfective is present in solution , the free antiinfective is readily available in close proximity to the liposome , and is available to be taken back up into the liposome on re - formation . those skilled in the art will recognize , or be able to ascertain using no more than routine experimentation , many equivalents to the specific embodiments of the invention described herein . such equivalents are intended to be encompassed by the following claims .

US-201314080922-A

a biosensing device for detecting biological analytes , and methods of use and manufacture , are disclosed . the device includes a biosensing element that can remain implanted for extended periods of time . the biosensing element is connected to an optical fiber terminating outside of the body . the optical fiber is also connected to an information analyzer . the information analyzer directs light through the optical fiber into the biosensing element . the light excites fluorophores , created by a chemical reaction between analytes and biosensing material within the biosensing element . emitted fluorescent light is redirected through the optical fiber to the information analyzer . detectors detect the deflected fluorescent emissions and , according to their determined wavelength , report the presence or quantity of specific analytes to the patient on an external display .

the detailed description set forth below in connection with the appended drawings is intended as a description of exemplary embodiments and is not intended to represent the only embodiments in which the biosensing devices , methods and systems can be practiced . the term “ exemplary ” used throughout this description means “ serving as an example , instance , or illustration ,” and should not necessarily be construed as preferred or advantageous over other embodiments . the detailed description includes specific details for the purpose of providing a thorough understanding of the biosensing devices , methods and systems . however , it will be apparent to those skilled in the art that the biosensing devices , methods and systems may be practiced without these specific details . in an exemplary embodiment , minimally invasive biosensors are attached to the ends of percutaneously injected optical fibers . the fiber - optic biosensor takes advantage of the configuration of chronically implanted artificial hair used for cosmetic purposes . such hairs consist of filaments of synthetic polymer that can be injected into the scalp , where they form a stable epithelial interface . likewise , the biosensor is implantable underneath the skin into a well - vascularized subcutaneous space such as the scalp . in an exemplary embodiment , a single optical fiber makes up the “ shaft ” of the hair , and the sensing system is the “ follicle ”. in order to manage certain diseases , it is often beneficial to make frequent measurements of specific biochemicals over an extended period of time . accordingly , some embodiments of the biosensing devices and systems can be used to measure glucose . other analytes that can be analyzed by embodiments include , but are not limited to , hormones related to fertility , premature delivery and other late - term complications of pregnancy such as eclampsia . some embodiments of the technology could be applied to assay tissue levels of drugs that have narrow margins between effective and dangerous levels , such as cytotoxic chemotherapeutics ( e . g . taxol ) and anticoagulants . clinically significant analytes that can be analyzed include , but are not limited to : glucose , cholesterol , amylase , urea , triglycerides , ph , creatinine kinase , creatinine , aspartate aminotransferase , phenylalanine , lactate dehydrogenase , akaline phosphotase , got , bilirubin , oxygen , carbon dioxide , ammonia , theophylline , dilantin , gentamicin , tobramicin , digoxin , coumadin , vincristine , cortisol , estriol , progesterone , aldosterone , cortisone , thyroxine binding globulin , placental lactogen , prolactin , human chorionic gonadotropin , insulin , parathyroid hormone , growth hormone , angiotensin , oxytocin , vasopressin , igm ( total ), igg ( specific ), syphilis , rubella , hepatitis , alpha - fetoprotein , and various cancer proteins . fig1 illustrates am exemplary compact and portable biosensing system 220 comprising a biosensing device 100 , an analyzer 112 , and an exemplary mode of positioning relative to a patient &# 39 ; s body . the exemplary biosensing device comprises an optical fiber 102 that extends through the patient &# 39 ; s skin 104 . the optical fiber 102 may be injected percutaneously to sample interstitial fluid ( e . g . in the scalp or forearm ), or in any other region in which analytes 108 are being tested . the biosensing device 100 includes a biosensor element 110 , attached to a first end of the fiber 102 that is inserted into the patient &# 39 ; s body . the second , opposite , end of the fiber 102 is releasably attached to an analyzer 112 by means of a connector 114 . the analyzer 112 receives light emitted by the biosensing element 110 via the optical fiber 102 , then filters and analyzes the received light to detect the presence and / or quantity of analytes within the patient &# 39 ; s body . in an exemplary embodiment , the analyzer 112 is sized and configured to be easily carried by the patient . the information analyzer 112 is portable such that it may be easily moved or even worn by the patient , sized and configured to be easily carried by the patient . for example , the information analyzer 112 could be sized to fit within a patient &# 39 ; s hand , and could be light enough to be easily moved by the patient , or attached to the patient &# 39 ; s clothing or to a strap that is worn by the patient . because of its portability and small size , the information analyzer 112 may be used to take continuous measurements , such as when the patient wears it on his body or clothing . its small size also makes the information analyzer 112 convenient for taking frequent , yet intermittent measurements , such as when the patient wears it or simply carries it with him because it is easily portable and accessible . in use , the patient slips the free external end of the optical fiber 100 of the implanted biosensing device into a connector 114 , which triggers the analyzer 112 to take a reading and display the results to the user . in some exemplary embodiments , the implanted device can remain continuously in the patient without removal for varying lengths of time . for example , in one exemplary embodiment , the implanted device can remain continuously in the patient without removal for at least one day . in another exemplary embodiment , the implanted device can remain continuously in the patient without removal for at least seven days . in a further exemplary embodiment , the device can remain continuously in the patient without removal for at least one month . the information transmitted through the optical fiber 102 is light energy ( photons at different wavelengths ), and the connector is an optical connector 114 , to ensure the presence of an optical connection between the optical fiber 102 and the analyzer 112 . in this exemplary embodiment , the analyzer 112 exposes the biosensor element 110 to excitation light of a first wavelength from light emitting diode ( led ) that is directed through an optical connector 114 to optical fiber 102 to the biosensor element 110 , and in response receives emitted fluorescent light of at least a second wavelength from the biosensor element , directed through the optical fiber in the opposite direction . the emitted fluorescent light can then be filtered and measured by the analyzer 112 to identify and / or quantify the analytes detected by the biosensor element 110 . the analyzer 112 may identify the presence of specific analytes by measuring the wavelength of the fluorescent light emitted , and may measure the quantity of analytes present by measuring the intensity of the fluorescent light emitted . in one exemplary embodiment , the biosensor element 110 comprises biosensing material 116 located substantially at the end of the optical fiber 102 . in some embodiments , it may be desirable to prevent substantially direct contact between the biosensing material 116 and patient tissue 106 . in such cases , the biosensor element 110 may include a containment matrix 118 that substantially contains the biosensing material 116 within a reaction region that is in close proximity to the end of the optical fiber 102 . in some embodiments , for example , the containment matrix may comprise polyethylene glycol ( peg ), a silicone - based material , or other biocompatible material known to those skilled in the art . further , the containment matrix 118 may be configured to be in contact with or form a seal with the optical fiber 102 . the containment matrix 118 thereby can contain the biosensing material so that it does not diffuse away from the biosensor element . the containment matrix 118 may also contain the products of a reaction between analytes 108 and the biosensing material 116 . this containment of the reactive products can prevent them from dispersing throughout the patient &# 39 ; s body such that they are retained within a concentrated area for signal communication to the optical fiber 102 . the containment matrix 118 can include pores 120 to allow analytes 108 to diffuse within the containment matrix 118 to contact the biosensing material . the pores 120 may be inherently formed due to the characteristics of the material used for the containment matrix 118 or , if the selected material is not sufficiently porous , then pores may be explicitly created therein , for example by burning holes using a tightly focused laser beam such as an excimer laser . the pores can be sized such that they are large enough to allow the diffusion of analytes 108 into the reaction region , and small enough to prohibit the passage of other elements from the reactive region to other areas of the patient &# 39 ; s body . fig2 illustrates another exemplary embodiment of the biosensor element 110 . in the embodiment illustrated in fig2 , the containment matrix 118 and biosensing material 116 can be combined . the materials of the containment matrix 118 can be selected to be biocompatible with the patient , permeable to the analytes being detected , capable of chemically or physically trapping the biosensing material 116 ( including its fluorophores ) and of a material that forms a strong adhesion to the optical fiber 102 . the containment matrix can be attached directly to the internal end of the optical fiber , permitting efficient and constant coupling to a small sensing structure . in an exemplary embodiment , polyethylene glycol ( peg ) polymers can be used since peg demonstrates good biocompatibility and structural integrity . the polymer can be applied to the optical fiber in an unpolymerized state , and then polymerized to enhance stability of the structure by gamma irradiation , chemical cross - linking or uv radiation . an exemplary method of preparing a containment matrix precursor solution combines a peg carrier with tetramethylrhodamine isothiocyanate ( tritc - dextran ), fluorescein isothiocyanate concanavalin a ( fitc - con a ), and fluorophores . one method is described by russell et al . ( r . j . russell , m . v . pishko , c . c . gefrides , m . j . mcshane and g . l . cote , 1999 , “ a fluorescence - based glucose biosensor using concanavalin a and dextran encapsulated in a poly ( ethylene glycol ) hydrogel ”, anal . chem 71 : 3126 - 3132 ), and is hereby incorporated by reference . for example , fitc - con a and tritc - dextran are dissolved prior to use in about 0 . 1 m pbs ( about ph 7 . 4 ). the fitc - con a solution and peg - nhs , polyethylene glycol - n - hydroxysuccinimide ( con a / peg - nhs = 100 μl / 1 mg ) are added to peg - da , polyethylene glycol - diacrylate ( for example , the volume ratio of peg - da to fluorescein solution can be 2 : 1 ) and the resultant mixture can be vortexed for approximately 30 minutes . tritc - dextran , 100 μl of tpt , and 10 mg dmpa are added and vortexed for approximately 30 minutes . in an exemplary embodiment , the containment matrix is attached to the optical fiber by dipping the optical fiber into a containment matrix precursor solution , such as the solution described above . uv light ( for example , 4 w / cm 2 ) can then be passed through the fiber to induce cross - linking polymerization onto the end of the fiber . after the fiber is pulled out from the solution , the fiber can be dipped again , removed from the solution , and polymerized with uv from the side to increase the interface contact area for better adhesion . in some embodiments , the optical fiber 102 may be composed of a number of different materials such as , for example , glass , silicon or plastic . for example , glass has desirable optical properties and can be configured to have a silicon outer surface that can be modified to bind different coatings . some embodiments can be covered with a variety of biocompatible polymers that enhance the fiber optics &# 39 ; strength and tissue integration . although the optical fiber 102 does not have a specific size requirement , fibers having a diameter between about 50 μm and about 200 μm can be used for ease of insertion through the skin 104 of a patient . fibers within this range of sizes are also sufficiently large for effective data transmission , suitably flexible that a patient can manipulate them with ease , and sufficiently strong to withstand patient wear . for example , a 100 μm / 110 μm ( core / cladding ) glass fiber can be bent to a radius of about 0 . 5 mm before fracturing . fig3 is a diagram of an exemplary analyzer 112 , which is sized and configured as a pen - like , battery - powered device with lcd read - out . in the exemplary embodiment , the analyzer 112 comprises a photonic analyzer . specifically , the information analyzer comprises a fluorescence spectrophotometer that photonically excites a sample within , or in proximity to the biosensor element 110 , and then detects the wavelength and / or intensity of any optical signal emitted there from . in some embodiments , the analyzer 112 comprises a light source 302 , optical connector 114 , optical splitter 330 , one or more optical filters 304 , lens coupler 303 , a photon detector 306 , signal processing electronics 308 and a patient readout system 310 . in some embodiments , the optical splitter 330 can include fused fiber optical couplers , half - silvered mirrors , dichroic mirrors , and diffused optical waveguides . in an exemplary method employed by the analyzer 112 , an excitation wavelength is produced by light source 302 . the light source 302 may be , for example , a fiber - coupled blue laser diode with a built - in source driver capable of producing , for example , 20 mw - 24 mw . alternatively , blue light - emitting diodes ( led ) with high output power may be used as the light source 302 . those skilled in the art will also recognize other suitable excitation light sources such as a broadband , incandescent light source from which a tunable , narrow band of excitation wavelengths can be selected by a diffraction grating or prism . in an exemplary embodiment , the filtering member 304 ( which may also be an optical fiber ) includes an acoustic tunable filter region . filtering members that can be used and / or adapted to be used in some embodiments are described in u . s . pat . no . 5 , 611 , 004 ( chang ) and by birk et al . ( birk , t a , russel , p s j , pannel , c n ( 1994 ) “ low power acoustic - optical device based on a tapered single - mode fiber .” ieee photon . technol . lett . 6 : 725 - 727 ), the contents of each of which are incorporated by reference herein . as fluorescent emissions from the fluorophore pass through the filter section , a pzt transducer deflects photons with wavelengths matched to the acoustic wavelength into detector , where they are captured and quantified by the photodiode . the electronic feedback control of the filter band can be used advantageously to identify and quantify the two fluorescence peaks even if the accuracy of the filter drifts over time . an algorithm in the power and signal processing unit 308 can sweep the center wavelength of the filter over a range of wavelengths while measuring the output of photodetector 306 . the location of fluorescence peaks can be identified by a change in the slope of the fluorescence intensity from positive to negative as a peak is traversed . photon counts on either side of the peak can be integrated to improve the signal to noise ratio . other potentially useful algorithms for digital signal processing can be used by those with skill in the art . in an exemplary embodiment , adhesion between the containment matrix and the optical fiber can be achieved and / or enhanced in numerous ways in order to prevent these two components from physically separating . for example , mild etching at adhesion region 122 , illustrated in fig1 and 2 , can be used to increase surface roughness of the glass fiber by immersing it in hydrofluoric acid ( for example , 25 % hydrofluoric acid for 10 minutes ). a portion of the etched fiber can then be cleaved off to create a clean end to minimize scattering of light into and out of the end of the fiber that would occur at an etched surface . in some embodiments , a portion of the etched fiber can be beveled at an angle . in another exemplary embodiment , chemical agents such as ( aminopropyl ) triethoxysilane can modify the fiber surface and provide covalent bonding with the matrix after polymerization to enhance the containment matrix adhesion at adhesion region 122 . in an alternative exemplary embodiment , mechanical abrasion can increase the surface roughness of optical fiber 102 . the surface roughness modification should avoid damage to the optical properties of the cladding . the limiting factor of all of the above methods appears to be the surface area of the optical fiber actually in contact with the matrix . this can be increased by using multiple dip coats and photopolymerization steps , which builds up a matrix with a larger volume ( increasing the amount of dye available to fluoresce ) and increases the surface area of the containment matrix 118 in contact with region 122 . an exemplary embodiment of the biosensing device detects the presence of analytes within the patient &# 39 ; s tissues by employing a biosensing material 116 . a chemical binding or reaction between the analyte 108 and the biosensing material 116 can give rise to a state change that can be transmitted to and detected by the information analyzer 112 . the biosensing material 116 takes advantage of the unique specificity of biosensing molecules for analyte ( s ) of interest . this high selectivity allows the analyte to be measured even when mixed with other substances , such as occurs in blood or extracellular fluids . the biosensor materials can be selected to maintain mechanical stability and biocompatibility during chronic implantation . in an exemplary embodiment , fluorescence optical sensing can be utilized . the biosensing material includes molecules that undergo a change in fluorescent emission in proportion to the concentration of analyte of interest in the surrounding medium . in some embodiments , many different fluorescent dyes can be bound covalently to molecules that bind specifically to analytes ( such as glucose ). for example , some fluorescent molecules that may be used are described in publications by tompson , mcnichols et al ., and czarnik ( thompson , r . b . “ fluorescence - based fiber - optic sensors .” topics in fluorescence spectroscopy , vol . 2 : principles . new york : plenum press 1991 : 345 - 65 ; mcnichols r and cote g . “ optical glucose sensing in biological fluids : an overview .” journal of biomedical optics january 2000 , 5 : 5 - 16 ; czarnik , a . ( 1993 ) fluorescent chemosensors for ion and molecule recognition . washington : american chemical society ), each of which are herein incorporated by reference . some embodiments of the biosensing devices and systems may use other optical sensing techniques such as absorption and transmission , which are well known to individuals skilled in the art . exemplary embodiments of the biosensing devices and systems can utilize various potential fluorescence sources . for example , two particular alternative systems may be useful where fluorescence is selected as the mode of optical transmission , as described by krohn ( krohn , d . fiber optic sensors : fundamentals and applications . north carolina : instrument society of america , 1988 ), which is incorporated herein by reference . in one system , the analyte itself is fluorescent . in another system , the analyte is not fluorescent but interacts with a fluorophore that emits a fluorescent signal . where the analyte to be detected is glucose , a number of techniques may be employed , including , but not limited to enzyme based and competitive affinity binding . see , for example , mcnichols r and cote g . “ optical glucose sensing in biological fluids : an overview .” journal of biomedical optics january 2000 , 5 : 5 - 16 , incorporated herein by reference . in an exemplary embodiment having analytes that do not emit fluorescence , the combination of fret and a specific receptor - analyte competition model can be used as a photonic assay method for an implantable sensor that is likely to be slowly biodegrading . in such embodiments , quantitative measurements may depend on the ratio of fluorescence at two wavelengths . another exemplary embodiment of the biosensing material and system utilizes fluorescence resonance energy transfer ( fret ) in a receptor - analyte competition assay . fret depends on the proximity of two fluorophores ; if the distance between them is less than the forster radius , energy absorbed by the first fluorophore is transferred efficiently to the second fluorophore , which then emits at a longer wavelength . the externally detectable fluorescence associated with the short wavelength fluorophore is thus decreased or “ quenched ”; the long wavelength fluorescence actually increases . in some embodiments quantum dots , which can generate narrow band ( for example , 470 nm ) emissions suitable for exciting a second fluorophore and can be excited with light source having much shorter wavelength , could replace the traditional fluorescence photodonor . this combination may produce more efficient and more readily detectable fret . for example , if a receptor , which binds the target analyte , is labeled with one type of fluorophore , and a competitive ligand of the target analyte is labeled with the other dye , the affinity between receptor and the competitive ligand brings the two dyes in proximity and results in fret quenching . when an analyte approaches the receptor , it replaces the ligand and reverses the quenching phenomenon , and the quantity of the analyte can be measured by the change in quenching . an exemplary embodiment of the biosensor uses an affinity - binding assay for polysaccharides based on the jack bean lectin concanavalin a ( cona ), as described by mansouri et al ( mansouri s , schultz j . “ a miniature optical glucose sensor based on affinity binding .” biotechnology 1984 , 885 - 90 ), which is incorporated herein by reference . dextran binds to cona but can be displaced by glucose . dextran ( for example , 102 kd ) can be coupled to fluorescein isothiocyanate ( fitc ), which fluoresces at about 520 nm when excited at about 488 nm . cona ( for example , 2000 kd ) can also be coupled to tetramethylrhodamine isothiocyanate ( tritc ), which fluoresces at about 580 nm and can be excited at about 520 nm ( the emission wavelength of fitc ) as described by meadows et al . ( meadows d and shultz j . “ design , manufacture and characterization of an optical fiber glucose affinity sensor based on an homogeneous fluorescence energy transfer assay system .” analytica chimica acta january 1993 , 280 : 21 - 30 ), which is incorporated by reference . the tritc - cona and fitc - dextran can be incorporated into peg spheres ( as described by russell et al . russel r ; pishko m ; gefrides c and cote g . “ a fluorescent glucose assay using poly - i - lysine and calcium alginate microencapsulated tritc - succinyl - concanavalin a and fitc - dextran .” ieee engineering in medicine and biology 1998 , 20 : 2858 - 61 ; hereby incorporated by reference ), where they have sufficient mobility to bind and result in fret between them . in some embodiments , the size of both receptor and competitive ligand , and the position of dye - labeling site and analyte - binding site on the receptor are chosen to optimize the efficiency of fret . the efficiency of fret is r 0 6 /( r 0 6 + r 6 ), which r is the distance between the two fluorophores . the value of forster radius ( r 0 ) depends on the extinction coefficients , quantum yields , and mutual orientation of the two specific dyes and solvent environment . in some embodiments , the size of both receptor and ligand should not be much larger than forster radius . in some embodiments of the affinity - binding model mentioned above , the amount of quenching achievable for the large molecular weight dextran ( with molecular weight of about 155 kd , dye labeling ratio of about 2 moles dye / mole , and a radius of about 85 angstroms ) is less than for the smaller dextran ( with molecular weight of about 3 kd , dye labeling ratio of 1 mole dye / mole , and a radius about 14 angstroms ). in an exemplary embodiment , concentration can also influence the distance ( r ) of two fluorophores . fret quenching can be triggered by affinity , which typically occurs when concentrations of both the labeled receptor and the labeled ligand are low enough to minimize random proximity . in other embodiments , the concentrations of both fluorescence labeled materials can be high enough to reach the sensitivity limit of the photodetector in the analyzer . the working range of the two fluorophores can be defined by the two concentration limitations . the affinity between ligands and receptors can be reduced to a low enough level so that the target analytes can efficiently compete to interact with the binding site . typically , the concentration of target analytes is located in the range of nm - pm in normal physiological conditions . in an exemplary embodiment of the affinity - binding model , using betacyclodextrin instead of linear dextran reduces the affinity ( because of its rigid circular structure ) between this saccharide and con a . this permits higher concentrations ( in some embodiments , at least 10 fold ) of the fluorescent analytes to be used while preserving sensitivity to physiological concentrations of glucose . in an exemplary embodiment , receptors , antibodies , and enzymes that specifically interact with the analyte ( s ) to be detected may be immobilized by physical capture within or covalent bonding to a biocompatible , polymeric matrix such as can be formed by the polymerization of various analogues of ethylene oxides to form , for example , polyethylene glycol . in one exemplary embodiment of the glucose biosensing material 116 , the fitc - concanavalin - a is covalently bound to a polyethylene glycol that contains an n - hydroxysuccinimide ester group . the tritc - dextran can be trapped within the small pores of the dense polyethylene glycol polymer , which is formed when polyethylene glycol diacrylate ( with , for example , molecular weight of abouit 575 daltons ) is illuminated with ultraviolet light . in an exemplary embodiment of the biosensing material , a peg carrier can serve as a polymer matrix , fitc - con a molecules attached to the peg can act as a labeled receptor , and tritc - dextran connected to the peg can serve as a competitive binding molecule that competes with the patient &# 39 ; s glucose to bind with the fitc - con a receptor . in another exemplary embodiment , the labeled betacyclodextrin can be modified with acryloyl group , which will provide a covalent binding site for peg matrix , the same functional group used for the uv polymerization . a solution of acryloyl chloride ( about 0 . 54 g , 6 mmole ) in about 10 ml ch 2 cl 2 is added dropwise to a solution of tarma - abcd ( about 3 mmole ) and triethylamine ( about 3 . 2 g , 31 . 7 mmole ) in about 60 ml ch 2 cl 2 at − 5 c during approximately one hour . the reaction mixture is stirred over night at room temperature , and then triethylamine hydrochloride is filtered off . the filtrate is diluted with about 100 ml ch 2 cl 2 and extracted with about 2 × 50 ml nahco 3 ( 10 %) and about 1 × 50 ml brine . the organic phase is dried over mgso4 , filtered and distilled to give crude product . ( sha ). the effectiveness of the binding can be assayed by measuring the fluorescence of the supernatant after prolonged soaking of polymerized matrix material in saline . other exemplary embodiments of the biosensor can use quantum dot fluorophors . one of the technical challenges in optical biosensors is to filter out the relatively intense excitation wavelength from the two fluorescence wavelengths . the excitation light tends to backscatter from the optical connector , the junction between the optical fiber , the splitter , and the optical fiber in the portable measurement instrument , and the polymer matrix on the internal end of the optic fiber . the larger the differences in wavelength , the easier it is to achieve adequate filtering to avoid saturating the fluorescence detection circuitry and resolve the two peaks whose ratio are measured . quantum dots , or fluorescent semiconductor nanocrystals , are inorganic spheres with nanometer dimensions that can be excited with a broad range of short wavelengths and produce high efficiency fluorescence at longer wavelengths that are precisely controllable . quantum dots are described by michalet et al . ( michalet et al ., quantum dots for live cells , in vivo imaging , and diagnostics , science , jan . 28 , 2005 ; 307 ( 5709 ): 538 - 44 ), which is hereby incorporated by reference . in an exemplary embodiment , a conventional fluorophor with a narrow band of excitation wavelength can be conjugated to one of the reactants ( e . g . tritc to concanavalin ) while one or more quantum dots that emit the wavelength that excites the conventional fluorophore can be conjugated to the other reactant ( e . g . dextran ). a relatively short wavelength can be used to excite the quantum dots and their fluorescence will be absorbed by the tritc and reemitted at a much longer wavelength when the two fluorophors are within the forster radius . another exemplary application of the biosensor is on chemotherapeutics , such as such as taxol , which bind to the intracellular protein tubulin . the affinity between tubulin and taxol provides the basis for taxol detection . in one embodiment , taxol can be labeled with fitc , and tubulin can be conjugated to a quantum dot , which can generate about a 470 nm emission when excited at a much shorter wavelength . in some embodiments , the binding of fitc to taxol can be modified to reduce the taxol &# 39 ; s affinity to tubulin . application of quantum dot ( replacing traditional fluorescence photodonor ) may produce more efficient and readily detectable fret in this and other assays . the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the biosensing devices , methods and systems . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the biosensing devices , methods and systems . thus , the biosensing devices , methods and systems arenot intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein .

US-8846005-A

a rotating dovetail attachment mechanism for connecting a modular provisional augmentation block to the distal surface of a provisional tibial tray . the augmentation block has lateral components which contact a vertical surface on a prepared bone . the rotating dovetail attachment mechanism permits the block to be used with a stemmed tibial implant provisional by rotating the lateral components of the augmentation block around the stem during connection of the provisional block to the provisional tibial component .

the preferred embodiment herein described is not intended to be exhaustive or to limit the invention to the precise form disclosed . rather , it is chosen and described to best explain the invention so that others skilled in the art might utilize its teachings . referring now to the figures , implant provisional 10 consists of a tibial component 12 and modular augmentation blocks 14 . for illustration purposes , only one augmentation block 14 is illustrated ; however , in practice , a set of augmentation blocks would be provided to the surgeon each having a different thickness and angular orientation . with the set , the surgeon may build the optimum implant provisional for the patient . the use of augmentation blocks is known in the industry and is understood by one skilled in the art . for the ease of discussion , only the illustrated augmentation block 14 will be discussed . provisional tibial component 12 includes a tibial tray 16 having a bottom or distal surface 18 . the upper or proximal surface 20 of the tibial tray 16 is configured to accommodate a bearing insert ( not shown ) for sliding engagement with the femoral component of the knee ( also not shown ). a post or stem 22 extends from tray 16 away from distal surface 18 and generally perpendicular to the tray 16 . as is well known in the art , stem 22 is configured for insertion into the prepared intramedullary canal of the tibia . the anterior edge 24 of the provision tibial component 12 is arcuate . it should be understood that the terms anterior , posterior , distal , and proximal are commonly used and understood in the art as well as the specific relevance to the implant provisional . a slot 26 is formed in the distal surface 18 on each side of stem 22 extending from the anterior edge as illustrated and terminating in an arcuate end wall 27 . each slot 26 is formed with diverging side walls 28 , 30 and a flat wall 32 which form a dovetail slot configuration . one slot 26 is illustrated in cross section in fig9 to more fully illustrate the orientation of the slot and the dovetail shape . it should be understood that slots 26 are identical to one another . modular augmentation blocks 14 , only one shown , are shaped having an outer periphery 34 which is angled from the proximal surface 36 toward the distal surface 38 such that the edge of the proximal surface 40 of the outer periphery of the block 14 is in alignment with the edge of the distal surface 18 of the tibial tray 16 . the outer periphery 34 follows the periphery of approximately one half of the tibial tray 16 as illustrated in fig6 . the distal surface of block 14 is substantially flat . a protrusion 44 extends transversely from proximal surface 36 and includes a diverging outer wall 46 and a flat wall 46 . a cross section of protrusion 44 is illustrated in fig8 from where it can be seen that the protrusion is generally dovetail in shape to substantially match the dovetail shaped slot 26 in the tibial tray 16 . from the elevational view of fig7 it is evident that the protrusion of 44 is generally round . a second protrusion 50 extends transversely from proximal surface 36 adjacent the anterior edge of the augmentation block 14 . protrusion 50 includes a pair of side walls 52 which diverge with distance from the proximal surface 36 of the augmentation block . as illustrated best in fig9 the cross section of protrusion 50 is generally dovetail in shape and is configured for sliding accommodation within a slot 26 . the posterior wall 54 of protrusion 50 generally follows the contour of the anterior edge of the block 14 . finally , augmentation block 14 includes an anterior extension 56 and a posterior extension 58 which extend laterally from block 14 as illustrated and define a gap therebetween . each extension 56 and 58 terminates in a generally flat end wall at a midpoint of the tibial tray 16 . fig1 through 6 illustrate in progression the method of attaching the augmentation block 14 to the distal surface of the tibial tray 16 . in the step illustrated in fig1 protrusion 44 is inserted into a slot 26 of tibial tray 16 . as illustrated , to accommodate extension 58 , the augmentation block 14 is angled slightly relative to the tibial tray . the augmentation block 14 is slid posteriorly along slot 26 until protrusion 50 contacts the anterior wall of the tibial tray as illustrated in fig2 and 3 ). next the augmentation block 14 is rotated such that the posterior wall of protrusion 50 follows the anterior wall of the tibial tray 16 until protrusion 50 is aligned with slot 26 ( see fig4 ). with protrusion 50 aligned in slot 26 , the augmentation block 14 may be slid further laterally until protrusion 44 contacts the arcuate end wall of slot 26 ( see fig5 through 9 ). at this point the augmentation block is fully seated . it should be noted that extensions 56 and 58 terminate at a mid - point on the tibial tray such that when the tibial tray and augmentation block are placed on the prepared tibia , the extensions would contact a vertical edge 60 of the prepared tibia bone 62 to thereby prevent lateral movement of the block 14 ( see fig1 ). the rotational connection of the augmentation block to the tibial tray is necessary so that extensions 58 may pass around the stem of the tibial tray . it should be understood that the invention is not to be limited to the precise forms disclosed but may be modified within the keeping of the appended claims .

US-1691593-A

the present invention relates to a sterile pharmaceutical composition comprising tiotropium or a pharmaceutically acceptable salt thereof , for inhalation via nebulization to a subject . the invention also relates to a process for preparing the pharmaceutical composition and its use in the treatment of respiratory diseases such as chronic obstructive pulmonary disease in a subject .

salts of tiotropium include , but are not limited to , acid addition salts and base salts thereof , solvates thereof , and any mixture thereof . suitable salts of tiotropium include , but are not limited to , halide salts such as bromide , chloride and iodide salts . these and other salts are described , for example , in u . s . pat . no . re 39 , 820 , which is hereby incorporated by reference in its entirety . the preparation of the tiotropium bromide monohydrate is described in u . s . pat . no . 6 , 777 , 423 , which is incorporated herein by reference in its entirety . tiotropium and its salts can be administered to provide a bronchodilation effect and relief from symptoms associated with copd . tiotropium bromide has a molecular weight of 472 . 416 g / mol and the empirical formula c 19 h 22 brno 4 s 2 . tiotropium bromide monohydrate is sparingly soluble in water and soluble in methanol . the established chemical structure of tiotropium bromide monohydrate is as follows : the term “ tiotropium ” as used herein , include acids , salts , esters , hydrates , polymorphs , hemihydrates , solvates , and derivatives thereof . 2 - hydroxy - 2 , 2 - dithiophen - 2 - ylacetic acid is an impurity of tiotropium identified as impurity a in the present invention . in the present invention , tiotropium may be provided in a variety of pharmaceutically acceptable vehicles , including , but not limited to , water or hydroalcoholic solution or any other aqueous solution comprising a pharmaceutically acceptable amount of an osmotic agent . in a preferred embodiment , the tiotropium salt in the pharmaceutical composition or pharmaceutical solution described herein is tiotropium bromide , such as tiotropium bromide monohydrate (( 1α , 2β , 4β , 7β )- 7 -[( hydroxydi - 2 - thienylacetyl ) oxy ]- 9 , 9 - dimethyl - 3 - oxa - 9 - azoniatricyclo [ 3 . 3 . 1 . 02 , 4 ] nonane bromide , monohydrate ). in another embodiment , the tiotropium salt in the pharmaceutical composition or pharmaceutical solution described herein is amorphous tiotropium bromide . in another embodiment , the tiotropium salt in the pharmaceutical composition or pharmaceutical solution described herein is anhydrous tiotropium bromide . in another embodiment , the tiotropium salt in the pharmaceutical composition or pharmaceutical solution described herein is anhydrous amorphous tiotropium bromide . to treat indications with a therapeutic agent , an “ effective amount ” of a therapeutic agent will be recognized by clinicians and persons of ordinary skill in the art , and includes an amount effective to treat , reduce , alleviate , ameliorate , eliminate or prevent one or more symptoms of the condition sought to be treated , or alternately , the condition sought to be avoided , or to otherwise produce a clinically recognizable favorable change in the condition or its effects . in another embodiment , the present invention provides sterile pharmaceutical composition of tiotropium for inhalation wherein the composition is substantially free of preservative , preferably substantially benzalkonium chloride free to treat bronchospasm associated with copd . a composition is “ substantially benzalkonium chloride free ” or “ substantially free of benzalkonium chloride ” when the amount of benzalkonium chloride is not an amount sufficient to materially act as a preservative for the pharmaceutical composition or solution . moreover , in a “ substantially benzalkonium chloride free ” or “ substantially free of benzalkonium chloride ” composition , benzalkonium chloride may be present in concentration less than 0 . 008 % w / w based on total weight of composition or solution . the term “ substantially free of preservative ” denotes that preservative may be present in concentration less than 0 . 008 % w / w based on total weight of composition or solution . generally , pharmaceutical inhalation solutions contain a preservative such as benzalkonium chloride . one problem with these solutions is that the benzalkonium chloride may cause paradoxic bronchoconstriction if the solution is administered repeatedly over short intervals and frequent exposure to benzalkonium chloride may lead to occupational asthma . another problem is that , when inhaled by patients , the benzalkonium chloride can cause dose - dependent bronchoconstriction . the inhalation solutions of the present invention may be provided without benzalkonium chloride , thereby making them suitable , especially in situations where the inhalation solution is administered repeatedly over a short period of time . also , administering a substantially benzalkonium chloride - free inhalation solution to a patient reduces the concomitant liability of adverse effects associated with benzalkonium chloride alone or in combination other excipients and / or tiotropium . it also negates the toxicity and other side effects associated with benzalkonium chloride . the inhalation solutions of the present invention may also be provided in sterile , unit dose treatments . in another embodiment of the present invention , there is provided a sterile , unit dose pharmaceutical solution composition for inhalation via nebulization comprising tiotropium or its salt wherein the composition is substantially free of a complexing agent such as ethylene diamine tetra - acetic acid ( edta ). low ph levels , particularly below 3 . 2 , are preferred for the long - term stability of the tiotropium salts in the formulation . the absence of or reduction in the concentration of the additive edta also helps to reduce the paradoxic effect associated with cough . in another embodiment of the present invention , the inhalation solution has a ph of from about 2 . 0 to about 6 . 0 . in another embodiment , the solution has a ph of from about 2 . 0 to about 4 . 0 . the preferred ph range of tiotropium bromide solutions is from about 2 . 0 to about 4 . 5 , preferably from about 2 . 5 to 3 . 5 , most preferably from about 2 . 7 to about 3 . 2 . in another embodiment of the present invention , the inhalation solution has a ph from about 2 . 2 to about 2 . 9 . the ph may be adjusted by the addition of one or more pharmaceutically acceptable acids . examples of suitable pharmaceutically acceptable acids include inorganic acids , such as hydrochloric acid , hydrobromic acid , nitric acid , sulfuric acid , and phosphoric acid , and combinations thereof . examples of other suitable pharmacologically acceptable acids include organic acids , such as ascorbic acid , citric acid , malic acid , maleic acid , tartaric acid , succinic acid , fumaric acid , acetic acid , formic acid , and / or propionic acid . in one embodiment , the ph is adjusted with 1n hydrochloric acid or 1n sulfuric acid . in another embodiment , the ph is adjusted with one or more organic acids selected from ascorbic acid , fumaric acid and citric acid . a preferred organic acid is citric acid . if desired , mixtures of the abovementioned acids may also be used , particularly in the case of acids which have other properties in addition to their acidifying properties , e . g ., those which act as flavorings or antioxidants , such as for example citric acid or ascorbic acid . the inhalation solution of the present invention may contain sodium citrate at a concentration of about 0 . 1 to about 1 . 0 % ( w / w ) and citric acid at a concentration of about 0 . 1 to 1 . 0 % ( w / w ) to control ph . the inhalation solution may optionally include a buffer . general and biological buffers in the ph range of about 2 . 0 to about 8 . 0 include , but are not limited to , acetate , barbital , borate , britton - robinson , cacodylate , citrate , collidine , formate , maleate , mcilvaine , phosphate , prideaux - ward , succinate , citrate - phosphate - borate ( teorell - stanhagen ), veronal acetate , mes , bis - tris , ada , aces , pipes , mopso , bis - tris propane , bes , mops , tes , hepes , dipso , mobs , tapso , trizma , heppso , popso , tea , epps , tricine , gly - gly , bicine , hepbs , taps , and ampd buffers . in another embodiment of the present invention , a therapeutically effective amount of tiotropium may include from about 0 . 001 mg to about 0 . 3 mg of tiotropium bromide . therapeutically effective amounts may also include the following intermediate ranges of tiotropium bromide : from about 0 . 010 mg to about 0 . 280 mg ; about 0 . 020 mg to about 0 . 260 mg ; about 0 . 025 mg to about 0 . 240 mg ; about 0 . 005 mg to about 0 . 1 mg ; about 0 . 005 mg to about 0 . 05 mg ; about 0 . 01 mg to about 0 . 04 mg ; about 0 . 02 to about 0 . 07 mg ; about 0 . 04 mg to about 0 . 08 mg ; about 0 . 04 mg to about 0 . 10 mg ; about 0 . 05 mg to about 0 . 15 mg ; about 0 . 10 mg to about 0 . 19 mg ; about 0 . 15 mg to about 0 . 20 mg ; 0 . 20 mg to about 0 . 25 mg ; and about 0 . 26 mg to about 0 . 30 mg . the pharmaceutical composition or solution may include from about 0 . 001 mg to about 0 . 3 mg of tiotropium or its salt ( such as tiotropium bromide ), such as from about 0 . 010 mg to about 0 . 280 mg ; about 0 . 020 mg to about 0 . 260 mg ; about 0 . 025 mg to about 0 . 240 mg ; about 0 . 005 mg to about 0 . 1 mg ; about 0 . 005 mg to about 0 . 05 mg ; about 0 . 01 mg to about 0 . 04 mg ; about 0 . 02 to about 0 . 07 mg ; about 0 . 04 mg to about 0 . 08 mg ; about 0 . 04 mg to about 0 . 10 mg ; about 0 . 05 mg to about 0 . 15 mg ; about 0 . 10 mg to about 0 . 19 mg ; about 0 . 15 mg to about 0 . 20 mg ; about 0 . 20 mg to about 0 . 25 mg ; or from about 0 . 26 mg to about 0 . 30 mg tiotropium per unit dosage of pharmaceutical composition or solution . in another embodiment of the present invention , a therapeutically effective amount of tiotropium may include from about 0 . 0001 % to about 0 . 030 % by weight tiotropium bromide , including the following intermediate ranges of tiotropium bromide : about 0 . 0002 wt % to about 0 . 02 wt %; about 0 . 0003 wt % to about 0 . 01 wt %; about 0 . 0005 wt % to about 0 . 008 wt %; about 0 . 0002 wt % to about 0 . 001 wt %; about 0 . 001 wt % to about 0 . 005 wt %; about 0 . 006 wt % to about 0 . 010 wt %; about 0 . 011 wt % to about 0 . 015 wt %; about 0 . 016 wt % to about 0 . 020 wt %; about 0 . 021 wt % to about 0 . 025 wt %; or about 0 . 026 wt % to about 0 . 030 wt %. one embodiment is a pharmaceutical solution suitable for administration with a nebulizer consisting essentially of ( a ) about 0 . 0005 % to about 0 . 008 % w / w tiotropium or a pharmaceutically acceptable salt thereof , based upon 100 % total weight of the pharmaceutical solution , wherein the ph of the pharmaceutical composition is about 2 to about 4 ( such as about 2 . 7 ). in one preferred embodiment , the pharmaceutical solution is free , or substantially free , of quaternary ammonium preservatives . in another preferred embodiment , the pharmaceutical solution is free , or substantially free , of preservatives . in one embodiment , the pharmaceutical composition or solution provided herein has a long shelf life , i . e ., it is stable during long term storage . the pharmaceutical composition or solution may contain greater than about 80 %, such as greater than about 85 %, greater than about 90 %, greater than about 95 % or greater than about 98 % of the initial amount of tiotropium or its salt in the pharmaceutical composition or solution after being stored for 3 or 6 months or 1 , 2 or 3 years at 25 ° c . when stored in a suitable ldpe container , cyclic olefin polymer container , cyclic olefin copolymer container , or glass container . the stability may be determined using arrhenius kinetics . another embodiment is a container containing a pharmaceutical composition or solution of the present invention , wherein the volume of the composition or solution is from about 0 . 1 ml to about 5 ml , such as from about 1 ml to about 3 ml , or from about 1 . 5 ml to about 2 . 5 ml . in another embodiment , the volume of the tiotropium solution of the present invention is from about 0 . 05 ml to about 1 . 0 ml ; such as from about 0 . 1 ml to about 0 . 9 ml ; from about 0 . 1 ml to about 0 . 8 ml ; from about 0 . 1 ml to about 0 . 7 ml ; from about 0 . 1 ml to about 0 . 6 ml ; from about 0 . 1 ml to about 0 . 5 ml ; from about 0 . 1 ml to about 0 . 4 ml ; from about 0 . 1 ml to about 0 . 3 ml ; or from about 0 . 1 ml to about 0 . 2 ml . in another embodiment , the pharmaceutical composition of the present invention comprises about 0 . 002 % to about 0 . 01 % w / w tiotropium or any pharmaceutically acceptable salt thereof , about 0 % to about 0 . 01 % w / w edta , about 0 . 9 % sodium chloride , wherein the composition is free of preservative and wherein the composition has a ph in the range of about 2 . 0 to about 4 . 0 . another embodiment is a prepackaged , sterile , premixed , premeasured tiotropium inhalation solution for the relief of bronchospasm in patients suffering from copd . another embodiment of the present invention is to provide a substantially benzalkonium chloride free tiotropium inhalation solution to treat bronchospasm associated with copd . in another embodiment , the present invention comprises one or more prefilled containers . each container comprises a single unit dose of an aqueous solution comprising a therapeutically effective amount of tiotropium for the treatment of copd . in another embodiment , the present invention relates to a sterile , premixed , premeasured , substantially benzalkonium chloride free inhalation solution comprising a single unit dose of a therapeutically effective amount of tiotropium in a single container . a further embodiment of the present invention is to provide a method for treating or relieving bronchospasm associated with copd comprising administering to a patient in need thereof a tiotropium inhalation formulation according to any of the embodiments described herein . an additional embodiment of the present invention is to provide a kit and / or system for administering a bronchodilator to relieve bronchospasm associated with copd . in an alternative embodiment , the kit and / or system of the present invention comprises an inhalation solution comprising a therapeutically effective amount of tiotropium in a prepackaged , premeasured , premixed and / or single unit dose form for the treatment of copd . in another alternative embodiment , the prepackaged inhalation kit and / or system of the present invention provides one or more premixed , premeasured single unit dose vials comprising a therapeutically effective amount of tiotropium for the treatment of bronchospasm associated with copd , and instructions for using the same . more specifically , the present invention provides a kit for the treatment , prevention or amelioration or one or more symptoms of diseases or disorders associated with broncho constriction which comprises : ( ii ) a nebulizable composition for the treatment , prevention or amelioration or one or more symptoms of diseases or disorders associated with bronchoconstriction which comprises : yet another embodiment is a kit comprising a nebulizer , instructions for using the nebulizer and the unit dose vials containing the pharmaceutical compositions of the present invention . in another embodiment of the present invention , the osmolality of the inhalation solution may be from about 200 to about 500 mosm / kg . in another embodiment , the osmolality of the solution may be from about 275 to about 325 mosm / kg . in a further embodiment , the compositions of the present invention may comprise about 0 . 4 to about 1 . 0 weight percent ionic salt . suitable tonicity adjusting agents may include , but are not limited to , ammonium carbonate , ammonium chloride , ammonium lactate , ammonium nitrate , ammonium phosphate , ammonium sulfate , ascorbic acid , bismuth sodium tartrate , boric acid , calcium chloride , calcium disodium edetate , calcium gluconate , calcium lactate , citric acid , dextrose , diethanolamine , dimethyl sulfoxide , edetate disodium , edetate trisodium monohydrate , fluorescein sodium , fructose , galactose , glycerin , lactic acid , lactose , magnesium chloride , magnesium sulfate , mannitol , polyethylene glycol , potassium acetate , potassium chlorate , potassium chloride , potassium iodide , potassium nitrate , potassium phosphate , potassium sulfate , propylene glycol , silver nitrate , sodium acetate , sodium bicarbonate , sodium biphosphate , sodium bisulfite , sodium borate , sodium bromide , sodium cacodylate , sodium carbonate , sodium chloride , sodium citrate , sodium iodide , sodium lactate , sodium metabisulfite , sodium nitrate , sodium nitrite , sodium phosphate , sodium propionate , sodium succinate , sodium sulfate , sodium sulfite , sodium tartrate , sodium thiosulfate , sorbitol , sucrose , tartaric acid , triethanolamine , urea , urethan , uridine , zinc sulfate , and mixtures thereof . suitable osmotic adjusting agents that may be used include , but are not limited to , sodium chloride , potassium chloride , zinc chloride , calcium chloride and mixtures thereof . other osmotic adjusting agents may also include , but are not limited to , mannitol , glycerol , dextrose and mixtures thereof . any cosolvent that is suitable for inhalation and capable of dissolving or solubilizing the tiotropium in the mixture of cosolvent and water can be used . examples of suitable cosolvents include , for example , alcohols , ethers , hydrocarbons , and perfluorocarbons . preferably , the cosolvent is a short chain polar alcohol . more preferably , the cosolvent is an aliphatic alcohol having from one to six carbon atoms , such as ethanol or isopropanol . the most preferred cosolvent is ethanol . examples of suitable hydrocarbons include n - butane , isobutane , pentane , neopentane and isopentanes . examples of suitable ethers include dimethyl ether and diethyl ether . examples of suitable perfluorocarbons include perfluoropropane , perfluorobutane , perfluorocyclobutane , and perfluoropentane . when ethanol is utilized as the cosolvent , the cosolvent is usually present in an amount of from about 1 % to about 40 % by weight , based on the total weight of the formulation . the ethanol should be present in an amount which fully dissolves or solubilizes tiotropium in the mixture of ethanol and water . preferably , ethanol is present in amount sufficient to fully maintain the tiotropium in solution at freezing temperatures , such as 0 ° c . in general , as the temperature is decreased , the solubility of active ingredient in ethanol is decreased . therefore , an excess of ethanol over the amount required to fully dissolve or solubilize active ingredient at ambient or room temperature is preferred . in this regard , ethanol is preferably present in an amount of at least 10 % by weight , more preferably at least 15 % by weight , even more preferably at least 20 % by weight , and most preferably at least 25 % by weight . based on the disclosure provided herein , one skilled in the art will recognize that lower concentrations of active ingredient usually require lower concentrations of cosolvent , and vice versa , in order to form a stable solution . suitable surfactants that may be used include , but are not limited to , c5 - 20 - fatty alcohols , c5 - 20 - fatty acids , c5 - 20 - fatty acid esters , lecithin , glycerides , propyleneglycol esters , polyoxyethylenes , polysorbates , sorbitan esters and / or carbohydrates . c5 - 20 - fatty acids , propyleneglycol diesters and / or triglycerides and / or sorbitans of the c5 - 20 - fatty acids are preferred , while oleic acid and sorbitan mono -, di - or trioleates are particularly preferred . suitable antioxidants that may be used include , but are not limited to , ascorbic acid , for example , provided that it has not already been used to adjust the ph , vitamin a , vitamin e , tocopherols and similar vitamins or pro - vitamins occurring in the human body . the inhalation solution may be contained in a unit - dose , low - density polyethylene ( ldpe ) container , polypropylene container , or a cyclic polyolefin container . each unit - dose container may be disposed in a foil pouch , and each foil pouch may contain 2 or more unit - dose containers . each foil pouch containing the unit dose container may be disposed in a shelf carton . the inhalation solution comprises a single unit dose of a therapeutically effective amount of tiotropium . such system and / or kit may provide such containers in prepackaged form . the container with a twist - flex ™ top prefer , such top comprising an easy - to - grip tab - like handle such that the container may be opened , for example , by twisting off the tab by hand . the twist - flex ™ top is advantageous in that it allows for easy dispensing of the solution , prevents spillage and eliminates the need to open the container or tearing by cutting or tearing off the top , or the like , thereby reducing cross - contamination . one or more of the semi - permeable single unit dose containers may be prepackaged in aluminum foil pouch , such that the foil provides a protective barrier against environmental contaminants and light as it helps to improves the shelf - life and stability of the inhalation solution . dispensing vials may include , but are not limited to , any container comprising glass , low density polyethylene , polypropylene , cyclic polyolefins or any other material capable of preventing the solution from leaking out of the container . the vial may be enclosed by any conventional means including , but not limited to , screw cap , heat seal , snap - on top , flip - top , twist - off stopper , peel away top , and the like . the inhalation solution of the present invention may be administered by nebulizer . suitable nebulizers include , but are not limited to , a jet nebulizer , an ultrasonic nebulizer , vibrating mesh nebulizer and a breath actuated nebulizer . preferably , the nebulizer is a jet nebulizer connected to an air compressor with adequate airflow . the nebulizer being equipped with a mouthpiece or suitable face mask . the inhalation solution may be administered by nebulizers manufactured , designed or sold by omron , such as the omron micro air ™ ultrasonic nebulizer . other nebulizers may also include those manufactured , designed , or sold by aerogen . additionally , the formulations described herein can also be nebulized using inhalers other than those described above , for example jet - stream inhalers . the following non - limiting examples suitably illustrate the pharmaceutical compositions of the present invention . the pharmaceutical compositions of the invention may include the following ingredients in amounts as provided in the following table : the pharmaceutical compositions of the invention may include following ingredients and amounts : the pharmaceutical compositions from example 1 and example 2 may be sterilized by filtration ( through a 0 . 2 micron filter ) and filled into a suitable container . the solution compositions may be inserted into a suitable nebulizer and the patient breathes into the nebulizer to deliver the dosage into the lungs . 10 mcg / 20 mcg / 40 mcg / 80 mcg / sr . 2 ml 2 ml 2 ml 2 ml no ingredients quantity (% w / w ) 1 tiotropium bromide 0 . 0005 0 . 001 0 . 002 0 . 004 anhydrous eq . to tiotropium 2 sodium chloride 0 . 9 3 disodium edetate 0 . 001 4 hydrochloric acid q . s . to ph 2 . 7 as 1n hcl solution 5 water for injection q . s . 1 . collect 95 % of batch quantity water for injection in manufacturing vessel . cool water for injection to 15 - 25 ° c . 2 . add and dissolve to it batch quantity of sodium chloride under stirring . check clarity of the solution . 3 . add and dissolve to it batch quantity of disodium edetate under stirring . check clarity of the solution . 4 . check ph and adjust ph to 2 . 7 using 1n hcl solution . 5 . add and dissolve to it batch quantity of tiotropium bromide anhydrous under stirring . check clarity of the solution . 6 . make up volume of bulk . 7 . filter bulk through 0 . 24μ pvdf filter . 8 . fill in suitable containers . the below example illustrates the effect of different concentrations of edta on the stability of the composition stability data related substances # 4a 4b 4c impurity a ( 2 - hydroxy - 2 , 2 - dithiophen - 2 - ylacetic acid ) initial 0 . 02 nd 0 . 01 1m 2 - 8 ° c . 0 . 01 0 . 03 0 . 02 1m_25 ° c ./ 60 % rh 0 . 05 0 . 06 0 . 05 1m_40 ° c ./ 75 % rh 0 . 17 0 . 16 0 . 2 total impurities initial 0 . 07 nd 0 . 06 1m 2 - 8 ° c . 0 . 08 0 . 00 0 . 12 1m_25 ° c ./ 60 % rh 0 . 13 0 . 09 0 . 16 1m_40 ° c ./ 75 % rh 0 . 26 0 . 17 0 . 39 assay % initial 101 . 5 101 . 1 103 . 1 1m 2 - 8 ° c . 101 . 1 99 . 7 102 . 6 1m_25 ° c ./ 60 % rh 101 . 1 100 . 2 102 . 4 1m_40 ° c ./ 75 % rh 100 . 8 100 . 6 102 . 1 1 . 90 % batch quantity of water for injection was collected in a vessel . 2 . batch quantity of sodium chloride was added and dissolved under stirring . 3 . batch quantity of disodium edetate was added and dissolved under stirring . 4 . ph was checked and adjusted to ph 2 . 7 using 1n hcl solution . 5 . batch quantity of tiotropium bromide was added and dissolved under stirring . the below example illustrates the compositions with different ph adjusting agents such as citrate buffer and 1 n hcl stability data related substances # 5a 5b ( impurity a ( 2 - hydroxy - 2 , 2 - dithiophen - 2 - ylacetic acid ) initial 0 . 02 nd 1m 2 - 8 ° c . 0 . 03 0 . 03 1m_25 ° c ./ 60 % rh 0 . 06 0 . 06 1m_40 ° c ./ 75 % rh 0 . 18 0 . 16 total impurities initial 0 . 07 nd 1m 2 - 8 ° c . 0 . 16 0 1m_25 ° c ./ 60 % rh 0 . 26 0 . 09 1m_40 ° c ./ 75 % rh 0 . 38 0 . 17 assay % initial 104 . 9 101 . 1 1m 2 - 8 ° c . 104 . 2 99 . 7 1m_25 ° c ./ 60 % rh 104 . 4 100 . 2 1m_40 ° c ./ 75 % rh 103 . 5 100 . 6 1 . 90 % batch quantity of water for injection was collected in a vessel . 2 . batch quantity of sodium chloride was added and dissolved under stirring . 3 . batch quantity of disodium edetate was added and dissolved under stirring . 4 . batch quantity of citric acid monohydrate was added and dissolved under stirring . 5 . batch quantity of sodium citrate dihydrate was added and dissolved under stirring . 6 . batch quantity of tiotropium bromide was added and dissolved under stirring . 1 . 90 % batch quantity of water for injection was collected in a vessel . 2 . batch quantity of sodium chloride was added and dissolved under stirring . 3 . batch quantity of disodium edetate was added and dissolved under stirring . 4 . ph was checked and adjusted to ph 2 . 7 using 1n hcl solution . 5 . batch quantity of tiotropium bromide was added and dissolved under stirring . stability data related substances # 6a 6b 6c 6d impurity a ( 2 - hydroxy - 2 , 2 - dithiophen - 2 - ylacetic acid ) initial 0 . 03 0 . 03 0 . 02 0 . 03 1m 2 - 8 ° c . 0 . 04 0 . 05 0 . 05 0 . 06 1m_25 ° c ./ 60 % rh 0 . 07 0 . 09 0 . 09 0 . 12 1m_40 ° c ./ 75 % rh 0 . 21 0 . 27 0 . 19 0 . 23 total impurities initial 0 . 19 0 . 19 0 . 19 0 . 18 1m 2 - 8 ° c . 0 . 18 0 . 20 0 . 21 0 . 18 1m_25 ° c ./ 60 % rh 0 . 20 0 . 13 0 . 23 0 . 26 1m_40 ° c ./ 75 % rh 0 . 33 0 . 41 0 . 33 0 . 35 assay % initial 97 . 9 102 . 5 103 . 1 102 . 8 1m 2 - 8 ° c . 95 . 6 102 . 30 102 . 2 102 . 2 1m_25 ° c ./ 60 % rh 95 . 6 102 . 3 101 . 6 101 . 9 1m_40 ° c ./ 75 % rh 95 . 0 101 . 4 100 . 8 101 . 2 1 . 90 % batch quantity of water for injection was collected in a vessel 2 . batch quantity of sodium chloride was added and dissolved under stirring . 3 . batch quantity of disodium edetate was added and dissolved under stirring . 4 . ph was checked and adjusted as desired using 1n hcl solution 5 . batch quantity of tiotropium bromide was added and dissolved under stirring . the below example illustrates compositions with different fill volumes per unit dosage form related substances # 7a 7b 7c impurity a ( 2 - hydroxy - 2 , 2 - dithiophen - 2 - ylacetic acid ) initial nd nd nd 1m 2 - 8 ° c . 0 . 01 nd nd 1m_25 ° c ./ 60 % rh 0 . 04 0 . 09 0 . 04 1m_40 ° c ./ 75 % rh 0 . 15 0 . 17 0 . 15 total impurities initial 0 . 09 0 0 1m 2 - 8 ° c . 0 . 11 0 . 16 0 1m_25 ° c ./ 60 % rh 0 . 17 0 . 19 0 . 04 1m_40 ° c ./ 75 % rh 0 . 29 0 . 28 0 . 15 assay % initial 103 . 2 102 . 9 104 . 1 1m 2 - 8 ° c . 102 . 9 102 . 7 103 . 4 1m_25 ° c ./ 60 % rh 101 . 8 101 . 8 102 . 1 1m_40 ° c ./ 75 % rh 100 . 9 102 . 1 101 . 4 1 . 90 % batch quantity of water for injection was collected in a vessel . 2 . batch quantity of sodium chloride was added and dissolved under stirring . 3 . batch quantity of disodium edetate was added and dissolved under stirring . 4 . ph was checked and adjusted to ph 2 . 7 using 1n hcl solution . 5 . batch quantity of tiotropium bromide was added and dissolved under stirring . although the invention herein has been described with reference to particular embodiments , it is to be understood that these embodiments are merely illustrative of the principles and application of the present invention . it is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as described .

US-201615157143-A

a remote monitoring system that includes a portable measuring device that can be coupled to a portable wireless gateway . the portable measuring device obtains measurements including physiological data , movement data and ambient measurements and provides these measurements to the portable wireless gateway . the portable wireless gateway can interface with a networked personal computer through an usb connector . once interfaced to the computer , the measurement data can be loaded into the computer and delivered to a central system through the networked personal computer . the system enables the monitoring of a user &# 39 ; s medical information to allow diagnostics of the user .

referring now to the drawings , in which like numerals refer to like parts throughout the several views , exemplary embodiments of the present invention are described . the present invention is of a portable system and method for enabling medical data collection to be performed remotely , at the user location , while the user may easily carry the system , install and operate it in different locations . in each of these locations , there is a pc , which may be connected to a communication network that may access the central server , such as the internet . in some locations in which the pc has audio / visual capabilities , the system may also permit audio / video conferencing between the subject and the medical personnel . where the pc is not connected on - line to the network , it may store the medical data and forward it to the central server when the link becomes on - line , alternately it may store the data within its local disk or on the nonvolatile memory permanently or temporarily to be retrieved later by the user or by a medical personnel . more specifically , the present invention is of an apparatus , which features bi - directional communication for transferring medical data with medical personnel operated call center , alternately or simultaneously , to a central server . the communication may be carried over any communication network such as the internet via regular telephone line , isdn , adsl , cable tv , cellular or any other type of physical network . the pc in which the apparatus is connected may be integrated with audio and video conferencing between a remote ( home , “ internet cafe ” and office ) subject and a medical service center . the invention is particularly useful for subjects having some type of medical risk who wishes to be supervised by a medical service center from numerous locations as long there is a pc with a usb connector or similarly functional connector and a network connection available . according to an embodiment of the present invention , the system of the present invention features a remote apparatus and a medical service center with central server , which operates to enable remote monitoring for a subject at the home or other locations . the medical examinations may include visual and verbal communication and examinations with a two - way audio and video channel for enabling conversation between the subject and medical personnel at a medical service center . fig1 illustrates a schematic block diagram of a system according to an exemplary embodiment of the present invention . as shown , a system 100 features a wearable device 101 to be worn by a user , or a wireless medical device for measuring at least one physiological parameter of the user . wearable device 101 may be as a wrist - mounted device , for example by being attached with a wristband or other fastening article to the wrist of the user ; however , it should be understood that the device can be attached to clothing , carried in a pocket or attached to other parts of the body as well . the present invention enables such a measurement to preferably be transformed into medical information about the user . such information may be sent through a portable wireless gateway 210 via usb connection , or similarly functional connection , 212 to pc 220 . pc 220 may or may not process the received information and transfers the data over the computer network 180 to central server 187 . the information may also be delivered to medical personnel ( for example at a call center 185 ). the call center 185 and the central server 187 may be in the same site and may be connected over a lan or internet . as previously noted , the present invention is not limited to wearable device . other measuring equipment 190 a to 190 c may be used such as , but not limited to , scale , egc , blood pressure measuring device , glucometer , smoke detectors , etc . portable wireless gateway 210 may communicate with one or more measuring equipment devices 190 a to 190 c . computer network 180 may be any network solution such as , but not limited to , internet protocol based network as the internet , intranet , lan etc . over communication links such as telephone line , cellular , isdn , adsl etc . henceforth , the description of the present invention may use the term ‘ internet ’ as a representative term for any of the computer network solutions . examples of medical information which may be extracted from the measured physiological parameter or parameters include , but are not limited to : heart rate ; heart rate regularity ; breathing rate ; arrhythmia of the heart ( if any ), as well as the general rhythm and functioning of the heart ; blood pressure ( systolic and diastolic ); presence of abnormal body movements such as convulsions for example ; body position ; fall detection ; general body movements ; body temperature ; presence and level of sweat ; oxygen saturation in the blood ; and glucose levels in the blood . the pwg 210 may communicate with the wearable device 101 of the present invention through a wireless communication channel . the wireless communication may be based on common standards such as , but not limited to , bluetooth , wireless lan ( ieee 802 . 11 ) or proprietary protocol . other embodiments may use ir communication instead of rf communication between the wearable device 101 and the pwg 210 . the pwg may convert the information coming from the wearable device into the format that fit the communication over usb . pwg 210 is described in detail herein below in conjunction with fig2 and 4 . additional information about the operation of wearable device 101 , call center 185 and the central server 187 is disclosed in pct applications pct / il01 / 01187 ; pct / il02 / 00285 ; pct / il02 / 00995 ; pct / il02 / 00994 the contents of which are incorporated herein by reference . in an exemplary embodiment of the present invention , the pwg , the wearable device or the medical device may also measure other parameters that may affect the subject &# 39 ; s physical condition , including but not limited to , ambient temperature and humidity , lighting conditions , smoke and / or other material in the air , user location , distance from home etc . the present invention may feature a manually / automatically activated medical measurement signal that may be initiated by the subject himself , by pc 220 , or from the call center 185 . the activate signal from the call center is transferred over the internet 180 through pc 220 for being transmitted through the pwg 210 . in same cases the activate signal may be used as alarm signal in order to indicate an emergency or otherwise dangerous situation for the user . the activate / alarm signal may optionally be transmitted in the reverse direction according to a manual action of the user , such as pressing a “ panic button ” 116 for example . most preferably , the alarm signal is transmitted automatically upon measurement of the one or more physiological parameters of the user , preferably even if the user is unable to press the panic button . optionally , the alarm signal may be given to the user , additionally or alternatively , for example by sounding an audible alarm , more preferably from the wrist - mounted device itself . upon receipt of manually / automatically activated medical measurement of the user , the pwg may store it on its local nonvolatile memory module 240 or transfer it the host pc 220 to be stored there on its local hard disk or to be transferred further on to the central server 187 to be stored and analyzed . pc 220 , after receiving and processing the message may return the processed information to the pwg 210 in order to store in the nonvolatile memory of the pwg 210 . upon receipt of the manually / automatically activated alarm signal via pwg 210 , the pc 220 would preferably initiate immediately a call to a human operated call center 185 . then the pc 220 may instruct , via pwg 210 , the user to manually activate the wearable device 101 to collect one or more current physiological measurements of the user . these measurements may be sent directly to pwg 210 , or alternatively may be analyzed , in the wearable device , in order to compute the medical parameters of the user before sending the results to pc 220 via the pwg 210 . the pc 220 may analyze the measurement . the human operator , at the medical center , would then preferably be able to assess the user &# 39 ; s medical condition from the received information . the wearable device 101 of the present invention may also monitor , at least periodically but more preferably continuously , the value or condition of one or more physiological parameters of the user . continuous monitoring would more easily enable the device to transmit the alarm signal if measurements of one or more physiological parameters are collected and analyzed by a microprocessor to form medical information , which then could be determined to be above predefined criteria , such as unstable heart rate , or very high or low blood pressure , for example . according to a non - limiting exemplary embodiment of the present invention , the wrist - mounted device 101 features one or more sensors attached to a wristband or other fastening article . the sensor ( s ) are preferably connected to a microprocessor , optionally by a wire but alternatively through a wireless connection . the microprocessor may optionally also be located within the wristband , or otherwise attached to the wristband . the sensor ( s ) preferably support automatic collection of at least one physiological measurement ; more preferably , the microprocessor is able to execute one or more instructions for extracting clinically useful information about the user from such measurement ( s ). the microprocessor more preferably operates a software program to process and analyze the data , which is collected , in order to deliver medical information . the measurement data , is then preferably transferred via pwg 210 to pc 220 . the pc 220 may relay such information to a central server 187 , which may be able to provide such information to medical personnel , for example as part of a call center 185 . therefore , continuous monitoring of the physiological parameters of the user may optionally and more preferably be made , enabling better medical care for the user . a general , non - limiting example of suitable methods for measuring the heart rate and / or other heart - related physiological parameters of a subject who is wearing the device according to the present invention may be found in the article “ cuff - less continuous monitoring of beat - to - beat blood pressure using sensor fusion ”, by boo - ho yang , yi zhang and h . harry asada — ieee ( also available through http :// web . mit . edu / zyi / www / pdf / ieeetrans2000 . pdf as of dec . 9 , 2001 ), hereby incorporated by reference as if fully set forth herein , where systolic and diastolic blood pressure are calculated using the pulse pressure shape per heartbeat . the disclosure does not describe a device , which has the functionality according to the present invention , but the disclosed method is generally useful for determining blood pressure from an external measurement of pressure from the pulse through the skin of the subject . device 101 may have at least one physiological sensor 102 for measuring at least one physiological parameter of the user , a vibration sensor 123 , preferably a piezoceramic sensor , which is not in direct contact with the skin of the user . sensor 123 measures the movement of the wrist . the output of sensor 123 can be used by a processing unit 103 to capture the movement of the wrist and to recover some noise received by sensor 102 , which is caused by such movement . sensor 123 may be used for measuring the breath of the subject . for measuring the breath , the subject may be requested to put the hand ( with the wearable device 101 ) over the subject &# 39 ; s abdomen . in this position sensor 123 measures the movement of the abdomen , which is due to the subject &# 39 ; s breath . device 101 may include additional ambient sensors 130 such as but not limited to a humidity sensor for measuring the ambient humidity . an exemplary humidity sensor may be the humidity gauge manufactured by honeywell . in order to support processing of the measured physiological parameter or parameters , processing unit 103 may optionally include internal ram and non - volatile program memory ( not shown ). also processing unit 103 may optionally include an extended data memory 105 located externally to processing unit 103 . processing unit 103 preferably executes at least one instruction for processing the data obtained by sensor 102 . examples of such processing units 103 include but are not limited to pic18lc452 by microchip technology inc ., which contains 10 channels of 10 bit a / d converters , a 1 . 5k bytes of internal ram and 32k bytes of non - volatile program memory . extended memory component 105 is preferably an electrically erasable non - volatile external memory component . examples of such a memory component include but are not limited to fm24cl64 - s ( ramtron , usa ), with 64 kbit of fast access read / write serial memory for storing temporary data related to the sampled physiological parameter . device 101 may have a real time clock 117 in order to provide an accurate time and date for each measurement , as device 101 can optionally store a few measurements before transmitting such data and / or information to pwg 210 , as described in greater detail below . real time clock may also optionally be used for such applications as reminding the subject to take medication , perform a prescheduled measurement , and so forth . an a / d converter 109 with multiple inputs may be utilized if sensor 102 is an analog sensor , in order to convert the analog signal to a digital signal . device 101 may include a display unit or units 118 and / or 124 . the display unit may be used for displaying messages coming from the call center 185 , alarm information , instructions to the user etc . device 101 may also optionally feature a watchdog 115 , which monitors the function of device 101 . if the end of a watchdog time period is reached , device 101 is assumed to have a fault in its operation , and a master reset is preferably initiated automatically . device 101 preferably features an internal communication unit 104 , for at least unidirectional , but more preferably bi - directional , communication with pwg 210 . communication unit 104 may act as an interface module between processing unit 103 and the communication protocol that is used over the wireless connection 121 with pwg 210 . in addition communication unit 104 may include the transmitter and the receiver that are used for the wireless communication 121 . communication 121 may be rf communication based on standard protocols such as bluetooth or ieee 802 . 11 ( wireless lan ) or on a proprietary protocol or other wireless communication methods such as ir . in case of using an rf proprietary protocol , the communication may be in any allocated frequency band but most preferably is in the unlicensed frequency spectrum . in order to save power and increase the life of the battery , wearable device 101 may be placed into a sleep mode for the majority of the time . the wearable device 101 can be awaked according to a prescheduled program that is sent from the medical center or by manual activation . fig2 illustrates a schematic block diagram of the pwg part of the system 200 according to an exemplary embodiment of the present invention . the pwg section 200 of the system may comprise a pwg 210 and a pc 220 connected to the computer network 180 . pc 220 may have audio / visual capabilities . pwg 210 together with pc 220 act as the interface between the user and / or the wearable device 101 ( fig1 ) and the central server 187 and / or the call center 185 . pc 220 may act as a host platform having a usb host controller for controlling and managing all usb transfers on the usb bus . pwg 210 may be implemented as a single unit that is plugged into the usb port of pc 220 . pwg 210 may have the shape of a usb flash memory disk that is illustrated in us design pat . no . d 462 , 689 or d 468 , 090 the contents of which are incorporated herein by reference . however the present invention is not limited to this shape , other embodiments of the present invention may have other shapes or may be connected to other ports of pc 220 . pwg 210 may comprise a usb module 230 , a non - volatile memory module such as flash memory , eeprom , fram that may be logically divided into several non - volatile memory modules that are represented by three modules 240 a to 240 c , rf module 270 , antenna 245 , a memory 250 , authentication / encryption module 280 , and a processor / controller 260 that controls the operation of the different modules of pwg 210 . pwg 210 may comprise two buses , a data bus 266 and a control bus 263 or any other serial or parallel bus structure . in other embodiments of the present invention the two logical buses data bus 266 and a control bus 263 may share the same physical bus . pwg 210 collects medical data from at least one monitor equipment such as wearable device 101 ( fig1 ) via wireless communication . the data is sent to computer 220 over usb connection 212 and from pc 220 over the computer network 180 to the call center and / or the central server 187 . usb module 230 acts as the interface module between the controller 260 of pwg 210 and pc 220 . usb module 230 may include the physical interface for receiving and transmitting electrical signals to and from pc 220 according to the communication protocol and a logical interface for decoding the address , synchronizing the signals and communicating with the controller 260 . the incoming packets from pc 220 are parsed and transferred to controller 260 over the internal buses 266 and / or 263 . in the other direction information from the controller 260 are received by usb module 230 , packetized according to the usb protocol and sent over the usb 212 port to the pc 220 . in case of using other type of communication port than usb , such as rs232 , then usb module 230 may be replaced by an appropriate module . nonvolatile memory module ( nvmm ) 240 a - 204 c may be divided into several logical non - volatile memory modules . nvmm 240 a may store the software that controls the operation of controller 260 . nvmm 240 b may store the operating software that is used by pc 220 for controlling the operation of the user site . this software may be loaded into pc 220 immediately after connecting the pwg 210 to the usb port 212 . nvmm 240 c may be used for storing the personal information of the user . the personal information may include authentication data of the user as well as medical information , such as the file history of the user , current results of medical measurements , the schedule for taking medicine , sensitivity information about medicines , or any type of data that may help a medical personal that take care of the user . the present invention is not limited to 3 modules of nvmm 240 a to 240 c and any other number of modules may be used . the operation of nvmm 240 is controlled by processor 260 . exemplary nvmm may be built of nonvolatile memory , such as but not limited to flash memory , eeprom , fram , a section of nvmm 240 may be built of non - erasable memory modules such as eprom , prom , etc . rf module 270 is used as the complementary communication unit to the communication unit 104 ( fig1 ) of the wearable device . rf module 270 may comprise an interface unit ( not shown ) that converts the data coming from the internal bus 266 and / or 263 according to the rf communication protocol and vice versa . the interface unit is connected in one side to bus 266 and / or 263 and on the other end to rf transmitter / receiver ( not shown ). the rf transmitter / receiver is connected to an antenna 245 that may be an external antenna or an internal antenna . rf module 270 and communication unit 104 may use a standard rf protocol , such as bluetooth or ieee 802 . 11 ( wireless lan ) or any other technology or proprietary protocol . the rf frequency may be 433 mhz , 868 mhz , 915 mhz or any other frequency that may be used for such an application . other exemplary embodiments of the present invention may use wireless communication techniques other than rf , for example ir communication . in such an embodiment , the rf module will be replaced by an appropriate module having the appropriate transmitter / receiver and may have a lens / sensor instead of antenna 245 . memory module 250 may be a combination of any type of short - term memory such as ram , sram and dram etc . with long - term memory such as eprom that is used to support the operation of the controller 260 . the memory 250 may be used for storing the bootstrap program of controller 260 , the current program , setting parameters for monitoring equipment 101 and may be used for intermediate buffer for data coming from / to the medical center 185 to / from the monitoring equipments 101 . controller 260 may be a computational device such as , but not limited to , a general - purpose microprocessor , a dsp , a micro - controller or a special asic designed for that purpose . in some embodiments of the present invention controller 260 is used to control the operation of the internal modules of pwg 210 , while pc 220 is used to control the operation of system 200 as well as the wearable device 101 ( fig1 ). in those embodiments , pc 220 may analyze the medical information that is coming from the wearable device 101 via pwg 210 . in other embodiments of the present invention the pc 220 is just used as an interface between pwg 210 and the internet 180 . in those embodiments the controller 260 may process the physiological measurements into medical information before transferring the results to the call center 185 via pc 220 and the internet . in other embodiments of the present invention , processing the information may be done in the central server 187 ( fig1 ). an exemplary embodiment of the present invention may comprise an authentication / encryption module 280 . authentication / encryption module 280 may be used in order to protect the privacy of the information that is stored in pwg 210 . pc 220 and / or the pwg 210 may be used as an intermediate buffer that stores commands and / or data , which requested by the user using the software running on the pc 220 or commands and / or data coming from the medical service center 185 ( fig1 ) to the monitoring equipment 101 , until receiving a request from the monitoring equipment 101 to set communication with the pwg 210 . the information coming from the medical center 185 and / or from the user may include data like , but not limited to , type of measurements that are needed , setting the sleeping period , setting the internal clock of the monitoring equipment etc . upon setting the communication between the two , the monitoring equipment 101 asks the pwg 210 to retrieve the information that has been received from the medical center 185 and / or from the user during the recent sleeping period . in this method of operation , the pwg 210 and / or pc 220 is used as an intermediate buffer for calls coming from both sides either from the monitoring equipment 101 or from the medical center 185 . the pwg 210 and / or pc 220 eliminate the need for the medical center as well as the monitoring equipment 101 to be on - line on the same time . fig3 is an exemplary flow diagram illustrating the operation of pc 220 and pwg 210 during the set up , after installing the pwg 210 in a usb port 212 ( fig2 ). upon installing 310 pwg 210 in the usb socket , a standard usb configuration process 315 takes place . in this process pc 220 configures the usb new device 210 and the mode of communication with usb device 210 . although there are many different methods for configuring usb devices , for the purposes of clarity only and without intending to be limiting , the present invention is explained in greater detail below with regard to a method in which pc 220 issues commands and requests to a usb device through one endpoint . pc 220 queries usb device 210 through the other endpoint for status changes , and receives related packets if any such packets are waiting to be received . then in step 320 pc 220 may check whether the driver for the new device exist in its library . if yes , pc 220 moves to step 335 and starts loading the software that performs the operation of pc 220 . if not , pc 210 indicates to the user 325 about the new device and waits 330 for the loading of the driver of the pwg 210 by the user . the loading may be done from a portable media such as cd rom or from the nvmm 240 b of device 210 or through the internet . in case of using the pwg 210 as the storage media of the driver , the pwg 210 upon installing and turn on , emulates a usb flash memory disk device , which is known to pc 220 . then the user may load 330 the driver from pwg 210 and continue to step 335 . after loading 335 , pc 220 reads 340 the file history and the personal information of the user from nvmm 240 c updates pwg 210 accordingly and synchronizes with pwg 210 . then pc 220 prompts the user to identify him and perform an authentication protocol . if 350 the authentication is successful , the pc 210 continues to step 355 and calls the call center 185 , updates it with the current situation of the user and the current communication link to the system 200 via pc 220 . if the authentication fails 350 , pc 220 returns to step 340 . this procedure may repeat for several times until the pc 220 sends a fail indication to the user . then pc 220 and pwg 210 may wait 360 for new call . the new call may come from the wearable device 101 ( fig1 ) or from the call center 185 . the response of pgw 210 with pc 220 to incoming calls may be like the response of the remote gateway that is disclosed in the incorporated pct applications ( pct / il01 / 01187 ; pct / il02 / 00285 ; pct / il02 / 00995 ; pct / il02 / 00994 ) the contents of which are incorporated herein by reference . fig4 is an exemplary flow diagram illustrating the removal of the pwg 210 from the usb port 212 . when the user desires to remove the pwg 210 from the pc 220 , the user instructs pc 220 to disconnect 410 the pwg 210 . then pc 220 updates 415 the call center 185 ( fig1 ) and the central server 187 ( fig1 ) about the disconnection and exchange the required information before the disconnection . then 420 pwg 210 is updated regarding the incoming disconnection . pc 220 updates nvmm 240 c ( fig2 ) with the current information . if during this period of time there is a valid connection with the wearable device 101 , the pwg 210 may update the wearable device too . otherwise , the wearable device will be updated upon the next installation of pwg 210 . after the updating , pc 220 may indicate 430 to the user that the pwg 210 may be safety removed . and the task of pc 220 is terminated 440 . in the description and claims of the present application , each of the verbs , “ comprise ” “ include ” and “ have ”, and conjugates thereof , are used to indicate that the object or objects of the verb are not necessarily a complete listing of members , components , elements or parts of the subject or subjects of the verb . in this application the words “ unit ” and “ module ” are used interchangeably . anything designated as a unit or module may be a stand - alone unit or a specialized module . a unit or a module may be modular or have modular aspects allowing it to be easily removed and replaced with another similar unit or module . each unit or module may be any one of , or any combination of , software , hardware , and / or firmware . the present invention has been described using detailed descriptions of embodiments thereof that are provided by way of example and are not intended to limit the scope of the invention . the described embodiments comprise different features , not all of which are required in all embodiments of the invention . some embodiments of the present invention utilize only some of the features or possible combinations of the features . variations of embodiments of the present invention that are described and embodiments of the present invention comprising different combinations of features noted in the described embodiments will occur to persons of the art . the scope of the invention is limited only by the following claims .

US-55211204-A

a collapsible and erectable organizer for holding bags and their contents , such as bags containing grocery items , upright during transport , such as in the trunk of a car . the organizer has velcro ® pieces on its bottom that resist slipping on a carpeted surface and that secure opposite halves of the bottom when the bottom is folded in half to collapse the organizer . the organizer can be used when collapsed to carry smaller items .

when fully open and erected as in fig4 , 5 , 6 , and 8 , the fabric organizer 10 has a bottom 12 and four sides 14 , 16 , 18 , 20 . the top is open . the sides and bottom are fabric lined on the inside . sides 16 and 20 comprise rectangular pieces of semi - rigid material , such as cardboard , that provide rigidifying inserts completely enclosed by fabric on the outside and liner fabric on the inside that are stitched together around their edges . sides 14 and 18 and bottom 12 comprise fabric and liner stitched together along their edges , but without an insert . while not always necessary , it is generally desirable that the fabric comprising the outside of the organizer be durable and of relatively heavy weight in order to contribute to the shape and stability of the open organizer . fabric handles 22 , 24 are attached to the outside of opposite sides 16 , 20 as shown . on the outside of bottom 12 are two pieces of velcro ® hook material 26 , 28 and two pieces of velcro loop material 30 , 32 arranged in a rectangular pattern as shown . the bottom 12 is divided into two halves by a fold 34 defined by a row of stitching which continues up sides 14 and 18 , also defining folds 36 and 38 . when the bottom is folded onto itself as in the conditions of fig1 , 2 , 3 , and 7 . piece 26 adheres to piece 30 and piece 28 to piece 32 . the two halves extend into the space between the sides 16 - 20 . vertical fold lines 36 , 38 divide each side 14 , 18 into two halves . those sides also tend to fold approximately along imaginary lines 40 , 42 allowing the organizer to assume conditions like those of fig1 , 2 , and 7 . proximate the top of each fold line 36 , 38 is an attachment means 44 such as two mating parts of a snap or else opposite velcro ® pieces . fig2 shows the attachment means holding the sides 14 , 18 together at the tops of the fold lines 36 , 38 . for the organizer to assume fully open condition for erection to hold grocery bags , the attachment elements are detached from each other . sewn to the inside of sides 14 and 18 just below the attachment means 44 are ends of respective rectangular flaps 46 , 48 . the flaps have a height about one - fourth to one - third the height of the sides . with the organizer fully open , free ends of flaps 46 , 48 are brought together in overlapping relation . opposite velcro ® pieces 50 , 52 fasten the free ends of the flaps together to create two generally equal sized interior compartments , with the flaps forming a divider between the compartments . each is capable of holding a paper grocery bag containing groceries ( not shown ). when the grocery bags are removed and the organizer is to be collapsed to the folded fig1 condition , flaps 46 , 48 are disconnected and folded back as in fig3 . the sides 14 and 18 are brought together at the top and fastened together by attachment means 44 , with appropriate folding of the sides as in fig2 concurrent with folding of the bottom . the bottom is pushed up along its fold line 34 to fold its halves onto each other so that the opposite velcro ® pieces on the bottom can re - attach to hold the bottom in folded condition . the velcro ® pieces on the bottom aid in holding the organizer against sliding on a carpet or fabric , such as in a car trunk , when the organizer is opened and used to contain the grocery bags . it keeps the bags upright and in place . the handles allow the organizer to be carried by hand , even with grocery bags in it . in a modified form , the two halves of the bottom could be provided with respective rigidifying inserts without impairing the ability for the halves to be folded onto each other when the organizer is collapsed . the organizer can also be used in the condition of fig2 to carry flat sheet - like materials , such as notebooks and the like , or other small objects . the arrows in fig7 show how such materials can be inserted to the organizer while the bottom remains fully folded . each of the four fastener pieces 26 , 28 , 30 , 32 is disposed proximate a corner of bottom 12 to provide a line about which sides 16 and 20 can pivot when the organizer is collapsed with pieces 26 , 28 , 30 , 32 fastening the two bottom halves , and attachment means 44 is attaching sides 14 and 18 together . such pivoting tends to enlarge the open area to either side of the attachment means at the top of the organizer . while a presently preferred embodiment of the invention has been illustrated and described , it should be appreciated that principles of the invention apply to all embodiments falling within the scope of the following claims .

US-19551605-A

an inclined conveyor of an agricultural harvesting machine has at least one endless pulling element , at least one pulling - means guide operative for redirecting of the at least one endless pulling element and being pivotable , at least one tensioning device for tensioning the at least one pulling element , the tensioning device generating a return torque that acts on the at least one pulling - means guide .

an agricultural harvesting machine 2 configured as a self - propelled combine harvester 1 is shown in a side view in fig1 , on the inclined conveyor 3 of which a cutting mechanism 4 is located . cutting mechanism 4 is composed of a cutting table 5 and a rotating reel 6 assigned to this cutting mechanism on the top . crops 7 are cut by a cutter bar 8 installed in the front region of cutting table 5 and transferred to inclined conveyor 3 according to the present invention and located behind it using a feed screw 9 located in cutting table 5 . crops 7 are grasped by a pulling means 11 — which rotates in a counterclockwise direction — of inclined conveyor 3 and are conveyed further in an undershot manner over a bottom 12 of inclined conveyor 3 to a threshing device 10 that mechanically processes crops 7 . a drive shaft 24 driven in a rotating manner in a counterclockwise direction is rotatably supported in outlet region 21 of inclined conveyor 3 , on which said drive shaft chain wheels 25 are mounted in a rotation - proof manner . fig2 shows a perspective view of inclined conveyor 3 according to the present invention , rotating pulling means 11 of which are enclosed in a housing 13 , whereby housing 13 is essentially composed of two side walls 14 and a cover 15 and bottom 12 . conveyor 16 , formed by pulling means 11 , is located inside housing 13 , said pulling means 11 including a plurality of conveyor chains 18 located in parallel with and equidistant from each other , whereby adjacent conveyor chains 18 are joined via conveyor strips 19 . conveyor chains 18 of traction device 11 are redirected in an inlet region 20 of housing 13 with a first pulling - means guide 22 , and in an outlet region 21 of housing 13 with a further pulling - means guide 23 . instead of conveyor chains 18 , a belt or a rope can be used , for example . pulling - means guide 22 located in outlet region 21 of the housing is composed of drive shaft 24 supported in side walls 14 . each conveyor chain 18 of traction device 11 encircles a chain wheel ( see fig1 ) and engages in the teeth of the chain wheel , resulting in a form - fit functional connection . pulling - means guide 23 located in inlet region 20 of housing 13 is composed of a return shaft 26 and two pivoting swing arms 27 configured as mirror images and rotatably supported on the two outer ends of return shaft 26 . return shaft 26 includes a drum 28 , on the jacket of which flanges 29 are located with distance between them . conveyor chains 18 of pulling means 11 rest on flanges 29 and encircle them . a guide bolt 30 is welded on each of the swing arms 27 , said guide bolt being guided in a slot 31 in side wall 14 located next to each swing arm 27 . both side walls 14 are reinforced by reinforcing sheets 32 in the edge region of slots 31 . both swing arms 27 are rotatably connected with a tensioning device 35 according to the present invention and to be described in greater detail at pivot points 34 located above guide bolts 30 at distances 33 from guide bolts 30 . an opening 36 is provided in side walls 14 in the region of the tensioning devices 35 , through which said opening tensioning devices 35 located in the interior of housing 13 are adjustable . an enlarged section of the side view of inclined conveyor 3 with a pulling - means guide 22 and a tensioning device 35 according to the present invention is shown in fig3 . the description below applies accordingly for the components of inclined conveyor 3 , which are configured either identically or as mirror images and are located further back and are therefore not visible . tensioning device 35 is composed of a threaded rod 37 that is hingedly connected on one end via a yoke section 38 with swing arm 27 of pulling - means guide 22 and , at the other end , is screwed into a threaded blind hole 39 of a guide bolt 40 . guide bolt 40 is supported in a displaceable and rotatable manner in a through hole 41 of a web plate 42 that is welded to the inside of side wall 14 . guide bolt 40 passes through a compression spring 44 configured as coil spring 43 , whereby a collar 45 located on guide bolt 40 preloads compression spring 44 against web plate 42 . to secure guide bolt 40 from being screwed down by threaded rod 37 , threaded rod 37 and guide bolt 40 are braced against each other with a lock nut 46 . tensioning device 35 according to the present invention generates a return torque 47 around guide bolt 30 with the spring force of preloaded compression spring 44 , in addition to the pulling means tensioning force . return torque 47 acts on swing arm 27 and presses swing arm 27 in a lower position 48 against lower stop 49 . stop 49 located on the inside of side part 14 is rotatable from the outside , by way of which lower position 48 of return shaft 26 is adjustable . crops 7 , which are pressing against return shaft 26 , rotate swing arm 27 in the clockwise direction around guide bolt 30 into an upper position 50 , by way of which guide bolt 40 is moved within through hole 41 guiding it into a rear region of web plate 42 on which tensioning device 35 is mounted . this results in compression spring 44 being compressed further , and return torque 47 produced by tensioning device 35 around guide bolt 30 increases as the spring force increases . return torque 47 acting on swing arm 47 presses return shaft 26 against harvested crops 7 . the strength of return torque 47 depends on the spring force of compression spring 44 , which is proportional to the spring path of compression spring 44 , and on distance 33 between pivot point 34 and guide bolt 30 of swing arm 27 . an upper stop 51 is rigidly mounted above swing arm 27 on the inside of side wall 14 of housing 13 , the stop limiting the swivel range of swing arm 27 in the upward direction . to always act upon pulling means 11 with the optimum tension , a marking 52 is provided on opening 36 provided in side wall 14 , the marking indicating the length to which compression spring 44 should be preloaded . during on - going operation , conveyor chains 18 of pulling means 17 elongate due to wear , by way of which pulling - means guide 22 along with tensioning device 35 travels into an anterior region of inclined conveyor 3 . compression spring 44 relaxes , since the distance between collar 45 of guide bolt 40 and web plate 42 increases simultaneously . to restore the optimum preload of compression spring 44 , guide bolt 40 is screwed down by threaded rod 37 to the point where collar 45 is again located at the level of marking 52 . it is within the ability of one skilled in the art to modify the exemplary embodiment described in a manner not shown , or to use it in other machine systems to obtain the effects described , without leaving the scope of the present invention . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions differing from the types described above . while the invention has been illustrated and described as embodied in an inclined conveyor of an agricultural harvesting machine , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention .

US-18854705-A

the present invention relates to a novel ursolic acid derivative as an ursolic acid prodrug form , and to a method for preparing same , wherein the novel ursolic acid derivative as an ursolic acid prodrug can have excellent pharmacokinetic characteristics such as stability and oral absorptivity and exhibit excellent pharmaceutical activities by being converted into an ursolic acid in vivo , and . the ursolic acid derivative can be in an ester form in which c28 carboxylic acid in the ursolic acid is combined with a prodrug of a certain pharmaceutical compound .

hereinafter , exemplary embodiments of the present invention will be described to assist in understanding the present invention . however , the following exemplary embodiments are provided only to more easily understand the present invention . the present invention is not limited thereto . 7 . 5 g of an ursolic acid ( purity : 98 %) was added to 50 ml of tetrahydrofuran at room temperature to be dissolved . then , 6 . 45 g of pyridine and 0 . 2 g of n , n - dimethylaminopyridine were added thereto , followed by cooling to 10 ° c . or less , and 5 . 9 g of acetic anhydride was slowly added dropwise thereto . after the mixture was stirred at room temperature for 12 hours and the reaction completion was completed , the reaction liquid was concentrated . here , the confirmation of the reaction completion was conducted by thin film chromatography ( ethyl acetate : n - hexane = 1 : 4 rf = 0 . 4 ). the reaction concentrate was separated and purified by column chromatography using development solvent ( ethyl acetate : n - hexane = 1 : 2 to 2 : 1 ) to prepare 5 . 5 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 11 . 92 ( 1h . s ), 5 . 12 ˜ 5 . 14 ( 1h , t ), 2 . 10 ˜ 2 . 12 ( 1h , d , j = 11 . 0 hz ), 2 . 00 ( 3h , s ), 1 . 06 ( 3h , s ), 0 . 91 ˜ 0 . 92 ( 6h , d ), 0 . 81 ˜ 0 . 86 ( 9h , m ), 0 . 76 ( 3h , s ); 1 . 0 g of the compound obtained from reference example 1 was dissolved in 20 ml of acetone . 0 . 9 g of potassium carbonate and 0 . 4 g of potassium iodide ( ki ) were added thereto , and 0 . 6 g of 4 - chloromethyl - 5 - methyl - 2 - oxo - 1 , 3 - dioxolane was added thereto . the mixture was reacted at room temperature for 24 hours and concentrated . 10 ml of ethyl acetate was added to the concentrate , the concentrate was washed with 10 ml of water and brine , respectively , and dried over anhydrous sodium sulfate . after filtration under reduced pressure and concentration to obtain residue , the residue was separated and purified by column chromatography to thereby obtain 0 . 7 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 4 . 76 ˜ 4 . 99 ( 2h , dd ) 5 . 17 ( 1h , t ), 2 . 15 ˜ 2 . 17 ( 1h , d , j = 11 . 0 hz ), 2 . 11 ( 3h , s ), 2 . 00 ( 3h , s ), 1 . 06 ( 3h , s ), 0 . 90 ˜ 0 . 92 ( 6h , d ), 0 . 81 ˜ 0 . 86 ( 9h , m ), 0 . 76 ( 3h , s ); ir ( cm − 1 ) 2924 , 1819 , 1732 , 1447 , 1371 , 1244 , 1129 , 1010 . 0 . 5 g of the compound obtained from example 1 was dissolved in 4 ml of dichloromethane and 0 . 7 ml of methanol , and 0 . 68 g of 4 - toluenesulfonic acid was added thereto , and the mixture was reacted al room temperature for 10 days . then , 10 ml of dichloromethane and 10 ml of water were added thereto , extracted , and dried over anhydrous sodium sulfate , then filtrated . the obtained residue was separated and purified by column chromatography using development solvent ( ethyl acetate : n - hexane = 1 : 2 to 2 : 1 ) to prepare 0 . 3 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 4 . 76 ˜ 4 . 99 ( 2h , dd ) 5 . 16 ( 1h , t ), 2 . 96 ˜ 3 . 01 ( 1h , m ), 2 . 14 ˜ 2 . 16 ( 1h , d , j = 11 . 5 hz ), 2 . 11 ( 3h , s ), 1 . 04 ( 3h , s ), 0 . 90 ˜ 0 . 92 ( 3h , d ), 0 . 88 ( 3h , s ), 0 . 86 ( 3h , s ), 0 . 81 ˜ 0 . 86 ( 3h , d , j = 11 . 5 hz ), 0 . 75 ( 3h , s ), 0 . 56 ( 3h , s ); ir ( cm − 1 ) 2918 , 1822 , 1686 , 1720 , 1455 , 1383 , 1219 , 1186 , 1044 , 1029 . 1 . 0 g of the compound obtained from reference example 1 was dissolved in 20 ml of acetone . 0 . 9 g of potassium carbonate and 0 . 4 g of potassium iodide ( ki ) were added thereto , and 0 . 65 g of 1 - chloroethyl cyclohexyl carbonate was added thereto . the mixture was reacted at room temperature for 24 hours and concentrated . 10 ml of ethyl acetate was added to the concentrate , the concentrate was washed with 10 ml of water and brine , respectively , and dried over anhydrous sodium sulfate . after filtration under reduced pressure and concentration to obtain residue , the residue was separated and purified by column chromatography to thereby obtain 0 . 8 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 5 . 74 ˜ 5 . 87 ( 1h , dd ) 5 . 17 ( 1h , t ), 3 . 0 ( 1h , m ) 2 . 11 ˜ 2 . 13 ( 1h , d , j = 11 . 0 hz ), 2 . 00 ( 3h , s ), 1 . 45 ( 3h , d ), 1 . 06 ( 3h , s ), 0 . 90 ˜ 0 . 92 ( 6h , d ), 0 . 81 ˜ 0 . 86 ( 9h , m ), 0 . 76 ( 3h , s ), 1 . 00 ˜ 2 . 20 ( 10h , m ); ir ( cm − 1 ) 2925 1756 1732 , 1697 , 1466 , 1373 , 1245 , 983 . 0 . 7 g of the compound obtained from example 3 was dissolved in 4 ml of dichloromethane and 0 . 7 ml of methanol , and 0 . 68 g of 4 - toluenesulfonic acid was added thereto , and the mixture was reacted at room temperature for 10 days . then , 10 ml of dichloromethane and 10 ml of water were added thereto , extracted , and dried over anhydrous sodium sulfate , then filtrated . the obtained residue was separated and purified by column chromatography using development solvent ( ethyl acetate : n - hexane = 1 : 2 to 2 : 1 ) to prepare 0 . 4 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 5 . 70 ˜ 5 . 85 ( 1h , dd ) 5 . 17 ( 1h , t ), 3 . 0 ( 1h , m ) 2 . 11 ˜ 2 . 13 ( 1h , d , j = 11 . 0 hz ), 1 . 45 ( 3h , d ), 1 . 06 ( 3h , s ), 0 . 90 ˜ 0 . 92 ( 3h , d ), 0 . 88 ( 3h , s ), 0 . 86 ( 3h , s ), 0 . 81 ˜ 0 . 86 ( 3h , d ,), 0 . 75 ( 3h , s ), 0 . 56 ( 3h , s ), 1 . 00 ˜ 2 . 20 ( 10h , m ); 1 . 0 g of the compound obtained from reference example 1 was dissolved in 20 ml of acetone . 0 . 9 g of potassium carbonate and 0 . 4 g of potassium iodide ( ki ) were added thereto , and 0 . 55 g of 1 - chloromethyl pivalate was added thereto . the mixture was reacted at room temperature for 24 hours and concentrated . 10 ml of ethyl acetate was added to the concentrate , the concentrate was washed with 10 ml of water and brine , respectively , and dried over anhydrous sodium sulfate . after filtration under reduced pressure and concentration to obtain residue , the residue was separated and purified by column chromatography to thereby obtain 0 . 7 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 5 . 63 ˜ 5 . 68 ( 2h , dd ) 5 . 16 ( 1h , t ), 2 . 11 ˜ 2 . 13 ( 1h , d , j = 11 . 0 hz ), 2 . 02 ( 3h , s ), 2 . 0 ( 3h , s ), 1 . 13 ( 9h , m ), 1 . 06 ( 3h , s ), 0 . 90 ˜ 0 . 92 ( 6h , d ), 0 . 82 ( 9h , m ), 0 . 71 ( 3h , s ); ir ( cm − 1 ) 2920 , 1749 , 1726 , 1686 , 1466 , 1372 , 1245 , 1152 . 0 . 5 g of the compound obtained from example 5 was dissolved in 4 ml of dichloromethane and 0 . 7 ml of methanol , and 0 . 68 g of 4 - toluenesulfonic acid was added thereto , and the mixture was reacted at room temperature for 10 days . then , 10 ml of dichloromethane and 10 ml of water were added thereto , extracted , and dried over anhydrous sodium sulfate , then filtrated . the obtained residue was separated and purified by column chromatography using development solvent ( ethyl acetate : n - hexane = 1 : 2 to 2 : 1 ) to prepare 0 . 3 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 5 . 63 ˜ 5 . 68 ( 2h , dd ) 5 . 17 ( 1h , t ), 2 . 11 ˜ 2 . 13 ( 1h , d , j = 11 . 0 hz ), 3 . 0 ( 1h , m ) 1 . 13 ( 9h , m ), 1 . 04 ( 3h , s ), 0 . 90 ˜ 0 . 92 ( 3h , d ), 0 . 88 ( 3h , s ), 0 . 86 ( 3h , s ), 0 . 81 ˜ 0 . 86 ( 3h , d ,), 0 . 75 ( 3h , s ), 0 . 56 ( 3h , s ); ir ( cm − 1 ) 2920 , 1749 , 1726 , 1686 , 1466 , 1372 , 1219 , 1180 . 1 . 0 g of the compound obtained from reference example 1 was dissolved in 20 ml of acetone . 0 . 9 g of potassium carbonate was added thereto , and 0 . 6 g of 1 -( acetoxyethyl ) bromide was added thereto . the mixture was reacted at room temperature for 24 hours and concentrated . 10 ml of ethyl acetate was added to the concentrate , the concentrate was washed with 10 ml of water and brine , respectively , and dried over anhydrous sodium sulfate . after filtration under reduced pressure and concentration to obtain residue , the residue was separated and purified by column chromatography to thereby obtain 0 . 7 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 5 . 76 ˜ 5 . 87 ( 1h , dd ) 5 . 16 ( 1h , t ), 2 . 11 ˜ 2 . 13 ( 1h , d , j = 11 . 0 hz ), 2 . 03 ( 3h , s ), 2 . 0 ( 3h , s ), 1 . 48 ( 3h , d ), 1 . 13 ( 9h , m ), 1 . 06 ( 3h , s ), 0 . 90 ˜ 0 . 92 ( 6h , d ), 0 . 82 ( 9h , m ), 0 . 71 ( 3h , s ); ir ( cm − 1 ) 2920 , 1750 , 1728 , 1690 , 1465 , 1370 , 1245 , 1152 . 0 . 5 g of the compound obtained from example 7 was dissolved in 4 ml of dichloromethane and 0 . 7 ml of methanol , and 0 . 68 g of 4 - toluenesulfonic acid was added thereto , and the mixture was reacted at room temperature for 10 days . then , 10 ml of dichloromethane and 10 ml of water were added thereto , extracted , and dried over anhydrous sodium sulfate , then filtrated . the obtained residue was separated and purified by column chromatography using development solvent ( ethyl acetate : n - hexane = 1 : 2 to 2 : 1 ) to prepare 0 . 3 g of a target compound . 1 h - nmr ( dmso - d6 , 500 mhz ) 5 . 75 ˜ 5 . 85 ( 1h , dd ) 5 . 16 ( 1h , t ), 3 . 0 ( 1h , m ), 2 . 11 ˜ 2 . 13 ( 1h , d , j = 11 . 0 hz ), 2 . 02 ( 3h , s ), 1 . 45 ( 3h , d ), 1 . 06 ( 3h , s ), 0 . 90 ˜ 0 . 92 ( 3h , d ), 0 . 88 ( 3h , s ), 0 . 86 ( 3h , s ), 0 . 81 ˜ 0 . 86 ( 3h , d ,), 0 . 75 ( 3h , s ), 0 . 56 ( 3h , s ); experimental example : pharmacokinetic animal test on sprague dawley ( sd ) rat , using ursolic acid and ursolic acid derivatives of examples the ursolic acid was single - intravenously administered on sd rats and the ursolic acid derivative of example 2 was orally administered , then blood collection was performed each time , and concentration of the test substance in blood was analyzed . accordingly , bioavailability of the ursolic acid and ursolic acid derivatives of examples were measured and compared with each other . i ) control substance ( intravenous administration ): ursolic acid ( ua ) ( hplc purity of 99 . 0 % or more / area percentage ) ii ) test substance ( oral administration ) ursolic acid derivative of example 2 ( hplc purity of 99 . 4 % or more / area percentage ) the control substance for intravenous administration was diluted with 0 . 9 % saline which was sterilized and sealed to be prepared in 0 . 5 mg / ml . the test substance for oral administration was diluted with 0 . 9 % saline which was the same as the test substance , to be prepared in 25 mg / ml , then diluted to be prepared in 12 . 5 mg / ml . ( 4 ) weight ranges when administration starts : within the average body weight ( 5 ) other details for animal test were followed with reference to the food and drug administration notice no . 2009 - 183 ( dec . 22 , 2009 ), good laboratory practice ( glp ), and oecd principles of good laboratory practice ( 1997 ). ( 3 ) calculation of injection amount : the injection amount was calculated to be 1 . 0 or 2 . 0 ml / kg , on the basis of the recently measured body weight before the administration . ( 4 ) administration method : for intravenous ad administration , an animal to be administered was put into a compensator , and tail was disinfected with 70 % alcohol cotton , then the alcohol component was removed by using gauze , and the substance was administered by bolus using a 26g needle . for oral administration , the animal was fixed by a dorsocervical skin fixation method , and the substance was directly injected into the stomach using a sonde for oral administration . intravenous administration : after 0 , 5 , 15 , 30 , 45 minutes , and 1 , 2 , 4 and 8 hours ( 10 times ) from the administration of test substance , 0 . 6 ml of whole blood was collected and stored in a tube treated with heparin ( 5 iu / ml ) to separate blood plasma , and an overall amount was stored in one tube . oral administration : after 0 , 5 , 15 , 30 , 45 minutes , and 1 , 2 , 4 , 8 , and 12 hours ( 9 times ) from the administration of test substance , 0 . 6 ml of whole blood was collected and stored in a tube treated with heparin ( 5 iu / ml ) to separate blood plasma , and an overall amount was stored in one tube . after blood collection , the blood plasma was separated by centrifugation at 10 , 000 rpm for 5 minutes . the separated blood plasma was stored in a deep freezer at − 75 ± 5 ° c . until it is sent to laboratory . concentration of ursolic acid in the blood plasma of the rats was measured . blood plasma samples which were pre - treated were analyzed under the following hplc / ms / ms conditions shown in table 2 below . the ursolic acid standard was dissolved in methanol to have a concentration of 1 mg / ml , kept in a freezer , and then , the solution was diluted with a frozen blank blood plasma to prepare blood plasma samples so that the blood plasma of the ursolic acid has concentrations of 2 , 5 , 10 , 50 , 100 , 500 , and 1000 ng / ml . 100 ng / ml of an internal standard substance and 50 μl of hydrochlorothiazide were added to 50 μl of respective standard plasmas and mixed . 500 μl of methyl - 1 - tert - butyl ether was added thereto , followed by vortexing for 10 mins , and centrifugation at 13000 rpm for 5 mins . 450 μl of an organic layer was moved to a clean polypropylene tube , and completely dried under nitrogen . 120 μl of mobile phase was added to the residue so as to be dissolved , and 5 μl was taken and injected into lc - ms / ms . an area ratio of a peak of the ursolic acid to a peak of the internal standard substance was calculated to construct a calibration curve . the blood plasma samples obtained by collecting blood from the animal each time and storing the blood at − 70 ° c . or less was allowed to stand at room temperature to be dissolved and shaken , then , 50 μl was taken and pre - treated by the same method as the construction of calibration curve , and injected into lc / ms / ms . the area ratio of the peak of the ursolic acid to the peak of the internal standard substance was calculated from the obtained chromatogram , and the concentration of the ursolic acid in the blood plasma was calculated from the previously constructed calibration curve . ba calc . pharmacokinetic analysis was conducted by non - compartment analysis ( best fit ) using ba calc . 2007 ( kfda ), and auc last , c max , t max and t 1 / 2 were calculated . auc last and c max results were performed by bioequivalence analysis . bioavailability data obtained from the measurement results according to the above - described methods were summarized and shown in table 3 below . referring to table 3 , it was confirmed that as a result from the pharmacokinetic test on the rats using the ursolic acid derivative of example 2 , the ursolic acid derivative exhibited excellent oral absorptivity at dose of 25 mg / kg , and bioavailability of about 2 . 3 %, which was increased about 3 to 4 times as compared to existing ursolic acid . therefore , it is determined that the ursolic acid derivative is preferably applicable as an oral drug exhibiting excellent efficacy of the ursolic acid , unlike the ursolic acid which is not usable as an oral drug due to low oral absorptivity . for reference , paper 1 disclosed that as the pharmacokinetic test results on oleanolic acid which is an isomer having physicochemical characteristics which are similar to the ursolic acid , the oral absorptivity thereof was about 0 . 7 %, and therefore , excellent oral absorptivity and bioavailability of the ursolic acid derivative of example 2 could be also proven through the results of paper 1 .

US-201314420978-A

methods and products for stimulating hematopoiesis , preventing low levels of hematopoietic cells and producing increased numbers of hematopoietic and mature blood cells are provided . the methods and products can be used both in vivo and in vitro . the methods involve administering an agent of formula i : wherein m is an integer between 0 and 10 , inclusive ; a and a 1 are l - amino acid residues such that the a in each repeating bracketed unit can be the same or a different amino acid residue ; the c bonded to b is in the l - configuration ; the bonds between a and n , a 1 and c , and between a 1 and n are peptide bonds ; and each x 1 and x 2 is , independently , a hydroxyl group or a group capable of being hydrolyzed to a hydroxyl group in aqueous solution at physiological ph . a particularly preferred agent that is useful in practicing the invention is a valboropro .

the invention involves the stimulation of proliferation , differentiation and mobilization of hematopoietic cells . the invention is useful whenever it is desirable to stimulate the proliferation or differentiation , of or to mobilize , hematopoietic cells . mobilization of hematopoietic cells is characterized by the enrichment of early progenitor cells in the bone marrow and the recruitment of these cells to the periphery in response to a mobilization agent ( e . g . g - csf , gm - csf , etc .). the agents useful according to the invention can be used to inhibit hematopoietic cell deficiencies or to restore hematopoietic and mature blood cell count in subjects with such deficiencies . such agents also may be used in connection with hematopoietic cell transplants , such as bone marrow or peripheral blood transplants , when used to replenish or create an immune system in a subject . the agents further can be used as an immune booster . the agents also are useful in vitro in connection with the culturing of cells for therapeutic and research uses . as used herein , subject means humans , nonhuman primates , dogs , cats , sheep , goats , horses , cows , pigs and rodents . one important aspect of the invention involves restoring or preventing a deficiency in hematopoietic cell number in a subject . such deficiencies can arise , for example , from genetic abnormalities , from disease , from stress , from chemotherapy ( e . g . cytotoxic drug treatment , steroid drug treatment , immunosuppressive drug treatment , etc .) and from radiation treatment . the invention is useful in general to restore deficiencies created by hematopoietic cell inhibitors . a hematopoietic cell inhibitor is an exogenously - applied agent ( such as a drug or radiation treatment ) which causes a decrease in the subject of hematopoietic cells and / or mature blood cells . hematopoietic cells as used herein refer to granulocytes ( e . g . promyelocytes , neutrophils , eosinophils and basophils ), erythrocytes , reticulocytes , thrombocytes ( e . g . megakaryoblasts , platelet - producing megakaryocytes and platelets ), lymphocytes , monocytes , dendritic cells and macrophages . mature blood cells consist of mature lymphocytes , platelets , erythrocytes , reticulocytes , granulocytes and macrophages . in certain important aspects of the invention , the agents useful according to the invention increase the number of neutrophils , erythrocytes and platelets . in connection with neutrophils , the agents may be used to treat , inter alia , drug or radiation - induced neutropenia , chronic idiopathic neutropenia and cyclic neutropenia . one important aspect of the invention is restoring in a subject “ normal ” or “ protective ” hematopoietic cell levels . a “ normal ” level as used herein can be a level in a control population , which preferably includes subjects having similar characteristics as the treated individual , such as age . the “ normal ” level can also be a range , for example , where a population is used to obtain a baseline range for a particular group into which the subject falls . the population can also be divided into groups , such as into quadrants , with the lowest quadrant being individuals with the lowest levels of hematopoietic cells and the highest quadrant being individuals having the highest levels of hematopoietic cells . thus , the “ normal ” value can depend upon a particular population selected . preferably , the normal levels are those of apparently healthy subjects which have no prior history of hematopoietic cell disorders . such “ normal ” levels , then can be established as preselected values , taking into account the category in which an individual falls . appropriate ranges and categories can be selected with no more than routine experimentation by those of ordinary skill in the art . either the mean or another preselected number within the range can be established as the normal preselected value . likewise , the level in a subject prior to treatment with a hematopoietic cell inhibitor can be used as the predetermined value . in general , the normal range for neutrophils is about 1800 - 7250 per μl ( mean − 3650 ); for basophils 0 - 150 per μl ( mean − 30 ); for eosinophils 0 - 700 per μl ( mean − 150 ); for macrophages and monocytes 200 - 950 per μl ( mean − 430 ); for lymphocytes 1500 - 4000 per μl ( mean − 2500 ); for erythrocytes 4 . 2 × 10 6 − 6 . 1 × 10 6 per μl ; and for platelets 133 × 10 3 − 333 × 10 3 per μl . the foregoing ranges are at the 95 % confidence level . in connection with certain conditions , the medical community has established certain preselected values . for example , mild neutropenia is characterized as having a count of between 1000 and 2000 per μl , moderate neutropenia at between 500 and 1000 per μl and severe neutropenia at below 500 per μl . likewise , in adults , a lymphocyte count at less than 1500 is considered a medically undesirable condition . in children the value is less than 3000 . other preselected values will be readily known to those of ordinary skill in the art . the agents useful according to the invention can be used to establish or to re - establish such preselected values , including normal levels . protective levels of hematopoietic cells is the number of cells required to confer clinical benefit to the patient . the required levels can be equal to or less than “ normal levels ”. such levels are well known to those of ordinary skill in the art . for example , a protective level of neutrophils is above 1000 , preferably , at least 1500 . according to another aspect of the invention , the agents useful herein can be applied at doses below those which were described in the prior art . in particular , it has been discovered unexpectedly that the agents of the invention can be administered in doses less than 1 mg / kg body weight per day . in particular , the agents of the invention have been used successfully at levels of 0 . 1 mg / kg body weight per day , which is one order of magnitude below the teachings of the prior art . as will be readily recognized by those of ordinary skill in the art , this has advantages in that less material is required for treatment , thereby lessening any risk of side effects . likewise , this has advantages in connection with the cost of manufacture of the drug products of the invention . according to another aspect of the invention , better therapeutic results can be achieved when the agents are applied in multiple doses per day . this finding is unexpected and , additionally , it has been found that there is no added medically useful effect when the agents useful according to the invention are administered for lengthy periods of time . thus , it has been discovered , unexpectedly , that only very brief periods of treatment are needed to achieve established therapeutic goals . as described in the examples below , subjects treated with the agents useful according to the invention in 2 doses per day versus 1 dose per day achieved recovery of hematopoietic cells almost 33 % faster than subjects receiving only 1 dose per day . surprisingly , this result did not depend upon the absolute amount of drug given to the subject , but instead related to the number of times the subject was administered the drug . in other words , as shown below , giving twice as much drug , but only once a day , did not speed the recovery of hematopoietic cell number . thus , an aspect of the invention involves giving the agents useful according to the invention in 2 or 3 doses in an 18 hour period . as used herein , an 18 hour period refers in general to the time during which a subject is awake in any 24 hour period ; it is intended to indicate 2 doses per day , 3 doses per day , and the like . according to still another aspect of the invention , it has been discovered unexpectedly that the agents useful according to the invention need be administered for fewer days than expected according to the prior art . in particular , in the mouse models employed , there was very little difference in the speed of recovery of hematopoietic cell count and in the ability to reestablish normal levels of hematopoietic cells when treatment was 3 days , versus 4 days , versus 5 days . it is believed , therefore , that when applied to humans , a complete drug treatment will involve 7 days or less , more preferably 6 days or less , more preferably 5 days or less , more preferably 4 days or less , and even more preferably 3 days or less . as a result , the invention therefore provides kits which contain complete treatment packages for restoring hematopoietic cell count , which kits are described in greater detail below . according to another aspect of the invention , the time that a subject has an abnormally low level of hematopoietic cells resulting from treatment with a hematopoietic cell inhibitor is shortened . it has been discovered , unexpectedly , that the agents used according to the invention stimulate growth factor production by stromal cells . for example , granulocyte colony stimulating factor ( gcsf ) production by stromal cells is stimulated . gcsf acts to drive specifically neutrophil - lineage differentiation . it does not affect the differentiation or proliferation of other committed hematopoietic cells , including other granulocytes , such as eosoniphils , basophils , mast cells and macrophages . ( it is known to act synergistically , however , in vitro with other cytokines to affect proliferation of pluripotent stem cells , though the in vivo importance of this observation is not known ). because stromal cells are not rapidly dividing cells and are not generally adversely impacted by hematopoietic cell inhibitors , the agents useful according to the invention can be applied to subjects substantially simultaneously with or even prior to treatment with a hematopoietic cell inhibitor in order to stimulate stromal cells to produce growth factor which will be readily abundant and helpful in regenerating the hematopoietic cells after treatment by the hematopoietic cell inhibitor . in the prior art , such treatment has been delayed until substantially after treatment with the hematopoietic cell inhibitor . substantially simultaneously with , as used herein , means within 24 hours of treatment with the hematopoietic cell inhibitor . preferably , the agents useful according to the invention are administered within 2 hours of treatment with the hematopoietic cell inhibitor , if they are administered after treatment with the hematopoietic cell inhibitor . if they are administered before treatment with the hematopoietic cell inhibitor , then they are administered close enough in time to the treatment with the inhibitor so that stromal cell production of growth factor is enhanced in the days immediately following treatment with the hematopoietic cell inhibitor . another aspect of the invention involves treatment of a subject to prepare a subject for subsequent treatment with other agents . it has been discovered , unexpectedly , that the agents useful according to the invention stimulate the proliferation of primitive , noncommitted hematopoietic progenitor cells , but not directly the differentiation of committed progenitor cells . it is known in the art that such cells may or may not include cd34 + cells . cd34 + cells are immature cells present in blood products , express the cd34 cell surface marker , and are believed to include a subpopulation of cells with the capacity to self - renew and to differentiate into all of the mature blood cell types . because the agents useful according to the invention stimulate the proliferation of such self - renewing cells , the invention is useful to prepare a subject for treatment with other exogenous growth factors and cytokines which in turn result in the differentiation of such uncommitted progenitor cells into committed progenitor cells . likewise , the agents useful according to the invention can be administered to a subject to expand in the subject hematopoietic cells and to mobilize such cells , prior to extracting the cells from the subject for transplantation or re - infusion . such cells may be used for research purposes or can be treated ex vivo or reintroduced into the subject with or without expansion in vitro . the agents useful according to the invention can be administered in conjunction with exogenous growth factors and cytokines which are specifically selected to achieve a particular outcome . for example , if it is desired to stimulate a particular hematopoietic cell type , then growth factors and cytokines which stimulate proliferation and differentiation of such cell type are used . thus , it is known that interleukins - 1 , 2 , 3 , 4 , 5 , 6 , 7 , 9 , 10 , 11 , 12 , 13 and 17 are involved in lymphocyte differentiation . interleukins 3 and 4 are involved in mast cell differentiation . granulocyte macrophage colony stimulating factor ( gmcsf ), interleukin - 3 and interleukin - 5 are involved in the eosinophil differentiation . gmcsf , macrophage colony stimulating factor ( mcsf ) and il - 3 are involved in macrophage differentiation . gmcsf , gcsf and il - 3 are involved in neutrophil differentiation . gmscf , il - 3 , il - 6 , il - 11 and tpo are involved in platelet differentiation . flt3 ligand is involved in dendritic cell growth . gmcsf , il - 3 , and erythropoietin are involved in erythrocycte differentiation . finally , the self - renewal of primitive , pluripotent progenitor cells capable of sustaining hematopoiesis requires scf , flt3 ligand , g - csf , il - 3 , il - 6 and il - 11 . various combinations for achieving a desired result will be apparent to those of ordinary skill in the art . because the agents useful according to the invention stimulate primitive , non - committed hematopoietic progenitor cells , they can be used in connection with any of the foregoing categories of agents to stimulate specifically the proliferation of a particular hematopoietic cell type . the foregoing factors are well known to those of ordinary skill in the art , and most are commercially available . the invention also lends itself to a variety of in vitro uses . hematopoietic progenitor cells are preserved or expanded , or their colony forming unit potential increased , in vitro . one benefit that can be obtained according to the invention is the stimulation of hematopoietic progenitor cells by the agents useful according to the invention . another benefit that can be obtained is the effect that the agent can have on stromal cells used in in vitro culturing of hematopoietic progenitor cells . in vitro culturing of hematopoietic cells is often carried out in the presence of stromal cells . hematopoietic progenitor cells typically will not survive , proliferate or differentiate for very long periods of time in vitro without appropriate growth factor support . stromal cell layers are used to supply such growth agents to cultured hematopoietic cells , either by culturing the hematopoietic progenitor cells in vitro with such stromal cells or by supplying the hematopoietic progenitor cells with stromal cell - conditioned medium . the agents useful according to the present invention can be used to treat such stromal cells to cause the stromal cells to manufacture and release growth factors . the incubation of stromal cells with the agents useful according to the invention and in medium is for a period of time sufficient to allow the stromal cells to secrete factors into the medium . the medium then can be used to supplement the culture of hematopoietic progenitor cells and other hematopoietic cells . the culture of hematopoietic cells is with media which is conventional for culturing cells . examples include rpmi , dm , iscoves , etc . the conditions for such culturing also are known to those of ordinary skill in the art . the conditions typically refer to a combination of parameters ( e . g . temperature , co 2 and o 2 content , nutritive media , etc .). the time sufficient to increase the number of cells is a time that can be easily determined by a person skilled in the art , and can vary depending on the original number of cells seeded and the amount added of growth factors and agents useful according to the invention . the colony forming potential of hematopoietic uncommitted progenitor cells can be increased by in vitro culturing of hematopoietic cells . the cells can be obtained from any blood product or organ containing cells of hematopoietic origin . crude or unfractionated blood products can be enriched for cells having hematopoietic progenitor cell characteristics in ways well known to those of ordinary skill in the art , prior to or after culture with the agents useful according to the invention . a particularly important aspect of the invention is in the use of the agents for treatment of neutropenia . a combination of unexpected results makes the invention particularly useful in the treatment of neutropenia . firstly , the agents according to the invention can stimulate the proliferation of uncommitted progenitor cells . secondly , the agents according to the invention also stimulate stromal cells to make gcsf , which is the growth factor critical in the differentiation and production of neutrophils per se . thus , the patient has the dual benefit of stimulation of progenitor cells and differentiation of those cells into neutrophils using the agents useful according to the invention . similar effects are shown with erythrocytes and platelets . thus , treatment to restore neutrophils , erythrocytes and platelets form an independent and distinct aspect of the invention , based on the unexpected findings described above . the invention also involves kits for housing an entire medicinal course of treatment for a hematopoietic cell deficiency such as neutropenia . as discussed above , it has been discovered surprisingly that the number of doses per day and the number of doses overall affect favorably the recovery of hematopoietic cells after treatment with a hematopoietic cell inhibitor . these unexpected findings lend themselves to the development of a medicinal dispenser which houses an entire medical course of treatment using the agents useful according to the invention . patient compliance therefore will be enhanced , and an entire prescription can be contained in a single package . ordinarily , a pharmacist individually fills a dispenser unit with a medicament once the pharmacist receives a doctor &# 39 ; s prescription . because the dispenser of the invention includes an entire medicinal course of treatment and can always include a specific number of solid oral dosage forms , the package can be pre - filled with the appropriate number of units of medicament for treatment for a particular medical purpose . the medicinal dispenser is a package defining a plurality of medicinal storage compartments , each compartment for housing an individual unit of medicament . an entire medicinal course of treatment is housed in a plurality of medicinal storage compartments . a package defining a plurality of medicinal storage compartments may be any type of disposable pharmaceutical package or card which holds medicaments in individual compartments . preferably the package is a blister package constructed from a card , which may be made from stiff paper material , a blister sheet and backing sheet . such cards are well known to those of ordinary skill in the art . fig1 shows a medicinal dispenser ( 1 ) for housing a preferred entire medicinal course of treatment for neutropenia . the day indicia ( 2 ) indicate which day the individual units of medicament are to be taken . these are marked along a first side of the medicinal package . the dose indicia ( 3 ) is marked along a second side of the medicinal package perpendicular to the first side of the medicinal package and indicates the time which the individual unit of medicament should be taken . the unit doses ( 4 ) are contained in the dispenser which is a blister pack . this particular package shows a 5 day course of treatment , with 2 doses per day . the pharmaceutical preparations , as described above , are administered in effective amounts . the effective amount will depend upon the mode of administration , the particular condition being treated and the desired outcome . it will also depend upon , as discussed above , the stage of the condition , the age and physical condition of the subject , the nature of concurrent therapy , if any , and like factors well known to the medical practitioner . for therapeutic applications , it is that amount sufficient to achieve a medically desirable result . in some cases this is any increase in hematopoietic cell count or mature blood cell count . in other cases , it will be an increase to a preselected level . the invention is useful in one aspect to ameliorate the effects of treatment with a hematopoietic cell inhibitor . if the agents are used prophylactically , they can decrease the amount of hematopoietic cells that would be lost in the subject versus the amount lost if the subject were treated with the inhibitor but not with the agent . if used prophylactically or acutely , the agents can shorten the time for recovery of a hematopoietic cell - type to at least protective levels , and preferably to normal levels , versus the length of time which would pass before protective or normal levels were achieved if the subject were treated with the inhibitor but not with the agent . generally , doses of active compounds of the present invention would be from about 0 . 01 mg / kg per day to less than 1 mg / kg per day . a variety of administration routes are available . the methods of the invention , generally speaking , may be practiced using any mode of administration that is medically acceptable , meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects . such modes of administration include oral , rectal , topical , nasal , interdermal , or parenteral routes . the term “ parenteral ” includes subcutaneous , intravenous , intramuscular , or infusion . intravenous or intramuscular routes are not particularly suitable for long - term therapy and prophylaxis . they could , however , be preferred in emergency situations . oral administration is preferred for the convenience to the patient as well as the dosing schedule . see remington &# 39 ; s pharmaceutical sciences , 18th edition , 1990 , pp 1694 - 1712 ; incorporated by reference ). those of skill in the art can readily determine the various parameters and conditions for producing dosages without resort to undue experimentation . compositions suitable for oral administration may be presented as discrete units , such as capsules , tablets , lozenges , each containing a predetermined amount of the active agent . other compositions include suspensions in aqueous liquids or non - aqueous liquids such as a syrup , elixir or an emulsion . preparations for parenteral administration include sterile aqueous or non - aqueous solutions , suspensions , and emulsions . examples of non - aqueous solvents are propylene glycol , polyethylene glycol , vegetable oils such as olive oil , and injectable organic esters such as ethyl oleate . aqueous carriers include water , alcoholic / aqueous solutions , emulsions or suspensions , including saline and buffered media . parenteral vehicles include sodium chloride solution , ringer &# 39 ; s dextrose , dextrose and sodium chloride , lactated ringer &# 39 ; s or fixed oils . intravenous vehicles include fluid and nutrient replenishers , electrolyte replenishers ( such as those based on ringer &# 39 ; s dextrose ), and the like . preservatives and other additives may also be present such as , for example , antimicrobials , anti - oxidants , chelating agents , and inert gases and the like . lower doses will result from other forms of administration , such as intravenous administration . in the event that a response in a subject is insufficient at the initial doses applied , higher doses ( or effectively higher doses by a different , more localized delivery route ) may be employed to the extent that patient tolerance permits . multiple doses per day are contemplated . the agents may be combined , optionally , with a pharmaceutically - acceptable carrier . the term “ pharmaceutically - acceptable carrier ” as used herein means one or more compatible solid or liquid filler , diluents or encapsulating substances which are suitable for administration into a human . the term “ carrier ” denotes an organic or inorganic ingredient , natural or synthetic , with which the active ingredient is combined to facilitate the application . the components of the pharmaceutical compositions also are capable of being co - mingled with the molecules of the present invention , and with each other , in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy . when administered , the pharmaceutical preparations of the invention are applied in pharmaceutically - acceptable amounts and in pharmaceutically - acceptably compositions . such preparations may routinely contain salt , buffering agents , preservatives , compatible carriers , and optionally other therapeutic agents . when used in medicine , the salts should be pharmaceutically acceptable , but non - pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically - acceptable salts thereof and are not excluded from the scope of the invention . such pharmacologically and pharmaceutically - acceptable salts include , but are not limited to , those prepared from the following acids : hydrochloric , hydrobromic , sulfuric , nitric , phosphoric , maleic , acetic , salicylic , citric , formic , malonic , succinic , and the like . also , pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts , such as sodium , potassium or calcium salts . other delivery systems can include time - release , delayed release or sustained release delivery systems . such systems can avoid repeated administrations of the agent , increasing convenience to the subject and the physician . many types of release delivery systems are available and known to those of ordinary skill in the art . they include polymer base systems such as poly ( lactide - glycolide ), copolyoxalates , polycaprolactones , polyesteramides , polyorthoesters , polyhydroxybutyric acid , and polyanhydrides . microcapsules of the foregoing polymers containing drugs are described in , for example , u . s . pat . no . 5 , 075 , 109 . delivery systems also include non - polymer systems that are : lipids including sterols such as cholesterol , cholesterol esters and fatty acids or neutral fats such as mono - di - and tri - glycerides ; hydrogel release systems ; sylastic systems ; peptide based systems ; wax coatings ; compressed tablets using conventional binders and excipients ; partially fused implants ; and the like . specific examples include , but are not limited to : ( a ) erosional systems in which the agent is contained in a form within a matrix such as those described in u . s . pat . nos . 4 , 452 , 775 , 4 , 667 , 014 , 4 , 748 , 034 and 5 , 239 , 660 and ( b ) difusional systems in which an active component permeates at a controlled rate from a polymer such as described in u . s . pat . nos . 3 , 832 , 253 , and 3 , 854 , 480 . in addition , pump - based hardware delivery systems can be used , some of which are adapted for implantation . use of a long - term sustained release implant may be particularly suitable for treatment of chronic conditions . long - term release , are used herein , means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 30 days , and preferably 60 days . long - term sustained release implants are well - known to those of ordinary skill in the art and include some of the release systems described above . we have demonstrated in a series of in vivo studies that the agent valboropro ( pt - 100 ), has the ability to shorten myelosuppression caused by chemotherapy in mice . in these studies , mice were injected intraperitoneally with a sublethal dose of 220 mg / kg cyclophosphamide ( day 1 ). this treatment reproducibly induced a nadir in blood cell counts by day 4 . after 72 hours ( day 3 ) mice were divided into 3 groups . one group received pt - 100 , at the concentrations indicated , by gavage or by subcutaneous administration ( s . c . ), one group received g - csf by s . c . injections and the third group received saline as a control , either by oral gavage or by s . c . injections . g - csf was used at 0 . 04 ug / dose ( 4 μg / kg / day ) which is the dose frequently used in published reports studying the g - csf effects in mice and is also the equivalent dose used in cancer patients . all administrations were performed twice daily ( b . i . d .) for 5 consecutive days or as indicated . blood samples were taken from individual mice on day 4 - 8 , and in some experiments on days 13 or 17 . at each time pont four or five test animals were sampled . total and differential white blood cell counts of gimsa - stained blood smears were performed . for data presented in fig2 cyclophosphamide treated mice received 0 . 1 μg , 2 μg or 5 μg / b . i . d . of pt - 100 or saline by oral gavage twice daily for 5 consecutive days starting on day 3 post cyclophosphamide treatment and continuing through day 7 . in mice that received 2 or 5 μg / b . i . d . pt - 100 recovery of neutrophils reproducibly preceded recovery of saline treated mice by 1 or 2 days , while 0 . 1 μg / b . i . d . of pt - 100 did not significantly enhance neutrophil recovery over saline . normal levels of absolute neutrophil counts ( anc ) were reached on day 5 for mice receiving 2 μg or 5 μg / b . i . d . of pt - 100 , while saline treated mice did not reach normal levels until day 7 . on day 5 mice had received a total of 4 doses of pt - 100 ( on days 3 and 4 ). additional administration of pt - 100 on days 5 , 6 and 7 caused a further increase in anc . the effect of pt - 100 on neutrophil recovery when administered by s . c . route was very similar to that seen when administered orally . for data shown in fig3 mice were injected s . c . with doses of pt - 100 ranging from 1 to 20 μg / b . i . d . for 5 days and blood cell counts determined on days 4 through 8 , and on day 17 . for mice receiving 5 μg , 10 μg , or 20 μg / b . i . d . pt - 100 , neutrophil recovery was accelerated over that observed in the saline treated mice . a dose of 1 μg / b . i . d . pt - 100 did not show much effect . after termination of treatment with pt - 100 , in conclusion , pt - 100 accelerates neutrophil regeneration in cyclophosphamide treated mice . g - csf is currently used to accelerate neutrophil recovery in cancer patients undergoing chemotherapy . the effects of g - csf in mice are well established and can be used as a reference for elucidating the mechanism by which pt - 100 stimulates hematopoiesis in mice . fig4 shows data from an experiment in which the effects of pt - 100 and g - csf on neutrophil regeneration are compared . cyclophosphamide treated mice were administered 2 μg / b . i . d . of pt - 100 by gavage or 0 . 04 μg / b . i . d . of g - csf ( the dose equivalent used in patients and most commonly used in published reports for murine studies ) by subcutaneous injections for 5 consecutive days starting on day 3 . blood cell counts were performed on days 4 - 8 , and on day 13 . pt - 100 and g - csf treated mice stimulated neutrophil regeneration to a similar level during the treatment period . after treatment was stopped , anc decreased to normal counts by day 13 . although pt - 100 has a very similar effect on neutrophil reconstitution , the mechanism of action is different from that of g - csf . not only does pt - 100 target a different cellular receptor ( cd 26 ), it also has been shown to stimulate growth of early human hematopoietic progenitor cells which are not affected by g - csf . to determine the dose numbering of administration for optimal recovery of neutrophils , pt - 100 , at indicated doses , was administered s . c . to cyclophosphamide treated mice , either once or twice per day over a five day period , starting on day 3 post cyclophosphamide treatment . as shown in fig5 for both doses , a twice daily administration resulted in a faster rate of neutrophil recovery to higher neutrophil levels than once per day administration . in the experiments described above mice had been treated with pt - 100 for 5 consecutive days . to determine whether a shorter period of treatment with pt - 100 was sufficient for the recovery of neutrophils 5 μg , 2 μg , or 1 μg / b . i . d . ( six hours apart ) of pt - 100 was administered to cyclophosphamide treated mice by gavage for 1 , 2 , 3 , or 5 days starting on day 3 post cyclophosphamide treatment . blood counts were obtained on days 4 through 8 . administration of pt - 100 for one day was sufficient to cause an accelerated reconstitution of neutrophils over saline treated animals . however , additional administrations of pt - 100 for 2 or 3 days increased the rate of recovery even further . data for the 5 μg dose are shown in fig6 . continued administration of pt - 100 for a total of 4 or 5 days does not significantly increase the rate of neutrophil recovery or the anc over that achieved with 3 day administrations ( data for 2 μg / b . i . d . are shown in fig7 ). results shown in fig6 and 7 indicate that the pt - 100 effect on the regeneration of neutrophils occurs early during treatment and continues until anc between 1000 and 1400 are achieved . repeated administrations affect the kinetics of neutrophil restoration during the early period but does not significantly alter the anc reached after 3 days of administration . in conclusion , pt - 100 accelerates neutrophil reconstitution over that seen with saline even after a one day of treatment . an accelerated reconstitution of neutrophils is obtained with each additional day of treatment for up to three days . a fourth or fifth day of treatment did not significantly increase anc or the kinetics of reconstitution . hematopoiesis is sustained by a pool of hematopoietic stem cells ( hscs ) that can self - renew and differentiate into hematopoietic progenitor cells ( hpcs ). hpcs are committed to specific lineages which can be identified based on their colony morphology when grown in semi - solid media in vitro , typically over a 2 week period . the colonies grown in the semi - solid colony assay are functionally defined as colony - or burst - forming units and include bfu - e and cfu - e ( cells committed to the erythroid lineage ), cfu - gm ( cells committed to the granulocytic / monocytic lineage ), bfu - mk and cfu - mk ( cells committed to the megakaryocyte lineage ) and cfu - gemm ( multipotent progenitors ). although the semi - solid colony assay is a valuable tool to identify factors , such as g - csf , which affect terminal differentiation , it does not assess the proliferative potential or self renewing properties of the primitive hematopoietic progenitor cells ( phpcs ) ( dexter , t . a . et al ., acta hemat . 62 : 299 - 305 ( 1979 ); chen , b . p . et al ., immunological reviews : 15 7 : 41 - 51 ( 1997 )). an assay to evaluate the effect of a compound or of growth factors on phpcs was first described by dexter ( dexter t . m . et al , j . cell . physiol . 91 : 335 - 344 ( 1977 )), and combines the long - term culture ( ltc ) with the semi - solid colony assay . ltc is initiated over a pre - formed stromal cell layer which provides the necessary hematopoietic growth factors . it has been used extensively for the in vitro examination of murine and human hematopoiesis and to evaluate the ability of test compounds to generate ltc - ics . the effect of pt - 100 on growth of human hematopoietic cells was examined in the 2 week cfu and the 4 and 5 week ltc assays using human bone marrow , apheresed peripheral blood or umbilical cord blood cells . pt - 100 did not stimulate the generation of cfus in the 2 week semi - solid assay , indicating that pt - 100 does not affect the differentiation of committed progenitor cells into mature blood cells . it also suggests , that the mechanism and the cellular targets for pt - 100 for the stimulation of neutrophil regeneration in vivo is different from that of g - csf which has been shown to stimulate cfu formation in this assay . in the ltc assays , which test for effects on early progenitor cells , pt - 100 significantly increased the growth of very early progenitor cells from all three cell sources . moreover , the data suggest that the effect of pt - 100 is on phpcs as increases in ltc - ics were observed at 4 weeks ( fig8 ) 5 weeks and 6 weeks ( data not shown ) in culture . at this time less primitive hematopoietic progenitor cells have undergone terminal differentiation and lost the ability to form colonies in semi - solid cultures . for the ltc assays , cd34 + cells were isolated by positive selection from human bone marrow cells , apheresed peripheral blood or umbilical cord blood using a mac separation system . to establish a stromal feeder layer , human bone marrow cells were cultured in myelocult long term culture medium for 2 weeks . one day prior to use , the adherent stromal cells were cultured overnight with indicated concentrations of pt - 100 in ltc medium and irradiated . isolated cd34 + cells were overlaid onto the stromal cell layer and incubated for 30 days in the absence or presence of indicated amounts of pt - 100 . medium and pt - 100 was exchanged every three days thereafter . at the end of the culture period the culture was assayed for progenitor cells by plating in semi - solid medium ( methylcellulose ) supplemented with growth factors ( stem cell factor , gm - csf , il - 3 and erythropoietin ). the total number of myeloid , erythroid , blast forming and multilineage clonogeneic progenitors ( colonies cfu - gm , cfu - e , bfu - e and cfu - gemm , respectively ) were determined after 14 days in methylcellulose culture . data showing in fig8 for a human bone marrow culture indicate that during a 4 week ltc assay , pt - 100 increased , in a dose dependent manner , the number of clonogeneic progenitors which are able to form colonies in semi - solid medium . this suggests that pt - 100 stimulates growth of primitive hematopoietic progenitor cells . in similar fashion cd34 + cells purified from apheresed peripheral blood or umbilical cord blood were cultured on irradiated primary stromal cells for 30 days . as had been observed with bone marrow cells , pt - 100 increased the number of 4 and 5 week ltc - ics from peripheral and umbilical cord blood to very similar levels , indicating the pt - 100 is able to stimulate primitive hematopoietic progenitor cell growth from these cell sources as well ( data not shown ). human bone marrow cells were enriched for cd34 + cells and 200 cd34 + cells per well were incubated in serum free x - vivo 15 medium ( biowhittaker ) with or without the indicated concentrations of pt - 100 for 4 hours at 37 ° c . the pre - incubated cd34 + cells were added to 0 . 9 % methylcellulose in iscove &# 39 ; s mdm containing sub - optimal concentrations of recombinant human growth factors ( 5 ng / ml stem cell factor , 1 ng / ml gm - csf , 1 ng / ml il - 3 , 0 . 3 units / ml erythropoietin ( stem cell technologies vancouver , bc ). pt - 100 was added to the medium at the same concentrations used for the pre - incubation . the methylcellulose mixture was plated in duplicate in 35 mm dishes and incubated for 14 days at 37 ° c . progenitor colonies ( cfu - e , cfu - gm , cfu - gemm and bfu - e ) were counted under an inverted microscope . pt - 100 did not stimulate differentiation of these committed progenitor cells . 6 - 8 week old female balb / c mice were administered either saline or pt - 100 twice daily for 5 days at the indicated doses via either subcutaneous injection or oral gavage . on the sixth day the animals were sacrificed and their spleens were excised using sterile procedures . the spleens were disrupted to produce single cell suspensions which were subsequently treated with a solution of tris ammonium chloride ( ph 7 . 2 ) to lyse erythrocytes . the resulting splenocyte populations were in a hemocytometer and resuspended at 5 × 10 6 cells / ml in iscove &# 39 ; s modified eagles medium ( imdm ) supplemented with 2 % heat inactivated fetal calf serum . 0 . 3 ml of each splenocyte solution was added to 3 ml of methocult ™ gf m3434 ( stem cell technologies , vancouver , bc , canada ), a methylcellulose medium containing recombinant cytokines used for colony assays of murine progenitor cells . the medium was vigorously mixed and then 1 . 1 ml of the mixture was placed in duplicate onto sterile 35 mm diameter culture dishes , resulting in 5 × 10 5 splenocytes / plate . the plated cells were incubated at 37 ° c . under humidified conditions in 95 % air / 5 % co 2 for 7 days . cfu - e were enumerated as per the manufacturers specifications after 2 days , while bfu - e , cfu - gm and cfu - gemm were enumerated after 7 days . for each mouse , the absolute cfu / spleen were calculated using the total splenocyte count determined in the hemocytometer . the data shown in fig9 represents the mean ± sd cfu / spleen from 3 mice in each dosing group . pt - 100 stimuated hematopoiesis for all progenitor colony types tested . pt - 100 induces production of g - csf from human bone marrow stromal cells mononuclear cells were purified from bone marrow and cultured long - term culture medium , ( stem cell technologies , inc ., vancouver , b . c .) for 2 weeks , with a single feeding of fresh medium after 1 week . the established stromal cells were removed by trypsin - edta digest and seeded into a 35 mm tissue culture plate at 10 6 cells per well in 1 ml of medium containing 10 − 5 m pt - 100 or medium alone as control . culture media were collected on day 1 . supernatants were assayed for human g - csf using a quantikine high sensitivity immuno - assay kit ( r + d systems , minneapolis , minn .). fig1 depicts the effect of pt - 100 on the production of g - csf by cultured human stomal cells . pt - 100 stimulates production of g - csf by such cells . the manufacture of l - val - r - boropro is described in a number of published procedures ( kelly , t . a ., et al . j . am . chem . soc . 1993 . 115 : 12537 - 12638 ; coutts , s . j ., et al ., j . med . chem . 1996 . 39 : 2087 - 2094 ; beak , p ., et al ., tetrahedon letters , 1989 , 30 : 1197 ; bean , f . r ., et al ., j . amer . chem . soc . 1932 . 54 : 4415 ). pure isomers are preferred . see also u . s . pat . nos . 4 , 935 , 493 and 5 , 462 , 928 , the disclosures of which are incorporated here by reference . while the invention has been described with respect to certain embodiments , it should be appreciated that many modifications and changes may be made by those of ordinary skill in the art without departing from the spirit of the invention . it is intended that such modifications , changes , and equivalents fall within the scope of the following claims .

US-87879201-A

a parts feeding apparatus is disclosed for use in feeding a supply of garment appliance parts such as buttons , hooks , slide fastener component parts and the like from parts reservoirs or parts feeders through a plurality of feed chutes onto a parts applying holder . the feed chutes each carrying thereon an array of parts of different types and colors are pivotally movable in the same plane into and out of an operative position relative to the parts applying holder , in which position the parts are selectively transferred onto the holder .

referring now to the drawings and fig1 in particular , there is shown a parts feeding apparatus generally designated 10 which comprises a plurality of parts feeder 11 , 12 storing therein garment appliance parts of different types or colors such as bottom end stops p for a slide fastener and equipped with for example with vibrating bowls 13 , 14 , respectively , for orienting a multiplicity of end stops p into aligned arrays for gravity sliding movement in and along a plurality of feed chutes 15 . the parts feeders 11 , 12 are conventional and well known and hence will require no further explanation . only two of feed chutes 15 are shown for purposes of illustration but they may be as many as operationally feasible for feeding garment parts which are shown conveniently to be bottom end stops p having different forms or colors . the illustrated bottom end stop p has a cross sectionally &# 34 ; h &# 34 ; configuration with upper and lower arms p1 and p2 which are clamped by a punch 100 onto a fastener stringer f as shown in fig1 and 11 . the end stop p is secured in place at a bottom end portion of the fastener stringer f as shown in fig1 , so as to restrict the movement thereat of a slider not shown in a manner well known in the art . the color of the end stop p may be gold or silver , as a matter of example , to be harmonious with the color of a row of fastener coupling elements e . now , there are illustrated two parallel feed chutes 15a and 15b each having a straight vertical portion 16 , an arcuate portion 17 merging integrally therewith and a track 18 extending longitudinally centrally of and through both portions 16 and 17 for slidably receiving and transporting bottom end stops p supplied from the respective parts feeders 11 and 12 . each of the feed chutes 15a and 15b is pivotally connected at its one or upper end to a support frame 60 by means of a pivotal pin 19 extending through and interconnecting a support bracket 20 , to which the chute 15a 15b ) is secured , as better shown in fig3 . the chute 15a and 15b are moved pivotably or rockably about their respective pins 19 in the same plane by means of a chute drive means 21 . as shown in fig6 the drive means 21 is preferably in the form of a pneumatically operated cylinder 22 having a piston rod 23 operatively connected to a connecting bracket 24 . a stroke of the piston rod 23 is determined such that the feed chutes 15a , 15b are selectively moved in either direction into and out of operative position relative to a parts applying holder later described . the other or lower end of each of the feed chutes 15a and 15b is connected to a chute holder 25 which is in turn connected at one of its ends by a pin 26 to the connecting bracket 24 . each chute holder 25 has a first cavity 27 defined by upper and lower horizontal walls 28 and 29 having concavely contoured or arcuate surfaces 28 &# 39 ; and 29 &# 39 ; and a second cavity 30 defined by two parallel vertical walls 31 and 32 . a guide block 33 secured to the support frame 60 is provided with a guide roll 34 receptive in the first cavity 27 and slidably engageable between the arcuate surfaces 28 &# 39 ; and 29 &# 39 ; of the chute holder 25 and further with an integral downwardly projecting lug 35 receptive in the second cavity 30 and slidably engageable between the vertical walls 31 and 32 of the chute holder 25 as the latter is moved by the drive means 21 . the arcuate surfaces 28 &# 39 ; and 29 &# 39 ; of each chute holder 25 have a radius of curvature corresponding to the distance between the guide roll 34 and the pivotal pin 19 to which the feed chute 15 is pivotally connected , such that the feed chute 15 can move pivotally or rockably with a minimum of frictional resistance . designated at 36 is a retainer arm extending midpart between the chute holder 25 and pivotally connected at one of its ends through a pin 37 to a support block 38 . the retainer arm 36 has a hook portion 39 at its other or free end disposed in alignment with the track 18 of the feed chute 15 for releasably holding a leading one p &# 39 ; of bottom end stops p in a row transported on the feed chute 15a or 15b . a vertical operating rod 40 has one or lower end thereof connected by a pin 41 to the retainer arm 36 and a compression spring 42 wound thereon for normally urging the retainer arm 36 counterclockwise to hold its hook portion 39 in abutting relation to the leading bottom end stop p &# 39 ; as shown in fig7 . a parts applying holder 43 is vertically movable and comprises a first vertical guide member 44 having a horizontally projecting jaw 45 at its lower end and secured to a casing 46 and a second vertical companion guide member 47 vertically movable relative to the first guide member 44 and having a clamping surface 48 at its lower end which defines with the jaw 45 a parts transfer pocket 49 ( fig7 and 8 ) for releasably holding a bottom end stop p . the second guide members 47 is resiliently held by a pair of springs 50 , 50 accommodated in brackets 51 , 51 secured to the casing 46 as shown in fig9 . a horizontally extending lever 52 is pivotally connected by a pin 53 and has an offset abutment 54 at one of its ends which is engageable with an abutting lug 55 formed on the second guide member 47 of the parts applying holder 34 . the other or opposite end of the lever 52 is connected to a vertical parts pusher 56 having a presser foot 57 resiliently held relative to the feed chute 15 by means of a compression spring 58 , the arrangement being that when the parts applying holder 43 is moved upwardly from the position shown in fig7 to the position in fig8 by a pneumatic cylinder or other suitable drive means not shown , the abutting lug 55 abuts against the offset abutment 54 thereby allowing the lever 52 to rotate clockwise about the pin 53 and hence urging the pusher 56 downward against the tension of the spring 58 , whereupon the presser foot 57 engages and pushes forward the row of bottom end stops p on the chute 15 and at the same time the vertical operating rod 40 is urged downward in contact with the lever 52 , allowing the retainer arm 36 to rotate clockwise with its hook portion 39 lifted apart from the leading bottom end stop p &# 39 ;. this permits the leading bottom end stop p &# 39 ; to move into the pocket 49 of the parts applying holder 43 as shown in fig8 . this is followed by descending the parts applying holder 3 back to the position of fig7 in which the pocket 49 registers with the path of fastener stringer chain f , whereupon the bottom end stop p in the pocket 49 is transferred and clamped onto the chain f as illustrated in fig1 - 12 . selective feeding and application of parts , i . e . bottom end stops p for slide fasteners , are effected by actuating the chute drive means ; namely , the cylinder 22 so that forward and reverse strokes of its piston rod 23 bring the beed chutes 15a and 15b alternately into operative position relative to the parts applying holder 43 as shown in fig4 and 5 in which the leading bottom end stop p &# 39 ; is transferred onto the pocket 49 of the parts applying holder 43 . the stroke of the piston rod 25 is of course variable in accordance with the number of feed chutes 15 to be installed as appears obvious to those skilled in the art . obviously , various modifications and variations of the present invention are possible in the light of the above teaching . it is therefore to be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described .

US-57548890-A

a new and distinct variety of walnut rootstock denominated ‘ vx211 ’ is described . this new variety , ‘ vx211 ’, can be propagated through standard tissue culture micropropagation or rooted cuttings . ‘ vx211 ’ has vigor and survivability in the nursery and in the orchard . it has reduced susceptibility to damage from nematodes compared to other ‘ paradox ’ rootstock . ‘ vx211 ’ also has reduced susceptibility to damage from phytophthora citricola in greenhouse screens and in the field compared to other ‘ paradox ’ rootstock .

the new rootstock of the present invention was selected as part of the “ paradox diversity study ” ( pds ) which was initiated in 1996 to study the genetic diversity of commercial ‘ paradox ’ sources . the study included approximately 300 – 500 seeds each ( depending on the predicted percent ‘ paradox ’), from 37 black walnut sources of ‘ paradox ’ provided by california walnut nurseries , and seven controlled crosses made in davis , calif . and open - pollinated controls from different juglans species . seeds were germinated and grown at 3 different nurseries for one year and then seedlings were distributed to cooperating researchers for tests of response to nematodes , phytophthora ( seed supplied ), crown gall ( agrobacterium tumefaciens ) and the field environment ( field trials ). the study was repeated in 1997 . the rootstock of the present invention was evaluated for response to nematodes in 1998 along with 9 siblings and the remaining rootstock families . one - year old seedlings were planted on 1 . 2 or 1 . 8 meter spacing with 3 . 35 meter centers . the field test site was infested with a single population of root lesion nematode ( p . vulnus ) originally placed on site in 1976 . at planting time seedlings were inoculated with additional p . vulnus . each fall 20 grams of root tissue were collected from each tree . these roots were placed in a mist chamber for 5 days for nematode extraction and nematodes / gram root was calculated . in july 1998 it was evident that one seedling (‘ vx211 ’) was more vigorous than the others , but in the fall the nematodes were abundant on the roots of ‘ vx211 ’. in july 1999 roots were collected and again nematodes were found to be abundant , but the seedling ‘ vx211 ’ continued to be more vigorous than the other seedlings in spite of the nematodes . due to its apparent superiority it was transplanted to a “ mother block ” at an agriculture center in parlier , calif . in winter 2000 – 2001 propagating wood was collected . ‘ vx211 ’ was propagated by hardwood cuttings . additionally , ‘ vx211 ’ was asexually reproduced by standard tissue culture micropropagation in davis , calif . in 2002 a “ stock block ” was established in davis , calif . with 6 trees of ‘ vx211 ’ as well as other promising selections . propagation of ‘ vx211 ’ both by standard hardwood cuttings and by standard tissue culture micropropagation was successful . from november 2002 to october 2003 , 212 ‘ vx211 ’ plants were micropropagated , rooted in gelled medium and acclimatized in the greenhouse ; 153 ( 72 %) survived . when rooted ex vitro , 126 / 184 ( 68 %) survived . hardwood cuttings rooted between 73 % ( 11 / 15 ) to 87 % ( 13 / 15 ). by november 2003 there were 187 available for field trials and 60 available for phytophthora screening . in march 2004 , 48 plants of the ‘ vx211 ’ clone and a standard ‘ paradox ’ (‘ ax1 ’) were evaluated for additional nematode screening and comparison . these were planted in 1 / 100 th acre macroplots . the macroplots had concrete sides 1 . 5 meter deep into the soil with open bottoms and were nematode - free . ‘ vx211 ’ and ‘ ax1 ’ were planted side by side in 48 separate macroplots infested with 0 , 1 , 20 , or 500 p . vulnus nematodes per 250 cc of soil . tree diameters and number of nematodes on the roots were determined 2004 – 2006 ( fig1 ). nematodes built up quickly but ‘ vx211 ’ was 30 % taller in the first year and the diameter of ‘ vx211 ’ was significantly greater than ‘ ax1 ’ in all three years ( fig1 ). the vigor of ‘ vx211 ’ under pressure from nematodes suggests that ‘ vx211 ’ has a means to avoid or escape severe damage from nematodes . in spring 2004 , 106 plants of ‘ vx211 ’ produced through standard tissue culture micropropagation were planted in a nursery along with over 1800 plants of 17 different clones . at the end of the growing season ‘ vx211 ’ was the most vigorous of all clones ( table 1 ) demonstrating that propagation is true - to - type through successive generations . eighty - two percent were graftable and the mean diameter was 31 mm at 5 cm from the soil surface . graftable trees were distributed for grafted field trials in 5 different orchards in replant situations in 2005 . grafting posed no problem and ‘ vx211 ’ is considered compatible with english walnut scions . it is a typical ‘ paradox ’ in that respect . in addition , 30 each of 11 different genoptypes including ‘ vx211 ’ were planted in may 2005 in davis , calif . for artificial inoculation with phytophthora citricola . a randomized block split plot design was used . for each rootstock clone , there were six four - tree plots to be infested and six single - tree plots to serve as non - infested controls . northern california black ( juglans hindsii ) and wingnut ( pterocarya stenoptera ) were included as susceptible and resistant controls , respectively . in january 2006 , 100 ml of a v8 juice - oat mixture infested with phytophthora citricola was mixed into the upper 5 cm of soil around the trunk of each tree . a sterile mixture was applied to the uninoculated controls . early results from several of the grafted field trials are shown ( fig2 – 4 ; table 2 ). in all cases ‘ vx211 ’ was one of the superior clones . the block artificially inoculated with phytophthora was assessed for growth in trunk circumference and development of crown rot as indicated by trunk cankers extending up from the soil surface in november 2006 . sixty - two percent of the susceptible controls were rotted or dead . the uninoculated controls of ‘ vx211 ’ were the most vigorous trees in the block apart from the wingnut controls . no cankers were found on ‘ vx211 ’ or many of the other clones , however the phytophthora inoculation did appear to depress growth somewhat in ‘ vx211 ’ ( table 3 ). simultaneously with field trials , greenhouse trials were carried out to assess the relative susceptibility of ‘ vx211 ’ and other selected clones to phytophthora citricola . standard phytophthora screening methods were used . clonal selections including ‘ vx211 ’ were micropropagated , rooted , acclimatized and chilled , and at 2 – 6 months were transplanted to pots of artificially inoculated soil . four isolates of p . citricola from different districts of california were used to infest the soil . the isolates were grown in separate jars of v8 juice - oat - vermiculite substrate for one month , mixed in equal proportions and mixed in the soil ( 40 ml inoculated substrate per liter of soil ). starting two weeks after transplanting , all plants received 48 - hour periods of soil flooding every two weeks . three months after transplanting , soil was washed from the plants and the incidence and severity of crown rot were determined . one selected clone , ‘ vx211 ’ consistently showed moderate resistance . the results from 2006 trials are shown in fig5 . this description is based on the original selection of ‘ vx211 ’, ungrafted , at ten years of age , a 3 - year old ungrafted tree in phytophthora field screen , and a greenhouse - grown plant at 6 months of age . figures are also shown of a grafted ‘ vx211 ’ tree . data for the botanical description were collected in spring 2007 . the munsell color charts for plant tissues ( 1977 . gretagmacbeth , new windsor n . y .) is used in the identification of color . also , common color terms are to be accorded their ordinary dictionary significance , ‘ vx211 ’ differs from its female parent by having fewer leaflets / leaf , broader leaflets and hybrid vigor . ‘ vx211 ’ differs from its male parent by having more leaflets / leaf and hybrid vigor . ‘ vx211 ’ does not differ substantially from other similar hybrids except in its superior performance under adverse soil conditions as described in the “ background of the invention ”. plant : the growth habit of the tree is illustrated in fig6 . this 10 year old tree is approximately 7 . 3 meters in height with a canopy diameter of approximately 5 meters . the trunk circumference at 1 . 2 meters above ground level is about 0 . 61 meters . the bark and year - old branches are light brown ( 2 . 5y 7 / 2 ) ( fig7 ). new shoots are green ( 5gy 7 / 6 ). lenticels ( approximately 12 per 2 . 5 square cm ) are slightly lighter than the bark ( 2 . 5y 8 / 2 ). the 3 year old trees are 4 . 3 – 4 . 9 meters tall ( fig8 ). the bark is brownish - green ( 2 . 5gy 5 / 8 ) with scattered ( 22 / 2 . 5 square cm .) buff - colored lenticels ( 7 . 5yr 8 / 2 ) ( fig9 , 10 ). the six month old greenhouse grown tree is about 35 cm . tall and the main stem is about 1 cm . in diameter ( fig1 ) and green ( 5gy / 10 ). lenticels about 0 . 5 mm long are more dense at the base of the plant and are a buff color ( 2 . 5y 8 / 4 ). graft take is in the normal range for seedling ‘ paradox ’ walnuts ( fig1 ). foliage : the slightly pubescent new spring foliage has a reddish hue to it ( 10r 4 / 8 ), darkest towards the tip ( fig1 and 14 ) turning green ( 5gy 5 / 6 ) as the leaves get older . the leaves are smooth and the margins are entire ( not serrate ). the leaves are pinnately compound with 13 – 15 leaflets . the mature leaves of the 6 month old plant have 9 – 11 leaflets and are 30 cm long and 23 cm wide . the number of leaflets may vary depending on the age and size of the plant . the upper leaf surface is bright green and the same color as the stem ( 5gy 5 / 10 ) ( fig1 ). the lower surface is slightly duller ( 5gy 6 / 6 ) ( fig1 ). the leaflets are about 5 cm wide and 14 cm long with a petiole 4 – 8 cm long . inflorescence : no catkins or female flowers appeared in the first 10 years . the tree is probably male sterile as is typical with juglans hindsii × juglans regia hybrids . no nuts were observed . disease resistance and susceptibility : this rootstock is typical of other juglans hindsii × juglans regia hybrids except that it possesses higher vigor and ability to survive heavy nematode loads . it is also less susceptible to phytophthora citricola than other similar hybrids . usage : the new rootstock of the present invention provides walnut growers with a new clonally propagated ‘ paradox ’ rootstock . it can be easily micropropagated . 1 all trees were planted may 2005 . the assessments of crown rot and mortality were made 21 nov . 2006 . means within a column and without letters in common are significantly different ( waller k ratio ).

US-82184407-V

a cooker for continuous grilling of hamburger patties and the like uses a shiftable grid which intermittently lifts the patties off a stationary grid and effects advancement after each lift - off until a u - shaped path is traversed extending initially through and terminating beyond one end of the cooker exteriorly thereof . the patties travel upwardly along a straight line with respect to a first pair of legs of the grids and then upwardly and arcuately with respect to a pair of first grid quadrants , whereupon they invert and drop such as to travel upwardly and arcuately with respect to a pair of second grid quadrants . finally , the patties travel upwardly along a straight line with respect to a pair of legs of the grids forming the final stretch of the travel .

in the embodiment of fig1 - 8 , a cooker 18 for broiling food items 20 , such as hamburger patties ( fig1 - 16 ), has a kettle 22 supported by legs 24 and carrying a cover 26 through use of hinges 28 . after the items 20 enter one end of the kettle 22 , they are advanced continuously by intermittent pulses along a u - shaped path and before emerging from the same end of the kettle 22 , they are broiled on both sides as the result of being continuously subjected to heat thereabove emanating from electric heaters 30 carried by the cover 26 therewithin . flipover of the items 20 midway their travel ( fig1 - 16 ) occurs automatically as hereinafter explained . a primary , stationary grid 32 has a u - shaped configuration to present a first elongated leg 34 which receives the items 20 exteriorly of the kettle 22 for advancement through an opening 36 in one end 38 of the kettle 22 . the grid 32 has a semi - circular bight 40 at the opposite end 42 of the kettle 22 , made up of a first quadrant 44 , as a continuation of the leg 34 , and a second quadrant 46 from which a second leg 48 extends , terminating outside the kettle 22 after passing through the opening 36 , rendering the cooked items 20 accessible . the leg 48 is a continuation of the quadrant 46 and is disposed in spaced parallelism to the leg 34 . the leg 34 and its quadrant 44 slope upwardly as the end 38 of the kettle 22 is approached whereas the leg 48 and its quadrant 46 slope upwardly as the end 38 of the kettle 22 is approached , with the two u - shaped heaters 30 sloping accordingly ( fig1 ). the straight terminal ends of the quadrants 44 and 46 extend radially inwardly of the u - shaped end 42 with such end of the quadrant 44 spaced above the end of the quadrant 46 ( fig1 - 16 ). the grid 32 is removably supported by the kettle 22 through use of open top , notched lugs 50 rigid to the kettle 22 and by an upstanding tubular assembly 52 extending through the bottom of the kettle 22 at the axis of the bight 40 . each leg 34 , 48 has a plurality of spaced , longitudinal rod elements 54 rigidly interconnected by cross bars 56 , the latter of which rest in the lugs 50 . the quadrant sections 44 and 46 have arcuate rod elements 58 joined by cross bars 60 at the terminal ends thereof , the bars 60 being supported by lugs 50 at the center of the wall 42 and by the assembly 52 . a u - shaped secondary grid 62 , shiftable up and down intermittently relative to the grid 32 is provided with sloping legs 64 and 66 corresponding to the legs 34 and 48 respectively and a bight 68 corresponding to the bight 40 . and , as in the case of the grid 32 , the bight 40 has a pair of sloping sections 70 , 72 in the form of quadrants corresponding to the quadrants 44 and 46 respectively . once again , as shown , the removable legs 64 , 66 have straight , spaced , parallel rod elements secured to cross bars , and the removable quadrants have arcuate rod elements secured to cross bars . however , each leg 64 , 66 has a pair of separate , end - to - end parts , and the quadrants 70 , 72 are separate from each other and from the legs 64 , 66 . each leg 64 , 66 is supported by a pair of elongated , inclined , spaced , walking beams 74 extending from the exterior of the kettle 22 and through the opening 36 , terminating adjacent the assembly 52 . the upper edges of the beams 74 are notched to receive the cross bars of the legs 64 , 66 and each beam 74 has a pair of spaced supporting members 76 depending therefrom . a motor 78 has a driveshaft 80 rotatably suspended from the bottom of the kettle 22 and provided with a pair of bevel gears 82 . each of the four driven eccentric shafts 84 , rotatably suspended from the bottom of the kettle 22 and corresponding with the members 76 , is provided with a bevel gear 86 . two of the eccentric shafts 84 radiate from the shaft 80 in one direction and have their gears 86 in mesh with corresponding gears 82 , whereas another pair of the eccentric shafts 84 radiate in the opposite direction from the shaft 80 and also have their gears 86 in mesh with corresponding gears 82 . thus , the eccentric shafts 84 on one side of the shaft 80 are rotated in one direction and the opposite pair of eccentric shafts 84 are driven in the opposite direction by the shaft 80 during operation of the motor 78 . each member 76 has a circular hole rotatably receiving eccentric portion 87 of the shaft 84 ( fig1 ). accordingly , the beams 74 and their legs 64 , 66 travel through essentially circular paths . the leg 64 rises , progresses toward the quadrant 44 , descends and regresses toward the end 38 during each cycle . simultaneously , the leg 66 rises , progresses toward the end 38 , descends and regresses toward the quadrant 46 . the rods of the legs of the grid 62 interleave with the rods 54 of the legs 34 , 48 such that , during each cycle , the legs of the grid 62 rise above the legs 34 , 48 to raise the items 20 off the legs 34 , 48 . after the items 20 on the leg 34 are raised they are advanced toward the quadrant 44 and then set back onto the leg 34 . conversely , after the items 20 on the leg 48 are raised they are advanced toward the end 38 and then set back onto the leg 48 . manifestly , such intermittent movement of the items 20 toward and away from the bight 40 takes place during each cycle of the beams 74 . incidentally , slots 88 in the bottom of the kettle 22 for clearing the members 76 are best shown in fig1 and 3 , and slots 90 ( fig4 ) in the end 38 clear the beams 74 . not shown are two brackets which extend upwardly from the bottom of the kettle 22 for supporting the two lugs 50 shown in fig2 between the legs 34 and 48 . referring now in more detail to the assembly 52 , especially fig5 - 8 , there is provided an outer , upright tube 92 , open at both ends and extending through the bottom of the kettle 22 , to which the tube 92 is firmly attached . bearings 94 in the tube 92 surround a vertically reciprocable , inner tube 96 which is oscillatory about its upright axis of reciprocation . the tube 96 is so moved by the continuation of shaft 80 passing through diametrically opposed clearance openings 100 in the tube 92 . the tube 96 has an oblong hole 102 with its major axis disposed vertically and an opposed , oblong hole 104 having it major axis disposed horizontally . a rotor 106 engaging the tube 96 in the hole 102 is eccentric to and rigid to the shaft 80 , and a rotor 108 engaging the tube 96 in the hole 104 is eccentric to and also rigid to the shaft 80 . a third tube 110 is an upper contination of the tube 96 , although separate therefrom , and a fourth tube 112 is surrounded by the tubes 96 and 110 . a fifth tube 114 is disposed in the tube 110 at the upper end of the latter . a knurled cap 116 has an inner flange 118 loosely fitted into the tube 114 and a bolt 120 rigid thereto and threaded into a bar 122 extending across the tube 112 and notched at its ends into the tubes 96 and 112 . fasteners 124 attach a closure plate 126 for the bottom of the tube 112 to the bar 122 . notches are illustrated in fig5 - 7 for releasably receiving certain components of the grid assemblies 32 and 62 . the tube 112 has a number of such notches 128 at its upper edge for receiving the cross bars of the quadrant 72 which are , in turn , cleared by notches 130 in the tube 110 . the tube 110 is also provided with notches 132 in its upper edge which correspond to notches 133 in tube 114 for receiving the cross bar at the terminal end of the quadrant 70 . the outer tube 92 has notches 134 and 135 at its upper end which receive the proximal bars 56 and 60 respectively of the leg 34 whereas the cross bar 56 of the leg 48 is received in a long notch 136 in the tube 92 . therefore , the grids 32 and 62 may be removed from the kettle 22 by first turning the cap 116 to release the bolt 120 from the bar 122 . then , by slipping the tube 114 from within the tube 110 , the quadrant 70 is released from the notches 132 and 133 . next , the tube 110 may be slipped off the tube 112 to clear the notches 128 and 130 such as to release the quadrant 72 , and the leg 34 as well as the quadrant 48 can be readily removed from the notches 134 and 136 . the legs 34 and 48 are simply lifted out of the lugs 50 and the legs 64 and 66 are lifted off the beams 74 . a predetermined , elevated temperature is produced in the cooker 18 by use of a suitable control for the heaters 30 , and a desired speed of rotation of the shaft 80 is selected by a suitable control for the motor 78 . the food items 20 placed on the leg 34 of the grid 32 exteriorly of the cooker 18 , are advanced through the opening 36 of the kettle 22 , and cooking continues until they exit through the opening 36 on the leg 48 outside the wall 38 . rotation of the shaft 80 causes the shafts 84 to rotate through the gears 82 and 86 causing rotation of all four eccentric shafts 84 in their corresponding members 76 . each time the leg 64 rises and progresses toward the quadrant 70 , the items 20 are raised off the leg 34 and advanced toward the end 42 of the kettle 22 . simultaneously , each time the leg 66 rises and progresses away from the quadrant 72 the items 20 are raised off the leg 48 and advanced toward the end 38 of the kettle 42 . all the while , the shaft 80 rotates the rotors 106 and 108 continuously to oscillate and raise and lower the tube 96 as well as all parts carried thereby . this causes the quadrant 70 to raise the items 20 ( received from the leg 64 ) and carry the items 20 along an arcuate path toward the quadrant 72 . as demonstrated by fig1 - 16 , when the items 20 arrive at the discharge end of the quadrant 70 ( such end extending radially inwardly from the end 42 of the kettle 22 toward the assembly 52 ), they tilt downwardly and then fall upside down onto the lower quadrant 72 as shown by the arrows . immediately , the inverse side of the items 20 begin to cook , such cooking continuing throughout the arcuate movement along the quadrant 72 and the leg 66 . manifestly , the movement of the inverted items 20 along the quadrant 72 until delivered to the leg 66 also results from the rise and fall of the tube 96 by action of the rotor 108 and oscillation of the tube 96 during rotation of the rotor 106 . the up and down and arcuate movement is imparted from the assembly 52 to the quadrants 70 and 72 simultaneously with the quadrant 70 moving arcuately away from the leg 64 and the quadrant 72 moving arcuately toward the leg 66 during travel of the items along the bight 68 . as in the case of the action imparted to the legs 64 and 66 by the beams 74 , the assembly 52 causes the quadrants 70 and 72 to descend below the quadrants 44 and 46 and regress toward the leg 64 and away from the leg 66 during each cycle , depositing the items 20 back onto the quadrants 44 and 46 each time the quadrants 70 and 72 pass beneath the upper surfaces of the quadrants 44 and 46 . during the successive , intermittent advancements of the items 20 along the leg 34 , thence along the bight 40 and finally along the leg 48 , they are continuously cooked on both sides to the extent desired by adjustment of the heaters 30 and / or the speed of the motor 78 prior to successive emergence of the items 20 from the end 38 of the kettle 22 . while conveyance of the items 20 is not continual , there is no pause except somewhat momentarily each time the items come to rest on the grid 32 . a cooker 138 as shown in fig9 - 11 , differs from the cooker 18 of fig1 - 8 only with respect to the nature of the two legs of the stationary grid and of the movable grid . therefore , the same numerals are used with respect to components which are the same in both cookers 18 and 138 . legs 140 and 142 of the stationary grid have rods 144 and 146 rigidly secured to the kettle 22 and extending inwardly from corresponding sides of the kettle 22 . the spaced rods 144 continue from the exterior of the end wall 38 to the quadrant 44 and the spaced rods 146 continue from the quadrant 46 to and through the opening 36 . on the other hand , legs 148 and 150 of the movable grid each have a series of rods 152 and 154 extending toward the sides of the kettle 22 . once again the rods 152 continue through the opening 36 to the quadrant 70 and the rods 154 extend from the quadrant 72 , terminating beyond the end wall 38 . the inner ends of the rods 152 and 154 are secured to corresponding beams 74 carried by members 76 actuated by the motor 78 as above explained . while the cookers 18 and 138 as described above contemplate a stationary grid , e . g . the primary grid 32 and a movable grid , e . g . the secondary grid 62 , it is contemplated that both grids be movable if such is to be desired . it has been fully illustrated and carefully explained above how the grid 62 is caused to be moved in relation to the grid 32 . as an additional embodiment , i contemplate that the grid 32 be moved in the same manner and through use of the same structural components as employed in connection with the grid 62 , and duplication of such components for the grid 32 has not , therefore , been included in the drawings . it is but necessary to further explain that the two movable grids would move alternately such that one would arrive at its greatest height as the other grid arrives at its lowermost position . each grid would advance the product the same distance during each cycle of movement . hence , the speed of advancement of each product would be doubled and , if as such result , the products are not sufficiently cooked by the time they emerge from the cookers 18 or 138 , one need merely reduce the speed of the motor 98 .

US-8283587-A

this disclosure describes a composition and method of magenitic nanoparticles that are bound to a baculovirus . the mnp - bv can be systemically administered to a patient , and a strong magnetic field applied to the target btissue , thus allowing uptake and expression only in the target tissue . off - target effects are not seen because the mnp - bc is inactivated by the complement system outside of the magnetic field .

we have combined two important tools ( crispr and bv ) to develop a novel way of genome editing . in order to overcome serum inactivation of the insect virus , we combine the virus with magnetic nanoparticles , inject or otherwise introduce the virus in vivo , and then subject the target tissue to a strong magnetic field within 30 minutes , preferably within 10 ″, of viral introduction . this allows the virus to escape complement inactivation and allows transient expression of the crispr payload . meanwhile , tissues that are not suject to the magnetic field will not take up virus , because any virus outside the target zone will be inactivated . we have exemplified the method using a cas9 / crispr genomic editing tool , but the method is of broader application and can be used to deliver other genome editing tools or other agents , such as drugs or other dnas or rnas and the like . in more detail , the invention includes any one or more of the following in any combination ( s ) thereof : a ) packaging an expression vector ( v ) encoding a gene editing system ; b ) attaching a plurality of magnetic nanoparticles to said v to make mnp - v ; c ) introducing said mnp - v to a patient having a gene to be edited ; nontargeted tissue , so that the mnp - v are only taken up and expressed in cells in said a ) packaging an expression vector encoding a cas9 or dcas9 protein , single or multiple guide rnas and an optional donor template into a baculovirus vector ( bv ), wherein said guide rna and said optional donor template have homology to one or b ) attaching a plurality of magnetic nanoparticles to said bv to make mnp - bv ; c ) introducing said mnp - bv to a patient comprising said gene ( s ) to be edited ; nontargeted tissue , so that the mnp - bv are only taken up and expressed in cells in said a ) packaging an expression vector encoding a crispr nuclease , single or multiple guide rnas and an optional donor template into a baculovirus vector ( bv ), wherein said guide rna and said donor template have homology to one or more gene ( s ) that is to b ) attaching a plurality of magnetic nanoparticles to said bv to make mnp - bv wherein c ) introducing said mnp - bv to a patient having said gene to be edited ; d ) applying a magnetic field of at least 0 . 1 tesla and 0 . 1 tesla / m to said targeted tissue within 10 minutes of said introducing step c , without applying said magnetic field to nontargeted tissue , so that the mnp - bv are only taken up and transiently expressed in any method herein described , wherein said magnetic field is at least 0 . 1 tesla . any method herein described , wherein said gradient of the magnetic field is at least 0 . 1 any method herein described , wherein said magnetic field is applied within 5 ″, 10 ″, or any method herein described , wherein said magnetic field is applied for at least 30 any method herein described , wherein said mnp : bv ratio is at least 500 : 1 . any method herein described , wherein said guide rna is a synthetic guide rna any method herein described , wherein said magnetic field is at least 0 . 1 tesla and the any method herein described , wherein said expression vector is a baculovirus vector any method herein described , wherein said mnp are made with iron oxide any method herein described , wherein said mnp are made with iron ( iii ) oxide any method herein described , wherein said mnp are made with magnetite crystals of any method herein describes , which is performed on ex vivo tissue rather than a whole a transformed cell or tissue or animal made by the methods herein described . production of bv vector : bv constructs including bv - luc , bv - egfp and bv - crispr , were generated using pfb - cmv - luc , pfb - ef1a - egfp and pfb - ef1a - egfp - u6 - sgrna - cbh - cas9 , respectively , and propagated in sf9 insect cells using the bac - to - bac baculovirus expression system ( thermo fisher ) according to the distributor &# 39 ; s protocol . synthesis of mnps : magnetic iron oxide nanoparticles ( mnps ) were synthesized according to previously published protocols 29 , 30 . in brief , magnetite nanocrystals were synthesized through thermodecomposition of iron ( iii ) acetylacetonate ( fe ( acac ) 3 , sigma ) in benzyl ether using oleic acid ( sigma ) and oleylamine ( sigma ) as the capping molecules . as - synthesized nanocrystals were subsequently coated with dspe - mpeg2000 ( avanti lipids ) and dspe - peg - maleimide ( avanti lipids ) at a molar ratio of 9 : 1 using a dual solvent exchange method . to conjugate tat peptides to the surface of mnps , freshly coated mnps were mixed with cys - tat peptides ( cgygrkkrrqrrr , genscript ) at a molar ratio of 1 : 400 in pbs and incubated overnight . unconjugated tat peptides were removed by washing the nanoparticles with deionized water in centrifugal filter tubes ( cutoff mol . wt .= 100 kda ). the physical properties of the mnps were characterized using transmitted electron microscopy ( tem ), dynamic light scattering ( dls ) ( mobius , wyatt ) and squid ( mpms , quantum design ). in vitro bv transduction : hepa 1 - 6 mouse liver cell line was purchased from atcc ( clr - 1830 ). human umbilical vein endothelial cells ( huvec ) were purchased from lonza ( cc - 2517 ). these cell lines were tested for mycoplasma contamination but not authenticated after receiving them . all cells were cultured according to the standard protocols from the distributors . in a typical in vitro bv transduction experiment , the cells were seeded in a chamber slide . before bv transduction , 2 μl of bv suspension was mixed with 4 μl of mnps for 20 minutes . the cells were then incubated with the mixture for 30 minutes with or without the magnet . in each group , the cells were transduced with bv at an moi of 100 pfu per cell unless otherwise specified . after transduction , the cells were incubated with fresh medium . after 24 hours post transduction , luciferase activity was measured using an in vitro luciferase kit in a microplate reader ( one - glotm luciferase assay system , promega ). egfp fluorescence was examined using flowcytometry or fluorescence microscopy . in vitro gdna analysis : hepa 1 - 6 cells were seeded in chamber slides and transduced with bv or mnp - bv as discussed above . genomic dna was extracted from treated cells with a dneasy blood and tissue kit ( qiagen ). the amplicon containing the crispr cutting site was amplified with the indicated primers ( f : cccccattcgctagtgtgta ( seq id no : 1 ); r : agcacggagtgattgatgcc ( seq id no : 2 )) using platinum ® pcr supermix high fidelity kit ( invitrogen ). the pcr products were purified with a pcr purification kit ( qiagen ) and denatured , reannealed and digested with a t7e1 nuclease ( new england biolabs ). the fragments were examined by gel electrophoresis in 1 . 5 % agarose gel . cytotoxicity study : hepa 1 - 6 cells were cultured in 96 - well plates and incubated with bv at designated mois with or without mnps for 12 hours . after treatment , the cells were incubated in fresh medium for 3 days and cell viability was evaluated by mtt assay . in brief , mtt was dissolved in sterile pbs at 5 mg / ml and added to the culture medium at 20 μl per well . after 4 hour incubation , the supernatant was removed and dmso was added to the cells at 150 μl per well to dissolve the formazan generated by the cells . the optical density of the solutions was measured at 490 nm using a microplate reader . immunostaining : the cells were seeded in chamber slides and incubated with bv or mnp - bv under designated conditions . after treatment , the cells were fixed in 4 % paraformaldehyde for 20 minutes , permeabilized with pbs containing 0 . 1 % triton for 3 minutes and blocked with 5 % bsa for 1 hour at room temperature . bv was detected by incubating the cells with an antibody against vp39 ( the late capsid protein of bv , kindly provided by prof . loy volkman and dr . taro ohkawa ) overnight at 4 ° c . followed by an alexa fluor 647 goat anti - mouse igg antibody ( abcam ) 35 . after that , the cells were stained with hoechst 33342 ( thermo fisher ) and alexa fluor 488 phalloidin ( thermo fisher ). the images were acquired with a confocal microscope ( zeiss lsm 710 ). in vivo bv transduction : all animal studies were approved . athymic nude mice ˜ 25 g body weight were purchased from charles river . c3 knockout mice were purchased from the jackson laboratory . the mice were randomly allocated to the experimental groups ( n = 3 per group ) without blinding . the mice were injected with bv ( 10 9 pfu ) with or without mnps ( 0 . 1 mg fe ) dispersed in 200 μl sterile pbs through the tail vein . injected mice were placed on an n52 grade ndfeb block magnet ( l × w × h = 1 ″ ½ ″× ½ ″) ( k & amp ; j magnetics ) for one hour under anesthesia ( fig6 b ). the magnetic field and the magnetic force exerted on individual mnps were simulated with comsol multiphysics ( fig9 ). to examine the luciferase activity resulting from bv transduction , each mouse was injected with in vivo luciferase substrate ( promega ) intraperitoneally ( i . p .) and imaged using an ivis kinetic iii live imaging system ( perkin elmer ). to examine the outcomes of genome editing , organs were harvested at 1 or 4 days after injection of baculovirus . individual liver cells were isolated from the liver tissue using liver dissociation kit ( miltenyi biotec ). genome editing was evaluated with next generation sequencing using the following primers : f — tgaaagaacacccaagggagg ( seq id no : 3 ) and r — gggacggagaaggagtctgt ( seq id no : 4 ). to examine the in vivo toxicity of mnp - bv , vital organs and blood were harvested from treated mice after 10 days post injection . the organs were fixed in 10 % formalin solution overnight and embedded in paraffin . histology evaluation was performed in tissue sections stained with hematoxylin and eosin . alanine transaminase ( alt ) and aspartate aminotransferase ( ast ) levels in the blood were measured using the alt elisa kit ( biocompare ) and ast colorimetric kit ( biovision ) respectively , according to the manufacturer &# 39 ; s instructions . statistics : spss statistics ( spss ) was used for all calculations . data was analyzed using student &# 39 ; s t - tests or one - way anova and post hoc multiple comparison tests . the difference with p & lt ; 0 . 05 was considered statistically significant (* denotes p & lt ; 0 . 05 ; # denotes p & lt ; 0 . 01 ). recombinant bv was produced as described above . magnetic iron oxide nanoparticles ( mnps ) that can bind to bv were synthesized in three steps . first , magnetite nanocrystals were synthesized through thermodecomposition of iron acetylacetonate in benzyl ether 29 . as - synthesized nanocrystals were 15 . 5 ± 1 . 1 nm in diameter and had a saturation magnetization of 87 . 2 emu / g , similar to that of bulk magnetite . water - dispersible mnps were then generated by coating the nanocrystals with copolymers of phospholipid and poly ( ethylene glycol ) using a dual solvent exchange method 25 to form micelles around the crystals . mnps were then conjugated with the tat peptide , a positively charged peptide that can attach to the bv surface ( fig3 a ) 30 , 31 . however , this step is optional as the mnps were sufficient to protect and deliver the bv to the cells without the tat . tat peptide conjugation to mnp was confirmed by zeta potential measurements and dna retardation assay . when tat - conjugated mnps were mixed with bvs in phosphate buffered saline ( pbs ), multiple mnps could attach to a single bv to form the bv - mnp hybrid , presumably due to electrostatic interactions ( fig3 a ). mnps can disperse in aqueous buffers with negligible magnetic interactions , but upon exposure to a magnetic field , they migrate against the field gradient as nanomagnets . in this study , the magnetic field was generated by using ndfeb magnets with a residual induction of 1 . 48 tesla ( see fig9 ). when a mixture of bv and mnp were infused through a silicone tubing at physiologically relevant flow rates , more than 50 % of bv could be captured by a block magnet placed next to the tubing , as determined by a viral titration assay . this suggests that hybrids of bv and mnp were formed and that the block magnet was effective in attracting the bv - mnp complex to a specific location . we next investigated the effect of nanomagnets on the interactions of bv with cultured hepa 1 - 6 cells , which are known to have high bv infectibility 32 . bv alone exhibited negligible attachment to the cell surface as examined by immunostaining with the anti - vp39 antibody , which detects a bv capsid protein ( fig3 b ) 33 , 32 . in contrast , with the applied magnetic field , a large amount of mnp - bv complexes became attached to the cell surface and entered the cytoplasm after 10 min incubation ( fig3 b ). tem images of cell cross - sections show co - existence of mnp and bv in the lysosomes , indicating cellular internalization of the mnp - bv hybrids . to examine the effect of nanomagnets on bv - induced transgene expression in vitro , bv - luc and bv - egfp , containing luciferase and egfp plasmids respectively , were constructed ( fig4 a ). bv - egfp was mixed with mnps , and the mixture was incubated with hepa 1 - 6 cells under a magnetic field for 30 minutes . we found that under the applied magnetic field , the bv - mnp complex induced higher egfp expression compared with bv alone ( fig4 b ). when bv - egfp was mixed with mnps labeled with a fluorophore , dii ( a fluorescent lipophilic cationic indocarbocyanine dye , ex / em = 549 / 565 nm ), mnps could be observed in perinuclear vesicles in the cells that had a strong egfp expression , indicating that mnps enhanced bv uptake , and without interfering its endosomal escape ( fig4 c ). the bv transduction efficiency was determined by quantifying luciferase activity in the cells incubated with bv - luc ( fig2 d ). we found that mnps or the magnetic field alone did not affect the transgene expression . having mnps mixed with bvs and applying magnetic field could increase the bv transduction by 2 . 4 fold compared with that by bv alone . no significant cell death was found following bv treatment , even at an moi of 500 , nor for the cells incubated with mnp - bv at different concentrations . the results shown in fig4 were obtained with an mnp to bv ratio of ˜ 10 4 : 1 in the mnp - bv mixture , so the vast majority of mnps were not attached to bv . using mnps without the tat peptide conjugation , we also found that nanomagnets alone could enhance the cellular uptake of bv as well as bv - luc induced transgene expression ( data not shown ). the transduction efficiency of bv increases with the ratio between mnp and bv , the strength of the magnetic field and the incubation time ( see fig8 ). it has been shown that cellular uptake of bv is mediated by actin filaments in the cells 25 . we consistently found that hepa 1 - 6 cells treated with cytochalasin d , an actin depolymerization agent , showed disrupted actin filament structure and reduced bv uptake compared to control cells ( not shown ). however , subsequent use of mnps together with the applied magnetic field could partially restore actin filament formation and bv uptake . these results suggest that the increase in the cellular uptake of mnp - bv complexes may be due to magnetic force - induced mechano - transduction that involves actin filaments 19 , 34 . this result is quite surprising , as one might have predicted that the magnetic field effect was the result of local increases in the concentration of bv . however , if that were true , then increasing the concentration of bv should improve efficacy and it did not ( data not shown ). to determine if mnps can protect bvs from serum inactivation similar to that of polymer coating or ligand displaying 22 , 24 , 25 , we performed bv transduction in a culture medium containing 50 % of adult mouse serum ( ams ), which contains the complement system to inactivate bv . when the cells were incubated with bv alone , bv transduction was abolished by ams as indicated by the negligible luciferase expression in the cells ( fig5 a ). neither mnps nor the applied magnetic field alone could rescue bv - luc transgene expression . in contrast , in the presence of the applied magnetic field , bv - luc associated with mnps gave a high level of luciferase expression in hepa 1 - 6 cells . we found that ams had essentially no effect when mnp - bv - luc was used together with an applied magnetic field , however , the transgene expression was greatly suppressed by ams without mnp or magnetic field alone ( fig4 d and 5 a ). these results indicate that mnps coupled with the magnetic field induce a rapid cellular uptake of bv , suggesting a drastically increased kinetic process for bv transduction that outpaced ams - induced bv inactivation . we also investigated if the serum inactivation and magnetic activation could be combined to provide spatial control of bv transduction . cells in a chamber slide were incubated with mnp - bv - egfp in the presence of ams ; only half of the chamber was placed on a block magnet . we found that after 12 hours post transduction , most egfp - positive cells were in the area above the magnet ( fig5 b ). as further proof , an artificial vein was created by growing a layer of endothelial cells in a silicone tubing . the mnp - bv - egfp vector in culture medium containing ams was infused into the tubing at a flow rate of 7 mm / s . a section of the tubing was placed along a block magnet during the infusion . after overnight incubation , we found that only the cells in the tubing next to the magnet showed egfp fluorescence ( data not shown ), further demonstrating the ability to provide accurate spatial control of bv transduction . it was been well established that bv administrated intravenously can circulate throughout the body , where the complementary factor c3 in the blood will bind to circulating bv and initiate molecular events that lead to bv inactivation ( fig2 , ( 1 )) 26 . in contrast , a magnetic field applied to target cells can drive mnp - bv toward cell surface and enhance its cellular uptake with faster kinetics , which overcomes bv inactivation by the complementary factor c3 ( fig2 , ( 2 )). once inside the cell , mnp - bv can escape from endosomes and releases its genomic content into the cytoplasm ( fig2 , ( 3 - 4 )). for in vivo genome editing , the released pdna will express encoded grna and cas9 in transduced cells ( fig2 , ( 5 - 6 )). therefore , magnetic activation of bv will enable selective in vivo genome editing in just those tissues exposed to the applied magnetic field . we tested this nanomagnet - based approach for localized gene editing in live mouse liver , which can be readily targeted with a block magnet applied externally . mnp - bv carrying the plasmid encoding luciferase ( fig6 a ) was administrated systemically through tail vein injection , and the mouse was positioned on top of a block magnet for 1 hour belly side down ( fig6 b ). the transgene expression was evaluated by examining the luciferase activity with live animal imaging . consistent with the results from our in vitro studies , the mice treated with mnp - bv - luc and subjected to an applied magnet field showed strong luminescence in the liver , whereas there was no luminescence in the mice treated with bv - luc alone , or with mnp - bv - luc but without applying a magnetic field ( fig6 c - d ). ex vivo examination confirmed that the high luciferase expression was only in the liver tissue exposed to the magnetic field ; other vital organs including heart , lung , spleen and kidney did not show luminescence signal ( fig6 e - f ). the level of luciferase expression in the liver also increased with the strength of the magnetic field ( not shown ). importantly , the luciferase expression in mouse liver lasted less than 48 hours , and the mnp - bv - luc did not induce significant acute liver damage ( not shown ). these results confirm that the nanomagnets induced transgene expression in vivo can be switched on remotely and locally , and the expression is transient , resulting in good spatiotemporal control . further , the components of the method do not appear to be toxic . to further demonstrate the spatiotemporal control of in vivo genome editing , we integrated the cassettes encoding egfp , the streptococcus pyogenes ( spy ) cas9 , and grna targeting mouse vegfr2 gene into one plasmid for bv packaging , thanks to its large dna loading capacity (& gt ; 38 kb ) ( fig7 a ). the fluorescence from egfp was used to determine the transduction efficiency and isolate transduced mouse cells . when delivered as plasmid and using the bv - crispr vector respectively into mouse hepa 1 - 6 cells , the crispr / cas9 system had cutting efficiencies of 9 - 30 % of the mouse vegfr2 gene ( not shown ). when hepa 1 - 6 cells were incubated with the mnp - bv vector carrying crispr / cas9 ( mnp - bv - crispr ) in the medium containing 50 % ams , both the egfp expression and the crispr / cas9 induced gene modification rate increased with the strength of the applied magnetic field ( fig7 b ). without applying a magnetic field to overcome bv inactivation by ams , there was no egfp expression or site - specific vegfr2 gene modification in hepa 1 - 6 cells ( fig7 b ). for in vivo genome editing , mice were injected with mnp - bv - crispr and subjected to a magnetic field targeting mouse liver similar to that shown in fig6 b . following the workflow illustrated in fig7 c , after 24 hours post mnp - bv - crispr delivery , the egfp positive cells were harvested from mouse liver and t7e1 assays performed to quantify the gene modification rate . we found that the nanomagnets induced site - specific gene modification in transduced mouse liver cells with a ˜ 50 % indel rate ( fig7 d ), which is higher than that in mouse liver cells treated in vitro with mnp - bv - crispr as a positive control . a representative pattern of the indels at the vegfr2 target locus is shown in fig7 e . our next - generation sequencing analysis suggested that ˜ 86 % of mutations ( 3n + 1 , 3n + 2 ) may lead to a frameshift . in a parallel experiment , mouse organs beyond the range of the magnetic field , including heart , lung , spleen , and kidney , were harvested 4 days post mnp - bv - crispr delivery and the genomic dna was extracted for sequence analysis . no site - specific gene modification was detected in these off - target organs . we also evaluated some of the factors affecting efficiency of the system . the transduction efficiency of mnp - bv increases with the magnetic field strength ( fig8 ). the transduction efficiency also increases as the length of magnetic treatment increases from 5 to 60 minutes , or when the ratio between mnp and bv increases from 500 : 1 to 10 , 000 : 1 . taken together , the results conclusively demonstrate that the mnp - bv system can deliver crispr / cas9 in vivo , and the nuclease activity in target tissues / organ can be induced by an external magnetic field in a site - specific manner . the mnp - bv based delivery system takes advantage of the ability of nanomagnets to overcome bv serum - inactivation locally , thus enabling spatiotemporal control of in vivo genome editing . owing to the large dna loading capacity of bv , this system has the potential to facilitate multiplexed genome editing in vivo . the following references are incorporated by reference herein in its entirety for all purposes : 1 . sander , j . d . & amp ; joung , j . k . crispr - cas systems for editing , regulating and targeting genomes . nat biotechnol 32 , 347 - 355 ( 2014 ). 2 . cong , l . et al . multiplex genome engineering using crispr / cas systems . science 339 , 819 - 823 ( 2013 ). 3 . yin , h . et al . genome editing with cas9 in adult mice corrects a disease mutation and phenotype . nat biotechnol 32 , 551 - 553 ( 2014 ). 4 . swiech , l . et al . in vivo interrogation of gene function in the mammalian brain using crispr - cas9 . nat biotechnol 33 , 102 - 106 ( 2015 ). 5 . cox , d . b ., platt , r . j . & amp ; zhang , f . therapeutic genome editing : prospects and challenges . nat med 21 , 121 - 131 ( 2015 ). 6 . liao , h . k . et al . use of the crispr / cas9 system as an intracellular defense against hiv - 1 infection in human cells . nat commun 6 , 6413 ( 2015 ). 7 . lin , y . n . et al . crispr / cas9 systems have off - target activity with insertions or deletions between target dna and guide rna sequences . nucleic acids research 42 , 7473 - 7485 ( 2014 ). 8 . cradick , t . j ., fine , e . j ., antico , c . j . & amp ; bao , g . crispr / cas9 systems targeting beta - globin and ccrs genes have substantial off - target activity . nucleic acids research 41 , 9584 - 9592 ( 2013 ). 9 . fu , y . et al . high - frequency off - target mutagenesis induced by crispr - cas nucleases in human cells . nat biotechnol 31 , 822 - 826 ( 2013 ). 10 . hsu , p . d . et al . dna targeting specificity of rna - guided cas9 nucleases . nat biotechnol 31 , 827 - 832 ( 2013 ). 11 . lee , c . m ., cradick , t . j ., fine , e . j . & amp ; bao , g . nuclease target site selection for maximizing on - target activity and minimizing off - target effects in genome editing . mol ther 24 , 475 - 487 ( 2016 ). 12 . dow , l . e . et al . inducible in vivo genome editing with crispr - cas9 . nat biotechnol 33 , 390 - 394 ( 2015 ). 13 . nihongaki , y ., kawano , f ., nakajima , t . & amp ; sato , m . photoactivatable crispr - cas9 for optogenetic genome editing . nat biotechnol 33 , 755 - 760 ( 2015 ). 14 . pansare , v ., hejazi , s ., faenza , w . & amp ; prud &# 39 ; homme , r . k . review of long - wavelength optical and nir imaging materials : contrast agents , fluorophores and multifunctional nano carriers . chem mater 24 , 812 - 827 ( 2012 ). 15 . zincarelli , c ., soltys , s ., rengo , g . & amp ; rabinowitz , j . e . analysis of aav serotypes 1 - 9 mediated gene expression and tropism in mice after systemic injection . molecular therapy 16 , 1073 - 1080 ( 2008 ). 16 . yin , h . et al . therapeutic genome editing by combined viral and non - viral delivery of crispr system components in vivo . nat biotechnol 34 , 328 - 333 ( 2016 ). 17 . wang , y . et al . systemic dissemination of viral vectors during intratumoral injection . mol cancer ther 2 , 1233 - 1242 ( 2003 ). 18 . stanley , s . a ., sauer , j ., kane , r . s ., dordick , j . s . & amp ; friedman , j . m . remote regulation of glucose homeostasis in mice using genetically encoded nanoparticles . nat med 21 , 92 - 98 ( 2015 ). 19 . mannix , r . j . et al . nanomagnetic actuation of receptor - mediated signal transduction . nat nanotechnol 3 , 36 - 40 ( 2008 ). 20 . wheeler , m . a . et al . genetically targeted magnetic control of the nervous system . nat neurosci 19 , 756 - 761 ( 2016 ). 21 . sammet , s . magnetic resonance safety . abdom radiol 41 , 444 - 451 ( 2016 ). 22 . airenne , k . j . et al . baculovirus : an insect - derived vector for diverse gene transfer applications . mol ther 21 , 739 - 749 ( 2013 ). 23 . mansouri , m . et al . highly efficient baculovirus - mediated multigene delivery in primary cells . nat commun 7 , 11529 ( 2016 ). 24 . chen , c . y ., lin , c . y ., chen , g . y . & amp ; hu , y . c . baculovirus as a gene delivery vector : recent understandings of molecular alterations in transduced cells and latest applications . biotechnol adv 29 , 618 - 631 ( 2011 ). 25 . kost , t . a ., condreay , j . p . & amp ; jarvis , d . l . baculovirus as versatile vectors for protein expression in insect and mammalian cells . nat biotechnol 23 , 567 - 575 ( 2005 ). 26 . hofmann , c . & amp ; strauss , m . baculovirus - mediated gene transfer in the presence of human serum or blood facilitated by inhibition of the complement system . gene ther 5 , 531 - 536 ( 1998 ). 27 . kaikkonen , m . u ., maatta , a . i ., yla - herttuala , s . & amp ; airenne , k . j . screening of complement inhibitors : shielded baculoviruses increase the safety and efficacy of gene delivery . mol ther 18 , 987 - 992 ( 2010 ). 28 . raty , j . k . et al . enhanced gene delivery by avidin - displaying baculovirus . mol ther 9 , 282 - 291 ( 2004 ). 29 . sun , s . et al . monodisperse mfe2o4 ( m ═ fe , co , mn ) nanoparticles . j am chem soc 126 , 273 - 279 ( 2004 ). 30 . tong , s ., hou , s ., ren , b ., zheng , z . & amp ; bao , g . self - assembly of phospholipid - peg coating on nanoparticles through dual solvent exchange . nano lett 11 , 3720 - 3726 ( 2011 ). 31 . torchilin , v . p . tat peptide - mediated intracellular delivery of pharmaceutical nanocarriers . adv drug deliv rev 60 , 548 - 558 ( 2008 ). 32 . boyce , f . m . & amp ; bucher , n . l . r . baculovirus - mediated gene transfer into mammalian cells . p natl acad sci usa 93 , 2348 - 2352 ( 1996 ). 33 . matilainen , h . et al . baculovirus entry into human hepatoma cells . j virol 79 , 15452 - 15459 ( 2005 ). 34 . romet - lemonne , g . & amp ; jegou , a . mechanotransduction down to individual actin filaments . european journal of cell biology 92 , 333 - 338 ( 2013 ). 35 . danquah , j . o ., botchway , s ., jeshtadi , a . & amp ; king , l . a . direct interaction of baculovirus capsid proteins vp39 and exon0 with kinesin - 1 in insect cells determined by fluorescence resonance energy transfer - fluorescence lifetime imaging microscopy . j virol 86 , 844 - 853 ( 2012 ).

US-201715441089-A

a method and apparatus for preparing a bone graft composite using an infusion chamber . a modular tube having a porous material contained therein and having removable end caps is provided . bone marrow aspirate or other bone morphogenic protein containing suspensions may be infused into the tube . a filter on one end of the tube prevents the fluid from escaping while permitting air to be expelled from the tube as it is filled with bone marrow aspirate . once infused into the tube , the bone marrow aspirate is allowed to settle to a putty or paste - like consistency , the putty and material together forming a bone graft composite .

the present invention relates to a method and apparatus for preparing a bone graft composite . the invention allows the composite to be mixed ( i . e ., infused ) in the operating room , preferably , but not only , using the patient &# 39 ; s own healing potential in the form of bone marrow aspirate , blood or platelet concentrate . like structures are provided with like reference numerals throughout the drawings . as seen in fig1 the apparatus comprises a modular tube 10 having first and second ends , 12 and 14 . the size of the tube 10 is not of particular importance . however , convenient sizes are 7 cc and 15 cc . preferably , the tube 10 is manufactured from a material which is biocompatible and pyrogen - free such as glass , plastic or metal . the tube 10 is filled , either partially or completely , with a porous or non - porous , biocompatible , and implantable material m (“ the material ”). regardless of the amount of material m in the tube 10 , sufficient space should remain in the tube 10 for bone marrow aspirate to be received around the material m in the tube 10 . the inside of the tube 10 and the material m should be sterile . the material m provided within the tube 10 may be any suitable porous or non - porous , biocompatible , implantable material . for instance , the material m may comprise grains of calcium sulfate , calcium phosphate , tri - calcium phosphate , hydroxyapatite , coral hydroxyapatite , demineralized bone matrix , mineralized bone matrix , or biopolymers such as , for example , polylactic acid , polyglycolic acid , polygalactic acid , polycaprolactone , polyethylene oxide , polypropylene oxide , polysulfone , polyethylene , polypropylene , or hyaluronic acid , which may be purified with or without crosslinking , bioglass ( including silica based resorbable bioglasses ) and collagen . while it is desirable that the material m be porous , biocompatible , implantable , the amount of porosity of the material m is not of particular importance . the exact configuration of the material m within the tube 10 is not of particular importance . preferably , the material m comprises a plurality of small pieces . the size and shape of the individual pieces of material m should be such that when bone marrow aspirate is introduced into the tube 10 , the bone marrow aspirate will fill in gaps between the pieces of material m . thus , for example , the pieces of material m may be irregularly shaped as small pebbles or chips or regularly shaped as spheres , pellets , or cylinders . additional products may be added to the tube 10 or to the material m within the tube 10 if desired . these may include , for example , growth factors such as isoforms of platelet derived growth factors ( pdgf ), fibroblast growth factors , epithelial growth factors , isoforms of transforming growth factor beta , insulin - like growth factors , and bone morphogenic proteins . the first and second end caps 16 and 18 are configured for detachable coupling to the first and second ends 12 and 14 of the tube 10 . each of the first and second end caps 16 and 18 is configured for further attachment to another component after attachment to the tube 10 . specifically , the first end cap 16 may be coupled to a syringe 100 ( fig6 b ) and the second end cap 18 may be coupled to a filter 20 . alternately , the first and second end caps 16 and 18 may be coupled to a sealing cap . first and second sealing caps 22 and 24 , such as luer caps , may be provided to seal each of the first and second end caps 16 and 18 . the filter 20 should allow air to be expelled from the tube 10 but should be sufficiently dense to prevent leakage of the bone marrow aspirate , as the bone marrow aspirate is introduced into tube 10 at first end 12 and forced towards second end 14 by the action of the plunger of syringe 100 . [ 0046 ] fig2 is an exploded view of one embodiment of the present invention and particularly shows an exemplary coupling mechanism of each of the components . in this embodiment , the first and second ends 12 and 14 of the tube 10 are threaded . each of the first and second end caps 16 and 18 includes first and second couplings . the first coupling is complimentary threaded to threadably couple with the first and second ends . the second coupling 26 and 28 of the first and second end caps enable further coupling of the end caps to additional components . the second couplings 26 and 28 may be configured as female luer caps . the second coupling of the first end cap may mate with another syringe ( not shown ) or a sealing cap 22 , such as a male luer cap . the second coupling of the second end cap 28 may mate with the filter 20 or a sealing cap 24 , such as a male luer cap . the filter 20 may also provided with a coupling 36 for mating with the sealing cap 24 . first and second washers 38 and 40 may be provided between the first and second ends 12 and 14 and the first and second end caps 16 and 18 to relieve friction , prevent leakage , or distribute pressure . the washers may be metal , rubber , plastic , or any suitable material . [ 0047 ] fig3 illustrates a suitable configuration for an end cap 44 in accordance with the present invention . the end cap 44 may be used as either the first or the second end cap of the apparatus . further , the first and second end caps may be identical or may differ . the end cap 44 is provided with a first coupling 46 and a second coupling 48 . the first coupling 46 is threaded and is designed to mate with threading on the end of the tube 10 . the second coupling 48 is a female coupling and is designed to mate with a male coupling on the filter , a sealing cap ( such as a luer cap ), or a syringe . as seen in fig4 a filter 20 for use with the present invention includes a filter component 50 allowing air to be expelled through the filter but preventing seepage of bone marrow aspirate therethrough . the filter is also provided with first and second couplings 52 and 54 . the first coupling 52 mates with the second coupling of the second end cap . the first coupling 52 may be provided as a male luer fitting . the second coupling 54 for mating with a sealing cap . it is not necessary for a sealing cap to be coupled to the filter . however , it may be desirable to couple the sealing cap to the filter to provide a relatively air tight environment after the air has been expelled from the tube 10 . in the preferred method of the present invention , as shown in fig6 a , bone marrow aspirate a is harvested in accordance with known methodology using a syringe 100 and needle 101 . preferably , the method is performed intraoperatively , harvesting the bone marrow aspirate a from the patient p . bone marrow aspirate a contains plasma , nucleated connective tissue progenitor cells , nucleated hematopoietic cells , endothelial cells , and cells derived from contaminating peripheral blood , including red cells and platelets . since bone marrow aspirate also contains peripheral blood , it may be useful for the bone marrow to be collected in a syringe containing an anti - coagulant . suitable anti - coagulants include , for example , heparin , sodium citrate , and edta . after harvesting of the bone marrow aspirate a , the needle 101 may be removed from the syringe 100 . the apparatus including the tube 10 having first and second end caps 16 and 18 coupled to the first and second ends 12 and 14 thereof , and a filter 20 coupled to the second end cap is then provided for use with the method . the tube 10 includes a porous , biocompatible , implantable material m , as previously described above . sufficient material m is provided to fill the inside of the tube 10 but maintain spaces around the individual pieces of material m . the first end cap 16 is then attached to the syringe 100 having the harvested bone marrow aspirate a therein . this may be done by mating the second coupling 26 of the first end cap 16 to the syringe 100 . by depressing the plunger of syringe 100 , the bone marrow aspirate a from the syringe 100 is forced into the tube 10 , air inside the tube 10 escapes through the filter 20 attached to the second end cap 18 of the tube 10 , and the bone marrow aspirate a seeps in and around the material m within the tube 10 as the bone marrow aspirate a enters the tube 10 from the first end and is forced towards the second end and then stopped by the porosity of the filter , which is such that the bone marrow aspirate a cannot pass there through . additionally , as shown in fig7 typically what occurs is that bone marrow aspirate will be forced back towards the first end of tube 10 and thereby even further mix with material m . furthermore , if the material is porous , the bone marrow aspirate will seep into the pores of the material . given the porosity of the material m , marrow will seep therein and provide a composite graft . however , the material m need not be so porous as to absorb any significant amount of marrow . the syringe 100 may then be removed from the tube 10 if desired . if the syringe 100 is removed from the tube 10 , a sealing cap 32 may be coupled to the first end cap 16 to prevent any leakage of the bone marrow aspirate a from the tube 10 . likewise , once the bone marrow aspirate a is in the tube 10 and air from the tube 10 has been expelled through the filter 20 , the filter 20 may be removed from the second end cap 18 and a sealing cap 24 coupled in its place . alternately , the sealing cap 24 may be coupled directly to the filter 20 or the filter 20 may be left in place without the sealing cap 24 being coupled thereto . if the sealing cap 24 is used , it functions to make the tube 10 relatively airtight after the air has been expelled therefrom . the tube 10 is allowed to rest such that the marrow begins to solidify in and around the material m within the tube 10 . the marrow will primarily solidify around the material m to form a structure around and including the material m . as it solidifies , the marrow will form a putty or paste - like substance . the longer the marrow is allowed to rest , the more firm it will become . once the desired consistency is achieved , the first and / or second end caps 16 and 18 ( and any further components attached thereto ) are removed . the putty substance , together with the material m that was in the tube 10 , comprises a bone graft composite and is then accessible to the surgeon . it may be desirable to force the bone graft composite from the tube 10 using a plunger ( after removing end caps 16 , 18 ) to provide a log of material . alternately , the bone graft composite may be removed piecemeal with , for instance , a scraper . the invention has been discussed primarily with respect to the insertion of bone marrow aspirate into tube 10 . however , the invention is not so limited . for example , any suspension containing bone morphonegenic proteins may be used , whether naturally derived in the form of bone marrow aspirate or genetically created products . furthermore , tube 10 may have inserted therein blood or platelet concentrate , which may be mixed ( infused ) with material m to create a bone graft having the proper consistency as one created with bone marrow aspirate , but where the need for bmps is not paramount . an alternate embodiment of the invention is illustrated in fig5 and comprises a vacutainer 60 in the place of the tube 10 of the first embodiment . the vacutainer 60 has a closed end 62 and an open end 64 . the open end is sealed with a vacuum seal 66 . a suitable porous , biocompatible , implantable material m is provided within the vacutainer 60 . after harvesting of the bone marrow aspirate , the seal 66 is punctured and the bone marrow aspirate is drawn into the vacutainer 60 . the bone marrow aspirate is allowed to rest in the vacutainer 60 . once the desired consistency is achieved , the seal 66 may be removed to allow the surgeon access to the bone graft composite . regardless of the embodiment used , the present invention enables a bone graft composite can be prepared while the patient is in the operating room directly prior to the bone graft placement . while various embodiments in accordance with the present invention have been shown and described , it is understood that the invention is not limited thereto , and is susceptible to numerous changes and modifications as known to those skilled in the art . therefore , this invention is not limited to the details shown and described herein , and includes all such changes and modifications as encompassed by the scope of the appended claims .

US-68228903-A

a stent delivery assembly can include a stent , a tube , a shaft slidably disposed within the tube , and an engagement member on the shaft . the engagement member is operable via the shaft so as to facilitate manipulation of the stent via the shaft . the engagement member can engage the stent inner wall and cooperating with the tube to grip the stent . the shaft is arranged within the tube with a close tolerance between the shaft and the tube so as to provide stability during retraction or advancement of the shaft .

the following detailed description should be read with reference to the drawings , in which like elements in different drawings are numbered identically . the drawings , which are not necessarily to scale , depict selected embodiments and are not intended to limit the scope of the inventions . several forms of inventions have been shown and described , and other forms will now be apparent to those skilled in art . it will be understood that embodiments shown in drawings and described above are merely for illustrative purposes , and are not intended to limit scope of the inventions as defined in the claims that follow . fig1 illustrates a stent delivery assembly including a stent delivery device 20 , a stent 26 , a delivery shaft or tube 22 , and an elongate release member 24 . release member 24 can be used to releasably secure or couple stent 26 to delivery shaft or tube 22 . stent 26 is illustrated in a configuration prior to being everted and proximally disposed about delivery tube 22 . delivery tube 22 may be seen to have a distal region 30 , a distal end 28 , an intermediate region 32 , a tube wall 38 , a tube wall inner surface 36 , and a lumen 34 therethrough . release member 24 may be seen to have a distal region 40 and a distal end 42 having a distal element 43 . in the embodiment illustrated in fig1 , release member distal end 42 is dimensioned so as to form an interference fit between stent 26 and delivery tube wall inner surface 36 . delivery tube wall 38 may be seen to be slightly distended in the area of release member distal end 42 . stent 26 , described with reference to the everted state , has generally a distal region 46 , a distal end 47 , an intermediate region 44 , a proximal region 48 , a proximal end 50 , and a lumen 52 therethrough . release member 24 may be seen , at distal end 42 , to have an outside diameter d 1 which closely approximates the inside diameter of delivery tube 22 in the distal region . stent 26 may be seen gripped between release member distal end 42 and delivery tube 22 . stent 26 , in some embodiments , may be biased to expand radially when unconstrained . as illustrated in fig1 , stent proximal end 50 has an unconstrained diameter d 2 that is substantially larger than the constrained diameter d 1 . self - expanding stents are well known to those skilled in the art . such self - expanding stents may be formed , for example , from nitinol , which can be heat set to assume a desired shape when unconstrained . stent 26 in fig1 is illustrated in an intermediate step during assembly . stent proximal end 50 may be everted and pulled proximally as a sleeve over delivery tube 22 . other methods of assembly are possible . in preferable methods , stent 26 may be heat set in an uneverted shape and disposed as a sleeve over delivery tube distal region 30 in the uneverted state . stent distal region 46 may then be everted and tucked within delivery tube distal end 28 . release member 24 may then have its proximal end threaded through stent lumen 52 and delivery tube lumen 34 until release member distal end 42 has been proximally retracted within delivery tube distal region 28 , firmly capturing stent distal region 46 between the elongate member distal end 42 and the delivery tube distal region 28 . fig2 illustrates stent delivery device 20 further included within a more comprehensive stent delivery assembly 60 . stent delivery assembly 60 includes generally a guide catheter or microcatheter 62 having a distal region 64 , an intermediate region 69 , a proximal region 72 , and a distal end 66 having a lumen 68 therethrough . release member 24 can have an optional collar 51 disposed about the release member distal region and dimensioned to slidably fit within delivery tube 22 . fig2 further illustrates release member 24 having a proximal region 25 coupled to an optional larger diameter proximal end 27 dimensioned so as to form an axially slidable seal between release member proximal end 27 and the surrounding delivery tube proximal region 33 . fig2 also illustrates optional annular seal member 29 forming a larger diameter proximal region 33 for the delivery tube 22 . annular element 29 may be seen to form a slidable seal between delivery tube 22 and the surrounding guide catheter or microcatheter 62 . fig2 also illustrates that stent 26 can expand outward radially while within guide catheter 62 . in particular , stent intermediate region 44 , proximal region 48 , and proximal end 50 may be seen to have expanded radially to the extent permitted by the surrounding guide catheter 62 . the dimensions illustrated for the proximal region of stent delivery assembly 62 and fig2 may vary depending on the embodiment and the intended use . fig2 illustrates only one , non - limiting example of the inventions . microcatheters are well known devices , commonly used to deliver drugs to cerebral arteries . “ microcatheters ”, as the term is used herein , is defined to be a tubular catheter having an outside diameter less than about 5 fr . ( 1⅔ mm .). microcatheters used with the present inventions preferably have an outside diameter between about 1 . 5 fr . ( ½ mm .) and 4 fr . ( 1⅓ mm ), inclusive . microcatheters preferably have a floppy distal region and tip , the distal region being more pliable and softer than the intermediate and proximal microcatheter regions . fig3 illustrates one use of assembly 60 in a body conduit or vessel 82 having a target region 80 at least partially occluded by a blockage 84 . blockage 84 can at least partially block vessel 82 , thereby reducing the effective size of vessel lumen 86 . blockage 84 represents any of a number of blockages , including , but not limited to plaque , thrombus , and a stenosed vessel region generally . in one method according to the present inventions , a guidewire is advanced distally through the vessel until the guidewire distal tip is across or proximally near vessel target region 80 . guide catheter or microcatheter 62 can then be advanced over the placed guidewire until microcatheter distal end 66 is disposed proximal of blockage 84 . in some methods , the guidewire is now retracted proximally from microcatheter 62 . with microcatheter 62 in place , stent delivery device 20 may be advanced through microcatheter lumen 68 to a position within microcatheter 60 proximal of vessel target region 80 . as may be seen from inspection of fig3 , stent 26 is everted over the distal end of delivery tube 22 and releasably secured to delivery tube 22 with elongate release member distal end 42 . in the embodiment illustrated , stent 26 is a self - expanding stent , with proximal end 50 having a larger outside diameter than constrained distal end 47 . with release member 24 , delivery tube 22 , and everted stent 26 in position , the release member , the delivery tube , and the captured , constrained and everted stent 26 may be distally advanced across the target site 80 having blockage 84 . in some methods , the advancing of release member , delivery tube , and everted stent is accomplished while leaving guide catheter or microcatheter 62 positioned proximal of the vessel target site . in other methods , guide catheter or microcatheter 62 is advanced across target vessel region 80 . in one method , microcatheter 62 , everted stent 26 , delivery tube 22 , and release member 24 are all advanced together across target region 80 . in this method , after microcatheter 62 and constrained , everted stent 26 are across target vessel region 80 , microcatheter 62 can be proximally retracted , exposing the stent . as may be seen from inspection of fig3 , stent 26 is still releasably secured to delivery tube 22 and may be further advanced distally . in some uses of the inventions , a microcatheter such as microcatheter 62 may be used to advance the releasably secured stent and delivery tube only so far as the microcatheter can reach , followed by the distal exit of the everted stent from the microcatheter to attain even greater distal reach for the stent . fig3 also illustrates that stent 26 can be axially elongated as the stent is pulled through narrow passages , which can reduce the stent profile while the stent is being pulled . once everted stent 26 is at the desired location , the stent can be released from delivery tube 22 . in one example of the inventions , release member 24 is urged proximally , thereby pulling the release member distal end proximally until release member distal end 42 is disposed proximally of everted stent distal end 47 . stent 26 may then expand further radially to embrace the surrounding vessel target region 80 . in another example of the inventions , elongate release member 24 can be distally urged , thereby forcing release member distal end 42 distally from delivery tube 22 , thereby releasing stent 26 from delivery tube 22 . in embodiments having optional collar 51 , the collar can be used to help push out the stent after release . both distal and proximal movement of release member 24 can be accomplished by manipulating the proximally accessible portion of the release member . stent 26 is then free to radially expand and retain its previous , non - everted shape . it may be seen from inspection of fig3 that everted stent 26 has a smaller distal profile than proximal profile , allowing easier entry into narrow target sites . in some embodiments of the inventions , delivery tube 22 has a tapered distal tip , such that the profile of the distal end of delivery tube 22 is smaller than the profile of delivery tube 22 in an intermediate or proximal location . fig3 also illustrates that the everted distal region 46 of stent 26 forms a rather atraumatic tip , relative to many other distal delivery devices and , in most embodiments , more benign than the delivery tube distal end 28 . due in part to the self - expanding nature of the stent illustrated in fig3 , distally urging the half released , half secured stent forms a proximally widening shape that can act to initially penetrate , then dilate a blocked vessel region , prior to totally releasing the stent . the distance between release member 24 and delivery tube 22 is indicated at d 3 in fig3 . in some embodiments , the proximal and intermediate regions of delivery tube 22 have a very tight fit between release member 24 and delivery tube 22 . a close tolerance between the release member and the delivery tube can provide columnar support for advancing release member 24 . such close tolerance can also provide strength and stability when the elongate release member 24 is retracted proximally to release stent 26 , in embodiments calling for such retraction . fig4 illustrates vessel target region 80 after stent 26 has been expanded to create and stabilize an expanded or dilated flow channel 87 through vessel 82 . stent proximal region 48 and distal region 46 may be seen to have expanded radially against blockage 84 . stent 26 is preferably radially expanded outwardly against the vessel walls and / or blockage once released by release member 24 . in one method , stent 26 is biased to radially expand outwardly , once unconstrained . some self - expanding stents useful with the present inventions are formed of nitinol . stents may be heat - set to radially expand and assume the heat - set diameter once released in some methods . in one method according to the inventions , after stent 26 has been allowed to expand radially , this process may be assisted using parts of the device previously described . in embodiments where the release rod has sufficient strength in compression to be pushed , release member 24 may be advanced distally through deployed stent 26 to ensure that an initial clear flow passage exists through stent 26 . elongate release member 24 may be followed by distally advancing delivery tube 22 through deployed stent 26 . in other methods , guide catheter or microcatheter 62 may be advanced through deployed stent 26 , to further widen the already stented passage . these methods may also be employed to assist with eversion of the distal end of the released but incompletely deployed stent . in some methods , the delivery tube and release member may be retracted proximally , and an inflatable balloon catheter advanced to the now stented vessel site to further dilate the deployed stent by inflating the inflatable balloon disposed in the balloon catheter distal region . fig3 illustrates only one embodiment of the inventions , which is not necessarily drawn to scale . in particular , in some embodiments , the distal region of delivery tube 22 can be significantly smaller in profile . in one embodiment , release member 24 has distal end 42 being substantially smaller in profile than that illustrated in fig3 . in one embodiment , distal end 42 is tapered distally or proximally to facilitate the frictional fit between the stent and the delivery catheter . the inside of the delivery catheter distal region and / or outside of the release member distal end 42 can be coated with a compressible , tacky , flowable , or high friction material to augment the security of reversible stent engagement . in one device , release member distal end 42 is only slightly larger in profile than the intermediate portion of release member 24 . in one embodiment , release member 24 has strength substantially only in tension rather than compression , and acts as a string . this string or wire can be very small in profile , and can be coupled to a very small release member distal element . in one embodiment , elongate release member 24 is a fine gauge wire , metallic or polymeric , coupled to a small distal plug . delivery tube distal end 28 may also be much smaller and significantly distally tapered relative to that illustrated in fig3 . delivery tube distal end 28 may also be reinforced against diametric enlargement by incorporation of a strong circular loop or band within or outside of the wall of the delivery tube distal end . preferably the loop or band is metallic and more preferably radiopaque so as to facilitate visualization under fluoroscopy . inspection of fig3 indicates that the lower limit on the transverse cross - sectional size or profile of the stent delivery assembly may be limited by the profile of the everted stent 26 . in one embodiment of the inventions , elongate release member 24 is effectively a thin wire or string terminating distally in a plug or ball shape only slightly larger in profile than the wire or string . delivery tube 22 may be , significantly distally tapered such that the inside diameter of the delivery tube distal end approaches the outer diameter of the release member distal end or plug 42 . the stent may thus be everted and the stent distal region tightly bunched or gathered together between the small distal ball or plug and the surrounding , tapered , distal end of the delivery tube . while the release member and delivery tube occupy space , it may be seen that the absolute lower limit of the cross - sectional profile in some embodiments may be ultimately bounded by the lower size limit in releasably compressing the stent distal end . fig5 a illustrates another embodiment of the inventions . the stent delivery assembly 100 illustrated in fig5 a can be similar to that of assembly 20 as illustrated in fig1 and 2 . delivery assembly 100 may be seen to have an everted stent 26 and an elongate release member 24 as previously discussed . assembly 100 has a delivery shaft 122 rather than a delivery tube . delivery shaft 122 has an intermediate region 132 extending to a distal region 124 . distal region 124 includes support struts 128 extending distally and radially outward to support a short tube section or annular ring 126 . in some embodiments , annular tube or ring 126 may be significantly longer than that illustrated in fig5 a , which is not necessarily to scale . the distal region of delivery shaft 122 may thus form a delivery tube in the many respects previously discussed . stent 26 may be seen to be everted over distal annular ring or hoop 126 and held in place by a tight , interference fit between release member distal element 43 and annular ring 126 . as may be seen from inspection of fig5 a , everted stent 26 may be released from the assembly 100 by proximally retracting release member 24 or distally extending release member 24 , depending on the embodiment and the properties of the release member shaft forming release member 24 . fig5 b illustrates a transverse cross - sectional view of the assembly 100 of fig5 a , showing release end element 43 disposed within one layer of stent 26 which is in turn disposed within annular ring 126 which has a second layer of stent 26 disposed to the outside . fig5 c illustrates another stent delivery assembly 160 , somewhat similar to that of delivery assembly 100 of fig5 a and having the same reference numerals for similar elements . assembly 160 includes elongate release member 24 and stent 26 as previously discussed . the delivery device includes a distal tube 166 coupled to a proximal elongate member or shaft 162 . tube 166 includes a proximal end 174 , a distal region 170 , a distal end 172 , and a lumen 168 extending through the tube . proximal shaft 162 can be coupled to tube 160 at a shaft distal region 164 . proximal shaft 162 can extend distally along or within tube 166 in some embodiments . tube 166 may be slit to accommodate proximal shaft 162 . stents that may be used with the present inventions include self - expanding and balloon expandable stents , well known to those in the cardiovascular arts . stents may be formed from many of the well known stent materials , including nitinol , stainless steel , and polymers . the stents may be braided , knit , meshed , formed of non - woven wires , helically wound and helically counterwound . stents according to the present inventions are preferably porous , wire , braided stents , with various embodiments having an average pore or inter - wire opening size of at least about 20 microns in one embodiment , and at least 50 microns in another embodiment . in a preferred embodiment the stent ends are coated with flexible adherent material to prevent unraveling of , for example , braided stents . alternatively , the stent strands can be welded or otherwise fastened to one another to prevent unraveling during eversion . in one use of the inventions , the everted stent may be used to stabilize a blockage such as a thrombus , while providing a perfusing path through the dilated thrombus . in another use , the stent may be positioned across a stenosed blood vessel region , and the region treated with a restenosis inhibiting agent . the restenosis inhibiting agent can be infused through the porous stent wall or reside on the stent itself and release into the vessel wall . fig3 and 4 may be used to visualize blockage 84 being formed primarily of thrombus , with stent 26 being put in place to primarily stabilize the thrombus and to provide oxygenating blood flow to downstream brain regions , preventing brain cell death . small distal profile catheters as previously discussed and as illustrated in fig3 may thus be used to advance an everted stent across a thrombus and deploy the stent . the stent , which can be either self - expanding or expandable from within using a stent placement device , can then expand against the vessel walls and / or blockage . in some methods , an infusion catheter is advanced to within vessel site 80 , and thrombolytic agents infused through the porous stent wall . various therapeutic agents may be applied in this way . a non - limiting list of such therapeutic agents includes thrombolytic agents , anticoagulants , anti - platelet agents , and tissue plasminogen activator . in a similar way , stents according to the present inventions can be used to treat an area stenosed because of arteriosclerosis . the present inventions can be used to accurately position the stent proximal end . the stent proximal end may be positioned accurately relative to a vessel ostium . the stent can be positioned near the proximal end of a stenosis located near or at an ostium . the everted stent can be advanced as previously discussed , until the proximal end is positioned at the desired location . the stent proximal end can be allowed to radially expand against the vessel walls . in some methods , the stent can be advanced further distally until the expanded proximal end is at the desired position . the stent placement may be followed using fluoroscopy . this desired position may be exactly at the ostium beginning , slightly within the ostium , or extending slightly from the ostium . the stent distal region can be released and allowed to expand . in this way , the stent proximal end can be positioned accurately relative to the ostium . in one embodiment of the inventions , the elongate release member has a length of between about 100 cm . and 200 cm . in one embodiment , the outer diameter of the release member distal element is less than 2 mm . in various embodiments , the release member may be formed from stainless steel , nitinol , polyimide , reinforced polymer , or peek and the like . the delivery tube or shaft in some embodiments has a length of between about 75 cm . and 175 cm . the delivery tube can have an outside diameter of between about 6 fr . and 1 fr . in various embodiments of the inventions , the distal region of the delivery tube may be distally tapered . in some embodiments , the cross - sectional outer diameter of the delivery tube distal end is less than about 6 fr . delivery tubes can be made from flexible polymers such as pebax , nylon , polyester , polyurethane , polyethylene , fep , teflon , silicone , and the like , with or without reinforcement by metallic or polymeric elements . microcatheters are well known to those skilled in the art and any suitably sized guide catheter or microcatheter may be used in combination with the present inventions , preferably about 3 fr . or 4 fr . in outer diameter . some exemplary sized catheters that can be used with the present inventions are between about 75 cm . and 175 cm . in length . guide or microcatheters useful in conjunction with the present inventions may be formed from nylon , pebax , polyurethane , and the like . guide catheters can be reinforced with metallic braids , with microcatheters preferably having very flexible distal end regions . the catheters can have a distal outer diameter of less than about 8 fr . for guides and 4 fr . for microcatheters .

US-201314076448-A

a transport tank for use in live haul truck transport of aquatic species such as catfish is formed of rotomolded plastic . the tank has a grooved floor which is covered with a perforated plate . the grooves contain aeration lines which run along the length of the floor . the aeration lines have threaded end fittings which engage a doubly threaded nut which is received in a sidewall opening of the tank . the hoses can be removed for servicing by simply unthreading the doubly threaded nut and pulling the aeration lines out of the sidewall openings .

the transport system of the invention is used to transport aquatic life , preferably finned fish . however , as will be appreciated by those skilled in the art , the term “ fish ” can be interpreted broadly to encompass not only animals taxonomically classified as such ( e . g ., fin fish ) but also “ fishery products ” including , for example , a wide variety of saltwater and freshwater fish species as well as crustaceans , shellfish , and other species exhibiting similar life - support requirements . as used herein , the term “ transport tank ” refers to a molded container specially adapted for harvesting , storing and transporting live fish . the transport tanks of the present invention have generally rectangular or square cross - section , although other shapes are within the scope of the invention . the transport tanks of the present invention are preferably made from lightweight , durable , synthetic plastic , such as a medium - density polyethylene resin . however , other materials such as fiberglass and other plastics are contemplated by the invention . the main components of the transport tanks of the invention are preferably molded as single pieces , for instance , by rotational molding , vacuum forming , blow molding , or injection molding . preferably , the tanks are rotationally molded from synthetic materials . rotational molding is a manufacturing technique which will be familiar to those skilled in the relevant arts . basically , in rotational molding , the product is formed inside a closed mold or cavity where the mold is rotated by biaxially in a heating chamber . to obtain the mold rotation in two planes perpendicular to each other , a spindle is rotated on a primary axis , while the mold is rotated on a secondary axis . in the loading stage , either liquid or powdered plastic is charged into a hollow mold . the mold halves are then clamped shut and then moved into an oven where the loaded mold spins biaxially . in the oven , heat penetrates the mold causing the plastic , if it is in the powder form , to become tacky and stick to the mold surface , or if it is in the liquid form , to start to gel . usually , the heating is done by air or liquid or high specific heat , such as molting salt . since the mold continues to rotate while the heating is going on , the plastic will gradually become distributed evenly on the mold cavity walls through gravitational force . as the cycle continues , the synthetic material melts completely and forms a homogeneous layer of molten plastic . when the parts have been formed , the mold is moved to a cooling chamber where cooling is accomplished by either a cold spray of water and / or forced air or liquid circulation inside the mold . the mold continues to be rotated during the cooling cycle . additional details on rotational molding can be found in the plastic engineering handbook of the society of plastics , inc ., 4 th ed . j . frados , nostrand - reinhold publishers , and similar references . turning to fig1 and 2 , there is shown a transport tank 11 for live haul transport of aquatic life . the tank body 11 has a top 13 , a bottom 15 , opposing sidewalls 17 , 19 , 21 , 23 , a length “ 1 ”, a width “ w ” and an interior floor ( 25 in fig4 ). as best seen fig4 and 5 , the interior floor 25 is molded with alternating ribs and grooves 27 , 29 running longitudinally parallel to the length “ 1 ” thereof . the alternating ribs and grooves are formed as apart of the plastic rotomolding process . the use of a rotomolding process also makes it convenient to provide an anti - skid surface ( 24 in fig1 ) to the top surface 13 as well as external strap depressions 26 for receiving transport straps . an aeration system is incorporated into the floor of the tank and is exposed from the tank interior 31 . in the example illustrated , a plurality of aeration lines , such as lines 33 and 35 in fig4 , run along at least a part of the length of at least selected ones of the grooves 29 in the interior floor 25 . the aeration lines could conceivably be any of a number of types of elongate conduits having apertures along the length thereof or being formed of a suitable porous material . the preferred aeration lines 33 , 35 are commercially available “ soaker hose ” lines of the type available at home supply stores used for home gardening purposes . soaker hoses are typically made of synthetic materials , such as polyethylene , old recycled car tires , and the like , and have tiny weep holes which make them porous in nature . as used in gardening applications , the hoses lie directly on the ground , are tucked beneath a layer of mulch , or are located below ground so water can slowly seep into the roots of the plants , bushes , shrubbery and vegetable gardens . they supply water at a steady , slow rate , which keeps the soil moist . when they are immersed in water , as in the present application , the porous nature of the material allows oxygen to bubble upwardly and aerate the tank water . in order to prevent finned fish from contacting and damaging the porous aeration lines 33 , 35 , a perforated floor plate ( 37 in fig7 a ) is located atop the interior floor 25 . the plate 37 is arranged to cover at least that portion of the interior floor 25 which contains the aeration lines within the alternating grooves 29 . preferably , the entire floor area is substantially covered by the perforated floor plate 37 . the floor plate could be formed of any convenient material , including aluminum or other metals , but cannot also be a suitably injection molded from a suitable plastic . preferably , the aeration lines which run along at least a part of the length of the grooves 29 are connected to both a source of pure oxygen and to a blower fan source . the system may utilize any of a number of commercially available oxygen delivery systems . such systems typically include an oxygen flow meter having a supply coupling for fluidly connecting the flow meter to an oxygen supply line and a delivery coupling for fluidly connecting the flow meter to an oxygen delivery line . as has been explained , the soaker hose ( aeration lines 33 , 35 ) act as an oxygen diffusing system to direct oxygen upwardly from the floor of the tank 11 . in the industry at the present time , electric agitators or air blowers are commonly used to enhance carbon dioxide removal and aerate live fish transport tanks . while these devices are practical and readily available , they can have some disadvantages : high initial investment , possible equipment or power failure , and they may cause water temperature to rise more rapidly during transport . recently , the use of pure oxygen gas for fish transport has become more commonplace . in some instances , there can be advantages to the use of pure oxygen , including the fact that there is little chance of equipment failure ; it may reduce water temperature slightly ; water turbulence is limited ; and loading rates can generally be increased . in order to further explain the general environment of the invention , pure oxygen flow rates used for live transport generally range from about 3 – 6 liters / minute of oxygen gas for each 100 gallons of fish transport water . actual flow rates will vary from load to load and must be adjusted accordingly . oxygen is introduced into the water as very fine bubbles through the porous material of the soaker hose . dissolved oxygen levels are dependent on bubble size ; smaller bubbles produce higher levels . because water agitation is minimal with pure oxygen injection , carbon dioxide tends to accumulate ; reducing oxygen availability to fish during long trips if water is not exchanged . alternatively , some type of mechanical agitator may be utilized . if accumulation is slow and oxygen levels are adequate , channel catfish will tolerate on the order of 20 – 30 mg / l of carbon dioxide . thus , a 160 liter ( 42 gallon or 5 . 6 cubic foot ) liquid oxygen container will supply approximately 127 , 000 liters of oxygen gas . that amount would supply , for example , at 3 liters / min , 100 gallon – 1 , 000 gallons of transport water for about 70 . 5 hours . compressed oxygen gas is available in steel cylinders which are commonly used for welding and are available in a number of sizes . oxygen concentrations can be adjusted up or down by increasing or decreasing gas flow rates with the standard regulator valve / gauge and a flow meter . oxygen levels below the minimum recommendation may stress or suffocate fish . levels above the maximum recommendation could cause gas bubble disease or tissue damage . standard catfish loading rate recommendations are made for transport water at 65 ° f . loading rates must be reduced approximately 25 % for every 10 ° increase above 65 ° f . the features of the present aeration system may be utilized with either a pure oxygen system of the type described above , or with a mechanical blower type system . the above discussion is merely intended to describe the general background of a live haul operation , in the case described using a pure oxygen source for the aeration . as mentioned in the background discussion , a problem has existed in performing routine maintenance type operations on live haul tanks . more specifically , the location and mounting of the aeration lines has proved to be problematical . in the prior art systems , it was generally necessary for a worker to enter the tank interior in order to access the aeration lines 33 , 35 . this required draining the tank and removing the stock of live fish . the present invention provides improved access to the aeration lines 33 , 35 from the tank exterior so that it is not necessary for a worker to enter the tank interior 31 . turning to fig6 , there is shown an aeration line 33 formed of soaker hose type material . the aeration line 33 has an externally threaded end fitting 39 . each line is connected to a sidewall opening 41 of the tank body 11 by means of a double threaded nut 43 . the double threaded nut 43 has an inner threaded surface 45 and an outer threaded surface 47 . as can be seen in fig6 , the outer threaded surface 47 is threadedly engaged within mating threads 49 . the inner threaded surface 45 matingly engages the externally threaded surface 51 of the hose end fitting 39 . both the hose end fitting 39 and the oxygen supply hose 53 terminates in a nut element , 55 , 57 , respectively , to facilitate turning by either hand or with a wrench . the operation of the improved transport system of the invention will now be briefly described . the molded transport tank is formed , for example by a rotomolding process , as previously described . the aeration lines are placed in the interior floor of the tank and secured to the tank sidewall by means of the previously described double threaded nut 43 . in a typical maintenance operation , the aeration lines 33 , 35 can be accessed for servicing by simply turning the nut element ( 57 in fig6 ) which causes the double threaded nut 43 to back out of the threads 49 provided in the opening 41 in the tank sidewall . while the hose 33 also rotates with the nut 43 , the positioning of the hose 33 is not critical since the entire surface is formed of a porous material which distributes the oxygen evenly in use . once the threaded surfaces 47 , 49 break free , the soaker hose 33 can be removed from its respective groove in the tank floor by simply pulling the soaker hose from the tank interior to the exterior thereof , as viewed in fig6 . this action exposes the aeration line 33 on the exterior of the tank so that it can be repaired or replaced . an invention has been provided with several advantages . the tank of the invention is lightweight and durable since it is formed in one piece in a rotomolding operation . because the tank is molded from plastic , the top surface can easily be provided with anti - skid surface . the tank body can also be provided with a plurality of external strap depressions for receiving transport straps . the interior floor of the tank is provided with alternating ribs and grooves with the aeration lines being placed within the grooves . a perforated plate prevents the fish contained within the tank interior from contacting or damaging the aeration lines . the aeration lines can be quickly and easily removed for repair or replacement by means of a special threaded connection in the tanks sidewall . while the invention has been shown in only one of its forms , it is not thus limited but is susceptible to various changes and modifications without departing from the spirit thereof .

US-40454806-A

the present invention is directed to novel compositions that cause effective redirection of class i - immunity to tc1 effectors , that take advantage of the unexpected loading of mhc i by peptide within igg backbone combined with appropriate instruction of antigen presenting cells . such compositions are able to transform a seemingly ineffective therapeutics into a highly effective one , associated with generation of class i - restricted cytolytic cells and ifn - γ , il - 2 producing t cells , further associated with protection against a highly virulent microbe or recovery from malignant tumoral process .

the following definitions are intended to act as a guide and are not to be considered limiting of terms found throughout the specification : adjuvant — a substance that enhances the adaptive arm of the immune response to an antigen ; adoptive transfer — transfer of a cell population from one animal to another of the same haplotype ; antigen — a molecule that can be specifically recognized by the adaptive elements of the immune system ( b cells , t cells or both ); antigen presenting cell — heterogeneous population of leukocytes with very efficient immunostimulatory capacity ; balb / c mouse — widely distributed and among the most widely used inbred mouse strains ; b cell — a type of lymphocyte developed in the bone marrow . each b cell encodes a surface receptor specific for a particular antigen . upon recognition of a specific antigen , b cells multiply and produce large amounts of antibodies which in turn bind to the antigen which activated the b cell ; cdr — complementarity determining region ; hypervariable regions in an immunoglobulin which create the antigen binding site . there are three cdr regions : cdr1 , cdr2 and cdr3 ; chemokines — a group of at least 25 small cytokines , all of which bind to heparin ; cross primed — antigen presenting cells that have acquired antigens from infected tissues and then present them to cognate t cells ; epitope — parts of an antigen which contact the antigen binding site of the antibody or t cell receptor ; fcγr — ig receptors on cell surfaces of which there are three recognized groups : fcγri ( cd64 ), fcγrii ( cd32 ) and fcγriii ( cd16 ); high zone tolerance — a state of unresponsiveness specific to a particular antigen that is induced upon challenge with a high concentration of said antigen ; immunoglobulin — a group of glycoproteins present in the serum and tissue fluids of all mammals and are located on the surface of b cells and serve as antibodies free in the blood or lymph . there are five classes of immunoglobulins : igg ( 70 - 75 %), igm ( 10 %), iga ( 15 - 20 %), igd (& gt ; 1 %) and ige ( found on basophils and mast cells in all individuals ). igg has four human subclasses ( igg1 , igg2 , igg3 and igg4 ); immunoglobulin backbone — refers to an immunoglobulin molecule or portion thereof wherein at least one cdr region is able to receive an inserted peptide epitope ; immunoglobulin isotype switching — stimulation of b cells to switch production from one immunoglobulin isotype to another ; incomplete freund &# 39 ; s adjuvant — an oil - in - water emulsion not containing mycobacterial cell wall components ; innate immunity — the innate immune system provides broad relatively nonspecific host defenses that lack antigenic specificity but have the ability to guide acquired immunity . among the cells types involved are dendritic cells and macrophages ; macrophages — any mononuclear , actively phagocytic cell arising from monocytic stem cells in the bone marrow ; monocytes — mononuclear leukocytes found in lymph nodes , spleen , bone marrow and loose connective tissue ; peptide — a compound consisting of two or more amino acids joined together by a peptide bond ; secondary expansion — immune response which follows a second or subsequent encounter with a particular antigen ; th1 cells — t helper 1 cells which are involved in cell mediated inflammatory reactions , identified by production of ifnγ , tnfβ and il - 2 ; th2 cells — t helper 2 cells which encourage production of antibodies and are identified by production of il - 4 and il - 5 ; th3 cells — t helper regulatory cell , known to produce transforming growth factor ( tgf )- beta ; for selective in vivo loading of antigen presenting cell subsets , the use of compounds described schematically in the fig1 a are used : ( a ) representation of natural igg ( light chain - heavy chain heterodimer ); ( b ) antigen ( ag ) derived peptide inserted within cdr 3 , 2 , 1 or framework region ; ( c ) vh segment replaced with an antigen or fragment ; and , ( d ) vh and ch1 segments replaced with antigen or antigen fragment . this type of molecules are engineered using methods known in the art and as stated as follows : polymerase chain reaction ( pcr ) mutagenesis was used to replace the cdr3 region of vh chain with the stated epitopes . briefly , a puc19 plasmid harboring the 5 . 5 - kb ecori fragment carrying the vh gene of the murine anti - arsonate antibody , 91a3 , was used as template dna in two pcrs to delete the diversity segment ( d ) of the complementarity - determining region 3 ′ ( cdr3 ) loop and inserted dna fragments encoding various antigen epitopes . these chimeric vh and as well as wild type vh genes were then ligated with ig gamma 1 heavy chain constant region within the plasmid psv2δhgptdnsvh - hcgamma1 from which the ecori dansyl ( dns )- conjugated vh gene was cut out . the sequences of vh and inserted epitopes were confirmed by dna sequencing . to express these chimeric iggs with murine 91a3 vh - human c gamma1 heavy chain genes and a mouse - human chimeric k light chain gene , an 8 - kb bamhi fragment encoding the entire murine 91a3 kappa light chain gene was subcloned into the bamhi site of puc19 plasmid . subsequently , a hindiii fragment with the kappa light chain promoter and the v kappa region coding sequences was cut out from this plasmid and subcloned into the hindiii site of psv184δhneodnsvk - hck upstream of the gene encoding a human k light chain c region ( ck ) from which the dns - conjugated vk ( dnsvk ) had been excised . this plasmid , which will encode a murine 91a3 vk - human ck light chain , is designated psv184δhneo91a3vk - hck . the human igg backbone was obtained from igga1 myeloma cell line by rt - pcr . the recombinant human igg was cloned by inserting the stated epitopes to replace the cdr2 or cdr3 regions of the human igg1 backbone . briefly , t cell epitopes were created by pcr mutagenesis and subcloned into the cdr2 / cdr3 region . the recombinant heavy chains were then subcloned into pmg vector ( invivogen , san diego , calif .) by bamhi and xbai sites . the heavy chain expression was controlled by the hcmv promoter . in parallel , the human kappa light chain was subcloned into the pmg vector by stui and nhei sites . the expression of the light chain was controlled by an ef - 1 alpha and htlv - 1 ltr hybrid promoter . the double expression vector carrying both the recombinant heavy chain and light chain were then transfected into expression cell lines . the fc - peptides were constructed by cutting off the vh and ch1 fragment and replacing it with stated viral or tumor antigens ( 8 - 150 aas ). briefly , the human igg1 heavy chain was subcloned into pcdna3 vector by ecori and xhoi sites . then the stated antigens are inserted between the leader sequence and hinge region of igg1 by pcr mutagenesis . to increase the flexibility of the fused antigens , an oligo - glycine linker ( 5 glycines ) was added after the antigen . the expression of human igg recombinant molecules can be performed by using either one of the strategies displayed in fig1 b . the human igg backbone has been selected rationally , based on the ability to bind to fcγr , complement and cytokine activation in various states . properties of selected human igg backbone are shown in the fig1 c and the sequence of the constant region of the heavy chain as well as the schematic depiction of a prospective construct , is shown in fig1 d . epitopes used for model recombinant igg are shown in fig1 e ( mouse mhc class ii - restricted ha epitope and mouse mhc class i restricted np epitope ). the nomenclature of recombinant constructs is recigg - epitope ( ha or np )- restriction element ( i - ed or kd , respectively ). in short , they may be referred to as igha or ignp . model molecules comprising defined mouse self epitopes ( mbp or plp derived ) were similarly constructed . the sequence of the variable region of the heavy chain of anti - arsonate antibody used as the backbone has been depicted in fig1 e and the technology is well known in the art ( zaghouani et al ., science jan . 18 , 1993 ; 259 ( 5092 ): 224 - 7 ) the contents of which is hereby incorporated by reference . in fig1 e - 1m , examples of antigens and epitopes ( in bold ) are provided that could be inserted ( larger parts up to 150 aa spanning one or multiple epitopes ) or attached to the backbone . such constructs comprising the shown antigens / epitopes may be used as drugs against infectious or tumoral diseases . in fig1 i there is the hla - a2 anchor motif displayed , that allows the prediction of location of potentially therapeutic cytotoxic epitopes in any protein , facilitating the selection of the antigen fragment to be used in the recombinant immunoglobulin . in fig1 j , examples of “ universal ” t helper epitopes ( kumar et al . j immunol mar . 1 , 1992 ; 148 ( 5 ): 1499 - 505 ) are provided , both dominant and promiscuous from the point of view of mhc restriction , that could be used for construction of composite molecules for the purpose of inducing or enhancing immunity to mhc class i - restricted epitopes , using compounds such as : examples of such constructs are schematically represented in fig1 k ( bottom ). in fig1 k top , examples of human self antigens with epitopes bolded are shown , that could be used to generate recombinant igg molecules against autoimmune / inflammatory disorders . in fig1 l and 1m other antigen sequences that could be used for the construction of above mentioned immunoglobulin constructs are shown . the antigen fragments of interest could be defined by using methods to predict mhc class i epitopes ( lim et al ., mol immunol . february 1996 ; 33 [ 2 ]: 221 - 30 ). the sp2 / 0 cell line ( american type culture collection ) is used for the production of all the recombinant iggs ( rigg ) discussed in this patent application . stable expressing cell lines ( i . e . transfectomas ) were produced using a double transfection protocol with plasmids encoding the heavy and light chains of an anti - arsenate mouse igg . each transfectoma differs only in the sequence of the cdr3 region of the heavy chain . methods for growing the cell lines as well as producing the different purified rigg used in the experiments reported in this application are identical in all cases . the sp2 / 0 transfectomas were initially grown in quantum yield media ( bd biosciences ) supplemented with 5 % ( v / v ) heat - inactivated fetal bovine serum , 0 . 5 mg / mm gentamicin and 2 . 5 μg / ml fugizone . cultures were maintained at 37 ° c . in a humidified co2 incubator . efforts were made to adapt each of the cell lines to growth in different commercially available serum - free medias ( lymphocyte growth media 2 , clonetics ; cell mab growth media serum free , bd biosciences ; animal component free cell media , bd biosciences ). each of the serum - free medias was supplemented with antibiotics as above . culture media containing secreted igg was produced from each media noted above . no difference in the iggs produced in the different medias was observed over the course of this work ( molecular weight analysis by sds page [ see below ], elispot assays , and immune responses in mice ). the amount of secreted rigg was quantitated using an elisa : capture antibody was a goat anti - mouse igg ( sigma ) and secondary antibody was an anti - mouse igg hrp conjugate ( sigma ). purified mouse igg ( sigma ) was used as a standard . four different methods have been used to produce media containing the different riggs ( i . e . conditioned media , “ cm ”): flasks , stirred vessels , packed bed bioreactors ( new brunswick cellagen ), celline flasks ( bd biosciences ). in the case of cm produced in flasks , the cells were fed and / or harvested twice a week and maintained at least 50 % viability , but viability was generally greater than 70 %. collected media was filtered and held at 4 c . stirred vessels ( 1 l ) were seeded at 10 6 cells per ml in 200 ml starting volume . media was added weekly to keep the cell number between 10 7 and 10 6 per ml until 800 ml of total volume was reached . at this point cell viability was determined ( typically greater than 80 %), and the run was continued until such time that the viability fell below 50 %. media was then collected and sterile filtered to remove cells and held at 4 ° c . for the packed bed bioreactors : each unit was seeded with approximately 10 8 cells in 400 ml of media ; maintained in a co 2 incubator at 37 ° c . with constant stirring ; media was changed every 3 - 4 days and cm was filtered as above ; production of riggs in the cm was monitored with elisa . bioreactor runs were continued until production of riggs began to decline or the vessel became contaminated . the 1 l celline flasks were used according to manufacturer &# 39 ; s instructions : each flask was seeded with 10 7 to 10 8 cells in a total volume 40 ml in the cell compartment ; 1 l of media was added to the feed compartment ; cm was harvested from the cell chamber after 2 to 3 weeks , or when viability of the cells fell below 20 %. the riggs produced by the above methods were purified by one of two methods . for cm that contained fbs , an anti - mouse igg immunoaffinity resin was used . the immunoaffinity resin was synthesized using the following protocol : 10 ml of cyanogen bromide - activated sepharose 4b ( sigma ) was washed with 1 mm hcl as per manufacturer &# 39 ; s instructions ; 10 - 20 mg of goat anti - mouse igg ( sigma ) was dissolved in coupling buffer ( 0 . 1 m sodium carbonate [ ph 8 . 4 ]/ 0 . 5 m nacl ) at a concentration of 2 mg / ml ; the igg solution was added to the washed resin , and the slurry was mixed end - over - end at room temperature ; the extent of coupling was monitored using the bradford assay to determine the amount of remaining soluble igg ; the coupling was quenched by addition of ethanolamine to a final concentration of 10 mm when the amount of soluble igg was less than 10 % of the starting concentration ( approximately 45 minutes ). the immunoaffinity resin was then washed with the following buffers : pbs , 10 mm glycine ( ph 2 . 4 ), 20 mm tris / 1 m nacl ( ph 8 . 0 ), pbs . the resin was stored at 4 ° c . in pbs . the protocol for purifying rigg with this resin was initiated by passing cm through the column at 1 to 2 ml / min . the resin was then washed free of nonbound protein using the following protocol : 100 ml pbs / 0 . 5m nacl followed by 50 ml 1 mm tris ( ph 8 ). fractions were monitored for protein using the bradford assay . specifically bound rigg was eluted with a low ph buffer ( 5 mm glycine ( ph 2 . 4 )/ 0 . 5 m nacl ). the eluted protein was collected and held at 4 ° c . for further processing ( see below ). the rigg produced in serum - free culture media was purified using protein a affinity chromatography . typically , a 5 ml rprotein a column ( hitrap rprotein a ff from amersham pharmacia biotech ) was equilibrated with pbs and the sample was run through the column at 2 ml / min using a fplc unit ( pharmacia ). the resin was washed free of nonspecifically bound protein with pbs , followed by 20 mm tris ( ph 8 . 0 )/ 1 m nacl , then water . the specifically bound rigg was eluted with 1 mm glycine ( ph 2 . 4 ). the eluted peak was collected and held at 4 c for further processing . generally , the rigg fractions were pooled and concentrated using centricon ultrafiltration units ( amicon ) to a final concentration of 1 to 4 mg / ml ( bradford assay with igg as standard ). the concentrated fraction was then dialyzed into 1 mm glycine ( ph 2 . 4 ), the final concentration determined by a 280 using an extinction coefficient of 1 . 4 for a 1 mg / ml igg solution , and aliquoted into 100 μl fractions that were stored in the − 80 ° c . freezer . the purified riggs were analyzed for structural integrity and purity by sds gel electrophoresis . the gels were stained with coomassie blue ( pierce chemical ). in all cases the riggs used in the reported experiments displayed their expected molecular weight ( reduced and nonreduced ) as compared to protein standards and control igg . generally , the purified rigg was greater than 95 % pure as determined by visual inspection of the stained bands relative to the bands of known amounts of control igg run on the same gel . the double stranded rna ( dsrna ) or single stranded rna ( ssrna ) segments of the present invention can be made according to the following method ( and are available commercially ): 1 ) ssrna : the polynucleotides ( polya , polyu ) are enzymatically prepared , using nucleotides and polynucleotide - phosphorylase , with no animal - sourced material entering into its preparation process . 2 ) dsrna : annealing of polyadenylic acid ( polya or pa ) with polyuridylic acid ( polyu or pu ). in general , the dsrna and ssrna of the present invention are homopolymers with , in the case of dsrna , a single base or nucleotide ( e . g ., adenine ) consistently forming one strand with its complement consistently forming the other strand . in the case of ssrna , the single strand is consistently made of the same nucleotide . however , it is within the scope of the invention to use dsrna or ssrna compositions that are made up of mixed nucleotides ( and without or without their complements in the case of dsrna ). for example , a polya : polyu dsrna segment with occasional substitution by an a non - complementary nucleotide ( e . g ., guanine , cytosine or inosine ). the dsrna and ssrna compositions of the present invention are comprised of the bases / nucleotides adenine ( a ), guanine ( g ), cytosine ( c ), uracil ( u ) and inosine ( i ) and could also be comprised of a small percentage of the dna base thymine ( t ). the rna compositions in table i and fig8 a is descriptive of various rna compositions used in the examples . the rna compositions of the present invention were prepared and purified according to example 30 . the various rna strands used in the present invention are generally between 100 - 2000 base pairs in length but may be between 1 - 20 , 20 - 40 , 40 - 60 , 60 - 80 , 80 - 100 , 1 - 100 , 100 - 200 , 200 - 300 , 300 - 400 , 400 - 500 , 500 - 600 , 600 - 700 , 800 - 900 , 1000 - 1100 , 1100 - 1200 , 1200 - 1300 , 1300 - 1400 , 1400 - 1500 , 1500 - 1600 , 1600 - 1700 , 1700 - 1800 , 1800 - 1900 , 1900 - 2000 , 2000 - 2100 , 2100 - 2200 , 2300 - 2400 , 2400 - 2500 , 2500 - 3000 , 3000 - 4000 , 4000 - 5000 , 5000 - 10 , 000 base pairs and greater than 10 , 000 base pairs in length and / or mixtures thereof . example 1 shows that a significant factor limiting the activity of peptides that encompass t cell epitopes is the poor pharmacokinetics resulting in reduced in vivo loading of apc antigen presenting cells (“ apcs ”) from 1 naïve balb / c mouse were obtained from splenic tissue . following washing , three million apc were incubated with 13 . 5 nm ha 110 - 120 peptide for 3 hours at 37 ° c ., in 1 ml of hl - 1 medium . the cells were washed , divided into three equal inoculi and injected ( ½ subcutaneously + ½ intraperitoneally ) into 3 naïve balb / c mice . the mice were sacrificed 2 weeks later and the immune response measured against ha 110 - 120 peptide , by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μ / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 20 μg / ml ha 110 - 120 peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ), and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day , the plates were washed five times with washing buffer , and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). in parallel , 3 naïve balb / c mice were each injected with 4 . 5 nm of ha peptide in sterile pbs , half of it administered subcutaneously and half of it intraperitoneally . the mice were sacrificed 2 weeks later and the t cell response characterized as above , by elispot analysis . in fig2 ( a ), the experimental protocol is described . in fig2 ( b ), the results of the experiment are shown : they were expressed as number of ifn - γ , il - 2 and il - 4 spot forming colonies / spleen , after the subtraction of the background ( mean ± sem ). “ ha - apc ” corresponds to antigen presenting cells ( dendritic cells ) loaded ex vivo prior to adoptive transfer . “ ha ” corresponds to peptide directly injected into animals . the results described in the fig2 a - 2b show that while the injection of the peptide epitope in saline was not immunogenic , a similar dose of peptide used for ex vivo loading of apc effectively triggered a substantial immune response upon adoptive transfer . this shows that if directly injected , the peptide does not effectively reach apc , a prerequisite for effective induction of an immune response . example 2 demonstrates that incorporation of a peptide epitope with the igg ameliorated its pharmacokinetics balb / c scid mice ( 3 / group ) were injected intravenously with 60 nm of sferfeifpke (“ ha ”) [ seq . i . d . no . 5 ] peptide or 2 . 4 nm of recha ( i - ed )- igg (“ ig - ha ”) and blood was harvested at various intervals . serum was immediately separated and promptly frozen at − 70 ° c . later , the serum samples were incubated with 2 × 10 4 cells / well / 50 μl ha - specific t cell hybridoma ( tch ) and 1 × 10 4 cells / well / 50 μl m12 b cell lymphoma apc , in serum free hl - 1 medium at 37 ° c . and 5 % co 2 for 24 hours . the next day the plate was centrifuged for 15 min / 4 ° c ./ 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min / 4 ° c ./ 1500 rpm . fixing solution was flicked off the plate , cells washed once with pbs 200 ul / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μl / well of the x - gal substrate freshly prepared as follows : 200 μl of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 mm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope . the activation of tch was represented as function of time post - injection . the epitope could be detected in the blood only in the case of mice injected with recha ( i - ed )- igg , for an interval of about one day . in contrast , the ha peptide injected as is , was not detected in the periphery despite being used in large molar excess ( 25 fold ). thus , the results described in the fig3 show that delivery of epitope within ig backbone considerably favored its stability in the systemic circulation . example 3 shows that a peptide encompassing a t cell epitope is ineffectively presented by apc to specific t cells in the presence of serum and this is corrected by incorporation of the peptide epitope within the igg backbone fig4 ( a ) shows the detrimental effect of serum on the presentation of a t cell epitope peptide : m12 b cell lymphoma apc were incubated with tch in the presence of various amounts of sferfeifpke ( ha ) peptide in serum - free hl - 1 medium (“ ha + hl - 1 ”) or hl - 1 medium supplemented with 20 % mouse serum from balb / c scid mice (“ ha + serum ”). the number of cells incubated was 2 × 10 4 m12 and 1 × 10 4 tch / 100 μl of hl - 1 medium supplemented or not with serum . the next day the plate was centrifuged for 15 min / 4 ° c ./ 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min / 4 ° c ./ 1500 rpm . fixing solution was flicked off the plate , cells washed once with pbs 200 μl / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μ / well of the x - gal substrate freshly prepared as follows : 200 ul of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 mm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope . the serum negatively interfered with the formation and / or presentation of immunogenic mhc - peptide complexes . fig4 b : the serum negatively interfered with the formation and / or presentation of immunogenic mhc - peptide complexes . this phenomenon was further studied by sequential incubation of peptide (“ ha peptide ”) or recha ( i - ed )- igg (“ igha ”) first with apc or serum , followed by addition after 1 hour of tch and serum , or apc and tch , respectively . control corresponds to cells incubated with antigens in the absence of added serum (“ ctrl ”). the number of cells incubated was 2 × 10 4 m12 and 1 × 10 4 tch / 100 μl of hl - 1 medium supplemented or not with serum . the next day the plate was centrifuged for 15 min / 4 ° c ./ 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min / 4 ° c ./ 1500 rpm . fixing solution was flicked off the plate , cells washed once with pbs 200 μl / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μl / well of the x - gal substrate freshly prepared as follows : 200 μl of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 mm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope . the results were represented as percentage of activated t cells ( beta - gal + tch )/ well at concentrations of 2 μg / ml of recha ( i - e d )- igg (“ igha ”) or 40 μg / ml of ha peptide ( 1 , 000 molar excess relative to the recombinant ig ). the results described in the fig4 show that pre - incubation of peptide with serum resulted in decreased tch activation . addition of serum after apc pulsing did not have an effect on tch activation . in contrast , the formation of mhc - peptide complexes was not impaired by serum when the recombinant immunoglobulin carrying the peptide was used instead of the peptide alone . example 4 shows that incorporation of a t cell peptide epitope within an igg backbone improves its presentation to specific t cells by apc , with a rate depending on the nature of apc as shown in fig5 a , ex vivo formation of mhc - peptide complexes on antigen presenting cells ( apcs ) from spleen was measured as follows : splenic apc were isolated by magnetic sorting using anti - mhc ii antibodies . separation by using magnetic beads coupled with anti - mhc ii was carried out using magnetic cell separators and reagents from miltenyi biotec , germany as follows : spleens were processed to single cell suspension , red blood cells lysed , then cells washed , counted and resuspended in macs buffer ( pbs supplemented with 2 mm edta and 0 . 5 % bsa ). magnetically labeled cells were passed through a separation column which is placed in the magnetic field of a macs separator . the magnetically labeled positive fraction is retained in the column while the negative fraction runs through . after removal of the column from the magnetic field , the magnetically retained positive cells are eluted from the column , cells are washed , counted , resuspended in hl1 complete media and they were incubated with specific t cell hybridoma recognizing i - e d + sferfeifpke overnight , in the presence of various amounts of sferfeifpke (“ ha ”) peptide or recha ( i - ed )- igg (“ igha ”). per well , 2 × 10 4 apc were incubated with 1 × 10 4 tch . next day the plate was centrifuged for 15 min / 4 ° c ./ 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min / 4 ° c ./ 1500 rpm . fixing solution was flicked off the plate , cells washed once with pbs 200 μl / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μl / well of the x - gal substrate freshly prepared as follows : 200 μl of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 mm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope . the number of activated tch was quantified and the results expressed as activation versus molar amount of epitope . ( b ) a protocol similar to that described above has been applied to m12 b cell lymphoma apc . thus , the results described in the fig5 b show that the relative efficiency of mhc - peptide complex formation greatly varied depending on the nature of antigen and apc . on a molar basis , the peptide epitope within the igg backbone was 10 times more effectively handled by mhc ii + apc from lymphoid organs and 1000 times more effectively handled by transformed b cell lymphoma cells , as compared to the free peptide itself . thus , the cellular handling of the epitope and formation of mhc - peptide complexes subsequent to delivery within igg , greatly varies with the nature of apc . example 5 shows that fcγr - mediated delivery of a peptide encompassing a t cell epitope results in more effective cellular handling and presentation by cell populations ( peripheral blood white cell ) containing reduced numbers of professional apc ( a ) to quantify the apc , peripheral blood mononuclear cells ( pbmc ) were separated by ficoll gradient centrifugation from balb / c mice and facs analysis for expression of cd11c , cd11b and b220 was carried out . the results are represented in fig6 a as percentage of apc and t cells in blood versus a prototype secondary lymphoid organ ( spleen ). the number of professional apc such as cd11c + cells is tremendously ( 2 logs ) decreased in blood as compared to spleen . b220 + and cd11b + cells were decreased as well ( 1 order of magnitude ). the following materials and methods were used . antibodies : cd11b cat # 01715a , cd11c cat # 557401 , b220 cat # 01125a , all pe conjugated ( bd pharmingen ) 1 . animal blood was harvested and mononuclear cells were separated by ficoll gradient separation . 2 . cells were suspended and labeled with fluorescently - tagged anti - mouse cd - 11c , cd11b or b220 at 2 ug / ml for 20 minutes on ice 3 . cells were washed once and resuspended in 300 ul of facs buffer 4 . flow cytometric analysis was carried out to determine fractions of total cell population which labeled with each specific antibody ( b ) pbmc were used as apc with sferfeifpke ( ha )- specific tch , in the presence of cognate peptide or recha ( i - ed )- igg . the cells were co - incubated for 24 hours ( 2 × 10 4 apc + 1 × 10 4 tch ). the next day the plate was centrifuged for 15 min / 4 c / 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min / 4 ° c ./ 1500 pm . fixing solution was flicked off the plate , cells washed once with pbs 200 μl / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μl / well of the x - gal substrate freshly prepared as follows : 200 μl of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 nm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope . the results are expressed as number of activated tch / well , at different molar concentrations of epitope . the results described in the fig6 a - 6b show that the peptide epitope within igg backbone was more effective on a molar basis ( 1 order of magnitude ) than the peptide alone in inducing tch activation when handled by blood - derived apc , suggesting that in suboptimal conditions associated with limiting numbers of professional apc , the ig backbone greatly facilitates the creation of mhc - peptide complexes . example 6 shows that delivery of a t cell epitope within igg backbone dramatically improves the loading and presentation of epitope by apc in the secondary ( draining lymph nodes + spleen ) but not central lymphoid organs . the emulsification of the peptide epitope in ifa or increase of dose 100 fold could not reproduce the same degree of loading . thus , epitope insertion within the igg backbone removes limiting factors associated with peptide - based strategy , that cannot be otherwise compensated by dose escalation or depot effect assessment of in vivo formation of mhc - peptide complexes and a comparison with peptide in saline or standard oil - in - water emulsion were carried out in i - ed + balb / c mice . balb / c mice were treated with recha ( i - ed )- igg , peptide in saline or peptide emulsified in incomplete freund &# 39 ; s adjuvant ( ifa ), by subcutaneous and intraperitoneal injection ( doses depicted in fig7 b ). at 24 hours , the local ( mesenteric ) lymphoid nodes ( ln ), spleen and thymus were harvested , single cell suspensions were made , red blood cells lysed from the spleens , ln and thymus were collagenase digested . all cells were washed , counted and incubated with tch recognizing i - ed + sferfeifpke ( mhc class ii - ha ) complexes . the number of tch was 1 × 10 4 / well . the formation of such mhc - peptide complexes was evaluated by titrating the number of apc with constant number of tch and measuring tch activation after overnight incubation . the next day the plate was centrifuged for 15 min / 4 ° c ./ 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min / 4 ° c ./ 1500 rpm . fixing solution was flicked off the plate , cells washed once with pbs 200 μl / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μl / well of the x - gal substrate freshly prepared as follows : 200 μl of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 mm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope . the data are expressed as tch activation versus apc number ( fig7 a ) and as estimated percentage of apc expressing mhc - peptide complexes ( fig7 b ), based on in vitro standard curve obtained as depicted in the previous examples , 5 and 6 . the data presented in the fig7 a - 7b show that the use of oil - in - water adjuvant ( ifa ) modestly enhanced the in vivo formation of mhc - peptide complexes on apc of lymph nodes but not spleen or thymus . substantial dose escalation of peptide in saline or in emulsion is not paralleled by proportional enhancement in the generation of loaded apc and / or mhc - peptide complexes on apc in vivo . in contrast , use of peptide within ig backbone enhances the formation of mhc peptide complexes considerably , on apc from secondary lymphoid organs such as lymph nodes and spleen . the formation of mhc ii - peptide complexes on apc from thymus remained limited , similar to that conferred by peptide alone . the enhancement factor conferred by incorporation of peptide within the igg was unexpectedly high ( approximately 2 - 3 orders of magnitude ), indicating that other factors , in addition to cellular handling ( e . g . the above described pharmacokinetics and protective effects ), were involved . even 100 fold dose escalation of peptide alone , in saline or ifa , could not restore the in vivo loading of apc noted with peptide within igg backbone . example 7 shows that among the three major apc subsets ( dc , monocytes / macrophages and b cells ) rather than b cells are the most potent on a per cell basis in presenting the peptide epitope subsequent to in vivo delivery via igg backbone . the efficiency of apc loading and resulting presentation is substantially higher than that resulting from delivery of free peptide in vivo formation of mhc - peptide complexes on apc has been assessed subsequent to the administration of peptide epitope within igg backbone followed by separation of various subsets of apc . ( a ) separation by using magnetic beads coupled with anti - mhc ii or anti - cd11c mab is carried out using magnetic cell separators and reagents from miltenyi biotec , germany as follows : spleens were processed to single cell suspension , red blood cells lysed , then cells washed , counted and resuspended in macs buffer ( pbs supplemented with 2 mm edta and 0 . 5 % bsa ). magnetically labeled cells were passed through a separation column which is placed in the magnetic field of a macs separator . the magnetically labeled positive fraction is retained in the column while the negative fraction runs through . after removal of the column from the magnetic field , the magnetically retained positive cells are eluted from the column , cells are washed , counted , resuspended in hl1 complete media and incubated in elispot plates . usually , from the total number of approximately 90 million splenocytes separated / 1 balb / c mouse approximately 20 millions bind to magnetic beads coupled to anti - mhc ii antibody and 3 millions interact with anti - cd11c mab . thus , less than 20 percent of splenocytes are able to present mhc class ii restricted epitopes and approximately 2 - 3 percent are dendritic cells ( see fig8 a ). these figures were confirmed by facs analysis using specific antibodies . ( b ) the in vivo loading of apc and formation of mhc ii - peptide complexes on mhc ii + splenocytes has been assessed comparatively in balb / c mice injected intravenously with 0 . 72 um of recha ( i - ed )- igg (“ igha ”) or 18 um of ha peptide . at 24 hours , mhc class ii + apc were isolated from spleen by macs as above , and incubated with peptide specific tch ( 1 × 10 4 / well ), in dose response manner . the next day the plate was centrifuged for 15 min / 4 ° c ./ 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min ./ 4 ° c ./ 1500 rpm . fixing solution was flicked off the plate , cells washed once with pbs 200 μl / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μl of the x - gal substrate freshly prepared as follows : 200 μl of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 nm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope . the results are expressed in fig8 b as number of activated tch / well . as a control , mhc ii + apc from naive balb / c mice were incubated in vitro , overnight , with an optimal concentration of ha peptide ( 50 ug / ml ), extensively washed and incubated in different numbers with tch as above . the results show that the formation of mhc ii - peptide complexes on splenic apc is at least 2 orders of magnitude more effective when the epitope is delivered within igg backbone . ( c ) a comparative assessment of the in vivo loading of various apc subsets after administration of recha ( i - ed )- igg has been carried out by magnetic separation of cd11c +, cd11b + and cd19 + apc using the same protocol as above , using cd11c , cd11b and cd19 microbeads from miltenyi biotec . at 24 hours after intravenous injection with 0 . 72 um of recombinant immunoglobulin , the apc were isolated and incubated in a dose effect manner with a constant number of peptide specific tch . after additional 24 hours , the assay was developed as above and results expressed as number of activated tch / well . the results in fig8 c show that on a per cell basis , use of peptide within igg backbone led to predominant formation of immunogenic mhc ii - peptide complexes on cd11c + apc ( dendritic cells ), followed by cd11b + monocytes and very ineffectively on cd19 + b cells . ( d ) a comparison between the efficiency of in vivo formation of mhc ii - peptide complexes on cd11c + apc subsequent to peptide versus recombinant ig delivery has been carried out following treatment of mice as described in the section b above . the cd11c + splenic dc were isolated by macs using cd11c microbeads and incubated in different numbers with 1 × 10 4 tch / well . activated tch were quantified as above and the results expressed as number of x - gal + t cells / well . as a control , cd11c + apc from naive mice loaded ex vivo with peptide were used as described in section b . the results in fig8 d show that formation of mhc ii peptide complexes was at least three orders of magnitude more effective when the peptide epitope was delivered within igg backbone . in conclusion , delivery of a peptide epitope within an igg backbone resulted in more effective formation of mhc ii - peptide complexes on cd11c + dc . in addition , the efficiency of apc loading and formation of mhc ii - peptide complexes was substantially higher when the peptide was delivered within igg backbone . the results in fig8 a - 8d show that use of fcgr mediated delivery of peptides results in preferential formation of immunogenic mhc ii - peptide complexes on cd11c + and cd11b + apc . example 8 shows a prolonged persistence in vivo of mhc - peptide complexes on apc ( dc and monocytes ) following administration via a igg backbone the persistence of mhc ii - peptide complexes on specific apc subsets was measured by magnetic separation of cd11c + dc and cd11b + monocytes at various intervals subsequent to intravenous injection of 2 um of recha ( i - ed )- igg . in brief , magnetic separation was carried out using magnetic cell separators and reagents from miltenyi biotec , germany as follows : spleens were processed to single cell suspension , red blood cells lysed , then cells washed , counted and resuspended in macs buffer ( pbs supplemented with 2 mm edta and 0 . 5 % bsa ). magnetically labeled cells were passed through a separation column which is placed in the magnetic field of a macs separator . the magnetically labeled positive fraction is retained in the column while the negative fraction runs through . after removal of the column from the magnetic field , the magnetically retained positive cells are eluted from the column , cells are washed , counted , resuspended in hl1 complete media and incubated . different numbers of separated apc ( a — cd11b + monocytes , b — cd11c + dendritic cells , c — whole splenocyte population ) were incubated overnight with 1 × 104 tch specific for the ha peptide . as a control , apc from naive mice were used that were in vitro loaded with optimal amounts of ha peptide ( 50 μg / ml ), overnight and washed prior to incubation (“ ctrl ”). the next day the plate was centrifuged for 15 min / 4 ° c ./ 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min / 4 ° c ./ 1500 rpm . fixing solution was flicked off the plate , cells washed once with pbs 200 μl / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μl / well of the x - gal substrate freshly prepared as follows : 200 μl of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 mm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope and the number of activated tch / well was plotted against the number of apc harvested at various intervals after treatment . the results show long lasting expression of peptide onto endogenous mhc ii , on both dc and monocytes . the complexes persisted between 1 and 2 weeks on these two apc subsets , in the conditions employed in this assay ( strategy of apc separation and detection of mhc ii - peptides ). thus , the results in fig9 a - 9c show that the mhc - peptide complexes on selected apc formed subsequent to in vivo delivery of epitope via ig are long - lived . example 9 shows that the γ chain of the fc receptors ( i and iii ) is essential for effective in vivo loading and presentation of a t cell epitope delivered within igg backbone , by dc and monocytes the dependency of apc loading on the interaction with fcγr was studied by administration of 2 um of recha ( i - ed )- igg to balb / c mice that lack a functional fcr gamma gene . one day after intravenous treatment , the cd11c + and cd11b + apc from spleen were separated by macs . separation by using magnetic beads coupled with anti - cd11c and anti - cd11b antibodies was carried out using magnetic cell separators and reagents from miltenyi biotec , germany as follows : spleens were processed to single cell suspension , red blood cells lysed , then cells washed , counted and resuspended in macs buffer ( pbs supplemented with 2 mm edta and 0 . 5 % bsa ). magnetically labeled cells were passed through a separation column which is placed in the magnetic field of a macs separator . the magnetically labeled positive fraction is retained in the column while the negative fraction tuns through . after removal of the column from the magnetic field , the magnetically retained positive cells are eluted from the column , cells are washed , counted , resuspended in hl1 complete media and they were incubated in different numbers with 1 × 10 4 tch specific for the ha peptide , overnight . as a control , apc from fcr gamma competent balb / c mice were used . the next day the plate was centrifuged for 15 min / 4 ° c ./ 1500 rpm , then the supernatant was flicked , the cells were fixed with cold freshly made fixing solution ( 2 % formaldehyde , 0 . 2 % glutaraldehyde in 1 × pbs ) and the plate was again centrifuged for 3 min / 4 ° c ./ 1500 rpm . fixing solution was flicked off the plate , cells washed once with pbs 200 μl / well , centrifuging the plate for 3 min / 4 ° c ./ 1500 rpm . pbs was flicked off the plate and cells were incubated overnight at 37 ° c . with 200 μl / well of the x - gal substrate freshly prepared as follows : 200 μl of the x - gal stock solution , ( 40 mg / ml in dmso ) in 10 ml of substrate buffer ( 5 mm potassium ferrocyanide , 5 mm potassium ferricyanide , 2 mm mgcl 2 in 1 × pbs ). the blue activated tch were scored visually using the microscope . the results are expressed as number of activated tch / well for different apc subsets : cd11c + dc ( a ) and cd11b + monocytes ( b ), or as control , whole splenic population ( c ). the results ( fig1 ) clearly show that the formation of mhc ii - peptide complexes on dc and monocytes , subsequent to igg mediated delivery of peptide epitope , is critically dependent on itam + fcgr that encompass the gamma chain . in addition , gamma chain negative fcr isoforms cannot compensate for the absence of gamma chain + fcr isoforms , in that regard . example 10 shows that the efficiency of t cell activation by a peptide delivered within the igg backbone is dependent on the expression of γ chain + fcγr ( that promote activity ) and fcγriib ( that limit the activity ) on apc . in addition , this experiment shows that itim - bearing fcγriib keeps in check that immune response to a peptide delivered within igg backbone the differential role of fcr gamma + versus gamma − isoforms to the immune response triggered by peptide epitope within igg backbone , was studied by ex vivo loading of apc followed by adoptive transfer . splenocytes from wild type , fcr gamma − or fcriib - balb / c mice were incubated for 3 hours at 370 ° c . as follows : 10 million cells / 1 ml of serum free hl - 1 medium were admixed with 50 ug / ml of ha 110 - 120 peptide or 10 ug / ml of recha ( i - ed )- igg . subsequently , the cells were washed and adoptively transferred into naive balb / c mice ( 1 million cells suspended in 200 ul serum free hl - 1 and divided into 2 equal inoculi administered subcutaneously and intraperitoneally ). after 2 weeks , the recipient mice were sacrificed , spleens harvested and the t cell response to the ha 110 - 120 peptide measured by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 50 μg / ml ha 110 - 120 peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ), and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day plates were washed five times with washing buffer , and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results are expressed in fig1 as frequency of cytokine producing ( a : il - 2 , b : il - 4 , and c : ifn - gamma ) spot forming colonies obtained by incubation with medium only , or medium supplemented with ha 110 - 120 peptide ( 10 ug / ml ) ( mean + sem of triplicates , corresponding to 3 mice / group ). the results ( fig1 ) show that the expression of the gamma chain of itam + fcgr isoforms is necessary for the induction of t cell response to apc loaded with peptide within igg backbone . this was not necessary for the immunogenic effect of apc pulsed with peptide . conversely , absence of itim + fcgrii results in profound increase of the t cell response to apc pulsed with recombinant igg but not ha peptide . together , these data show that the t cell response to recombinant igg bearing a peptide epitope is determined by a complex interplay between itam + and itim + fcgamma receptors on apc . example 11 shows that unexpectedly , various subsets of apc in vivo loaded with epitope inserted within igg backbone , differentially induce distinct regulatory subsets ; while monocytes induce th2 and tr1 cells more effectively , both dendritic cells and monocytes induce th3 cells . in addition , on a cell population level , the cd11b + monocytes are more potent than the dendritic cells in triggering regulatory response following igg - mediated delivery of t cell epitope four balb / c mice were injected intravenously with 2 μm of recha ( i - ed )- igg . one day later , the spleens were harvested and apc were isolated by macs using anti - cd11c , anti - cd11b or anti - cd19 monoclonal antibodies coupled with magnetic beads . separation by using magnetic beads coupled with anti - cd11b , anti - cd11c and anti - cd19 mab is carried out using magnetic cell separators and reagents from miltenyi biotec , germany as follows : spleens were processed to single cell suspension , red blood cells lysed , then cells washed , counted and resuspended in macs buffer ( pbs supplemented with 2 mm edta and 0 . 5 % bsa ). magnetically labeled cells were passed through a separation column which is placed in the magnetic field of a macs separator . the magnetically labeled positive fraction is retained in the column while the negative fraction runs through . after removal of the column from the magnetic field , the magnetically retained positive cells are eluted from the column , cells are washed , counted , resuspended in serum free hl - 1 medium as follows : 3 × 10 6 / ml cd11c + dc , 28 × 10 6 / ml cd11b + or 84 × 10 6 / ml of cd19 + b cells . this numerical distribution respects the proportion of the apc subsets isolated from the splenic tissue . cells were transferred into naïve balb / c mice by subcutaneous and intraperitoneal injection ( 100 + 100 μl / mouse , n = 2 mice / group ). at 2 weeks after the adoptive transfer , mice were sacrificed and t cell response measured by elispot ( il - 4 and ifn - γ ) or measurement of cytokine production in cell culture supernatants , by elisa tgf - β1 kit ( r & amp ; d systems , cat # dy240 ) and il - 10 kit ( biosource international , cat # kmc0104 ). the results are expressed in fig1 as number of spot forming colonies / spleen ( average of duplicates ; panels a , b ) or amount of cytokine measured in supernatants ( pg / ml , average of duplicates ; panels c , d ) at various concentrations of ha peptide used for restimulation . the results ( fig1 , panels a - d ) clearly show that unexpectedly , and in contrast with the potency / cell basis ( example 8 ), at the organism level , the cd11b + monocytes have the highest impact on the immune response to a peptide epitope delivered within the igg backbone . thus , the cd11b + apc subset induced both th2 , tr1 and th3 cells . in contrast , the cd11c + dc induced th3 cells and more reduced th2 response . finally , despite their substantial number , the cd19 + b cells were poor inducers of t cell immunity to the peptide epitope within the igg backbone . no significant th1 responses were induced by either of the apc subsets tested . example 12 shows that the loading of apc in vivo with a peptide delivered within igg backbone results in induction of th2 but not th1 immunity balb / c mice were immunized with 100 μg of recha ( i - ed )- igg (“ igha ”), or a molar equivalent amount of ha peptide epitope ( 2 μg ), by subcutaneous injection and sacrificed 2 weeks later . the immune response was measured by elispot analysis using splenocytes from treated mice as responders , and mitomycin - treated splenocytes ; from naïve mice as stimulators , as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 20 μg / ml ha 110 - 120 peptide or just with media , to assess the background . stimulator cells were prepared from naïve mice as follows : single cell suspension was prepared from spleens , red blood cells were lysed , cells were washed , resuspended in hl1 complete and mitomycin treated for 30 minutes . afterwards , cells were washed 3 times , counted and resuspended in serum free hl1 media . the plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ), and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day , the plates were washed five times with washing buffer and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results are expressed in fig1 as number of il - 4 - producing ( a ) or ifn - γ producing ( b ) t cell colonies / spleen ( mean ± sem of triplicates ) when splenocytes were restimulated with 10 μg / ml of ha peptide or cell culture medium alone . thus , this example shows that fcgr - mediated delivery of t cell epitope within recombinant ig backbone results in th2 rather than th1 response . example 13 shows that the repeated loading of apc in vivo with a peptide delivered within igg backbone results in induction of th1 and tr1 immunity balb / c mice were immunized with 40 ug of heat aggregated ( 15 mins at 63 ° c .) of recha ( i - ed )- igg (“ igha ”) administered by intranasal instillation boosted 2 weeks later by subcutaneous injection with 100 ug of recombinant immunoglobulin in saline . as controls , mice primed with heat aggregated igg2b isotype control were used . after an additional 2 weeks , the mice were sacrificed and t cell response assessed by in vitro restimulation of splenocytes with ha peptide by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 20 μg / ml ha 110 - 120 peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ), and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day , plates were washed five times with washing buffer and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . plates were , then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the tgf - beta and il - 10 production were measured by elisa tgf - β1 kit ( r & amp ; d systems , cat # dy240 ) and il - 10 kit ( biosource international , cat # kmc0104 ). the results are expressed as cytokine concentration ( average of triplicates ) after subtraction of background . the data , as shown in fig1 , show that mucosal priming with epitope bearing recombinant immunoglobulin resulted in differentiation of th3 and tr1 cells that were expanded subsequently by systemic boosting . example 14 shows that only a virus , but not the conventional adjuvant cfa , was able to trigger significant th1 response to a peptide epitope inserted within the igg backbone balb / c mice were immunized intraperitoneally with 100 ug of recha ( i - ed )- igg in saline , emulsified in complete freund &# 39 ; s adjuvant (“ cfa ”) or with 105 tcid50 of influenza virus strain wsn , that bears the ha epitope . at 2 weeks after immunization , the mice ( n = 3 / group ) were sacrificed and the t cell response to ha peptide measured by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media , and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 20 μg / ml ha 110 - 120 peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ), and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day , plates were washed five times with washing buffer , and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results are represented as mean ± sem of frequency of cytokine producing colonies in the spleen . the results in fig1 show that a peptide epitope within the igg backbone triggers a cellular response of th2 profile that is enhanced but not switched by a conventional adjuvant ( cfa ). in contrast , the profile afforded by live virus immunization was th1 biased . example 15 shows that the presentation of peptide epitope subsequent to igg mediated delivery results in a t cell response that could be further manipulated by decreasing co - stimulation with anti - cd40mab , recombinant il - 12 or synthetic dsrna dendritic cells from naive balb / c mice were harvested by macs from splenic cell suspensions as follows : separation by using magnetic beads coupled with anti - cd11c was carried out using magnetic cell separators and reagents from miltenyi biotec , germany as follows : spleens were processed to single cell suspension , red blood cells lysed , the cells washed , counted and resuspended in macs buffer ( pbs supplemented with 2 mm edta and 0 . 5 % bsa ). magnetically labeled ,. cells were passed through a separation column which is placed in the magnetic field of a macs separator . the magnetically labeled positive fraction is retained in the column while the negative fraction runs through . after removal of the column from the magnetic field , the magnetically retained positive cells are eluted from the column , cells are washed , counted , resuspended in hl1 complete media and were pulsed ex vivo in serum free hl - 1 medium for 2 hours , at a concentration of 3 million / ml , with 50 ug / ml of recha ( i - ed )- igg alone or supplemented with 5 ng / ml of recil - 12 , 50 ug / ml of double stranded rnas ( pa : pu or pi : pc ). alternatively , the cells were incubated with recombinant ig and wells precoated with 10 ug / ml of anti - cd40 mab . the cells were harvested , washed and adoptively transferred to naive balb / c mice ( 300 , 000 delivered half subcutaneously and half intraperitoneally ) in serum free hl - 1 medium . at 2 weeks , the mice were sacrificed and t cell responses measured against ha by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 50 μg / ml ha 110 - 120 peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day plates were washed five times with washing buffer and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results are shown as mean + sem ( n = 3 ) of the frequency of spot forming colonies associated with il - 2 or il - 4 production , after subtraction of the background , for each ex vivo stimulatory combination . the results in fig1 show that peptide presentation by apc , subsequent to loading with antigen by using recombinant igg as delivery platform , occurs in context of limited co - stimulation . il - 12 , anti - cd40 or synthetic dsrna can all enable apc loaded with antigen via fcgr , to prime il - 2 and enhanced il - 4 producing t cell immunity against the cognate ( ha ) peptide . example 16 : the activity of the long - lived il - 4 producing th2 cells triggered by in vivo loading of apc with igg - peptide is dependent on the continuous interaction with endogenous apc and requires competent cd4 balb / c mice were immunized with 100 ug of recha ( i - ed )- igg or ha peptide subcutaneously , sacrificed at 2 weeks and the t cell response measured by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml anti - il - 4 , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plate was washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 20 μg / ml ha 110 - 120 peptide or just with media , to assess the background . the plate was incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plate was washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day , the plate was washed five times with washing buffer and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plate was then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). ( a ) during the ha stimulation phase , blocking anti - cd4 or anti - cd8 mab was added at 10 ug / ml in selected wells . the results are expressed in fig1 a as mean + sem of number of ha - stimulated il - 4 producing colonies per spleen , after subtraction of background ( n = 3 mice / group ). ( b ) splenocytes from mice immunized with recombinant ig as above , were incubated in elispot plate as is or after magnetic depletion of endogenous mhc ii + apc with mhc ii + from naive balb / c mice , with medium alone or in the presence of 10 ug / ml of ha peptide . separation by using magnetic beads coupled with anti - mhc ii was carried out using magnetic cell separators and reagents from miltenyi biotec , germany as follows : spleens were processed to single cell suspension , red blood cells lysed , then cells washed , counted and resuspended in macs buffer ( pbs supplemented with 2 mm edta and 0 . 5 % bsa ). magnetically labeled cells were passed through a separation column which is placed in the magnetic field of a macs separator . the magnetically labeled positive fraction is retained in the column while the negative fraction runs through . after removal of the column from the magnetic field , the magnetically retained positive cells are eluted from the column , cells are washed , counted , resuspended in hl1 complete media and were incubated in the elispot assay , protocol to follow . the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 50 μg / ml ha 110 - 120 peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day , plates were washed five times with washing buffer , and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .) and the results expressed as mean ± sem of the frequency of il - 4 producing t cells . the results in fig1 a - 17b show that the activity of ha specific il - 4 producing t cells triggered by administration of recha ( i - ed )- igg is dependent on cd4 rather cd8 . in addition , the long lived il - 4 production by primed t cells depends on stable interaction with endogenous apc . example 17 shows that fcγr - mediated delivery of a t cell epitope is more effective that the peptide in differentially affecting the phenotype of activated , specific t cells : dose - dependent down regulation of il - 2 , ifn - γ , and il - 4 , with up - regulation of il - 10 and tgf - β activated sferfeifpke - specific t cells were separated from balb / c mice immunized 2 weeks previously with 100 μg peptide in cfa . they were incubated with mitomycin treated splenocytes in the presence of various amounts of recha ( i - ed )- igg or corresponding peptide . the expansion and cytokine production ( ifn - γ , il - 4 , il - 2 ) was estimated by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour , at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 20 μg / ml ha 110 - 120 peptide or just with media , to assess the background . the plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day , the plates were washed five times with washing buffer , and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). in addition , tgf - β and il - 10 production were measured by elisa at 48 hours after incubation using tgf - β1 kit ( r & amp ; d systems , cat # dy240 ) and il - 10 kit ( biosource international , cat # kmc0104 ). the results are expressed as frequency of spot forming cells ( sfc ) or concentration of cytokine versus amount of antigen added in vitro . the results in fig1 show that the igg mediated delivery of a t cell epitope has a profound and differential effect on the expansion and cytokine production by activated t cells : il - 2 , ifn - γ and surprisingly il - 4 , were down - regulated in a dose - related manner . the ig - peptide was substantially more effective in modulating the cytokine production , as compared to the peptide itself . in contrast , only the ig - peptide turned on effectively the production of il - 10 and tgf - beta in a dose - dependent manner . thus , the t cell epitope in context of ig backbone , but not separately , differentially modulated the function of activated cells . example 18 shows that surprisingly , a peptide delivered within the igg backbone , that is not an immune complex nor is a receptor cross - linking antibody , results in induction of a class i restricted immune response . this response had a different profile from that triggered by live virus ( tc2 type consisting in il - 4 but not ifn - γproduction balb / c mice were injected with 50 μg of recnp ( kd )- igg encompassing the mhc class i - restricted peptide tytqtralv ( seq . i . d . no . 6 ) by subcutaneous injection . the mice were sacrificed 2 weeks later and peptide - specific cytokine production was measured by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with various concentrations of np peptide . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day the plates were washed five times with washing buffer and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results are expressed in fig1 a as total number of spot forming colonies ( sfc )/ spleen ( mean of n = 3 ). as controls , naïve mice or mice injected intraperitoneally with 10 5 tcid 50 of live wsn influenza virus were used . the results in fig1 a - 19b show that in contrast to viral immunization with an influenza virus strain bearing the cognate peptide , ig - mediated peptide delivery was ineffective in triggering ifn - γ producing tc1 cells . however , ig - peptide administration still resulted in formation of mhc class i - peptide complexes and induced significant np - specific mhc class i - restricted t cell immunity consisting in il - 4 producing tc2 cells . example 19 shows that in vivo loading of selected apc with disease associated epitopes suppressed an aggravated form of autoimmunity by expanding rather than ablating , epitope - specific autoreactive t sjl mice were injected subcutaneously with 200 μl of rat brain homogenate emulsified in complete freund &# 39 ; s adjuvant and boosted with 50 ng of pertussis toxin at 6 hours and 2 days . the mice developed an aggravated , progressive form of paralytic disease . half of the mice received via subcutaneous injection a combination of recombinant immunoglobulins bearing the mbp and the plp epitopes ( recmbp ( i - as )- igg ; recplp ( i - as )- igg ), respectively ( 150 μg / molecule , on day 8 , 12 , 18 after induction of disease ). in panel a , the mean clinical score for treated and non - treated mice is represented , respectively ( n = 8 ). after a period of observation of 70 days , the mice were sacrificed , spleens harvested and elispot analysis carried out as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μ / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 1 × 10 6 / well together with 20 μg / ml of peptides ( plp or mbp ) or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 % ( elispot buffer ) overnight at 4 ° c . the next day , the plates were washed five times with washing buffer , and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results ( fig2 b ) were expressed as frequency of il - 4 producing t cell colonies in the absence of added plp peptide plotted against the frequency of ifn - γ - producing t cells in condition of peptide stimulation . mice progressing to full - blown limb paralysis ( score equal to or higher than 1 . 5 ) were represented with closed symbols . mice that did not progress to limb paralysis were represented with open symbols . in fig2 c , the total number of il - 4 spot forming colonies / spleen ( mean ± sem ) in condition of in vitro stimulation was represented with nil , mbp or plp peptide . an additional control , consisting of splenocytes from mice treated with igg2b isotype control , has been included . in parallel , in vitro culture was carried out in the presence of neutralizing anti - il - 4 mab ( 40 μg / ml ) and the number of ifn - yγproducing t cells was represented in the panel d . the results in fig2 a - d show that co - administration of mbp and plp epitopes by using recombinant igg significantly curbed the chronic progression of disease . the mice protected from paralysis developed unexpectedly , an enhanced reactivity to self - epitopes mbp and plp , manifested by increased basal and peptide - stimulated il - 4 or ifn - y production , respectively . finally , the reactivity of ifn - γ - producing t cells is kept in check by il - 4 suggesting a complex immunomodulatory mechanism triggered by igg - mediated delivery of epitopes . example 20 summarized the impact of igg / fcγr - mediated delivery of epitopes on the t cell response , based on data provided in the examples 1 - 19 first , the loading of apc t cell response to igg - mediated delivery of t cell epitopes is controlled by two functionally opposing receptors : itim and itam fc ( gamma + )- bearing receptors on apc . itim + fcγriib limits the degree of activation of t cells and gamma + fcrs are required for effective formation of mhc - peptide complexes when epitopes are delivered via the igg backbone . such in vivo delivery of epitope results in effective formation of mhc - peptide complexes on peripheral cd11c + and cd11b + apc , but not thymic apc . however , the interplay between itim + and itam + fcγrs makes the nature and magnitude of resulting t cell response difficult to predict without experimentation . the data in fig2 show that igg - delivery of peptide epitope results in exposure of t cells to peptide - loaded apc in context of limited co - stimulation , having a differential effect on naïve versus activated t cells : 1 ) de novo induction of th2 , tc2 , th3 , tr1 cells and , 2 ) downregulation of activated th1 , th2 cells with stimulation of activated tr1 and th3 cells . the overall effect is immunomodulatory , rather than pro - inflammatory ( associated with th1 and tc1 immunity ). example 21 . naturally occurring dsrna bridges the innate with adaptive immune response . example 21 shows that natural , non - infectious double stranded rna produced during infection with influenza virus , has substantial effects on the specific immune response to a protein antigen permissive mdck cells were infected with wsn influenza virus ( 10 8 tcid 50 / 1 × 10 9 cells ) and after 24 hours , the cells were harvested , washed and the total rna extracted using an rna separation kit ( qiagen , valencia , calif .). the rna was further purified by treatment with rnase - free dnasei ( stratagene , san diego , calif .). the single stranded rna in the samples was then removed by 30 minutes incubation at 37 ° c . with 5 u of s1 nuclease ( ambion , inc ., austin , tex . )/ μg of rna . the rna was analyzed prior to and subsequent to the digestion by gel electrophoresis . the absence of infectious properties of the purified dsrna was confirmed by standard influenza virus titration . as a control , material purified and treated similarly , from 10 9 non - infected mdck cells was used . the concentration of nucleic acid was measured by spectrophotometry ( a 260nm ) and the absence of endotoxin confirmed by limulus assay . the purified dsrna and control rna were used individually , or as a mixture with gp140 recombinant antigen ( 25 μg of rna and 2 μg of antigen in 25 ml of sterile pbs ). after demonstrating lack of infectivity , 40 μg of dsrna or control rna were admixed with 40 μg of recombinant truncated antigen ( gp140 of hiv envelope ) and were administered to balb / c mice by intranasal instillation ( n = 3 / group ). additional controls were animals immunized with 40 μg of gp140 protein in saline ( n = 3 / group ). the mice were boosted once , at 2 weeks after priming . blood was harvested 2 weeks after the boost , sera prepared and the antibody response against gp140 measured by elisa . in brief , wells were coated with antigen ( 2 μg / ml of gp140 ) and blocked with seablock ( pierce , rockford , ill ., catalog # 37527 ). serial dilutions of serum and bronchoalveolar lavage fluid were incubated for at least 2 hours at room temperature . after washing , the assay was developed with anti - mouse igg antibody coupled with alkaline phosphatase ( sigma , cat # a7434 ) followed by addition of substrate ( pnpp , sigma , cat # n2765 ) and measurement by using an automatic microtiter plate reader ( molecular devices , thermomax ) equipped with softmax software . in fig2 a , the general principle of the experiment is illustrated . in fig2 b , the absorption after assay development is represented , corresponding to various serum dilutions , in case of whole igg . in fig2 b , the absorption at 1 / 50 serum dilution , in case of igg2a and igg1 antibody isotypes , is represented . overall , the data in fig2 a - b show that natural , non - infectious dsrna from influenza virus - infected mdck cells , has an unexpected enhancing effect on the adaptive response to a prototype antigen . both igg1 and igg2a antibody responses were increased showing that a strong t helper1 and t helper 2 response was induced . example 22 . effects of selected rna motifs on the innate immune response : heterogeneous motifs . this example shows , unexpectedly , that different synthetic rna motifs have a distinct effect on the adaptive specific immune response to a protein antigen fig2 a shows an extensive library of synthetic rna motifs , that was grouped in pools and used for a two - tier screening process as follows : ( a ) the mice were immunized intratracheally with rna pools , followed by 2 boosts two weeks apart , carried out by intranasal instillation . the antibody response measured ( fig2 b ) by elisa was expressed as mean ± sem of igg endpoint titers ( n = 4 / group ). as controls , dose - matched ova in sterile pbs was used , ova with cholera toxin subunit b ( ctb ) and pbs alone , respectively . in brief , wells were coated with antigen ( 10 μg / ml of ova ) and blocked with seablock ( pierce , rockford , ill ., catalog # 37527 ). serial dilutions of serum and bronchoalveolar lavage fluid were incubated for at least 2 hours at room temperature . after washing , the assay was developed with anti - mouse igg antibody coupled with alkaline phosphatase ( sigma , cat # a7434 ) followed by addition of substrate ( pnpp , sigma , cat # n2765 ) and measurement by using an automatic microtiter plate reader ( molecular devices , thermomax ) equipped with softmax software . ( b ) the effect of various dsrna motifs on the induction of antibody response to ova : the results are expressed as in fig2 c . the data are representative for two independent experiments . inset : the ratio between mean igg2a and igg1 titers to ova . for this purpose , biotin - conjugated anti - mouse igg1 and igg2a antibodies were used followed by incubation with streptavidin - akp conjugate . the order from left to right is similar as in the main panel in fig2 c : pbs ova , ctb ova , pc : pg ova , pi : pc ova and pa : pu ova . ( c ) the magnitude and profile of t cell response induced by ova together with various dsrna motifs , in female c57bl / 6 mice . for the measurement of cellular response , splenic cell suspensions were obtained by passing the organ through 70 micron nylon falcon strainers ( becton dickinson , cat # 352350 ) followed by lysis of red blood cells with red blood cell lysis buffer ( sigma , cat # r7757 ). the lymphocytes from the pulmonary associated lymphoid tissue were isolated by collagenase ( sigma , cat # c9891 ) digestion of lung tissue followed by ficoll - paque ( amersham pharmacia , cat # 17 - 1440 - 02 ) gradient centrifugation . the t cell response was measured by elispot analysis as follows : 96 - well 45 micron mixed cellulose ester plates ( millipore , cat # maha s4510 ) were coated with 4 μg / ml of rat anti - mouse anti - ifnγ , il - 2 or il - 4 monoclonal antibodies ( bd - pharmingen , cat # 554430 , cat # 18161d , cat # 554387 respectively ). after blocking with 10 % fcs in sterile saline for 1 hour at 37 ° c ., spleen cell suspensions were added at 5 × 10 5 cells / well , with or without antigens / peptides . for stimulation , graded amounts of antigen ( ova ) were used . at 72 hours after stimulation , the assay was developed with biotinylated rat anti - mouse cytokine antibodies ( bd - pharmingen ) followed by streptavidin - hrp ( biosource int ., camarillo , calif .) and insoluble aec substrate . the results were measured using an automatic imaging system ( navitar / micromate ) equipped with multiparametric - analysis software ( image pro , media cybernetics ). the results are expressed in fig2 d as mean ± sem of the number of ifn - γ and il - 4 spot - forming - colonies ( sfc ) per spleen ( n = 4 / group ). the results are representative for two independent experiments . the results in fig2 b - d show that different synthetic rnas have an enhancing effect on the b and t cell response to a prototype protein antigen . in addition , different motifs , comprising specific nucleotide combinations , have specific effects in terms of t1 versus t2 induction and subsequently , immunoglobulin isotype switching . example 23 . use of selected synthetic rna motifs facilitates the induction of mhc class i - restricted tc1 cells , producing ifn - γ ( a ) cross - priming stimulated by dsrna motifs was studied in balb / c mice treated ( priming plus 2 boosts ) with 10 μg of recombinant - engineered hiv gp140 antigen together with pa : pu . the response was measured by elispot analysis as described in example 22 , using in vitro stimulation with the mhc class i - restricted cognate peptide r10k derived from the v3 domain . as a control , dose - matched gp140 antigen was used . the results are expressed in fig2 a as mean ± sem of the number of ifn - γ and il - 4 sfc / spleen ( n = 4 / group ). ( b ) cross - priming stimulated by dsrna motifs was studied in c57bl / 6 mice treated with 100 μg of whole ova together with pa : pu by elispot analysis as described in example 22 , using in vitro stimulation with the mhc class i - restricted peptide siinfekl ( seq . id no .). as a control , dose - matched ova antigen in saline or sterile pbs was used . the results are expressed in fig2 b as mean ± sem of the number of ifn - γ and il - 4 sfc / spleen ( n = 4 / group ). the results in fig2 a - b show that a selected synthetic rna motif was able to promote increased t cell immunity to different mhc class i - restricted peptides encompassed within larger antigens ( polypeptides ). this immune response comprised a tc1 component , consisting in ifn - γ - producing mhc class i - restricted t cells . example 24 shows that unexpectedly , different synthetic rna motifs bind to different receptors ; in other words , there are multiple receptors that discriminate among rna motifs in vitro binding of cd11b + apc by fluorescently - tagged pa : pu was measured by facs analysis . the macs - separated apc were incubated at 4 ° c . for 30 minutes with 10 μg / ml of tagged pa : pu ([ pa : pu ]- f ), washed and analyzed . alternatively , apc were preincubated for 10 minutes with 20 or 100 μg / ml of non - tagged pa : pu , pa or pi : pc respectively , before staining with tagged pa : pu and facs analysis . the profiles of stained ( open area ), non - stained ( filled area ) cells and the percentage of highly stained apc were represented in each panel , with logarithmic x axis . the data are representative of two independent measurements with 10 , 000 events acquired for each sample . 1 . mouse cd11b , cd11c magnetic separation beads : miltenyi biotec , cat # 130 - 049 - 601 , cat # 130 - 052 - 001 respectively ; 2 . ulysis nucleic acid labeling kit : alexa 488 , molecular probes cat # u21650 ; 6 . collagenase buffer : 0 . 225 mg bsa , 0 . 0062 mg collagenase in 50 ml rpmi ; and , 1 . in the following protocol , each rna motif was tagged with the ulysis alexa 488 label . 1 . isolate splenocytes and lung cells from 4 female c57 bl / 6 mice ; lung cells , in contrast to splenocytes , must be minced and incubated in collagenase buffer for 30 minutes at 37 ° c . prior to the following step ; 2 . label with either cd11b or cd11c specific macs beads following suggested protocol ; 3 . cells were then treated with : non - tagged pa , pa : pu , or pi : pc ( 20 or 100 ug / ml ) for 10 minutes at room temperature ; ulysis tagged pa or pa : pu was added at 1 . 5 ug / tube and 10 ug / tube , respectively , to match dye : dsrna ratio of each motif . run flow cytometric analysis to determine / compare competitive inhibition of tagged versus non - tagged rna motifs and cell receptor binding . the results in fig2 show that pa : pu and pi : pc bind to different cellular receptors . since pi : pc binds to tlr3 , it results that additional receptors distinct from tlr3 are involved in rna recognition immune function . example 25 shows that selected synthetic rna motifs trigger in vivo expression of chemokine genes , of importance for immunological activity local up - regulation of chemokine gene - expression by dsrna motifs was measured by dna array technique using rna from the pulmonary tissue , extracted one day after the administration via the respiratory tract . total rna was isolated from lungs using an rneasy kit ( qiagen , valencia , calif .). the rnas were further purified by treatment with rnase - free dnase i ( stratagene , san diego , calif .). dna array was performed by using the nonrad - gearray kit from superarray inc . ( bethesda , md .). briefly , cdna probes were synthesized using mmlv reverse transcriptase with dntp mix containing biotin - 16 - dutp . the gearray membranes were prehybridized at 68 ° c . for 1 - 2 hours . the hybridization was carried out by incubation of the membranes with biotin - labeled cdna . the hybridized membranes were washed in 2 × ssc - 1 % sds twice and 0 . 1 × ssc - 0 . 5 % sds twice . the membranes were fuirther incubated with alkaline phosphatase - conjugated streptavidin ( biosource int ., camarillo , calif .) and finally developed with cdp - star chemiluminescent substrate . the intensity of signal was measured with image - pro analysis system equipped with gel - pro software ( media cybernetics , silver springs , md .). the results are expressed as fold - increase of gene expression , over expression levels measured in the pulmonary tissue of non - treated mice . the pattern of chemokine expression triggered by dsrnas ( 50 μg of pa : pu and pi : pc , respectively ) was compared to that induced by 1 μg of lps . the chemokines that selectively bind to receptors on th1 and th2 cells were indicated with continuous and interrupted contours , respectively . the results in fig2 show that pa : pu and pi : pc trigger expression of a wide range of chemokines and that the expression pattern is motif - dependent and different from that elicited by lps ( endotoxin ). example 26 shows that selected synthetic rna motifs mobilize an immune defense that is capable to control infection with a pulmonary virus dsrna motifs display differential ability to mobilize immune defense against influenza virus infection . c3h / hej mice were treated via the respiratory route with 50 μg of pi : pc , pa : pu or 50 μl of saline one day before and after pulmonary infection with a sublethal dose of influenza virus . for virus challenge , c57bl / 6 and tlr4 −/− c 3 h / hej mice under metofane anesthesia were infected with sublethal doses ( 10 4 tissue culture infective doses 50 %- tcid 50 ) of live wsn virus , via the nasal route . on day 5 after infection , the mice were sacrificed , lungs retrieved , homogenized and stored at − 70 ° c . the virus titers were measured by 48 - hour incubation of serial dilutions of samples with permissive mdck cells , followed by standard hemagglutination with chicken red blood cells ( from animal technologies ). the endpoint titers were estimated in triplicate measurements by interpolation and expressed as tcid 50 / organ ( means ± sem ; n = 6 / group ; results are representative of two independent studies in c 3 h / hej tlr - 4 −/− and competent mice ). similar results were obtained in tlr4 competent , c57bl / 6 mice . thus , the results depicted in fig2 show that the control of replication of influenza virus can be achieved by using selected synthetic rna motifs ( dsrna1 is pa : pu and dsrna2 is pi : pc ). example 27 shows that co - administration of selected synthetic rna motifs breaks tolerance to high dose standard antigen dsrna motifs prevent high - zone tolerance in mice injected with human igg . the mice ( c57bl / 6 ) were initially injected intravenously with a toleragenic dose of 200 μg of higg alone ( closed symbols ) or together with 100 μg of pi : pc or pa : pu ( open symbols ) and subsequently boosted subcutaneously with an immunogenic dose of 100 μg of higg emulsified in cfa . the titer of antibodies against higg was measured by elisa ( as detailed in the example 23 , with the difference consisting in use of 10 μg / ml of higg for coating ) at various intervals after the first injection . as a control , mice immunized with 100 μg of higg emulsified in cfa were included and represented the maximal titer on the graph ( interrupted line ). the results are represented in fig2 as means ± sem of endpoint titers ( n = 5 / group ). similar results were obtained in tlr4 deficient ( c3h / hej ) and lps - responsive c3h / snj mice . thus , the results in fig2 show that selected synthetic rna motifs pi : pc and pa : pu largely prevent high zone tolerance that is usually associated with administration of large amounts of purified protein . example 28 shows that selected rna motifs induce differential cytokine production by human apc human thp - 1 monocytic cells , following differentiation , were incubated with different concentrations of synthetic rna ( pa : pu , pi : pc or pa ) for 24 hours , and the cell supernatants collected . the concentration of il - 12 and tnf - α were measured by elisa . the results are expressed in fig2 as pg / ml ( concentration ) for each cytokine and culture condition . pa : pu , ( sigma , lot # 22k4068 ); pi : pc , ( sigma , lot # 52k4047 ); and , pa , ( sigma , lot # 22k4022 ). 1 . the thp - 1 cells were allowed to differentiate following addition of 10 ng / ml pma in media containing 10 % fcs . 2 . after gently washing cells and adding non - fcs containing media ( hl - 1 ), treatments ( rna motifs and controls ) were added at concentrations of from 3 to 100 μg / ml on top of adherent thp - 1 cells . 3 . after 24 hours incubation , cell supernatants were harvested and il - 12 and tnf alpha concentrations were measured by elisa . the results in fig2 show selected synthetic rna motifs effect on human monocytic cells ; in addition , this effect is heterogeneous , depending on the chemical structure of the motifs ( nucleotide composition ). selected but not all synthetic rna motifs are able to trigger il - 12 production , an important t1 regulatory cytokine , by human monocytic cells . example 29 shows that two distinct synthetic rna motifs bind to human thp - 1 monocytic cells in a manner demonstrating interaction with different receptors thp - 1 cells were incubated at for 15 minutes at room temperature with different amounts of non - labeled synthetic rna . subsequently , tagged pa : pu was added for 30 minutes at 4 ° c ., cells washed and the fluorescence quantified by facs analysis . the results are expressed in fig3 a - 30b as histograms corresponding to the large cell subset ( a ) and total cell population ( b ). percentages of stained cells were represented on each figure . 1 . ; following removal of endotoxin using a detoxi - gel column , pa : pu was labeled with the alexa fluor 488 fluorescent dye using the ulysis nucleic acid labeling system . the pa : pu was precipitated using sodium acetate and ethanol at − 70 ° c . ; the pa : pu was heat denatured and labeled with the alexa fluor 488 reagent at 90 ° c . ; and , 2 . 50 μl of above suspension ( 5 × 10 4 cells ) were placed in 12 × 75 mm tubes ; 3 . non - tagged pa : pu or pi : pc were added to the thp - 1 cells at a concentration of either 20 or 100 μg / ml and incubated 15 minutes ; ulysis labeled pa : pu was added at a concentration of 100 ug / ml for 30 minutes on ice . 4 . the thp - 1 cells were washed once and suspended in facs buffer followed by flowcytometric analysis to determine relative fluorescent differences between different treatment populations . the results in fig3 a - 30b show that non - tagged pa : pu but not non - tagged pi : pc was able to compete out the binding of tagged pa : pu to human thp - 1 monocytic cells , both at the level of large cell subset and whole population . example 30 shows how the adjuvant synthetic rna should be prepared and purified prior to use in its most effective format the bulk synthetic rna material is obtained by standard methods of organic synthesis . afterwards , the material is dissolved in sterile endotoxin - free saline , passed through endotoxin removal columns until the concentration of lps is below 0 . 005 eu / μg . the measurement of lps is carried out by standard limulus assay . subsequently , the material is fractionated by a series of centrifugation steps through filters of defined porosity ( see fig3 ). a useful fraction comprises synthetic rna of less than 20 to maximum 100 bp size , however , larger rna fragments may be used . after purification , the material is measured and validated on standard assays : spectrophotometry ( od260 nm ); gel electrophoresis ; endotoxin quantitation by limulus assay ; bioactivity on human thp - 1 cells ( as in example 28 ). example 31 shows that unexpectedly , different fractions of a selected synthetic rna compound are endowed with different biological activity , based on size differentiated human thp - 1 monocytic cells were incubated with different concentrations of synthetic rna ( pa : pu , fractionated as described in the example 30 ) for 24 hours , and the supernatants collected . the concentration of tnf - α was measured by elisa using biosource international kits ( camarillo , calif .). the results are expressed in fig3 as pg / ml ( concentration ) for each culture condition . the results depicted in fig3 show that lower molecular weight fractions of a selected synthetic rna compound are endowed with higher biological activity , in terms of cytokine production , by human monocytic thp - 1 cells . example 32 . selected synthetic rna motifs , have unexpectedly , a different immune profile in regard to generation of anti - rna antibodies balb / c mice were immunized intraperitoneally and subcutaneously with 50 μg + 50 μg of higg and synthetic rna ( pi : pc or pa : pu ) and serum samples were prepared 1 week later . as a control , mice injected with higg in saline were used . the anti - higg , and dsrna igg antibody titers against pa : pu , pi : pc , pa and higg were measured by elisa . in brief , wells were coated with antigen ( 10 μg / ml of higg or synthetic rnas ) and blocked with seablock ( pierce , rockford , ill ., catalog # 37527 ). serial dilutions of serum and bronchoalveolar lavage fluid were incubated for at least 2 hours at room temperature . after washing , the assay was developed with anti - mouse igg antibody coupled with alkaline phosphatase ( sigma , cat # a7434 ) followed by addition of substrate ( pnpp , sigma , cat # n2765 ) and measurement by using an automatic microtiter plate reader ( molecular devices , thermomax ) equipped with softmax software . the results are expressed in fig3 as mean ± sem of endpoint titers ( n = 3 / group ). the results in fig3 show that pi : pc but not pa : pu induced antibody response against itself , with a cross - reactive component against another rna motif . example 33 . in vivo loading of apc by recombinant igg results in generation of tc1 type of mhc class i responses only when additional conditions are satisfied balb / c mice were immunized with 50 ug of recigg - np ( kd ) subcutaneously , admixed with 50 ug of selected synthetic rna ( pa : pu or pi : pc ). as a control , naive mice or mice immunized with recombinant igg only were used . at 3 weeks after immunization , the t cell response was measured by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with np 147 - 155 peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day , the plates were washed five times with washing buffer and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the frequency of cytokine producing t cells reacting to np peptide was measured and expressed against the amount of peptide used for stimulation . the results are expressed as means + sem of triplicates ( n = 3 mice / group ). as shown previously in fig1 , the administration of recombinant igg bearing the np mhc class i - restricted epitope resulted in generation of tc2 immunity but not tc1 response , implying in vivo formation of class i - peptide complexes with a specific co - stimulation profile . the results in fig3 a and 34b show that co - use of selected synthetic rnas promoted effective induction of il - 2 and ifn - gamma subsequent to igg mediated delivery of an mhc class i - restricted epitope ( dsrna1 is pa : pu and dsrna2 is pi : pc ). example 34 : effective formation of mhc class i - peptides and instruction of the resulting t cell response by simultaneous manipulation of apc loading via fcgamma r and activation via rna receptors splenic apc were isolated from naive balbc mice and pulsed ex vivo overnight with 1 ug np peptide , or 50 μg recigg - np ( kd ) with or without 50 μg / ml selected synthetic dsrna ( pa : pu ). the cells were washed and 5 × 10 6 cells were administered by s . c . and i . p . injection equal amount , to naive balb / c mice . the response was measured 3 weeks later by elispot analysis as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 μg / ml for anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 30 μg / ml , 10 μg / ml , or 3 μg / ml np peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day the plates were washed five times with washing buffer and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results are expressed in fig3 as frequency of cytokine producing spot - forming colonies against the concentration of peptide used for ex vivo stimulation ( mean ± sem , n = 3 mice / group ). in addition , the mean area / colony versus the concentration of peptide used for stimulation is plotted , for both ifn - gamma and il - 4 ( arbitrary units ). the results in fig3 show that ex vivo apc loading by recombinant igg is significantly more effective in formation of mhc class i - peptide complexes and generation of tc response , compared to use of peptide itself . in addition , the mere formation of mhc class i - peptide complexes subsequent to epitope delivery via igg / fcgammar results in differentiation of tc2 cells producing il - 4 but not ifn - gamma . simultaneous treatment of apc with selected synthetic rna results in broadening of the t cell profile , to ifn - gamma producing tc1 cells . example 35 shows that co - priming with igg - peptide together with a selected co - stimulatory motif resulted in more effective secondary expansion of mhc class i - restricted t cells subsequent of virus infection balb / c mice were injected with recigg - np ( kd ), pa : pu separately , or in combination ( 50 ug / injection ). as a control , naive mice were used . three weeks after treatment , the mice were infected with 104 tcid50 of a / wsn / 32 h1n1 influenza virus , via the respiratory tract . four days after infection , the t cell profile in the spleen was measured by elispot analysis subsequent to ex vivo stimulation with np peptide as follows : the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with 20 μg / ml np peptide or just with media , to assess the background . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day the plates were washed five times with washing buffer and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results are expressed in fig3 as frequency of np - specific mhc class i - restricted t cells forming cytokine producing colonies ( means ± sem , n = 4 mice / group ). the results in fig3 show that igg mediated delivery of a class i restricted epitope is most effective in priming class i restricted tc1 responses when co - administration of selected synthetic rna was carried out . such primed precursors were rapidly expanded subsequent to infection with influenza virus . example 36 show that the most effective priming of cytotoxic lymphocytes recognizing an mhc class i - restricted epitope occurs by co - administration of selected rna motif together with peptide epitope inserted within the igg backbone balbc mice were immunized and challenged with recigg - np ( kd ) as in the previous example and sacrificed 4 days after influenza virus infection . the splenocytes were prepared , suspended in hl - 1 medium at 5 million / ml and co - incubated for 5 days with 10 μg / ml of np 147 - 155 peptide and in presence of 5 u / ml of recombinant il - 2 . splenocytes from 4 mice / group were pooled and incubated in flasks . after expansion , viable cells were recovered by ficoll gradient centrifugation , washed and incubated for 5 hours in v - bottom plates , in various numbers , with a fixed number of sp20 target cells with or without np peptide ( 20 μg / ml ). the supernatants were harvested after plate centrifugation , and the concentration of ldh measured by using a promega kit ( cat # g1780 ). the results are expressed as percent specific lysis at different e : t ratios ( effector to target ratio ). the results in fig3 show that effective priming of anti - viral cytotoxic t cells requires both effective in vivo loading of apc with class : i restricted epitope delivered via igg , together with appropriate instruction by selected synthetic rna motif , namely pa : pu . example 37 shows that vaccination with an igg bearing a viral mhc class i - restricted epitope , together with selected synthetic rna motif , provided protection against infectious challenge with a prototype virus balb / c mice were immunized with 50 ug of recigg - np ( kd ) together with 50 ug of selected synthetic rna ( pa : pu ), by subcutaneous injection . three weeks after immunization , the mice were challenged with 10 4 tcid 50 of infectious wsn influenza virus and sacrificed 5 days later . the pulmonary virus was titrated in lung homogenates by standard mdck hemagglutination assay as follows : on day one mdck cells were plated in 96 well plates at 2 × 10 4 / well / 200 ul and incubated for 24 hours at 37 ° c ., 5 % co 2 . the next day , 25 μl of the 10 fold dilutions in dmem media of the lung homogenates were incubates in briefly tripsinized mdck plates ( 1 minute ) in triplicates and incubated at 37 ° c . after one hour , 175 ul of the dmem complete media was added and plates were incubated for 48 hours at 37 ° c ., 5 % co 2 . after two days , the hemagglutination - inhibition was done with chicken red blood cells incubated with the cell culture supernatants from the mdck plate for 30 minutes at room temperature and the results were expressed as means ± sem of total pulmonary virus ( n = 4 mice / group ). as a control , non - immunized mice were used . the results in fig3 show that immunization with a recombinant igg bearing a viral class i restricted epitope together with selected synthetic dsrna ( pa : pu ) resulted in priming of an immune response capable to limit the replication of a virus subsequent to infectious challenge . example 38 . fig3 describes the tumor models used for testing the efficiency of a ig - peptide - based molecules balb - c mice ( k d restricted ) have been used to establish a tumor model . tumor cells ( 1 to 15 million in 100 μl ) were typically injected in the flank to the mouse ( see arrow in upper photo in fig3 ). primary tumors ( i . e . those at the sight of injection ) were first detected by palpating the area and then quantitated by measuring the tumor size with a caliper ( see fig3 ). in one series of experiments , the mouse myeloma cell line ( sp2 / 0 ), either untransfected cells or cells stable transfected expressing heterologous protein ( recombinant igg expressing different epitope peptides in the cdr3 region of the heavy chain or the complete np protein ), was used to induce tumors in the mice . expression of heterologous proteins in the sp2 / 0 cells provided specific tumor associated antigens ( taa ) for testing various anti - tumor strategies in the immunocompetent mice . typically , untreated mice developed palpable solid primary tumors 1 week post injection that led to morbidity and death over the next 4 weeks . postmortem examination of the injected mice revealed metastatic lesions ( see fig3 ). sp2 / 0 cells were cultured from primary tumor tissue as well as spleen taken from tumor - bearing mice ( data not shown ). sp2 / 0 cells were stably transfected with a recombinant igg - expressing plasmids that were all identical except for the specific epitope sequence introduced into the cdr3 region of the heavy chain , for example , the mhc i restricted np epitope ( amino acids 147 - 155 , see fig3 ). sp2 / 0 cells were also stably transfected with a plasmid containing the coding sequence for the entire np protein of wsn virus under control of the cmv promoter . all transfected cell lines produced primary tumors over the same frame as wild type sp2 / 0 cells . this tumor model was extended to include an adenocarcinoma cell line ( 4t1 , atcc crl - 2539 , k d restricted ), previously shown to induce metastatic tumors in balb - c mice . the 4t - 1 cell line was similar to that described above for the sp / 0 line . injection of 1 to 15 million 4t - 1 cells into the flank of balb - c mice produced a palpable primary tumor over a time frame similar to injections of sp2 / 0 cells eventually leading to death . postmortem collection of tissue from various organs showed that 4t - 1 could be recovered from spleen , lungs as well as the primary tumor ( not shown ). 4t - 1 cells were stably transfected with a np - expressing plasmid described above . as with sp2 / 0 cells , transfection of the 4t - 1 cell did not affect the course of tumor growth and lethality of disease . example 39 demonstrates successful control and treatment of a tumor after clinical diagnosis , by using a tumor associate t cell epitope within a recombinant igg together with a selected co - stimulatory rna motif balb / c mice were injected with sp2 / 0 cells ( 15 million in 100 μl ) stably expressing recombinant igg carrying the mhc i ( kd ) np epitope peptide in the cdr3 region of the heavy chain ( ignp ). at day 7 post injection all mice had palpable tumors and the mice were randomized into 3 groups : co - stimulatory motif ( i . e . dsrna comprised of polymeric papu ) alone ; purified igtaa protein ( ignp ); and both dsrna pa : pu and purified igtaa protein . the time of treatment is indicated by the arrows in fig4 , and each injection contained 50 jig of the indicated compound . the mice that developed metastatic disease and died are represented with a “ d ” in the figure . the data show that the combination of dsrna ( co - stimulatory motif ) and igtaa ( ignp ) produced a dramatic protective response in mice that all had primary tumors at the start of therapy . while all mice treated with either the dsrna or igtaa compound alone succumbed to disease , 100 % of the mice treated with both were still alive 3 weeks after initiation of treatment and were in good clinical condition at the time of sacrifice for measurement of t cell response . these data show that in vivo loading of apc with taa ( accomplished by uptake of ignp via the fc receptor of apc ) is not sufficient for a potent anti - tumor response . the tumor rejection and survival displayed by mice treated with ignp in combination with papu dsrna highlights the important role co - stimulation plays in treatment of tumors with tumor - associated antigens . in conclusion , the results in fig4 show that both effective in vivo loading of apc with tumor associated antigen , together - with simultaneous activation by selected synthetic rna motifs , are necessary and sufficient for effective control of tumor growth and induction of tumor rejection . example 40 . this example , in context of sublethal inoculation of tumor cells , shows that the suboptimal response to tumor antigens could be corrected by therapy with peptide epitope within an igg backbone , together with co - stimulatory motif balb / c mice were injected with sp2 / 0 cells stably expressing recombinant igg ( ignp ) that contains the mhc i ( k d ) epitope ( amino acids 147 - 155 ) of wsn virus nucleoprotein in the cdr3 of the heavy chain . the cell inoculum was 1 million cells ( in 100 μl ) per mouse . the mice were observed until such time as palpable tumors were detected at the site of injection . at this point the tumors were measured and 8 mice were left untreated ( control ) while 6 were injected intratumorally with purified igtaa ( i . e . purified ignp , 2 mg / kg ) and dsrna ( papu , 4 mg / kg ) weekly . weekly measurements of the tumors were taken . panel a of fig4 shows that in 6 of 8 of the control mice the induced tumor was progressive and ultimately lethal whereas 2 of the mice completely rejected the tumor spontaneously . panel b of fig4 shows that the 3 weekly treatments with ignp / dsrna ( indicated by the arrows ) stimulated complete tumor rejection in 4 of the 6 mice and significant remission in another . the results in fig4 shows that both effective - in vivo loading of apc with tumor associated antigen , together with simultaneous activation by selected synthetic rna , can trigger an effective immune response to tumor - associated antigens . example 41 shows that therapy of tumor - bearing mice with a tumor epitope within an igg backbone together with co - stimulatory synthetic dsrna results in the restoration of the activatory status of tumor infiltrating lymphocytes two balb / c mice were injected with 10 million sp20 transfectoma expressing the np - k d epitope . after tumors developed , one mouse was injected intratumorally with 50 μg of selected dsrna motif ( papu ) plus 50 μg of “ ignp ”- recigg - np ( k d ) in saline . the mice were sacrificed 24 hours later , tumors excised , digested with collagenase , filtered through 70 um filter and viable cells isolated on ficoll gradient . cells were stained with mabs against tcrβ , cd25 or isotype control and assessed by facs analysis . the results were expressed as histograms , with percentage stained cells indicated . 5 . collagenase buffer : 0 . 225 m bsa + 0 . 00625 gm in 50 ml rpmi ; 3 . tumor was minced with sterile scissors and 10 ml of collagenase buffer added ; 5 . force tumor through a 70 μm falcon filter with a 3 ml syringe plunger into a 50 ml tube while washing with rpmi ; 6 . wash 1 × and resuspend in 4 mls warm rpmi buffer ; 7 . with equal volume of cell suspension layered over ficoll , centrifuge at rt , 2000 rpm , for 15 minutes ; 8 . isolate layer and wash once in hl - 1 buffer and resuspend in facs buffer to 2 × 10 6 / ml and run flow cytometry analysis ; 10 . cells were placed in 12 × 75 mm tubes , 50 μl / tube and stained with fitc labeled anti - mouse antibody , 2 μg / tube plus 1 μl / tube mouse serum : isotypic control ; anti - cd40 ; anti - cd8 ; anti - cd4 ; anti - cd25 ; anti - tcr gamma delta ; anti - tcr beta ; 12 . wash once with facs buffer and resuspend in 300 μl facs buffer . the results in fig4 show that tumor infiltrating lymphocytes displaying the t cell receptor marker tcrβ acquired expression of the activation marker cd25 upon treatment with recombinant immunoglobulin bearing tumor associated epitope , together with selected synthetic dsrna motif . example 42 shows that successful therapy of tumor bearing mice with a peptide epitope within the igg backbone together with a selected co - stimulatory molecule is associated with a specific differentiation pattern of tc , comprising tc1 in addition to tc2 mice that successfully rejected the tumor following treatment with recombinant ig carrying a tumor associated epitope together with selected synthetic dsrna motif as explained in example 40 , were sacrificed and the t cell response against tumor associated epitope measured by elispot analysis . the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with various concentrations of np peptide . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ), and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day the plates were washed five times with washing buffer , and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results were expressed as number ( mean ± sem ) of spot forming colonies corresponding to il - 4 , il - 2 and ifn - γ . as a control , non - treated mice were used , which failed to reject tumor ( n = 4 / group ). the results in fig4 show that the treated mice that successfully rejected the tumor , developed tc1 responses against the tumor associated epitope on the therapeutic ig , along with tc2 immunity . in contrast , the mice that failed to reject the tumor developed only tc2 immunity . example 43 shows induction of effective memory response subsequent to specific treatment of tumor bearing mice with a t cell epitope within the igg backbone , together with a selected co - stimulatory motif mice bearing sp2 / 0 tumors expressing the np - k d taa were treated as described in the example 40 , by injection with recombinant ig bearing taa together with selected synthetic rna motifs . after tumor rejection , the mice were challenged by subcutaneous injection administered contralaterally , with 15 million sp2 / 0 cells expressing np - kd epitope . in parallel , 4 control naïve mice were similarly injected with a tumorigenic / lethal dose of same type of cells . the development and size of the tumors was monitored and represented as diameter ( mm ) versus time since challenge . the results in fig4 show that successful rejection of the tumor induced by indicated treatment is followed by effective protection against subsequent challenge with the same tumor , indicating development of effective immune memory . example 44 shows that surprisingly , the induction of tumor rejection by an igg bearing a taa together with a costimulator dsrna motif , results in cross - protection against a range of tumor cell variants lacking the taa or displaying variants of taa the mice protected against homologous challenge as described in example 43 , were subjected to sequential challenge with 15 million tumor cells representing the same tumor cells devoid of taa ( loss of antigen mutants ) or bearing variants of taa lacking the np - k d epitope . in addition , mice were challenged with a different type of tumor cell line ( 4t - 1 adenocarcinoma ) as a control , displayed in the table attached to fig4 a . in every case , naïve controls were included . the status of t cell immunity of mice protected against multiple challenges with tumor variants , has been assessed by elispot analysis using splenic cell suspensions stimulated with taa ( np - kd peptide ), ha ( mhc class ii - restricted peptide ), or protein extracts from cell lysates . the elispot plates ( millipore , molsheim , france ) were incubated with purified anti - cytokine abs ( 4 ug / ml for anti - il2 and anti - il4 , and 8 μg / ml for anti - ifn gamma , from bd pharmingen ) in sterile pbs ( 50 μl / well ) at 4 ° c . overnight . the next day , the plates were washed 2 times with dmem media and blocked with 200 μl / well of dmem complete containing fbs , for an hour at 37 ° c . single cell suspension was made from the spleens , red blood cells were lysed , cells washed , counted and incubated at 5 × 10 5 / well together with various concentrations of antigen . plates were incubated 72 hours at 37 ° c ., 5 % co2 . after 3 days , the plates were washed 5 times with pbs - tween20 0 . 05 % ( washing buffer ) and incubated with 100 μl / well of biotinylated anti - cytokine abs , 2 μg / ml in pbs - tween20 0 . 05 %- fbs 0 . 1 %( elispot buffer ) overnight at 4 ° c . the next day the plates were washed five times with washing buffer , and incubated for an hour with 1 : 1000 streptavidin - hrp diluted in elispot buffer . the reaction was developed with 3 - amino - 9 - ethylcarbazole substrate ( sigma , st . luis , mo .) and stopped by washing the plate twice with tap water . the plates were then allowed to dry at room temperature for 24 hours . the data were acquired using an automated system ( navitar , rochester , n . y .) with imagepro - plus ) software ( media cybernetics , silver spring , md .). the results were expressed as number ( mean ± sem ) of spot forming colonies corresponding to il - 4 , il - 2 and ifn - γ . as a control , non - treated mice that failed to reject tumor ( n = 4 / group ) were used . as a control , naïve mice were included . the data are expressed as number ( mean ± sem ) of cytokine producing cells / organ ( n = 3 / group ). the results in fig4 a - 45b ( including the table in fig4 a ) show that the emerging immunity , subsequent to the indicated treatment that results in tumor rejection , protects against challenge with loss of antigen variants and is associated with overall expansion of cytokine producing cells . this indicates a broadening of the repertoire of anti - tumor lymphocytes , promoted by the proposed regimen , to tumor associated antigens that are not borne by the immunotherapeutic molecule .

US-52793105-A

a cortical sensing device is provided that includes a sensing element and at least one pad attached adjacent to a support member . the pad is substantially thin and made from flexibly - conformable material to accurately and safely place the sensing device upon the brain surface . contact between the lower surface of the pad and the brain surface anchors the sensing element at a desired position against unintentional movement . the sensing device preferably has three circular pads equidistant from one another . a method to position a cortical sensing device upon a brain surface is also disclosed comprising the steps of providing a cortical sensing device having a sensing element and three dielectric pads attached to a support dielectric member where the member and the pads are thin and flexibly - conformable , placing the sensing device upon the brain surface at a desired position for sensing brain activity , and allowing the pads to conform to the brain surface so that interaction therebetween prevents movement of the sensing element along the brain surface .

fig1 is a top view of a cortical sensing device 10 having a preferred embodiment in accordance with this invention . cortical sensing device 10 includes a sensing element , preferably an electrical contact 12 as shown , secured to circular support member 14 . support member 14 is provided with a circular opening 16 surrounded by a rim 18 . contact 12 has a central disk 20 with support - flange 22 extending along the circumference of disk 20 . opening 16 is sized to receive disk 20 in a manner where lower surface 24 of disk 20 can protrude downward from and not be covered by support member 14 . disk 20 protrudes no more than 0 . 025 in . through opening 16 and , in certain preferred embodiments , lower surface 24 is flush with support member 14 . support - flange 22 is preferably adhesively sealed along its length to rim 18 . cortical sensing device 10 is also provided with three substantially similar circular pads 26 extending outward from support member 14 . support member 14 and pads 26 are formed from a single thin and substantially planar layer 28 of a dielectric material that is both flexible and bio - compatible . a silicone material such as a medical grade of silastic ® is preferred although an equivalent dielectric elastomer can also be used . the material is also preferably transparent to enable the underlying features of the cortical surface to be visualized when sensing device 10 is placed upon the brain . as illustrated in fig1 - 2 , layer 28 has a thickness t and each pad 26 has a diameter d . the thickness of layer 28 is substantially uniform throughout the strip , preferably about 0 . 006 in . the diameter of each pad 26 ranges from 0 . 25 in . to 0 . 35 in . the center 30 of each pad 26 is equidistant from the centers of the other two pads , thereby forming a clover - like shape . each pad 26 is attached to support member 14 along an arc 32 . a proximal end 34 of a single lead wire 36 is electrically secured to contact 12 by solder or by being crimped within lip 38 of support - flange 22 . as seen in fig2 , upper cover 40 is placed over contact 12 and adhesively sealed to support member 14 . cover 40 is formed from a transparent , bio - compatible , dielectric material similar to that comprising layer 28 . cover 40 has a diameter slightly less than that of support member 14 . a portion of wire 36 is embedded between cover 40 and support member 14 to further firmly secure wire 36 to sensing device 10 . distal end 42 of wire 36 is electronically attached to socket 44 . fig3 shows a number of sensing devices 10 positioned upon the surface 46 of the cerebral cortex following a craniotomy . sockets 44 of each wire 36 have a tapered interior to snugly receive a connector pin 52 on a connector 48 in frictional engagement . connector 48 is mounted upon a support apparatus 50 , each being illustrated in fig3 - 5 in a preferred embodiment in accordance with this invention . pads 26 interact with brain surface 46 so that sensing device 10 clings to the cortex . lateral movement of sensing device 10 is avoided once each sensing device 10 has been individually positioned at a desired specific location that is selected by the physician for that sensing device 10 to perform a certain procedure such as sensing brain activity . bathing each sensing device 10 in saline or sterile water before placing it upon brain surface 46 helps in preparing sensing device 10 for secure placement . disk surface 24 of contact 12 makes direct contact with brain surface 46 . contact 12 is preferably platinum or stainless steel and can be utilized to measure brain electrical activity or to provide electrical stimulation to a select tissue region . other sensing elements such as chemical sensors and optical sensors can be used in place of or in connection with an electrical contact or electrode to monitor chemical activity , temperature and blood flow within the cortex . pulling upward upon sensing device 10 in a direction away from brain surface 46 allows sensing device 10 to be disengaged from brain surface 46 for relocation to another site on brain surface 46 where sensing device 10 can initiate similar treatment . as can be seen in fig3 , pads 26 do not need to be sandwiched between the dura and the cortex to remain in place . moreover , given the size and shape of sensing device 10 , one can clearly see that the weight of sensing device 10 is less of a factor in its ability to stay in one spot than is the case for the heavier strip sensing devices in the prior art . the thinness of pads 26 , the length of arcs 32 , and the nature of the material selected for layer 28 each contribute to the ability of pads 26 to retain their shape but still be sufficiently flexible to conform to an area of brain surface 46 of comparable size . each arc 32 has a length less than the diameter of support member 14 and less than the diameter of pad 26 . each pad 26 is capable of swinging about its adjacent arc 32 independently of any other pad 26 such that each pad 26 is free to drape over the portion of brain surface 46 directly beneath it . in this manner , sensing device 10 provides as much as 300 % more area in direct contact with brain surface 46 than is touched by contact 12 and its surrounding support member 14 alone . as illustrated in fig3 - 5 , connector 48 is provided with a plurality of connecting pins 52 . each pin 52 is in electrical communication with an electrical conduit 54 , each wire conduit 54 having an input jack 56 attached at the end opposite from the corresponding connecting pin 52 . input jack 56 enables the electrical conduit 54 and thereby the associated sensing device 10 to be connected to an external device 58 . where sensing device 10 is intended to monitor electrical brain activity , external device 58 will preferably consist of a conventional monitoring device with output display and a suitable power source to record or display information communicated by sensing device 10 . electrical conduits 54 preferably combine to form a conduit ribbon 60 upon exiting connector 48 so that individual loose wires can be avoided . as seen in fig4 , conduit ribbon 60 separates into the individual electrical conduits 54 at a distance from connector 48 to enable one or more input jacks 56 to be electronically attached to the necessary external devices 58 . connector 48 is mounted to support apparatus 50 to provide better access to connector 48 during treatment of a patient . as illustrated in fig3 and 4 , support apparatus 50 includes a clamp 62 for attaching support apparatus 50 to the skull 64 . clamp 62 comprises a lower clamping portion 66 forming the proximal end 67 of a post 68 and an upper clamping portion 70 slidably disposed upon post 68 . fig5 shows that lower clamping portion 66 has a smooth lower clamping surface 72 extending outward from axis 74 of post 68 . upper clamping portion 70 is provide with a serrated upper clamping surface 76 that is in registry with lower clamping surface 72 . in mounting support apparatus 50 to the skull 64 , the spacing between both clamping surfaces 72 , 76 is increased by sliding upper clamping portion 70 in the direction of the distal end 77 of post 68 . lower clamping portion 66 is inserted into an opening 79 in skull 64 so that lower clamping surface 72 can be placed up against the interior surface of skull 64 . upper clamping portion 70 is then lowered to bring upper clamping surface 76 in contact with the exterior surface of skull 64 . support apparatus 50 includes adjustment member 78 to stop upper clamping portion 70 from sliding upward and to maintain upper and lower clamping portions 66 , 70 firmly in contact with skull 64 . adjustment member 78 has a threaded bore 81 that is threadably mounted upon post 68 along a threaded portion 80 adjacent to lower clamping portion 66 . adjustment member 78 can then be rotated in a conventional manner so that adjustment member 78 is forcefully urged against upper clamping portion 70 to reduce the spacing between clamping portions 66 , 70 and thereby firmly tighten clamp 62 upon skull 64 . support apparatus 50 also includes mount 82 . as seen in fig5 , mount 82 is provided with three apertures 84 , 86 , 88 . first aperture 84 is at one end of mount 82 and has a top portion 90 opening onto top surface 92 and a bottom portion 94 opening onto bottom surface 96 . portions 90 , 94 are coaxial but have different diameters . top portion 90 is sized to receive the bottom end 98 of connector 48 so that connector 48 can then be secured to mount 82 by having a fastener 100 , preferably a screw , threadably engage bottom end 98 through bottom portion 94 . second aperture 86 is at the other end of mount 82 and extends from top surface 92 to bottom surface 96 . second aperture is adapted to receive the distal end 77 of post 68 . third aperture 88 is orthogonal to and in communication with second aperture 86 . third aperture 88 is sized to threadably receive a grip screw 102 . post 68 is firmly secured within mount 82 by threadably advancing grip screw 102 within third aperture 88 until grip screw 102 is urged into contact with and frictionally engages post 68 . one can readily see that mount 82 can be raised or lowered along post 68 or pivoted about post 68 before grip screw 102 is tightened so that a desirable position for mount 82 in relation to skull 64 and thereby the adjacent surgical field can be achieved . as shown in fig4 , each input jack 56 is numbered , preferably with a collar 106 embedded with numerical indicia . likewise , a numerical decal 108 is fastened on the connector 48 adjacent to each connecting pin 52 . the number on the collar 106 of each input jack 56 is the same number found on the decal 108 corresponding to the connecting pin 52 that is connected via electrical conduit 54 to that specific input jack 56 . one can appreciate that in this manner the physician or technician can immediately identify which sensing device 10 is being monitored by a specific external device 58 by matching the number on the collar 106 of the input jack 56 connected to that device with the corresponding number on the connector 48 to see which sensing device 10 is engaged to the connecting pin 52 associated with that number . in a similar fashion , the connecting pin 52 associated with a certain desired external device 58 can be easily identified when attaching sensing devices 10 to connector 48 or when replacing one sensing device 10 with another such as when a lead breaks or contact 12 becomes inoperative . sensing devices 10 are also provided with numerical indicia 104 to use to distinguish one sensing device from the others . although the physician or technician remains free to attach the socket 44 for a given sensing device 10 to any empty or unattached connecting pin 52 on the connector 48 , connecting the socket 44 to the connecting pin 52 having a number on the adjacent decal 108 that matches the number on the sensing device 10 itself will permit that individual to more quickly , easily and with greater assurance associate each sensing device 10 with a corresponding external device 58 . although the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art . accordingly , it is intended to embrace all such alternatives , modifications and variations that fall within the spirit and broad scope of the appended claims .

US-13248805-A

generally , the present invention relates to medical devices and a method of vision screening , and more particularly to a pediatric vision screening system and method thereof that identifies a risk factor for amblyopia or diagnoses amblyopia by measurement of microstrabismus . an embodiment of the invention is directed to a method of patient screening for risk factors for amblyopia which includes the steps of illuminating the eye with polarized light , scanning the polarized light about the eye , capturing the retro - reflected light emanating back from the eye , analyzing the retro - reflected light to determine ocular misalignment ; and calculating a metric to determine if the patient passes or fails the screening test thereby providing an indication that the patient may have a risk of amblyopia based on either strabismus or anisometropia . the method is effective at detecting amblyopia related to focusing problems without the measuring the focus of the eye directly .

in general , the present invention is directed to medical devices and more particularly to a pediatric vision screening system that identifies a risk factor for amblyopia by measurement of microstrabismus . what follows is an overview of the optical measurement technique to detect ocular misalignment ( strabismus ). the human eye has birefringent properties that may alter the state of polarization of an incoming optical beam traversing and ultimately retro - reflected from the retina region of the eye . the eye serves best as a retro - reflector when the eye is focused in the same plane , and nearly boresighted to , the incoming optical beam . in this case , an image of the source of light is formed on the central region of the retina , wherein the majority of the reflection in the eye takes place . reflected light from this image is focused by the optics of the eye , and directed back toward the light source . under certain conditions the polarization state of the incoming optical beam may be modified by interacting with naturally occurring birefringent elements within the eye . the nerve fibers in the retina of the eye have this birefringent property and may alter the polarization state of light impinging on them as a function of their incident orientation . these nerve fibers are arrayed in a characteristic pattern in the retina , specifically radiating outward from the fovea and converging to the optic nerve head . by analyzing polarization related changes in retro - reflected light from multiple retinal areas of both eyes either sequentially or simultaneously , characteristic birefringence signatures of portions of the retina can be identified which can be used to assess the direction of fixation of the eye . fig1 is a cross sectional view of the human eye 10 . light incident upon the eye 10 enters through the transparent cornea 11 , passes through the pupil 12 , traverses the transparent crystalline lens 13 , and proceeds toward the fundus region of the eye , which is the inside aspect of the back of the eye , and passes through the retina 14 which lines the inner surface of the back of the eye . a central depression in the retina identifies the fovea 15 which is the area of the retina having the most acute vision . in viewing an object 16 , the brain uses the neck and eye muscles to aim the eye at the object . the direction of fixation is defined by the orientation of the axis of fixation 17 which connects the object 16 with the fovea 15 of the eye . when the eye is fixed on object 16 , an image of the object 16 is formed on the fovea 15 , and in a conjugate manner an image of the fovea 15 is projected onto the object 16 . further , retinal nerve fibers ( see fig2 ; element 20 ) arising from all parts of the retina 14 travel along the surface of the retina 14 and converge to form the optic nerve 18 which conveys visual information from the eye to the brain . fig2 is a flattened view of the posterior surface of the retina 14 , showing the characteristic array of retinal nerve fibers 20 arising from all parts of the retina 14 and converging to the optic nerve head 21 . a large fraction of the retinal nerve fibers 20 arise from the foveal area where the concentration of neural elements is greatest and vision is most acute . as the retinal nerve fibers 20 leave the foveal area , they first travel in a radial direction away from the fovea 15 , then curve around as necessary to eventually reach the optic nerve head 21 . fig3 is an enlarged view of the foveal area of the retina 14 , centered on the fovea 15 , showing in greater detail the paths of the nerve fibers leaving the fovea 15 . the cell bodies 25 of the photoreceptor elements are in the very center of the fovea 15 . these cell bodies send nerve fibers called axons to communicate with a ring of ganglion cells 27 surrounding the fovea . the ganglion cells in turn give rise to long axons of their own , constituting the retinal nerve fibers 20 which travel to the optic nerve to communicate with the brain . the short axons 26 of the photoreceptor cell bodies are called henle fibers and emanate radially about the center of the fovea 15 . this radial array of henle fibers , ending at the ring of ganglion cells 27 , has an overall diameter subtending approximately four degrees of visual angle . besides the area surrounding the fovea , the only other location in the retina having a radial array of nerve fibers is the area around the optic nerve head . the optic nerve head 21 subtends a visual angle of about five degrees . therefore , an area of the retina at least six or seven degrees in diameter would have to be examined in order to detect the radial pattern of nerve fibers surrounding the optic nerve head . thus , the array of henle fibers centered on the fovea 15 , because of its relatively small angular size and its precise radial symmetry , constitutes a unique arrangement of nerve fibers within the retina and , therefore , can serve as a marker for the fovea . therefore , identification of the location of the array of henle fibers also identifies the location of the fovea , being centered in the array of henle fibers . both the henle fibers and the other retinal nerve fibers are birefringent , with the optical axis of the birefringence being parallel to the direction of the fiber . in general , this birefringence will change the state of polarization of polarized light that passes across the nerve fiber . polarized light striking the retina , therefore , will be changed in its state of polarization as it passes through the layer of nerve fibers . a small fraction of the light passing through the nerve fibers is reflected by deeper layers of the fundus to pass back through the pupil of the eye . this portion of the light thus double - passes the nerve fibers , and its state of polarization is changed twice by the birefringence of the nerve fibers . fig4 is a schematic representation of one embodiment of an optical instrument 400 which may illuminate and subsequently detect polarization related changes in optical energy retro - reflected by a human eye . an optical source 410 of energy may provide a linearly polarized output which is routed to the patient &# 39 ; s eyes by relay optics . the optical source 410 may comprise , but is not limited to , a laser , a laser diode , a light emitting diode , or a broad - band optical source such as a halogen lamp with appropriate wavelength selective filter and linear polarizer . the output of the optical source 410 may be collimated by optical lens 420 and reflected by partial beamsplitter 430 . the optical beam reflected by partial beamsplitter 430 may be brought to a focus by condensing lens 440 at a location passing through aperture stop 445 and through the clear hole in mirror 450 , which may be oriented at 45 degrees relative to the incoming optical beam . the optical beam diverging from mirror 450 may be collimated by lens 460 enroute to mirror 470 . mirror 470 may be tilted slightly off axis relative to incoming beam 461 such that reflected beam 471 returns to lens 460 displaced laterally a sufficient amount to be focused back onto the reflective surface of mirror 450 . the reflected beam 451 from mirror 450 is thereby incident upon the patient eyes 480 . the tilted mirror 470 may be rotated at angular frequency ω ( omega ) about its axis of symmetry such that the incident optical beam 451 impinging upon the patient &# 39 ; s eyes may map out a circular arc when ultimately focused on the patient &# 39 ; s retina ( see fig5 ). the retro - reflected signal emanating from the patient &# 39 ; s eye is reflected by mirror 445 and captured by lens 460 , i . e . captured in the sense that the retro - reflected signal is focused onto mirror 470 by lens 460 in such a manner as to retrace the path of incoming optical beams 451 , 471 , and 461 in this order eventually passing through the central hole in mirror 450 enroute to lens 440 . the reason that the retro - reflected signal retraces the illumination pathway is that the optical channel to capture the retro - reflected signal , composed primarily of mirrors 445 and 470 and lenses 460 and 440 , is that the illumination and capture optics are designed to be optically conjugate . after recollimation by lens 440 , a fraction of beam 441 is transmitted by partial beam splitter 430 enroute to knife edge reflecting prism 490 . knife edge reflecting prism 490 spatially separates the retro - reflected signal from the patient &# 39 ; s left and right eyes enroute to polarizing beam splitters 491 and 492 . polarizing beam splitter 491 spatially separates the input beam from one eye ( say , the right eye for example ) into its &# 39 ; orthogonal x and y polarized components which are then focused by condensing lens 493 and 494 onto separate optical detectors 495 and 496 . in one embodiment of the present invention , the electronic outputs of optical detectors 495 and 496 are subtracted from one another to produce a differential polarization ( x − y ) output insensitive to common mode specular reflections and non - polarized light . the optical beam incident upon polarizing beam splitter 492 , for the left eye , is processed similar to that of beamsplitter 491 outlined above . the output of optical detector 495 ( and 496 ) may be analyzed in the frequency domain as outlined below to determine if the patient is fixated within an acceptable offset angle relative to the incident optical beam 451 . with reference to fig5 a and 5b , when the patient &# 39 ; s eye is fixating directly at the incoming optical beam ( fig4 , element 451 ), the circular arc mapped out by way of rotating mirror 470 , forms a circular arc 510 centered about the fovea region 520 and subtending approximately 3 ° of the patient &# 39 ; s angular field of view . fig5 a depicts a view of the henle fibers 530 radially expanding from the fovea region 520 . the henle fibers 530 exhibit form birefringence wherein a principal axis of each fiber lines along the direction of its &# 39 ; radial path . when interacting with polarized light , each individual henle fiber may alter the state of polarization of an incident linearly polarized beam by an amount depending upon the vector angle between the incident beam &# 39 ; s polarization vector relative to the fiber &# 39 ; s principal axis . locations 1 through 4 in fig5 a represent one representative clockwise circular arc generated by rotating mirror 470 , wherein the arc encompasses the fovea region 520 . similarly , fig5 a - 1 maps in the time domain a one - to - one relationship of locations 1 through 4 in the circular arc to the electronic signal generated by the differential polarization output ( x − y ) described earlier . as can be seen , in one revolution of the arc 510 about the fovea at angular frequency ω , the time domain differential polarization signal ( x − y ) generates a 2ω ( frequency doubled ) component . in contrast , fig5 b depicts one representative clockwise circular arc generated by rotating mirror 470 , wherein the patient &# 39 ; s eye is skewed off axis relative to the incoming optical beam 451 by a sufficient amount that the circular arc lies outside and does not encompass the fovea region 520 . in this case the one - to - one mapping in the time domain generates a time domain differential polarization signal ( x − y ) at the same angular frequency ω as the rotating mirror 470 . given this , the differential polarization signal can be analyzed by frequency spectrum analysis to detect the presence , or absence ; of the 2ω frequency doubled signal which can be used to determine if the patient &# 39 ; s eye is within a particular angular offset relative to the incoming optical beam 451 . for example , fast fourier transform techniques can be used to analyze the ratio of the 1ω to 2ω signal strength and a predetermined threshold for this ratio may be established in clinical trials to establish a pass / fail (“ refer ”) criterion for the test . instrumentation similar to that as described in fig4 was used to evaluate the clinical performance of screening children for strabismus in a pediatric ophthalmology office setting . in one study 77 subjects between 2 and 18 years of age received “ gold standard ” orthoptic examinations , and were classified as “ at risk ” for amblyopia if strabismus or anisometropia ( greater than 1 . 50 diopters difference ) was present . strabismus was sub - classified as variable or constant . the subjects were then tested with the instrumentation , a metric termed the binocularity score was calculated from the collected data ( see equation below ) and a pass or fail recommendation based upon the binocularity score was assessed . if the calculated binocularity score met or exceeded a predetermined threshold the subject was considered to have passed the screening test , otherwise the subject was considered to have failed the test and may be referred for follow - on testing ( the failed subject being coined a “ refer ”). during central fixation , the incoming light beam to the eye ( see fig4 ; element 451 ) is focused by the eye and surrounds the fovea , as illustrated by the circle centered on the fovea shown in fig5 a . the device measures the number of times in a series of five measurements that the subject is able to binocularly fixate and produces a binocularity score as a percentage , wherein binocularity was calculated as : binocularity = number ⁢ ⁢ of ⁢ ⁢ bilateral ⁢ ⁢ ⁢ readings number ⁢ ⁢ ⁢ of ⁢ ⁢ unilateral ⁢ ⁢ readings + number ⁢ ⁢ of ⁢ ⁢ bilateral ⁢ ⁢ readings × 100 ⁢ % thus binocularity included only those readings in which at least one eye was fixating on the target . a subject who was relatively inattentive to the target did therefore not influence this parameter . if neither eye was centrally fixating , the reading was not included in the binocularity calculation . that is , a subject with 100 percent binocularity had bilateral alignment for every usable reading . based on the results of a pilot study in adults , a binocularity score of greater than 60 % was defined as “ passing .” in the first study , measurements were obtained from 77 children , 40 of whom had risk factors for amblyopia . given the above criterion of a binocularity score greater than 60 % as passing , all control subjects ( n = 37 ) received a passing score . subjects were considered “ control ” if there they had no history of major ocular problems , and if both eyes met all of the following criteria : less than 3 . 25 diopters of myopia , less than 3 . 25 diopters of hyperopia , less than or equal to 1 . 50 diopters of anisometropia , and no strabismus . no separate criterion was set for astigmatism . also , the results of this study yielded a binocularity score of less than 20 % ( a “ refer ”) for all subjects with constant strabismus and subjects with variable strabismus had binocularity scores ranging from 0 % to 52 % ( also a “ refer ”). in addition , the 3 subjects pre - screened with anisometropia , and no strabismus , were all tested to have a binocularity score less than 10 %. follow - on testing with an additional 8 subjects pre - screened with anisometropia ( 7 of which with greater than 1 . 5 diopters difference ), and no strabismus , yielded similar results with all subjects with anisometropia greater than 1 . 5 diopters having a binocularity score less than 60 %. given these results , the binocular retinal birefringence scanning technique may be directly sensitive to anisometropia , a risk factor for amblyopia . one possible explanation for these results may be that a sufficient focus in both eyes is a prerequisite for accurate fixation . to achieve a passing binocularity score , a subject must be able to focus and fixate on the target simultaneously with both eyes . however , a subject with anisometropia has one eye severely out of focus , which may impair the accuracy of fixation in that eye , leading to low binocularity score . for example , the lack of fixation ( meandering ) may mimic the effect of lack of binocular alignment , but the scores on successive scans may be substantially different from each other . this may give clues that the risk factor is not binocular alignment but anisometropic induced meandering . for the screener , it does not matter . the goal is to rapidly identify subjects at risk for further evaluation . an acuity test given to a small group of selected subjects , who are suspected of being at risk for amblyopia is far simpler and more cost effective than testing every subject for acuity . this effect may be understood by examining the binocularity score equation shown below one possible explanation is that the defocused spot on the retina in the anisometropic eye is sufficiently large so as to generate a significant amount of 1ω signal at the mirror scanning frequency ( see fig5 b ) during the cyclical scans so as to be designated as a unilateral reading ( i . e ., one good reading via the 2ω signal from the in - focus eye ). the large 1ω ( unilateral ) term may directly drive down the binocularity score leading to the patient being “ referred ” to follow - on treatment . alternatively , the anisometropic eye , unable to effectively focus , may wander throughout the procedure , generating a mixture of 2ω signal while on or near axis , but generating a sufficient amount of 1ω signal while wandering off axis to bias the result to a unilateral score , again driving down the binocularity score leading to the patient being “ referred ”. the present invention also contemplated the use of statistical analysis techniques applied to multiple determinations of the binocularity score as described above . here , the protocol established above may be repeated multiple times and a mean and standard deviation may be calculated from the data set of individual binocularity scores . this test protocol may be useful in determining if eye wandering , whether random or induced by lack of fixation via an anisometropic eye , may influence the repeatability of the binocularity score . furthermore , statistical non repeatability may itself set a threshold for identifying the patient as having a risk factor for amblyopia . for example , if the deviations in the binocularity scores vary by more than 2 standard deviations from the mean binocularity score , the patient may be indicating a probability of a risk factor for amblyopia . an alternative criterion may be , if the standard deviation of repetitive binocularity scores exceeds a predetermined clinically established threshold , the patient may be indicating a probability of a risk factor for amblyopia . the instrumentation as described in fig4 may also be designed with additional optical components that can assess the patient &# 39 ; s ability to fixate and focus on a target . the focus detection characteristics of the instrumentation have been published elsewhere ( see hunter et . al ., “ automated detection of ocular focus ”, journal of biomedical optics , 2004 , 9 : 1103 - 1109 ) which is incorporated in its entirety herein by reference . however , given the above results , it may be possible to screen children for risk factors for amblyopia by measurement of microstrabismus alone , without the need for simultaneous or follow - on visual acuity / focusing data . as a result , it is possible to determine subjects at risk of amblyopia by testing for binocular misalignment ( strabismus ) as set forth above , but without the need to explicitly test for anisometropia ( focal differential between eyes ). this permits the development of a faster and cheaper screening device than was heretofore possible . given this , a single test ( binocular retinal birefringence scanning ) may directly identify one risk factor for amblyopia and indirectly identify another ( anisometropia ); the device required may thus be simpler than first imagined . furthermore , because mass screening must be done quickly , by using one test , the time required to achieve results may be reduced . in future embodiments of screening devices , optimization of this single test will undoubtedly result in even faster screening with higher patient throughput . in some cases , the binocularity score returned to normal after treatment of amblyopia improved visual acuity to within the normal range . in other cases , patients with potential risk for amblyopia ( but no amblyopia ) had normal binocularity scores . this suggests that the detection of microstrabismus in association with amblyopia may diagnose the condition of amblyopia rather than simply detecting conditions that place the patient at risk for amblyopia . as noted above , the present invention is applicable to medical devices and is believed to be particularly useful for screening children ( pediatric ) for risk factors for amblyopia because this screening technique requires very little co - operation of the patient and no patient response or interaction is required . this is particularly advantageous in pediatric screening of very young children . the present invention should not be considered limited to the particular examples described above , but rather should be understood to cover all aspects of the invention as fairly set out in the attached claims . various modifications , equivalent processes , as well as numerous structures to which the present invention may be applicable will be readily apparent to those of skill in the art to which the present invention is directed upon review of the present specification . the claims are intended to cover such modifications and devices .

US-29412007-A

a plant growth enhancing composition comprising as an active ingredient a synergistic mixture of gibberellins , the heteroauxin indole - 3 - acetic acid and the cytokinin 6 - purine in definite proportions . application of the composition to the locus of various plants or to the seeds of a plant produces a wide variety of plant growth enhancing responses including , increasing yields ; stimulating seed germination and breaking of dormancy ; increasing flowering and fruiting ; preventing lodging and freeze injury ; aiding in the recovery of damaged crops and increasing root proliferation .

the gibberellins employed as one of the phytochemical components of the growth enhancing composition of the present invention preferably comprise about 40 % by weight of a mixture of gibberellic acids consisting essentially of gibberellin a 2 ( ga 2 ), gibberellin a 3 ( ga 3 ), gibberellin a 5 ( ga 5 ), gibberellin a 7 ( ga 7 ) and gibberellin a 14 ( ga 14 ). the following mixture of gibberellic acids taken in the following specific proportions (% by weight ) is especially preferred because of its high activity on various plants and ready availability : ______________________________________preparation a______________________________________ ga . sub . 2 4 ga . sub . 3 76 ga . sub . 5 4 ga . sub . 7 4 ga . sub . 14 12______________________________________ the heteroauxin indole - 3 - acetic acid employed in the practice of the invention preferably comprises about 40 % by weight of the present growth enhancing composition , with the remaining essential component being the cytokinin 6 -( 4 - hydroxy - 3 - methyl - 2 - trans - betenylamino ) purine ( zeatin ) and preferably comprising about 20 % by weight of the composition . an especially preferred growth enhancing preparation according to the present invention had the following chemical composition , wherein the components are listed as percent by weight : the growth enhancing compositions according to the invention generally comprise the above active components mixed with a carrier or auxiliary nutrients . the auxiliary nutrients used in conjunction with the practice of the present invention are precursory in their role in that they furnish only minute portions of nutrients to the plant to sustain the plant for a very short period of time until the compositions used in the practice of the present invention are able to exert their growth enhancing activity by assimilation into the metabolic system of the plant . these auxiliary nutrients further serve as a carrier whereby the compositions of the invention may be suitably applied in a manner that is convenient and precise with regard to rates . the auxiliary nutrients used in conjunction with the invention comprise ingredients of superior grade in terms of purity and other essential properties . the chemical characteristics of the auxiliary nutrients is dictated by several factors . one factor is the requirement that the applied form of the compositions of the present invention be maintained at a ph of 6 . 7 or higher to insure the integrity of certain gibberellic acid constituents which are dependent upon the degree of acidity . another factor is that analytical investigations have shown that the purity of the selected carrier greatly influences the rate of absorption and distribution of nitrogen , phosphate and potassium nutrients by plant tissues . based on the aforementioned criteria , the auxiliary nutrients selected for use in association with the growth enhancing compositions of the present invention comprise liquids consisting of photographic grade ammonium thio - sulfate , ammonium polysulfate , 75 - 85 % technical grade phosphoric acid and 45 % potassium hydroxide solution ; and dry solubles consisting of tri - potassium polyphosphate , potassium phosphates , technical grade diammonium phosphate - ammonium phosphate containing no more than 3 % by weight of the impurity tri - calcium phosphate , and feed grade urea of low biuret manufacture . the growth enhancing compositions of this invention may be formulated for application with an auxiliary nutrient comprising liquid sulfur ; nitrogen , phosphate and potassium ; and a dry soluble high phosphate , high potassium as the base materials . the essential restriction on the auxiliary nutrient used in the resulting formulation is that the form in which the compositions are applied be maintained at ph levels of 6 . 7 or higher . this key criteria , together with the requirements of purity and integrity of the present growth enhancing compositions , is virtually assured if the formulation procedure is followed according to a particular sequence . for example , in a liquid sulfur based formulation , 1 / 3 parts by weight of liquid ammonium polysulfate are combined with 2 / 3 parts by weight of photographic grade ammonium thio - sulfate and the resulting liquid product is then blended with water as the diluent in parts that yield a sulfur content in the range of 14 - 17 . 5 % by weight . the combined sulfite content of the two liquid sulfates must not exceed 1 / 2 of 1 %. utilizing commercially available sources of the two liquid sulfates , the resultant liquid formulation should have a weight per gallon of 9 . 5 - 9 . 75 lbs ., which should fall well within the recommended ph levels . it is suggested , however , that the ph be tested on each lot or batch . a suitable amount of the growth enhancing composition of the invention is then fed into the sulfur based diluent with vigorous agitation until thorough dissolution is obtained . a nitrogen ( n ), phosphorus ( p ) and potassium ( k ) liquid base formulation having 4 % by weight nitrogen , 12 % by weight phosphorus and 4 % by weight potassium or ( 4 - 12 - 4 n - p - k ) as the recommended ratio is obtained by feeding water as a diluent into a closed , but vented stainless steel vessel . next , the proper amount of 75 % furnace grade phosphoric acid is mixed into the water , wherein some heat may occur . approximately one half of the necessary amount of low biuret urea is then added into the solution very slowly to allow heat generated by the occurring reactions to dissipate between additions . the remaining one half of the urea may be added immediately to calm the reaction if it becomes too violent , otherwise the remaining urea and potassium hydroxide are sequentially fed into the vessel to complete the mixing process . care should be taken in mixing these ingredients since violent reaction and tremendous heat exchange may occur if improper sequences are followed in the mixing process . after all the ingredients have been properly fed into the vessel , the resultant product is allowed to cool and a clear liquid free of particles and having a ph of 7 . 0 should be obtained . a ph reading of less than 7 . 0 indicates the need for slightly more potassium hydroxide , whereas a reading of more than 7 . 0 indicates the need for slightly more phosphoric acid . when a ph of 7 . 0 is reached a sufficient amount of the growth enhancing composition of the invention is added and thoroughly mixed . the relatively small quantities of composition added does not effect the ph of the resulting formulation . the formulation of the liquid compositions of the invention into a soluble high phosphate , high potassium auxiliary powder base may also be obtained by the practice of the present invention to facilitate subsequent precise application of the resulting formulations at recommended rates . first , highly soluble clay granule blanks are auto - claved to reduce the moisture content to a range of 1 - 3 %. these granules are then evenly misted while in a tumbling mixer with a highly concentrated solution of the present growth enhancer in an isopropyl alcohol solvent , wherein the weight of both the granules and growth enhancer are carefully determined . after the granules have been impregnated with alcoholic solution of the growth enhancer , the mixture is placed in a chamber where a low vacuum is applied and the temperature is raised slightly , not to exceed 85 ° f . under these conditions , the alcohol solvent quickly evaporates and the dried granules containing the crystalline growth enhancer are milled to a fineness approximating flour in a laboratory type ball mill to produce a highly concentrated soluble powder . the highly concentrated soluble powder is then thoroughly mixed with specific quantities of potassium polyphosphate - potassium phosphate combinations , preferably in a ribbon blender , to increase volume and decrease concentration to a manageable form . the recommended resulting formulation contains 42 % by weight of phosphorus ( p ) and 42 % by weight of potassium ( k ) or a preferred ratio of ( 0 - 42 - 42 p & amp ; k ). the precise amount of growth enhancing compositions employed in the practice of the present invention will depend upon the type of response desired , the formulation used and the type of plant species or seed treated . for example , when employed as a seed dressing a preferred rate of from 0 . 33 to 0 . 50 gm / acre , based on seedling rates of 14 - 50 lbs . per acre , of the present compositions applied in conjunction with a ( 4 - 12 - 4 n - p - k ) auxiliary nutrient base produces optimum results . for use of the growth enhancer of the invention as a foliar cover spray to balance sulfur : nitrogen ratios and stimulate root development , particularly in nitrogen sensitive crops , or to improve fruit setting in citrus fruits , pears , apples and grapes , optimum rates of from 0 . 50 to 67 gm / acre are employed . to balance sulfur : nitrogen ratios the present growth enhancer is preferably applied in a liquid sulfur auxiliary nutrient spray and to increase parthenocarpic setting and maturation , phosphate / potassium - based auxiliary nutrient sprays are preferably used . further , it is preferred that growth enhancers of the present invention be applied at rates of 0 . 67 to 0 . 75 gm / acre when employed for the purposes of increasing flowering in a number of economic crops and stimulating regrowth in damaged crops caused by hail , light frost , ect ., during early stages of plant development . the application rate in terms of total volume of formulation used in the practice of this invention may conveniently vary , but must be sufficient to insure that the applied rate of the auxiliary nutrient base delivers the recommended rates of the present growth enhancer to the target crop . for example , if the growth enhancer is applied in a liquid auxiliary nutrient base in the form of an aqueous solution and the desired rate of application is 1 quart per acre of the finished formulation , then the growth enhancing composition of the present invention may be advantageously combined in the formulation in an amount that equals the recommended rate of growth enhancer calculated on a qt / acre basis . the application rate of the finished formulation may be similarly determined on a gallons per acre basis . thus , the compositions and auxiliary base materials employed in the practice of the present invention may be efficiently mixed at the place of utilization . also , in view of the relatively low water requirements for the present formulations , the compositions and auxiliary nutrient are obviously advantageous in areas with water deficiency . the chemical compounds employed as active components of the growth enhancing compositions of the present invention may be prepared in accordance with processes well known in the prior art or may be obtained commercially from ready available sources . it is preferred that the individual chemical compounds be combined in an isopropyl alcohol diluent in the ratios set forth hereinabove , i . e . percentage by weight of the active components , and then formulated into the auxiliary nutrient base in the appropriate amounts . there will now be presented a number of examples which specifically involve the preferred growth enhancing composition of the present invention , designated hereinabove as &# 34 ; composition 1 &# 34 ;, as applied under a variety of application rates and formulations to a variety of plant and seed species in order to induce a number of beneficial responses . extensive testing in both the controlled environment of the greenhouse and in - field testing has repeatedly verified that the specifically preferred composition applied over exacting rate ranges produces consistent , predictable plant growth responses in most agricultural and other agronomic crops . it can be concluded that the active components of the present composition are quite readily metabolized within the plant tissue to cause an artificial acceleration of the plant &# 39 ; s natural life cycle . however , it seems that the composition does more than this because the plant growth enhancing effects of the present invention occur to a greater degree than would be expected to occur in nature . thus , it would seem to follow that the assimilation of the combination of active components of the invention may trigger the enzymatic or other systems within the plant to produce an unexpected synergistic result . the foregoing theory is presented in an effort to promote a better understanding of the present invention , although there is no intention to limit the invention to this or any other theory . other investigations are still being carried out and it is quite possible that additional observations may offer revised explanations . in recognition of this , it is again repeated that the reasons as to why the present invention has proved to be so successful have not as yet been determined with certainty , and this specification is to be so understood . the following examples are illustrative of the wide range of plant growth responses that can be realized by application of a preferred composition of the present invention to various plant species . nevertheless , there is no intention that the invention be limited to these optimum ratios of active components since workers in the art will find the compositions of the invention set forth hereinabove to be effective growth enhancers . also , it should readily occur to one skilled in the art that the recognition of improved results using the compositions according to the present invention in connection with other plants , seeds , fruits and vegetables not specifically illustrated herein is readily within the capabilities of one skilled in the art . this evaluation demonstrates the use of the composition of the invention as a wheat seed dressing for stimulating seed germination and increasing vigor . the experiments were made using a formulation consisting of &# 34 ; composition 1 &# 34 ; as the growth enhancer in association with a ( 4 - 12 - 4 n - p - k ) auxiliary base , prepared as set forth hereinabove . all the experiments were run in the summer ( august ) using wheat seed tagged 80 % germination ( caldwell certified ). the formulation was applied as a solution in the concentration of 4 fl . oz . per 50 lb . seed , wherein the auxiliary base was formulated to a constant of 8 . 8 lb ./ gal . four plantings of wheat seeds in separate seeding trays at a depth of 0 . 5 inches was made using 100 seeds per tray selected at random . three of the four trays were treated with the growth enhancer at the rate shown in table 1 and the formulation applied with stirring onto the seeds . the fourth tray , designated herein as the control , was prepared in the exact manner as the other three trays , except that it received no treatment with the growth enhancer ( composition 1 ). the height of the emerged plants was recorded at the periodic intervals and the following table shows a comparative summary of the results : table 1______________________________________treatment increase over controlrate ( gm / acre ) 3 days 5 days 7 days * ______________________________________control -- -- --. 33 20 . 5 % 23 . 2 % 19 . 7 %. 40 28 . 2 % 26 . 1 % 22 . 5 %. 50 35 . 9 % 23 . 2 % 19 . 7 % ______________________________________ * increase at 7 days is considered the overall increase since no additiona plants are reasonably expected to emerge after this period . the advantageous results of the effect of treatment with the growth enhancer is evident . the treated seeds were quicker to germinate . however , the overall increase in germination of about 20 % is the most economically pertinent statistic in this experiment , where hostile conditions were not encountered . in a similar experiment utilizing the identical formulation described herein , ten plants per trial were selected at random and the plants from both treated and untreated seeding trays were visually inspected 10 days after planting . the height of the inspected plants was recorded and the collected data is shown in the following table : table 2______________________________________growth growthenhancer rate enhancer rate (. 33 grams / acre ) (. 50 grams / acre ) controlheight ( in .) height ( in .) height ( in . ) ______________________________________5 . 500 5 . 625 4 . 2505 . 625 5 . 375 5 . 0005 . 500 5 . 500 4 . 2505 . 125 6 . 000 4 . 5005 . 375 5 . 375 4 . 3755 . 750 6 . 125 4 . 5005 . 000 5 . 375 4 . 3755 . 500 5 . 500 4 . 5005 . 625 5 . 500 4 . 5006 . 250 6 . 000 4 . 250______________________________________ the data from the above table 2 demonstrates additional growth increments achieved with the growth enhancer of the invention . excavated plants from both treated and control trays were inspected and show markedly increased root proliferation ( size , number and length ) in the treated over the untreated control . the results clearly indicates improved vigor and more rapid growth of emerged plants where the growth enhancing composition has been used . a summary of the above data is shown below : ______________________________________growthenhancer un - heightrate treated treated advantage ( grams / acre ) ( avg . ht .) ( avg . ht .) treated______________________________________ . 33 5 . 527 in . 4 . 426 in . 24 . 8 %. 50 5 . 640 in . 4 . 426 in . 27 . 4 % ______________________________________ this evaluation demonstrates the use of the growth enhancer of the invention for stimulating seed breaking of dormancy . the experiment was conducted using the formulation described in example 1 in combination with a conventional fungicide . replicated plantings of peanut seeds in seeding trays were made at a depth of 1 . 25 inches using 100 seeds per tray . selected trays were treated with the indicated growth enhancing composition using the recommended rate ranges for seeds , 0 . 33 to 0 . 50 grams per acre , and the formulation applied onto the seeds . other trays were prepared in the exact manner as the treated trays ( t ), except that they received no treatment with the growth enhancer and these untreated trays were designated as the controls ( c ). the result are recorded in the tables below . table 3______________________________________emerged emerged emerged emerged emergedtray 80 hrs . 92 hrs . 104 hrs . 7 days 14 daysno . t - c t - c t - c t - c t - c______________________________________ 1 29 - 22 38 - 28 70 - 51 85 - 64 87 - 81 2 27 - 23 41 - 27 71 - 52 84 - 63 86 - 79 3 28 - 23 39 - 27 71 - 50 85 - 65 87 - 81 4 30 - 22 39 - 28 72 - 51 86 - 61 88 - 82 5 30 - 22 39 - 28 68 - 52 86 - 61 89 - 82 6 30 - 22 38 - 27 70 - 51 85 - 63 86 - 78 7 26 - 61 38 - 26 68 - 51 86 - 64 88 - 81 8 29 - 24 40 - 27 68 - 54 84 - 64 86 - 80 9 29 - 25 37 - 27 69 - 50 86 - 64 88 - 8210 32 - 26 38 - 27 71 - 51 85 - 64 86 - 8011 31 - 25 36 - 28 70 - 54 86 - 65 88 - 8112 29 - 23 35 - 29 71 - 51 84 - 66 88 - 8113 31 - 23 38 - 28 71 - 50 86 - 64 88 - 8114 28 - 22 38 - 28 72 - 49 85 - 61 87 - 7915 29 - 22 37 - 27 71 - 51 86 - 66 87 - 7916 31 - 22 39 - 27 71 - 50 86 - 61 88 - 8117 30 - 23 39 - 28 71 - 49 81 - 66 85 - 7818 27 - 24 39 - 26 72 - 51 84 - 65 87 - 8019 29 - 22 40 - 28 71 - 50 84 - 65 86 - 7920 30 - 22 41 - 29 72 - 51 86 - 65 88 - 81______________________________________ table 4______________________________________emerged emerged emerged emerged emergedtray 80 hrs . 92 hrs . 104 hrs . 7 days 14 daysno . t - c t - c t - c t - c t - c______________________________________ 1 32 - 23 39 - 28 73 - 53 86 - 67 86 - 80 2 31 - 24 41 - 28 71 - 53 86 - 65 86 - 78 3 33 - 24 40 - 29 71 - 50 85 - 65 86 - 84 4 34 - 25 38 - 31 70 - 51 84 - 65 86 - 84 5 32 - 25 39 - 32 72 - 51 79 - 61 86 - 84 6 33 - 24 37 - 30 72 - 52 85 - 63 84 - 81 7 31 - 24 40 - 28 71 - 50 85 - 64 85 - 83 8 31 - 25 40 - 29 73 - 51 84 - 65 85 - 83 9 32 - 25 39 - 28 69 - 51 86 - 65 85 - 8310 32 - 23 38 - 27 70 - 51 86 - 63 87 - 8111 32 - 24 39 - 27 71 - 50 86 - 60 86 - 8312 31 - 25 37 - 28 71 - 50 85 - 66 86 - 8313 32 - 26 37 - 29 74 - 50 84 - 66 85 - 8014 33 - 23 37 - 28 72 - 52 83 - 60 84 - 8315 31 - 24 38 - 31 74 - 51 83 - 54 86 - 8316 32 - 24 39 - 31 72 - 51 83 - 61 86 - 8117 31 - 23 40 - 30 72 - 54 86 - 62 87 - 8318 32 - 25 41 - 28 71 - 51 87 - 63 85 - 8319 31 - 24 39 - 29 73 - 52 84 - 63 85 - 8120 32 - 23 38 - 30 72 - 51 86 - 59 85 - 81______________________________________ soil temperatures were held at a constant 68 ° f . in the treatments set forth in table 3 and the soil temperatures in the treatments of table 4 were held at 72 ° f . it should be noted that there is little difference between the 68 and 72 degrees at 7 days on the treated seed , while there was a marked difference in the germination rate of the untreated seeds with a 4 degree variable . at 14 days , the 4 degree differential made little difference in the net result of treated compared to treated , and control compared to control . there was , however , a wide gap between the germination rate of treated versus control trays . this substantiates postulations of the initiation of dormancy break by the growth enhancer of the invention under lower than normal temperatures or adverse hostile conditions in the field . the results of the experiments set forth in tables 3 and 4 are summarized below . __________________________________________________________________________ emerged emerged emerged emerged emerged 80 hrs . 92 hrs . 104 hrs . 7 days 14 days t - c t - c t - c t - c t - c__________________________________________________________________________table 3 ( total ) . 29 -. 23 . 39 -. 28 . 71 -. 51 . 85 -. 64 . 87 -. 81table 4 ( total ) . 33 -. 25 . 44 -. 32 . 75 -. 55 . 85 -. 73 . 87 -. 82totals - treated 62 83 146 170 170totals - control 48 60 96 137 163average treated 31 % 42 % 73 % 85 % 87 % average control 24 % 30 % 48 % 68 % 81 % __________________________________________________________________________ as indicated above the growth enhancing composition repeatedly exhibited the ability to cause the planting seed to break dormancy much more quickly than would be normal . also , the dormancy break is more even than would be experienced under usual field conditions . this characteristic is especially important in crops such as peanuts , where germination and emergence may normally take place over as much as three weeks . peanuts treated with the composition of this invention emerge more quickly and evenly than do untreated peanut seed . on an average peanut seeds treated with the present composition emerge to an acceptable stand within 7 - 8 days after planting , or in a minimum of one - half the usual time . other experiments conducted under conditions similar to those hereinabove demonstrated the use of the composition of the present invention in inducing freeze resistance . specifically , shortly after planting , within 36 hours , the temperature fell to below 40 ° f . treated seed was fully emerged within 7 days and showed little , if any , cold shock after emergence . untreated seed failed to come up at all . this evaluation demonstrates the use of the composition of the invention for increasing the dry weight content of shoot and root growth in various plants . the experiments were conducted using the formulation and general procedure set forth in example 1 . the formulation had a concentration of 0 . 33 grams of the plant growth enhancing composition per 4 fl . oz . of the auxiliary nutrient base ( 4 - 12 - 4 n - p - k ). the liquid formulation was applied to the seed at the rate of 4 fl . oz . per 14 lbs . of cotton seed and 4 fl . oz . per 50 lbs . of soybean seed . the results are recorded in the tables below . table 5______________________________________the effect of test formulations on growth of soybeans at 8 days dry weight * shoot - roottreatment shoot root total ratio______________________________________control1 . 825 . 258 1 . 083 3 . 192 . 807 . 234 1 . 041 3 . 453 . 934 . 236 1 . 170 1 . 444 . 992 . 298 1 . 290 3 . 565 . 990 . 234 1 . 224 4 . 236 1 . 056 . 238 1 . 294 4 . 437 1 . 070 . 292 1 . 362 3 . 66______________________________________ * total for ten representative seedlings recorded in grams . table 6______________________________________the effect of test formulations on growth of cotton at 8 days dry weight * shoot - roottreatment shoot root total ratio______________________________________control1 . 501 . 118 . 619 4 . 252 . 428 . 067 . 495 6 . 383 . 486 . 087 . 573 5 . 594 . 697 . 083 . 780 8 . 405 . 578 . 091 . 669 6 . 356 . 529 . 072 . 601 7 . 357 . 541 . 065 . 606 8 . 32______________________________________ * total for ten representative seedlings recorded in grams . table 7______________________________________the effect of test formulations ongrowth of soybeans at 10 days dry weight * shoot - roottreatment shoot root total ratio______________________________________control1 . 873 . 363 1 . 236 2 . 402 1 . 002 . 265 1 . 267 3 . 783 . 982 . 270 1 . 252 3 . 634 . 980 . 234 1 . 214 4 . 185 . 888 . 399 1 . 287 2 . 236 1 . 202 . 274 1 . 476 4 . 397 . 994 . 268 1 . 262 3 . 70______________________________________ * total for ten representative seedlings recorded in grams . table 8______________________________________effect of test formulations onselected cotton growth parameters shoot root length length shoot - roottreatment ( cm ) ( cm ) ratio leaf area______________________________________control1 70 175 . 40 100 % 2 78 87 . 90 138 % 3 75 164 . 46 126 % 4 62 163 . 38 112 % 5 98 168 . 58 149 % 6 80 108 . 74 151 % 7 82 117 . 70 162 % ______________________________________ table 9______________________________________effect of test formulations onselected cotton growth parameters shoot root length length shoot - roottreatment ( cm ) ( cm ) ratio leaf area______________________________________control1 118 263 . 45 100 % 2 138 263 . 52 131 % 3 168 248 . 68 135 % 4 177 312 . 57 132 % 5 140 215 . 65 78 % 6 187 280 . 67 155 % 7 139 215 . 65 86 % ______________________________________ table 10______________________________________effect of test formulations on soybean seed germination * daytreatment 1 2 3 4 5 6 7______________________________________control1 0 0 20 86 100 972 0 35 84 87 90 903 0 0 82 96 96 944 0 0 95 97 98 985 0 11 78 91 92 956 0 3 90 98 99 927 0 3 24 87 88 91______________________________________ table 11______________________________________effect of test formulations on cotton seed germination * daytreatment 1 2 3 4 5 6 7______________________________________control1 0 1 4 75 862 0 4 9 58 753 0 0 0 70 824 0 0 0 40 675 0 0 0 53 776 0 0 0 69 867 0 0 0 66 77______________________________________ * rated as emergence ; data is percent germination of 100 seeds in soil , in greenhouse trials . the above tests clearly indicate the overall growth and development of plants achieved with the compositions of the present invention . the treated seed produced plants having heavier stems and appreciably more lateral shoots than the controls . the effects are desirable in that firmer and stronger plants reduce lodging and give greater crop bearing vegetation . this evaluation demonstrates the use of the composition of the invention for increasing yield . the experiments were conducted using a formulation consisting of &# 34 ; composition 1 &# 34 ; as the growth enhancer in conjunction with the liquid sulfur auxiliary nutrient base , prepared in accordance with the method specifically described hereinabove . the formulation had a concentration of 2 . 0 grams of the growth enhancer per gallon of the sulfur nutrient base and was applied to a field at a rate of 1 quart per acre . this rate directly corresponds to the recommended rate of 0 . 50 grams of the active growth enhancing composition per acre . the experiments were run in the winter ( december - january ) in a field environment . the formulation was applied to an area of the field planted with corn seed , while the remainder of the planted field was untreated . corn was harvested from various areas within both plots and an average of 15 ears were found within each area . the total ear weights were determined then shuck , kernel and cob were separated . the individual kernel and cob weights were determined and converted to lbs ./ acre . the results are recorded below , wherein the numerical values are set forth in lbs ./ acre . table 12______________________________________i ii iii iv mean % increase______________________________________treated producttotal ear 4838 4805 4851 4840 4833 9 . 1kernel 3400 3410 3379 3392 3395 10 . 5cob 964 975 981 996 979 11 . 6untreated controltotal ear 4398 4402 4430 4493 4431kernel 3091 3070 3035 3087 3071cob 876 880 891 862 877______________________________________ even though the above test was conducted under adverse field conditions , treatment of seed corn with a composition of the invention is of significant economic value for increasing the actual yield of the crop . the results set forth above fully illustrate the wide variety of plant growth enhancing responses achieved by the present invention . similar experiments with various other plant species indicate that similar results can be attained by such treatments on a wide variety of plants . therefore , those skilled in the art may find the compositions of the present invention to be an effective growth enhancer on other plant species . also , various changes and modifications can be made without departing from the spirit of invention . accordingly , the foregoing illustrations are not to be interpreted as restrictive of the invention beyond that necessitated by the following claims .

US-44601289-A

the formulations have an antimicrobial , antiviral , and anti - pathogenic composition that combines , in various forms , a redox - active polyphenol , an oxidizing agent , and / or a redox - active , transition metal ion and / or electrochemical potential . the composition relates to methods for decreasing or eliminating the infectivity , morbidity , and rate of mortality associated with a variety of pathogenic organisms and viruses . the present invention also relates to methods and compositions for treating herpes simplex and hiv viruses and drug - resistant bacteria , and for decontaminating areas colonized or otherwise infected by pathogenic organisms and viruses . moreover , the present invention relates to methods , compositions , electrochemical devices , and storage containers for decreasing the infectivity of pathogenic organisms in pharmaceuticals , medical devices , personal care products , recreational products , and foodstuffs .

this invention embodies the ph and redox control of phenolic compounds , with the specific example of egcg , to determine the most efficacious pharmacological activity , namely antiviral and antibacterial properties at different ph &# 39 ; s and eh &# 39 ; s . examples to support this invention include : 1 ) uv - visible absorption spectra ; 2 ) electron spin resonance spectra ; 3 ) electrochemical oxidation reactions ; 4 ) in vitro antiviral assays against herpes simplex 1 and 2 ; 5 ) in vitro antiviral assays against human immunodeficiency virus hiv - 1 ; 6 ) in vitro antibacterial assays against multidrug - resistant staphylococcus aureus ; and in vitro anticancer binding assays against bcl - xl protein . the present invention covers redox - active phenols , polyphenols , or antioxidants , individually or in combination , at use levels between 0 . 2 % and 30 % by weight and preferably between 0 . 5 % and 12 %, or combined with other redox - active phenols , polyphenols or antioxidants to form pro - oxidant systems that exhibit antibacterial , antifungal , antiviral , or anticancer activity . combined redox - active phenols , polyphenols or antioxidants at use levels between 0 . 01 % and 40 . 0 % by weight , preferably between 0 . 5 % and 15 . 0 % by weight , are contemplated to exhibit antibacterial , antifungal , antiviral , or anticancer properties but will vary depending on the composition and its application . concentration of the oxidizing agent should be between 0 . 001 % and 10 . 0 % by weight , preferably between 0 . 05 % and 2 . 0 % by weight . concentration of the redox - active transition metal ion ( catalyst ) should be between 0 . 01 % and 5 . 0 % by weight , and preferably between 0 . 05 % and 1 . 0 % by weight are contemplated . uv - visible absorption spectra vs . ph : egcg solutions undergo an immediate spectral absorption shift as the ph increases from acidic to alkaline , with a change noted at ph 7 when a peak at 320 nm appears and the dominant phenol peak at 272 nm begins to decrease ( fig3 a ). the 320 nm peak likely represents the absorbance of the quinone form of egcg . when produced by simply raising the ph of the solution , the 320 nm oxidation peak is labile under air and disappears within hours ( fig3 b ). however , if the alkaline solution is re - acidified within minutes , the reaction is reversible . it is spontaneous with ph change and does not require a catalyst . epr vs . ph study of egcg : the epr and uv - visible spectra of egcg , stabilized with 0 . 2 m mgcl 2 , were measured as a function of ph ( i . e ., 6 . 03 , 6 . 54 , 7 . 03 , 7 . 57 , 8 . 09 , 8 . 56 , 9 . 10 , 9 . 56 ). a corresponding increase in a peak at ˜ 314 nm and a g = 2 epr spectrum occurred with increasing ph . the addition of mgcl 2 greatly improved the intensity of the epr spectrum . this is in agreement with the known stabilizing effect on semiquinone free radicals by divalent cations like mg + 2 . fig4 shows the semiquinone radical at ph 8 . 5 . basification of the egcg solution resulted in strong semiquinone signals that decayed over 30 minutes , demonstrating radical instability in the absence of electrochemical modulation ( fig5 ). the multiple peaks and valleys in fig5 a and 5 b are the fine structure detail of a high concentration radical solution . epr detects unpaired spinning electrons due to the absorption of microwaves in an applied magnetic field . the peak splitting is due to interaction of the lone electron &# 39 ; s spin magnetic field with environmental magnetic fields . in another experiment at ph 6 where no 320 nm peak is ever observed ( fig1 ), a weak epr signal for the semiquinone was present in the freshly dissolved solution , and the signal increased in intensity as the solution aged to 48 hours . these results demonstrate that the 320 nm peak is not the semiquinone . antiviral activity against herpes simplex 1 and 2 : of the many variant forms of herpes viruses , eight are known to affect more than 90 % of the world &# 39 ; s six billion inhabitants . the three that affect the skin / or mucus membranes are herpes simplex virus 1 ( hsv - 1 , the cold sore virus ), herpes simplex virus 2 ( hsv - 2 , the genital herpes virus ), and the varicella zoster virus ( vzv , the chicken pox and shingles virus ). herpes simplex viral infections are capable of causing life - threatening and lethal herpes encephalitis in otherwise normal people , lethal and blinding infections in newborns , blindness in adults , and serious to life - threatening infections in immuno - compromised patients . currently there is no cure for any of the human herpes viral infections . acyclovir and its derivatives act to interfere with viral reproduction by offering the virus defective nucleoside dna building blocks that are preferentially incorporated into the replicating viral dna chain , thus slowing its continued replication . however , these antiviral medications do not kill the herpes virus . egcg from green tea has been found to inhibit hsv - 1 and hsv - 2 ( lyu et al ., 2005 ; isaacs et al ., 2008 ), influenza virus ( nakayama et al ., 1993 ; song et al ., 2005 ), adenovirus ( weber et al ., 2003 ), epstein - barr virus ( chang et al ., 2003 ), and hiv ( fassina et al ., 2002 ; yamaguchi et al ., 2002 ; kawai et al ., 2003 ). in the studies cited above where the mechanism of activity was addressed , egcg impinged on multiple steps in the life cycle of the virus besides simply blocking absorption . reduced and oxidized states of egcg were not addressed in those studies . several investigations allude to the relative effects of the antioxidant and pro - oxidant forms of polyphenols and related compounds in antiviral assays . koyama et al . ( 2001 ) found a definite correlation between the redox potentials and inhibitory effects on epstein - barr virus activation of azaanthraquinones . those compounds at the lowest redox potentials at ph 7 . 2 had the most potent activity , although all the concentrations were high ( ic 50 s & gt ; 100 μm ). conversely , when the hepatitis c proteinase inhibitor 4 - methyl - 1 -( phenylmethyl )- 2 , 6 - pyridinedione underwent an autooxidation process that resulted in dimer formation , the dimer was found to be a relatively more potent inhibitor of the enzyme ( bennett et al ., 2005 ). another possibility is that the reduced and oxidized forms of egcg have different effects in the same cells . in an anticancer study , the auto - oxidation of egcg led to the inactivation of epidermal growth factor receptor in kyse 150 cells , but the inhibition of cell growth was observed with reduced egcg ( hou et al ., 2005 ). those authors stabilized the egcg in the reduced state in the growth medium by adding superoxide dismutase , with and without catalase . it is notable that pro - oxidant activity of egcg has been recorded in studies of a variety of cell culture lines ( alvarez et al ., 2002 ; tobi et al ., 2002 ; salter et al ., 2004 ; elbling et al ., 2005 ). alvarez et al . ( 2002 ) found egcg acted as a pro - oxidant at low concentrations ( 1 - 10 μm ) and an antioxidant at higher concentrations , but tobi et al . ( 2002 ) and salter et al . ( 2004 ) found the opposite results : at low concentrations egcg was an antioxidant , and at high concentrations it was a pro - oxidant . the inherent ability of egcg and other polyphenols to act as antioxidants or pro - oxidants , undergo redox reactions with stable phenolic radical intermediates , and chelate metals could be why they have variable bioactivity under in vitro assay conditions ( i . e ., the in presence of atmospheric o 2 ). the extent of oxidation ( either auto - oxidation or coupled reactions ) of egcg in vivo , where free o 2 is very low , is largely unknown . sang et al . ( 2007 ) found egcg in the plasma of mice injected with egcg was conjugated as the 4 ″- glucoronide , but no oxidized forms of the polyphenol were detected . egcg is a good model compound to investigate whether it acts as an antioxidant or pro - oxidant as an antiviral drug under a suite of redox states and ph &# 39 ; s . polyphenols such as egcg are a promising class of antiviral agents because they appear to inhibit the viruses at multiple steps in their life cycle . a number of synthetic derivatives of natural polyphenols are also under investigation as possible antiviral drugs ( klocking et al ., 2002 ; savi et al ., 2005 ), and ultimately egcg may not prove to be the most efficacious antiviral polyphenol . tea polyphenols are added to some skin care products and are generally considered to be safe in topical formulas ( thornfeldt , 2005 ; hsu , 2005 ). treatment of green tea polyphenols to the skin has been shown to modulate the biochemical pathways involved in inflammatory responses , cell proliferation , and responses of chemical tumor promoters as well as ultraviolet light - induced markers of skin inflammation ( katiyer and elmets , 2001 ; kapoor et al ., 2004 ; an et al ., 2005 ). stability studies of topical formulations have been conducted ( proniuk et al ., 2002 ) and the pharmacokinetics of topical administration of egcg have been documented ( dvorakova et al ., 1999 ). experimental — hsv - 1 and 2 : herpes simplex viruses were titrated by inoculation of 10 - fold dilutions ( hsv - 1 was inoculated into vero cell cultures , and hsv - 2 was inoculated into cv1 cultures ) in 96 - well microtiter tissue culture plates . a virus dilution ( 0 . 1 ml ) in rpmi 1640 with 1 % fetal bovine serum ( mm ) was inoculated into each well with three wells per dilution . the plates were kept for 2 to 5 days , depending on the virus , and examined daily for cytopathic effect . virus titers were calculated by the method of reed and muench ( 1938 ). about 10 5 50 % tissue culture infective doses ( tcid 50 s ) of virus were mixed with varying concentrations ( 12 . 5 , 25 , 50 , 75 and 100 μm ) of reduced and oxidized egcg in mm and incubated at 37 ° c . for 30 min . the following samples were tested : the reduced form of egcg (# 1 ); the partially oxidized form of egcg (# 2 ); the quinone or fully oxidized form of egcg with the addition of a copper catalyst (# 3 ); and quinone or fully oxidized form of egcg with the addition of a zinc catalyst (# 4 ). in samples # 3 and # 4 , the addition of the copper and zinc catalysts , respectively , raised the ph to 9 . 0 - 9 . 5 . these compounds were totally oxidized , thereby taking a quinone form . these samples polymerized and turned a dark brown color with a heavy amount of precipitate . virus mixed with mm alone was used as a control . after incubation , the infectivity of each mixture was titrated by the serial dilution endpoint method . dilutions ( 10 - fold ) were made in mm . the 10 − 1 to 10 − 5 dilutions were inoculated into monolayers of vero or cv1 cells , and the virus titers were determined as described above . the difference between the titer ( log 10 ) of the control virus and the titers of egcg - virus mixtures , i . e ., the reduction of virus titer , was used as a measure of antiviral activity . as shown in fig6 , the oxidized form of egcg shows the highest efficacy against hsv - 1 and hsv - 2 relative to the reduced form compared to commercial viricides . an important follow - up experiment was performed in light of the hsv - 1 and - 2 data described above . in the antiviral activity assay ( fig7 ) the activated version of egcg completely inactivated hsv - 1 and hsv - 2 viruses . the test involves treating suspensions of viruses with a drug , mixing them with the cells they normally infect , incubating the mixture for a preset time that is generally required for viruses to infect the cells and then determining the number of infected cells . the lower number of infected cells represents a better drug . activated egcg at a very low concentration ( 0 . 1 mm concentration or 40 parts per million ) nearly completely inactivated the viruses as only a few infected cells were observed . other antiviral drugs merely slowed down virus replication but were not able to effectively protect against infection of the test cells . there are plans to test egcg against four members of the herpes family : hsv - 1 , hsv - 2 , human cytomegalovirus , and varicella zoster virus ( chicken pox and shingles ). in on - going experiments , egcg inactivated the herpes family of viruses at very low concentration compare to the concentration that impacted the test cells . the low concentrations that inactivate the viruses , coupled with the high safety level against the host cells make egcg a very promising drug candidate . generally most of the test compounds that work against the viruses are also highly toxic to host cells , as shown in table 1 below . fig8 a and 8b demonstrate that the pro - oxidant forms of egcg are more effective against hsv - 1 and hsv - 2 , respectively , and fig9 shows greater antiviral activity at the more alkaline ph &# 39 ; s when semiquinone , quinone , and oligomeric forms of egcg are present . the concentrations of egcg used in these assays ( 0 - 100 μm ) were not cytotoxic to the host cells ( table 2 ). 1 these assays were performed using the cell titer 96 aqueous cell proliferation assay from promega . it is accomplished by dehydrogenase enzymes in metabolically active cells . 2 each number is the mean ± sd for assays done in triplicate . antiviral activity against hiv - 1 : egcg is a known inhibitor of human immunodeficiency virus hiv - 1 ( fassina et al ., 2002 ; yamaguchi et al ., 2002 ; kawai et al ., 2003 ). the aids epidemic caused by the human immunodeficiency virus hiv - 1 has no cure . antiviral drugs and drug combinations slow viral replication , but don &# 39 ; t eliminate the virus . in the underdeveloped world , the cost of the current drugs is prohibitive , and the death rates among certain populations have changed the fabric of societies . for example , it is estimated worldwide that more than 15 million children under the age of 18 have been orphaned as a result of aids . more than 12 million of these children live in sub - saharan africa , where it is currently estimated that 9 % of all children have lost at least one parent to aids ( http :// www . avert . org / aidsorphans . htm ). as hiv infections become increasingly common among the heterosexual adult population of the region , millions of children will lose parents to aids . by 2010 , it is predicted that there will be around 15 . 7 million aids orphans in sub - saharan africa alone . the technology embodied in this patent can be developed to produce an effective topical viricide that kills hiv - 1 fig1 demonstrates the activity profiles of reduced and oxidized solutions of egcg against hiv - 1 suspensions before infecting cells . the most oxidized formulation was the most effective . inhibition of apoptosis is implicated in virtually every known human malignancy ( reed , 1995 ; johnstone et al ., 2002 ). proteins in the bcl - 2 ( b - cell lymphocyte / leukemia - 2 ) family are critical components of the intrinsic apoptotic pathway , and anti - apoptotic bcl - 2 proteins such as bcl - xl are over - expressed in most human cancer types . inhibition of apoptosis may involve more than one pathway . in mia paca - 2 pancreatic carcinoma cells , egcg invokes bax oligomerization and depolarization of mitochondrial membranes to facilitate cytochrome c release into cytosol and caspase - dependent apoptosis ( qanungo et al ., 2005 ). those authors concluded that egcg induces stress signals by damaging mitochondria and reactive oxygen species - mediated jnk activation in pancreatic cancer cells . nakagawa et al . ( 2004 ) concluded that the generation of hydrogen peroxide by egcg primarily contributes to the induction of fe ( ii )- dependent apoptosis in jurkat cells , indicating a beneficial pro - oxidant mechanism . from a combination of nmr binding assays , fluorescence polarization assays , and computational - docking studies , it is known that the green tea compounds egcg , gallocatechin - 3 gallate ( gcg ), epicatechin - 3 gallate ( ecg ) and catechin - 3 gallate ( cg ) are very potent inhibitors ( k i s in the nanomolar range ) of the anti - apoptotic protein bcl - xl ( kitada et al ., 2003 ). the inherent ability of egcg to act as antioxidant or pro - oxidant , undergo redox reactions with stable phenolic radical intermediates , and chelate metals could be why it is bioactive once it is bound to a target . in this example using the bcl - xl binding assays to support our claims , egcg solutions were the same as those used in some of the antiviral assays ( fig8 a and 8b ), including reduced , partially oxidized , oxidized containing cu 2 + , and oxidized containing zn 2 + under assay conditions outlined by pellechia et al . ( 2002 ) and pellechia and reed ( 2004 ). 1d - 1 h nmr spectra of all the compounds were taken at 1 mm concentration , 1 % d 2 o , 10 % h 2 o , 50 mm phosphate buffer at ph near 7 . 2 . the partially oxidized egcg solution without metal ions showed a two - fold better binding response in the fluorescence polarization displacement assay with a fitc - bad peptide , and the nmr spectrum of bcl - xl had an extra peak at 6 . 1 ppm ( fig1 ). the two other highly oxidized preparations of egcg showed either no difference or less activity than reduced egcg . gossypol , another polyphenol with known anticancer activity , was also tested under similar conditions . the solution of partially oxidized gossypol had similar activity as reduced egcg ( it is normally several times less active than egcg in the same assay ). it produced a similar nmr spectrum as reduced gossypol with a single aromatic peak , but the peak typical of the free aldehyde had a marked decreased intensity . these data demonstrate that oxidized states of egcg and gossypol may be more active agents for binding to the anti - apoptosis protein , and that redox states of activity can be monitored by spectrometric methods . the bcl - xl assay is an appropriate model system to show feasibility and proof of concept that redox control of anticancer drug agents can improve their activity . antibacterial activity : egcg was tested as an antibacterial agent against a multidrug - resistant strain ( 33591 ) of staphylococcus aureus . after pre - incubating the cells with various concentrations of egcg at ph 6 , 7 . 5 , and 8 . 5 , cells were plated and colony - forming units ( cfu ) were counted as a measure of efficacy ( fig1 ). at the lowest concentration tested ( 0 . 08 % egcg ), only the solutions containing pro - oxidant semiquinone and quinone forms ( ph 7 . 5 and 8 . 5 ) were effective at killing nearly all the bacteria . at concentrations of 0 . 4 - 0 . 8 % egcg , the solutions were strongly bactericidal at all three ph &# 39 ; s . at higher concentrations , egcg was less effective . with the burgeoning medical problem of drug - resistant pathogens surviving all available drug therapies , the discovery of highly effective polyphenolic drug candidates whose efficacy can be modulated by redox and ph falls under the claims of this patent . oxidation states modulated and measured electrochemically : the multiple oxidation states of the molecule of interest can be determined electrochemically by cyclic voltammetry . the first phase involves applying an excessive positive potential ( oxidizing potential ) and oxidizing all the species present to one form . then the applied voltage is stepped down in increments while monitoring current . when the mid - point redox potential of a reaction is approached , molecules begin to be reduced , causing current through the circuit . after returning all molecules to the reduced form , the voltage is increased and the redox potentials of the reaction ( s ) are recorded . this technique has been employed by others to determine redox states of egcg ( kilmartin and hsu , 2003 ). additionally , the open circuit potential of the solution versus a standard reference electrode can be measured . this method utilizes two electrodes , working and reference , to determine the electrochemical potential generated by the solution versus a reference electrode , such as ag / agcl . this method will give an indication of the overall degree of oxidation of the formulation , and when combined with cyclic voltammetry , can be used to determine the species present . by knowing the electrochemical potentials that create the semiquinone and quinone species , an external electrical potential can be applied to drive the redox state of the formulation to a predetermined oxidation state . continued application of the electrical potential will maintain the formulation in the desired oxidation state . this electrochemical potential can be supplied from a battery , small circuit , and electrodes designed into a container format ( battery - in - a - bottle ). the reduction potential of egcg at ph 7 is 430 mv versus a normal hydrogen electrode . an electrochemical cell was fabricated using a fine porosity glass frit in one - inch - diameter glass tubing . the electrochemical cell houses the counter electrode and keeps the ag / agcl reference electrode and platinum working electrode separate from the counter electrode . this addition to the system allowed the preparation of bulk solution . the working electrode and reference electrode compartment was continuously stirred using a small stir bar and a magnetic stirrer to minimize gradient effects at the working electrode . the egcg solutions were oxidized using a positive potential to a visual end point . uv - visible spectral data were collected during these experiments , including the absorbance at 270 nm and 320 nm , corresponding to the phenol and quinone forms of egcg , respectively . in addition , the open cell potential was recorded as experiments progressed . the active redox potentials and experimental endpoints were determined based on current and visual color changes to oligomers . due to solution evaporation over time , the ratio of absorbance at 320 nm divided by the absorbance at 270 nm was determined in order to account for overall absorption increases . this value was then tracked throughout the experiments and proved to be a more stable indicator of reaction progress than absorbance alone . in addition , the visual change in solution color from clear to yellow and pink was also monitored as an indicator of degree of oxidation . stirred egcg solutions in 0 . 1 m phosphate buffer with 0 . 1 m kcl at ph 6 . 0 were monitored . the open circuit potential was initially 220 mv . a potential of 800 mv was applied , resulting in approximately 1 microamp of current in the cell . a duplicate solution was left uncovered on the table next to the electrochemical cell as the control . after seven hours , no change in either solution at 270 and 320 nm was found . at this point the experimental potential was increased to 1000 mv for a further 16 hours ( table 3a ). these data demonstrate the increase in 320 nm quinone absorbance and associated decrease in the 270 nm phenol absorbance associated with oxidation of the egcg over 16 hours at 1000 mv . the control sample did not oxidize , which is consistent with the known stability of egcg under acidic conditions . after the combined time of 23 hours ( 7 h plus 16 h ), the potential of the cell was increased to 1500 mv ( table 3b ). at 68 hours , the control sample was still clear , but the experimental solution had a faint yellowish color ( dimerization ). the ph of the solutions remained 6 . 0 throughout the experiment . all data support the forced oxidation of egcg at ph 6 . 0 . solutions were allowed to sit for two more days to observe the stability of the electrochemically - induced changes ( table 3c ). these data indicate that the solutions are stable for over two days without a significant increase or decrease in 320 nm absorbance over time . a summary of these data is presented in fig1 . solutions were ph - modified following electrochemical oxidation to observe stability . the spectra of samples prepared from an egcg solution at ph 6 . 26 under 1500 mv potential for 11 . 4 hours are shown in fig1 . the ph 6 . 26 solutions could not be compared to control samples because control samples at ph 6 . 26 did not oxidize . the figure shows the samples were stable after one day , and in the case of ph 8 . 43 , it was relatively stable after 7 days . these samples were open to air , and no other precautions were taken to prevent oxidation by atmospheric oxygen . the following references are specifically applicable to the examples and to the remainder of the specification . they are incorporated herein by referenced and are identified , where appropriate , by their authors and publication dates as indicated . alvarez e , leiro j , orallo f . 2002 . effect of (−)- epigallocatechin - 3 - gallate on respiratory burst of rat macrophages . int immunopharmacol . 2 ( 6 ): 849 - 855 . an b j , kwak j h , son j h , park j m , lee j y , kim y s , jo c , byun m w . 2005 . physiological activity of irradiated green tea polyphenol on the human skin . am j chinese med . 33 ( 4 ): 535 - 546 . asanuma , m , i miyazaki , et al . 2003 . dopamine - or l - dopa - induced neurotoxicity : the role of dopamine quinone formation and tyrosinase in a model of parkinson &# 39 ; s disease . neurotox . res . 5 : 165 - 176 . bors , w , c michel , and k stettmaier . 2000 . electron paramagnetic resonance studies of radical species of proanthocyanidins and gallate esters . arch . biochem . biophys . 374 : 347 - 355 . chang l k , wei t t , chiu y f , tung c p , chuang j y , hung s k , li c , liu s t . 2003 . inhibition of epstein - barr virus lytic cycle by (−)- epigallocatechin gallate . biochem biophys res commun . 301 ( 4 ): 1062 - 8 . dvorakova k , dorr r t , valcic s , timmermann b , alberts d s . 1999 . pharmacokinetics of the green tea derivative , egcg , by the topical route of administration in mouse and human skin . cancer chemother pharmacol . 43 ( 4 ): 331 - 335 . elbling l , weiss r m , teufelhofer o , uhl m , knasmueller s , schulte - hermann r , berger w , mickshe m . 2005 . green tea extract and (−)- epigallocatechin - 3 - gallate , the major tea catechin , exert oxidant but lack antioxidant activities . faseb j 19 ( 2 ): u17 - u42 . fassina g , buffa a , benelli r , varnier o e , noonan d m , albini a . 2002 . polyphenolic antioxidant (−)- epigallocatechin - 3 - gallate from green tea as a candidate anti - hiv agent . aids 16 : 939 - 41 . hamza , a , and c - g zhan . 2006 . how can ( _ )- epigallocatechin gallate from green tea prevent hiv - 1 infection ? mechanistic insights from computational modeling and the implication for rational design of anti - hiv - 1 entry inhibitors . j . phys . chem . b 110 : 2910 - 2917 . hou z , sang s , you h , lee m j , hong j , chin k v , yang c s . 2005 . mechanism of action of (−)- epigallocatechin - 3 - gallate : auto - oxidation - dependent inactivation of epidermal growth factor receptor and direct effects on growth inhibition in human esophageal cancer kyse 150 cells . cancer res . 65 : 8049 - 56 . hsu s . 2005 . green tea and the skin . j am acad dermatol . 52 ( 6 ): 1049 - 1059 . isaacs , c e , g y wen , w xu , j h jia , l rohan , c corbo , v di maggio , e c jenkins , jr ., and s hillier . 2008 . epigallocatechin gallate inactivates clinical isolates of herpes simplex virus . antimicrob . agents chemother . 52 : 962 - 970 . johnstone , r w , a a ruefli , and s w lowe . 2002 . apoptosis : a link between cancer genetics and chemotherapy . cell 108 : 153 - 164 . kapoor m , howard r , hall i , appleton i . 2004 . effects of epicatechin gallate on wound healing and scar formation in a full thickness incisional wound healing model in rats . am j . pathol . 165 ( 1 ): 299 - 307 . katiyar s k , elmets c a . 2001 . green tea polyphenolic antioxidants and skin photoprotection ( review ). int j . oncol . 18 ( 6 ): 1307 - 1313 . kawai k , tsuno n h , kitayama j , okaji y , yazawa k , asakage m , hori n , watanabe t , takahashi k , nagawa h . 2003 . epigallocatechin gallate , the main component of tea polyphenol , binds to cd4 and interferes with gp120 binding . j allergy clin immunol . 112 : 951 - 7 . kilmartin , p a , and c f hsu , 2003 . characterisation of polyphenols in green , oolong , and black teas , and in coffee , using cyclic voltammetry . food chem . 82 : 501 - 512 . kitada , s , m leone , s sareth , d zhai , j c reed , and m pellecchia . 2003 . discovery , characterization and structure activity relationship studies of pro - apoptotic polyphenols targeting bcl - xl . j . med . chem . 46 : 4259 . klocking r , helbig b , schotz g , schacke m , wutzler p . 2002 . anti - hsv - 1 activity of synthetic humic acid - like polymers derived from p - diphenolic starting compounds . antivir chem chemother . 13 ( 4 ): 241 - 9 . koyama j , morita i , tagahara k , osakai t , hotta h , yang m x , mukainaka t , nishino h , tokuda h . 2001 . correlation with redox potentials and inhibitory effects on epstein - barr virus activation of azaanthraquinones . chem pharm bull ( tokyo ). 49 : 1214 - 6 . lyu s y , rhim j y , park w b . 2005 . antiherpetic activities of flavonoids against herpes simplex virus type 1 ( hsv - 1 ) and type 2 ( hsv - 2 ) in vitro . arch pharm res . 28 : 1293 - 1301 . mochizuki , m , s - i yamazaki , k kano , and t ikeda . 2002 . kinetic analysis and mechanistic aspects of autoxidation of catechins . biochim . biophys . acta / gen . subj . 1569 : 35 - 44 . nakagawa , h , k hasumi , j - t woo , k . nagai , and m . wachi . 2004 . generation of hydrogen peroxide primarily contributes to the induction of fe ( ii )- dependent apoptosis in jurkat cells by (−)- epigallocatechin gallate . carcinogenesis 25 : 1567 - 1574 . nakayama m , suzuki k , toda m , okubo s , hara y , shimamura t . 1993 . inhibition of the infectivity of influenza virus by tea polyphenols . antiviral res . 21 : 289 - 99 . pellecchia , m ., d . sem , and k . wüthrich . 2002 . nmr in drug discovery . nat . rev . drug disc . 1 : 211 - 218 . pellecchia , m , and j c reed . 2004 . inhibition of anti - apoptotic bcl - 2 family proteins by natural polyphenols . new avenues for cancer chemoprevention and chemotherapy . curr . pharmaceut . design 10 : 1387 - 1398 . potta , s p ., m x doss , j hescheler , and a sachinidis . 2005 epigallocatechin - 3 - gallate ( egcg ): a structural target for the development of potential therapeutic drugs against anti - proliferative diseases . drug design rev .- online 2 : 85 - 91 . proniuk s , liederer b m , blanchard j . 2002 . preformulation study of epigallocatechin gallate , a promising antioxidant for topical skin cancer prevention . j pharmaceut sci . 91 ( 1 ): 111 - 116 . qanungo , s , m das , s haldar , and a basu . 2005 . epigallocatechin - 3 - gallate induces mitochondrial membrane depolarization and caspase - dependent apoptosis in pancreatic cancer cells . carcinogenesis 26 : 958 - 967 . reed , j c . 1995 . regulation of apoptosis by bcl - 2 family proteins and its role in cancer and chemoresistance . current opinion oncology 6 : 541 - 546 . reed , l j and muench , m . 1938 . a simple method of estimating 50 percent end points . am . j . hyg . 27 ; 493 - 497 . salter l , clifford t , morley n , gould d , campbell s , curnow a . 2004 . the use of comet assay data with a simple reaction mechanism to evaluate the relative effectiveness of free radical scavenging by quercetin , epigallocatechin gallate and n - acetylcysteine in uv - irradiated mrc5 lung fibroblasts . j photochem photobiol b - biol . 75 ( 1 - 2 ): 57 - 61 . sang , s , i yang , b buckley , c - t ho , and c s yang . 2007 . autoxidative quinone formation in vitro and metabolite formation in vivo from tea polyphenol (−)- epigallocatechin - 3 - gallate : studied by real - time mass spectrometry combined with tandem mass ion mapping . free radical biology & amp ; medicine 43 : 362 - 371 . savi l a , leal p c , vieira t o , rosso r , nunes r j , yunes r a , creczynski - pasa t b , barardi c r , simoes c m . 2005 . evaluation of anti - herpetic and antioxidant activities , and cytotoxic and genotoxic effects of synthetic alkyl - esters of gallic acid . arzneimittelforschung . 55 ( 1 ): 66 - 75 . song , j m , lee k h , seong b l . 2005 . antiviral effect of catechins in green tea on influenza virus . antiviral res . 68 : 66 - 74 . su , y l , l k leunga , y huang , and z - y chen . 2003 . stability of tea theaflavins and catechins . food chem . 83 : 189 - 195 . thornfeldt , c . 2005 . cosmeceuticals containing herbs : fact , fiction , and future . dermotol surg . 31 ( 7 ): 873 - 880 part 2 . tobi s e , gilbert m , paul n , mcmillan t j . 2002 . the green tea polyphenol , epigallocatechin - 3 - gallate , protects against the oxidative cellular and genotoxic damage of uva radiation . int j cancer 102 ( 5 ): 439 - 444 . van maanen , j j , m v lafleur , d r mans , e van den akker , c de ruiter , p r kootstra , d pappie , j de vries , j retel , and h m pinedo . 1988 . effects of the ortho - quinone and catechol of the antitumor drug vp - 16 - 213 on the biological activity of single - stranded and double - stranded phi x174 dna . biochem pharmacol . 37 : 3579 - 3589 . weber j m , ruzindana - umunyana a , imbeault l , sircar s . 2003 . inhibition of adenovirus infection and adenain by green tea catechins . antiviral res . 58 : 167 - 73 . yamaguchi k , honda m , ikigai h , hara y , shimamura t . 2002 . inhibitory effects of (−)- epigallocatechin gallate on the life cycle of human immunodeficiency virus type 1 ( hiv - 1 ). antiviral res . 53 : 19 - 34 . zhou , q , h chiang , c portocarrero , y zhu , s hill , k heppert , h jayaratna , m davies , e janle , and p kissinger . 2003 . investigating the stability of egcg in aqueous media . curr . separations 20 : 83 - 86 .

US-51085009-A

a set of travelling line guiding members are moved relative to stationary line guiding members with the two sets of line guiding members containing separate individual wraps or partial loops of line . by moving the guiding members relatively toward and away from one another the line can be quickly released when letting out line or retrieved for retracting a line . wrap retaining devices are provided for releasably holding the wraps of line when in the retracted position after the movable line guiding members are moved from the retracted position toward the fixed line guiding members .

a fishing pole or other pole type or handle device 10 is preferably formed of hollow multiple portions such as a tip portion 12 , a standard middle portion 14 , a linear line collecting portion 16 and a handle portion 17 . it will be understood , of course , that in the case of an underwater spear gun fishing type device , the pole will essentially constitute a single short cylindrical piece or handle rather than a long pole . in the fishing pole embodiment these portions can be of a single tubular or solid rod but preferably are individual tubular glass or carbon fibre hollow tubes joined together by conventional friction ferrules 18 . the pole section or portions can be of a convenient sizes such as two meters and additional sections can be added . the total rod length may be from twelve to thirty feet . in the preferred embodiment , linear line collecting portion 16 is provided with an internal rigid tube forming an elongated plugged cylinder 20 in which a piston 21 is slidably received . the piston is coupled to the line 22 which passes out the opening 24 toward the tip end and again out of the opening 25 near the handle end , the line 22 passes over sheaves 26 and 27 and is then coupled to a carriage 28 . the sheaves 26 and 27 are mounted on brackets 23 and 23a secured to the rod portion 17 within the openings 24 and 25 . a taut line 29 is affixed to the brackets . the carriage slides on the line 29 . mounted on the bracket 23 are a set of stationary sheaves or guides 30 - 32 . mounted on the carriage 28 are a second set of movable sheaves or guides 34 - 36 . as is readily apparent by moving the piston 21 , the movable sheaves 34 - 36 can be reciprocated toward and away from the stationary sheaves 30 - 32 . in the alternative an elastic band can be attached between the fixed or movable sets of sheaves to elastically draw the movable sheaves toward the fixed sheaves . line 39 from a standard spool 40 is wrapped in multiple wraps around the stationary and movable sheaves and hence moves out through an eye 46 at the tip end of the rod . the line is connected to a suitable line and hook . adjustable stops 50 and 51 are provided on the guide track to limit the stroke of the movable carriage 28 and thus limit the amount of line which can be extended and withdrawn . in one embodiment a finger grip 56 is provided so that the carriage can be manually reciprocated and thus the piston 21 and additional structure can be eliminated . still further , the piston 21 can also be carried in a cylinder or tube externally of the rod or can be mounted within a cylindrical rod portion . to operate the fluidic or air powered system , air line 61 and 62 which are coupled to a conventional two position , rotary valve 63 . the valve is placed near the handle end of the line collection portion 16 so that it is easily accessible to the angler . air from the accumulator 64 pressurized from a conventional foot air pump 66 provides a pressurized supply of air or fluid selectively coupled to either line 61 or 62 for determining direction of the movement of the piston 21 . in the alternative a standard pressurized co - 2 cartridge can be substituted for the pump and accumulator . by reciprocating the piston the carriage 28 follows , shortening or lengthening the distance between the movable and fixed sheaves . in this type of fishing where the line is extended or retrieved numerous times , but generally in always the same amount , it is apparent that the adjustable reciprocatory stroke of the carriage enables repetitive accurate dispensing of an amount of line . secondly , the line can be very rapidly retrieved by the single stroke of reciprocation rather than by numerous turns of a reel . when fishing is done by using many rod sections but a short length of line , the movable sheaves can be moved toward the stationary sheaves to lengthen the line so that the hooked fish can be removed by the angler . as an alternative , the linear line collecting portion or section of the rod can be removed entirely and a short handle section with a conventional bait casing reel added where more conventional bait casting is employed . while the fixed line guides or sheaves and movable line guides or sheaves are located externally of the rod , it should be understood that they can also be placed internally of the rod . the wrap retaining device of this invention is best shown in fig5 - 11 . a pole 70 is provided with an inner portion 72 . on the inner end 72 or inner portion of the pole 70 is provided the line extending and retrieving device 73 . it should be understood that the inner portion 72 can be the handle of a spear gun as well as be the inner end of a long , lightweight , light line casting fishing pole as in fig1 . on the inner portion 72 is a bracket 75 on which are a plurality on stationary transversely spaced line guides or hooks 74 . a second bracket 76 is movably mounted toward and away from the bracket 75 and is provided with a plurality of transverse spaced rings or second line guides 78 . a third bracket 80 is fixed to the pole and holds a plurality of transversely spaced wrap restraining members 82 . a taut line or post 84 is attached between the two stationary brackets 75 and 80 . the movable bracket 76 is provided with a guide bore 85 and slides on the post 84 when moving toward and away from the stationary bracket 75 . in the preferred form the opposite side of the bracket 76 is fixed , such as by pin 86 , to a line 87 that runs over a sheave 88 rotatably mounted on stationary bracket 75 and a second sheave 89 which is rotatably mounted on the stationary bracket 80 . a piston 90 is fixed to the line 87 and runs in a cylinder which is coupled to air lines 93 and 94 for controlling the position of the piston and thus the position of the moving bracket 76 . in the alternative , of course , as in the preferred embodiment the movable bracket can have a standard grip 98 for manually moving the movable bracket . as is readily understood , and shown in fig5 and 8 , for example a line 100 , whether a fishing line attached to a light object or a heavy object , or a line attached to a propelled object , such as a spear of an underwater fishing spear gun , passes through the rings 78 and guides 74 by passing first down through a first ring 78a and thence up through ring 78b , around guide 74a , down through ring 78b , up through ring 78c , around guide 74b , down through ring 78c , up through ring 78d and around guide 74c and down unitl the line finally returns and is either dead ended on the stationary bracket 80 or can run to the conventional line spool 40 ( fig1 ). the spool 40 serves no other function than as a convenient supply of fresh line or to make a major adjustment in the length of line extended and retracted . fig6 illustrates the position of the movable guides or rings 78a - 78d and the stationary guides or hooks 74a - 74c . as is readily apparent from fig6 the sets of movable guides move into interdigitating relationship with the fixed guides so that the line 100 transverses a substantially straight path 100a when the movable bracket 76 is adjacent the stationary bracket 75 . to retrieve line 100 , of course , the movable bracket is moved away from the stationary bracket pulling loops or partial loops of the line downwardly any desired distance preferably about one meter . this will return approximately 7 meters of length of line in a single stroke . it is a unique feature of this invention to provide free withdrawal of the line to pay out line when the object on the end of the line is propelled by power or cast by the angler . this is accomplished by selectively holding the wraps or partial loops of line in the retracted position while the movable bracket is moved upwardly adjacent fixed bracket 75 to the position shown in fig6 . as best shown in fig6 it can be seen that the rings 78b - 78d move upwardly beyond the lower ends of the wire hooks 74a - 74c interdigitating with the hooks . this allows the line 100 when extended and taut to form a straight line through the hooks 74a - 74c as indicated by the reference numeral 100a without wrapping around each ring . this straight - line path thus eliminates any source of friction which would otherwise possibly cause the line to snarl or not move freely when being paid out . between each of the rings 78a - 78d wraps or partial loops of the line become suspended . one of the advantages of the ring - shaped guides on the movable bracket 78 is that the wraps of line become self - centering in the two closest adjacent portions of adjacent rings . this can be seen in fig1 and 7 , for example . as a result , the line can then be engaged and retained by the line retaining members 82 since the wrap of line or partial loop will always appear and be centered over the retaining members 82 when the bracket 78 is retracted . each retaining member 82 ( fig5 and 10 ) includes a forked block 110 defining a pair of aligned slots 111 which receive the line 100 . a retaining hook slot 112 is provided in another side of the block at right angels to the slots 111 . finally , a groove 114 is provided in alignment with the hook slot 112 in an inside surface of the block 110 . pivotally mounted as a separate or integral piece of the block 110 is a hook 116 which can be moved into the phantom line position in fig1 by a manual depressed button 118 and upon release of the button will allow the hook to move to the left into the solid position shown in fig1 . when released , the hook member moves into the groove 114 . a small tension spring 120 can be provided if the resiliency of the plastic hook 116 is not sufficient to pull the hook into the solid line position . as the line 100 is moved downwardly by the rings in the movable bracket 76 , the aligned wraps of line between the rings 78 are pushed beyond the hooks 116 , snapping the hook open and allowing the hook to snap closed into the position shown in fig1 . thus each of the line wraps or partial loops become trapped in the restraining member 82 . one or more of the buttons 118 can be depressed at any one time to control the amount of line which will be paid out when the line 100 is pulled from the rod by momentum of a weight or propulsion of a spear or the like . that is , if all buttons are depressed at one time , the full extent of the line will be extended . if only the button to the left in fig7 is depressed , only a few of the wraps of line will be payed out . in operation of all of the embodiments , it can be seen that by manually or powered action the movable bracket 76 can be reciprocated toward fixed bracket 75 or 23 for paying out line or away from the fixed bracket 75 or 23 for retrieving line . if completely free dispensing or paying out of the line is needed , the line can be held in the retracted position in separate wraps or partial loops by the retaining members 82 . then the movable bracket 76 is moved up into the position shown in fig6 . by casting and depressing all of the buttons 118 at the full extent of the throw of the rod , much as in bait casting from an open - face casting reel , the line will move without any obstruction whatsoever as it passes through the space between the fixed bracket 80 and the fixed bracket 75 . if less than the full several loops are desired to be fed out , then only the first of the buttons is depressed . while the preferred embodiments of the invention have been illustrated and described , it should be understood that variations will be apparent to one skilled in the art without departing from the principles herein . for example , elastic band can be substituted for the fluidic or air powered actuation system shown in fig9 . preferably , this would occur by fixing one end of the elastic band to the movable bracket 76 , running the band over the sheave 88 and fixing the other end of the elastic band to stationary bracket 80 . this would give a two - fold multiple of elasticity available in the elastic band . still further , the powered movement of the movable bracket 76 can be replaced altogether with a manual movement knob 98 . furthermore , the manual knob 98 can be used to reciprocate the movable bracket back and forth less than the full extent of movement between the two fixed brackets for playing a fish , if desired . as is also understood the movable and fixed brackets 28 and 23 can be revised as can the fixed brackets 78 and 80 . accordingly , this invention is not be be limited to the specific forms illustrated in the drawings .

US-9368179-A

a multi - composite disc prosthesis is adapted to be implanted within the annulus of an evacuated disc nucleus space in a human spine . the disc prosthesis has a generally solid unitary body with a size and a shape adapted to be positioned within the annulus of the evacuated disc nucleus space . the body has an outer portion comprised of a first biomaterial and an inner portion comprised of a second biomaterial . the second biomaterial has a compressive modulus that is harder than a compressive modulus of the first biomaterial and the first and second biomaterials are chemically or physically bonded to form a multi - composite material that forms the solid body .

in contrast to conventional disc or nucleus replacements , the present invention comprises a composite system wherein the outer portion consists of soft modulus material mimicking the natural disc and the inner portion consists of harder modulus material which provides support and stability . two biocompatible polymers may be chemically bonded to form the composite system of the present invention . many conventional total disc replacements include upper and lower rigid plates and a non - rigid material disposed therebetween , while other existing nuclear replacements consist of a mass of soft material without a stabilizing hard inner core . the composite system of the present invention offers advantages over the existing devices in that the soft outer portion provides cushioning while not eroding the endplates as may happen with harder materials of other disc nucleus replacements . further , the soft outer portion is deformable to correspond to the desired modulus in response to normal physiologic forces of about 30 to 300 pounds . because of this deformability , the prosthesis produces a physiologically appropriate amount of loading on the end plates of the intervertebral disc . as a result , the end plates will not excessively deform over time and ultimately conform to the contours of the implant as is the case with more rigid disc nucleus replacement implants . further , the harder inner core of the present invention provides support and stability lacking in the implants made of hydrogel blocks or chunks . in an embodiment of the present invention , the nucleus replacement 10 may include several components that are sequentially inserted into the evacuated disc nucleus space . this sequential insertion allows for a small surgical exposure because the device is inserted one component at a time as opposed to some problematic devices that are inserted in their entirety requiring a larger surgical exposure . as shown in fig1 , each component 20 may be composed of an inner connecting track of hard modulus biomaterial 22 and an outer surrounding coat of a softer modulus biomaterial 24 . during insertion , the first component may slide along a track consisting of a high modulus biomaterial and into place within the disc annulus . in one embodiment , the device is inserted in a minimally invasive procedure through a small opening in the posterior annulus . each component may mechanically interlock with the adjacent component such that when all components are fully inserted , the interlocked components comprise a single unit . in one embodiment , the device of the present invention may consist of two biocompatible materials of different hardness . in an embodiment of the device , the biomaterials may consist of a biocompatible polyurethane based on a diisocyanate and a polyol . in one embodiment , the isocyanate component may be 4 , 4 ′- diphenylmethane diisocyanate (‘ mdi ”) and the polyol component may be a combination of polytetramethyleneoxide (“ ptmo ”) 1000 and ptmo 2000 . the polymers may also contain a chain extender , a cross linking agent and a catalyst . in one embodiment , the chain extender may be 1 , 4 - butanediol (“ bdo ”); the cross linking agent may be trimethylpropane (“ tmp ”) and the catalyst may be bis -( dodecylthio )- dimethylstannane (“ fomrez catalyst ul22 ”). the two biomaterials may be bonded together forming a composite system . for example , such bonding may be chemical or physical . in one aspect of the present invention , such bonding may include a urethane bond . one of ordinary skill in the art will recognize that additional biomaterials and constituents of the biomaterials suitable for the composition of the present nucleus prosthesis are contemplated and are within the scope of the present disclosure . other biomaterials that may be used within the scope of the present invention include , but are not limited to : hydrogels , rubbers , silicones , thermoplastic elastomers , acrylate monomers , curable epoxies , curable monomers and any combination thereof . in one embodiment of the device , the outer surrounding coat of the device may be comprised of a first biomaterial consisting of a softer polymer that provides cushioning and support , mimicking the characteristics of a natural disc nucleus . in an embodiment of the device , the outer polymer may be modified to provide for elution of medicants such as analgesics , antibiotics , antineoplastics , or bioosteologics such as bone growth agents or any other desired material . while motion preservation is generally a principle goal in nucleus replacement , in certain indications it may be desirable to promote some bony fusion . such indications may include nuclear replacements in the cervical spine . the solid polymer outer shell of the modular disc nucleus prosthesis may provide for better and more controllable elution rates than some hydrogel materials . in an alternate embodiment , the modular disc nucleus prosthesis may include different elution rates for each polymer material . this would allow for varying elution rates for different medicants . the softer biomaterial may consist of a harder segment content in the range of about 15 to 25 weight percent . one of ordinary skill in the art will recognize that additional ranges of hard segment weight percent within this explicit range are contemplated and are within the scope of the present disclosure . the softer biomaterial may have a compressive modulus in the range of about 10 - 20 mpa . for example , the softer biomaterial may have a shore a hardness no greater than 80 and a shore d hardness no greater than 40 . the tensile strength of the softer biomaterial may be in the range of 10 - 30 mpa . in an embodiment of the present device , the softer biomaterial may have a yield strength of 1 - 1 . 5 mpa . the modulus of elasticity of the softer biomaterial may be in the range of 6 - 8 mpa . one of ordinary skill in the art will recognize that additional ranges within the explicit ranges set forth hereinabove are contemplated and are within the scope of the present disclosure . one embodiment of device may further include a second biomaterial . the second biomaterial may consist of a harder polymer of high durometer , preferably of at least a shore d hardness of 55 . the hardness of the second biomaterial provides structural support for the insertion track and the interlocking mechanism . in an alternative embodiment , the first or second biomaterial may consist of a thermoplastic polyether - urethane or polycarbonate - urethane , such as pellethane ®, tecothane ® or bionate ®. in an embodiment , the first or second biomaterial may consist of poly - ether - ether - ketone ( peek ) or another polymer of similar stiffness . in another alternative embodiment , the second biomaterial may consist of a mdi , ptmo based polyurethane processed to have a hard segment weight content in the range of about 50 to 70 percent , smaller homogenous molecular weight chain lengths in the prepolymer and an optimal micro - phase separation of the hard and soft segment components to provide a macroscopically homogenous distribution in the cured polymer . one of ordinary skill in the art will recognize that additional ranges of hard segment weight percent within this explicit range are contemplated and are within the scope of the present disclosure . the harder biomaterial may have a tensile strength in the range of 40 - 75 mpa . the yield strength of the harder biomaterial may be in the range of 20 - 45 mpa . the harder biomaterial may have a modulus of elasticity in the range of 400 - 700 mpa . the compressive modulus of the harder biomaterial may be in the range of 200 - 400 mpa . one of ordinary skill in the art will recognize that additional ranges within the explicit ranges set forth hereinabove are contemplated and are within the scope of the present disclosure . in an aspect of the first softer biomaterial , the weight percent of the mdi may be in a range of 5 to 35 weight percent of the total cured polymer . in an alternate embodiment of the first softer biomaterial , the weight percent of the mdi may be in a range of 15 to 25 weight percent of the total cured polymer . in one embodiment , the weight percent of the mdi may be in a range of about 18 to 20 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of mdi weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the ptmo 1000 of the first softer biomaterial may be in a range of 0 to 40 weight percent of the total cured polymer . in an alternate embodiment , the weight percent of the ptmo 1000 may be in a range of 10 to 30 weight percent of the total cured polymer . in one embodiment , the weight percent of the ptmo 1000 may be in a range of 25 to 27 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of ptmo 1000 weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the ptmo 2000 of the first softer biomaterial may be in a range of 0 to 80 weight percent of the total cured polymer . in an alternate embodiment , the weight percent of the ptmo 2000 may be in a range of 40 to 60 weight percent of the total cured polymer . in one embodiment , the weight percent of the ptmo 2000 may be in a range of 52 to 54 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of ptmo 2000 weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the bdo of the first softer biomaterial may be in a range of 0 to 10 weight percent of the total cured polymer . in an alternate embodiment , the weight percent of the bdo may be in a range of 0 to 5 weight percent of the total cured polymer . in one embodiment , the weight percent of the bdo may be in a range of 1 to 2 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of bdo weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the tmp of the first softer biomaterial may be in a range of 0 to 5 weight percent of the total cured polymer . in an alternate embodiment , the weight percent of the tmp may be in a range of 0 to 0 . 1 weight percent of the total cured polymer . in one embodiment , the weight percent of the tmp may be in a range of 0 . 06 to 0 . 08 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of tmp weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the ul22 of the first softer biomaterial may be in a range of 0 to 2 weight percent of the total cured polymer . in an alternate embodiment , the weight percent of the ul22 may be in a range of 0 to 1 weight percent of the total cured polymer . in one embodiment , the weight percent of the ul22 may be in a range of 0 . 0001 to 0 . 0030 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of ul22 weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . in one aspect of the first softer biomaterial , the combined weights of the mdi and bdo generally correlate to the hard segment content and hardness of the cured polymer . in an embodiment of the first softer biomaterial , the combined weight percentage of the mdi and bdo may be in a range of about 15 to 25 weight percent of the total cured polymer . in one embodiment of the first softer biomaterial , the combined weight percentage of the mdi and bdo may be in a range of about 20 to 22 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of combined mdi and bdo weight percentages of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the first softer biomaterial may comprise two separate prepolymers , part a and part b , that are mixed together to form the cured polymer . in one embodiment , part a is formed by processing mdi and ptmo 2000 together and part b is formed by processing ptmo 1000 , bdo , tmp and ul22 together . any combination of mdi , ptmo 1000 , ptmo 2000 , bdo , tmp , ul22 and / or other suitable constituents may be processed to form the prepolymers , part a and part b . in an embodiment of the first softer biomaterial where part a and part b are mixed together to form the cured polymer , part a and part b may be mixed such that the total isocyanate to polyol ratio is in the range of about 0 . 96 to 1 . 04 . in one embodiment , part a and part b may be mixed together such that the total isocyanate to polyol ratio is in the range of about 1 . 01 to 1 . 03 . one of ordinary skill in the art will recognize that additional ranges of total isocyantate to polyol ratios within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the mdi of the second harder biomaterial may be in a range of 30 to 70 weight percent of the total cured polymer . in an alternate embodiment of the second harder biomaterial , the weight percent of the mdi may be in a range of 40 to 60 weight percent of the total cured polymer . in one embodiment of the second harder biomaterial , the weight percent of the mdi may be in a range of about 47 to 49 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of mdi weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the ptmo 1000 of the second harder biomaterial may be in a range of 0 to 40 weight percent of the total cured polymer . in an alternate embodiment of the second harder biomaterial , the weight percent of the ptmo 1000 may be in a range of 10 to 30 weight percent of the total cured polymer . in one embodiment of the second harder biomaterial , the weight percent of the ptmo 1000 may be in a range of about 20 to 22 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of ptmo 1000 weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the ptmo 2000 of the second harder biomaterial may be in a range of 0 to 40 weight percent of the total cured polymer . in an alternate embodiment of the second harder biomaterial , the weight percent of the ptmo 2000 may be in a range of 10 to 30 weight percent of the total cured polymer . in one embodiment of the second harder biomaterial , the weight percent of the ptmo 2000 may be in a range of about 15 to 17 weight percent of the total cured polymer . one of ordinary skill in the art will recognize that additional ranges of ptmo 2000 weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the bdo of the second harder biomaterial may be in a range of 0 to 35 weight percent of the total cured polymer . in an alternate embodiment of the second harder biomaterial , the weight percent of the bdo may be in a range of 5 to 25 weight percent of the total cured polymer . in one embodiment of the second harder biomaterial , the weight percent of the bdo may be in a range of about 14 to 16 weight percent of the total cured polyurethane . one of ordinary skill in the art will recognize that additional ranges of bdo weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the tmp of the second harder biomaterial may be in a range of 0 to 5 weight percent of the total cured polyurethane . in an alternate embodiment of the second harder biomaterial , the weight percent of the tmp may be in a range of 0 to 1 weight percent of the total cured polyurethane . in one embodiment of the second harder biomaterial , the weight percent of the tmp may be in a range of about 0 . 1 to 0 . 3 weight percent of the total cured polyurethane . one of ordinary skill in the art will recognize that additional ranges of tmp weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . the weight percent of the ul22 of the second harder biomaterial may be in a range of 0 to 2 weight percent of the total cured polyurethane . in an alternate embodiment of the second harder biomaterial , the weight percent of the ul22 may be in a range of 0 to 1 weight percent of the total cured polyurethane . in one embodiment of the second harder biomaterial , the weight percent of the ul22 may be in a range of about 0 . 0001 to 0 . 002 weight percent of the total cured polyurethane . one of ordinary skill in the art will recognize that additional ranges of ul22 weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . in one embodiment of the second harder biomaterial , the combined weights of the mdi and the bdo generally correlate to the hard segment content and hardness of the cured polymer . the combined weight of the mdi and bdo may be in the range of about 50 to 70 weight percent of the total weight of the cured polymer . in one embodiment , the combined weight of the mdi and bdo may be in the range of about 62 to 64 weight percent of the total weight of the cured polymer . one of ordinary skill in the art will recognize that additional ranges of combined mdi and bdo weight percent of the total cured polymer within the above described explicit ranges are contemplated and are within the scope of the present disclosure . for a more detailed description of one tracked embodiment of fig2 and 3 of the present invention , reference is made to the previously identified co - pending application entitled , “ rail - based modular disc prothesis ,” the disclosure of which is hereby incorporated by reference . in one aspect of the implant of the present invention , the second harder biomaterial may be comprised of two separate prepolymers , part a and part b . part a and part b may be selected from the group consisting of mdi , tdi , ptmo 1000 , ptmo 2000 , bdo , tmp , ul22 or any other combination of suitable constituents . further , part a may be processed such that the prepolymer contains smaller molecular weight chain lengths of one or two polymer populations than that of part b . in one embodiment , the mdi , ptmo 1000 and ptmo 2000 are processed together to form the part a . preferably , the bdo , tmp and ul22 are processed together to form the part b . part a and part b may be mixed such that the total isocyanate to polyol ratio is in the range of about 0 . 96 to 1 . 04 . in one embodiment , the isocyanate to polyol ratio is in the range 1 . 01 to 1 . 03 . one of ordinary skill in the art will recognize that additional ranges of isocyanate to polyol ratios within the above described explicit ranges are contemplated and are within the scope of the present disclosure . various modifications to the disclosed apparatuses and methods may be apparent to one of skill in the art upon reading this disclosure . the above is not contemplated to limit the scope of the present invention , which is limited only by the claims below .

US-48926406-A

an implantable medical device , such as a defibrillator , performs a capacitor reform or other temporary high current mode , such as to maintain efficacy of a battery or a high voltage defibrillation energy storage capacitor in spite of non - use . before performing the capacitor reform or other high current mode , a voltage delay test can be performed . a voltage delay can be declared when an initial battery voltage measurement is less than a later battery voltage measurement during a loaded condition such as the charging of the capacitor . if a voltage delay is present , the capacitor reform or other temporary high current mode is enabled , otherwise , the capacitor reform or other temporary high current mode is inhibited . this saves energy , increasing the life of the imd before explant .

the present inventors have recognized that certain high voltage capacitors for storing the defibrillation energy can lose their effectiveness during an extended period of non - use . as an illustrative ( but non - limiting ) example , suppose that an aluminum electrolytic capacitor is used as the high voltage capacitor for storing the defibrillation energy . this type of capacitor can include strips of aluminum foil and electrolyte - impregnated paper . each strip of aluminum foil can be covered with an aluminum oxide , which insulates the foils from the electrolyte in the paper . one maintenance issue with aluminum electrolytic capacitors concerns the degradation of their charging efficiency after long periods of inactivity . the degraded charging efficiency , which is believed to stem from instability of the aluminum oxide in the liquid electrolyte , ultimately requires the battery to progressively expend more and more energy to charge the capacitors for providing therapy . thus , to repair this degradation , a processor in the imd can be programmed to regularly charge and hold aluminum electrolytic capacitors at or near a maximum - energy voltage ( the voltage corresponding to maximum energy ) for a time period less than one minute , before discharging them internally through a non - therapeutic load . ( in some cases , the maximum - energy voltage is allowed to leak off slowly rather than being maintained ; in others , it is allowed to leak off ( or droop ) for 60 seconds and discharged through a non - therapeutic load ; and in still other cases , the voltage is alternately held for five seconds and drooped for 10 seconds over a total period of 30 seconds , before being discharged through a non - therapeutic load .) these periodic charge - hold - discharge ( or charge - hold - droop - discharge ) cycles for capacitor maintenance are called capacitor “ reforms .” wet - tantalum capacitors may similarly exhibit degradation from disuse and , therefore , may also benefit from capacitor reform . certain batteries may also exhibit degradation from disuse at a high current draw , which may result in formation of an oxidation or other layer about the battery anode , thereby increasing the apparent battery impedance of the battery . therefore , such batteries may also benefit from the same capacitor reform , or any other recurrent mode that tends to draw a high current from the battery , thereby disrupting the resistive layer formed about the battery anode . unfortunately , the capacitor reform ( or other high current draw mode ) expends energy and , therefore , tends to reduce battery life of the imd , thereby hastening its explantation and replacement . the present inventors have recognized , among other things , that it is possible to test whether a capacitor reform or ( other temporary high current mode ) is actually needed . by performing capacitor reform or other high current mode only when actually needed , the energy used in performing the capacitor reform or high current mode can be saved . this can increase the battery life of the imd , thereby prolonging its useful life before explantation and replacement occurs . fig1 is an illustrative example of a method of testing whether a voltage delay is present , such as to determine whether to perform a capacitor reform or high current mode . at 102 , one or more timers are reset . at 104 and 106 , monitoring is concurrently performed for expiration of the timer or detection of a test - triggering event . one example of a triggering event is the occurrence of a capacitor charging , such as for a defibrillation shock delivery . at 104 , if the timer expires , then a voltage delay test is performed at 108 , otherwise triggering event detection is checked at 106 . if a triggering event is detected at 106 , process flow proceeds to 108 to test for voltage delay during the charging for defibrillation shock delivery , otherwise process flow returns to 104 to wait for the timer to expire . voltage delay refers to a time delay for the voltage of the battery to reach a maximum after a device mode is enabled that involves a high current drain from the battery ( e . g ., charging of a high voltage capacitor ). the voltage delay test is described below in regard to fig3 a - 3b . if desired , a different timer period can be used depending on whether a triggering event was detected at 106 , or whether the timer expired at 104 without having detected such a triggering event at 106 . for example , a high voltage capacitor charging in preparation for a defibrillation shock delivery may trigger a different timer duration than a previous voltage delay measurement that did not result in performing a capacitor reform , as discussed below . at 110 , after testing for voltage delay at 108 , if a voltage delay is present , a capacitor reform ( or other temporary high current mode ) is performed at 112 and the timer is then reset at 102 , otherwise , the capacitor reform or other high current mode at 112 is skipped and the timer is reset at 102 . process flow then repeats , such as described above . typically , a high current mode can draw about one amp ( 1 a ) of current from the battery . for example , charging of a high voltage capacitor can draw from one to three amps from the battery . fig2 is a block diagram of an imd 200 including certain portions that may be germane to the present discussion of testing for voltage delay and performing a capacitor reform or other temporary high current mode . in this example , the imd 200 includes a battery 202 , which is coupled to at least one high voltage capacitor 206 by a switched - mode or other dc - to - dc converter circuit 204 . a switching circuit 208 selectively couples the high voltage capacitor 206 to desired electrodes 210 , located in association with the subject to be defibrillated , such as via one or more leads 212 or other conductors . a battery measurement circuit 214 is configured to measure the terminal voltage of the battery 202 , such as during charging of the high voltage capacitor 206 by the dc - to - dc converter 204 . a processor 216 controls operation of , among other things , the dc - to - dc converter 204 and the switching circuit 208 , such as to test for voltage delay or perform the capacitor reform or other temporary high current mode , such as described above with respect to fig1 . the processor 216 may include a digital signal processor , application specific integrated circuit ( asic ), microprocessor , or other type of processor , interpreting or executing instructions in software or firmware . fig3 a and 3b are graphs of voltage vs . time illustrating generally a first example in which voltage delay is present ( fig3 a ) and a second example in which voltage delay is absent ( fig3 b ). in certain examples , a voltage delay measurement is performed by initiating charging of the high voltage capacitor 206 by the dc - to - dc converter 204 shortly before ( e . g ., 100 ms ) performing an initial battery terminal voltage measurement v 1 at time t 1 . after a programmable time delay ( t 2 - t 1 ) ( e . g ., 2 seconds ), a second battery terminal voltage measurement v 2 is performed at time t 2 . if v 2 & gt ; v 1 ( as shown in fig3 a ), then a voltage delay condition is declared to exist , otherwise v 2 ≦ v 1 ( as shown in fig3 b ), and a voltage delay condition is declared absent . if the voltage delay condition is absent , then charging of the high voltage capacitor is discontinued immediately , thereby conserving any further energy that would have been used in further charging the high voltage capacitor , such as in performing a full capacitor reform . if the voltage delay condition exists , then a capacitor reform ( or other temporary high current mode ) is performed , such as by continuing to charge the high voltage capacitor to a specified high voltage value ( e . g ., 750 volts ) such as that stored for usage in delivering a defibrillation shock . in an example in which the voltage delay measurement is performed with a similar regularity as a capacitor reform would otherwise be performed ( e . g ., without such voltage delay measurement ), then by comparison , using the voltage delay measurement to decide whether to perform the capacitor reform will save energy in the instances in which no voltage delay is present . this can increase the battery life of the imd , thereby prolonging its useful life before explantation and replacement occurs . in an example , a voltage delay measurement is also performed when the imd monitoring ( e . g ., detection circuit 218 ) detects an arrhythmia and responds by charging the high voltage capacitor in preparation for delivering a defibrillation shock . if this charging continues ( e . g ., is not aborted ) beyond time t 2 , then the battery voltage measurements can be obtained for testing for any voltage delay . if no voltage delay is present , then the timer can be reset , thereby putting off the next voltage delay test and delaying expenditure of the energy associated therewith . although specific examples have been given for the values associated with the times t 1 , t 2 , etc ., in certain examples , such values are programmable , such as by the designer , an end - user , or as a function of another automated process of the imd . the above detailed description includes references to the accompanying drawings , which form a part of the detailed description . the drawings show , by way of illustration , specific embodiments in which the invention can be practiced . these embodiments are also referred to herein as “ examples .” such examples can include elements in addition to those shown and described . however , the present inventors also contemplate examples in which only those elements shown and described are provided . all publications , patents , and patent documents referred to in this document are incorporated by reference herein in their entirety , as though individually incorporated by reference . in the event of inconsistent usages between this document and those documents so incorporated by reference , the usage in the incorporated reference ( s ) should be considered supplementary to that of this document ; for irreconcilable inconsistencies , the usage in this document controls . in this document , the terms “ a ” or “ an ” are used , as is common in patent documents , to include one or more than one , independent of any other instances or usages of “ at least one ” or “ one or more .” in this document , the term “ or ” is used to refer to a nonexclusive or , such that “ a or b ” includes “ a but not b ,” “ b but not a ,” and “ a and b ,” unless otherwise indicated . in the appended claims , the terms “ including ” and “ in which ” are used as the plain - english equivalents of the respective terms “ comprising ” and “ wherein .” also , in the following claims , the terms “ including ” and “ comprising ” are open - ended , that is , a system , device , article , or process that includes elements in addition to those listed after such a term in a claim are still deemed to fall within the scope of that claim . moreover , in the following claims , the terms “ first ,” “ second ,” and “ third ,” etc . are used merely as labels , and are not intended to impose numerical requirements on their objects . method examples described herein can be machine or computer - implemented at least in part . some examples can include a computer - readable medium or machine - readable medium encoded with instructions operable to configure an electronic device to perform methods as described in the above examples . an implementation of such methods can include code , such as microcode , assembly language code , a higher - level language code , or the like . such code can include computer readable instructions for performing various methods . the code may form portions of computer program products . further , the code may be tangibly stored on one or more volatile or non - volatile computer - readable media during execution or at other times . these computer - readable media may include , but are not limited to , hard disks , removable magnetic disks , removable optical disks ( e . g ., compact disks and digital video disks ), magnetic cassettes , memory cards or sticks , random access memories ( rams ), read only memories ( roms ), and the like . the above description is intended to be illustrative , and not restrictive . for example , the above - described examples ( or one or more aspects thereof ) may be used in combination with each other . other embodiments can be used , such as by one of ordinary skill in the art upon reviewing the above description . the abstract is provided to comply with 37 c . f . r . § 1 . 72 ( b ), to allow the reader to quickly ascertain the nature of the technical disclosure . it is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims . also , in the above detailed description , various features may be grouped together to streamline the disclosure . this should not be interpreted as intending that an unclaimed disclosed feature is essential to any claim . rather , inventive subject matter may lie in less than all features of a particular disclosed embodiment . thus , the following claims are hereby incorporated into the detailed description , with each claim standing on its own as a separate embodiment . the scope of the invention should be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled .

US-34069208-A

an external , self - contained laryngeal prosthesis is adapted for use by a tracheostomized patient having a surgically - formed &# 34 ; pseudoglottis &# 34 ; separating the trachea and the hypopharynx . the prosthesis includes a housing and a fitting for attaching the housing to the tracheostoma formed in the patient &# 39 ; s neck . the housing contains an inhalation valve to allow inhaled air to pass through a first conduit into the trachea , and an exhalation valve for directing exhaled air from the first conduit into the housing downstream from the inhalation valve toward a second conduit . the second conduit is adapted for communicating between the housing and the hypopharynx through the fitting and through an incision in the pseudoglottis . downstream from the exhalation valve is a tone - generating mechanism responsive to air pressures in a range normally produced by a speech effort . at higher air pressures , such as produced by panting or gasping , the tone - generating mechanism is disabled , and an alternative air flow path from the exhalation valve to the second conduit is opened .

referring first to fig1 a preferred embodiment of the present invention is shown installed in a human patient or user . as is usually the case with a laryngectomized patient , a tracheostoma 10 is made through the neck and into the trachea 12 . the tissue separating the trachea 12 and the esophagus 14 , which may be termed the tracheal - esophageal wall 16 , is flapped over the end of the trachea 10 and sutured to the internal neck tissue , as at 18 , to provide a &# 34 ; pseudoglottis &# 34 ; 20 . the pseudoglottis 20 is a barrier between the trachea and the hypopharynx 22 to prevent the entry of food , saliva , mucous , etc . into the trachea . other surgical techniques to provide such a pseudoglottis may also be used . as can be seen from fig1 the invention comprises two major subassemblies , which may be described as the internal and external subassemblies . the external subassembly comprises a housing 100 and the components contained therein , as will be described in detail later on . the internal subassembly comprises a sealing fitting 30 for the tracheostoma 10 , and a hypopharyngeal tube 32 which extends from an upper passage 34 in the fitting 32 , through an incision in the pseudoglottis 20 , and into the hypopharynx 22 . the fitting 30 also includes a lower passage 36 . the fitting 30 is configured to provide a sealing fit within the tracheostoma , and yet to be easily removable therefrom if desired . it can be made of any suitable biocompatible material . a first end of the hypopharyngeal tube 32 is , as previously mentioned , inserted into the upper passage 34 in the fitting 30 ; the other or second end passing into the hypopharynx through the pseudoglottis . this second end of the tube 32 is provided with a one - way epiglottal valve 38 . the valve 38 may have any of a number of specific configurations . as shown in fig1 for example , it comprises a resilient flap which is normally in an open position ( as shown by the solid outline ), but which flexes to a closed position ( dotted outline ) when food or bodily secretions ( such as saliva or mucous ) pass over it . in this regard , it is advantageous to have the flap &# 34 ; hinged &# 34 ; to the tube at the flap &# 39 ; s upstream side , as shown , so that the tube opening is shielded by the flap , which deflects food and secretions away from the tube opening . alternatively , a normally closed tricuspid valve may be used in place of the flapper valve 38 . in either case , an epiglottal function is simulated . the tube 32 has a pair of inflatable cuffs 40 disposed on either side of the pseudoglottis . the cuffs 40 retain the tube in place with minimal abrasion of the tissue . they are inflated via a lumen ( not shown ) in the tube wall , as is a standard practice with devices such as tracheostomy tubes and catheters . fig2 through 5 illustrate in detail the external subassembly , comprising the housing 100 and the components contained therein . as best shown in fig2 the housing comprises three axially - aligned cylindrical segments 100a , 100b , and 100c attached end - to - end to form a hollow cylinder . the first , or lower segment 100a has an aperture 102 in the side into which extends a first or lower conduit 104 , itself having an elongate side - wall aperture or port 104 . situated within the housing segment 100a near its open lower end is a retaining ring 106 which retains an inhalation valve seat 108 . although shown as separate components , the retaining ring 106 and valve seat 108 may be formed as an integral unit . seated in the valve seat 106 is a one - way inhalation valve 110 which allows gas to enter the housing through its lower open end ( fig3 ), but does not allow gas to pass outwardly therefrom . the valve 110 is a disc or diaphragm of highly pliable , resilient material which is held in the seat 108 by a central stem 112 , and which flexes upwardly away from the seat around its edges in response to an incoming flow of air , as shown in fig3 . at the upper end of the lower housing segment 100a is situated an exhalation valve seat 114 , which seats an exhalation valve 116 . the exhalation valve seat 114 and the exhalation valve 116 may advantageously be of the same type as the inhalation valve 110 and its seat 108 . that is , the exhalation valve 116 comprises a highly flexible disc or diaphragm retained in the seat 114 by means of a central stem 118 . the exhalation valve 116 allows gas to flow only upwardly through it ; that is , out of the lower housing segment 100a and into the middle housing segment 100b . thus , as described above , the lower housing segment forms a first chamber defined between the inhalation valve 110 and the exhalation valve 116 . the lower end of the middle housing segment 100b is joined to the upper end of the lower housing segment 100a . situated inside the middle housing segment 100b near its upper end is a sealing ring 120 , which may advantageously include a plurality of upwardly - extending guide rods 122 . the inner periphery of the sealing ring 120 is formed as an upwardly extending rim or bead 124 . the middle housing segment 100b may thus be considered a second chamber defined between the exhalation valve 116 and the sealing ring 120 . the lower end of the upper housing segment 100c is joined to the upper end of the middle housing segment 100b . the sidewall of the upper housing segment 100c is apertured at a suitable location to receive a second or upper conduit 126 . that portion of the interior surface of the upper housing segment 100c above the upper conduit 126 is advantageously threaded , as at 128 , for threaded engagement with an adjustment plate 130 , the purpose of which will be explained below . the upper surface of the adjustment plate 130 may have a linear slot 132 to facilitate the adjustment of its position within the upper housing segment 100c , while the lower surface of the adjustment plate is advantageously provided with an annular groove 134 ( fig3 , 5 ). the upper end of the upper housing segment 100c is sealed with an end cap 136 . a third chamber is thus defined between the end cap 136 and the sealing ring 120 . the vibratory tone - generating mechanism of the preferred embodiment comprises a reed 138 , formed from an l - shaped band of a suitable metal . a band formed of stainless steel with a thickness of approximately 5 mils has produced good results , although other materials ( metallic and nonmetallic ) and thicknesses may also be acceptable . the reed 138 is retained in a slot 140 formed in one of two diametrically - opposed legs or posts 142 extending downwardly from an annular reed carrier 144 . the posts 142 serve to locate the carrier 144 within the central opening of the sealing ring 120 , and they should be long enough to stay within said opening at the upper extreme of the carrier &# 39 ; s travel , as will be explained below . the reed 138 overlies the flat surface of a reed seat 146 , the latter having a central aperture 148 ( fig4 ) communicating with the hollow interior of a threaded shaft 150 . the shaft 150 passes through a central aperture 152 in the carrier 144 ( fig2 ), and it is held in a preselected position with respect to the carrier by a threaded nut 154 and a retaining spring 156 , the latter engaging the underside of the carrier and a shoulder 158 ( fig2 ) formed around the bottom terminus of the threaded shaft 150 . the surface of the reed seat 146 which underlies the reed 138 is advantageously covered by a gasket 160 formed of a soft material , such as a rubber or a soft plastic . the nut 154 is used to adjust the position of the reed seat 146 with respect to the carrier 144 such that one edge of the reed seat engages the reed 138 and pushes it away from the reed seat , as shown in fig3 , and 5 . the reed 138 is thus biased so that , when properly adjusted , it vibrates with an audible frequency at exhalation pressures corresponding to normal speech efforts , and it collapses against the gasket 160 at pressures in excess of speech levels , as explained in greater detail below . the carrier 144 is biased downwardly by a mainspring 162 which is seated in the groove 134 of the adjustment plate 130 and in a similar annular groove 164 in the upper surface of the carrier . on the underside of the carrier , opposite the groove 164 , is an annular gasket 166 ( fig2 and 5 ). the carrier 144 , as will be seen below , functions as a valve body biased in a normally closed position by the main spring 162 so that the gasket 166 engages the bead 124 of the sealing ring 120 ( fig3 and 4 ). the adjustment plate 130 is used to selectably adjust the pressure at which the carrier is lifted off of the bead 124 , thereby resulting in an open valve position . this pressure is selected to be that at which the coughing or gasping mode is to be initiated , as will be explained below . advantageously , both the nut 154 and the adjustment plate 130 may be adjusted to their selected positions during manufacture , and then fixed in place , as by a suitable adhesive or by ultrasonic welding . toward this end , both the nut 154 and the adjustment plate 130 are advantageously formed of the same material as the other parts of housing and its associated components ( except the reed 138 and the springs 156 and 162 ). preferably , this material is a biocompatible plastic , such as a polysulfone . referring once again to fig1 it can be seen that when the invention is in use , the housing 100 is installed in the fitting 30 with the lower conduit 102 communicating with the lower passage 36 , and the upper conduit 126 in communication with the upper passage 34 . this puts the first or lowermost chamber in the housing in communication with the user &# 39 ; s lungs through the trachea 12 , and the third or uppermost chamber of the housing in communication with the hypopharynx through the tube 32 . the operation of the invention is best understood with reference to fig3 , and 5 , which show the various operational modes of the external subassembly of the invention . first , fig3 shows the invention during inhalation . in response to an inhalation effort by the user , air is drawn through the open bottom of the lower housing segment 100a and into the lowermost chamber of the housing through the inhalation valve 110 . from there , the air enters the lower conduit 102 through the port 104 , for delivery to the user &# 39 ; s lungs via the lower passage 36 of the fitting 30 and the trachea ( fig1 ). the exhalation valve 116 remains closed , as shown . fig4 shows the invention during the normal exhalation mode and during the speaking mode . in both of these modes of operation , exhaled gas passes through the lower conduit 102 into the lowermost chamber of the housing . from there , the exhalation valve 116 admits the air into the second or middle chamber of the housing , while the inhalation valve 110 remains closed . as previously discussed , normal exhalation usually occurs at peak pressure levels of less than 10 centimeters of water ( cmh 2 o ). with the reed 138 biased by the edge of the reed seat 146 as described above , the reed 138 is spaced from the reed seat gasket 160 , leaving a gap which communicates with the air passage formed by the reed seat aperture 148 and the hollow bore of the threaded shaft 150 . by appropriate manipulation of the nut 154 , the tension on the reed 138 can be selectably adjusted so that it remains substantially stationary ( as shown in the solid outline in fig4 ) at sub - phonation pressure levels , i . e ., less than approximately 10 cmh 2 o . likewise , if the tension on the reed has been appropriately adjusted , the pressure levels produced by a speech effort ( typically 12 to 20 cmh 2 o ) will cause the reed to vibrate , as shown by the dotted lines in fig4 . by judicious selection of the reed material , thickness , and tension , the reed will vibrate with an audible tone within the frequency range of normal speech ( i . e ., between approximately 100 hz and 400 hz ). the gasket 160 , being of a softer , more resilient material than the reed seat 146 , serves to muffle any unpleasant noises or sounds created when the reed strikes the reed seat during vibration . during both the normal exhalation and speech modes ( i . e ., at sub - phonation and phonation pressure levels ), air passing over and around the reed is conducted through a principal flow path , comprising the reed seat aperture 148 and the bore of the hollow threaded shaft 150 , into the uppermost chamber of the housing . from there , the exhaled air passes through the upper conduit 126 and the upper passage 34 of the fitting 30 , and into the hypopharyngeal tube 32 ( fig1 ). the air then exits into the hypopharynx through the epiglottal valve 38 . during the speaking mode , the vibrations of the reed 138 are transmitted to the air passing into the hypopharynx , and it is this vibrating air that is modulated by the pharyngeal and buccal structures , including the tongue and lips , to produce speech . during heavy breathing ( gasping or panting ) and coughing , it is usually desirable to disable the tone - generating mechanism to avoid the production of possibly annoying or embarrassing noises . this mode of operation , which may be termed the &# 34 ; coughing &# 34 ; mode , is illustrated in fig5 . as in the normal exhalation and speech modes , exhaled air passes into the middle chamber of the housing via the lower conduit 102 , and the port 104 , and the exhalation valve 116 , with the inhalation valve 110 remaining closed . the pressures generated by heavy breathing and coughing are typically well in excess of 20 cmh 2 o . by appropriate selection of the tension on the reed 138 ( as adjusted by the nut 154 ), the reed can be caused to collapse against the reed seat gasket 160 , blocking the aperture 148 , when such pressure levels are reached . pressure then very quickly builds in the second chamber to a level sufficient to overcome the bias of the main spring 162 , thereby lifting the carrier 144 upwardly . this allows air to pass through the central aperture of the sealing ring 120 and between the gap that is created between the bead 124 on the sealing ring and the valving surface ( gasket 166 ) of the carrier . air thus enters the uppermost chamber of the housing through a secondary flow path without actuation of the tone - generating mechanism . the air then travels into the hypopharynx in the manner described above , to be exhausted from the body via the nose and / or mouth . the collapsing of the reed and the lifting of the carrier thus , effectively , removes the operative part of the tone - generating mechanism from the stream of the exhalation air flow . the pressure level at which this coughing mode is initiated can be selected , as previously described , by adjusting the compression of the mainspring 162 via the adjustment plate 130 . after each exhalation in this manner , the carrier 144 is returned to its &# 34 ; closed &# 34 ; position ( i . e ., the bead 124 engaging the gasket 166 ) by the force of the mainspring 162 . during this oscillatory movement of the carrier 144 , the downwardly - extending posts 142 guide the carrier and maintain its proper alignment in the interior of the sealing ring 120 . thus , the posts 142 must be of sufficient length to remain within the ring &# 39 ; s interior at the uppermost extreme of the carrier &# 39 ; s travel , as previously mentioned . as discussed above , the adjustments of the reed tension and the mainspring compression may be preselected during manufacture , with the nut 154 and the adjustment plate 130 being thereafter fixed in their respective preselected positions . in this manner , devices in accordance with the present invention can be specifically adjusted for different types of users . for example , small children may require different settings of these adjustments from those required by adults . from the foregoing description , it can be seen that the present invention provides many significant advantages . specifically , good discrimination is provided between the various modes of operation , and switching between these modes occurs automatically , and in a manner which closely simulates the natural functions . moreover , installation of the present invention is surgically simple , requiring only the pseudoglottal incision in addition to the tracheostomy . furthermore , it can be appreciated that the construction of the present invention allows for economy of manufacture , and ease of use and maintenance . still another advantage resides in the facility with which the external subassembly can be removed from the fitting 30 for cleaning and maintenance , or when extended periods of heavy breathing are anticipated , leaving the user to breathe through the tracheostoma via the passages 34 and 36 in the fitting . while a specific preferred embodiment of the invention has been described , it should be understood that various modifications may suggest themselves to those skilled in the pertinent arts . for example , the housing may take a variety of forms , and may be of one piece , instead of the three - piece cylindrical structure shown . also , the internal components within the housing may be modified from the specific configurations shown while maintaining their operative characteristics . such modifications should be considered within the spirit and scope of the invention , as defined in the claims which follow .

US-52530683-A

the outfeed unit of a cigarette maker establishes a feed path along which at least one cigarette rod is caused to advance in a predetermined direction from the outfeed end of a beam , on which the rod is formed , toward a cutter device by which the rod is divided into sticks constituting single cigarettes ; the unit is equipped with a cut - off device located in close proximity to the outfeed of the forming beam , by which the rod is severed and diverted from the feed path , and , at a given point downstream of the cut - off device , with pinch rollers by which a portion of the rod separated through the action of the cut - off device is removed from a final stretch of the feed path between the cut - off device and the cutter device .

referring to fig1 of the drawings , 1 denotes a portion , in its entirety , of a machine serving to fashion a continuous cigarette rod 2 . the machine 1 is equipped with an outfeed unit denoted 3 in its entirety , which comprises an aspirating conveyor belt 4 looped around two pulleys 5 positioned one at either end ( one only of which is illustrated in fig1 ) and rotatable clockwise , as viewed in the drawing , about mutually parallel horizontal axes 6 . the endless loop described by the conveyor belt 4 compasses a chamber 7 connected to a source of negative pressure ( not illustrated ) and delimited at the bottom by a wall 8 pierced with suction holes 9 . as discernible in fig1 the bottom branch 10 of the conveyor belt 4 runs in sliding contact with the wall 8 and is able to retain the particles 11 of tobacco by suction as they emerge from a riser ( not illustrated ) located beneath the branch 10 , thus forming a continuous ribbon 12 of tobacco . the ribbon 12 is directed by the branch 10 of the belt 4 in a substantially horizontal direction 13 , transverse to the axis 6 of the pulley 5 , onto a feed path 14 running through a station 15 at which the continuous cigarette rod 2 is formed . the forming station 15 is occupied by a running strip 16 of paper , directed along the feed path 14 , which is decoiled by a relative feeder unit 17 from a roll 18 through the action of a pair of pinch wheels 19 . the decoiling strip 16 is taken around a pulley 20 and routed toward the forming station 15 , which incorporates a belt conveyor 21 capable of retaining the strip 16 of paper by suction and advancing it along the feed path 14 together with the ribbon 12 of tobacco filler released onto the strip 16 by the bottom branch 10 of the conveyor belt 4 . the forming station 15 also comprises a beam 22 of conventional embodiment extending along the feed path 14 , of which the function is to wrap the paper strip 16 around the ribbon 12 of tobacco filler . the two longitudinal edges of the strip 16 are overlapped gradually along the beam 22 and glued together ( in a conventional manner not indicated ), thereby generating the aforementioned continuous cigarette rod 2 . the feed path 14 extends beyond the beam 22 and along a feed direction 23 followed by the rod 2 toward a cutting station 24 , at which a rotating cutter device 25 divides the continuous rod 2 into discrete cigarette sticks 26 of predetermined and constant length . the feed path 14 presents a final stretch 14 a between the beam 22 and the cutting station 24 , coinciding with a table 27 along which the rod 2 is guided , and including a quality control device 28 by which the cigarette rod 2 is scanned in order to verify that it is correctly formed , and to reveal any possible defects . also located between the quality control device 28 and the outfeed end of the beam 22 is a cut - off device 29 comprising a blade 30 capable of movement between a raised first position of disengagement from the feed path 14 a , illustrated in fig1 and a second position of interference with the feed path 14 , illustrated in fig2 in which the cigarette rod 2 is diverted by the device 29 toward a reject station 31 , having been cut during the passage of the blade from the first to the second position . the cut - off device 29 can come into operation either when the machine 1 is started up and shut down , or whenever a defect is detected in the cigarette rod 2 by the quality control device 28 , to which the cut - off device 29 is interlocked . referring to fig1 and fig2 the outfeed unit 3 further comprises means 32 , located between the cutting station 24 and the quality control station 28 , of which the function is to remove a portion 2 a of the cigarette rod 2 that may be left on the final stretch 14 a of the feed path 14 , which extends from the cut - off device 29 to the rotary cutter device 25 , following the operation of the cut - off device 29 . observing fig2 and 6 it will be seen that the removal means 32 comprise gripping and feeding means 33 by which the aforementioned portion 2 a of cigarette rod 2 is taken up and advanced along the final stretch 14 a of the feed path 14 . the gripping and feeding means 33 comprise a pair of rollers 34 positioned one on either side of the final stretch 14 a of the feed path 14 and mounted to respective mutually parallel shafts 35 extending transversely to the path 14 . in the example of fig5 and 6 , the rollers 34 are mounted to respective shafts 35 carried in turn by the jaws 36 of a gripper 37 centered on a pivot denoted 38 . the gripper 37 is operated by respective drive means 39 comprising a lever 40 of which one end carries a pair of cams 41 acting on the gripper 37 by engagement with the free ends 42 of the jaws 36 , on either side of the pivot 38 . the remaining end of the lever 40 is connected to relative actuator means 43 , consisting in a cylinder , by which the jaws 36 are opened and closed through the agency of the lever 40 , the cams 41 and the free ends 42 . the rollers 34 are rendered capable thus of movement between a first non - operating position spread apart as illustrated in fig5 and a second operating position , drawn together as illustrated in 6 , in which they combine to create a passage coinciding with a break 44 in the table 27 and presenting a transverse dimension substantially equal to the transverse dimension of the cigarette rod 2 . the rollers 34 are driven by a motor indicated by a block denoted 45 , and set in rotation in opposite directions so that the portion 2 a of the cigarette rod 2 is caused to advance in the aforementioned direction 23 toward the rotary cutter device 25 . in particular , the gripper actuator 43 , the motor 45 and cutter device 25 are interlocked to a master control unit 46 which in turn is connected to the quality control device 28 . on receiving a signal from the quality control device 28 , the unit 46 will pilot the actuator 43 to draw the rollers 34 closer together and activate the motor 45 to set them in rotation about the respective shafts 35 , while causing the cutter device 25 ( in the example of fig2 ) to rotate at a prescribed frequency generally higher than during normal operation so as to chop up the portion 2 a of the cigarette rod 2 advanced toward the device 25 by the rollers 34 . the fragments of cigarette rod thus produced are diverted toward a reject station , indicated as a block denoted 47 , by means of a movable flap 52 forming part of the table 27 and able to pivot about an axis transverse to the feed path 14 , between a raised position of substantial alignment with the plane occupied by the table 27 ( fig1 ) and a lowered position ( fig2 ) in which the fragments of cigarette rod are diverted away . in an alternative embodiment of the unit shown in fig3 the rollers 34 are located between the cut - off blade 30 and the quality control device 28 , rather than beyond this selfsame device 28 . in this instance the motor 45 will be piloted to rotate the rollers 34 in the direction opposite to that described previously , so that the portion 2 a of cigarette rod 2 is taken up and advanced along the final stretch 14 a of the feed path 14 in the direction opposite to the predetermined direction denoted 23 toward the cut - off device 29 , which will then divert the portion 2 a of rod toward the reject station 31 . in particular , the surface 29 a of the cut - off device 29 directed toward the rollers 34 is fashioned in such a way as to provide an effective diverting element by means of which to guide the portion 2 a of rod 2 toward the reject station 31 . in the example of fig4 the two rollers 34 of the gripping and feeding means 33 are mounted to respective shafts 35 with respective fixed parallel axes 48 by which the rollers are carried in a fixed position , corresponding to the operating position described previously , and in which they combine to create a passage coinciding with a break 44 in the table 27 and presenting a transverse dimension substantially equal to the transverse dimension of the cigarette rod 2 . in this instance the motor 4 is coupled to a pair of gear wheels 49 , engaged in constant mesh , which during normal operation of the machine 1 will drive the rollers 34 at a tangential velocity identical to the linear velocity of the advancing rod 2 . in both the embodiments illustrated in fig4 and 5 , the surface of revolution presented by each of the rollers 34 and engaging in contact with the cigarette rod presents a cross - section of u - shaped profile , and the gear wheels 49 and the motor 45 are included in both the solutions indicated ( see fig4 and 6 ). to advantage , as illustrated in fig1 and 2 , the unit comprises pneumatic means 50 located along the final stretch 14 a of the feed path 14 , by which a flow of pressurized air can be directed along the path 14 to eliminate any residual paper and tobacco filler . importantly , the outfeed unit 3 described above might incorporate any number of variations without straying from the spirit of the present invention . for example , the shafts 35 of the rollers 34 can be oriented in any given direction , provided they are disposed transversely to the feed path 14 . finally , in the event that the cigarette maker is of a type designed to fashion two cigarette rods simultaneously , the relative outfeed unit , embodied in accordance with the invention , will include a pair of rollers 34 for each one of the two rods .

US-26206902-A

a tumble breading system for applying a breading material to a food includes a housing designating an internal clean area , and an infeed belt for conveying the breading material and the food , arranged across the infeed belt in an infeed order , into the clean area . a rotary assembly with a plurality of vertically offset , rotating tumblers accepts and tumbles the food with the breading material as the tumblers rotate , to bread the food . an output belt accepts the breaded food from the tumblers and conveys the breaded foods from the clean area and the housing . the food arrives at the output belt in substantially the infeed order .

fig1 is a simplified perspective view of a tumble breading system 100 . system 100 has a housing 102 , for example constructed of a frame assembly encapsulated in sheets of stainless steel , or other suitable metal or material for separating an interior clean area 104 where food is breaded ( not labeled ) from exterior power assemblies that drive the system . power assemblies are for example located along or configured with an exterior housing surface 106 . an infeed conveyor belt 108 conducts food in the direction of arrow 110 , through an input 112 into the clean area 104 within housing 102 . infeed belt 108 is driven by suitable rotational mechanisms , such as rollers 114 . for clarity of illustration , only one roller 114 is shown in fig1 , at a distal end 116 of infeed belt 108 . it will be appreciated that infeed belt 108 may likewise rotate around a second roller 114 at a proximal end 118 of infeed belt 108 . alternately , gears or like rotational mechanisms may be used to guide infeed belt 108 . a removable hood 120 fits onto housing 102 , as indicated by directional arrows 122 , for safety reasons and / or to protect infeed belt 108 and input 112 from dust and other contaminants . at proximal end 118 , food traveling along infeed belt 108 is transferred ( e . g ., passed or dropped ) onto a second conveyor 124 , illustrated by a dashed line , within clean area 104 . second belt 124 is referred to hereinafter as a “ flip belt ,” as food may flip partially or completely over during transfer from infeed belt 108 . in one embodiment , food passes beneath a breading material hopper 126 , illustrated by a dotted line , at or near proximal end 118 and / or flip belt 124 . hopper 126 has bottom openings ( not shown ) through which breading material drops onto the food , for example when hopper 126 is shaken or vibrated , or when one or more covers blocking the bottom openings is displaced , e . g ., by sliding or rotating . flip belt 124 conducts food from infeed belt 108 to a plurality of tumblers 128 of a rotary unit 130 ( five tumblers are shown in fig1 ; for clarity , three tumblers 128 are labeled ). tumblers 128 , shown by dotted lines , are likewise within clean area 104 , whereas power and drive mechanisms of rotary unit 130 are configured with or disposed along exterior surface 106 . as described further below with respect to fig2 , tumblers 128 may be offset rollers arranged vertically with respect to one another , each having a plurality of surface concavities or channels for holding breading material and food . in one embodiment , each tumbler is about 10 inches in diameter ; however , it will be appreciated that tumbler size may vary as a function of food size , shape or consistency , and desired quality of breading . food is passed between tumblers 128 and from tumblers 128 to an output conveyor belt 132 . output belt 132 is for example a mesh belt , a grate or a chain pan having a plurality of openings through which excess breading material may drop downward into a reclamation assembly 134 . output belt 132 conducts breaded food out of housing 102 , as indicated by motion arrow 115 . system 100 is configured such that infeed belt 108 and output belt 132 are at a height that facilitates use of system 100 with other equipment typically used in the food processing industry . in one embodiment , height of infeed belt 108 and output belt 132 is adjustable . reclamation assembly 134 is for example a pan or sieve that empties onto a reclamation apparatus , such as a belt or auger system ( see fig2 and 5 , described below ) that carries excess breading material back to hopper 126 , to infeed belt 108 and / or to tumblers 128 , where the material is released to coat additional food traveling along belts 108 , 124 or passing through tumblers 128 . fig2 is a schematic perspective view showing movement of food and breading material through system 100 , in accordance with an embodiment . clean area 104 is indicated by a dotted box . movement of food through system 100 is indicated by hollow movement arrows 110 , 111 and 113 . output of breaded food from system 100 , via output belt 132 , is indicated by motion arrow 115 . movement of breading material is indicated by dotted movement arrows 136 . as indicated by motion arrow 110 , food enters clean area 104 via infeed belt 108 , and is transferred to flip belt 124 ( see motion arrow 111 ). food is for example dropped a short distance onto flip belt 124 , to flip the food . from flip belt 124 , food is transferred to rotary unit 130 ( fig1 ). fig2 shows a rotary unit 130 having three tumblers 128 . tumblers 128 have longitudinal depressions , cups or channels 138 ( indicated by hatching ) extending along their length , for holding food and breading material . for clarity , only one channel 138 is labeled in fig2 . it will be appreciated that more or less tumblers 128 , and / or tumblers having more or less channels 138 may be employed as a matter of design preference . channel depth and width may likewise be customized . for example , when breading delicate foods such as shrimp or mushrooms , a lesser number of tumblers 128 decreases manipulation of the food by system 100 and may prevent the food from falling apart during breading . where more robust foods , e . g ., chicken , are breaded , more tumblers 128 may be added . likewise , tumblers 128 may include fewer large channels 138 for breading larger foods , or more smaller channels 138 for breading smaller foods . in one embodiment , rotary unit 130 is provided as a self - contained , removable retro - fit assembly to allow customization of breading and to facilitate cleaning or repair . one system 130 having a set number of tumblers ( e . g ., 3 ) may for example be exchanged for another set having more or less tumblers ( e . g ., two or five ), to customize food handling by system 100 . likewise , a system 130 with tumblers 128 having five channels 138 per tumbler may be “ swapped ” for a system 130 with tumblers having fewer channels 138 per tumbler , as a function of the size and / or type of food being breaded . in one embodiment , rotary system 130 is provided as a retrofit assembly , for fitting the space occupied by a single large drum in a conventional drum breader . as illustrated in fig2 , food passes from flip belt 124 to tumbler 128 a . tumbler 128 a rotates to transfer food to tumbler 128 b , which in turn rotates opposite the direction of rotation of tumbler 128 a , to transfer food to tumbler 128 c . see motion arrow 113 . tumbler 128 c rotates counter to tumbler 128 c ( e . g ., in the direction of rotation of tumbler 128 a ) to transfer food to output belt 132 , which conducts the breaded food out of clean area 104 and system 100 , as indicated by motion arrow 115 . breading material such as flour , cornmeal or the like may be added to system 100 at hopper 126 , described above with respect to fig1 . optionally or additionally , a breading material chamber 140 , shown in fig2 as a dotted box , stores and releases breading material within clean area 104 . chamber 140 for example has a door , chute or other breading port 141 opening into an interior container , or simply into a bottom portion of clean area 104 . chamber 140 may also be a slidable drawer for holding breading material . in one embodiment , chamber 140 is combined with reclamation apparatus 134 , described above . breading material released from chamber 140 is conveyed to infeed belt 108 via an internal breading material conveyor 142 . conveyor 142 is shown as a belt ; however , an auger mechanism may likewise be used to deliver breading material to infeed belt 108 . likewise , conveyor 142 and infeed belt 108 may be one and the same . roller 114 may be a drive sprocket , around which breading material is dragged . breading material is for example dragged from chamber 140 to form a layer on infeed belt 108 . the layer of breading material adheres to food placed thereon . one or more rollers or finger assemblies 144 create a curtain or wave in the breading material . as food placed upon the breading material passes under finger assembly 144 , a top portion of the food is exposed to and may be coated by the wave of breading material . food and breading material are transferred or , in the case of the food , flipped to flip belt 124 , which in turn transfers and / or flips the food and the breading material to tumblers 128 . as the tumblers rotate , the breading material and food are gently turned or tumbled from a channel 138 of one tumbler 128 to a channel 138 on an adjacent tumbler 128 . this automated action efficiently replicates the gentle tumbling of a food from one container of breading material to a second container of breading material , as is characteristic of hand breading . for example , tumbler 128 a of fig2 rotates counterclockwise to accept additional food and breading material from flip belt 124 into a subsequent longitudinal channel 138 , and to transfer the breading material and food to the longitudinal channels 138 of tumbler 128 b . tumbler 128 b in turn rotates to expose un - filled longitudinal channels 138 for filling from tumbler 128 b , and to transfer the food and breading material to longitudinal channels 138 of tumbler 128 c . tumbling food in multiple quantities of breading material via tumblers 128 works the breading material into pores , muscle , hollows or cracks in the food to achieve a homestyle appearance . contacting breading material with food at infeed belt 108 , finger assembly 144 and flip belt 124 , as described above , enhances this effect . longitudinal channels 138 span approximately the length of tumblers 128 . hence , food may be transferred between tumblers 128 in the linear arrangement or order in which it lands on or is transferred to flip belt 124 . this arrangement for example reflects the arrangement in which food is placed upon infeed belt 108 . breaded food is transferred from the final tumbler 128 in rotary assembly 130 ( tumbler 128 c , in fig2 ) onto output belt 132 in substantially the same linear arrangement , facilitating subsequent processing or packaging and reducing or eliminating the need to spread out heaps of food that is common to prior art drum breaders . the gentle rotational action and food alignment provided by tumblers 128 may decrease damage to breaded food , as compared with rotary drum breaders , where food knocks together and against walls of one larger , non - segmented container with greater force . at the same time , tumblers 128 repeatedly expose all sides of the food to the breading material , results in uniform and consistent breading . in addition , alignment features provided by system 100 may reduce or eliminate the need for manual alignment of breaded food , as is needed when breading with conventional drum breaders . fig3 is a front view of finger assembly 144 of fig2 . finger assembly 144 has a plurality of fingers 146 supported along a bar 148 that for example attaches to housing 102 of system 100 . fingers 146 are for example plastic , rubber or another material that is flexible enough to permit food passing beneath ( e . g ., between fingers 146 and infeed belt 108 ), yet firm enough to encourage the aforementioned wave of breading material , under which the food passes . optionally , finger assembly 144 rotates to allow food to pass therebeneath . height of finger assembly 144 may be adjusted up or down , as indicated by arrows 150 , to accommodate a range of food sizes . fig4 is a side , plan view further illustrating wave action of finger assembly 144 and breading material , depicted as dotted line 152 , with infeed belt 108 or flip belt 124 . it will be appreciated that one or more finger assemblies may be positioned with either or both belts . here , first and second finger assemblies 144 and 154 are positioned over infeed belt 108 / 124 . breading material 152 builds against fingers 146 of assemblies 144 and 154 , creating first and second waves 156 and 158 . food 160 passes beneath waves 156 and 158 , as indicated by motion arrow exposing upper food surface 162 to breading material 152 . where the belt in fig4 is flip belt 124 , food 160 and breading material 152 leaving flip belt 124 are transferred to channels 138 of tumbler 128 , as the belt advances and tumbler 128 rotates to sequentially advance channels 138 to a receiving position . food 160 and breading material 152 are gently tumbled as tumbler 128 rotates to pass the food and breading materials 160 , 152 to a subsequent tumbler 128 of rotary unit 130 , e . g ., as shown and described above with respect to fig1 and 2 . fig5 shows further detail of rotary assembly 130 , flip belt 124 , conveyor 142 and support structures of output belt 132 , within clean space 104 ( represented by a dashed box ). rotary assembly 130 is for example a removable , independently powered assembly for removably fitting with system 100 . as shown , rotary assembly 130 is driven by a belt 164 that interacts with gears 166 of each tumbler 128 a - e . for clarity , only three of the five illustrated gears 166 are labeled in fig5 . rollers 168 and 170 may be used to encourage food 160 ( see fig4 ) along its path from flip belt 124 , through rollers 128 a - e and onto output belt 132 ( see also fig4 ), for example preventing food 160 from passing over tumbler 128 a as it passes from flip belt 124 to rotary assembly 130 , and directing food 160 from assembly 130 onto output belt 132 , proximate tumbler 128 e . output belt 132 is for example a mesh or slotted belt supported by tray 172 and rotary assembly 174 . exemplary fasteners 176 ( shown as a plate and bold / screw set , although other fasteners may be utilized ) are shown securing rotary assembly 174 within housing 102 . encouraged by roller 168 , food 160 and breading material 152 ( see fig4 ) pass from infeed belt 108 to a channel 138 ( see fig2 ) of tumbler 128 a , which rotates counterclockwise to transfer food 160 and breading material 152 to a channel 138 of tumbler 128 b . tumbler 128 b rotates clockwise to transfer food 160 and breading material 152 to a channel 138 of tumbler 128 c , which rotates counterclockwise to transfer food 160 and breading material 152 to a channel 138 of tumbler 128 d . finally , tumbler 128 d rotates clockwise to transfer food 160 and breading material 152 to a channel 138 of tumbler 128 e , which rotates counterclockwise to deposit food 160 and breading material 152 onto output belt 132 , supported by the tray and rotary assembly 172 , 174 shown in fig5 . roller 170 is for example a stationary or a counterclockwise - rotating cylinder for encouraging food 162 onto output belt 132 . both rollers 168 , 170 may be finished with or made from a smooth material , such as silicone , to prevent transfer of breading material 152 from food 160 . excess breading material 152 falls from rotary assembly 130 to reclamation assembly 134 / chamber 140 , indicated by a dashed line , where it is conducted to infeed belt 108 via conveyor 142 to bread additional food 160 , as described with respect to fig2 . where conveyor 142 is a belt , it may be combined with infeed belt 108 such that system 100 has three independently driven belts 108 / 142 , 124 and 132 . reclamation assembly 134 / chamber 140 may be removed from assembly 100 for cleaning and for refilling with additional or alternate breading material 152 , as needed . fig6 is a simplified view of the rotary assembly and belts of fig5 , illustrating maintenance of an input order of food 160 . as shown , food 160 is arranged roughly in a line across flip belt 124 . food 160 is transferred to tumbler 128 a in generally the same linear order , and is passed between tumblers 128 b - 128 e in generally the same linear order . thus , food 160 is linearly deposited on output belt 132 , reducing clumping of breaded food 160 . fig7 and 8 are simplified side views of assembly 100 , indicating flow of food 160 and breading material 152 and showing exemplary internal support for housing 102 ( see fig1 ). as described above with respect to fig1 , housing 102 may be constructed with a frame assembly , shown here as internal frame 178 . stainless steel or other suitable housing material is supported by internal frame 178 to form housing 102 . in one embodiment , shown in fig7 , infeed belt 108 and conveyor 142 form one continuous belt 108 / 142 , and flip belt 124 is omitted . as indicated by dotted arrows 136 , infeed belt 108 / 142 transfers breading material 152 from reclamation assembly 134 / chamber 140 to a food input area 180 , beneath optional hopper 126 , where additional breading material 152 may be added , to rotary assembly 130 . rotary assembly 130 is independently driven , e . g ., by belt 164 . excess breading material 152 is collected at reclamation assembly 134 / chamber 140 and picked up by infeed belt 108 / 142 . food processed by system 100 follows the path of arrows 110 , 111 , 113 and 115 . for example , food 160 placed in input area 180 is carried by infeed belt 108 / 142 beneath optional hopper 126 to rotary assembly 130 . food 160 is tumbled with breading material , via tumblers 128 , and passed to output belt 132 for subsequent processing , packaging or cooking . in one embodiment , illustrated by fig8 , infeed belt 108 is an independently driven belt , and flip belt 124 forms a continuous belt with conveyor 142 . as indicated by motion arrows 136 , breading material 152 ( see fig4 ) is carried from reclamation assembly 134 / chamber 140 to a transfer point 182 , where food is transferred from infeed belt 108 to continuous belt 124 / 142 . breading material 152 is conveyed from point 182 along continuous belt 124 / 142 to rotary assembly 130 ( shown here with three large tumblers ). output belt 132 is preferably mesh , slotted or otherwise porous , to allow breading material 152 not adhered to food 160 to pass through , into reclamation assembly 134 / chamber 140 . system 100 ( as shown in any of the previously - described drawings ) for example employs a fan or blower 184 to dislodge excess breading material 152 from food 160 and output belt 132 . dislodged breading material 152 falls through mesh or slotted output belt 132 and collects at reclamation assembly 134 / chamber 140 , which is for example a sieve for allowing fine breading material 152 to pass through and pile at depression 186 of sloped floor 188 while catching clumped breading , which may then be removed from system 100 . in one embodiment , output belt 132 vibrates to dislodge excess breading material from food 160 and belt 132 , for collection by reclamation assembly 134 / chamber 140 . fig9 is a flow chart illustrating a tumble breading method 200 . step 202 is a decision . if the hopper is not full , the hopper is filled , in step 204 . steps 202 , 204 are optional , as indicated by dotted box 203 . in embodiments where breading material is input into a lower chamber of a tumble breading systems , a hopper may be omitted or used optionally . in one example of steps 200 , 202 , hopper 126 ( fig1 ) is filled with breading material 152 if hopper 126 is not filled to a desired level . if the hopper contains ample breading material , at optional step 202 , a decision 206 is made as to whether ample breading material is contained in a breading chamber , such as chamber 140 . if not , the chamber is filled with breading material , in step 208 . in one example of step 208 , chamber 140 and / or reclamation apparatus 134 is opened via a door or chute in housing 102 and filled with breading material 152 . in another example of step 208 , chamber 140 and / or reclamation apparatus 134 slides from housing 102 , e . g ., as a drawer in the housing , for filling . once the chamber has ample breading material , the breading material is distributed on an input belt , and food is placed on the input belt , in steps 210 , 212 . in one example of step 210 , breading material conveyor 142 delivers breading material from chamber 140 / reclamation apparatus 134 to infeed belt 108 . as noted above with respect to fig7 , conveyor 142 and infeed belt 108 may form one continuous belt . one or more finger assemblies 144 , described with respect to fig2 - 4 , are for example employed to facilitate distribution of breading material 152 across infeed belt 108 and to create waves of breading material to aid in covering food 160 , when placed on infeed belt 108 . in one example of step 212 , food 160 is linearly arranged across infeed belt 108 , atop breading material 152 . breading material 152 adheres to the bottom of food 160 as it travels along infeed belt 108 . top surface 162 of food 160 is coated with breading material 152 as food 160 passes beneath waves 158 of breading material 152 , created by finger assemblies 144 as described with respect to fig4 . in step 214 , food and breading material are conducted into a tumble breading apparatus . in one example of step 214 , food 160 and breading material 152 are conveyed within clean area 104 and optionally , beneath breading sprinkled by hopper 126 , via infeed belt 108 . food and breading material are transferred to a second , internal belt , in step 216 , and to a rotary system , in step 218 . in one example of steps 216 , 218 , food 160 is flipped over as it drops from infeed belt 108 to flip belt 124 . un - coated surfaces of food 160 may be exposed to breading material dropping from infeed belt 108 to flip belt 124 during flipping . food 160 and breading material 152 are transferred from flip belt 124 to a rotary system , in step 218 . food and breading materials are tumbled , in step 220 , and transferred to an output belt for conveyance from the tumble breading system , in step 222 . in one example of steps 218 - 220 , food 160 is transferred from flip belt 124 to a channel 138 of first tumbler 128 a , in generally the same linear order in which food 160 is arranged across infeed belt 108 , in step 212 . tumbler 128 a rotates to transfer ( i . e ., drop ) food 160 to a channel 138 of a second tumbler , e . g ., tumbler 128 b . the number of tumblers 128 used to tumble food 160 may be customized according to food type , size or breading preference , for example tumbling hardy food through more tumblers and delicate foods through fewer tumblers , and tumbling larger foods through larger tumblers and smaller foods through smaller tumblers . likewise , more tumblers 128 may be used where it is desired to work breading 152 thoroughly into muscle , pores or cavities of food 160 . as noted above , rotary assemblies 130 may be swapped to customize tumble breading system 100 for handling of specific foods . food 160 is transferred from a final tumbler 128 of rotary assembly 130 ( for example , from tumbler 128 e , in fig1 and 5 - 7 , or from tumbler 128 c , in fig2 and 8 ) to output belt 132 in generally the linear order in which it was placed upon infeed belt 108 ( step 212 ), and conveyed from clean area 104 to the outside of tumble breading apparatus 100 . excess material is dislodged from the food , in step 224 . for example , excess breading 152 falls from food 160 during conveyance , as well as during transfer to output belt 132 ). additional loose breading 152 may be removed using a fan or blower . in one example , blower 184 dislodges loose breading material 152 from food 160 , and blows the loose material over mesh output belt 132 . loose breading material 152 falls through openings in the mesh , and is collected , in step 226 . in one example of step 226 , breading material 152 dislodged from food 160 ( e . g ., by blower 184 and / or by transferring to output belt 222 ), and breading material dropped from tumblers 128 , falls into reclamation apparatus 134 and / or chamber 140 . reclamation apparatus 134 may be a removable sieve that allows fine breading material 152 to pass through and collect within chamber 140 , while catching clumps of breading material 152 and any bits of food 160 that may have escaped output belt 222 . reclamation apparatus 134 may thus be easily removed for cleaning . likewise , reclamation apparatus 134 may serve as a sifter for newly - input breading material 152 . new breading material 152 may be deposited directly into reclamation apparatus 134 and shaken or vibrated to sift the breading material into chamber 140 . optionally , breading material 152 collects or is deposited directly into chamber 140 , which may be a removable drawer , pan or other enclosure , or which may be a bottom portion within housing 102 . from chamber 140 , new or reclaimed breading material 152 is distributed from chamber 140 to infeed belt 108 , e . g ., via a breading material conveyor 142 or an auger mechanism ( step 210 ). having now described the preferred embodiment of the breading machine of the present invention , it will be realized that the same is susceptible to various modifications and arrangements of parts without departing from the inventive concept thereof as is defined in the appended claims .

US-99811107-A

this invention pertains to the novel use of n - acetyl glucosamine to minimize or eliminate food intolerance or food allergy symptoms in human beings afflicted with these symptoms by maintaining the integrity and normal function of the gastrointestinal tract in such human beings . a method of alleviating food sensitivity and food allergy in a human being comprising feeding the human being a therapeutic amount of n - acetyl glucosamine on a periodic basis .

there are tissue defects in the digestive tract of human beings suffering food intolerance or food allergies . these defects can be corrected to enable the mucosa in the tract to form a necessary barrier to transmission of food allergens and to maintain normal function . the mucosa tissue structure is rich in amino sugars derived from n - acetyl glucosamine and we have discovered that the availability of n - acetyl glucosamine is critical to its synthesis . we have also discovered that an external source of n - acetyl glucosamine is useful to ensure adequate synthesis of the mucosal barrier . indeed , we have found that the use of n - acetyl glucosamine alone might be sufficient in itself to treat milder food allergy cases . in more severe cases , the amino sugar , n - acetyl glucosamine might be combined with elemental diets so that the removal of offending substances is accomplished , while at the same time , providing the new amino sugar material necessary ro enable the human body to generate coherent mucosa tissue and maintain its defenses . n - acetyl glucosamine ( nag ) is an amino sugar , which is formed in all animal cells and is utilized for the synthesis of many cellular components . the biochemical process by which these components are made is similar in all cells although the end products differ depending upon the type of cell involved . most of the end products are found outside the cells where they form sheaths which bind cells together , and are major structural components , as in the walls of blood vessels , and fill the spaces between cells , i . e . the interstitium . amino sugars are found combined with other large molecules ( macromolecules ) of protein , lipid ( fats ) or other carbohydrates to form glycoproteins ( gp ), glycolipids ( gl ) and glycosaminoglycans ( gag ). glycoproteins have many functions , some circulate in the blood , others are anchored on the surface of cells , as are glycolipids . they can confer unique properties to the cell , for example , on the surface of red blood corpuscles there is a glycolipid which determines the blood groups a , b and o . the sole difference between these groups is the presence of a single amino sugar . such remarkable specificity indicates that there is a &# 34 ; language &# 34 ; in which amino sugars are the &# 34 ; letters &# 34 ; analogous to the genetic code , by which biological information is recorded and put into action . each cell makes its own amino sugars and the process , as in the case of most biochemical synthesis , is regulated by the availability of the first member of the sequence , which in this case is glucosamine . glucosamine is formed from the pool of sugars derived from glucose , blood sugar , and is acetylated to form n - acetyl glucosamine ( nag ). nag is the immediate precursor for two other amino sugars , n - acetyl galactosamine and n - acetyl neuraminic ( sialic ) acid . these amino sugars constitute about half the total weight of the gag found in human tissues ( references 1 - 7 ). in the synthesis of these molecules , the availability of the substrate , amino sugars , is critical to proper function . we have discovered that although the formation and utilization of amino sugars takes place in all human cells independently , nevertheless an external source of amino sugar is readily taken up by the cells and is utilized by them for incorporation into the macromolecules . an external source of amino sugar , we have found , can provide for an adequate amount of substrate to satisfy cell demands which otherwise might be greater than the cells can meet . the interstitium is the space between the cells which contains the fibrous protein collagen ensheathed by glycosaminoglycan ( gag ). the gag absorbs very large quantities of water to form a gel - like material which resists compression thereby giving shape and firmness to the tissue . this material acts as a medium which regulates the passage of nutrients , etc ., between the blood and the tissues , and also acts as a barrier , for example , to the spread of infection ( bert and pearce ). mucous membranes are covered by a microscopically thin glycoprotein rich in sialic acid called the glycocalyx . in the gastrointestinal tract ( gi ), this microscopically thin layer is the ultimate barrier between the underlying tissue and the corrosive digestive juices . when the layer is damaged , erosion and ulceration of the underlying tissue occurs . if the blood supply to the upper gi is arrested for about 5 minutes , for example , it has been found that all synthetic processes cease , including formation of the glycocalyx , and an ulcer can be seen forming within an hour . this illustrates the dynamic nature of the biological processes in the human body . there are several hundred grams of amino sugar in the various tissue components of the body but the average life of a given molecule is only 3 days or so . there is thus a constant turnover of all molecules in the body , even in tissues such as bone , and a constant supply of substrates for synthesis is therefore required . an important and novel feature of the present invention is that increased demands caused by injury such as food allergen injury can be placed upon cells which might strain their resources , and in this situation , an external supply of amino sugars is beneficial . in the gastrointestinal tract ( gi ), the rate of synthesis of the glycocalyx had been considered to be adequate in persons afflicted with inflammatory bowel disease ( ibd ). however , in these persons , as in many situations where there is disease or injury , the turnover of cells is increased , perhaps as much as threefold . this creates a demand that is beyond what is considered normal . we have found that the incorporation of nag into the intestinal mucosal tissue is three times greater in persons afflicted with ibd than in those who are not afflicted . we have also found that in human placenta near term , the formation of glycosaminoglycan ( gag ) is stimulated strongly by the steroid 17 α - hydroxyprogesterone ( burton et al .) which appears to function by increasing the synthesis of amino sugars . we have discovered that the same stimulation can be achieved merely by providing the appropriate amino sugars . others have shown that in chondrocytes , the cells which form cartilage , the presence of corticosteroids inhibits the formation of gag . supplying amino sugars largely overcame this inhibition ( fassbender ). in a recent publication , the question of intestinal permeability in persons with crohn &# 39 ; s disease , a form of ibd , was reviewed ( olaison et al .). it was found that these persons have greater than normal permeability of the gi tract which leads to the absorption into the bloodstream of substances normally excluded . this includes the substances which cause food sensitivities or food allergies . the condition is attributed to a defect in the mucosal barrier , the glycocalyx , and the intercellular cement composed of gg . even unaffected relatives of these patients have been found to have increased permeability ( hollander et al .) which supports the concept that some individuals have a genetic or constitutional defect which sets the stage for a spectrum of disorders ranging from mild to serious food intolerance to severe inflammatory lesions . various agents inhibit the formation of the mucosal barrier including ethanol , aspirin and other antiinflammatory agents . erosion and bleeding of the gi tract is a major side - effect of such drugs . an agent , proglumide , which protects against ulcer formation has been shown to stimulate the incorporation of nag into mucosal glycocalyx and this is considered the reason for its effectiveness ( umetsu ). inflammation is a common accompaniment of many forms of injury and is part of the body &# 39 ; s defense and repair mechanism . often , however , the inciting agent is such that the inflammation serves no protective purpose and in fact results in tissue damage causing pain and disability , as in arthritis . there are , therefore , many situations where an external source of amino sugar can be beneficial . we have discovered that a good choice is n - acetyl glucosamine ( nag ) which is a neutral compound , is stable , is very soluble , is tasteless , and is readily absorbed from the digestive tract . it circulates in the blood with a half - life about 4 hours and very little is excreted since it is a &# 34 ; committed metabolite &# 34 ; utilized exclusively for the synthesis of gp , gl , gag in tissue components . an external supply , we have found , is readily taken up and utilized by the human body and therefore has the potential to be of benefit in many situations where the synthetic processes are less than adequate to meet demands . nag alone is capable of efficient utilization for these processes when taken by mouth . g . e . d . is professor emeritus of the faculty of medicine , the university of british columbia , vancouver , b . c ., canada . for many years , g . e . d . suffered from a variety of food sensitivities . reactions had sometimes been dramatic , and even at one instance put him in the emergency department at vancouver general hospital , vancouver , b . c ., canada . the sensitivities started with orange juice , but subsequently expanded to include meat , milk products , corn , etc . g . e . d . had been able to control them , for the most part , by adhering closely to a rotation of dietary components every four days and refraining from eating in restaurants . gradually , his symptoms abated but he still had episodes of pain and discomfort that he attributed to dietary causes . in november , 1990 , he received a trial supply of n - acetyl glucosamine ( nag ), taking it with him on a trip to california , texas and florida . whereas normally he would have expected at least some dietary and food sensitivity problems on such a trip , he experienced none . since then , he has been much less troubled by symptoms , and these have quickly abated whenever he took a dosage of nag . because of the variability of his response to food , it has taken some months to evaluate the effect of nag , but g . e . d . is positive it helps considerably . recently , his daughter , who has similar problems , had persistent pain after drinking orange juice . this intestinal pain responded quickly to ingestion of the nag that g . e . d . gave her . male , 68 , experienced chronic constipation and intolerance of some foods , which had been attributed to deficient secretion of mucous in the gastrointestinal tract . he began taking nag , 3 g per day , in 1988 and reported normalization of bowel function without the need for oil or other laxatives . his tolerance of foods improved simultaneously and he also reported that a nasal allergy improved greatly . symptoms recurred in one to two weeks when his supply of nag ran out but came under control in a week or two upon resuming nag . he claims he needs at least 3 g of nag per day for effective control . t . l ., male , age 23 , began suffering sharp abdominal pain in 1985 , and a general intolerance of foods except for rice and a few other things . he could not tolerate fibre , fried foods , etc . he was prescribed an anti - ulcer regime which caused little improvement . in 1987 , he was given cimetidine and sulcrate , anti - ulcer agents . colonoscopy and gastroduodenoscopy in 1987 - 1988 were negative . he was also diagnosed as asthmatic , and allergic to grass , dust , trees , hair and some foods . t . l . began ingesting nag at a rate of 3 g per day in oct ., 1988 . his symptoms improved in three weeks . he continued nag treatment and reported that at eight months , his symptoms had all been alleviated , including the asthma . he continues to have some sensitivity to caffeine and alcohol , which he avoids , but he can now eat a wide variety of foods including salads and high - fibre items , without difficulty . t . l . no longer suffers nausea and &# 34 ; heaving &# 34 ; each morning as he did previously and feels in good health . he has gained 5 kg and has , since 1988 , successfully completed the last two years of a degree at the university of british columbia . s . c ., female , age 45 , had been experiencing food intolerance , including gluten sensitivity . she tried various diets without much success . she began in 1989 to take nag at 3 g per day . she continued for three months and noticed considerable reduction in food intolerance . thereafter , she tried other diets without nag for a year . at that time , she concluded that the nag treatment was superior to the other dietary measures and resumed nag treatment late in 1990 . s . c . reported that daily nag treatment enabled her to eat a wider variety of foods without experiencing difficulties as before , and that it has greatly improved her condition . w . r ., male , age 46 , has had crohn &# 39 ; s disease since the age of 18 . w . r . underwent surgery on three occasions with removal of considerable bowel . he suffered subsequently from near - intestinal blockage on several occasions since 1981 , and pain and bloating of the intestinal tract almost continuously . he took imodium and prednisone ( a corticosteroid ). physicians were reluctant to perform more surgery . w . r . began taking nag in 1989 and felt that it began to improve his condition in a week or so . he experienced less pain and noted a great increase in his ability to tolerate a wider variety of food which previously would cause severe symptoms . w . r . underwent surgery again in 1989 for residual damage caused by earlier bouts of inflammation . he then resumed ingesting nag at a rate of 3 to 4 g per day and reports that it is highly effective in controlling his symptoms . s . b ., female , 55 , underwent surgery for crohn &# 39 ; s disease in 1977 , with removal of about 1 m of her terminal ileum . subsequently , she experienced considerable pain , discomfort , nausea and diarrhea . cholestyramine has helped the diarrhea by eliminating excess bile salts ; she also requires injections of vitamin b12 because of the loss of terminal ileum . she began taking nag late in 1977 , initially at 1 g or so daily , ranging up to 10 g . usually , she finds about 3 g per day is sufficient to cause marked improvement in digestion , better tolerance of foods , little diarrhea and much improvement in her discomfort level . she has taken nag with the approval of her physician for over eleven years and has maintained a reasonably stable condition . s . b . has had intermittent problems , including surgery for abscess , kidney stone , hysterectomy , residual effects of the crohn &# 39 ; s disease , and the surgeons have reported finding no evidence for active crohn &# 39 ; s disease . numerous laboratory and organ function tests have been performed since she started taking nag . except for a tendency to require supplements of potassium , other tests have been normal , including blood , urine , thyroid and kidney function . s . b . has held a very responsible position for the past ten years , which she attributes largely to the benefits of nag in her diet . she would not be able to handle the situation without daily nag treatment . as will be apparent to those skilled in the art in the light of the foregoing disclosure , many alterations and modifications are possible in the practice of this invention without departing from the spirit or scope thereof . accordingly , the scope of the invention is to be construed in accordance with the substance defined by the following claims . 1 . balazs , e . a ., jeanloz , r . w . : the amino sugars . academic press , new york , 1965 , vol . iia . 2 heinegard , d ., paulsson , m . : extracellular matrix biochemistry . piez , k . a ., reddi , a . h . eds ., elsevier , new york , 1984 . 3 . varma , r ., varma , r . s . : mucopolysaccharides -- glycosaminoglycans -- of body fluids in health and disease . w . de gruyter , new york , 1983 . 4 . schachter , h . : biosynthetic controls that determine the branching and microheterogeneity of protein - bound oligosaccharides . biochemistry and cell biology 1986 , 64 : 163 - 181 . 5 . lukie , b . e ., forstner , g . g . : synthesis of intestinal glycoprotein . incorporation of 14 c - glucosamine in vitro biochimica et biophysica acta 1972 , 261 : 353 - 364 . 6 . bert , j . l ., pearce , r . h . : the interstitium and microvascular exchange . handbook of physiology -- the cardiovascular system iv , 1984 , 521 - 547 . 7 . zubay , g . : biochemistry 2nd ed . macmillan publishing co ., new york , 1988 , 663 . 8 . burton , a . f ., anderson , f . h . : decreased incorporation of 14 c - glucosamine relative to 3 h - n - acetyl glucosamine in the intestinal mucosa of patients with inflammatory bowel disease . american journal of gastroenterology 1983 , 78 : 19 - 22 . 9 . burton , a . f ., lockhart , f ., bosnjak , s ., yong , s . : stimulation by 17 - alpha - hydroxyprogesterone of glycoprotein and glycosoaminoglycan synthesis in human placenta in vitro . biology of the neonate 1989 , 55 : 151 - 155 . 10 . fassbender , h . g . : role of chondrocytes in the development of osteoarthritis . american journal of medicine 1987 , 83 ( supp . 5a ) 17 - 24 . 11 . olaison , g ., sjodahl , r ., tagesson , c . : abnormal intestinal permeability in crohn &# 39 ; s disease . scandinavian journal of gatroenterology , 1990 , 25 : 321 - 328 . 12 . hollander , d . et al . : increased intestinal permeability in patients with crohn &# 39 ; s disease and their relatives . annals of internal medicine 1986 , 105 : 883 - 885 . 13 . umetsu , t . et al . : effect of proglumide on glycoprotein synthesis in aspirin - induced gastric erosions in rats . european journal of pharmacology 1980 , 69 : 69 - 77 .

US-82676392-A

multiple branch peptide constructions formed from peptide - branches derived from the envelope transmembrane glycoprotein gp41 of hiv , and including the consensus sequence rqgy preceded by 0 to 4 amino acid residues and succeeded by 0 to 4 amino acid residues , most preferably rqgys , show increased receptor affinity and prevent cell - to - cell fusion . they have a direct virostatic effect . because they present the same peptide sequence several times , these mbpcs are able to neutralize in vitro the different steps of virus envelope / cell membrane fusion , and infected cell membrane / uninfected cell membrane fusion of several strains of hiv - 1 and hiv - 2 . these results open a potential use in treatment of hiv infection .

the inventors have now discovered further mbpcs which are effective as treatments for hiv infections . these mbpcs use peptides derived from the hiv envelope transmembrane glycoprotein gp41 . the amino acid sequences of these mbpcs were selected on the basis of sequence homologies between various hiv isolates . the choice of gp41 amongst viral proteins was based on the following : i ) the importance of this domain in the virus - cell and cell - cell fusion processes leading to virus entry into the host cell , ii ) the importance of the gp160 splicing into gp120 and gp41 for the fusogenic activity to take place , iii ) the existence of neutralizing anti - gp41 antibodies , e . g . antibody 2f5 , and iv ) the existence of a unique disulphide bridge , in contrast to gp120 , which makes it easier to obtain peptides mimicking specific conformational domains of gp41 . it is presumed that the gp41 - derived mbpcs of this invention interfere with a critical step of the fusion process . the invention provides a multiple branch peptide construction and a method for the therapeutic treatment of patients with hiv infections . the multiple branch peptide construction comprises a core matrix to which are bonded from 2 to 16 , and preferably from 2 to 8 peptides , each of which comprises the sequence rqgy ( seq . id . no . 1 ) preceded by from 0 to 4 amino acid residues and succeeded by from 0 to 4 amino acid residues . most preferably , the peptides bonded to a two - branched core matrix are rqgys ( seq . id . no . 2 ). the method for the therapeutic treatment of patients with hiv infections comprises administering such an mbpc to the patient , preferably in such an amount as to induce in the patient a blood concentration of the mbpc of from 10 − 7 to 10 − 4 molar . the core matrix is a dendritic polymer which is branched in nature , preferably with each of the branches thereof being identical . the core matrix is based on a core molecule which has at least two functional groups to which molecular branches having terminal functional groups are covalently bonded . suitable core molecules include ammonia or ethylene diamine . suitable molecular branches include acrylic ester monomers which are polymerized onto the core molecule . such molecules may be created to present varying number of branches , depending on the number of monomers branched from the core molecule . the preferred core molecule is lysine . a central lysine residue is bonded to two lysine residues , each through its carboxyl group , to one of the amino groups of the central lysine residue . this provides a molecule with four amino groups , which may be the core matrix for an mbpc having four peptides . alternatively , one can provide a molecule with eight branches by bonding four lysine residues through their carboxyl groups to one of the amino groups of the lysine residues which are attached to the central lysine . this molecule can serve as the core matrix for an mbpc having eight peptides or can alternatively receive eight lysine residues to form a core matrix for an mbpc having sixteen peptides . the c - ends of peptides are covalently bonded to each of the branches of the core matrix to form the mbpc . the peptides may be the same , which is preferred , or may be different from one another . the resulting molecule has a cluster of peptides at the surface and an interior core matrix which is not presented and is therefore not antigenic . spacers may , if desired , be included between the peptides and the core matrix . the carboxyl group of the first lysine residue may be left free , amidated , or coupled to β - alanine or another blocking compound . peptides can include d or l - amino acid residues . d amino acids last longer in vivo because they are harder for peptidase to cut , but the l amino acids have better activity , as discussed below . moreover , peptide analogues , synthetic constructs using the carbon skeleton of peptides but omitting the — conh — peptide bonds , can be employed in place of peptides . thus , it should be understood that references to peptides herein may also be taken to include peptide analogues . it is believed that peptide analogues will be more resistant to peptidase and last longer in vivo . if the peptide is too long , the mbpc will become antigenic . it is therefore desirable that each peptide should have not more than ten , and preferably not more than nine , amino acid residues . the preferred mbpcs for use in this invention are as follows : 1 . ( rqgyspl ) 8 -( k ) 4 —( k ) 2 — k - βa - oh , ( seq . id . no . 3 ) and has a short hand designation of “ rl . 1 ”; 2 . ( rqgyspl ) 16 -( k ) 8 —( k ) 4 —( k ) 2 — k - βa - oh , ( seq . id . no . 4 ) and has a short hand designation of “ rl . 2 ”; 3 . ( rqgys ) 2 - k - βa - oh , ( seq . id . no . 5 ) and has a short hand designation of “ short rl ”; 4 . ( rqgyspl ) 2 - k - βa - oh , ( seq . id . no . 6 ); 5 . ( rqgy ) 8 -( k ) 4 —( k ) 2 — k - βa - oh ( seq . id . no . 7 ). the oh terminal shown above on the 3 - alanine indicates the carboxyl group thereof , with the amino group being attached to the carboxyl group of the lysine residue . the carboxyl group of the β - alanine may alternatively be modified to form a carboxamide terminal . the preparation of the mbpcs of the invention , having a branched core with peptides attached thereto , can be effected by methods known in the art , see e . g . tam et al , j . immun . 148 , 914 - 920 ( 1992 ). preferably , for small quantities ( under one kilogram ), a solid phase method is used to obtain the mbpcs . stepwise assembly of the peptide chains can be carried out automatically on 4 -( oxymethyl )- phenylacetamidomethyl copoly ( styrene - 1 % divinyl benzene ). the boc / benzyl strategy may be used , including a systematic double coupling scheme with hydroxybenzotriazole active esters ( boc - amino - acid - obt ). the final cleaving from resin is effected with strong acid , such as anhydrous hydrogen fluoride ( 1 hour at 0 ° c .). the mbpc is then washed with diethyl ether and solubilized in water . after lyophilization , the mbpc may be pre - purified on a p2 or g15 type molecular filtration column , equilibrated with 0 . 1n acetic acid . the eluate fraction may then be recovered . the purification step is achieved by using c 8 or c 18 reversed - phase hplc . the mbpc may be characterized by its amino acid content after acid hydrolysis ( 6n hcl , 115 ° c ., 24 hours ) and electro - spray mass spectrometry . the gp41 - derived mbpcs of the invention have been tested in vitro for their ability to inhibit hiv - induced syncytium formation , and infection of human lymphocytes by both hiv - 1 and hiv - 2 viruses ( several laboratory strains including lav - 2 / b , an hiv - 2 virus able to infect some cd4 − / galcer − cells , as well as clinical isolates such as jrcsf , p16 / b6 and p16 / c9 ). the diverse peptide constructions were found to be inactive , except for mbpc rl1 which possessed potent antiviral properties in all tests . by contrast , the monomeric rqgyspl was found to be inactive . some results are shown in tables 1 and 2 below . similar results were obtained with other hiv strains and clinical isolates tested so far . the mbpc rl1 showed neither cellular toxicity nor lethal activity when injected by the intra - cerebroventricular route in both c57 / bl6 and balb - c mice ( concentration tested was 3 × 10 − 3 m , corresponding to 100 μg of peptide injected per 20 g mouse ). surprisingly and unexpectedly , the inventors have found that certain mbpcs are extremely effective when only two branches are attached to the core matrix molecule . these two - branched moieties , designated herein as mp2 rl , contain better anti - viral activity than the 8 - branched mbpc variety discussed supra , and in u . s . patent application ser . no . 09 / 342 , 847 , incorporated herein by reference . a salient feature of the mp2 rl constructs is the presence of the four - amino - acid long peptide rqgy . a preferred iteration of the peptide is where a serine is covalently attached to the tyrosine to yield the five - amino - acid long peptide rqgys . as can be seen in table 3 , mbpc containing the rqgys peptide render superior hiv inhibition characteristics . this is true whether the peptide contains solely the five peptides ( as depicted as peptide number 2 in the table ) or when the peptide contains more than the five peptides ( as depicted as peptide number 11 in table 3 ). fig1 - 2 depict the surprising efficacy of the two - peptide - branch construct utilizing the peptide branch rqgyspl . fig1 shows that even at 0 . 1 micro - molar ( μm ) concentrations of the mbpc , viral activity is one tenth that seen in controls . specifically , marked inhibition of syncytium formation and p24 production on hiv - 1 nl403 infected c8166 cells was noted . also , no viral activity is seen at 10 μm concentrations and virtually no activity at 5 μm . it should be noted that concentrations are in relation to blood or serum in which the cells are suspended . fig2 shows that at a concentration of 0 . 1 μm , the mbpc construct ( rqgyspl ) 2k - βa inhibits 100 percent of hiv - 1 nl403 infected peripheral blood mononuclear cells ( pbmcs ). the inventors also found that the mbpc ( d - lpsygqr ) 8 - k4 - k2 - k - βa can totally inhibit hiv infection of pbmcs and c8166 cells at a concentration of 1 μm and 0 . 1 μm . further , the mbpc ( rqgy ) 8 - k4 - k2 - k - βa and ( lpsygqr ) 8 - k4 - k2 - k - βa inhibit syncytium formation and p24 production of hiv - infected cells , with 100 percent inhibition occurring at 5 μm . the multi - branched peptides were not toxic for all cells , even at concentrations of 50 μm . n - α - fluorenylmethyloxycarbonyl ( fmoc ) amino acid derivative were purchased from perkin - elmer . all solvents were analytical - grade commercial products from perkin elmer or sds ( peypin , france ). human peripheral blood lymphocytes ( pbls ) obtained from healthy hiv - seronegative donor ( etablissement francais du sang , marseille , france ) were isolated by ficoll - hypaque gradient centrifugation . cells were cultured in r10 medium supplemented with 20 units / ml of interleukin - 2 ( il - 2 , proleukin , chiron , the netherlands ). r10 medium consists of rpmi 1640 supplemented with 2 mm ultraglutamine ( biowhittaker , vervires , belgium ), penicillin ( 100 units / ml ), streptomycin ( 100 μg / ml ), and 10 % heat - inactivated fetal calf serum ( biowhittaker ). cells were first stimulated with phytohemaggiutinin ( 20 μg / ml )- supplemented r10 ( pha p , difco , detroit , mich ., usa ) for three days . then , the medium was replaced with r10 supplemented with il2 ( 20 units / ml ), and subsequently cultures and experiments were carried out in this medium in a 37 ° c . humidified incubator with 5 % co 2 . viral stocks of the tcla x4 hiv - 1 nl4 - 3 ( obtained from i . hirsh , inserm u 372 , marseille , france ) ( adachi et al ., 1986 ; barre - sinoussi et al ., 1983 ) were produced in permissive cem cells . hiv - 1 hx10 and hiv - 1 mn ( obtained from q . sattenentau ) were propagated in h9 cells . cultured supernatants from infected cells were collected at the peak of maximal viral production as assessed by p24 assay , and residual cells were removed by centrifugation at 4 ° c . ( 2 , 000 rpm / 5 min ). they were sampled and stored at − 80 ° c . the viral stock infectious titer ( 50 % tissue culture infectious dose , tcid 50 ) was established on c8166 cells and pbl . stepwise elongation of mbpcs was carried out on 0 . 1 mmol of β - ala - wang resin . ( 0 . 38 mequiv . of amino group / g ) using an automatic peptide synthesizer ( applied biosystems inc .) trifunctional amino acids were protected on their side - chain as follows : trityl ( trt ) for gln ; t - butyl ( t - bu ) for ser and tyr , fmoc for lys and pentamethylchroman ( pmc ) for arg . the purity of peptides was verified by : ( i ) analytical reverse - phase hplc ( ii ) amino acid hydrolysis ( 6 n hcl / 1 % phenol ( mass / vol . ), 20 h , 120 ° c ., n2 atmosphere ), and ( iii ) mass determination by matrix - assisted laser desorption ionization - time of flight ( maldi - tof ) mass spectrometry . c8188 cells were infected with hiv to establish a baseline control . similar c8188 cells were pretreated the invented mbpcs and then subjected to hiv to determine inhibition rates . the results are illustrated in fig1 a , 1b and 2 . samples of 3 × 10 5 c8166 cells were placed in 96 - well plates in a volume of 100 μl of culture medium containing various concentrations of peptide . after a one hour treatment at 37 ° c ., 100 μl of viral solution of hiv - 1 nl4 - 3 were added . the cells were exposed to the virus of one hour at 37 ° c . at a multiplicity of infection of 1 , 000 tcid 50 per ml . after through washing , cells were replaced in 1 ml of r10 with the treatment in 24 - well plates and cultured in a 37 ° c . incubator . c8166 culture medium was replaced at day - 4 post - infection . during this assay , treatment with peptide was permanent ( before , during and after infection ). assays on c8166 cells have been performed at least twice and in duplicate . toxicity was evaluated by daily cell count and trypan - blue exclusion assay . infection of c8166 t - cells with hiv - 1 nl4 - 3 was assessed by virus - induced cytopathic effect ( syncytia formation ) and by quantification of p24 viral protein in the culture supernatants . measurements of hiv - 1 p24 gag concentrations in the culture supernatants were achieved by elisa , with a detection cut - off of 5 μg / ml ( p24 hiv kit , nen dupont , belgium ; quanti - kine software , rilab , genova , italy ). samples of 10 6 human pbls were placed in 96 - well plates in 100 μl of r10 containing various concentrations of peptide . after one hour treatment of 37 ° c ., 100 μl of viral solution of hiv - 1 nl4 - 3 were added . the cells were exposed to the virus for one hour at 37 ° c . flushed with 5 % co 2 . the pbl culture medium was replaced every 3 - 4 days . the cell viability was assessed by cell counts and trypan - blue exclusion assay . the viral production in the culture supernatant was quantified by p24 elisa test , as described supra . all the experiments have been done in blind - tests . tests have been achieved in duplicate . table 3 inhibition of hiv - 1 infection c8166 cells by rl mp2 analogs syncytium p24 ( pg / ml ) formation peptide 1 1 μm 10 μm 1 μm 10 μm 1 . ( rqgysp ) 2 - k - βa ( seq . id . no . 8 ) + − 2 . ( rqgys ) 2 - k - βa ( seq . id . no . 5 ) 0 0 − − 3 . ( rqgy ) 2 - k - βa ( seq . id . no . 9 ) ± ± 4 . ( rqg ) 2 - k - βa ( seq . id . no . 10 ) ± − 5 . ( qgyspl ) 2 - k - βa ( seq . id . no . 11 ) ± − 6 . ( gyspl ) 2 - k - βa ( seq . id . no . 12 ) ± ± 7 . ( yspl ) 2 - k - βa ( seq . id . no . 13 ) ± ± 8 . ( spl ) 2 - k - βa ( seq . id . no . 14 ) ++ ± 9 . 2 ( d rqgyspl ) 2 - k - βa ++ ++ 10 . ( kqgyspl ) 2 - k - βa ( seq . id . no . 16 ) ++ ++ 11 . ( rqgyspl ) 2 - k - βa ( seq . id . no . 8 ) 0 0 − − 12 . ( acrqgyspl ) 2 - k - βa ( seq . id . no . 17 ) ++ ++ 13 . azt 0 0 − − 14 . no peptide 25000 23000 ++ ++ 1 peptide concentrations are in micro - moles ( μm ). 2 seq . id . no . 15 symbols : “++” = number of syncytia present in the well were similar to that in control untreated well ( 35 to 40 syncitia per well ); “−“ = total absence of syncitia in the well ; “±“ = presence of 1 to 3 syncitia in the well . while the invention has been described with reference to details of the illustrated embodiment , these details are not intended to limit the scope of the invention as defined in the appended claims .

US-12691502-A

the invention proposes to detect and track an intervention device in a 2d fluoroscopy image and to steer an ultrasound probe beam towards this device . therefore , a method and corresponding system is proposed , by which an ultrasound probe is registered in a fluoroscopy image , wherein the registering includes the estimation of the position and of the orientation of the probe relative to the fluoroscopy .

fig1 shows , from left to right , an x - ray target image of an ultrasound probe , a non - aligned digitally rendered radiograph ( drr ) of an ultrasound probe , as well as an aligned drr . in fig1 c , the 3d model of fig1 b is orientated so that a projection thereof matches with the projection of the probe in the x - ray image of fig1 a . the orientated 3d model of fig1 c is then combined with the x - ray image . fig2 shows such an overlay of an aligned drr 110 on top of an x - ray image of chest 300 and heart 320 , after intensity based registration , i . e . an estimation of the position and orientation of the probe . this gives the position / orientation of the probe with respect to the x - ray imaging system . if both systems are calibrated , the ultrasound image can be merged with the x - ray image . also shown in fig2 are interventional devices 200 , for example catheters . a coordinate system in front of the ultrasound probe 110 indicates the estimated orientation of the ultrasound sensor elements relative to the image plane of the x - ray image . an x - ray acquisition system is configured to produce real - time 2d x - ray images of an anatomical region during an interventional procedure . this modality does not allow clear visualization of complex soft - tissue anatomy such as the heart . an ultrasound acquisition system with for example a trans - esophageal echocardiography ( tee ) ultrasound probe , is configured to produce images of the anatomy . this ultrasound acquisition system is assumed to lie at least partially in the field of view of the x - ray acquisition system with sufficient information that it is enough to recover the coordinate system of the images produced by this system . it is the case for example when the whole detector of the ultrasound acquisition system is present in the x - ray image and / or when its position can be estimated from other structures present in the x - ray image . subsequently , a 3d model of the ultrasound probe may be used to automatically compute the pose of the probe . this may be done by matching the x - ray image of the ultrasound probe with a digitally rendered radiograph generated by transparent projection of the 3d model ( cf . fig1 and 2 ). an optimization algorithm allows retrieving the 6 pose - parameters of the probe which gives the 3d position of the probe and its 3d orientation with respect to for example the c - arm system defining a reference coordinate system . an offline calibration of the probe gives the relationship between the ultrasound image and the 3d model . in combination with the previous step , it is then possible to have the relationship between the ultrasound image and the x - ray imaging system , and therefore with the x - ray image if the x - ray imaging system is also calibrated . fusion between x - ray image and ultrasound image is then straight forward . another interesting application is the use of the x - ray imaging system as a reference coordinate system to compound different ultrasound acquisition and build an extended field of view which is of great interest for tee acquisitions where the field of view is often very limited . as exemplarily shown in fig3 , the volume of acquisition 130 of the ultra - sound probe 110 may be represented as a truncated pyramid in 3d , assuming that the position and orientation of the ultrasound probe 110 with respect to the x - ray image is known . as can be seen in fig3 , an interventional device 200 with its interventional end portion may be located such that the field of view 130 encompasses that interventional end portion of the device 200 . further shown in fig3 is an angle 140 determining the angle of beam of the field of view of the ultrasound probe . here , the angle of beam is 42 . 3 degree . in fig4 is a flow chart showing the steps of a method for a combination of ultrasound and x - ray images according to the invention . the patient is simultaneous imaged by an ultrasound system 100 and an x - ray system 400 . in a preferred embodiment , a considered ultrasound probe of the ultrasound system 100 is capable of generating synthetically steered beams , preferably in 3d . it will be understood that the steps described with respect to the method are major steps , wherein these steps might be differentiated or divided into several sub - steps . furthermore , there might be also sub - steps between these major steps . therefore , a sub - step is only mentioned if that step is important for the understanding of the principles of the method according to the invention . in step s 1 , the ultrasound system 100 and the x - ray imaging system 400 are first mutually registered . this can typically be achieved by imaging the probe of the ultrasound system 100 by the x - ray system 400 , and based on the settings 150 and data 160 of the ultrasound system 100 and on the settings 410 of the x - ray system 100 , plus on the possible use of a probe 3d model 500 or markers , in determining the position of the probe in the x - ray referential . from this information , and based on the relevant calibration information , one can use the parameters of the probe field of view in the x - ray referential , as described above . data s 1 c will be exchanged for visualization of the resulting image . in step s 2 , at the same time , the intervention device ( for instant the tip of a catheter ), is detected and tracked in the x - ray images . this step relies on data 420 of the x - ray system 400 and on usual object detection means that rely on the spatial signature of the device and possibly on its motion characteristics ( for instance , the device is animated by a cardiac motion plus a steering motion , seen in projection ). in step s 3 , it is advantageous to improve the 2d location provided by device tracking in the x - ray images and to try to get a depth estimation of the considered device . several approaches are possible to reach the goal , among which the exploitation of the devices observed width , the use of other x - ray views under different angulation for instance in bi - plane context or the use of wiggling motions . for example , the width of the ultrasound probe may be estimated , wherein subsequently possible locations of the ultrasound probe are discriminated on the basis of the estimated size and of a segmentation of the imaged object . in step s 4 , the device - improved location s 3 a can then be compared to the found ultrasound field of view s 1 b , and several commands can be issued accordingly . for instance , a device flashing / blinking command can be issued to the imaging processing channel of the x - ray data stream , or a probe steering command s 4 a can be sent to the relevant module . on the other hand , the data s 4 b of step s 4 together with the information s 2 a of step s 2 will result in step s 5 , i . e . the visualization of the device in the x - ray image which is adapted based on events such as the entering ( blinking / flashing ) or the presence ( coloring ) of the device in the ultrasound field of view . this provides the ultrasound user with an easy way of controlling the steering of the probe based on the high resolution x - ray images . of course , this steering is also made easier by the visualization of the ultrasound cone as shown in fig3 . the result of step s 5 is an enhanced 2d view s 5 a facilitating the steering of the ultrasound probe . in step s 6 , alternatively or complementarily , a command s 6 a can be issued to the beam - steering module of the ultrasound system 100 , as to which field of view one should generate in order to nicely visualize the device at the center of the ultrasound cone ( volume or image ). the probe steering module , based on the ultrasound / x - ray registration information will determine and apply the relevant set parameters enabling this device - driven steering . when the invention has been illustrated and described in detail in the drawings and afore - going description , such illustrations and descriptions are considered illustrative or exemplary and not restrictive , the invention is not limited to the disclosed embodiments . other variations to the disclosed embodiments can be understood and effected by those skilled in the art in practicing the claimed invention , from a study of the drawings , the disclosure and the pendent claims . in the claims , the word comprising does not exclude other elements or steps , and the indefinite article a or an does not exclude a plurality . a single processor or other unit may fulfill the functions of several items recited in the claims . the mere effect that certain measures are recited and mutually different , dependent claims does not indicate that a combination of these measured cannot be used to advantage . a computer program may be stored / distributed on a suitable medium such as an optical storage medium or a solid - state medium supplied together with or as a part of another hardware , but may also be distributed in other forms , such as via the internet or other wired or wireless telecommunication systems . any reference signs in the claims should not be construed as limiting the scope . s 1 b ultrasound field of view in x - ray referential

US-201013513921-A

the present invention pertains to a dough intermediate that is subject to a further processing step by an end user and that has a uniform average air cell size . through the use of an average air cell size and void fraction volume , a dough intermediate can be produced without the use of chemical leavening agents .

turning to fig1 of the present invention , the dough intermediate generally designated as 10 illustrates the dough intermediate in its final rolled , sliced state ( having been cut from a larger roll of layered dough — not shown ) with an enlarged cut away showing the substantially regular cellular matrix or structure 15 of the present invention . as used herein , the term dough intermediate refers to dough - based products , such as rolls , biscuits , buns , cinnamon rolls or buns , croissants , pastries and the like which undergo a further processing step by the end user , such as baking or heating . the following table sets forth a suggested formula for use in practicing the present invention . is # ingredient chemist baker 16044 biscuit flour 53 . 53 100 . 00 11659 water 23 . 27 43 . 48 15905 gluten 0 . 00 0 . 00 dough conditioner 0 . 30 0 . 56 18206 salt 1 . 00 1 . 87 18940 phvo 8 . 00 14 . 95 15311 vanilla flavor 0 . 40 0 . 75 19611 compressed yeast 5 . 00 9 . 34 19202 sucrose 5 . 00 11 . 21 16813 sweet whey solids 1 . 00 1 . 87 12203 monoglycerides 1 . 50 2 . 80 rgb color solution 0 . 10 0 . 19 total % 100 . 00 186 . 82 to create the dough of the present invention , water , yeast , monoglycerides and a color solution ( if necessary ) are first combined and then all the remaining dry ingredients are placed in a bowl . the mixture is mixed on a low speed for about 60 seconds and then on a higher speed for about 8 minutes . after the mixing is completed , the dough is allowed to rest for about thirty minutes at room temperature and is kept covered to prevent the dough from loosing moisture during the drying step . the dough is then removed and sheeted to an approximate thickness of about 3 mm . next , the filling , as described below , is applied to the sheeted dough and the dough is then rolled upon itself to create a number of layers or swirls . in the present embodiment , 7 layers or swirls are created . the roll has a diameter of approximately 5 centimeters , a height of 4 to 5 centimeters and a weight of approximately 100 to 110 grams . the rolls are then sliced into approximately 1 - inch pieces and packaged for freezing . in order to obtain the desired browning in the microwave oven , a browning solution is applied , such as maillose . in a preferred embodiment of the present invention a solution of maillose , soy protein isolate and water is prepared and applied to the dough intermediate . the amount of maillose ranges from 10 to 30 % by weight of the solution . occasionally , it may be necessary to use a dough conditioner as part of the manufacture of the dough . the formula for the dough conditioner is as follows : % dough conditioner preblend dough 12218 datem w / amylase 0 . 175 11546 ascorbic acid 0 . 005 11614 ssl 0 . 12 the filling of the preferred embodiment of the present invention is as follows : % filling brown sugar , powder 27 . 15 shortening 35 . 00 sucrose 14 . 90 milk product 3 . 95 cinnamon 5 . 00 alginate 0 . 75 water 10 . 00 hf corn syrup 15 . 00 albumin 1 . 15 wheat starch 4 . 00 total : 116 . 90 the filling was prepared by first melting the margarine . next , the sugar , cinnamon , milk product , starch and albumin are dry blended together . finally , the sugar combination is mixed with the melted margarine using a kitchen aid ®, available from kitchen aid , inc . st . joseph , mich ., mixer on a low speed . the water and corn syrup are added and the mixture is mixed on a medium speed until fully blended . in the preferred embodiment of the present invention , it is important to obtain the necessary cellular structure prior to the dough intermediate being frozen . this will provide the dough intermediate with acceptable baking and volume properties upon exposure to microwave energy . preferably , a dough intermediate is created having a void fraction of at least 15 % of the product and a minimum air cell size of approximately 125 microns in diameter . as used herein , the term “ void fraction ” refers to the volume fraction of dough occupied by air rather than the gluten / starch matrix in the dough . for example , if a dough has a volume of 100 cc , and of that volume , 40 cc is occupied by air , the void fraction would be 40 / 100 which would be 0 . 4 . the void fraction can be measured from micrographs , or estimated using a measure of the total volume of the sample combined with the approximation that the density of air free dough is 1 . 2 g / cc ( specific volume 0 . 83 cc / gr ). that is , if a 100 gm sample of dough has a volume of 150 cc , the volume of air free dough is estimated to be ( 0 . 83 gm / cc × 100 = 83 cc ). thus , the volume occupied by air would be 67 cc and the void fraction would be 67 / 150 = 0 . 44 . as can been seed from the following table , the air cell size of the dough ranges from about 90 microns to around 220 microns and more preferably about 120 microns to about 190 microns with about 125 microns to about 150 microns being the optimal preferred sized for the air cells or bubble in the dough intermediate . the particular cells are illustrated in fig2 through fig4 . image analysis of bubble size distribution feb . 18 , 2002 ave . eq . pre - ferment / proof % bubbles circular diameter 0 - 0 8 . 7 110 . 9 6 . 3 92 . 4 average 7 . 5 101 . 7 0 - 1 . 2 11 . 8 125 . 9 14 . 5 120 . 2 average 13 . 2 123 . 1 0 - 1 . 4 17 . 3 130 . 4 15 . 8 128 . 5 16 . 6 129 . 5 20 - 0 7 . 5 104 . 4 5 . 5 103 . 5 average 6 . 5 104 . 0 20 - 1 . 2 20 . 6 147 . 3 29 . 7 160 . 8 average 25 . 2 154 . 1 20 - 1 . 4 36 . 5 169 . 6 44 . 8 210 . 4 average 40 . 7 190 . 0 the foregoing cellular structure is obtained through the use of a liquid preferment , increasing the normal dough rest time after the dough has been created and / or subsequent proofing after the rolls have been formed . the data in the table also provides that so long as the percent of cellular matrix in the dough was above roughly 14 %, then no blistering of the dough was seen after subjecting the dough intermediate to microwave energy . see the data sets collected for 20 - 1 . 4 , 20 - 1 . 2 and 0 - 1 . 4 listed above . in addition , the dough intermediate of the present invention has a cellular matrix ranging from about 14 to 45 % of the dough and more preferably around 20 to 30 %. it will thus be seen according to the present invention a highly advantageous dough intermediate has been provided . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it will be apparent to those of ordinary skill in the art that the invention is not to be limited to the disclosed embodiment , that many modifications and equivalent arrangements may be made thereof within the scope of the invention , which scope is to be accorded the broadest interpretation of the appended claims so as to encompass all equivalent structures and products .

US-10042702-A

the present invention relates generally to methods for introducing mutations that alter the probability of intranucleic acid base pairing of a conserved structured nucleotide in a nucleic acid . the present invention also provide methods for making mutant pathogenic organisms suitable as live attenuated vaccines , animal and human diagnostics , and for identifying suitable drug targets .

in various exemplary embodiments , provided herein are methods to determine regions in rna polynucleotides which contain evolutionarily conserved secondary structural elements , a method of predicting nucleotide mutations that can be disruptive for such regions , and , in some embodiments , an application of such nucleotide mutations to creating rna - based vaccines . provided herein is a new definition of structured rna regions based on alignment of multiple rna sequences instead of attempting to identify such regions based on analysis of an individual rna sequence . for example , a stem - loop structure in a particular location that is so important that it is present across the majority of strains means that nucleotides in positions corresponding to the stem would have probabilities to be in a double - stranded conformation close to 1 in all the strains constituting aligned dataset of rna sequences . at the same time , nucleotides in positions corresponding to the loop would have probabilities to be in a double - stranded conformation close to 0 in all the strains . thus , structured rna regions are defined herein as patterns of high and / or low probabilities for the nucleotides to be paired , which manifest across the spectrum of strains . the methods provided herein answer the long - standing conundrum of why different nucleotides in , for example , the influenza genome mutate with such different frequency . the methods provided herein demonstrate that those nucleotide positions that are the least prone to being mutated do not collocate with regions of conserved rna structures . instead , the frequently and / or rarely mutating positions are randomly spread along the rna sequences . we have demonstrated that in some influenza mrnas mutations in those nucleotide positions , which are naturally less prone to being mutated , would possess a greater disruptive effect on areas of conserved rna structures than mutations in positions , which mutate more frequently . as a result , mutations deleterious for vital rna structures would be eliminated due to the negative selection pressure . this demonstrates that conservation of rna structures could be a mechanism defining highly differential mutation rate in different influenza nucleotide positions . consequently , the methods provided herein enable a new approach for rational design of attenuated vaccines , which allows predicting mutations that would be disruptive for conserved rna structures . structurally conserved rna regions of viral rnas can be a novel class of anti - viral drug targets . for example , anti - viral agents selectively disrupting rna structures vital for a viral life cycle identified by the methods provided are useful for anti - viral therapies . the methods provided herein can be used for rational design of attenuated vaccines . for example , the methods provided can predicting mutation that would be disruptive for structured rna regions thus making the virus unable to efficient propagation , thereby generating attenuated viral strains , which can be used as vaccines . as used herein , the term “ nucleic acid ” refers to strands comprising backbones ( e . g ., of ribose phosphate and deoxyribose phosphate ) and side chains generally comprising heterocyclic bases such as a , c , g , t , and u . examples of natural nucleic acids include deoxyribonucleic acid ( dna ) and ribonucleic acid ( rna ). when referring to a nucleic acid molecule , the term “ native ” refers to a naturally - occurring ( e . g ., a wild - type ( wt )) nucleic acid . as used herein , the term “ pairing ” in reference to nucleotides refers to interaction between nucleotides by the formation of hydrogen bonds . pairing includes thermodynamically favorable “ watson - crick ” pairs ( i . e ., g - c and a - u pairs in rna ). pairing also includes non watson crick “ mismatch ” pairs ( g - u pairs in rna , referred to as “ wobble pairs ”), which are significantly less stable . as used herein , the term “ primary structure ” refers to the sequential order of units in a strand or chain . as used in reference to nucleic acids , the primary structure is the sequence of nucleotides in the nucleic acid strand . as used herein , the term “ secondary structure ” refers to the set of the pairing interactions between nucleotides within a single molecule , and can be represented as a list of bases which are paired in a nucleic acid molecule . as used herein , the term “ constraint ” refers to an aspect of a structure that might otherwise be variable , but that is assigned a particular value ( e . g ., a property , position or relationship ) during modeling of a structure . constraints may comprise experimental or theoretically derived aspects of a structure , including but not limited to : distances between components of a structure , ( e . g ., from nmr noe measurements or fret measurements ); dihedral angles ( e . g ., from nmr j - coupling measurements ); directions with respect to an axis ( e . g ., from nmr residual dipolar coupling measurements ); exposure of a component to the surface of a structure ( as determined by , e . g ., edta - fe probing ), exposure to solvent ( as determined by , e . g ., reaction with dms , depc , enu , cmct or kethoxal reagents ); positions of phosphorus atoms , positions of nucleotides ( as determined by , e . g ., low resolution x - ray crystallography , cryo - electron microscopy , atomic force microscopy , or nmr methods ); other aspects of nucleotide disposition in a structure ( e . g ., proximity to other nucleotides , paired or unpaired status , or pairing with a particular other nucleotide ) such as can be determined by , for example , cross - linking [ e . g ., using psoralin or mustard reagents ) or nuclease sensitivity ( e . g ., nucleases s1 and v1 , or structure - specific nucleases such as fens ). as used herein , the phrase “ sequence identity ” means the fraction of identical subunits at corresponding positions in two nucleic acid sequences when the two sequences are aligned to maximize subunit matching , i . e ., taking into account gaps and insertions . sequence alignment can be created using sequence alignment software ( e . g ., clustalw , muscle , t - coffee , etc .). methods of the invention compare related variant native nucleic acid sequences . in some embodiments , the variant nucleic acid sequences are from different generations of a particular virus or living organism . the phrases “ identity conserved nucleotide position ” and “ non - mutable nucleotide position ” refer to whether a nucleotide position within a nucleic acid will likely have a specific nucleobase ( e . g . a , c , g , or u for rna ) at a threshold probability . for example , if at nucleotide position i , wherein 0 & lt ; i & lt ; li + 1 for a nucleic acid of length li , is found to have an adenine residue above a certain probability threshold among a plurality of native nucleic acids of the same genetic region , then the nucleotide position is scored as an identity conserved position . every nucleotide position within a nucleic acid can be evaluated as to whether it meets the requirement of an identity conserved position . in an embodiment , the value of shannon entropy is calculated . the shannon entropy h is given by the formula : where p i is the probability of character number i showing up in a stream of characters of the given “ script ”. in the case of a nucleic acid sequence , such as rna , the shannon entropy is the probability of a given nucleotide appearing in a nucleic acid sequence . such probabilities , in turn , can be assessed based on the numbers of observed cases of every nucleobase at the particular position in the dataset of native rna sequences with taking in account pseudocounts . a pseudocount is an amount added to the number of observed cases in order to change the expected probability in a model of those data , when not known to be zero . methods of the invention also determine the probability that a nucleotide in a nucleic acid will be paired . the phrases “ probability of a nucleotide to be paired ”, “ probability of a nucleotide to be in a double - stranded conformation ”, and “ probability of intranucleic acid base pairing ” refer to the likelihood that a particular nucleotide position in a nucleic acid molecule is in a paired state with another nucleotide of the same nucleic acid molecule . a “ conserved structured nucleotide ” refers to whether a nucleotide position within a nucleic acid will likely be paired with another nucleotide within the same nucleic acid at a threshold probability . for example , if at nucleotide position j , wherein 0 & lt ; j & lt ; l i + 1 for nucleic acid of length l i , is determined to be in a paired state above a certain probability threshold , the nucleotide position is scored as a structure conserved nucleotide . in an embodiment , the structure conserved nucleotide , whose probability to be paired is significantly less variable than the mean variability of the probabilities of the other ribonucleotides to be paired . as used herein , the phrase “ structure conserved region ” refers to a plurality of contiguous nucleotides in a nucleic acid a high density of nucleotides within it that tend to evolutionarily maintain their probability to be in a double - stranded conformation . in contrast to “ structure conserved region ”, the phrase “ non - structured region ” refers to a region in rna polynucleotides with either low density or complete absence of nucleotides within it that tend to evolutionarily maintain their probability to be in a double - stranded conformation . provided herein are also methods to determine a suitable mutation in a nucleic acid sequence that alters the probability of intranucleic acid base pairing of a conserved structured nucleotide . for every conserved structured nucleotide position , the native range of probabilities determines the minimum and maximum allowed probability values in such way that it is very likely that the probability of a nucleobase at the particular nucleotide position from every native rna sequence would be higher than the minimum native probability and lower than the maximum native probability . mutations identified by the inventive methods can be introduced into the nucleic acid sequence using standard genetic techniques . the mutation can be a substitution , an insertion or deletion of one or more nucleotides . in an embodiment , provided herein is a method of introducing a mutation into a nucleic acid that alters the probability of intranucleic acid base pairing of a conserved structured nucleotide that includes ( a ) the introduction of a mutation at an identity conserved nucleotide position i , 0 & lt ; i & lt ; li + 1 , wherein li is the length of the nucleic acid sequence , in the nucleotide sequence corresponding to said nucleic acid ; ( b ) determination of the probability of intranucleic acid base pairing for a structure conserved nucleotide position j , 0 & lt ; j & lt ; l + 1 , in said nucleic acid sequence in the presence of the mutation ( pm ); ( c ) comparison of pm to a threshold probability of intranucleic acid base pairing for a structure conserved nucleotide position j in said nucleic acid sequence by either ( i ); comparing pm to pmin wherein pmin is a minimum threshold probability of intranucleic acid base pairing for a structure conserved nucleotide position j in said nucleic acid sequence ; or , ( ii ) comparing pm to pmax wherein pmax is a maximum threshold probability of intranucleic acid base pairing for a structure conserved nucleotide position j in said nucleic acid sequence ; wherein if pm & lt ; pmin or pm & gt ; pmax said mutation is identified as a structure conserved altering mutation ; and , ( d ) introduction of said mutation into said nucleic acid when said mutation is a structure conserved altering mutation . the method provided herein was used to determine structured regions of h1n1 influenza a strains because of their great public health importance ( spanish flu of 1918 , mexican swine flu , etc .). see example 1 . additionally , the described method can be easily utilized to find rna structured regions of other viruses and living organisms . in an embodiment , a dataset of related rna sequences is used to determine regions in rna polynucleotides with high density of nucleotides that tend to evolutionarily maintain their probability to be in a double - stranded conformation . the ability of rna polynucleotides to form particular base pairs and , hence , to form particular rna secondary structural elements , depends dramatically on the sequence of ribonucleotides in the rna molecule . therefore , introducing single nucleotide polymorphism ( s ) can cause an rna polynucleotide to become incapable of forming certain rna secondary structural elements . in an embodiment , methods of the invention include determining structurally disruptive mutations based on their effect on structured rna regions ( as defined in the previous section ). sequences of messenger rnas of h1n1 influenza a virus were analyzed by the method provided herein . as influenza viruses from different hosts may possess different characteristics , only human influenza strains were utilized in order to eliminate any potential bias . influenza strains from other hosts ( avian , swine , etc .) were excluded from the analysis . the influenza a genome is composed of eight segments encoding twelve proteins . as two influenza genes , hemagglutinin ( ha ) and neuraminidase ( na ), represent the major viral antigens , these two genes are usually sequenced much more often than any other genes . to eliminate potential bias caused by disproportional representation of similar ha and na sequences and to make datasets of sequences of different mrnas comparable to each other , only completely sequenced influenza genomes were used . only those strains were selected , which possess identical length for each of their genome segments with other strains in the dataset . the fact that every segment of influenza genome has the same length in every viral genome selected for our work eliminates potential mistakes , which could be introduced by effects of deletion and insertion polymorphisms ( dips ) on the secondary rna structure . in addition , it automatically ensures that for every mrna the rna sequences are aligned without gaps . sequences of coding regions of mrnas of those influenza genomes , which satisfied the above mentioned criteria were downloaded from the influenza virus resource [ hypertext transfer protocol :// world wide web ( dot ) ncbi ( dot ) nlm ( dot ) nih ( dot ) gov / genomes / flu / flu ( dot ) html ]. in order to increase the coherence of the dataset , pandemic influenza strains were separated from non - pandemic influenza strains ; thus , two separate datasets were created . the dataset of rna sequences should preferably be non - redundant , which means that it should not contain sequences that are characterized by high sequence identity . the level of sequence identity between two rna sequences in this case can be measured as a fraction of the identical nucleotide positions in a sequence alignment to the total length of the alignment . in other words , to make the datasets non - redundant , only those sequences should be included in the dataset , which have sequence identity levels with every other sequence in the dataset lower than some threshold . the threshold can be any real number in the range of 0 to 1 . another way of filtering redundant rna sequences is to exclude rna sequences , which differ from any other sequence in the dataset by less than some fixed threshold number of nucleotides . in the present analysis , only those influenza strains were included in the datasets , which in the coding regions of their mrnas have more nucleotide substitutions with coding regions of mrnas of any other influenza genome from the dataset than 49 . the created datasets of non - pandemic and pandemic influenza a strains consisted of 104 and 135 complete genomes respectively . rna propensity to form secondary structure and evolutionarily maintain it and structured rna regions for each coding region of mrna sequences from the datasets , the probabilities of nucleotides to be in a double - stranded conformation were calculated with the rnafold tool from the vienna rna package . the next step was to identify patterns of nucleotide pairing probabilities , which are repeatedly manifested in the rnas constituting the dataset . in other words , it is necessary to identify those ribonucleotide positions , whose probability to be paired varies the least from sequence to sequence . for every ribonucleotide position along the influenza mrnas , a set of probabilities consisting of 104 and 135 values was computed for the non - pandemic and the pandemic influenza datasets respectively . standard deviations of these sets of probabilities were calculated for every position . such standard deviations were used as a measure of structural conservation at a specific nucleotide position ( fig1 - 4 ). the novel definition proposed here considers conservation of stems equal to conservation of loops and provides computational friendly quantitative definition of the degree of rna structure conservation . to smooth stochastic fluctuations moving averages of individual standard deviations were calculated for every messenger rna of influenza virus with a sliding window of size 5 ( fig5 - 8 ). given a series of standard deviation values and a fixed window size , the first element of the moving average is obtained by taking the average of the initial fixed subset of the standard deviation series . the number of values in the initial fixed subset equals the fixed window size . then the subset is modified by “ shifting forward ”; that is , excluding the first number of the standard deviation series and including the next number following the original subset in the standard deviation series . this creates a new subset of standard deviation values , which is averaged . this process is repeated over the entire standard deviation series for every coding region of the messenger rnas of influenza virus . every moving average value was assigned to the ribonucleotide position , which is in the middle of a corresponding window . the resulting plot line connecting all the computed averages is the moving average . to determine structured and non - structured regions , all moving average values of individual standard deviations from all influenza mrnas were combined to one set of moving averages . mean value and standard deviation of that set of values were calculated . if an individual moving average value of a particular position is less than the overall mean of the moving averages minus the overall standard deviation of the moving averages ( this level is depicted with the black dashed line on fig5 - 8 ), this position is considered as “ structure conserved ”. the combination of structure conserved positions that possess low values of their standard deviations of probabilities of the corresponding ribonucleotides to be in a double - stranded conformation can be defined as structured rna regions . as described above , a dataset of aligned influenza sequences was created . for each individual rna sequence within the dataset , the probability of each nucleotide to be paired was computed . for every nucleotide position within coding regions of influenza mrna sequences , the mean value and the standard deviation of the probabilities of nucleotides to be paired were calculated . based on these values , for every nucleotide position within a structured region a range of probabilities from the mean value decreased by the standard deviation to the mean value increased by the standard deviation is considered as naturally occurring range . mutations that may potentially disrupt structured rna regions were in silico randomly introduced into the rna polynucleotides from the dataset of influenza sequences . the resulting sequences comprise a dataset of random mutants . for every random mutant from the newly generated dataset the probabilities of nucleotides to be in a double - stranded conformation were computed by the rnafold tool from the vienna rna package . a mutation occurring in the rna sequence may have an effect on the probability of each nucleotide within the sequence to be paired . for every random mutant , a number of nucleotides which have their probabilities to be paired that would be outside of a naturally occurring range ( as described above , for every particular nucleotide position such range is from a mean value decreased by a standard deviation to a mean value increased by a standard deviation ) was computed . if a random mutant has at least one such nucleotide , then mutation ( s ) that differ the mutant from the original rna sequence is ( are ) called disruptive for the structured rna regions . the effect of a mutation or set of mutations on the rna structured regions was assessed in a quantitative manner as the number of such nucleotide positions . although the present invention has been illustrated and described herein with reference to preferred embodiments and specific examples thereof , it will be readily apparent to those of ordinary skill in the art that other embodiments and examples may perform similar functions and / or achieve like results . all such equivalent embodiments and examples are within the spirit and scope of the present invention , are contemplated thereby , and are intended to be covered by the following claims .

US-201515121560-A

the infant product of the invention is of the type having an infant receptacle suspended from a frame . the infant product is foldable between a deployed position for use and a compact configuration for shipping and storage . in the assembled configuration , the infant receptacle is convertible between a bassinet configuration in which the infant receptacle has a substantially planar support surface and an infant seat configuration in which the support surface of the infant receptacle is partially titled or disposed at an angle such that the infant can be supported in an elevated or seated position . the infant product may include a fabric canopy incorporating floating webs and a quick connect system for securing the canopy in an open position . when the canopy is closed , it is folded so as to lie flat against the infant receptacle . the infant receptacle may also include a lateral support assembly to cradle the infant .

reference will now be made in detail to the presently preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . in particular , the invention is directed to an infant product , the presently preferred embodiments of which are shown generally in fig1 and 31 , for example . more particularly , the infant product in accordance with the invention is directed to : 1 ) a collapsible infant product that is configurable between : a ) an in - use , deployed or unfolded configuration , shown generally at 11 in fig1 - 9 and b ) a storage , stowed or folded configuration shown generally at 16 in fig2 - 31 ; and 2 ) deployed infant product 11 , which may be disposed in either of two configurations : a ) a deployed bassinet configuration shown generally at 12 in fig1 - 4 , and b ) an deployed infant seat configuration shown generally at 14 in fig5 - 9 . regardless of the respective configuration , however , the infant product in accordance with the invention includes a foldable frame shown generally 100 in fig1 - 14 and soft goods shown generally at 200 in fig1 - 9 which are suspended from frame 100 . accordingly , a detailed discussion of frame 100 and soft goods 200 follows . then , the method of converting the infant product between deployed bassinet configuration 12 and deployed infant seat configuration 14 will be described , as well as , the conversion between deployed configuration 11 and compact folded configuration 16 . referring now to fig1 - 14 , frame 100 will be described . frame 100 has a construction that suspends soft goods 200 and is convertible between deployed configuration 11 as shown in fig1 - 12 , for example , and compact folded configuration 16 as shown , for example , in fig2 . frame 100 is preferably converted by folding frame 100 along with soft goods 200 . therefore , the frame is not limited to a particular configuration so long as it can suspend soft goods 200 and can be easily converted between a compact configuration and a deployed configuration in accordance with the invention . frame 100 has a longitudinal axis l ( fig1 ) and a transverse axis t substantially perpendicular to longitudinal axis l . as shown , frame 100 generally includes an annular upper rim frame 102 , a front leg 104 , a back leg 106 , structural hubs 108 , 110 and back leg brackets 112 , 114 . annular upper rim frame 102 , front leg 104 and back leg 106 may be made of any lightweight rigid and durable material . in the illustrated embodiment , these members are 18 - gauge , powder - coated , hollow , cylindrical steel tubing . upper rim frame 102 may have a 0 . 5 ″ ( 1 . 2 cm ) outer diameter and front and back legs 104 , 106 may have ⅝ ″ ( 1 . 7 cm .) outer diameter . however , other types of materials may be used in accordance with the invention , such as rectangular tubing , aluminum , wood , or plastic tubing or channel , etc . annular upper rim frame 102 provides the support from which soft goods are suspended . annular upper rim frame 102 as shown includes a front rim tube 116 and a back rim tube 122 , both of which have a generally u - shaped configuration . front rim tube 116 has two ends 118 , 120 pivotally coupled to structural hubs 108 , 110 , respectively , such that front rim tube 116 is pivotal relative to back rim tube 122 as discussed in more detail below . back rim tube 122 has two ends 124 , 126 non - pivotally secured to structural hubs 108 , 110 as discussed in more detail below . as illustrated in fig1 , in the deployed position front rim tube 116 is disposed substantially parallel to transverse axis t , while back rim tube 122 is disposed at an angle relative to front rim tube 116 . back rim tube 122 is disposed at a slight angle such that infant recline / seat feature 222 ( see , e . g . fig1 and 18 ) can be positioned high enough to form deployed infant seat configuration 14 , as discussed in more detail below . however , other configurations are within the scope of the invention to accommodate infant recline / seat feature 222 , and if the recline / seat feature 222 is not used , back rim tube 122 may also be parallel to transverse axis t . front leg 104 and back leg 106 are disposed to support annular upper rim frame 102 in deployed configuration 11 at a suitable height above a supporting surface to suspend soft goods 200 above the supporting surface . for example , front and back legs 104 , 106 are disposed at angles opposing each other , with their upper ends relatively close together and their lower , support - surface engaging ends relatively far apart to provide a broad , stable base . front leg 104 has a generally u - shaped configuration including a base 128 and two side legs 130 , 132 extending substantially perpendicular from base 128 . side legs 130 , 132 have ends 134 , 136 respectively , which are pivotally attached to structural hubs 108 , 110 , respectively , as discussed in more detail below . back leg 106 is also of a generally u - shaped configuration and includes a base 138 including two side legs 140 , 142 extending substantially perpendicular from base 138 . side legs 140 , 142 have two ends 144 , 146 respectively , pivotally attached to back leg brackets 112 , 114 , respectively , as discussed in more detail below . side legs 140 , 142 of back leg 106 include transition portions 148 , 150 in the vicinity of ends 144 , 146 whereby the lateral spacing or distance between side legs 140 , 142 is increased such that back leg 106 does not interfere with the folding movement of front leg 104 ( front leg 104 pivots inside of back leg 106 ) and such that back leg 106 can detent against the outside of structural hubs 108 , 110 in compact folded configuration 16 as discussed later . although front and back legs 104 , 106 have been described as being pivotally coupled relative to upper rim frame 102 , any type of releasable connection may be used . to increase resistance to sliding of the legs with respect to the support surface in deployed configuration 11 , rubber feet 152 may be disposed , two each , on bases 128 , 138 of back leg 106 and front leg 104 , respectively . rubber feet 152 may be formed of any rubber material including , for example , a synthetic rubber such as a thermoplastic elastomers ( tpe ). rubber feet 152 also prevent the infant product in its deployed configuration 11 from shifting or “ walking ,” for example , when a vibration unit is used , as discussed below . annular upper rim frame 102 , front leg 104 and back leg 106 just described are deployed and interconnected using structural hubs 108 , 110 and back leg brackets 112 , 114 . accordingly , structural hubs 108 , 110 and back leg brackets 112 , 114 will now be discussed in detail along with the assembly of frame 100 . structural hubs 108 , 110 and back leg brackets 112 , 114 may be made of a lightweight plastic material , such as , structural nylon . referring now to fig1 in combination with fig1 - 12 , structural hubs 108 , 110 will be discussed in detail . structural hubs 108 , 110 include hollow box - shaped housings 154 , 156 . one of structural hubs 108 , 110 may include a vibration unit integrated into its housing 154 , 156 to sooth the infant . such a vibration unit may include , for example , a motor , a weight , an on / off switch , battery contacts and wiring . it is preferable to place the vibration unit on one of structural hubs 108 , 110 because structural hubs 108 , 110 are in structural communication with the entire frame 100 and therefore distribute the vibration most effectively , however , other configurations may be used in accordance with the invention . as structural hubs 108 , 110 are laterally disposed on frame 100 , they are mirror images of each other . accordingly , the following discussion only describes structural hub 108 in detail , because the construction of structural hub 110 is readily apparent from the detailed description of structural hub 108 . housing 154 of structural hub 108 includes an interior side wall 158 and an exterior side wall 160 ( fig1 ) opposing and substantially parallel to interior side wall 158 . housing 154 further includes an upper side 162 substantially parallel to transverse axis t , a lower side 164 disposed at an angle relative to transverse axis t , front side 166 and back side 168 . other configurations are within the scope of the invention . exterior side wall 160 includes a carrying handle 170 formed integrally therewith and extending outwardly therefrom . carrying handle 170 includes a recess on its lower side for being gripped by the hand such that the infant product in deployed configuration 11 may be moved . carrying handle 170 is preferably positioned such that it is at or near the center of gravity of deployed configuration 11 when the infant is in the infant product . exterior side wall 160 further includes a detent 171 , formed as , for example , a slightly raised surface area , and an abutment portion 172 ( fig1 ) to position and releasably hold back leg 106 in compact folded configuration 16 , as discussed in more detail below . the upper end of back side 168 of housing 154 is adapted to fixedly mount end 124 of back rim tube 122 . for example , housing 154 may include hollow tubular projection 174 having a hollow tubular opening 175 to receive end 124 of back rim tube 122 . hollow tubular opening 175 extends though projection 174 and into the interior of housing 154 for a distance sufficient to adequately support back rim tube 122 , and has an inner diameter substantially equal to the outer diameter of end 124 of back rim tube 122 . end 124 of back rim tube 122 is slidably disposed within hollow tubular projection 174 and may be secured by a screw ( not shown ), for example . at upper side 162 of housing 154 is formed a channel 176 extending substantially parallel to transverse axis t and between front side 166 and back side 168 . end 118 of front rim tube 116 is pivotally secured to housing 154 within channel 176 by a known pivotal connector , such as , a pin . this pivotal attachment is represented in fig1 by pivot point p 1 . in deployed configuration 11 of the infant product , front rim tube 116 is positioned within channel 176 as shown so as to extend substantially parallel to transverse axis t . as discussed in greater detail below , to collapse the deployed infant product , front rim tube 116 is rotated about pivot point p 1 in the direction illustrated by the directional arrow d 1 . accordingly , to deploy the infant product , front rim tube 116 would be rotated from its compact folded configuration 16 in a direction opposite to directional arrow d 1 into deployed configuration 11 as shown . lower side 164 of housing 154 includes another channel 178 extending between front side 166 and back side 168 of housing 154 . channel 178 extends at an angle relative to transverse axis t . for example , this angle may be approximately 35 ° from transverse axis t . end 134 of front leg 104 is pivotally attached to housing 154 within channel 178 using any known pivotal connector . this pivotal attachment is illustrated by pivot point p 2 . to collapse the deployed infant product , front leg 104 is pivoted about pivot point p 2 in the direction illustrated by directional arrow d 2 until front leg 104 is disposed in a position opposing the position shown in fig1 ( i . e . 180 °), as will be discussed in greater detail below . referring now to fig1 , back leg brackets 112 , 114 will be discussed . back leg brackets 112 , 114 are disposed laterally on frame 100 and are mirror images of each other . accordingly , only back leg bracket 112 will be discussed in detail as the construction of back leg bracket 114 will be readily apparent from the discussion of back leg bracket 112 . back leg bracket 112 includes an exterior side wall 180 , an interior side wall 181 ( see also fig1 ), an upper end 182 , a lower end 184 , a front end 186 and a back end 188 . at upper end 182 it is formed a hollow tubular sleeve through which back rim tube 122 is slidably disposed . in corner 192 between lower end 184 and front end 186 is formed a channel 194 disposed at an angle , for example , 45 °, relative to transverse axis t to support back rim tube 122 . end 144 of back leg 106 is pivotally attached to back leg bracket 112 and is disposed within channel 194 when back leg 106 is disposed in deployed configuration 11 of the infant product . end 144 of back leg 106 is pivotally attached to back leg bracket 112 by any known pivotal connector . this pivotal connection is represented in fig1 by pivot point p 3 . as discussed in detail below , when deployed configuration 11 is collapsed , back leg 106 is pivoted about pivot point p 3 in the direction represented by directional arrow d 3 . accordingly , to position back leg 106 in deployed configuration 11 from compact folded configuration 16 , back leg 106 is moved in a direction opposite to the direction represented by directional arrow d 3 until its detents on detent 171 on exterior sidewall 160 of housing 154 . as discussed below , in compact folded configuration 16 , back leg 106 is disposed substantially parallel to back rim tube 122 . a detent 198 ( fig1 ) is also formed on interior side wall 181 of back leg bracket 112 to releasably secure front leg 104 in compact folded configuration 16 . for example , detent 198 may include a raised surface or a raised surface with a depression corresponding to the shape of front leg 104 . to properly and releasably position back leg 106 relative to back rim tube 122 in the deployed configuration , a spring or valco button connection 196 may be used . in particular , spring button connection 196 includes spring button 195 formed on end 144 of rear leg 106 that is spring biased in an extended position , and a hole 197 formed in exterior side wall 180 of back leg bracket 112 . as back leg 106 is rotated into its assembly configuration , spring button 195 will become aligned with hole 197 and engage or lock into hole 197 . therefore , rear leg 106 can be easily locked into its proper deployed position , yet is easily unlocked by simply depressing spring button 195 . although illustrated with a valco button , any suitable latching or locking mechanism can be used . referring now to fig1 - 9 and 15 - 21 , soft goods 200 in accordance with the invention will be discussed in detail . soft goods 200 generally include a bassinet shell 202 , a canopy 212 , and a removable pad 216 . referring to fig1 - 9 , bassinet shell 202 is constructed such that , in deployed configuration 11 , it is suspended from frame 100 and naturally falls into deployed bassinet configuration 12 due to its own weight and gravity as shown in fig1 for example . thus , bassinet shell 202 is preferably formed of pliable and / or foldable construction such that bassinet shell 202 is conveniently collapsed and folded into deployed bassinet configuration 12 . bassinet shell 202 is constructed such that infant recline / seat feature 222 can be incorporated into soft goods 200 and operated independently of frame 100 , as discussed in more detail later . by minimizing the connections between frame 100 and soft goods 200 , bassinet shell 202 can be folded - up into compact folded configuration 14 without having to disassemble or disconnect any parts , which is time consuming and inconvenient . bassinet shell 202 generally includes a front end 203 , a back end 201 , a bottom wall 204 , an annular side wall 206 , and structure to suspend bassinet shell 202 from frame 100 which may include a front tunnel 208 formed on upper annular edge 220 of annular side wall 206 at front end 203 of bassinet shell 202 , and a back tunnel 210 formed on upper annular edge 220 of annular side wall 206 at back end 201 of bassinet shell 202 . referring to fig9 and 16 , bottom wall 204 of bassinet shell 202 has a generally elliptical shape with an outer perimeter 218 , a front end 224 , a back end 226 , a top surface 228 and a bottom surface 230 . top surface 228 of bottom wall 240 as illustrated in fig1 and 16 , is shown with removable pad 216 removed . as discussed later , removable pad 216 is disposed on top surface 228 of bottom wall 240 . bottom wall 204 has a jointed rigid construction whereby a substantially rigid flat surface can be maintained in deployed bassinet configuration 12 ( fig1 - 4 ), however , which also can be repositioned into deployed infant seat configuration 14 ( fig5 - 9 ). in particular , with reference to fig1 a , bottom wall 204 is a multi - layer construction including flexible upper cover 232 , flexible lower cover 234 and front , intermediate , and back rigid panels 236 , 238 , 240 interposed between upper cover 232 and lower cover 234 . this rigid panel construction also has the advantage of providing a minimal weight bias ( relative to lightweight annular side wall 206 ) in bottom wall 204 which will help bassinet shell 202 naturally fall into deployed bassinet configuration 12 and provide a slight tension on annular side wall 206 . of course , this tension on annular side wall 206 is increased when the infant is placed in bassinet shell 202 . upper cover 232 is preferably made of an easily cleanable material such as vinyl . it includes a pair of laterally disposed v - shaped notches 246 , 248 of elastic material at back end 226 . lower cover 232 is made of a generally non - elastic cloth material and also has a pair of laterally disposed v - shaped notches 242 , 244 of elastic material at back end 226 . notches 242 , 244 , 246 , 248 are provided for purposes of infant recline / seat feature 222 , discussed in more detail below . front , intermediate , and back rigid panels 236 , 238 , 240 are flat , thin , rigid panels made of any type of rigid relatively lightweight material , such as , hardboard . front rigid panel 236 is semi - circular in shape , intermediate rigid panel 238 is rectangular in shape and back rigid panel 240 is a partial elliptical shape with laterally disposed v - shaped notches 258 , 260 . front , intermediate , and back rigid panels 236 , 238 and 240 are disposed in spaced relationship such that they may be rotated and folded unencumbered . also , seams 260 , 262 ( fig1 ) may be provided to separate rigid panels 236 , 238 , 240 to prevent displacement of rigid panels 236 , 238 , 240 . for example , back panel 240 in back end 226 of bottom wall 204 can be pivoted from deployed bassinet configuration 12 substantially parallel to transverse axis t , to deployed infant seat configuration , which is angled relative to transverse axis t , for example , 30 - 35 ° from transverse axis t . back rigid panel 240 is held in deployed infant seat configuration 14 by infant recline / seat feature 222 , as discussed in more detail below . annular sidewall 206 is attached to outer perimeter 218 of bottom wall 204 by , for example , stitching . annular sidewall 206 forms a lateral restraint for the infant in addition to contributing to suspending bottom wall 204 . annular sidewall 206 is formed of soft flexible material and may include a patchwork of solid cotton fabric panels 251 and breathable mesh fabric 252 . however , any type of material that will not scratch or injure an infant may be used . panels 251 may be formed of a solid cotton fabric for durability . as discussed later , annular sidewall 206 can be folded and formed into compact folded configuration 16 , yet serves as a semi - rigid wall for providing lateral support when under tension in deployed configuration 11 . front and back tunnels 208 , 210 ( fig1 ) are formed to suspend bassinet shell 202 from annular upper rim frame 102 . front and back tunnels 208 , 210 may be sewn onto upper annular edge 220 of annular side wall 206 or may be an extension of annular side wall 206 . front and back tunnels 208 , 210 may be formed of a soft material padded with batting to cushion around front rim tube 116 and back rim tube 122 . front and back tunnels 208 , 210 are constructed to form a front passageway in front tunnel 208 having open ends 264 , 266 and a back passageway in back tunnel 210 having open ends 268 , 270 ( fig4 ). accordingly , front rim tube 116 is threaded through the front passageway in front tunnel 208 and back rim tube 122 is threaded through the back passageway in back tunnel 210 . removable pad 216 is disposed on top surface 228 of bottom wall 204 of bassinet shell 202 and may include any conventional pad having a substantially elliptical shape corresponding to the shape of bassinet shell 202 . removable pad 216 may be made of a cloth material having a batting filling . crease 292 ( fig4 ) may be formed in removable pad 216 , for example , using a seam to provide flexibility for lateral edges 288 , 290 as discussed below with reference to fig1 a . a known nylon webbing three - point restraint may be incorporated into bassinet shell 202 to support the infant in deployed infant seat configuration 14 . although a particular embodiment of bassinet shell 202 has been described above , other configurations and materials may be used so long as , for example , the bassinet shell is suspended from the frame in a manner appropriate to support the infant in either of the bassinet and infant seat configurations and the bassinet shell is easily folded into compact folded configuration 16 along with frame 100 . referring now to fig1 - 19 , infant recline / seat feature 222 will now be described . in particular , fig1 , 18 and 18 a illustrate back end 226 of bottom wall 204 in deployed infant seat configuration 14 , whereas fig1 and fig1 b illustrate the deployed bassinet configuration 12 . infant recline / seat feature 222 includes a support strap assembly 214 of the type described for use with a stroller in u . s . pat . no . 5 , 590 , 896 issued jan . 7 , 1997 to the same assignee as the instant application and the disclosure of which is incorporated herein by reference . support strap assembly 214 includes straps 272 , 274 . each strap 272 , 274 includes an end 276 , 278 , respectively , attached to upper annular edge 220 of annular side wall 206 by a seam , for example . in addition , each strap 272 , 274 has an end 280 , 282 to which a connector is attached . the connector may include any conventional easy connect connector such as a buckle as shown . when straps 272 , 274 are connected to each other , they form a support raised above where bottom wall 204 of bassinet shell 202 would otherwise rest as illustrated by the comparison of fig1 a and 18b , for example . in use , back end 201 of bottom wall 204 is raised to an angled position and straps 272 , 274 are interconnected to support back end 201 of bottom wall 204 in deployed infant seat configuration 14 . as illustrated in fig1 and fig1 b , when straps 272 , 274 are not in use , they simply hang along side annular side wall 206 of bassinet shell 202 . once straps 272 , 274 have been disconnected , the back end of bassinet shell 202 naturally returns to bassinet configuration 12 due to its own weight and gravity . it is within the scope of the invention to raise and / or tilt bottom wall 204 of bassinet shell 202 in any manner desirable . for example , the front end of bassinet shell 202 may also include a strap and buckle connector that when joined will support front end 224 of bottom wall 204 of bassinet shell 202 in a raised position to provide an alternate seating position for the infant . a variety of known seat back recline mechanisms which could be adapted for use with the disclosed bassinet shell in ways apparent to the artisan . furthermore , in accordance with the invention and as also illustrated in fig1 , 16 , 16 a , 17 , 18 a and 18 c , the infant product may also be constructed to provide additional lateral support at the back end of bassinet shell 202 to cradle the upper end of the infant in the deployed infant seat configuration 14 . this may be accomplished , for example , through the use of straps 272 , 274 , just described , in combination with the v - shaped notches 242 , 244 , 246 , 248 of elastic material formed in lower cover 234 and upper cover 232 , respectively , and v - shaped notches 258 , 260 in rigid panel 240 of bottom wall 204 . accordingly , straps 272 , 274 can compress against and into bottom wall 204 to create lateral protuberances 271 , 273 ( fig1 a , 18c ) extending upwardly from otherwise planar back end 226 of bottom wall 204 . with protuberances 271 , 273 , the portion of bottom wall 204 corresponding to the upper body and head of an infant forms a v - shape or cradle ( fig1 a ). when removable pad 216 is positioned on bottom wall 204 , removable pad 216 conforms to the shape of bottom wall 204 , thereby also forming a cradle shown generally at 217 in fig1 a . crease 292 facilitates the displacement of lateral edges 288 , 290 of removable pad 216 . as illustrated in fig1 b , when straps 272 , 274 are not connected , removable pad 216 is substantially flat . this cradle feature may be implemented in variety of ways and is not limited to the structure described herein . for example , the back end 226 of bottom wall 204 may include a three - way fold , which may be implemented using a three - piece rigid back panel 240 . another way to provide lateral support for an infant , which also may be used in accordance with the invention , is described in the context of a stroller in u . s . pat . no . 5 , 441 , 328 issued aug . 15 , 1995 , which has the same assignee as the instant invention and the disclosure of which is incorporated herein by reference . referring now to fig1 and 19 - 21 canopy 212 will be discussed in detail . canopy 212 is attached to the back end of bassinet shell 202 and is convertible between an open tensioned position as shown , for example , in fig1 and a closed relaxed position shown , for example , in fig2 . canopy 212 generally includes fabric panel 300 , ribs or stays 302 , 304 and connectors 306 , 308 . fabric panel 300 can be made of any lightweight material or cloth that is generally inelastic . sewn into fabric panel 300 are sleeves 310 , 312 in spaced relationship into which stays 302 , 304 are threaded as illustrated in fig1 . accordingly , stays 302 , 304 are separated from each other . stays 302 , 304 may be made of resilient material such as extruded plastic . stays 302 , 304 , when inserted into sleeves 310 , 312 in fabric panel 300 hold the arcuate shape of canopy 212 . connector 306 may include any suitable mechanism for releasably coupling front edge 320 of fabric panel 300 to a supporting structure so as to place fabric panel 300 in tension . suitable connectors include buckles , hook - and - loop fasteners , zippers , magnetic catches , j - hooks , etc . canopy 212 is held in the open position by connectors 306 , 308 as illustrated in fig1 a and 20 . fig1 a shows connector 306 , for example , in a connected position and fig2 shows connector 306 in a released position . connectors 306 , 308 are identical , accordingly , only connector 306 is described in detail . connector 306 includes tab 314 of cloth material sewn to front edge 320 of fabric panel 300 , a male snap 316 provided on tab 314 , and a female snap 318 provided on bassinet shell 202 . accordingly , canopy 212 is held in the open tensioned position by engaging snaps 316 , 318 . when connectors 306 , 308 are released , canopy 212 is foldable into a flat configuration at back end 201 and rests along back rim tube 122 as illustrated in fig2 . canopy 212 in accordance with the invention may be used on any type of infant product . for example , as illustrated in fig2 a and 21b , canopy 212 may be provided on a conventional bouncer seat 400 . fig2 a shows canopy 412 in the flat closed position and fig2 b shows canopy 412 in the open expanded position . accordingly , it is within the scope of the invention to use the canopy in a variety of infant products . referring now to fig2 - 25 , the manner of converting frame 100 from deployed configuration 11 into compact folded configuration 16 will now be described . of course , the steps would be performed in reverse to convert from compact folded configuration 16 into deployed configuration 11 . to begin folding deployed configuration 11 , it does not matter whether bassinet shell 202 is in deployed bassinet configuration 12 or deployed infant seat configuration 14 . the method is a three - step folding process . first , front leg 104 is pivoted as illustrated by directional arrows in fig2 about 180 ° to its folded position at which point front leg 104 detents against back leg brackets 112 , 114 . referring now to fig2 , secondly , back leg 106 is pivoted about 100 ° into its folded position at which point side legs 130 , 132 detent against the exterior side wall of housings 154 , 156 of structural hubs 108 , 110 . finally , thirdly , referring to fig2 - 25 , front rim tube 116 is pivoted about 150 ° about structural hubs 108 , 110 until it is positioned substantially adjacent and rests on back rim tube 122 . fig2 - 29 show the same conversion , but with the finished product , i . e ., frame 100 and soft goods 200 . in the compact folded configuration 16 , the infant product includes a generally flat configuration having an end 500 and a handle 504 which is formed by back leg 106 . end 500 may be slidably disposed within a carrying case 502 as illustrated in fig3 . accordingly , handle 504 which extends outwardly from carrying case 562 can be used for carrying the infant product in compact folded configuration 16 . carrying case 502 may be formed of nylon material and is used to protect and keep clean the folded infant device . when carrying case 502 is not in use , it may be stored on bassinet shell 202 . in particular , a pocket may be formed , for example , by sewing on bottom surface 230 of bottom wall 204 of bassinet shell 202 . accordingly , carrying case 502 can be folded and slidably disposed within the pocket for storage during use of the infant product .

US-12084402-A

a cycloaliphatic diol antimicrobial agent selected from the group consisting of 1 , 1 - cyclohexanedimethanol , 1 , 2 - cyclohexanedimethanol , 1 , 4 - cyclohexanedimethanol , and 2 , 2 , 4 , 4 - tetramethyl - 1 , 3 - cyclobutanediol was found to provide antimicrobial activity in coating compositions and latexes , and was found to enhance the effectiveness of other antimicrobial agents commonly used in coatings and dispersions . alone or as part of a preservative system , this cycloaliphatic diol antimicrobial agent in water can provide an easy - to - handle liquid that allows coatings producers to achieve improved microbial control , or achieve equivalent control while using less antimicrobial agents in their formulations . consequently , the shelf life of the products can be maintained while reducing the use of the traditional preservative , or the shelf - life can be enhanced with addition of this cycloaliphatic diol antimicrobial agent to an existing antimicrobial system .

it has been surprisingly discovered that at least one cycloaliphatic diol antimicrobial agent selected from the group consisting of 1 , 1 - cyclohexanedimethanol , 1 , 2 - cyclohexanedimethanol ( 1 , 2 - chdm ), 1 , 4 - cyclohexanedimethanol ( 1 , 4 - chdm ), and 2 , 2 , 4 , 4 - tetramethyl - 1 , 3 - cyclobutanediol ( tmcbd ) is effective as an antimicrobial agent in water - based coating compositions . additionally , this cycloaliphatic diol antimicrobial agent can enhance the efficacy of traditional antimicrobial agents used in coatings . when used in combination , this new cycloaliphatic diol antimicrobial agent can allow for a reduction in the number and / or the concentration of the individual agents used in the coating composition . the traditional antimicrobial agents that can be used as part of the improved antimicrobial systems of the invention include those described by kappock in “ biocides in wet state and dry film ,” handbook of coatings additives , pp . 272 - 75 ( 2d ed . 2004 ); which is hereby incorporated by reference . for example , the cycloaliphatic diol antimicrobial agents can enhance the antimicrobial activity of the more commonly used coating antimicrobial agents , including methylisothiazolinone ( mit ), chloromethylisothiazolinone , benzisothiazolinone ( bit ), 1 , 2 - dibromo - 2 , 4 - dicyanobutane , and 2 - bromo - 2 - nitropropane - 1 , 3 - diol . in one embodiment , the cycloaliphatic diol antimicrobial agents are a mixture of cis and trans isomers . for example , 1 , 4 - chdm can have a cis - to - trans ratio of about 31 / 69 . thus , in one embodiment , the present invention provides a coating composition comprising : ( a ) at least one cycloaliphatic diol antimicrobial agent selected from the group consisting of 1 , 1 - cyclohexanedimethanol , 1 , 2 - cyclohexanedimethanol , 1 , 4 - cyclohexanedimethanol , and 2 , 2 , 4 , 4 - tetramethyl - 1 , 3 - cyclobutanediol in an amount effective to reduce or inhibit microbial growth in the coating composition ; the amount of the cycloaliphatic diol antimicrobial agent used can vary , depending on several factors including the degree of antimicrobial protection desired , the extent of possible exposure to microbial contaminants , and the compatibility of the cycloaliphatic diol antimicrobial agent with the other ingredients in the coating composition . typically , the amount of the cycloaliphatic diol antimicrobial agent present in the coating composition will be in the range of about 0 . 1 to about 5 weight percent , based on the weight of the coating composition . preferably , the cycloaliphatic diol antimicrobial agent is present in the range of about 0 . 3 to about 4 weight percent , based on the weight of the coating composition . other ranges are from about 0 . 5 to about 4 , and about 1 to about 3 . 5 . the coating composition according to the invention contains water . water is typically present in an amount ranging from 40 to 70 weight percent , based on the weight of the coating composition . the binder in the coating composition of the invention refers to a film forming component . the binder imparts adhesion ; binds the pigments , if present , together ; and influences the properties of the resulting coating such as gloss , durability , flexibility , and toughness . the binders can be natural or synthetic resins such as acrylics , polyurethanes , polyesters , melamine resins , epoxy , and oils . in one embodiment , the binder comprises polymeric particles such as those used in latex paints . the coating composition typically contains from 30 to 60 weight percent of the binder , based on the weight of the coating composition . the coating composition of the invention can include pigments or dyes . the pigment can be present in an amount of 30 to 60 weight percent , based on the total weight of the composition . examples of suitable pigments include titanium dioxide , barytes , clay , calcium carbonate , ci pigment white 6 ( titanium dioxide ), ci pigment red 101 ( red iron oxide ), ci pigment yellow 42 , ci pigment blue 15 , 15 : 1 , 15 : 2 , 15 : 3 , 15 : 4 ( copper phthalocyanines ); ci pigment red 49 : 1 , and ci pigment red 57 : 1 . the coating composition of the invention can also include one or more other additives , such as , catalysts , thickeners , stabilizers , emulsifiers , texturizers , adhesion promoters , uv stabilizers , flatteners , flow control agents , extenders , plasticizers , pigment wetting agents , pigment dispersing agents , defoaming agents , antifoaming agents , anti - settling agents , anti - sag agents , and corrosion inhibitors . the coating composition may also contain from 0 to 30 weight percent , based on the total weight of the coating composition , of a water - miscible organic solvent . examples of such solvents include , but are not limited to , ethanol , n - propanol , isopropanol , n - butanol , sec - butanol , isobutanol , ethylene glycol , monobutyl ether , propylene glycol n - butyl ether , propylene glycol methyl ether , propylene glycol monopropyl ether , dipropylene glycol methyl ether , and diethylene glycol monobutyl ether . the coating composition of the invention can be formulated to be a flat and non - flat wall coating , primer , wash primer , sealer , undercoater , floor coating , roof coating , bond breaker coating , concrete curing compound , driveway sealer , dry fog coating , faux finish coating , form release compound , industrial maintenance coating , lacquer , mastic texture coating , enamel coating , rust preventative coating , sanding sealer , stain , swimming pool coating , traffic marking coating , varnish , waterproofing sealer , or wood preservative . the cycloaliphatic diol antimicrobial agent may be used alone or in combination with one or more additional antimicrobial agents in the coating composition of the present invention . the cycloaliphatic diol antimicrobial agent can provide an antimicrobial enhancement effect at concentrations ranging from about 0 . 1 to about 5 weight percent , based on the weight of the coating composition . in another embodiment of the invention , the cycloaliphatic diol antimicrobial agent is present in the range of about 0 . 3 to about 4 weight percent , based on the weight of the coating composition . other ranges are from about 0 . 5 to about 4 , and about 1 to about 3 . 5 . the upper concentration range would be limited by the compatibility of other ingredients of the coating composition with the cycloaliphatic diol antimicrobial agent . in another embodiment of the invention , the concentration range of the cycloaliphatic diol antimicrobial agent when used in combination with other antimicrobial agents is from 0 . 4 to 3 weight percent , based on the weight of the coating composition . the other antimicrobial agents or second antimicrobial agents that can be used as part of the improved antimicrobial systems of the invention include those described by kappock in “ biocides in wet state and dry film ,” handbook of coatings additives , pp . 272 - 75 ( 2d ed . 2004 ), which is herein incorporated by reference . such second antimicrobial agents include methylisothiazolinone ( mit ), chloromethylisothiazolinone , benzisothiazolinone ( bit ), 1 , 2 - dibromo - 2 , 4 - dicyanobutane , and 2 - bromo - 2 - nitropropane - 1 , 3 - diol . the concentration range for mit can range about 0 . 0005 to about 0 . 020 weight percent , from about 0 . 0010 to about 0 . 010 , and from about 0 . 0015 to about 0 . 005 , based on the weight of the coating composition . the concentration range for bit can range about 0 . 0005 to about 0 . 20 , from about 0 . 0010 to about 0 . 10 , and from about 0 . 0015 to about 0 . 05 , based on the weight of the coating composition . the concentration ranges for the other or second antimicrobial agents can be obtained from their respective suppliers , keeping in mind that the agents can be used at the lower end or even below the suggested usage range when used in combination with the cycloaliphatic diol antimicrobial agent . also , the agents can be used in combination with one another and with the cycloaliphatic diol antimicrobial agent as an antimicrobial system , to boost the combined efficacy against a variety of microorganisms ; as some agents are known to be more effective against specific types of microorganisms , e . g ., gram - negative bacteria , gram - positive bacteria , molds , and / or yeast . thus , in another embodiment , the invention provides a coating composition comprising : ( a ) an antimicrobial system comprising at least one cycloaliphatic diol antimicrobial agent selected from the group consisting of 1 , 1 - cyclohexanedimethanol , 1 , 2 - cyclohexanedimethanol , 1 , 4 - cyclohexanedimethanol , and 2 , 2 , 4 , 4 - tetramethyl - 1 , 3 - cyclobutanediol and at least one second antimicrobial agent ; wherein the antimicrobial system is present in an amount effective to reduce or inhibit microbial growth in the coating composition . in another embodiment , the invention provides a method for reducing or inhibiting microbial growth in a coating composition , comprising : adding a cycloaliphatic diol antimicrobial agent selected from the group consisting of 1 , 1 - cyclohexanedimethanol , 1 , 2 - cyclohexanedimethanol , 1 , 4 - cyclohexanedimethanol , and 2 , 2 , 4 , 4 - tetramethyl - 1 , 3 - cyclobutanediol to a coating composition comprising water and a binder , in an amount effective to reduce or inhibit microbial growth in the coating composition . in another embodiment , the invention provides a method for reducing or inhibiting microbial growth in a coating composition , comprising : adding an antimicrobial system comprising at least one cycloaliphatic diol antimicrobial agent selected from the group consisting of 1 , 1 - cyclohexanedimethanol , 1 , 2 - cyclohexanedimethanol , 1 , 4 - cyclohexanedimethanol , and 2 , 2 , 4 , 4 - tetramethyl - 1 , 3 - cyclobutanediol and at least one second antimicrobial agent , to a coating composition comprising water and a binder , in an amount effective to reduce or inhibit microbial growth in the coating composition . the manner in which the cycloaliphatic diol antimicrobial agent is added to the coating composition is not particularly limiting . for example , the cycloaliphatic diol antimicrobial agent may be added to the coating composition by simply combining it with the composition and mixing the ingredients . alternatively , the cycloaliphatic diol antimicrobial agent , due to its high solubilizing power , may be used as a solvent for one or more of the ingredients of the coating composition before it is mixed with the remainder of the composition ingredients . the 1 , 4 - chdm antimicrobial agent itself is a soft solid at room temperature . therefore , to provide the 1 , 4 - chdm antimicrobial agent in liquid form , facilitating mixing and / or handling , it may first be diluted with up to 10 wt % or more of water before it is combined with the coating composition or the ingredients thereof . this invention can be further illustrated by the following examples of preferred embodiments thereof , although it will be understood that these examples are included merely for purposes of illustration and are not intended to limit the scope of the invention . unless otherwise indicated , all percentages are based on weight , and all weight percentages are based on the total weight of the composition . a test of the antimicrobial efficacy of 1 , 4 - chdm was performed in a paint . test procedures were generally performed according to those of astm d2574 - 06 : standard test method for resistance of emulsion paints in the container to attack by microorganisms . the paint used for testing was a commercial water - based , interior latex flat wall paint purchased from wal - mart . the trade name for the paint was quik hide . the color was off white 26905 . a five gallon ( 18 . 9 l ) container was purchased . the voc ( volatile organic compound ) content was listed as & lt ; 100 g / l ( 0 . 8 lbs / gal ). the ingredients listed on the paint label are listed in table 1 . aliquots of uninoculated paint were distributed in sterile plastic tubes . the volume of paint added was adjusted such that the volume of additives plus the volume of paint would equal 25 ml . samples were prepared by adding individually or in combination chdm - d90 ( 1 , 4 - chdm , 90 % w / w in water ), 1 , 3 - chdm ( 100 %), bit ( proxel gxl , 20 % active ; arch ), mit ( acticide m20s , 20 % active ; thor specialties , inc . ), tmcd ( 2 , 2 , 4 , 4 - tetramethyl - 1 , 3 - cyclobutanediol ), pg ( propylene glycol ), and disodium ethylenediaminetetraacetic acid dihydrate ( edta ) as listed in table 2 to produce test paint samples . the percentages shown in table 2 are weight percentages . the concentration of the additives in the paint was adjusted to allow for a final volume of 28 ml per tube after addition of inoculum . all tubes were mixed for 10 minutes on a mechanical shaker set to 75 shakes per minute , and then left stationary at ambient temperature for a minimum of 48 hours . the bacteria ( first five in list ), yeast ( c . albicans ) and fungi ( a . niger ) in table 3 were used as challenge organisms for testing the antimicrobial efficacy of the additives contained in the test paint samples . each organism was isolated from previous naturally contaminated samples of paint , latex , or adhesive . the concentration of each organism ( colony - forming unit / gram ( cfu / g )) in the test paint samples added as inoculum is also given in table 3 . bacterial cultures were grown at 35 ° c .± 2 ° c . for a minimum of 96 hours in liquid media . srb was grown in a thioglycolate broth . all other bacteria and c . albicans were grown in a trypticase soy broth with 1 % dextrose . c . albicans cultures were grown at 22 ° c .± 2 ° c . for a minimum of 96 hours . a . niger was grown on the sabouraud dextrose agar ( sda ) and in the trypticase soy broth with 1 % dextrose at 22 ° c . for 7 to 14 days or until full sporulation ( in the case of the agar culture ) was achieved . spores from the plate culture of a . niger were dislodged by rubbing the growth gently with a sterile inoculating loop or removing it with a sterile glass impinger . the spores were added into the broth culture , and then the mixture was filtered through sterile nonabsorbent cotton and adjusted to a spore level of 1 . 0 × 10 8 using a hemocytometer . challenge organisms were initially acclimated to the paint without additives by adding 10 % by volume of individual broth culture to the paint to yield final concentrations of 10 6 - 10 7 cfu / ml for each bacterial culture to produce paint stock cultures . the a . niger and c . albicans cultures ( or suspension ) were first poured through nonabsorbent sterile gauze to remove aggregates , then centrifuged . the solids were re - suspended to the desired concentration in the paint by estimating the concentration using a hemocytometer . samples were incubated at 35 ° c .± 2 ° c . for bacteria and at 22 ° c .± 2 ° c . for a . niger and c . albicans . samples of these paint stock cultures were dilution - plated as described below for verification of organism concentration , and to rule out contamination . to these prepared test paint samples ( paint + additives ), 3 ml of each paint stock culture ( diluted as necessary ) was added to produce a theoretical 1 . 0 × 10 5 to 1 . 0 × 10 6 cfu / ml total concentration of challenge organisms to produce inoculated paint samples . prior to dilution , the paint stock cultures of c . albicans and a . niger were again filtered through sterile gauze , centrifuged to collect solids , and re - suspended as described above . dilutions of the paint stock cultures and inoculated paint samples were plated as described below to verify challenge levels . inoculated paint samples were maintained at 35 ° c .± 2 ° c . for 14 days and ambient room temperature after 14 days . the inoculated paint samples were again inoculated with the same paint stock cultures on day 5 to yield the same concentration of organisms as the day zero inoculation . the paint stock cultures and inoculated paint samples were dilution plated at 14 , 30 , and 60 days to determine the concentration of viable challenge organisms . the samples inoculated with bacteria , except the srb samples , were dilution - plated onto plate count agar ( pca ), and the plates were incubated at 35 ° c .± 2 ° c . in a humidified incubator . a . niger and c . albicans were subcultured onto sda and incubated at 22 ° c .± 2 ° c . in a humidified incubator . the samples challenged with srb were tested by performing a log dilution series of 1 : 10 through 1 : 100 , 000 in a commercially available test kit ( bacti - bottles ® ( difco )). the paint stock cultures and inoculated paint samples were tested with an iodonitrotetrazolium formazan ( int ; vital stain ) and / or gram stain prior to reporting as negative . whenever contamination was suspected , the identity of the microorganisms was confirmed by gram staining or cotton blue staining . serial dilutions for plate count determination of culture concentrations were performed as follows . using a sterile pipette , 1 ml of the growth from each inoculated paint sample was transferred into tubes of 9 ml sterile distilled water and mixed thoroughly . this process was serially repeated to prepare dilutions from 10 − 1 to 10 − 8 . subsequently , 0 . 1 ml of each sample or its dilution was spread onto three plate count agar plates . after & gt ; 48 hours of incubation ( at 35 ° c .± 2 ° c . for bacteria and 22 ° c .± 2 ° c . for fungi and yeast ) in a humidified incubator , the plates were counted and recorded with the corresponding dilution . if counting had to be delayed , plates were refrigerated , until they could be counted . plate counts were computed from dilutions that produced between 22 - 220 counts per plate . the counts were reported to the first two significant digits . if all plates had more bacterial colonies than could be counted , results were recorded as greater than maximum countable limit of the plates of dilution with the least number of colonies . srb viable cell concentrations were estimated by determining the greatest dilution at which positive growth ( blackening ) was observed in the bacti - bottle . the results of the testing are shown in table 4 . the duplicate results for each example were averaged . as seen in table 4 , there was growth and / or survival of each of the challenge organisms in the paint . in the presence of 1 , 4 - chdm ( runs 8 - 11 ), there was significant or complete killing of each challenge organism . there was a dose response associated with 1 , 4 - chdm for each organism . tmcd also killed all challenge organisms at the highest level tested ( run 16 ) and showed a dose response across the four levels tested ( runs 16 - 19 ). there was little benefit and no observable dose response for addition of the 1 , 3 - isomer of chdm ( runs 12 - 15 ) or propylene glycol ( runs 20 - 23 ). the combination of bit and 1 , 4 - chdm showed synergistic ( greater than additive ) response with respect to e . coli , aeromonas sp ., b . subtilis , and c . albicans in that there was substantially improved efficacy over the addition of either additive separately ( runs 24 - 29 ). similarly , the combination of tmcd and bit also showed synergism in control of e . coli , aeromonas sp ., b . subtilis , c . albicans , and a . niger in that there was substantially improved efficacy over the addition of either additive separately ( runs 42 - 47 ). the combination of bit / mit and 1 , 4 - chdm showed synergistic response for control of e . coli , aeromonas sp ., b . subtilis , c . albicans , and a . niger in that there was substantially improved efficacy over the addition of either additive separately ( runs 30 - 35 ). the combination of 1 , 4 - chdm , edta , and bit showed synergistic response for control of e . coli , aeromonas sp ., b . subtilis , c . albicans , and a . niger though the absence of a control with edta alone makes this assessment less confident . in contrast to the strong additive effects and synergistic activity of 1 , 4 - chdm and tmcd with bit , there were no such effects apparent for the combination of pg and bit ( runs 48 - 53 ). a test of the antimicrobial efficacy of 1 , 4 - chdm was performed in a latex dispersion . test procedures were generally conducted according to those of astm d2574 - 06 : standard test method for resistance of emulsion latexes in the container to attack by microorganisms . an antimicrobial agent - free , acrylic latex dispersion with ph of 7 . 2 , viscosity of 200 cps , and solids content of 49 . 8 % was used as the substrate for microbial challenge testing . aliquots of the latex dispersion were distributed in sterile plastic tubes . the volume of latex added was adjusted such that the volume of additives plus the volume of latex would equal 25 ml to produce latex test samples . the paint test samples were prepared by adding individually or in combination chdm - d90 ( 1 , 4 - chdm , 90 % w / w in water ), 1 , 3 - chdm ( 100 %), bit ( proxel gxl , 20 % active ; arch chemicals ), mit ( acticide m20s , 20 % active ; thor specialties , inc . ), ipbc ( 3 - iodo - 2 - propanyl - n - butylcarbamate ; acticide ips20 , 20 % active ; thor specialties , inc . ), pg ( propylene glycol ), and disodium ethylenediaminetetraacetic acid dihydrate ( edta ) as listed in table 5 . the concentration of the additives was adjusted to allow for a final volume of 28 ml per tube after addition of the latex stock cultures discussed in example 1 . all tubes were mixed for 10 minutes on a mechanical shaker set to 75 shakes per minute , and then left stationary at ambient temperature for a minimum of 48 hours . the bacteria ( sulfate - reducing bacteria isolate , bacillus subtilis , and pseudomonas aeruginosa ), yeast ( candida albicans ), and fungi ( aspergillus niger ) in table 6 were used as challenge organisms for testing the antimicrobial efficacy of the test latex samples . each organism was isolated from previous naturally contaminated samples of paint , latex , or adhesive . the concentration of each organism in the latex test samples added as inoculums is also given in table 6 . bacterial cultures were grown at 35 ° c .± 2 ° c . for a minimum of 96 hours in liquid media . srb was grown in a thioglycolate broth . all other bacteria and c . albicans were grown in a trypticase soy broth with 1 % dextrose . c . albicans cultures were grown at 22 ° c .± 2 ° c . for a minimum of 96 hours . a . niger was grown on the sabouraud dextrose agar and in the trypticase soy broth with 1 % dextrose at 22 ° c . for 7 to 14 days or until full sporulation ( in the case of the agar culture ) was achieved . spores from the plate culture of a . niger were dislodged by rubbing the growth gently with a sterile inoculating loop or removing it with a sterile glass impinger . the spores were added into the broth culture , and then the mixture was filtered through sterile nonabsorbent cotton and adjusted to a spore level of 1 . 0 × 10 8 using a hemocytometer . challenge organisms were initially acclimated to the latex without antimicrobial additives by adding 10 % by volume of individual broth culture to latex to yield final concentrations of 10 6 - 10 7 cfu / ml for each bacterial culture to produce latex stock cultures . the a . niger and c . albicans cultures ( or suspension ) were first poured through nonabsorbent sterile gauze to remove aggregates then centrifuged . the solids were re - suspended to the desired concentration in latex by estimating the concentration using a hemocytometer . the p . aeruginosa and c . albicans isolates were originally found as a mixed culture in a contaminated product . a mixed latex stock culture containing p . aeruginosa and c . albicans was prepared by adding a portion of the contaminated product to the latex without antimicrobial additives . the latex stock culture samples were incubated at 35 ° c .± 2 ° c . for bacteria and at 22 ° c .± 2 ° c . for a . niger and c . albicans . to determine challenge organism concentration , samples of the latex stock cultures were dilution - plated , or for srb , evaluated using the bacti - bottle method , as described below . to the latex test samples , 3 ml of each latex stock culture ( diluted as necessary ) was added to produce a theoretical 1 . 0 × 10 5 to 1 . 0 × 10 6 cfu / ml total concentration to yield inoculated latex samples . prior to dilution the latex stock cultures of c . albicans and a . niger were again filtered through sterile gauze , centrifuged to collect solids , and re - suspended as described above . dilutions of the latex stock cultures were plated as described below to verify challenge levels . inoculated latex samples were maintained at 35 ° c .± 2 ° c . for 14 days and ambient room temperature after 14 days . the samples were again inoculated with the same latex stock cultures on day 5 to yield the same concentration of organisms as the day zero inoculation . the latex stock cultures and latex test samples were dilution plated at 7 , 14 , 30 , and 60 days to determine the concentration of viable challenge organisms . the samples inoculated with bacteria , except the srb samples , were dilution - plated onto pca , and the plates were incubated at 35 ° c .± 2 ° c . in a humidified incubator . a . niger and c . albicans were subcultured onto sabouraud dextrose agar and incubated at 22 ° c .± 2 ° c . in a humidified incubator . the samples challenged with srb were tested by performing a log dilution series of 1 : 10 through 1 : 1000 in a commercially available test kit ( bacti - bottles ® ( difco )). all latex stock cultures were tested with an iodonitrotetrazolium formazan ( int ; vital stain ) and / or gram stain prior to reporting as negative . whenever contamination was suspected , the identity of the microorganisms was confirmed by gram staining or cotton blue staining . serial dilutions for plate count determination of culture concentrations were performed as follows . using a sterile pipette , 1 ml of the growth from each inoculated latex sample was transferred into tubes of 9 ml sterile distilled water and mixed thoroughly . this process was serially repeated to prepare dilutions from 10 − 1 to 10 − 8 . subsequently , 0 . 1 ml of each sample or its dilution was spread onto three plate count agar plates . after & gt ; 48 hours of incubation ( at 35 ° c .± 2 ° c . for bacteria and 22 ° c .± 2 ° c . for fungi and yeast ) in a humidified incubator , the plates were counted and recorded with corresponding dilution . if counting had to be delayed , plates were refrigerated until they could be counted . plate counts were computed from dilutions that produced between 22 - 220 counts per plate . the counts were reported to the first two significant digits . if all plates had more bacterial colonies than could be counted , the results were recorded as greater than maximum countable limit of the plates of dilution with the least number of colonies . srb viable cell concentrations were estimated by determining the greatest dilution at which positive growth ( blackening ) was observed in the bacti - bottle . the results of the testing are shown in table 7 . the duplicate results for each example were averaged . “ nd ” in the table means no data was obtained . as seen in table 7 , there was growth and / or survival of each of the challenge organisms in the latex test samples . in the presence of 1 , 4 - chdm ( runs 2 - 5 ), there was significant or complete killing of each challenge organism except srb . there was a dose response associated with 1 , 4 - chdm for each organism except srb . propylene glycol ( runs 6 - 9 ) at the same concentrations as 1 , 4 - chdm showed some ability to inhibit and kill the challenge organisms , but in each case , other than for srb , to a lesser degree than 1 , 4 - chdm . there was improved efficacy of 1 , 4 - chdm with the addition of edta ( runs 10 - 12 ), when compared to 1 , 4 - chdm or edta ( run 45 ) alone . this was particularly the case for control of b . subtilis , c . albicans , and the mixture of p . aeruginosa / c . albicans . bit and mit ( runs 39 - 44 ) were highly efficacious in control of all challenge organisms with the exception of srb . because there was little or no survival of challenge organisms in the presence of bit , mit , or bit / mit , it was not possible to detect a benefit of adding 1 , 4 - chdm ( runs 13 - 32 ) at these concentrations of bit , mit , and bit / mit . finally , ipbc was not found to be efficacious at the concentration tested ( run 47 ). the combination of 1 , 4 - chdm and ipbc provided little or no benefit over addition of 1 , 4 - chdm alone ( runs 48 - 50 ). the antimicrobial activities of 1 , 4 - cyclohexanedimethanol ( 1 , 4 - chdm ) and 1 , 1 - cyclohexanedimethanol ( 1 , 1 - chdm ) have been determined . each activity was calculated in terms of a minimum inhibitory concentration ( mic ), revealing the lowest concentration necessary to inhibit visible growth . mics were individually calculated for three consecutive days with both 1 , 1 - cyclohexanedimethanol and the 31 % cis : 69 % trans mixture of 1 , 4 - cyclohexanedimethanol . both compounds were evaluated against a panel of five strains of microorganisms . 1 , 1 - chdm afforded significant improvement in efficacy over 1 , 4 - chdm with correlation between different organisms . higher antimicrobial activity can allow for reduced concentrations and volumes of chdm during coating formulation . reducing the amount of chdm can minimize the impact on the properties of the coating being formulated while retaining comparable activity and can also reduce costs by producing less material with the same net activity . strains p . aeruginosa , c . albicans , e . coli , a . niger and s . aureus were purchased from the american type culture collection ( manassas , va .). nunc flat bottom polystyrene 96 well microtiter plates ( nunc cat # 269787 ), and 17 × 100 mm culture tubes ( vwr cat # 60818 - 703 ) were purchased from vwr international , llc ( west chester , pa .). eastman chdm - d90 and 1 , 1 - chdm (& gt ; 99 . 7 % by gc and verified by nmr ) were provided by eastman chemical company ( kingsport , tenn .). all bacterial cultures were grown in bd bbl trypticase soy broth , and all fungal cultures were grown in sabourand dextrose broth purchased from vwr international , llc ( west chester , pa .). absorbance measurements were taken with a tecan genios pro microplate reader . a small loopful of inoculum was transferred from a freshly streaked agar plate of each strain to 5 ml of sterile media in a 17 × 100 mm culture tube . the tubes were incubated without shaking at the appropriate temperature and in the appropriate medium as listed in table 8 . the bacteria were incubated for 20 - 28 hours and c . albicans for 44 - 52 hours . the procedure for a . niger was significantly different . a . niger was cultured on sabourand dextrose agar plates until a heavy concentration of black spores were visibly apparent . spores were harvested from the plate by suspension in 3 ml of sabourand dextrose broth utilizing a sterile plastic spreader and sterile transfer pipette . stock solutions were prepared for each isomer in the corresponding growth media at a concentration of 5 % w / v ( 1 , 4 - chdm ) or 2 . 25 % w / v ( 1 , 1 - chdm ). serial dilutions were prepared with a dilution ratio of 1 : 1 . 3333 such that one log range was covered with nine dilutions . two - hundred microliters of each chdm concentration was transferred into 4 wells of a sterile 96 - well plate . four extra wells of the highest concentration were filled for the uninoculated high - level controls . eight additional wells were filled with only sterile broth to serve as negative and positive controls . three of the four wells for each chdm concentration were inoculated with one of the test strains listed in table 8 . the last well of each chdm isomer dilution was left uninoculated to serve as controls for background turbidity associated with test compounds . plates with bacteria or c . albicans were inoculated with 2 μl of seed culture for final concentration of roughly 10 6 cfu / ml for the bacteria and 10 5 cfu / ml for the c . albicans . plates with a . niger were inoculated with 2 μl of spore suspension prepared above . each plate was covered and incubated at the appropriate temperature and turbidity as a measure of cell density was determined via absorbance measurement at 612 nm using a microplate reader . measurements were taken at 24 , 48 and 72 hours for each plate . the raw data was exported into an excel spreadsheet and the mic values were determined and expressed as wt %. the absorbance of each inoculated chdm well was retrieved by first subtracting out the average reading for each uninoculated well , then by comparison to a positive threshold to determine positive or negative status for growth . the positive threshold was calculated by multiplication of the average absorbance for the inoculated media - only wells by 0 . 05 . the mic was determined as the lowest test concentration resulting in all three replicate wells displaying values below the positive threshold . 1 , 1 - cyclohexanedimethanol exhibited a measurable increase in antimicrobial efficacy over that of 1 , 4 - cyclohexanedimethanol . antimicrobial efficacy increased against four of the five test organisms in these experiments . the solubility of 1 , 1 - chdm was limited to 2 . 25 % ( w / v ) in aqueous growth media , therefore comprehensive mic results were limited to the range of 0 - 2 . 25 %. final results have been summarized below in table 9 . these results show that 1 , 1 - chdm can be a more effective antimicrobial agent than its structural isomer 1 , 4 - chdm as shown by the lower mic values . the invention has been described in detail with particular reference to preferred embodiments thereof , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention .

US-77916110-A

a manually operated beverage maker and dispenser includes : a receptacle having an upper opening ; a manually operable air pump separate from and attached to the receptacle ; and an air passage from the air pump to the receptacle . the air passage is equipped with one - way valve for permitting air to pass from the air pump to the receptacle while preventing flow of fluids from the receptacle towards the air pump .

in one embodiment , the present invention comprises a beverage making device ( 10 ) comprising a receptacle ( 12 ) having an upper opening ( 14 ) and a separate but attached air pump ( 16 ). an air passage ( 18 ) connects the air pump to the receptacle and includes a one - way valve ( 22 ) which permits air to be pumped into the receptacle , while the opposite flow of fluids from the receptacle is prevented . a second intake one - way valve ( 20 ) for allowing the air pump to be filled with air may be positioned leading to the air outlet ( 24 ) into the receptacle . in an alternative embodiment , the intake one - way valve ( 20 ) may be included in the air pump ( 16 ) or piston ( 30 ) itself , and may not be necessary in the air passage ( 18 ). what is necessary is that the air pump ( 16 ) draw in air from outside the device , and when actuated , the air pump ( 16 ) discharges air into the receptacle ( 12 ). in one embodiment , the air passage ( 18 ) may be a transverse air passage tube which connects the air pump ( 16 ) to the receptacle ( 12 ), while holding the air pump ( 16 ) apart from the receptacle ( 12 ). in this fashion , the air pump ( 16 ) may serve as a handle for the device . in one embodiment , a lower connector ( 26 ) may more securely attach the air pump ( 16 ) to the receptacle , to reduce the physical stress on the transverse air passage ( 18 ). in an alternative embodiment , the air pump ( 16 ) may be closely integrated with the receptacle ( 12 ), as is shown in fig2 b . the air pump ( 16 ) is separate from receptacle , but is physically integrated into the receptacle . in any example , the air pump ( 16 ) may comprise any device which pumps air in one direction , such as a pump including a reciprocating plunger within an elongated cylinder , a flexible bladder pump , or a rotating vane or impeller pump . a filter assembly ( 28 ) is configured to securely attach to and cover the upper opening . in one embodiment , the filter ( 28 ) may comprise a reinforcing screen and a filter element , such as a disposable paper element . in another embodiment , the filter ( 28 ) may comprise a reusable fine metal or plastic mesh . the filter fits securely to the receptacle ( 12 ) such as by friction fit , or by a threaded connection , or some other physical connection . in one embodiment , the filter may be sufficiently restrictive as to substantially prevent the beverage from passing through the filter when the device is oriented with the filter assembly ( 28 ) at the bottom , in the absence of pressure from within the receptacle ( 12 ). in use , the receptacle ( 12 ) is filled with the solid material with which the beverage is made , such as coffee grounds or tea leaves , and hot water , as shown in fig1 , or only water or some other liquid in some examples . the air pump ( 16 ) is fully retracted in that the piston ( 30 ) is at its upper end of travel . in such a configuration , the receptacle may sit stably on a flat surface as the air pump does not extend beyond the height of the receptacle . once the beverage is ready to be dispensed or consumed , the device is turned upside down above a beverage mug or glass , and the air pump ( 16 ) is primed by withdrawing the piston ( 30 ), such that air enters the air pump , the piston ( 30 ) can then be activated to push air into the receptacle ( 12 ) through valve ( 22 ). the beverage is then pushed out by the elevated pressure in the receptacle , through the filter ( 28 ) and into the beverage mug or glass . in one alternative embodiment , the filter assembly ( 28 ) is adapted with accessory mounts ( 32 ) which permits the attachment of an accessory unit ( 34 ). for example , the accessory mounts ( 32 ) and the accessory unit ( 34 ) may have complementary threads so as to allow them to be threaded together , or some other attachment mechanism which allows convenient attachment and disengagement . in one embodiment , the accessory unit may comprise a water purification module or a pre - packaged beverage mix , such as a single use coffee pod . water purification modules may comprise activated charcoal filters and / or purification membranes or filters . as is known in the art , a single use coffee pod comprises coffee grounds packaged in a small pod which filters the coffee as water passes through the pod , and includes k - cups ™ and other commercially available pods . in such an alternative embodiment , the filter assembly ( 28 ) need not necessarily include a screen or filter , as the filter element may be included in the accessory unit . alternatively , the filter assembly ( 28 ) itself may comprise the purification filter or membrane , or include the beverage making solid . in one embodiment , as shown in fig4 , the accessory unit ( 34 ) comprises a k - cup ™ adapter which holds the rigid plastic k - cup up against the filter assembly ( 28 ). any cuts or openings to the pod required may be manually made before use . in one embodiment , as shown in fig5 , the filter assembly may support or include a member , such as a supporting circumferential flange ( 40 ), which allows the device to stably rest on top of a mug . the present invention is not intended to be limited by the type of beverage which it may dispense . the beverage may simply be water which is filtered by the device ( 10 ). the device may be used to make any beverage which is made with or from any solid material , such as coffee , tea , herbal drinks or medications and the like . the description of the present invention has been presented for purposes of illustration and description , but it is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . embodiments were chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . the corresponding structures , materials , acts , and equivalents of all means or steps plus function elements in the claims appended to this specification are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . references in the specification to “ one embodiment ”, “ an embodiment ”, etc ., indicate that the embodiment described may include a particular aspect , feature , structure , or characteristic , but not every embodiment necessarily includes that aspect , feature , structure , or characteristic . moreover , such phrases may , but do not necessarily , refer to the same embodiment referred to in other portions of the specification . further , when a particular aspect , feature , structure , or characteristic is described in connection with an embodiment , it is within the knowledge of one skilled in the art to combine , affect or connect such aspect , feature , structure , or characteristic with other embodiments , whether or not such connection or combination is explicitly described . in other words , any element or feature may be combined with any other element or feature in different embodiments , unless there is an obvious or inherent incompatibility between the two , or it is specifically excluded . it is further noted that the claims may be drafted to exclude any optional element . as such , this statement is intended to serve as antecedent basis for the use of exclusive terminology , such as “ solely ,” “ only ,” and the like , in connection with the recitation of claim elements or use of a “ negative ” limitation . the terms “ preferably ,” “ preferred ,” “ prefer ,” “ optionally ,” “ may ,” and similar terms are used to indicate that an item , condition or step being referred to is an optional ( not required ) feature of the invention . the singular forms “ a ,” “ an ,” and “ the ” include the plural reference unless the context clearly dictates otherwise . the term “ and / or ” means any one of the items , any combination of the items , or all of the items with which this term is associated .

US-201514923768-A

the magnetorheological medical brace includes a flexible outer shell that fits around the anatomical area to be braced and a plurality of adjustable straps for securing the shell onto the anatomical area . the shell encases a mar pack filled with magnetorheological fluid or gel . a plurality of magnets is attached to or encased in the shell to provide magnetic field acting on the mar pack . the interaction of the magnetic field with the mar pack adjustably increases or decreases the stiffness of the shell depending on the strength of the magnetic field . a control mechanism is provided for selective adjustment of the magnetic field and other functions .

the magnetorheological medical brace , a first embodiment of which is generally referred to by the reference number 10 , provides adjustable stiffness and other features for optimum support , convenience and comfort . the phrase “ magnetorheological medical brace ” will hereinafter be referred to as “ mar medical brace .” in the exemplary embodiment shown in fig1 and 2 , the mar medical brace 10 may be a leg brace 12 having an elongate shell or cover 14 adapted to be wrapped around the user &# 39 ; s leg l . the shell 14 is substantially semi - cylindrical or semi - frustoconical in shape so that the shell 14 may easily wrap around and conform to the anatomy of leg l . the shell 14 is also relatively stiff or rigid to provide minimum support , as well as to retain the general shape of the shell 14 . however , the shell 14 should also be flexible to allow for some movement without much effort . the shell 14 may be constructed from resilient , polymeric foam with some relative stiffness for minimum rigidity . other materials such as neoprene , cushioned mats , elastomers , steel , plastics and combinations thereof may also be used as needed for some components of the brace . the shell 14 can include a central through hole 18 where a patient &# 39 ; s or user &# 39 ; s knee joint k may protrude . the hole 18 permits flexing of the knee without encumbrance . a plurality of adjustable attachment connectors , such as straps 16 , may be disposed at spaced intervals along the length of the shell 14 . these straps 16 secure the shell 14 onto a wide range of leg girths . the straps 16 may be secured to the user by hook and loop fasteners , buckles , snap - fit fasteners or any other type of adjustable connectors . to facilitate adjustable stiffening of the leg brace 12 , the shell 14 includes a magnetorheological ( mar ) cell , tube or pack 20 disposed inside the shell 14 . the mar pack 20 is preferably a packet or durable balloon filled with magnetorheological material in fluid or gel form . mar material is a substance that can vary the material yield stress characteristics when exposed to a magnetic field . in other words , the stillness or rigidity of the mar pack 20 varies , depending on the strength of magnetic forces acting thereon . thus , whenever the mar pack 20 experiences some degree of magnetic force or field , the whole leg brace 12 correspondingly stiffens or loosens proportionately to the overall rigidity of the mar pack 20 . one example of such a mar material is a combination of carbonyl iron powder and silicone oil . it is to be understood that other mar materials may also be used for the mar pack 20 . in the preferred embodiment , the leg brace 12 is of unitary construction formed in a molding process with the mar pack 20 embedded within the shell 14 . as an alternative , the mar pack 20 may be removably inserted inside a cavity within the shell 14 . the magnetic force or field may be supplied by a plurality of magnet packs , consoles or terminals 30 disposed on one or both sides of the leg brace 12 . each magnet pack 30 can include a permanent magnet or an electromagnet of a given strength . in a preferred embodiment , the magnet packs 30 are magnetically shielded on the outside to ensure that magnetic forces influence the mar material , rather than anything else that may be nearby . when using permanent magnets , the physician or the user may selectively change one for another of higher or lower strength to adjust the of stiffness of the mar medical brace 10 . similar results may be obtained with an electromagnet by using a control mechanism to adjust the magnetic field strength , an example of which will be described below . in the preferred embodiment , the control mechanism 40 may be disposed in one of the magnet packs 30 . as shown schematically in fig6 , the control mechanism 40 includes a processor 42 for controlling the various functions of the control mechanism 40 and is connected to a power source 44 supplying power to the control assembly 40 and the electromagnets in the other magnet packs 30 . in a preferred embodiment , the power source 44 can be a rechargeable and reusable battery , such as lead - acid , nickel cadmium ( nicd ), nickel metal hydride ( nimh ), lithium ion ( li - ion ), and lithium ion polymer ( li - ion polymer ). as an alternative , the power may be supplied directly from an ac source . to adjust the strength of the electromagnet , the user can increase or decrease the amount of power being supplied to the mar pack 20 via the processor 42 to thereby selectively strengthen or weaken the magnetic field . the magnet pack 30 may include an indicator light or display 32 that provides information about the operations of the control mechanism 40 , e . g ., on , off and / or remaining power . in addition to the basic control of the magnetic field or force , the control mechanism 40 includes other features to help monitor the patient &# 39 ; s or user &# 39 ; s healing and / or exercise progress . the control mechanism 40 can include a sensor 48 that senses various activities such as the frequency of wear , the intensity of the magnetic field , the frequency of limb movement , and the like . this data may be recorded on the data recorder 50 and transmitted wirelessly via a wireless transceiver 46 to a monitoring station , such as a central database in a health care facility or to a personal computer . the recorded and transmitted data helps the physician or user calculate and determine physical activity goals . moreover , the data may be used to monitor the user &# 39 ; s adherence with the physician &# 39 ; s recommendations . for example , if the physician prescribed a strict guideline and duration of wearing the leg brace 12 and the patient fails to comply , as evidenced by prolonged periods of recorded inactivity , the transmitted data will note the lapse and alert the physician . then the physician may follow up with the patient in a timely manner to determine the cause . as an alternative , the data stored in the data recorder 50 may be retrieved at the end of a given period of time instead of being transmitted by the wireless transceiver 46 , especially for those who live in areas where wireless communication is not available . data transmission and the data itself may be compromised by the magnets used in the mar medical brace 10 . the magnets may cause magnetic interference , which can reduce the clarity of transmission from the wireless transmitter 46 and potentially damage the data recorded on the data recorder 50 . since the control mechanism 40 will be subject to magnetic interference from the magnets and / or electromagnets , at least the wireless transmitter 46 and the data recorder 50 are preferably magnetically shielded to overcome potential magnetic interference . while the above describes some of the user or patient defined adjustment of the stiffness of the mar medical brace 10 , the control mechanism 40 includes programming capabilities that may be preset by the physician or possibly the user . for example , the physician may program the mar medical brace 10 via the processor 42 to gradually decrease the magnetic strength from the magnet packs 30 over the course of the recommended healing or recovery time . this results in the stiffness or rigidity of the mar medical brace 10 gradually decreasing as the patient heals and grows stronger over time , which eliminates frequent visits with the physician for similar adjustments . moreover , the wireless transceiver 46 may also function as a receiver in order to receive programs , physician directed adjustments and other commands remotely . in the case of the mar medical brace 10 being worn for sports or recreational physical activity , the mar medical brace 10 may be programmed by the user to increase the stiffness over a user - defined period of time so that proper support is maintained as the user becomes physically fatigued from that activity . this relieves constant manual readjustments from the user . referring to fig3 - 5 , these drawings show alternative arrangements of the mar pack for selective reinforcement of the brace . in fig3 , the mar medical brace 100 in the form of a leg brace includes a plurality of mar packs 120 embedded in the shell . the mar packs 120 are shaped as elongate rods for longitudinal reinforcement of the mar medical brace 100 . the mar packs 120 are removably inserted into the shell . as an alternative , the elongate mar packs 120 may be molded with the shell . in fig4 , the mar medical brace 200 includes a plurality of relative short mar packs 220 disposed inside the shell . these mar packs 220 may be placed in a variety of select locations on the mar medical brace 200 wherever selective stiffening is desired . in fig5 , the mar medical brace 300 includes a mar pack 320 that is relatively smaller than the one shown in fig2 . the configuration thereof provides adjustable stiffness in a localized area around the joint . the variety of different mar pack configurations is subject only to the changing needs of the patient . thus , it can be seen that the mar medical brace 10 , 100 , 200 , 300 is a highly adjustable brace that promotes optimum healing , convenience and comfort for the user . the mar packs 20 , 120 , 220 , 320 provide an easy and simple means of adjusting the stiffness and rigidity of the brace for increased comfort and freedom of movement as needed while maintaining the necessary support . the unitary and relatively simple construction also allows the mar medical brace 10 , 100 , 200 , 300 to be easily and inexpensively manufactured . in addition , the control mechanism 40 provides increased functionality whereby the patient &# 39 ; s progress can be easily monitored and tailored to the individual . it is to be understood that the mar medical brace 10 , 100 , 200 , 300 encompasses a variety of alternatives . for example , although the exemplary embodiments above describes the mar medical brace 10 , 100 , 200 , 300 in terms of a leg brace , it is to be understood that the teachings thereof equally applies to all types of braces . moreover , the control assembly 40 is not limited to being installed in one of the magnet packs 30 . instead , the control assembly 40 can be a separate module or remote that can be carried by the user . furthermore , it is to be understood that the mar medical brace 10 , 100 , 200 , 300 is not limited to human subjects or patients . the mar medical brace 10 , 100 , 200 , 300 may also be used on other subjects , such as animals . it is to be understood that this disclosure is not limited to the embodiments described above , but encompasses any and all embodiments within the scope of the following claims .

US-201715645497-A

a method and system for fusing a region in the spine involve the use of at least one guide tube to pass instruments and substances into the spinal region in a minimally invasive manner . in the preferred practice of the method , a guide tube is anchored to a vertebra and the guide tube is moved to thereby position the vertebra . a steerable drilling tool is passed through the guide tube and steered into position to abrade at least a portion of an intervertebral disc and thereby create a cavity in the disc . a flowable substance is passed into the cavity and permitted to solidify to establish fusion in the cavity . optionally , an uninflated balloon is inserted into the cavity and the balloon is filled with the flowable substance to contain the flowable substance .

reference will now be made in detail to the present preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers ( optionally including different suffixes ) are used in the drawings and the description to refer to the same or like parts . fig2 , 3 , 5 , and 10 show examples of components that could be included in an embodiment of a system according to the present invention . as shown in fig2 , the system preferably includes at least one guide tube 10 having at least one inner lumen extending from a proximal end portion to a distal end portion . the distal end portion of the guide tube 10 preferably includes a releasable anchoring element 12 for releasably anchoring the distal end portion of the guide tube 10 in at least one vertebra . in the embodiment shown in fig2 , the anchoring element 12 is at least one thread on an outer surface of the guide tube 10 . the thread permits the guide tube 10 to be removably threaded into a hole bored in a vertebra . the guide tube 10 is preferably made of stainless , surgical steel but may be made of metal composites , ceramic composites , surgical polymers or surgical plastics . preferably , the guide tube 10 includes a suitable tracking element 14 configured to interact with a computer controlled surgical navigation system ( not shown ) using a detector for determining the position of the guide tube 10 with respect to a known reference in 3d space . by way of example only , the tracking element 14 could be at least one led emitter / reflector located on a proximal end portion of the guide tube 10 . the tracking element 14 could also be any structure that is capable of being detected / tracked by means of a surgical navigation system that uses any sonic , optical , electromagnetic , or other suitable technology known in the art . for example , the tracking element 14 is particularly capable of being used with a surgical navigation system constructed according to the teachings of u . s . pat . no . 5 , 383 , 454 ; pct application no . pct / u . s . 94 / 04530 ( publication no . wo 94 / 24933 ); and / or pct application no . pct / u . s . 95 / 12894 ( publication no . wo 96 / 11624 ), the disclosures of which are incorporated by reference . the guide tube 10 includes a lumen that extends from its proximal end portion to its distal end portion . preferably , the lumen is sized to allow for passage therethrough of at least one tool , such as the drilling tool 20 shown in fig3 . the drilling tool 20 preferably includes a bit 22 ( i . e ., burr ) configured to abrade soft tissue or bone , such as portions of an intervertebral disc or a vertebra . the bit 22 is preferably a high speed drill bit made of hardened surgical , stainless steel and optionally coated with teflon or other coatings to prevent aggregation or sticking of osseous material . the bit 22 is coupled to a flexible , rotatable drive member 24 , such as a cable , that is rotatably driven by an external motor ( not shown ) to rotate the bit 22 . the drive member 24 passes through a tubular member 26 that is preferably configured to be steerable . as shown in fig3 , the tubular member 26 includes a number of segments 28 a - 28 e . hinge members 30 a , 30 b , 30 c and 30 d couple adjacent pairs of the segments 28 a - 28 b , 28 b - 28 c , 28 c - 28 d , 28 d - 28 e together to permit relative pivotal movement of the segments in each of the pairs . an axially movable steering element 32 , such as a cable , passes freely through the segments 28 b - 28 e and has a distal end connected to the distal segment 28 a . axial movement of the steering element 32 causes bending at one or more of the hinge members 30 a - 30 d in a plane to vary the position of the distal end portion of the tubular member 26 with respect to the remainder of the tubular member 26 . this enables steerable movement of the drilling tool 20 , especially when the movement at the distal end portion is combined with rotation of the tubular member 26 and / or axial movement of the tubular member 26 . of course , there are many different ways in which the drilling tool 20 could be constructed to provide steering . a tracking element 34 could be provided on the drilling tool 20 to interact with a computer controlled surgical navigation system to determine the location of the bit 22 with respect to a known reference point . for example , the tracking element 34 could be provided on the steering element 32 and constructed like the tracking element 14 shown in fig2 . the drilling tool 20 is preferably made of surgical steel , but the drive member 24 and steering element 32 could be made of metal composites , surgical polymers , or other suitable materials . preferably , at least a portion of the drilling tool 20 is capable of being imaged with fluoroscopic imaging . the drilling tool 20 could be constructed to be connected to a stereotactic device that could be used to determine the position of the bit 22 . structure could be provided on the drilling tool 20 to remove materials with suction . for example , the drilling tool could include a lumen capable of being coupled to a suction source . for example , a flexible tube , such as surgical polymer tubing , could be provided in the tubular member and have an open end extending adjacent to the bit 22 . although the steerable drilling tool 20 is described below as being used in a spinal fusion procedure , the drilling tool 20 could be used in a number of different spinal or non - spinal procedures . the system according to the invention also preferably includes at least one inflatable balloon implant 40 shown in fig1 - 12 . the balloon implant 40 is configured to be filled with material to provide fusion in a cavity that is formed at least partially in an intervertebral disc , as described below . the balloon implant 40 is preferably made of a biodegradable substance such as collagen . the balloon implant 40 and the material used to fill it may include growth factors , such as bone morphogenic proteins or fibroplast growth factor , genetically modified cells for replacement therapy , or mesenchymal stem cells to further promote bony fusion . the system according to the present invention could include other components , such as a device for providing suction and / or irrigation of a surgical site . preferably , all or some of the components are made of permanent or disposable materials that are capable of being sterilized . the present invention also includes one or more preferred methods of fusing a spinal region . these procedures are explained with reference to the structural embodiments described above . however , it should be understood that the method of the invention could be practiced with structure other than that disclosed herein . in addition , the structure of the present invention could be used with processes other than those described herein . in one method according to the present invention , a patient is placed on an appropriate operating surface . optionally , imaging equipment , such as fluoroscopy , is used to visualize a region of the spine . small stab incisions are made in the back and a conventional drill is preferably used to drill a hole through corticle material on the outer surface of the pedicle of a vertebra . for the procedure shown in fig4 , a first hole is drilled in the pedicle of a first vertebra and a second hole is drilled in a pedicle of a second vertebra adjacent to the first vertebra . although fig4 - 11 show these holes as being substantially parallel to the plane of the disc , the holes are preferably angled from about 30 degrees to about 45 degrees with respect to the plane of the disc so that the axes of the holes form an angle having a vertex at the disc . a respective guide tube 10 a , 10 b is placed in contact with each of the vertebrae . preferably , each guide tube 10 a , 10 b is releasably anchored in the corresponding pedicle hole by engaging the threads on the guide tube 10 a , 10 b in the vertebrae . once the guide tubes 10 a and 10 b have been inserted , an x - ray , ct scan or other diagnostic scan could be used to localize the anatomical position of the tubes 10 a and 10 b , identify the best position for fusion and identify the best insertion points for subsequent instrumentation . after anchoring the guide tubes 10 a and 10 b , at least one of the guide tubes 10 a and 10 b is moved to thereby position one or more of the vertebrae . for example , as shown in fig5 , a distraction tool 50 is coupled to the guide tubes 10 a and 10 b to force the guide tubes 10 a and 10 b apart from one another and thereby distract one or more of the vertebrae away from the disc . the distraction tool 50 could be constructed in many different ways . for example , this device could have a ratchet ajustment . in addition to moving the guide tubes 10 a , 10 b toward or away from each other , one or more of the anchored guide tubes 10 a , 10 b could be rotated ( or translated ) to thereby rotate ( or translate ) one or more of the vertebrae . preferably , a computer - controlled surgical navigation device is used to determine the movement of the guide tubes , for example , by interacting with the tracking element 14 shown in fig2 . this preferably enables a surgeon to visualize the repositioning of the vertebrae . one or more steerable drilling tools 20 a and 20 b are inserted though the guide tubes 10 a and 10 b . the drive member 24 ( fig3 ) of each drilling tool 20 a , 20 b is rotated to thereby rotate each bit 22 . each drilling tool is moved further through the guide tubes 10 a and 10 b , as shown in fig7 , and the bit 22 abrades material in the respective vertebra , including medullary material spaced away from the disc . as shown in fig8 , each of the drilling tools 20 a and 20 b are preferable steered toward the disc , for example by axially moving the steering element 32 ( fig3 ), and the drilling tools 20 a and 20 b abrade at least a portion of the end plates of the disc between the vertebrae . the material abraded by the drilling tools 20 a and 20 b is preferably removed through one or both of the guide tubes 10 a , 10 b . for example , a suction and / or irrigation device could be passed into one of the tubes 10 a and 10 b , while one of the drill tools is passed through the other of the tubes 10 a and 10 b . the position of the distal end of the drilling tools 20 a and 20 b is preferably determined , for example , by using a computer controlled surgical navigation device that interacts with the tracking element 34 ( fig3 ). after abrasion of all material , the drilling tools 20 a and 20 b are pulled out of the tubes 10 a and 10 b , and the further removal of any remaining loose material occurs via suction , irrigation , flexible forceps , or other means for clearing such loose material . eventually , all of the interior of the disc , including its nucleus , is removed to form a cavity extending through the disc and preferably into portions of the adjacent vertebrae . preferably , none of the circumferential segments of the annulus fibrosis are abraded or removed during the procedure , such that at least a portion of the fibrosis extends around the cavity . in a preferred practice of the invention , the inflatable balloon implant 40 is preferably inserted into the cavity via one of the guide tubes 10 a and 10 b . the balloon is preferably filled with a contrast agent , as shown in fig1 , and the balloon is viewed with appropriate imaging equipment , such as a fluoroscope . one possible imaging agent that could be used to inflate the balloon is omnipaque . since the inflated balloon preferably fills the entire cavity , the imaging of the balloon can be used to evaluate whether the cavity is properly configured . it can also be used to ascertain proper anatomic alignment or position and to verify complete filling of the cavity . in the event that further material needs to be removed to enlarge the cavity , the implant 40 could be removed from the cavity , and abrasion with one or more of the steerable drilling tools could be continued . when the cavity is properly formed , a flowable fusion substance is preferably passed into the cavity via one of the guide tubes 10 a , 10 b . preferably , the fusion substance is a substance capable of solidfying such that it is no longer readily flowable . for example , the fusion substance could be a solidifying agent including polymethacrylate , such as methylmethacrylate or cranioplastic methacrylate , hydroxyapatite , another polymer , and / or a biological matrix . the flowable substance may include growth factors , such as bone morphogenic proteins or fibroplast growth factor , genetically modified cells for replacement therapy or mesenchymal stem cells to further promote bony fusion . in addition , the fusion substance could include antibiotics such as tobramycin , for example . in one possible practice of the invention , the balloon implant used for the imaging is removed from the cavity before the fusion substance alone is passed into the cavity . alternatively , the balloon implant 40 used for the imaging could be drained of the imaging agent and then filled with the fusion substance via one of the guide tubes 10 a , 10 b . in another alternate practice of the invention , the balloon implant 40 used for the contrast agent is removed from the cavity and another balloon implant is inserted in the cavity and filled with the fusion substance . filling a balloon implant with the fusion substance is preferred in order to contain the fusion substance and prevent migration into unintended areas , such as the area near the spinal chord . after passing the fusion substance into the cavity , the tubes 10 a and 10 b are removed from the vertebrae . fig1 shows the balloon implant 12 in place after being filled with the flowable agent and after solidification of the fusion substance . fig1 shows an alternate embodiment of a balloon implant 40 a that is configured to fill a relatively larger cavity extending into two adjacent discs positioned near a spinal fracture . in the preferred practice of the invention , the guide tubes 10 a , 10 b could be moved at various times during the procedure to reposition one or more of the vertebrae . for example , the movement shown in fig5 could take place after the cavity is fully formed . in addition , the vertebrae could be retained in their repositioned state until the fusion substance solidifies . fig1 - 17 show an alternative procedure like that shown in fig4 - 13 , but involving a single guide tube 10 . as shown in fig1 , the guide tube 10 is used to remove the inner material from a disc with suction applied though the guide tube 10 . as shown in fig1 - 17 , a balloon is inserted into a cavity formed in the disc and eventually filled with the fusion substance to fuse the spinal region . the method and apparatus according to the invention could be used for noninvasive or minimally invasive spinal disc distraction , rotation or translation and subsequent stabilization . the invention could be used for treatment of spinal disorders including , but not limited to , scoliosis , lordosis , kyphosis , spinal fractures , spinal instability , tumors , spinal degeneration due to disease , disc bulges , herniations , and tears . preferably , the invention will stabilize the spine and correct anatomic misalignment caused by the above disorders . for example , the movement of one or more of the guide tubes to reposition one or more vertebrae could be used to correct scoliosis prior to spinal fusion . the method and apparatus according to the present invention could be used for procedures in many different areas of the spine . although the invention has particular advantages in association with procedures for the lower spinal area , the invention could also be used for procedures for the thoracic area or the cervical area , for example . preferably , the present invention shortens the time a patient is being operated on by speeding up the repair of the spinal disorders and thereby reduces risks associated with pre - and post - operative complications . the invention also preferably decreases pain by decreasing pressure on nerve roots , improves mobility , and improves long - term alignment of the spine , thereby providing improved outcomes for spinal disorder patients . the invention could be used to fuse regions of various sizes . for example , the invention could be practiced to fuse two adjacent spinal discs or may be used across more than two . there are a variety of different ways in which the various instruments could be guided during a procedure . for example , stereotactic guidance could be used . it will be apparent to those skilled in the art that various modifications and variations can be made to the structure and methodology of the present invention without departing from the scope or spirit of the invention . in view of the foregoing , it is intended that the present invention cover modifications and variations of this invention provided they fall within the scope of the following claims and their equivalents .

US-201113087194-A

in a route planning system and method for agricultural working machines , a defined working width is assigned to the agricultural working machines to generate driving routes in a territory , and dynamic adaptation of the planned driving route is carried out thereby ensuring that the driving route to be covered is flexibly adaptable to changing external conditions such as driving around obstacles , thereby largely relieving the operator of the agricultural working machine of the task of performing laborious steering maneuvers .

fig1 shows a schematic representation of route planning system 1 , which implements route planning method and was made known in ep 0 821 296 , and which is integrated in an arithmetic and display unit 2 of an agricultural working machine 4 configured as a combine harvester 3 . arithmetic and display unit 2 is located in driver &# 39 ; s cabin 6 , within viewing and operating distance of operator 5 of combine harvester 3 . an attachment 8 , which is configured , e . g ., as a grain cutting device , is assigned to the front side of combine harvester 3 , the width of the attachment determining the working width ab of combine harvester 3 . in addition , agricultural working machine 4 includes a “ gps ” antenna 9 for receiving position coordinates via gps . according to an enlarged section outlined with dashed lines in fig1 , the route planning system includes one or more computation algorithms 10 that generate position coordinates of agricultural working machine 4 in a manner known per se based on the gps signals received by gps antenna 9 . with consideration for optimization criteria 11 of working machine - specific data 12 and field - specific data 13 , which will be explained below in greater detail , computation algorithms 10 generate digitized driving routes 14 which , in the simplest case , are displayed to operator 5 in driver &# 39 ; s cabin 6 via a display unit 16 designed as monitor 15 . in addition , route planning systems 1 of this type can be configured such that generated driving routes 14 are stored in a memory unit 17 such that they can be repeatedly called up . it is also known to derive control signals z from generated driving routes 14 , which influence steering 18 of agricultural working machine 4 as a direct function of the shape of driving routes 14 in such a manner that steered wheels 19 are deflected 20 depending on driving route 14 . fig2 shows a territory 21 , namely a grain field 22 to be harvested , to be covered by an agricultural working machine 4 configured as combine harvester 3 . grain field 22 selected as an example includes outer contours 23 that are straight and curved . the geographic data of these outer contours 23 can be determined by combine harvester 3 itself by operator 5 of combine harvester 3 driving along these outer contours 23 , whereby route planning system 1 generates a first driving route 24 during this drive using gps signals . in the simplest case , route planning system 1 defines this driving route 24 in a position that corresponds approximately to the center of working width ab of attachment 8 , whereby the reproduction of outer contour 23 of covered territory 21 is realized by lining up a large number of driving paths 25 . route planning systems 1 of this type , with consideration for the parameters shown in fig1 , such as highly diverse optimization criteria 11 and working machine - specific and field - specific data 12 , 13 , can generate further driving paths 25 , 26 in a manner known per se which , in the simplest case , are located substantially parallel to each other and either replicate relatively complicated outer contour 23 or are straight . to ensure that territory 21 can be worked completely , the distances between adjacent driving paths 25 , 26 approximately correspond to the working width ad of attachment 8 . according to fig3 , territory 21 to be covered can include one or more obstacles 27 that agricultural working machine 4 must drive around . in addition , operator 5 can decide , e . g ., to change driving route 14 generated by route planning system 1 by dividing up territory 21 to be worked . in the simplest case , this can take place by operator 5 intervening in the controls of agricultural working machine 4 and implementing a manual steering maneuver with the purpose , e . g ., of subdividing territory 21 to be worked into first and second sub - areas 28 , 29 . operator 5 often makes a subjective decision based on highly diverse criteria as to which working directions and field subdivisions permit a territory 21 to be worked efficiently . these subjective criteria can be , e . g ., the division of territory 21 to be worked into simple geometric figures with straight edges that require few steering maneuvers or driving around obstacles 27 or immature , wet or stored grain stocks . when , in these cases , operator 5 specifies a new driving path 30 , route planning system 1 can immediately access previously - generated driving route 14 . this is accomplished in this case by the present invention in that route planning system 1 recognizes the deviation of actual machine position 31 from target machine position 32 determined by generated driving route 14 and the change in actual machine orientation 33 from target machine orientation 34 and , based on this new machine position 31 , 33 , determines a new driving route 14 ′, whereby new generated driving route 14 ′ takes territory 21 already covered into account . in an analogous manner , operator 5 can intervene in the steering procedure to drive around obstacles 27 . in the exemplary embodiment shown , a case is shown in fig3 for reasons of simplicity in which operator 5 manually controls the entire steering procedure to drive around obstacle 27 along a driving path 30 until pre - determined driving route 14 is reached again . it is within the scope of the present invention that operator 5 initiates the avoidance procedure and route planning system 1 , starting with this change in position of agricultural working machine 4 , automatically determines a new driving route 14 ′. based on the fact that route planning system 1 operates in a gps - based manner , it is also feasible that route planning system 1 can access information regarding obstacles permanently integrated in territory 21 to be worked , such as trees , and automatically take their position into account when creating driving route 14 , 14 ′. as a result of this immediate reaction of route planning system 1 to interventions by operator 5 in the steering procedure of agricultural working machine 4 , a dynamic route planning system 1 is created that can react very flexibly to changes in driving route 14 . a route planning system 1 of this type is made even more flexible and highly precise when route planning system 1 permanently determines actual machine position 31 and actual machine orientation 33 and , as a function of this position data , carries out a permanent adaptation of driving route 14 , 14 ′ of agricultural working machine 4 . according to previous embodiments , driving routes 14 , 14 ′ determined by route planning system 1 are composed of a large number of driving paths 25 , 26 , whereby the definition of these driving paths 25 , 26 can depend on the length , orientation and processing sequence of highly diverse optimization criteria 11 . a grain field 22 , as shown in fig4 , is usually harvested such that one or more combine harvesters 3 harvest the grain and bring the harvested crops to one or more hauling vehicles 35 located on territory 21 to be harvested . it is extremely important that the various vehicles 4 , 35 in use cover short driving paths on territory 21 with consideration for a ground - saving method of working . in addition , an efficient harvesting procedure is also defined by short harvesting times and , associated therewith , a small proportion of unproductive auxiliary time . for this reason , route planning system 1 takes into account , in its stored computation algorithms 10 , the determining optimization criteria 11 “ shortest driving path ”, “ shortest working time ”, and / or “ small proportion of unproductive auxiliary time ”. in the simplest case , mathematical relationships between the gps - based position data of agricultural working machine 4 , hauling vehicle 35 and outer contours 23 of territory 21 to be worked are defined in computation algorithms 10 as a function of selectable or specified working machine - specific data 12 or field - specific 13 , said data to be described in greater detail below . a further optimization parameter 11 that is directly related to those stated above concerns “ short auxiliary drives between consecutive driving paths 25 , 26 to be worked ”. according to fig4 , combine harvester 3 would have to carry out a considerable amount of auxiliary driving if the working sequence of individual driving paths 26 would be carried out on both sides , extending from the outside to the inside . in this case , optimization can be carried out such that computation algorithms 10 determine an optimized working sequence that can be composed , e . g ., by first subdividing territory 21 formed by transversely extending driving paths 26 into first and second sub - areas 28 , 29 , so that separate driving routes 14 are subsequently assigned to each of these sub - areas 28 , 29 . a further optimization criterium 11 can be “ recognition and working of known driving routes 14 and sequences ”. territory 21 to be driven over is traveled by highly diverse agricultural working machines 4 during a single cultivation and harvesting phase . particular territory 21 is also worked repeatedly throughout the year . in both cases , it is an advantage if the process of generating driving routes 14 can be considerably reduced by configuring route planning system 1 such that it recognizes territories 21 and the previous working sequences and driving routes 14 generated earlier to work them , and can access them . short driving routes and a small proportion of unproductive auxiliary time are also achieved by the fact that further optimization criteria 11 are the “ minimization of drives between agricultural working machine 4 and hauling vehicle 35 ” and “ short turn - around drives 36 ”. due to the fact that agricultural field work is usually carried out by a plurality of agricultural working machines 4 working together , a particularly efficient route planning system 1 is created when route planning system 1 is capable of generating working strategies using computation algorithms 1 stored in said route planning system . in the simplest case , the working strategy is limited to the route planning system generating driving paths 25 , 26 and “ turn - around curves ” 37 , and specifying a defined sequence in which to work driving paths 25 , 26 and turn - around curves 37 . in the exemplary embodiment shown in fig4 , when two combine harvesters 3 are used , the working strategy could be , e . g ., that route planning system 1 — according to the previous embodiments — first subdivides territory 21 to be worked into first and second sub - areas 28 , 29 and subsequently assigns a sub - area 28 , 29 to each combine harvester 3 . in this case , the working strategy essentially consists of taking into account the number and position of highly diverse agricultural working machines 4 in use on particular territory 21 . when carrying out an “ load - transferring procedure ”, in particular , in which combine harvester 3 transfers the harvested crops it has stored during the harvesting travel to a hauling vehicle 35 , it is particularly important that combine harvester 3 be able to easily assume a suitable unloading position relative to hauling vehicle 35 , and that conflicts with further combine harvesters 3 that are filling hauling vehicle 35 be avoided . in the simplest case , this can be ensured by the working strategy determined by route planning system 1 taking into account the machine type - dependent machine kinematics , the geometry of territories 21 to be worked , in particular with regard for “ turn - around drive ” 36 , and , if applicable , the position of obstacles 27 in territory 21 to be worked . the machine kinematics are working vehicle - specific data 12 , which can be , e . g ., possible curve radii and steering angles of a combine harvester 3 , the geometry of its unloading device 38 and the dimensions of hauling vehicle 35 . it is extremely important to take into account the geometry of territory 21 to be worked , particularly with the loading procedure depicted schematically in fig4 , since the loading procedure is shortened considerably when a loading position is easy to reach ; this results in a reduction of the necessary auxiliary times . in addition , the working strategy can take into account crop conditions , such as laid grain , absence of vegetation , excessive moisture content , whereby information of this type is usually input by operator 5 of agricultural working machine 4 into route planning system 1 . the harvesting conditions and the geometry of territory 21 to be worked are “ field - specific ” data 13 in route planning system 1 according to the present invention . furthermore , the working strategy generated by route planning system 1 can take customer requests into account such that the customer specifies , e . g ., maximum limits for crop losses or working time . in addition , based on previous experience , the customer also often prefers a certain working sequence , e . g ., based on the dried condition of the crops , which can vary greatly within territory 21 to be worked , due to diverse external influences . in addition , the working strategy can specify complete working sequences such that , while combine harvester 3 is still harvesting particular territory 21 , subsequent processes such as pressing the straw set down on the field or breaking the stubble can be started . the method for determining driving routes 14 shown schematically in fig1 could be structured , in the simplest case , as shown in the flow chart in fig5 , such that , in a first step , operator 5 of agricultural working machine 4 drives around territory 21 to be worked , whereby the geographical data of outer contour 23 of territory 21 is determined in a gps - based manner . it is within the scope of the present invention that the geographical data for a known territory 21 can also be transferred from a data base 40 directly to route planning system 1 . in route planning system 1 , driving paths 14 , 14 ′ are calculated in a further processing step 41 , using computation algorithms 10 described above and with consideration for working vehicle - specific and field - specific data 12 , 13 . in a further processing step 42 and with consideration for optimization criteria 11 described above , generated driving routes 14 , 14 ′ are optimized in route planning system 1 whereby , in the simplest case , generated driving route 14 is automatically worked first . as described above , this method step 43 is implemented by route planning system 1 generating control signals z that intervene directly in steering 18 of agricultural working machine 4 , so that it is guided automatically along generated driving route 14 on territory 21 to be worked . if , in a further working step 44 , operator 5 of agricultural working machine 4 intervenes in the steering procedure or discards generated driving route 14 , route planning system 1 according to the present invention determines a new driving route 14 ′, and preliminary working steps 41 - 43 must be carried out again . this process repeats every time generated driving route 14 is discarded or the operator intervenes directly in the processing of a driving route 14 by actuating steering 18 of agricultural working machine 4 , so that route planning system 1 according to the present invention always determines a driving route 14 , 14 ′ that is an optimum 45 between the requirements of operator 5 and consideration for diverse optimization criteria 11 . to now enable generated driving routes 14 , 14 ′ to be processed further electronically and in a simple manner , and to be depicted graphically and transparently , driving routes 14 , 14 ′ are described in route planning system 1 using “ master lines ” 46 as indicated in the illustration on the left in fig1 , whereby master lines 46 of adjacent driving paths 25 , 26 are arranged such that they are offset from each other by the working width ab of agricultural working machine 4 , or by a multiple thereof . as a result , territory 21 to be worked , which is defined by its outer contours 23 , is described by a large number of master lines 46 that are separated from each other , whereby master lines 46 can also be drawn straight or curved , depending on the shape of outer contours 23 . to ensure that master lines 46 are capable of replicating generated driving route 14 , 14 ′ with sufficient accuracy , making them suitable as a command variable for automatically influencing steering 18 of agricultural working machine 4 , master lines 46 are always defined by two path points c , d separated by a distance , whereby a virtual extension 47 of master line 46 extending through these path points c , d serves as guide line 48 . since an exact depiction of curved driving paths 25 , 26 requires a considerable number of path points c , d , but this requires a considerable amount of computing effort , it is provided in a further advantageous embodiment of the present invention that further computation algorithms 49 are assigned to route planning system 1 that reduce the number of path points c , d of curved driving paths 25 , 26 depending on predefined or predefinable accuracy limits , so that , ultimately , generated driving path 14 , 14 ′ replicates territory 21 defined by its outer contours 23 with sufficient accuracy . to ensure that agricultural working machine 4 does not contact non - worked ground 50 on its turn - around drive 36 , driving paths 25 , 26 which form driving route 14 , 14 ′ are extended virtually in the region of turn - around drive 36 , as shown in fig3 , so that agricultural working machine 4 must first be moved correspondingly far enough away from ground 50 before its makes the particular turning curve 37 . to ensure that operator 5 of agricultural working machine 4 can exert direct influence on the working sequence of driving paths 25 , 26 that form driving route 14 , 14 ′, said driving paths are displayed in a visual manner to operator 5 using display unit 2 described above . individual driving paths 25 , 26 can be displayable permanently or only in certain sections , such as in the region of turn - around drive 36 . to ensure that operator 5 is capable of easily changing the sequence in which driving paths 25 , 26 — which form driving route 14 , 14 ′— can be worked , display unit 2 is designed as a “ touch - screen ” monitor 51 , so that the next driving path 25 , 26 to be worked can be selected directly on monitor 51 . this has the advantage , particularly in the region of turn - around drive 36 , that operator 5 can easily influence the subdivision of territory 21 to be worked into sub - areas 28 , 29 . in addition , means can be assigned to display unit 2 in a manner known per se that enable operator 5 to shift generated driving route 14 , 14 ′ entirely , or displace individual driving paths 25 , 26 of this driving route 14 , 14 ′ on territory 21 to be worked , so that any inaccuracies in the generation of the driving route can be easily compensated for . it lies within the abilities of one skilled in the art to modify route planning system 1 described above in a manner not shown or to use it in other machine systems to obtain the effects described , without leaving the scope of the present invention . it will be understood that each of the elements described above , or two or more together , may also find a useful application in other types of constructions and methods differing from the types described above . while the invention has been illustrated and described as embodied in route planning system for agricultural working machines , it is not intended to be limited to the details shown , since various modifications and structural changes may be made without departing in any way from the spirit of the present invention . without further analysis , the foregoing will so fully reveal the gist of the present invention that others can , by applying current knowledge , readily adapt it for various applications without omitting features that , from the standpoint of prior art , fairly constitute essential characteristics of the generic or specific aspects of this invention .

US-14390105-A

the invention relates to a new cosmetic cleansing composition with improved skin conditioning and stability properties . said cleansing composition contains 5 - 60 % of a surface - active agent , 0 . 1 - 10 % of a diblock or triblock copolymer or a mixture thereof , 0 . 1 - 10 % of a saturated liquid oligomer of an unsaturated fatty acid , said oligomer having more than 30 carbon atoms , 0 . 1 - 30 % of an oil or fat , 10 - 80 % of water , nd has an improved average foam stability ranging between 35 and 60 mm according to the foam stability test .

according to the invention , useable esters are butyl myristate , cetyl palmitate , decyl oleate , glyceryl laurate , glyceryl ricinoleate , glyceryl stearate , glyceryl isostearate , hexyl laurate , isobutyl palmitate , isocetyl stearate , isopropyl isostearate , isopropyl laurate , isopropyl linoleate , isopropyl myristate , isopropyl palmitate , isopropyl stearate , propylene glycol monolaurate , propylene glycol ricinoleate , propylene glycol stearate and propylene glycol isostearate . silicone oils which can be used according to the invention are silicone oils as such , gums and modifications thereof such as linear and cyclic polydimethylsiloxanes ; amino , alkyl , alkyl aryl and aryl silicone oils . hydrocarbons which can be used according to the invention are those as liquid paraffins , petrolatum , microcrystalline wax , ceresin , squalenes , squalanes and mineral oil . animal fats which can be used according to the invention are lanolin alcohols , acylated lanolin alcohols , lanolin , lard , mink oil and tallow . fatty acids and alcohols which can be used according to the invention are behenic acid , palmitic acid , lauric acid , myristic acid , oleic acid , linoleic acid , linolenic acid , lanoleic acid , stearic acid , isostearic acid and polyunsaturated fatty acids . alcohols include , but are not limited to , lauryl alcohol , behenyl alcohol , cetyl alcohol , stearyl alcohol , oleyl alcohol , eicosanyl alcohol and isocetyl alcohol , cholesterol alcohol and 2 - hexadecanol . it is preferred that oil or fat make up 12 to 25 % by weight . the cleansing composition according to the invention has a very good foaming ability , especially if it contains high proportions of surface - active agents and oils , e . g . if the amount of surface - active agent contained ranges between 5 and 60 % by weight and the ratio of surface - active agent to oil is 1 : 0 . 6 - 0 . 8 , particularly 1 : 0 . 7 - 0 . 78 , while the anti - foaming effect which is usually observed in case of such high contents is significantly reduced . this is demonstrated by a foam stability test . said foam stability test is carried out as follows : 4 g of a 10 % aqueous solution of the product to be tested is mixed with 146 g water having a hardness of 0 . 5 mmol / l of alkaline earth metal ions ( corresponding to a us hardness of 50 ppm ) and a temperature of 29 ° c .+ 1 ° c . the test solution is stirred at medium stirring speeds in an osterizer blender for 10 seconds . the foam obtained is filled into a graduated 500 ml cylinder and the initial foam volume in mm is determined at the nearest 5 ml graduation . 3 . 5 minutes later , the height of the foam at the foam / water interface is determined with the same accuracy . the second value in mm represents the foam stability , and the average foam stability is determined by averaging at least three measured values of the same test solution . the compositions according to the invention have an improved average foam stability ranging between 35 and 60 mm according to the foam stability test . the water content of the composition according to the invention preferably ranges between 20 and 75 % by weight , particularly 25 and 35 % by weight . further constituents of the composition according to the invention can be lipids , vitamins , uv - filters , phospholipids , electrolytes , antioxidants , protectants , perfumes , ph - adjusters . preferred lipids include cholesterol , ceramides , sugar esters and pseudo - ceramides , such as described in ep - a - 556 957 . preferred vitamins include those as vitamins a and e and vitamin alkyl esters , including vitamin c alkyl esters . preferred uv - filters are those as octyl methoxy cinnamate ( parsol mcx ) and butyl methoxy benzoylmethane ( parsol 1789 ). phospholipids and mixtures of the aforesaid substances are included as well . a preferred antioxidant is e . g . butylated hydroxytoluene ( bht ), advantageously in amounts of approx . 0 . 01 %, or above if desired . further antioxidants are the vitamins a , c , e and derivatives thereof ; flavones or flavonoids ; amino acids such as histidine , glycine , tyrosine , tryptophan and derivatives thereof ; carotenoids and carotenes such as α - carotene , β - carotene ; uric acid and derivatives thereof ; α - hydroxy acids such as citric acid , lactic acid , malic acid . preferred protectants are antimicrobial agents such as 2 - hydroxy - 4 , 2 ′ 4 ′- trichlorodiphenyl ether ( dp300 ) and protectants such as dimethyloldimethylhydantoin ( glydant xl1000 ), parabenes , sorbic acid , etc . it considerably improves the deposition of skin - conditioning emollients and enhances the long - lasting moisturizing of the skin once it has been rinsed off . if high proportions of surface - active agent and oil are contained , it has a very good foaming ability and is an ultra - mild body wash without phase separation . it overcomes the tendency that no foam will form if high proportions of surface - active agent and oil are contained . it enables a super - stable emulsion to be produced . the cleansing composition according to the invention has a viscosity ranging between 100 and 600 mpa · s ( cp ) necessary for use on wet skin in a shower and can be rinsed off easily at the same time . once the act of bathing or showering is finished , the composition has a long - lasting skin - conditioning effect without feeling oily . it surpasses the products currently available on the market , especially due to its foaming ability and moisturizing properties . in addition , the same cleansing effect is achieved using milder surface - active agents . the cosmetic composition according to the invention can e . g . be used in the form of washing lotions , deep - action hair care products , hair conditioners , hair shampoos , shower gels , shower lotions , bath oils , cleansing creams , pasty masks ( mud packs ). the aforesaid products can be manufactured in a manner known to those skilled in the art . the invention will now be explained in more detail by means of examples . all quantities are in % by weight unless indicated otherwise . the foam height was determined according to the foam stability test described above . the results are shown in the following table 1 . the compositions of the present invention have a considerably improved foam height compared to products of the same category which are currently available on the market . the foam height decreased slightly when the amount of dimer acid hydrogenated contained was increased , but it was still higher than that of the market products even at a dimer content of 2 . 5 %. as an additional check , a sample containing no dimer was tested , whose foam height was considerably higher too . all in all , this shows a clear superiority of the products according to the invention in case of high contents of surface - active agents and oil .

US-51249805-A

small , autonomous , low cost electrochemical gas generators containing an electrochemical cell assembly , a commercially available battery and a current controlling mechanism . current control , which defines the gas generation rate , is achieved either electronically by means of a resistor or through mass transfer control by means of a gas permeable film of known permeability . in either case , the gas generation rates are generally from 0 . 1 to 10 cc / day . the gas source must contain an electrochemically active gas such as oxygen or hydrogen . air is the preferred source for oxygen . these miniature gas generators , generally are less than 1 . 5 cm in diameter and length , require novel , compact , electrochemical cell assemblies . various cell assemblies , generally 1 cm in diameter and less than 05 mm thick , are described . these miniature gas generators are used for the controlled release of fluids such as pheromones , fragrances , insect repellents , and the like .

fig1 a and 1b are representative of a preferred embodiment of the present miniature and autonomous electrochemical gas generator 10 the gas generation of which is controlled by the simplest form of current controller , a resistor 20 [ the gas generated herein typically is oxygen ]. it is small , compact , easy to manufacture and assemble , simple to use , efficient , and cost - effective . this particular electrochemical gas generator 10 is of the current - controlled resistor based type in that generation of gases is controlled by a commercial resistor . an important component of this electrochemical gas generator is the electrochemical cell assembly 30 . this particular electrochemical cell assembly 30 is illustrated in detail in fig3 a and a second embodiment is illustrated in detail in fig3 b . this electrochemical gas generator 10 comprises a container 11 made of conductive material . the container 11 has a chamber 13 therein to accept a battery housing 19 , a battery 12 , and the resistor 20 with a first contact point 21 in communication with the battery 12 at one end and a second contact point 22 in potential communication with the activation arm 18 at the other end . activation of this electrochemical gas generator 10 occurs when it is placed into a suitable container having a diameter approximately equal to or slightly greater than the diameter of the electrochemical gas generator 10 which causes the activation arm 18 to move in the direction of arrow a and thereby come into contact with the second contact point 22 causing the process to begin . an inlet 14 [ one or more for allowing entry of any oxygen - containing gas , such as , but not limited to , air ] at the bottom of the container 11 permits the entry of air which will flow around the battery 12 and up to the electrochemical cell assembly 30 where oxygen will be extracted and released through the outlet 16 on top of the on the container 11 . resting on top of the battery 12 in this embodiment is a conductive member 15 generally comprised either of , but not limited to , conductive rubber or a metal screen . the conductive member 15 ensures good electrical contact between the battery 12 and the electrochemical cell assembly 30 . fig3 a illustrates in detail the electrochemical cell assembly 30 of this current - based current - controller generator 10 . it is composed of a solid electrolytic membrane 31 onto which electrodes 32 are embedded . current collectors 33 are on the top and bottom of the electrolytic membrane 31 and are in intimate contact with each electrode 32 to insure low resistance electrical contacts . this membrane - electrode / current - collector 31 , 32 , 33 combination is encircled by , and partially sandwiched between , an oxygen impermeable film 34 which is used to seal off the edges by way of outward extensions 35 . as can be seen clearly in fig1 a and 1b , the oxygen impermeable film 34 with the outward extensions 35 , in conjunction with the sealing ring 23 , will prevent air from circulating around the electrochemical cell assembly 30 but forces the air to flow to the electrochemical cell assembly 30 from its air intake side 24 , to be processed , with oxygen being released at the discharge side 26 of the electrochemical cell assembly 30 and out of the electrochemical gas generator 10 through its outlet 16 . the top of the container 11 has a recess 17 which , when assembled with the electrochemical cell assembly 30 inside , presses on the electrochemical cell assembly 30 . this maintains a tight fit of the electrochemical cell assembly 30 therein and on the conductive member 15 in tight communication with the top of the battery 12 . an air - tight seal is formed to prevent air from flowing around the electrochemical cell assembly 30 and to prevent the generated oxygen to reverse flow and escape to the air intake side 24 of the electrochemical cell assembly 30 . reference is now made to fig1 b for assembly of this current - based electrochemical gas generator 10 . first the sealing ring 23 is placed into the inverted housing 11 followed by the electrochemical cell assembly 30 , conductive member 15 , battery holder 19 with battery 12 and resistor 20 therein . the bottom of the housing 11 is crimped inward and upward . once so assembled and properly crimped , this electrochemical gas generator 10 , when activated becomes operational . referring now to fig3 a , typical conventionally available components of the electrochemical cell assembly 30 include : for the resistor [ 20 ], a vishay low - power surface mount chip resistor ; [ 2 ] for the electrolytic member ( cation or anion ) [ 31 ], a typical membrane which is manufactured by dupont ® and known as nafion ®; [ 3 ] for the electrodes [ 32 ], catalytically active materials such as platinum black or platinum activated carbons or graphite ; [ 4 ] for the current collector [ 33 ], which typically should be approximately 320 microns thick and less than 5 mm in diameter , porous conductive carbons or graphite paper or porous conductive materials such as conductive silicone rubber or a metal screen ; and [ 5 ] for the oxygen impermeable film [ 34 ] and outward extensions [ 35 ], dupont &# 39 ; s ® commercially available kapton ® film which generally should be of the non - conductive type . as illustrated in detail in fig3 a , the oxygen impermeable film 34 and its outward extensions 35 sandwich the membrane - electrode , current - collector combination 31 , 32 , and 33 and , with the outward extensions 35 , prevents air from circulating around the electrochemical cell assembly 30 . there is a substantially wide mouth opening on both the bottom surface and the top surface of the electrochemical cell assembly which defines a respective intake side 24 [ bottom ] and a discharge side 26 [ top ]. when the electrochemical cell assembly 30 is combined with the container assembly 11 described above , the air - tight seal described above forces air or any other oxygen - containing gas source to flow to the electrochemical cell assembly 30 from the intake side 24 of the electrochemical cell assembly 30 to be processed , with oxygen being released at the discharge side 26 of the electrochemical cell assembly 30 and out of the electrochemical gas generator 10 through its outlet 16 . electrochemical oxygen enrichment using air as a source has been previously described in the prior art . the process is typically conducted by applying a voltage across an electrochemical cell consisting of catalytic anode and cathode and an electrolytic member or ionic polymer such as dupont &# 39 ; s nafion ®. electrode processes are : the correlation between current and gas generation rate , at 25 ° c . is 5 . 5 cc of oxygen / day - ma . conversely , the amount of energy required to generate 1 cc of oxygen is 4 . 4 ma - hr . the over - all process can take place at a voltage of less than 1 . 5 volts and is therefore compatible with most commercial batteries . the amount of gas generated by batteries such as the 357 silver oxide button cell is ca . 36 cc of oxygen , while the 675 zinc - air battery can release from 110 - 140 cc of oxygen . larger volumes can be produced from commercial alkaline batteries such as aaa and aa . since the rates of fluid deliveries of interest to this invention are generally less than 1 ml / day , the applied currents are less than 200 micro - amps . in fact , 20 micro - amps are adequate for delivery rates of 0 . 1 ml / day . since air - operated electrochemical cells have a capacity of about 100 ma / cm 2 , or 550 cc of oxygen / day - cm 2 , it is apparent that to achieve the desired rates of 1 ml / day or less , the cell size can be extremely small , therefore , non - conventional electrochemical cell assemblies are required as compared to more conventional assemblies such as those described by maget in u . s . pat . no . 6 , 010 , 317 . fig2 a and 2b , in conjunction with fig3 a and 3b , illustrate a slightly modified version of an autonomous electrochemical oxygen generator which , for oxygen generation , is controlled by an oxygen permeable film , either conductive 115 or non - conductive 125 , thereby eliminating the need for the resistor 20 as required in the previously described electrochemical gas generator 10 . this electrochemical gas generator 110 is somewhat similar to the previously described electrochemical gas generator 10 in that it has a container 111 , with one or more oxygen inlets 114 on the bottom and an outlet 116 and activation member 118 on top of the container 111 . the oxygen inlet 114 and bottom however has an upward extending recess 117 thereat adapted to receive a compression - type fitting 120 , such as but not limited to washers , plugs , slugs , and lids , the purpose of which is described later herein . a chamber 113 within the container 111 houses the battery holder 119 and the battery 12 . this electrochemical oxygen generator 110 is film - based and , unlike the previously described current - based electrochemical gas generator 10 , is housed below the battery 12 and on the bottom of the container 111 . in assembling this generator 110 , a sealing ring 123 is placed on the floor [ bottom ] of the container 111 , followed by the electrochemical cell assembly 30 , and ending with the battery 12 in its holder 119 . in cases where the electrochemical cell assembly being used is that as illustrated in fig3 a , construction is followed by placement of either a conductive oxygen - permeable film 115 or a non - conductive oxygen - permeable film 125 into the recess 117 followed by insertion of the compression - type fitting 120 into the recess and in contact with the conductive oxygen - permeable film 115 or a non - conductive oxygen - permeable film 125 . similar to the previously described generator 10 , this is followed by crimping the container 111 inward and downward to achieve an electrical contact between the battery 12 and the electrochemical cell assembly 30 and the container 111 . with the compression - type fitting 120 so pressed into the recess 117 an intact and ready to use film - based electrochemical gas generator 110 is made . a ledge 122 supports the electrochemical cell assembly 30 and , with the sealing ring 123 , maintains an air - tight integrity of this electrochemical gas generator 110 . as so configured a large cavity 47 is defined below the electrochemical cell assembly 30 and the floor of the container 111 . a small cavity 37 is defined below the electrolytic membrane 31 and the lower segment of the oxygen - impermeable film 34 . as will be explained , the large cavity 47 serves an important function to the operation of this film - based electrochemical gas generator 110 . the compression - type fitting 120 should have one or more perforations 144 [ one is shown ] therein to permit access of air onto the oxygen - permeable film 115 , 125 . the oxygen - permeable film 115 , 125 allows a certain amount of oxygen to diffuse across the oxygen - permeable film 115 , 125 and to access the electrochemical cell assembly 30 above . a raised circular ridge 121 on the top of the compression - type fitting 120 defines the active area for oxygen permeation through the oxygen - permeable film 115 , 125 . the one or more perforations 144 are inside the circular ridge 121 and air for oxygen extraction contacts only the area of the oxygen - permeable film as defined by , and within , the circular ridge 121 . as previously described and illustrated in detail in fig3 a , the upper and lower segments of the oxygen impermeable film 34 and the respective outward extensions 35 sandwich the membrane - electrode , current - collector combination 31 , 32 , and 33 and , with the outward extensions 35 , prevents air from circulating around the electrochemical cell assembly 30 but forces oxygen to flow to the electrochemical cell assembly 30 to be processed , with oxygen being released at the discharge side 26 of the electrochemical cell assembly 30 and out of the electrochemical gas generator 110 through its outlet 116 , and as a result , the oxygen generation rate is now controlled by oxygen transfer through this oxygen permeable film 115 , 125 thereby eliminating the need for the resistor 20 . in cases where no compression - type fitting 120 is being applied , such as illustrated in fig4 a and 4b [ to be described in detail later ] the film must be conductive oxygen - permeable 115 as illustrated by the electrochemical cell assembly 130 in fig3 b . this embodiment of fig4 a and 4b simplifies the manufacture process and costs associated therewith . in the embodiment illustrated in fig2 a and 2b , the principle of operation of a film - based , or diffusion - based , oxygen generator eliminates the need for a resistor to control the current and thereby the oxygen generation . conventionally - available and typical oxygen - permeable film 115 , 125 should generally be of a silicone film and more specifically , if it is to be of the non - conductive type , a dimethylsilicone ( dms ) film of known oxygen permeability such as produced by silicone products , inc . it is the known permeability of the film which will dictate the quantity of oxygen to be generated and not the strength of the battery 12 rendering battery strength immaterial to its efficiency . the rate of oxygen transfer through the above - mentioned dms film 125 is 60 × 10 − 9 cc - cm / cm 2 - sec - cmhg pressure difference . if a specific oxygen partial pressure difference can be maintained across either type of oxygen - permeable film 115 , 125 , the oxygen transfer rate will be constant . if the partial pressure of oxygen on the down - stream side of the oxygen - permeable film 115 , 125 is small ( near zero ) the oxygen pressure difference is set at about 16 cm of hg . the transfer rate of oxygen then becomes equivalent to 0 . 083 cc - cm / day - cm 2 . for a film thickness of 10 mils , the rate becomes equivalent to 3 . 3 cc / day - cm 2 . to achieve a 1 cc / day transfer rate , the film diameter should generally be 0 . 6 cm . to achieve the desired low oxygen pressure on the down - stream side of the oxygen - permeable film 115 , 125 , a battery voltage of 0 . 9 and 1 . 7 volts is applied directly to the electrochemical cell assembly 30 , without current control . each of the film - based generators 110 , 210 involve a two stage process for oxygen generation : [ 1 ] oxygen diffusion ; and [ 2 ] electrochemical oxygen concentration . with regard to the generator 110 illustrated in fig2 a , oxygen within the large cavity 47 , as defined by the boundaries of the oxygen - permeable film and the electrochemical cell assembly 30 will be immediately scavenged and released as pure oxygen at the cell assembly anode . in fact , applicant has obtained oxygen partial pressures in cavity as low as 100 ppm , or 0 . 008 cm hg , a negligible value as compared to 16 cm hg of oxygen pressure in air . fig4 a and 4b in conjunction with fig3 b illustrates yet another embodiment of an electrochemical gas generator 210 also controlled by an oxygen - permeable film rather than a resistor 20 as previously described for the electrochemical gas generator 10 . in this embodiment , however , the oxygen - permeable film must be electrically conductive 115 . this electrochemical gas generator 210 is configured similarly to the previously described electrochemical gas generator 110 in that it has a container 211 , with one or more inlets 214 on the bottom [ one being illustrated for the purpose of allowing entry of an oxygen - containing gas , such as but not limited to , air ] and an outlet 216 and activation member 218 on top of the container 211 . a chamber 213 within the container 211 houses the battery holder 219 and the battery 12 securely positioned therein . a ledge 222 is defined on the bottom of the battery holder 219 . the bottom , or floor , of the container 211 has a raised ridge 221 defining a perimeter thereon having a clearly defined inner side and an outer side . there is no need for the compression - type fitting 120 as in the electrochemical gas generator 110 as previously described . in assembly of this embodiment , sealing ring 223 is first placed into the container 211 followed by the electrochemical cell assembly 130 [ see fig3 b ], battery 12 , and then the battery holder 219 . container 211 is then crimped inward and downward to achieve electrical contact between the battery 12 , electrochemical cell assembly 130 , and the raised ridge 221 . the ledge 222 in combination with the sealing ring 223 supports the electrochemical cell assembly 130 and maintains the required air - tight integrity necessary for the electrochemical gas generator 230 to properly and most efficiently function . the one or more inlets 214 on the electrochemical gas generator 210 allows free access of any oxygen - containing gas , such as but not limited to , air to the electrochemical cell assembly 130 and the raised ridge 221 , defining the active area [ inner side of the perimeter ] for air access to , and oxygen transfer across , the conductive oxygen - permeable film 115 to the electrolytic membrane 131 and lower electrode 132 . fig3 b illustrates in detail the electrochemical cell assembly 130 used in the above described electrochemical gas generator 210 . it is similar to the electrochemical cell assembly 30 previously described in that it has solid electrolytic membrane 131 onto which electrodes 132 are embedded on the top and on the bottom of the electrolytic membrane 131 . a single current collector 133 is on top of the top electrode 132 and in intimate contact therewith to insure a low resistance electrical contact . a major difference with this electrochemical cell assembly 130 is that the lower current collector 33 as described for the electrochemical cell assembly 30 is replaced by the conductive oxygen - permeable film 115 . electrical conductivity is achieved by the addition of conductive materials to the film such as , but not limited to , carbon , graphite , silver , nickel , or other similarly conductive materials . this membrane - electrode - film electrochemical cell assembly 130 is partially sandwiched between upper and lower segments of oxygen impermeable film 134 which is used to seal off the edges of electrochemical cell assembly 130 by way of outward extensions 135 . as can be seen the oxygen impermeable film 134 sandwiches the membrane - electrode - current collector - film combination 131 , 132 , 133 , 115 and , with the outward extensions 135 in conjunction with the sealing ring 123 [ refer to fig4 a and 4b ], prevents air from circulating around the electrochemical cell assembly 130 but forces the air to flow to the electrochemical cell assembly 130 from its air intake side 124 , to be processed , with oxygen being released at the discharge side 126 of the electrochemical cell assembly 130 and out of the electrochemical gas generator 210 through its outlet 216 . typical conventionally available components of the electrochemical cell assembly 130 include : for the electrolytic member ( cation or anion ) [ 131 ], a typical membrane which is manufactured by dupont ® and known as nafion ®; [ 2 ] for the electrodes [ 132 ], catalytically active materials such as platinum black or platinum activated carbons or graphite ; [ 3 ] for the current collector [ 133 ], which typically should be approximately 320 microns thick and less than 5 mm in diameter , porous conductive carbons or graphite paper or porous conductive materials such as conductive silicone rubber or a metal screen ; [ 4 ] for the oxygen permeable film [ 115 ], a conductive silicon rubber produced by silicone products , inc ., of known oxygen permeability ; and [ 5 ] for the oxygen impermeable film [ 34 ] and outward extensions [ 35 ], dupont &# 39 ; s ® commercially available kapton ® film . this electrochemical gas generator 210 is activated by moving the activation member 218 in the direction of arrow b which is then pressed and held in contact with the battery 12 . after this movement is completed , the electrochemical cell assembly 130 immediately extracts oxygen from the small cavity 137 . since the oxygen - permeable film 115 is in intimate contact with the lower electrode 132 , and because the cavity 137 is extremely small , oxygen pressure in the small cavity 137 in instantly decreased to near zero . this difference in oxygen pressure as contrasted to the air pressure on the intake side 124 of the electrochemical cell assembly 130 becomes the driving force for oxygen transfer across the oxygen - permeable film 115 and subsequent release from the upper electrode [ anode ] and discharge from the electrochemical gas generator 210 from its outlet 216 . the present disclosure includes that contained in the present claims as well as that of the foregoing description . although this electrochemical gas generator and cell assemblies have been described in its preferred forms with a certain degree of particularity , it is understood that the present disclosure of the preferred forms has been made only by way of example and numerous changes in the details of construction and combination and arrangement of parts and method steps may be resorted to without departing from the spirit and scope of the electrochemical gas generator and cell assemblies . accordingly , the scope of the electrochemical gas generator and cell assemblies should be determined not by the embodiments illustrated , but by the appended claims and their legal equivalents . it must be understood , however , that there may be unforeseeable insubstantial modifications to electrochemical gas generator and cell assemblies that remain as equivalents and thereby falling within the scope of the electrochemical gas generator and cell assemblies described and claimed herein .

US-41354609-A

a game apparatus and game methods of play that provide mental exercises to increase the level of abstract thinking to create 3 - d objects from universally accepted 2 - d flat patterns . since we read and write on 2 - d surfaces , the shapes we associate most with a 2 - d environment are alphanumeric characters . combining letters and numbers in a 3 - d environment creates challenging exercises for visualizing 3 - d shapes . the competitive games involve a series of 3 - d manipulative modules . play of the games involves scoring points for creating and / or discerning words made up of letters recognized from the 3 - d manipulative modules . the games are for multiple players and can also be implemented electronically and online .

a number of games are provided that each utilizes the core game pieces of the present invention , namely a set of 3 - d letter modules that each represents at least three letters of the alphabet when viewed from different angles . what follows are descriptions of a representative set of thirty - six letter modules suitable for the play of the games of the present invention . sets of modules that number more or fewer are anticipated although the preference is for a set having twenty - four to forty - eight modules . alternate individual modules are also anticipated . that is , the thirty - six modules described herein are not the only combinations of three or four letters that can be constructed into a single 3 - d module . other combinations are anticipated . fig1 is a perspective view of the ajt module 1 of the game components of the present invention . fig2 is a perspective view of the beg module 2 of the game components of the present invention . fig3 is a perspective view of the cux module 3 of the game components of the present invention . fig4 is a perspective view of the dnu module 4 of the game components of the present invention . fig5 is a perspective view of the emh module 5 of the game components of the present invention . fig6 is a perspective view of the sat module 6 of the game components of the present invention . fig7 is a perspective view of the gco module 7 of the game components of the present invention . fig8 is a perspective view of the hob module 8 of the game components of the present invention . fig9 is a perspective view of the jet module 9 of the game components of the present invention . fig1 is a perspective view of the kdo module 10 of the game components of the present invention . fig1 is a perspective view of the lse module 11 of the game components of the present invention . fig1 is a perspective view of the mug module 12 of the game components of the present invention . fig1 is a perspective view of the nce module 13 of the game components of the present invention . fig1 is a perspective view of the ohm module 14 of the game components of the present invention . fig1 is a perspective view of the red module 15 of the game components of the present invention . fig1 is a perspective view of the qud module 16 of the game components of the present invention . fig1 is a perspective view of the per module 17 of the game components of the present invention . fig1 is a perspective view of the sre module 18 of the game components of the present invention . fig1 is a perspective view of the tap module 19 of the game components of the present invention . fig2 is a perspective view of the uao module 20 of the game components of the present invention . fig2 is a perspective view of the vuh module 21 of the game components of the present invention . fig2 is a perspective view of the xav module 22 of the game components of the present invention . fig2 is a perspective view of the yeh module 23 of the game components of the present invention . fig2 is a perspective view of the fez module 24 of the game components of the present invention . fig2 is a perspective view of the eft module 25 of the game components of the present invention . fig2 is a perspective view of the aul module 26 of the game components of the present invention . fig2 is a perspective view of the elm module 27 of the game components of the present invention . fig2 is a perspective view of the hef module 28 of the game components of the present invention . fig2 is a perspective view of the hut module 29 of the game components of the present invention . fig3 is a perspective view of the ren module 30 of the game components of the present invention . fig3 is a perspective view of the deg module 31 of the game components of the present invention . fig3 is a perspective view of the nod module 32 of the game components of the present invention . fig3 is a perspective view of the pel module 33 of the game components of the present invention . fig3 is a perspective view of the noe module 34 of the game components of the present invention . fig3 is a perspective view of the fun module 35 of the game components of the present invention . fig3 is a perspective view of the heb module 36 of the game components of the present invention . the games are played with 3 - d letter modules in several ways . three such games : ( a ) a letter cards game ; ( b ) an alphabet bingo game ; and ( c ) a word / phrase guessing game , are for the beginner level with increasing degrees of difficulty . at the beginner level the players get familiar with the game concept , the letters , and begin to build their 3 - d visualization skills . two additional games : ( d ) a category word guessing game ; and ( e ) a construct a word game , are for more advanced players that are already familiar with the modules in general and are ready to play word games to consolidate 3 - d visualization skills while providing opportunities to enrich and diversify players &# 39 ; vocabulary . as shown in the 2 - d panel 40 of fig3 , the letter modules are designed to show a different letter contour when viewed from a different angle . three pairs of letters have the same contours but through simple rotation perform a dual role in the alphabet . these include the letters h & amp ; i ( views 42 ), the letters m & amp ; w ( views 44 ), and the letters n & amp ; z ( views 46 ). the components of the preferred embodiment of the basic game set include : thirty - six 3 - d letter modules each incorporating at least three different recognizable letters ; sixty - four letter cards ( two cards for each of the twenty - six letters of the alphabet plus eight extras ); thirty - two 5 × 5 array alphabet bingo cards ; a number of bingo marker rings ; one or more pads of blank formatted phrase guessing game play sheets ; a number of word lists with the most common words made out of four , five , six , seven , and eight letters ; a number of blank formatted score cards for the category word guessing game ( printed on both faces ); and a number of blank formatted score cards for the construct a word game ( printed on both faces ). preferably a number of ancillary components are provided with the game components to include : a game box containing ; pencils with erasers ; pencil sharpener ; and an opaque bag to hold all modules . the easiest and fastest way to get acquainted with the 3 - d letter modules is to play the letter card game embodiment of the present invention using the additional components 50 shown in fig3 . in this embodiment , a letter card 52 is drawn from a deck of cards 56 and each player finds the letter 54 in their modules ( see fig1 - 36 ). score cards are not needed for this game . all letter cards are shuffled and placed in a stack . from the beginning the players determine how many rounds will be in the game and how many modules will be individually drawn for a game . it is suggested that the number of rounds matches the number of players or a multiple thereof . one of the players is selected as a referee either for the entire game or the players will take turns being referee for each round . the referee makes the final decision in any letter dispute . all modules are in the bag and the players draw the same number of modules from it , one at a time , and place them on the table in front of them . the referee reveals the top letter card from the deck 56 . the players check their modules and the first player to show a module containing the letter gains one point , takes the card , and places it under the respective module . if there is no match the play continues and the next letter card is revealed . the players again check their modules and the first to announce a match gains one point , takes the card , and places it under the respective module . a module might have multiple cards depending on the letters played . if there is no match again the play continues until there is one and the card is placed under the respective module . if a letter previously claimed by a player comes up again it cannot be claimed again by the same player for the same module . the first player to have all the modules paired with at least three cards may close the game and earns one point for closing , but the winner is the player with the most points so , at times , it is advisable to postpone the closing in order to gain more points if the modules have more than three letters . once the round is over all the letters are returned to the stack and the modules are returned into the bag . a new set of modules is drawn for the next round . all subsequent rounds are played following the same rules . after all rounds are played the player with most points wins . if there are two or more players with the same number of points a tie - breaker play will have them use only one module and the first letter match will determine the winner . this is the next level game that can be used to help players get better acquainted with 3 - d letter modules and uses the additional components 60 shown in fig3 . score cards are not needed for this game . special 5 × 5 letter array bingo - type cards 62 and marker rings 64 are used for this game . each player should have one bingo - type card 62 . one of the players is selected as referee either for the entire game or the players will take turns being referee for each round . the referee makes the final decision in any letter dispute . all modules are in the bag and the players take turns to draw one module each from it . once a player draws a module he / she calls the letters observed in the module and places the module in the common area . all players put a ring 66 on each of the announced letters . if another player observes a letter that has not been announced in any of the played modules , only he / she can put a ring on that letter if the letter is on her / his card . the referee must validate any disputed call . a letter can have only one ring 66 . the first player to have rings on all five letters in a line , column , or on a diagonal and calls “ bingo !” is the winner of the game . the word / phrase guessing game is another introductory level game that can be used to help players get better acquainted with 3 - d letter modules . this game is for two players . all modules are out on the table . one phrase guessing sheet 70 is used for each game . player one thinks of a secret word ( or short phrase ) and draws a line in field 74 on sheet 70 for each letter of the word and then selects modules ( fig1 - 36 ) containing those letters and lines them in front of player two . player one can follow different strategies . she / he can choose modules containing multiple letters from the secret word or a module for each letter . if the secret word can be spelled with fewer modules , player one may add other , not related , decoy modules up to the total number of letters spelling the secret word . player two inspects the lined up modules , identifies the letters , and circles them in the field 72 on the pad 70 . since some modules might contain more than three letters there might be letters not identified by the player that would complicate the word or phrase guessing . using the identified letters player two attempts to figure out the secret word by calling one letter at a time . once a letter is called it is crossed out from the list . if a letter is correctly guessed , it is written on the appropriate line or lines by player one . for each guessed letter that is not contained in the secret word a body part is drawn on the gallows 76 . there are six body parts that can be used ( head , trunk , two hands , and two legs ) so player two has six chances to guess the secret word . if all the letters in the secret word are guessed before the complete body is drawn player two wins the game . if not , player one wins the game and the secret word with the modules containing all the secret word letters must be revealed . this is a game with a higher level of complexity that is best played by an even number of players that are forming pairs . the game may have multiple rounds with equal number of plays and their number should be established from the beginning . a round has the number of plays determined by the number of different pairs that can be formed with the participating players . after each play the pairs are rearranged until every player has been paired with every other player . then the turn is over and another turn may start . each player draws a module ( fig1 - 36 ) and selects from an acceptable category a word containing all the letters detected in the module . a preferred set of acceptable categories are : animals , birds , plants , fruits , things , activities , tools , professions , countries , states , and cities . each player uses game score card 80 . all modules are placed in an opaque bag . one of the players is selected as referee either for the entire game or the players will take turns being referee for each round . the referee makes the final decision in any letter dispute . each participating player draws a module and within an established time interval ( preferably two to three minutes ) selects from an acceptable category a word containing all the letters present in the module . a more challenging variation of the game would require that the selected word must also start with one of the module letters . once the words are selected the players within the pair exchange the modules and inform their partners of the word category they selected . the players have an allotted amount of time ( again , two to three minutes ) to figure out the selected word . each play carries four points per pair to be awarded as follows : a player in the pair finds the correct word — wins two points and zero points for the opponent ; a player finds a word that respects all the conditions but it is not the selected word — wins one point and the opponent wins one point ; a player finds no word to match the conditions — wins zero points and two points for the opponent ; if a player cannot find an initial word for the letters detected in the drawn module receives zero points and exchanges the module with the opponent , if the opponent then finds a word to match the letters he / she receives two points ; and if a player detects letters missed by the opponent wins two points while the opponent receives zero . score is kept on the score card 80 . after each play the drawn modules are retired until all the modules in the bag have been played . at that moment all the modules are replaced in the bag and the drawing starts anew . at the end of the game the player who won the most points is the game winner . if two or more players have an equal amount of points tie - breaking plays should determine the winner . this is a more advanced game level in which a word is selected and each player spells it with letters from their modules . each player uses a game score card 90 as shown in fig4 . all modules ( fig1 - 36 ) are placed in the opaque bag . from the beginning the players determine how many rounds will be in the game . it is suggested that the number of rounds matches the number of players or a multiple thereof . one of the players is selected as referee either for the entire game or the players will take turns being referee for each round . the referee makes the final decision in any letter dispute . the game includes a number ( preferably five ) of pre - established lists with the most common words made out of four , five , six , seven , and eight letters . words with fewer letters make the game shorter . the referee selects a word from one of the lists ( preferably with more letters than players ). the players write the word in the appropriate “ words ” box on the score card 90 . the players take turns to draw one module each from the bag . once a player draws a module he / she has half a minute ( preferably ) to identify its letters and try to match them with the letters contained in the selected word . if there are matching letters , the player announces them , circles the letters on his / her score card 90 , and places the module in front on the table . if more than one letter is found in one module all those letters are crossed with an x and circled for double points . all other players cross the respective letters on their score cards with one diagonal slash . if there are no useful letters on the module , the module is placed in a common area on the table and the game continues with the next player drawing a module . the next player is allowed to inspect the modules placed in the common area before drawing a new module . if a letter that was not called out is found in a previously drawn module the player circles the letter according to the rules , places the module in front on the table , and proceeds to draw a new module . if the module contains a new letter the player follows the same rules . if the player draws a previously drawn letter circles it on the personal score card . if there are multiple previously drawn letters in that module the player changes the slash to an x and circles the letters . the rest of the players do nothing . modules placed in front of a player cannot be inspected by other players . the points are awarded as follows : circled letters with or without a slash — one point ; circled and crossed with an x letters — two points ; letters crossed with one slash — zero points . when all the letters spelling the word have been drawn , the round ends , but only after every player has a turn to draw a module . the winner of the round is the player with the most points . if there are multiple players with equal number of points the player with most double points wins . if equality is still maintained , all those players will score a victory in that round . after each round all the modules are replaced in the bag . at the end of the game the player who won the most rounds is the game winner . if more players share the number of wins the player with the most total points is declared the winner of the game . the 3 - d letter modules can be used in word games played in additional alternative ways as described below . once a choice of game is made the players receives their score cards specific to the play selected . in one alternate embodiment , each player receives a word game score card that has at the top , letter boxes for six modules . there is a line of boxes for consonants and one for vowels . for the modules representing only consonants each player can choose any vowel and list it in its box . the lowest acceptable letter count in a word is three . words that increase their letter count by adding an “ s ” are not accepted . only one form of a verb is accepted . proper nouns and slang words are not accepted . one draw of several modules for all players occurs with all modules placed initially in the bag . from the beginning the players determine how many rounds will be in the game . it is suggested that the number of rounds matches the number of players or a multiple of it . one of the players is selected as referee either for the entire game or the players will take turns being referee for each round . the referee decides how many modules will be drawn for each round ( minimum three and maximum six ). at the end of each round the referee validates the correct words and the total score . the referee makes the final decision in any letter dispute . the number of modules agreed upon are drawn from the bag and laid on the table . each player inspects each module for a set amount of time ( recommended half a minute ) and writes down in its box all the letters that can be visually detected . when all the modules have been inspected by all players the round starts . it is suggested that for every module three to five minutes of play should be added . for the allotted time interval the players should make as many words with the letters detected as possible . there are preferably fifty places for words having up to eleven letters on one face of the score card . if needed , listing the words can be continued on reverse . lowest acceptable letter count in a word is three . each word made out of three letters is worth one point . every letter over three in an acceptable word adds an extra point . at the end of the set time the player with the most points wins . if the highest number of points is shared by more players , the player with the longest words wins . if equality is still maintained , all those players will score a victory in that round . after each round all the modules are replaced back in the bag . at the end of the game the player who won the most rounds is the game winner . if more players share the number of wins the player with the most total points is declared the winner of the game . although the present invention has been described in connection with specific examples of letters from the latin or roman alphabet , those skilled in the art will recognize that other alphabets and languages may be used without departing from the spirit and scope of the invention . in addition , the examples provided should not be construed as limiting the 3 - d letter combinations possible for any given module . other modules , even within the group of letters within the latin alphabet , are certainly possible and may be included within the game method of play . a further variation of the game may include numerals on separate modules or in combination with letter modules . the modules themselves may be constructed of any of a variety of rigid or partially resilient materials such as resins , plastics , wood , foam , and other materials with similar rigidity and mass . variations in size are also anticipated subject primarily to limitations associated with being easily handled by the players and easily contained within an opaque bag of medium size . variations in the configuration of the game case or storage container are also anticipated . the game modules may be stored in the bag itself or in a different container . the storage container may be cylindrical or box shaped , and hard sided or soft sided . the game apparatus may also contain one or more stands ( not shown in the drawing figures ) onto which the players might place the modules to arrange and view them during the play of the game . while the preferred embodiment of the construction of the modules herein has been presented as solid cube - shaped blocks with large cutouts in various directions that serve to form the various letters when viewed from different angles , other means for providing the same visual impressions are anticipated . each module might , for example , be constructed of a clear acrylic or glass block with opaque inclusions forming the letter patterns . other variations as to game component construction and game rules will be apparent to those skilled in the art of games and educational tools .

US-201715486278-A

a method and device are disclosed directed at harvesting of vessels , such as arteries and veins , especially as required in vessel grafting procedures . the device and method discloses a cannula - like device that provides identification , capture , manipulation , cautery and cleavage of branch vessels from the harvested vessel . in certain preferred embodiments of the disclosed method and device , irrigants containing co2 , as well as other agents capable of stimulate release of nitric oxide from vascular endothelium are applied to subject vessels so as to enhance the viability of vessels to be harvested as graft material .

fig1 - 5 illustrate a harvesting cannula in accordance with a first preferred embodiment of the present invention . harvesting cannula 2 is configured as an elongated , hollow , tubular structure . it is preferred that the cannula is fabricated of a transparent , biocompatible , non - conductive material such as , for example , a plastic . the cannula has an outer wall 4 , a central bore 6 , a distal terminus 8 , a proximal terminus 10 and a longitudinal axis running from the proximal to distal terminus . located adjacent the distal terminus , a harvesting head 12 exhibits a greater diameter relative to the remainder of the cannula and thus provides an increased central bore area . it is preferred that the harvesting head demonstrate a rounded , for example , “ egg shaped ” contour , as demonstrated in fig1 and 3 so as to assist the instrument in effecting the above and below - described blunt dissection of tissue about the vessel to be harvested . the tubular control segment 23 is located contiguous and proximal to the harvesting head and is discussed in further detail , below . portions of the outer walls of both the harvesting head 12 and tubular control segment 23 ( portions of said sections located upon a superior surface 7 of the cannula opposite the inferior surface of the cannula 77 ) are comprised of a sliding operation arm 9 . the sliding operation arm 9 , as discussed above , is slidably affixed to a superior portion of the harvesting head and tubular control segment so as to enable fore / aft motion of the arm . aft motion of the arm 3 , motion of the arm towards to proximal terminus 10 of the cannula , ( the “ open ” position ) forms an opening in the outer walls of the harvesting head — the branch vessel capture notches 22 and 24 . fore motion of the sliding arm 5 , motion of the arm towards the distal terminus of the cannula allows opposing walls of the capture notches to approximate each other ( the “ closed ” position ) and enables , in certain preferred embodiments , the cauterization ( in certain preferred embodiments , application of clips / coils ) and sectioning of branch arteries also discussed below . therefore , a distal portion of the sliding operation arm completes the outer wall of superior portion of the harvesting head when the device is in the closed configuration . in the first preferred embodiment of the present invention illustrated in fig1 - 5 , the distal terminus 8 of the cannula is open so as to form a distal aperture 9 which is contiguous with the central bore 6 . a main vessel alignment slot 20 penetrating through the outer wall 4 of the cannula arises at its distal terminus from and communicates with the distal aperture 9 of the cannula . thus both the distal bore and alignment slot provide access to the central bore within the cannula . in the first preferred embodiment of the present invention , the main vessel alignment slot 20 is not aligned with the longitudinal axis of the cannula , but lies at an angular relationship with said axis . utilizing a skewed main vessel alignment slot further enhances the ability of the harvesting head to capture a vessel to be harvested . for example , if the main vessel alignment slot is aligned with the longitudinal axis of the cannula , the vessel might be easily displaced from the harvesting head as the cannula progressed along a vessel and was thus brought into alignment with the vessel . in the first preferred embodiment , the alignment slot extends from the distal aperture , proximally along the outer wall of the harvesting cannula and terminates at a point 21 along the superior outer wall of the harvesting head formed by the sliding operation arm and in close proximity to the proximal terminus of the harvesting head 25 . thus the main vessel alignment slot comprises an opening of the outer wall of the cannula extending from the distal aperture along the outer wall of the harvesting head and terminates at a distal portion of the sliding operation arm 9 . in preferred embodiment illustrated in fig1 - 5 , two branch vessel capture notches 22 and 24 are formed by the aforementioned aft motion of the sliding operation arm 9 . more specifically , aft motion 3 of the arm opens a channel in the outer wall of a distal portion of the harvesting head running in a generally circumferential direction about the longitudinal axis of the cannula which communicates with both the central bore as well as the main vessel alignment slot . the notches thus formed are especially useful in the capture and severance of branch arteries . more specifically , when the sliding operation arm is urged in an aft direction , a channel — and , in regard to the first preferred embodiment of the present invention , 2 channels are formed — so as to provide a pair of branch vessel capture notches 22 and 24 . these notches are advantageously provided with means therewithin for both cauterizing and severing branch vessels from a main vessel to be harvested . in the first preferred embodiment of the present invention illustrated in fig1 - 5 , electro - surgery points 30 , 32 , 34 and 36 located upon the proximal walls of the branch vessel capture notches are oppositely charged ( ground or active ) as compared to electro - surgery contact points 38 , 40 , 42 and 44 positioned within and upon the opposing distal notch walls . therefore , when , as described below , branch vessels are maneuvered into the capture notches , forward movement of the sliding operation arm provides direct contact between the electrodes ( contact points ) and branch vessels . activation of an electro - surgery unit connected to the aforementioned operating points , allows the surgeon to seal of such vessels in to locations — one location more proximal to the main vessel and one location more distal . alternatively , the afore - mentioned contacts may , by means of forward motion of the sliding operation arm , be energized without need to independently activate an electro or radio cautery unit for each successive cautery application . in the first preferred embodiment of the present invention , a cutting blade 46 and 48 located upon the notch walls and positioned between adjacent radio or electro - surgery points allows the cannula to sever the branch vessels between the cauterization points . operation of the cutting blade may be controlled by the closure ( fore movement ) of the sliding operation arm , or a separate control rod may be utilized to actuate the blades . the harvesting cannula of the present invention includes a means for capturing , retaining and manipulating a vessel to be harvested once the vessel has been introduced into the central bore of the harvesting head through the main vessel alignment slot . the vessel capture and manipulation means may be advantageously comprised of a control rod positioned and retained within the tubular control segment or the sliding control arm of the cannula . such control rods include , at a distal terminus , a vessel capturing configuration designed to engage and hold a vessel for manipulation while still allowing proximal and distal movement of the device along the vessel . at a proximal terminus , the control rod includes a control means 52 so as to allow a surgeon to rotate , extend and retracting the vessel capturing configuration . for example , while the central portion of the control rod lies in general alignment with the longitudinal axis of the cannula , the distal terminus — the vessel capturing configuration —, may comprise a 90 degree bend in the rod thereafter presenting a “ v ” or “ u ” shaped opening of sufficient size so as to engage and provide manipulation of the vessel . in such embodiments , rotation of the control rod allows an operator to alter the position of the main vessel within the harvesting head so as to facilitate capture of branch vessels within the branch vessel capture notches . in the first preferred embodiment of the present invention illustrated in fig1 - 5 , control rod 50 includes dial 52 for rotation , extension and retraction of the rod and a “ pig tail ” vessel capturing configuration 54 on the distal terminus thereof . rotation of the control rod 50 allows capture and manipulation of the vessel — and the side branches attached thereto — in regard to movement of the vessel in superior 1 , inferior 3 and lateral directions . such control of the main vessel and resultant control of branch vessels , facilitates placement of branches into the capture notches for cauterization and removal . in a first alternative preferred embodiment of the present invention ( illustrated in fig6 ), a main vessel retention means comprises retention gates 70 and 72 . the retention gates , shown in a “ closed ” position , are utilized to ensure retention of the vessel to be harvested within the central bore of the harvesting head . in addition , the location of the gates , just distal to the proximal terminus of the main alignment slot , applies a strategic downward force upon the main vessel ( towards the inferior surface of the cannula 77 ). the downward biasing force is the result of i . the traction force already applied to the vessel due to its intact position , both proximally and distally within the circulatory conduit ; and ii . the opposing retentive force applied to the vessel to be harvested by the gates just prior to exit of the vessel from the proximal termini of the main alignment slot . as the cannula is advanced , proximally along a vessel to be harvested , the biasing force tends to urge branch vessels into the capture notches located , as discussed above , in close proximity with the capture gates . in the first preferred embodiment , the main vessel capture / manipulation means , e . g ., the control rod with pig tail also provide similar downward biasing force and the resulting facilitation of branch vessel notch capture . however , embodiments incorporating the capture / manipulation means demonstrate the added utility of allowing increased control of vessel position . in the first preferred embodiment of the present invention , the tubular control segment , provides a conduit and advantageously includes multiple channels for an endoscopic camera , operating light , vessel control rod , irrigation and aspiration . . the inferior surface 77 of the outer wall of the cannula may advantageously include a plurality of perforations 52 allowing for irrigation and aspiration of both the operative site ( within the harvesting head ) as well as irrigation and aspiration of the field about the cannula . it has now been discovered , as discussed in further detail above , that by including a gaseous stream of co 2 within the irrigant stream , the viability of the endothelium of vessels to be harvested may be greatly improved . fig4 is a cross sectional view of the first preferred embodiment . control rod channel 55 provides a conduit and mounting means for control rod 50 . in addition , fiber optic endoscopic camera 56 and light 63 are located adjacent to irrigation channel 58 which provides both irrigation of the operative field as well as a cleansing stream so as to keep the lens of the camera free of debris . aspiration channel 60 provides a conduit for the removal of irrigant , blood and other debris from the operative field . it is highly advantageous to position the endoscopic camera lens within the tubular control segment , just proximal to , and directed towards the central bore of the harvesting head . alternatively , such cameras may be placed within the sliding control arm . as stated above , the relatively large central bore of the harvesting cannula provides a wide operative field and excellent visualization . it is still further advantageous to utilize a lens with a sufficient field width so as to provide and generate an image providing a view of the central bore of the harvesting head , the branch vessel capture notches and the main vessel alignment slot . such positioning and field performance of the endoscopic camera and lens will therefore enable a surgeon the view 1 . the vessel to be harvested ; 2 . the position of the vessel to be harvested during vessel introduction into the harvesting head ( during the rotation , extension and retraction of the cannula by the surgeon as he or she attempts to position the vessel within the main vessel alignment slot ); 3 . manipulation of the control rod and vessel capture / manipulation means ( e . g . “ pig tail ”); 4 . manipulation of branch vessels , after capture by the capture control means , so as to position same within the branch vessel capture notches ; 5 . positioning the branch vessels within the branch vessel capture notches so as to align said vessels with the cautery and cutting means ; and 6 . cauterization ( or , in certain preferred embodiments , the application of clips and / or coils ) and severing of branch vessels . in practicing the method of the first preferred embodiment of the present invention , a vessel to be harvested is first identified . for example , it may be highly desirable to harvest the radial artery for use in bypass surgery . therefore , after properly anesthetizing the patient , a skin incision is made at a point adjacent to the most distal extent of the vessel to be harvested after preparing the surgical site in the usual manner and after application of the usual disinfecting agents . thereafter , a blunt dissection is carried out proximally , along the vessel sufficient so as to provide an ample operative field about the vessel . for this purpose , conventional surgical instruments may be utilized . however , the tapered “ egg shaped ” harvesting head of the embodiments of the present invention illustrated in the figures may also be utilized to provide such dissection . for this purpose , the harvesting cannula may be provided with a removable ( such as “ screw on ” or “ snap on ”) domed shaped cap for occlusion of the distal aperture during this initial procedural step . after sufficient blunt dissection is performed , the vessel , such as , for example , the radial artery , remains intact without any severance of the vessel at either the proximal or distal extent of the graft . the vessel is purposefully allowed to remain intact in this manner so as to take advantage of the traction and stabilization provided by the connection of the vessel — at both ends of the graft —, to the remainder of its course . the cannula is then positioned by the surgeon , utilizing the endoscopic camera for guidance , so as to urge the most distal extent of the graft to be harvested — the main vessel — into the main vessel alignment slot 20 . after positioning the main vessel within the slot , the surgeon then utilizes the main vessel capture and manipulation means to engage and capture the vessel . for example , the surgeon may utilize a control means to rotate , extend and retract the “ pig tail ” shaped distal terminus of the control rod so as to engage the main vessel . as the cannula is advanced toward the proximal extent of the graft to be harvested , the main vessel passes through the distal aperture , into the central bore of the harvesting head , through the capturing configuration of the control rod ( e . g . “ pig tail ”) and then exits the central bore of the harvesting head at the proximal terminus of the alignment slot . thereafter , the vessel passes , substantially parallel to the long axis of the cannula against the devices outer surface . upon encountering lateral vessels ( observed through the camera ) the surgeon utilizes a dial 50 or other control means to rotate extend and retract the control rod so as to manipulate the vessel to be harvested so as to position lateral branch vessels within the capture notches 22 and 24 . the control rod may be utilized in conjunction with manipulation of the entire cannula , or by itself , in order to position the branch vessels in such a manner as they are aligned with hemostatic and severing means . the surgeon may then advance the sliding operation arm forward , in a fore direction , so as to provide contact of opposing ( ground and active ) electro - surgical tips with each vessel on either side of the cutting means . upon contact with the branch vessels , current is applied to the branch vessels so as to cauterize same at two points lateral to the point where the vessel is to be severed . activation of the electro - surgery unit providing the cauterizing wave form may be provided by sliding contacts within the cannula that close upon forward motion of the sliding operation arm completing a circuit or may optionally be provided by a manually operated control switch mounted upon or separate from the tubular control segment . after cauterization of a branch vessel , a cutting means , such as , for example , a cutting electro - surgical current , laser , harmonic cutter or sharpened metal blade , located between the cauterization points , is used to transect the branch vessel . in the first preferred embodiment of the present invention illustrated in fig1 - 5 , sharpened steel edge 46 and 48 , located upon the notch walls and positioned between adjacent electro - surgery points , allows the cannula to sever the branch vessels between the cauterization points . operation of the cutting blade may be controlled by the closure ( fore movement ) of the sliding operation arm , or a separate control rod may be utilized to actuate the blades . the terms and expressions which have been employed in the foregoing specification and in the abstract are used therein as terms of description and not limitation , and there is no intention , in the use of such terms and expressions , of excluding equivalents of the features shown and described or portions thereof , it being recognized that the scope of the invention is defined and limited only by the following claims .

US-34573903-A

a lower limb prosthesis system and a method of controlling the prosthesis system to replace a missing lower extremity of an individual and perform a gait cycle are disclosed . the prosthesis system has a controller , one or more sensors , a prosthetic foot , and a movable ankle joint member coupled to the prosthetic foot . the movable ankle joint member comprises a hydraulic damping system that provides the ankle joint member damping resistance . the controller varies the damping resistance by providing volumetric flow control to the hydraulic damping system based on sensor data . in one embodiment , the hydraulic damping system comprises a hydraulic piston cylinder assembly , hydraulic fluid , and a valve to regulate the fluid . in one embodiment , the controller alters the damping resistance by modulating the valve to vary the hydraulic fluid flow within the hydraulic piston cylinder assembly of the movable ankle joint member based on sensor data .

fig1 shows a leg prosthesis system 1 with both knee joint 2 and ankle joint 3 according to the invention and a method of performing a gait cycle with a leg prosthesis system . a prosthesis wearer can attach the prosthesis to the amputated leg by means of the leg - enclosing socket 13 . furthermore the socket 13 is attached to the movable knee joint 2 in a suitable manner and the knee joint is connected to the ankle joint 3 by interconnecting elements 12 or the like . a foot prosthesis 14 is attached to the ankle joint 3 and can turn about the ankle joint 3 . additional components that may be included in a leg prosthesis system are shock absorbers , angularly adjustable couplings etc . most of the people with an amputated leg have lost their leg below the knee joint . the present leg prosthesis system and / or method can be used by prosthesis wearers who need a prosthesis with both knee joint and ankle joint , but the invention can also be used for a prosthesis with only an ankle joint or only a knee joint . the leg prosthesis system and / or the method can also be used by prosthesis wearers who lack both lower extremities , that is who are double - leg - amputated and need a leg prosthesis system with at least two movable joints . one common or two separate and / or communicating control means may be used . fig2 shows the support phase for a gait cycle on a flat surface . when placing the heel on the surface , fig2 . 1 , the body weight of the prosthesis wearer is applied to the leg prosthesis system . the knee joint then allows flexion and the foot is plantar flexed , fig2 . 2 , that is the foot blade moves away from the lower leg . body weight and muscular strength help to straighten knee joint and ankle joint to centered standing , fig2 . 3 . in fig2 . 4 , the foot blade is compressed and energy is returned in fig2 . 5 . when performing this movement , from fig2 . 1 to fig2 . 5 , the leg prosthesis system is completely passive , passive braking of both ankle joint and knee joint . the joints are rotated by means of body weight and muscular strength from the remaining lower extremity . for extra power in the gait , for instance when walking faster , the active drive unit in the foot can be used in the position in fig2 . 6 to push away . fig3 shows the swing phase in a gait cycle . fig3 . 1 corresponds to fig2 . 6 and when initiating a swing phase , fig3 . 3 , the active part of the ankle joint performs a dorsal flexion , that is the foot blade moves towards the lower leg . this dorsal flexion occurs to give the prosthesis wearer ground clearance , a safe distance between the foot and the ground to prevent stumbling . a passive foot does not manage the dorsal flexion from fig3 . 2 to fig3 . 3 but this movement of the foot blade requires some kind of drive . the knee joint performs the swinging movement by using the forward force created by the wearer &# 39 ; s body , and the passive braking controls the movement . when performing this movement , from fig3 . 3 after the dorsal flexion to fig3 . 5 , the leg prosthesis system is completely passive , passive braking of both ankle joint and knee joint . to provide extra force to the step , for instance when walking faster , the active drive unit in the knee joint can be used in the position in fig3 . 4 to straighten the knee joint and move the lower leg forward more quickly . to climb a staircase or slope , as illustrated in fig4 , fig5 , fig7 and fig8 , it is important for the knee joint and the ankle joint to cooperate . more energy is required in climbing , which means that cooperating active drive of both ankle joint and knee joint can advantageously help to perform the movement . when descending a staircase or slope , as illustrated in fig6 and fig9 , the passive braking in both knee joint and ankle joint cooperates . fig4 to fig6 illustrate the climbing of a staircase . fig4 shows the support phase when climbing a staircase . in fig4 . 1 the foot is positioned on the step , and balance is achieved . the leg prosthesis system and / or the use of the method according to the invention then push the prosthesis wearer upwards , fig4 . 2 , to centered standing , fig4 . 3 . the control system makes it possible for the knee joint and the ankle joint to cooperate . the active drive unit in the knee joint strives to straighten the knee joint while at the same time the active drive unit in the ankle joint presses the front of the foot towards the ground , fig4 . 2 . in this manner , the ankle joint helps to straighten the knee joint , thereby reducing the energy consumption . fig4 illustrates the consequences of a passive foot , dashed lines , in combination with an active knee joint . the passive foot gives a higher knee joint position and the gait will be higher than it need be , and it will be more difficult and require more energy for the user to raise himself up on the step . the contact point of the passive foot on the step is moved forwards compared with a foot which can perform a dorsal flexion , which results in also the center of gravity of the body having to be moved forwards . the solid lines indicate how climbing a staircase can be performed using a leg prosthesis according to the invention . fig5 illustrates the swing phase when climbing a staircase . also in this case the active drive units in the knee joint and the ankle joint are used . to prevent the prosthesis wearer from hitting the step with his foot and stumbling in the swing phase when climbing a staircase , it is important that the knee joint and ankle joint create a safe distance to the staircase . this is done by the active drive of the knee joint bending the joint and the drive of the ankle joint performing a dorsal flexion of the foot , fig5 . 1 . the leg prosthesis system according to the invention has then created a safe distance to the staircase and also a good starting position for positioning for the next gait . fig5 shows the consequences of a completely passive system , dashed lines . the knee joint does not bend the foot away , and the foot instead bumps into the staircase . fig6 illustrates the descending of a staircase . here both knee joint and ankle joint are mainly passive . the movement , fig6 . 1 to fig6 . 3 , brakes the fall of the body by means of the passive brake units in knee joint and ankle joint . the dashed lines indicate the consequences of a passive foot which is not capable of performing a dorsal flexion . the active drive units can optionally be used to help straighten knee joint and ankle joint in the swing phase . fig7 to fig9 illustrate walking on a very sloping surface . the leg prosthesis system according to the invention then functions in the same way as when climbing a staircase . the angle of knee joint and ankle joint is the only thing that distinguishes the climbing of a staircase from walking on a very sloping surface . when walking on a slightly sloping surface , the walking can be more resembled to walking on flat ground . fig4 , fig5 , fig7 and fig8 illustrate ordinary situations which require much energy to be managed . by letting the leg prosthesis system 1 cooperate with the prosthesis wearer &# 39 ; s body and existing lower extremities , it is possible to imitate the energy - saving way of the human body to perform the movement . for minimum consumption of energy , all joints in the lower extremities are allowed to cooperate , and the remaining stump of the prosthesis wearer can cooperate with the at least one movable joint in the leg prosthesis system . the leg prosthesis system should supplement the prosthesis wearer and should preferably , but not restrictively , be controlled by him or her . with a leg prosthesis system 1 and / or a method according to the invention , the disconnectable active drive unit 4 , 4 ′ of a knee joint or ankle joint makes it possible for the system and the method to use a combination of active and passive operation . the control system 15 can select the optimal method of performing a movement . the knee joint 2 can be active while the ankle joint 3 is passive and vice versa . for example , the knee joint 2 can perform the swinging movement in the swing phase using only the passive brake unit 2 while the ankle joint 3 uses its active drive unit for dorsal flexion of the foot in order to create extra ground clearance . fig1 and fig1 are side views in cross - section of a knee joint which , for instance , may be included in the leg prosthesis system 1 . the socket 13 is connected to the movable knee joint 2 which in turn is connected to a hydraulic piston 9 via a link arm 10 . fig1 shows how the piston 9 is moved when the knee joint is angled . fig1 shows a knee joint 2 according to the invention in its active state with a drive unit 4 , a brake unit 5 and a control system 15 . in this embodiment , the brake unit 5 involves throttling of the hydraulic oil which provides braking / dampening of the movement of the joint . the battery 11 drives the hydraulic pump 6 of the drive unit 4 via a motor ( not shown ) for operating the valve 8 of the brake unit 5 . the battery 11 also drives the control system 15 and transducers and sensors ( not shown ) of the leg prosthesis system 1 . the control system 15 in turn controls the drive unit 4 and the brake unit 5 and receives input data from transducers and sensors ; in addition the control system 15 coordinates the movements of the knee joint 2 and the ankle joint 3 . for activation of the drive unit 4 , according to fig1 , the hydraulic pump 6 is started , the pressure increases on one side of the pump 6 and , via one of the ducts which open adjacent to the spring 17 , the valve cone 7 is pressed aside and the duct system of the drive unit will communicate with the cylinder 16 where the piston 9 works and thus the pump 6 actuates the piston 9 in one or the other direction . when the active drive unit 4 is activated , the valve 8 in the passive brake unit 5 should be completely closed to be able to use the maximum efficiency of the hydraulic pump 6 . the active drive unit can drive the knee joint 2 in both directions , in the direction towards a straightened knee joint and in the direction to bend the knee joint . in fig1 , the active drive unit acts to straighten the knee joint 2 . when the piston 9 is moved in the cylinder 16 , it acts on the link arm 10 which in turn acts on the knee joint 2 to perform a movement . alternative types of driving and motors can be used for the leg prosthesis system other than those mentioned above . according to fig1 the drive unit 4 is disconnected by the hydraulic pump 6 being switched off . the pressure decreases and the spring 17 presses the valve cone 7 back to its rest position , that is the valve cone 7 closes the ducts to the drive unit 4 . the brake unit 5 is activated when the drive unit 4 is disconnected . a movement of the knee joint 2 actuates the piston 9 via the link arm 10 , the hydraulic oil in the cylinder 16 is pressed through the valve 8 of the brake unit 5 and the degree of braking / dampening can be adjusted by varying the opening degree of the valve 8 . the braking can be varied in brake force and can be varied from a completely unbraked ( freely swinging ) to a completely braked ( locked ) knee joint 2 . the foot 14 with the ankle joint 3 according to fig1 is shown in its active state and functions similarly to the knee joint according to fig1 and fig1 . to activate the drive unit , the hydraulic pump 6 ′ is started , the pressure is increased on one side of the pump 6 ′ and via one of the ducts which open adjacent to the spring 17 ′, the valve cone 7 ′ is pressed aside and the duct system of the drive unit will communicate with the cylinder 16 ′ where the piston 9 ′ works . in this manner , the pump 6 ′ actuates the piston 9 ′ in one or the other direction . when the active drive unit 4 ′ is activated , the valve 8 ′ in the passive brake unit 5 ′ should be completely closed to be able to use the maximum efficiency of the hydraulic pump 6 ′. the piston 9 ′ actuates the link arm 10 ′ which in turn actuates the ankle joint 3 to perform a movement of the foot 14 relative to the interconnecting element 12 . the drive unit 4 ′ is disconnected by the hydraulic pump 6 ′ being switched off . the pressure decreases and the spring 17 ′ presses the valve cone 7 ′ back to its rest position , that is the valve cone 7 ′ closes the ducts to the drive unit 4 ′. the brake unit 5 ′ in fig1 is then activated ; in normal working conditions the hydraulic pump 6 ′ is then switched off . a movement of the ankle joint 3 in the passive state actuates the piston 9 ′ via the link arm 10 ′, the hydraulic oil in the cylinder 16 ′ is pressed through the valve 8 ′ of the brake unit 5 ′ and the brake force can be adjusted by varying the opening degree of the valve 8 ′. the braking can be varied in brake force and can be varied from a completely unbraked ( freely swinging ) to a fully braked ( locked ) ankle joint 3 . if the leg prosthesis system 1 merely comprises a foot prosthesis 3 according to the invention , for instance at an amputation level below the knee joint , the foot prosthesis still needs a battery 11 ′ and a control unit 15 ′ which may then be arranged , for instance , around the interconnecting element or on a leg - enclosing socket . it goes without saying that the invention should not be considered limited to the embodiments described above and illustrated in the drawings , with the described variants and alternatives , and can be modified additionally in various ways within the scope of the appended claims .

US-201313846695-A

an ornamental corner piece for attachment to a casket includes a back plate which is adapted to mount to the corner of a casket . an attachment clip is operatively mounted within an elongated groove in the back plate . the clip member has at least one keyhole groove comprising an opening and a slot . an ornamental corner insert with at least one attachment member selectively slidingly engages the keyhole groove in the attachment clip such that the ornamental corner insert may be selectively mounted to or removed from the back plate . the attachment clip includes an indexing member . when the attachment clip is installed , the indexing member extends into a throughhole in the elongated groove in the back plate . the indexing member properly orients the attachment clip in the elongated groove . other embodiments of the invention are also disclosed .

with reference to fig1 , a casket 10 is shown incorporating the corner attachment mechanism 12 of the present invention . the casket has a top 14 , a pair of oppositely disposed end walls 16 and two oppositely disposed side walls 18 . advantageously , the casket 10 may be made from wood , although the corner attachment mechanism 12 is not limited to use on wooden caskets , i . e ., the corner attachment mechanism 12 has equal applicability to metal caskets . with further reference to fig2 , end walls 16 and side walls 18 are joined by brace or mounting member 20 . brace 20 includes throughhole 22 which , as described below , is sometimes used to mount corner attachment mechanism 12 to the casket 10 . the ends of end wall 16 and side wall 18 do not meet such that an opening 24 is formed which provides access to the interior of the casket 10 . corner attachment mechanism 12 includes a back plate 30 , an attachment clip 32 , and an ornamental corner insert 34 . the back plate 30 includes end pieces 36 , 38 joined by vertical member 40 . vertical member 40 includes an elongated groove 42 with a throughhole 44 extending from the front side of the vertical member 40 to the back side of vertical member 40 . vertical member 40 is secured to brace 20 by fasteners 45 . fasteners 45 could be screws , nails , brads and the like , but are preferably screws . vertical member 40 is preferably wood but could be made from any suitable structural material such as steel , aluminum , plastic or the like . with reference to fig2 - 5 , attachment clip 32 is sized to rest within and conform to the elongated groove 42 . attachment clip 32 is removably affixed to vertical member 40 with fasteners 46 inserted through throughholes 48 in attachment clip 32 . fasteners 46 are preferably screws . attachment clip 32 includes an indexing member 49 ( fig4 ) with throughhole 50 which aligns with and penetrates throughhole 44 when attachment clip 32 is placed into elongated grove 42 . indexing member 49 is positioned closer to the upper end of attachment clip 32 than the lower end . as a result of the offset position of indexing member 49 , the attachment clip 32 can be inserted into elongated groove 42 in only one orientation . as such , the installation and removal of the ornamental corner insert 34 will be consistent for all caskets 10 . that is , the ornamental corner insert 34 will always be installed by sliding it from left to right and removed by sliding it from right to left . with specific reference to fig4 and 5 , attachment clip 32 further includes two keyhole grooves 52 , 54 . keyhole grooves 52 , 54 include , respectively , openings 56 , 58 and slots 60 , 62 . slots 60 , 62 are partly formed by oppositely disposed rib members 64 , 66 . each rib member 64 , 66 includes a protrusion 68 , 70 . as will be explained in greater detail below , protrusions 68 , 70 assist in attaching ornamental corner insert 34 to the attachment clip 32 . ornamental corner insert 34 includes a decorative or ornamental side 80 and a mounting side 82 . generally , the decorative side 80 can be of any aesthetically pleasing shape . mounting side 82 , however , is preferably , but not necessarily , flat so that the ornamental corner insert 34 can be flushly mounted to vertical member 40 . threaded inserts 84 , 86 , 88 are flush mounted to mounting side 82 . as shown in fig2 , fasteners , and , preferably , shoulder screws 90 , 92 , are threaded into threaded inserts 84 , 88 . shoulder screws 90 , 92 include heads 94 , 96 and shoulder members 98 , 100 . preferably , the shoulder screws are # 14 - 10 type a , blunt tip shoulder screws sold by modular systems , inc . of fruitport , mich . heads 94 , 96 are sized in order that they may fit through openings 56 , 58 but not fit through rib members 64 , 66 . accordingly , to attach ornamental corner insert 34 to back plate 30 , the heads 94 , 96 of shoulder screws 90 , 92 are inserted into openings 56 , 58 . the ornamental corner insert 34 is then moved from left to right , as viewed in fig2 , such that the protrusions 68 , 70 on rib members 64 , 66 positively engage the shoulder screws 90 , 92 to hold them in slots 60 , 62 . to remove the ornamental corner insert 34 and possibly replace it with one of a different design , the ornamental corner insert 34 is moved from right to left until heads 94 , 96 are allowed to escape through openings 56 , 58 . advantageously , the design of back plate 30 and attachment clip 32 may accommodate former ornamental corner inserts which do not incorporate shoulder screws 90 , 92 . these former ornamental corner inserts typically have only a threaded rod protruding from its back for securing it to the corner of a casket . as such and with reference to fig6 , a former ornamental corner insert 112 is shown without inserts 84 , 88 . in this configuration , only threaded insert is present to receive threaded rod 114 . to install ornamental corner insert 112 to casket 10 , threaded rod 114 is inserted through indexing member 49 and throughhole 22 of brace 20 . wing nut 118 threadingly engages threaded rod 114 to secure ornamental corner insert 112 to back plate 30 . former ornamental corner insert 112 is representative of the corner inserts which must be rigidly affixed to the corner of caskets . judicious placement of indexing member 49 allows the former style ornamental corner inserts 112 to be used with attachment clip 32 and back plate 30 , i . e . be retrofitted according to the principles of the present invention . alternatively threaded insert 86 can be eliminated , with the threaded screw being screwed directly into the wood , plastic or metal insert . advantageously , ornamental corner insert 34 may be installed onto casket corners not incorporating back plate 30 and attachment clip 32 . that is , ornamental corner insert 34 of the present invention is not restricted to use with only back plate 30 and attachment clip 32 . importantly , ornamental corner insert 34 may be used on caskets which were initially constructed using former ornamental corner insert 112 . accordingly and with reference to fig7 , the ornamental corner insert 34 is shown affixed to a back plate 124 . back plate 124 is representative of back plates used previously in conjunction with former ornamental corner insert 112 . back plate 124 is similar to back plate 30 ; however , back plate 124 does not include elongated groove 42 . because back plate 124 does not include a place to secure attachment clip 32 , shoulder screws 90 , 92 cannot be used to secure ornamental corner insert 34 to back plate 124 . as such , shoulder screws 90 , 92 are removed and threaded rod 114 is threaded into threaded insert 86 . to install ornamental corner insert 34 to back plate 124 , threaded rod 114 is inserted through throughhole 44 and throughhole 22 and held in place with threaded wing nut 118 . the benefit of using the shoulder screws in conjunction with attachment clip 32 is that the ornamental corner insert 34 can be installed and removed quickly and efficiently without having to access the interior of the casket 10 . the embodiments shown in fig5 and 6 , however , require the use of hand tools and access to the interior of the casket 10 in order that wing nut 118 can be threaded onto threaded rod 114 . the embodiments referenced in fig2 - 7 are preferably used with a casket 10 constructed of wood . another embodiment of the present invention is used on a casket formed from sheet metal , e . g ., steel or aluminum . accordingly , and with reference to fig8 , a casket 128 made from steel is shown with a corner attachment mechanism 130 . the corner attachment mechanism 130 includes a base or mounting member 132 , a back plate 134 and an ornamental corner insert 136 . base 132 is affixed to the corner of casket 128 with fasteners , preferably screws , 138 . base 132 and back plate are preferably made from plastic . integrally molded within back plate 134 are keyhole grooves 140 , 142 which are similar to the geometry of keyhole grooves 52 , 54 . more specifically , keyhole grooves 140 , 142 include openings 144 , 146 and slots 148 , 150 which are similar to openings 56 , 58 and slots 60 , 62 . back plate 134 also includes a plurality of oppositely disposed fastening members 152 which engage oppositely disposed slots 154 along the vertical edges of base 132 to secure back plate 134 to base 132 . in this embodiment , back plate 134 does not include throughhole 44 . as such , the ornamental corner insert 112 , having only threaded insert 86 , cannot be attached to base 132 . like the attachment clip 32 of fig2 , the back plate 134 permits the ornamental corner insert 136 to be installed from left to right and removed from right to left . for example , to install the ornamental corner insert 136 , the heads 94 , 96 are inserted into openings 144 , 146 of keyhole grooves 140 , 142 and slid from left to right across slots 148 , 150 . referring now to fig1 , there is illustrated yet another embodiment of the present invention for use on sheet metal caskets . with like numbers representing like elements , the primary difference between the fig1 embodiment and the fig8 embodiment is the design and construction of the grooves 140 ′ and 142 ′ in the plate 134 . more particularly , groove 140 ′ includes a first keyhole portion comprising opening 144 ′ and slot 148 ′, and a second non - keyhole portion comprising slot 149 ′. similarly , groove 142 ′ includes a first keyhole portion comprising opening 146 ′ and slot 150 ′, and a second non - keyhole portion comprising slot 151 ′. as illustrated , the longitudinal axis of slot 149 ′ is perpendicular to the longitudinal axis of slot 148 ′. similarly , the longitudinal axis of slot 151 ′ is perpendicular to the longitudinal axis of slot 150 ′. to install the casket corner ornament 136 , the heads 94 , 96 are inserted into openings 144 ′, 146 ′ of grooves 140 ′, 142 ′; ornament 136 is then moved generally parallel to a plane defined by plate 134 from left to right thus sliding heads 94 , 96 from left to right in slots 148 ′, 150 ′. the ornament 136 is then moved again generally parallel to the plane defined by plate 134 downwardly thus sliding heads 94 , 96 down in slots 149 ′, 151 ′. the multi - direction movement to install ornament 136 in the fig1 embodiment reduces the potential for the ornament 136 to become inadvertently dislodged from plate 134 . while the two directions of motion to install the ornament 136 in the fig1 embodiment have been illustrated as being perpendicular , the openings , grooves , etc . could as well be configured such that the directions of motion were not perpendicular , but simply non - parallel . furthermore , while the motions to install ornament 136 in the fig1 embodiment have been illustrated as being rectilinear , the openings , grooves , etc . could as well be configured such that the motions were not rectilinear , but curvilinear . all such variations are within the scope of the present invention . while the present invention has been illustrated by a description of various preferred embodiments and while these embodiments have been described in considerable detail in order to describe the best mode of practicing the invention , it is not the intention of the applicants to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications within the spirit and scope of the invention will readily appear to those skilled in the art . the invention itself should only be defined by the appended claims , wherein we claim :

US-20443505-A

a curtain hanger for hanging a curtain . the curtain hanger can be inserted into a pocket of a curtain . the curtain hanger can include a plurality of teeth or barbs that engage vertical stitches and / or pleats at edges of the pocket to hold the curtain hanger in the pocket . the teeth can be arranged at different widths and / or different angles such that the curtain hanger can be pinched to fit into pockets of different widths . the teeth can also be angled upwardly such that a tugging force on the curtain spreads the teeth apart and forces them into stronger engagement with the vertical stitches and / or pleats at the edges of the pocket .

curtains are used in a variety of applications . for example , a curtain can cover a window or partition a space into separate sections . for example , in a hospital , curtains may be used to provide privacy to different beds in a hospital ward . as another example , curtains can be used to separate a first - class cabin of an aircraft from a coach class cabin of an aircraft . in various aspects described herein , hangers can be attached within pockets on the top of the curtain so that the curtain can be hung from the ceiling , wall , bulkhead , and / or other support structure . with reference now to fig1 a and 1b , aspects of a curtain hanger 100 include a suspension member 101 . the suspension member 101 includes a hook 102 attached to a neck 110 . the hook 102 can include an opening 104 in communication with an aperture 106 . the aperture 106 can engage a curtain rod or other attachments ( discussed below ). the curtain hanger 100 can include two wings 120 extending in substantially opposite directions from the neck 110 of the suspension member 101 . each wing 120 can include a first member 122 and a second member 124 extending from the neck 110 . the first member 122 and the second member 124 can transition into a body or support 128 . the first member 122 and the second member 124 , the body 128 , and the neck 110 can define an aperture 126 . the support 128 of each wing 120 can include a plurality of gripping teeth or barbs ( e . g ., teeth 134 a - d ). the body 128 can also include a grip portion 130 and a tab 132 . the curtain hanger 100 illustrated in fig1 a is in an undeformed state . referring now to fig1 b , the curtain hanger 100 ′ can be gripped in the grip portions 130 ( e . g ., by a person &# 39 ; s fingers , by a pair of pliers , by an installation tool , etc .) and squeezed , resulting in a force f 1 being applied to the grip portions 130 and / or to the tabs 132 . when sufficient force f 1 is applied to the grip portions 130 and / or to the tabs 132 , the first member 122 and the second member 124 can resiliently deform such that the wings 120 can move in the direction of arrows a toward the hook 102 . in various aspects , the curtain hanger 100 is made of a somewhat elastic material , such as a nylon polymer or another plastic that returns to an original shape after being deformed ( i . e ., is resiliently deformable ). in various aspects , the curtain hanger 100 can be made of metal , such as spring steel . fig2 a and 2b illustrate the curtain hanger 100 attached to a slider 200 . a plurality of sliders 200 can engage a slider track ( e . g ., mounted to a ceiling of a room or to a bulkhead in an aircraft cabin ). the plurality of sliders 200 can slide along the slider track to expand or retract a curtain attached to curtain hangers 100 . each slider 200 can include a loop 202 and a slider track engagement member 204 . the slider track engagement member 204 can engage the slider track such that the slider 200 can move along the track but cannot be pulled out of the track under ordinary forces that might be applied to the curtain , curtain hanger 100 , and / or slider 200 . in various aspects , the slider 200 can rotate about an axis 220 to enable the curtain hanger 100 to rotate to follow movement of a curtain suspended from the curtain hanger 100 . in various aspects , the entire slider 200 can rotate about the axis such that the slider track engagement member 204 rotates relative to the track . in various other aspects , the slider track engagement member 204 may not rotate relative to the track , but the loop 202 can rotate relative to the slider track engagement member 204 . as shown in fig2 a and 2b , the aperture 106 of the hook 102 of the curtain hanger 100 can engage the loop 202 of the slider 200 by passing the loop 202 through the opening 104 in the hook 102 . referring now to fig3 a and 3b , in various aspects , a plastic strap or zip tie 210 can be wrapped around the hook 102 after the hook has engaged the loop 202 of the slider 200 . the hook 102 can include a flared out portion 108 that can prevent the secured zip tie 210 from slipping off the hook 102 . the zip tie 210 can help prevent the hook 102 from being pulled open ( e . g ., if someone pulls down on a curtain being suspended by the curtain hanger 100 ) such that the curtain hanger can be pulled off of the slider 200 . in various other aspects , the hook 102 of the curtain hanger 100 can be attached to various other types of hanging assemblies . for example , each hook 102 can engage a curtain rod . in various other aspects , the curtain hanger may engage a slider feature using a shape different from a hook . for example , referring to fig8 a and 8b , in various aspects , the suspension member includes a neck 110 that terminates in a spherically - shaped cap 802 . a slider 804 can include a bent sheet of material 806 ( e . g ., steel , aluminum , etc .) that includes an aperture 808 with two portions . a first portion 810 of the aperture 808 includes a dimension large enough for the spherically - shaped cap 802 on the end of the neck 110 to pass through . a second portion 812 of the aperture 808 includes a dimension too small for the spherically - shaped cap 802 on the end of the neck 110 to pass through . generally , the first portion 810 of the aperture 808 can be positioned higher than the second portion 812 of the aperture 808 . in use , the spherically - shaped cap 802 on the end of the neck 110 of the curtain hanger 100 can be passed through the first portion 810 of the aperture 808 and thereafter be moved to the second portion 812 of the aperture 808 ( as shown in fig8 b ) such that the smaller dimension of the second portion retains the spherically - shaped cap 802 of the neck 110 . referring now to fig4 a and 4b , the gripping teeth 134 a - d of the curtain hanger 100 can define respective angles relative to an upward direction ( indicated by arrow u ) of a longitudinal axis 150 , such that at least one of the gripping teeth 134 a - d includes an upward — facing component . in both the undeformed state shown in fig4 a and the deformed state shown in fig4 b , the curtain hanger 100 and 100 ′ can define a longitudinal axis 150 ( e . g . along the neck 110 ). for the purpose of illustrating angles of the teeth 134 a - d , fig4 a and 4b also show a displaced longitudinal axis 150 ′. in the aspect of the curtain hanger shown in fig4 a and 4b , each wing 120 of the curtain hanger 100 includes four gripping teeth 134 a , 134 b , 134 c , and 134 d . each gripping tooth can define an angle relative to an upward direction ( indicated by arrow u ) of the longitudinal axis 150 ( i . e ., 150 ′). for example , a first gripping tooth 134 a can define an angle α relative to the upward direction of the longitudinal axis 150 . as another example , a second gripping tooth 134 b can define an angle β relative to the upward direction of the longitudinal axis 150 . as another example , a third gripping tooth 134 c can define an angle γ relative to the upward direction of the longitudinal axis 150 . as another example , a fourth gripping tooth 134 d can define an angle θ relative to the upward direction of the longitudinal axis 150 . in various aspects , in the undeformed state , at least one of the gripping teeth 134 a - d can be arranged so that the angle relative to the upward direction of the longitudinal axis 150 is acute ( i . e ., less than ninety degrees ). for example , referring to fig4 a , at least angles α and β are acute relative to the upward direction of the longitudinal axis 150 . in the deformed state , shown in fig4 b , angles α , β , γ , and θ of the gripping teeth 134 a - d , respectively , can become more acute and / or can become acute . for example , the angle α defined by the first gripping tooth 134 a is more acute in the deformed state of the curtain hanger 100 ′ ( shown in fig4 b ) than in the undeformed state of the curtain hanger 100 ( shown in fig4 a ). as another example , the angle β of the second gripping tooth 134 b is also more acute in the deformed state of the curtain hanger 100 ′ than in the undeformed state of the curtain hanger 100 . as another example , the angle γ of the third gripping tooth 134 c is approximately perpendicular to the longitudinal axis in the undeformed state of the curtain hanger 100 but is acute relative to the upward direction of the longitudinal axis . as a final example , the angle θ of the fourth gripping tooth 134 d is an obtuse angle ( i . e ., more than ninety degrees ) relative to the upward direction of the longitudinal axis 150 in both fig4 a and 4b . however , the angle θ is less obtuse ( i . e ., closer to being a perpendicular angle or an acute angle ) in the deformed state of the curtain hanger 100 ′ shown in fig4 b than in the undeformed state of the curtain hanger 100 shown in fig4 a . further deformation of the curtain hanger 100 may cause the angle θ of the fourth gripping tooth 134 d to become acute relative to the upward direction of the longitudinal axis 150 . fig5 is a perspective view of a top portion of an aspect of a curtain for use with aspects of the curtain hanger 100 . the curtain includes a first panel of fabric 504 and a second panel of fabric 506 . the panels of fabric 504 and 506 can be stitched with thread to form pockets 502 . for example , a horizontal stitch 512 can define bottoms of the pockets . also , vertical stitches 510 can define sides of the pockets 502 and pleats 508 between the pockets 502 . the pleats 508 can be formed , generally , by folding a portion of the panels 504 and 506 and sewing the stitches 510 through the folded panels 504 and 506 . the pockets 502 are generally open on top . for illustration purposes , the pockets 502 are shown with the panels 504 and 506 spaced apart . in various aspects , when two adjacent pleats 508 are pulled apart , the pocket 502 there between can become flat such that panels 504 and 506 lie against one another . referring now to fig6 a and 9a , a curtain hanger 100 can be inserted into each pocket 502 of the curtain 500 . fig6 a illustrates an undeformed curtain hanger 100 and a deformed curtain hanger 100 ′. as shown , the undeformed curtain hanger 100 may include a dimension d that is slightly larger than a width w of the pocket 502 . the deformed curtain hanger 100 ′ may include a dimension d that is slightly smaller than the width w of the pocket 502 . in various instances , the curtain hanger 100 ′ can be deformed to a degree necessary to fit within pockets of different widths ( block 902 of the method 900 shown in fig9 a ). referring now to fig6 b , the deformed curtain hanger 100 ′, with its smaller dimension d , can be inserted into the pocket 502 between the panels 504 and 506 ( shown in fig5 ) of fabric ( block 904 of fig9 a ). for example , an installer can squeeze the grip portions 130 and / or tabs 132 ( shown in fig1 a ) of the curtain hanger 100 to deform it . while squeezing the grip potions 130 and / or tabs 132 , the installer can insert the deformed curtain hanger 100 ′ into the pocket 502 ( see fig5 a , and 6b ). referring now to fig6 c , after the deformed curtain hanger 100 ′ is inserted into the pocket 502 , the grip portions 130 and / or tabs 132 can be released to allow the deformed curtain hanger 100 ′ to relax and expand toward the undeformed state 100 ( block 906 ). as the deformed curtain hanger 100 ′ expands , some of the gripping teeth 134 a - d can engage the vertical stitching 510 and the portions of fabric panels 504 and 506 that make up the pleats 508 . the engagement of ( at least some of ) the gripping teeth 134 a - d with the vertical stitching 510 and / or the material of the pleats 508 can hold the curtain hanger 100 in place . referring again to fig4 a , the gripping teeth 134 a - d can each be arranged at a different distance from the longitudinal axis such that each pair of teeth defines a different width for the curtain hanger 100 . for example , the first gripping teeth 134 a of the wings 120 can define a first width w 1 . as another example , the second gripping teeth 134 b of the wings 120 can define a second width w 2 that is less than the first width w 1 . as another example , the third gripping teeth 134 c of the wings 120 can define a third width w 3 that is less than either the first width w 1 or the second width w 2 . as another example , the fourth gripping teeth 134 d of the wings 120 can define a fourth width w 4 that is less than any of the first width w 1 , the second width w 2 , and the third width w 3 . referring again to fig4 b , deformation of the curtain can cause the widths to be reduced by varying degrees . for example , in the deformed state of the curtain hanger 100 ′ shown in fig4 b , the width defined by the first gripping teeth 134 a of the wings 120 can be reduced to w 1 ′. however , the width defined by the second gripping teeth 134 b of the wings 120 can be reduced to a lesser degree to a width w 2 ′ such that w 2 ′ is greater than w 1 ′. if a deformed curtain hanger 100 ′ is installed into different pockets of different widths , the tooth or teeth 134 a - d that engages the vertical threads and / or pleats of the pocket may depend on the width of the pocket . for example , if the pocket is of a width that is close to the width of the curtain hanger 100 in its undeformed state , then the first gripping tooth 134 a is most likely to engage the vertical threads and / or pleats , although additional teeth ( e . g ., teeth 134 b , 134 c , and 134 d ) may also engage the threads and / or pleats . as another example , if a pocket is significantly narrower than the width of the curtain hanger 100 in its undeformed state , then the deformed curtain hanger 100 ′ may not return to its fully undeformed state after it is inserted into the pocket and released . as a result , the first tooth 134 a may not engage the vertical stitches and / or pleats of the pocket . instead , referring again to fig4 b , the second tooth 134 b may engage the vertical stitches and / or pleats . by placing the teeth 134 a - d at different widths , a single curtain hanger 100 design can be deformed to different degrees to engage pockets of different widths . as described above , the teeth 134 a - d of the curtain hanger include at least one tooth that is arranged at an acute angle relative to an upward direction of a longitudinal axis 150 of the curtain hanger 100 . as a result , the teeth with such an acute angle include an upward - facing component . fig7 illustrates a single curtain hanger 100 installed in a curtain 500 . the curtain 500 can include a plurality of such curtain hangers 100 suspending the curtain 500 from a curtain rod , sliders 200 , or the like . as shown in fig7 , teeth 134 a and 134 b may be engaged with the vertical stitching 510 and / or the pleats 508 and include an upward - facing component . this upward - facing component of the teeth 134 a and 134 b may enable the curtain hanger 100 to more - strongly engage the vertical stitches 510 and / or pleats 508 on the sides of the pocket 502 when a force f 2 is applied to the curtain 500 . for example , someone may grab onto ( and pull downwardly on ) the curtain 500 for stability . the force f 2 is ultimately transmitted to the curtain rod or the sliders 200 through the curtain hangers 100 . the force f 2 can be transmitted from the curtain 500 to the teeth 134 a and 134 b that are engaged with the vertical stitches 510 and / or the pleats 508 of the curtain . each tooth 134 a and 134 b may receive a fraction f of the force f 2 applied to the curtain . the forces f may pull the wings 120 of the curtain hanger 100 downwardly in the direction of arrows b . as a result , the teeth 134 a and 134 b shift outwardly in the direction of arrows c . this outward shift can cause the teeth 134 a and 134 b to engage ( e . g ., dig into ) further into the vertical stitches 510 and / or the pleats 508 . additionally , the unengaged teeth 134 c and 134 d may begin to engage the vertical stitches 510 and / or the pleats 508 . as a result , the teeth 134 a - d may be more strongly engaged with the vertical stitches 510 and / or the pleats 508 of the curtain 500 , making it less likely that the curtain hangers 100 will break free from the pockets 502 when the force f 2 is applied to the curtain 500 . as described above , in various aspects , the wings 120 of the curtain hanger 100 can include a first member 122 and a second member 124 . having a plurality of members can inhibit twisting of the body 128 of each wing 120 when forces f are applied to the teeth 134 a - d . referring again to fig7 , if the second member 124 is removed , when the force f is applied to the teeth 134 a - d , the body 128 may twist about the first member 122 and allow the teeth 134 a - d to slip out of engagement with the vertical stitches 510 and / or the pleats 508 . having a first member 122 and a second member 124 can reduce such twisting and keep the teeth 134 a - d engaged with the vertical stitches 510 and / or pleats 508 when the force f 2 is applied . in the event that too much force f 2 is applied to the curtain 500 , the curtain 500 may fail by vertical stitching 510 tearing . such a failure may be readily repaired by repairing and / or replacing the broken vertical stitching 510 . in various aspects , the curtain hanger may not be deformable . for example the wings of a curtain hanger may be attached to a neck of the curtain hanger by hinges so that the wings pivot about the hinges to move towards the neck ( e . g ., arrow a shown in fig1 b ) or away from the neck ( e . g ., arrow b shown in fig7 ). the hinges can include springs or the like to bias the wings away from the neck . fig9 b illustrates a method 910 for removing a curtain hanger 100 from a curtain ( e . g ., curtain 500 shown in fig7 ). in block 912 , the wings 120 of the curtain hanger 100 are urged toward the suspension member 101 . this could be done , for example , by an operator reaching into a pocket ( e . g ., pocket 502 ) of the curtain with her fingers or an appropriate mechanical gripping tool and squeezing the grip portions 130 . in some instances , the curtain hanger 100 may be pushed into the pocket as the grip portions 130 are squeezed to enable the teeth 134 a - d to disengage from the vertical stitches ( e . g ., vertical stitching 510 ) and / or the pleats ( e . g ., pleats 508 ) that form the pockets . once the teeth 134 a - d have disengaged from the stitches and / or pleats , in block 914 , the curtain hanger 100 can be removed from the pocket . in block 916 , the operator can then release the grip portions 130 , enabling the wings 120 to return to a position away from the suspension member 101 . the descriptions of the various aspects of the present invention have been presented for purposes of illustration , but are not intended to be exhaustive or limited to the aspects disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described aspects . the terminology used herein was chosen to best explain the principles of the aspects , the practical application or technical improvement over technologies found in the marketplace , or to enable others of ordinary skill in the art to understand the aspects disclosed herein . while the foregoing is directed to aspects of the present invention , other and further aspects of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow .

US-201514607421-A

a floating gearbox includes an outer housing with first and second side walls opposite and spaced apart from each other and an inner gear assembly received within the outer housing . the inner gear assembly comprises an inner housing , a first gear member rotatably received within the inner housing , and a second gear member having an output shaft rotatably supported on the inner housing . a slider plate received within the outer housing has first and second pairs of axially aligned elongate openings , wherein the first and second pairs of elongate openings align with a first axis and a second axis , respectively . pins on the first sidewall are received in the first pair of elongate openings to allow relative sliding movement between the outer housing and the slider plate along the first axis . the inner housing includes pins received in the second pair of elongate openings , allowing relative sliding movement between the inner housing and the slider plate along the second axis .

referring to the drawings , wherein like reference numerals are used to indicate like or analogous components throughout the several views , and with particular reference to fig1 a and 1b , there is illustrated an exemplary embodiment floating gearbox 10 , which includes a front outer housing 20 , a slider plate 40 , an inner gearbox assembly 60 , and a rear outer housing 100 . the slider plate 40 and inner gearbox assembly 60 are secured between the front outer housing 20 and rear outer housing 100 . the front housing 20 is secured to the rear housing 100 via mechanical fasteners 12 , such as screws , rivets , clips , dogs , pawls , or the like . as best seen in fig2 a and 2b , the front outer housing 20 contains a front wall 30 , a first side wall 32 , a second side wall 34 , and a third side wall 36 . the front wall 30 has an opening 24 and pins 22 on its interior surface . the slider plate 40 contains elongated openings 42 , which align with and slidably receive the respective aligned pins 22 of the front housing 20 . the long axis of the openings 42 are aligned with the x axis to allow relative sliding movement between the front outer housing shell 20 and the slider plate 40 in the x axial direction . the slider plate 40 also contains an elongated opening 44 and a large , elongated opening 46 . the large opening 46 aligns with opening 24 of the front housing 20 when the slider plate 40 and the inner gearbox assembly 60 are secured within the front and rear housings , 20 and 100 respectively . referring now to fig3 a and 3b , the inner gearbox assembly 60 includes a front inner gearbox assembly housing 62 and a rear inner gearbox assembly housing 64 . the front inner gearbox assembly housing 62 contains pins 74 and 76 . the pin 74 is slidably received within the elongated opening 44 and the pin 76 is slidably received within the opening 46 when the slider plate 40 is placed on the inner gearbox assembly 60 . the long axis of the openings 44 and 46 are aligned with the y axis to allow relative sliding movement between the inner gearbox assembly 60 and the slider plate 40 in the y axial direction . in the depicted embodiment , the x and y axes are perpendicular to each other and each is perpendicular to the axis of rotation of the output shaft 80 , which is designated the z axis . in the depicted embodiment , the y axis intersects with the z axis , which minimizes or reduces the potential for binding by eliminating off - axis forces . in the depicted embodiment , by using one of the pins 74 or 76 ( 76 in the depicted embodiment ) as the bearing surface for the helical gear 70 , it is ensured that the output axis z is aligned with the y axis of the sliding openings 44 and 46 . it will be recognized , however , space or configuration requirements may require that one of the x or y axes be displaced or offset from the z axis , in which case , such offset axis should be placed as close as possible to the z axis to minimize off - axis forces . for example , in the depicted embodiment , the x axis intersects the y axis at an offset distance d from the z axis , as described below . as best seen in fig4 and 5 , the inner gearbox assembly 60 further includes a motor 66 , such as a dc gearmotor , which drives a worm 68 . the worm 68 , in turn , drives a helical gear or worm wheel 70 . an encoder board 72 including a rotary encoder senses the rotational position of the output shaft 80 of the helical gear 70 . the worm 68 has a first end 94 , a second end 96 , and at least one helical tooth 98 . the helical tooth 98 starts at the first end 94 and travels partially down the worm 68 toward the second end 96 in a helical or thread - like fashion . the helical gear 70 has a plurality of teeth 78 and a gear shaft 80 with an opening 122 . the motor shaft 112 of the motor 66 mates with the second end 96 of the worm 68 and the helical tooth 98 of the worm 68 mates with the teeth 78 of the helical gear 70 . the teeth 78 may be inclined or angled to intermesh with the thread 98 of the worm 68 . the motor 66 , worm 68 , and helical gear 70 are contained and supported within the inner housing shell defined by the front inner gearbox assembly housing 62 and the rear inner gearbox assembly housing 64 via mechanical fasteners 90 . the gear shaft 80 of the helical gear 70 interacts with the exterior environment via a first opening 82 on the front inner housing 62 and a second opening 84 on the rear inner housing 64 . the encoder board 72 is secured to the exterior of the rear inner gearbox assembly housing 64 . the encoder board 72 of the inner gearbox assembly 60 has an opening 88 , which aligns with an alignment pin 73 on the rear inner housing shell 64 to ensure proper alignment of the rotary encoder 72 . a clearance opening 108 is also formed in the rear outer housing 100 to provide a clearance for the pin 73 . referring now to fig6 a , 6 b , 7 a , and 7 b and with continued reference to fig1 - 5 , the slider plate 40 is placed on the inner gearbox assembly 60 , with the pins 74 and 76 on the inner gearbox assembly 60 slidably received within the corresponding openings 44 and 46 on the slider plate 40 . the openings 44 and 46 enable the slider plate 40 to move in the y axial direction relative to the inner gearbox assembly 60 . the inner gearbox assembly 60 and slider plate 40 combination is then placed into the front outer housing 20 , with the pins 22 on the front outer housing 20 slidably received within the corresponding aligned openings 42 on the slider plate 40 . the openings 42 enable the slider plate 40 to move in the x axial direction relative to the front outer housing 20 . in the exemplary illustrated embodiment , the x and y axes are perpendicular to each other , enabling the inner gearbox assembly 60 to float in two cardinal directions without causing any coupling or restorative forces when a torque is applied at the output shaft 120 . in certain embodiments , the x axis defined by the long axes of the openings 42 may be aligned with the z axis ( output drive axis ) to reduce or minimize any off axis forces and is preferable where space permits . in the depicted embodiment , however , the x axis is shown slightly offset by an offset distance d with respect to the z axis , as may be necessary depending on the space constraints of a given application . in such cases , the x axis defined by the openings 42 should be placed as close to the z output axis as possible to reduce or minimize off - axis forces . once the inner gearbox assembly 60 and slider plate 40 have been properly aligned and placed within the front outer housing 20 , the rear outer housing 100 is placed over the combination of the inner gearbox assembly 60 and slider plate 40 and secured via mechanical fasteners 12 . an output drive shaft 120 is inserted into the gear shaft 80 via the opening 122 , as best seen in fig6 a and 6b . as best seen in fig7 a and 7b , a tension member 140 such as a coil spring or the like is connected between a spring pin 106 on the rear outer housing 100 and a spring pin 92 on the inner gearbox assembly 60 . the tension member 140 preloads the gearbox 10 into the upper , centered position . the tension member 140 should provide a force that is sufficient to ensure the gearbox 10 is centered , but not so great as to impart a significant force against the shaft to be driven by the output shaft , such as an adjustment cap 254 of an iv administration set 250 ( see fig8 a , 8 b , and 9 ) as described below . referring now to fig8 a , 8 b , and 9 , the assembled floating gearbox 10 is mounted in a pump assembly 200 by rigidly attaching the front and rear outer housings 20 and 100 , respectively , to the inside of the pump housing 202 . in the depicted embodiment , the floating gearbox 10 is secured within the pump housing 202 via a mounting foot 38 and two snap members 28 and 110 ( see , e . g ., fig5 ). the pump assembly may be as described in u . s . application ser . no . 12 / 906 , 077 filed oct . 16 , 2010 , the entire contents of which are incorporated herein by reference . the mounting foot 38 of the front outer housing 20 engages the interior of the pump housing 202 and a snap member 28 of the front outer housing 20 is attached to a first boss ( not shown ) on the interior of the pump housing 202 . a snap member 110 of the rear outer housing 100 is attached to a second boss ( not shown ) on the interior of the pump housing 202 . once the gearbox 10 is secured within the pump housing 202 , the output drive shaft 120 protrudes through an opening 208 in the pump housing 202 , thus enabling the drive shaft 120 to interface with the adjustment cap 254 . when the pump assembly 200 is ready to be used , an administration set 250 is removably attached into a channel 210 of the pump housing 202 . a latch 214 of the administration set 250 is snapped into a groove 212 of the pump housing 202 and a keyed portion of the output drive shaft 120 is pushed into a complimentary groove or receptacle 260 of the adjustment cap 254 in the correct position to drive the adjustment cap 254 of a fluid flow resistor 252 . when assembled , the slider plate 40 enables the output drive shaft 120 of the floating gearbox 10 to float freely in the plane defined by the x and y axes as it interfaces with the adjustment cap 254 , thus minimizing the potential for binding within the gear transmission system due to misalignment between the axis of rotation of the output shaft 120 ( the z axis ) and the axis of rotation of the output cap 254 ( the driven shaft ). in operation , when the pump assembly 200 is removably secured to the pump housing 202 , pneumatic contacts 216 on the pump housing 202 are pneumatically coupled to a corresponding diaphragm of the respectively aligned pumping chambers 264 within the administration set 250 . by using a system of manifolds and valves within the pump housing 202 and check valves within the administration set 250 , positive or negative air pressure can be selectively applied to the diaphragm of one or both of the pumping chambers 264 in the administration set 250 to selectively pump fluid from fluid sources coupled to fluid inlets 256 through the flow resistor and to the vasculature of a patient . in operation , instructions are provided by a controller such as a processor , microcontroller , or like processing electronics , to operate the motor 66 and drive the worm 68 . as the worm 68 turns , the helical tooth 98 engages the teeth 78 of the helical gear 70 , causing the helical gear 70 and the shaft 80 to rotate . the rotation of the helical gear 70 , in turn , rotates the output drive shaft 120 . when the output drive shaft 120 is interacting with the adjustment cap 254 , the rotation of the output drive shaft 120 rotates the adjustment cap 254 , which may operate a valve to change the resistance of the fluid flow resistor 252 . because the output drive shaft 120 is able to move or float in the x - y plane , it is able to accommodate misalignments between the output shaft and the adjustment cap 254 . the rotary encoder 72 takes position readings from the output drive shaft 120 to determine the rotational position of the adjustment cap 254 . data readings from the encoder 72 are sent to the processer via a data cable 86 . in an exemplary embodiment , the fluid inlets 256 are fluidically coupled to one or more fluid sources ( not shown ), as generally known in the art , e . g ., an iv infusion fluid , medication , or the like , e . g ., via fluid inlet tubes . a fluid outlet 258 may be fluidically coupled to the vasculature of a patient , e . g ., via an iv catheter or cannula ( not shown ), as generally known in the art . operation of the pump assembly 200 is controlled and monitored by the processor electronics ( not shown ) within the pump assembly based on input information . for example , an operator , such as a healthcare provider or the patient , can manually input the desired infusion information via a user input interface , such as a keypad , touch screen , or the like ( not shown ). alternatively , the infusion information may be input using an alternative input means , such as a bar code reader , rfid tag , or the like . after the infusion data is input , it is desirable to confirm the infusion data before the infusion can begin . once the infusion information is input and confirmed , the processing electronics will determine the proper setting for the fluid flow resistor 252 . the flow resistor setting may be based on a number of factors , such as a desired or target flow rate , the volume of fluid to be infused , a desired or target infusion time , infusion fluid parameters such as fluid viscosity , temperature , and others . the fluid flow resistor 252 is rotated to the desired position by the output shaft 120 under programmed control via the gearbox 10 as detailed above . during the infusion , further adjustments may be made to the fluid flow resistor 252 , for example , to fine tune flow rate in response to feedback provided by an inline flow sensor 262 or otherwise in accordance with the input infusion information . it will be recognized that valve position within the fluid flow resistor need not be the only means within the flow control system for controlling or adjusting flow rate , and that the flow resistor may be used in combination with other parameters , such as a fluid driving pressure in the pumping chambers 264 , in order to achieve a desired flow rate . in the depicted preferred embodiment , the administration set 250 may also include an inline flow sensor 262 for sensing flow rate . in the depicted embodiment , the flow sensor is integrally formed with the fluid flow resistor 252 , although a separately formed flow rate sensor is also contemplated . the flow rate sensor 252 is preferably of a type that includes an moveable inline flow object or element ( not shown ), the position of which varies as a function of flow rate and the position of which can be monitored optically to determine an actual flow rate of the iv fluid as it passes out of the flow resistor 252 to the patient . the flow object may be monitored , for example , by an optical sensor , which includes a light source 204 such as an led array and an optical detector 206 , which may be a photosensor array , such as a charged - coupled device ( ccd ) array or the like . the light source 204 and optical detector 206 are preferably disposed on opposite sides of a flow chamber containing the flow object , although other configurations are also contemplated , such as an optical detector 206 positioned to sense light emitted by the light source 204 and reflected by the flow object . the pattern of light is sensed by the detector 206 to determine the position of flow object within the flow resistor 252 . the position information , in turn , is used to determine an actual fluid flow rate . the flow rate information can be sent to the electronic controller to provide feedback , which can in turn , be , used to control fluid flow in accordance with the infusion information . the processing unit may also be programmed to shut off flow by rotating the resistor cap 254 to an off or closed position in response to a detected alarm condition , such as an occlusion , a detected an air bubble in the line , etc . in especially preferred embodiments , the fluid flow resistor 252 and / or inline flow rate sensor 262 may be as described in commonly owned international patent application no . pct / us2009 / 068349 filed dec . 17 , 2009 , entitled “ extended range fluid flow resistor ,” which is incorporated herein by reference in its entirety . the invention has been described with reference to the preferred embodiments . it will be understood that the architectural and operational embodiments described herein are exemplary of a plurality of possible arrangements to provide the same general features , characteristics , and general system operation . modifications and alterations will occur to others upon a reading and understanding of the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations .

US-201113084062-A

the present invention relates to carriers , conjugate and pharmaceutical compositions and their use to increase the potency of drugs and to modify the pharmacokinetics of compounds . more particularly , the present invention relates to conjugates comprising the carrier described herein and their use in the treatment and diagnostic of cancer .

angiopep - 1 and - 2 represents two non - limitative , exemplary embodiments of aprotinin derived peptides which have been tested herein ( fig1 ). taxol which represents a non - limitative exemplary embodiment of a molecule or compound conjugated to the carrier of the present invention was chosen as a candidate anticancer drug as this natural compound , isolated from the bark and needles of the yew tree , is a highly efficient chemotherapeutic . moreover , this compound is approved by the food and drug administration ( fda ) for ovarian cancer , breast cancer , non - small cell lung cancer and kaposi &# 39 ; s sarcoma and is a well characterized anticancer agent . for the in vitro cell proliferation assay , between 2 . 5 and 5 × 10 4 of u87 or a549 cells were seeded in a 24 well tissue culture microplate in a final volume of 1 ml of medium with 10 % serum and incubated for 24 hours at 3tc and 5 % co 2 . the medium was then replaced with serum - free medium and incubated overnight . the next morning the drug was freshly dissolved in dimethyl sulfoxide ( dmso ) and the medium was replaced with complete medium containing the drug at different concentrations in triplicates . the final concentration of dmso was 0 . 1 %. the control used is a microplate well with cells and without drug . the cells were incubated for 48 to 72 hrs at 3tc and 5 % co 2 . after the incubation , the medium was changed and replaced with 1 ml of complete medium containing [ 3 h ]- thymidine ( 1 μci / assay ). the plate was incubated at 3tc and 5 % co 2 for 4 hrs . the medium was removed and the cells washed with pbs heated at 3tc . the cells were fixed with a mix of ethanol : acetic acid ( 3 ; 1 ), then washed with water and precipitated 3 times with 10 % of ice - cold tca ( trichloroacetic acid ). finally 500 μl of pca ( perchloric acid ) were added to the wells and the microplates were heated for 30 min at 65 ° c . and 30 min at 75 ° c . the contents of each well was then transferred in a scintillation vial with 10 ml of scintillation cocktail and the activity was measured in cpm ( count per minute ) on a liquid scintillation counter tri - carb from packard . peptides were iodinated with standard procedures using iodo - beads from sigma . both angiopep - 1 and angiopep - 2 were diluted in 0 . 1m phosphate buffer , ph 6 . 5 ( pb ). two iodo - beads were used for each protein . these beads were washed twice with 3 ml of pb on a whatman filter and re - suspended in 60 μl of pb . 125 i ( 1 mci ) from amersham - pharmacia biotech was added to the bead suspension for 5 min at room temperature . each iodination was initiated by the addition of the peptide ( 100 μg ). after an incubation of 10 min at room temperature , the free iodine was removed by hplc . in order to estimate the efficiency of the taxol - conjugates and formulations on tumor growth , we developed a subcuteanous model of glioblastomas . in this model , 2 . 5 × 10 6 cells in 100 μl of cell medium without serum containing 1 % methylcellulose were subcuteanously injected in the mice flank . the tumor was clearly visible and could be measured using a vernier caliper . the estimated tumor volume was then plotted as a function of time . the uptake of [ 125 i ]- peptides to the luminal side of mouse brain capillaries was measured using the in situ brain perfusion method adapted in our laboratory for the study of drug uptake in the mouse brain . briefly , the right common carotid of ketamine / xylazine ( 140 / 8 mg / kg i . p .) anesthetized mice was exposed and ligated at the level of the bifurcation of the common carotid , rostral to the occipital artery . the common carotid was then catheterized rostrally with polyethylene tubing filled with heparin ( 25 u / ml ) and mounted on a 26 - gauge needle . the syringe containing the perfusion fluid ([ 126 i ]- peptides or [ 14 c ]- inulin in krebs / bicarbonate buffer at a ph7 . 4 gassed with 95 % o 2 and 5 % co 2 ) was placed in an infusion pump ( harvard pump phd 2000 ; harvard apparatus ) and connected to the catheter . prior to the perfusion , the contralateral blood flow contribution was eliminated by severing heart ventricles . the brain was perfused for the indicated times at a flow rate of 1 . 15 ml / min . after 14 . 5 min of perfusion , the brain was further perfused for 60 s with krebs buffer , to wash the excess of [ 125 i ]- proteins . mice were then decapitated to terminate perfusion and the right hemisphere was isolated on ice before being subjected to capillary depletion . aliquots of homogenates , supematants , pellets and perfusates were taken to measure their contents in [ 125 i ]- conjugates by tca precipitation and to evaluate the apparent volume of distribution . since the resistance towards various drugs such as vincristine , etoposide , and doxorubicin is mediated through p - gp ( mdr1 ) overexpression ( fig2 ), any methods of bypassing this efflux pump may potentiate the action of these drugs on various cancer types . the bypass of p - gp may therefore be useful to increase the potency of drugs which are associated with resistance mediated by p - gp . carriers described herein were therefore tested for their ability to bypass p - gp . the conjugation of a drug to the carrier described herein is illustrated in fig3 . briefly , in order to conjugate taxol to the angiopep - 1 or angiopep - 2 carrier , taxol was first activated into n - succinimide ( 2 ′- nhs - txl ) derivative . then amines found for example in lysine residue or amino - terminal of angiopep - 1 or angiopep - 2 reacted on this activated - taxol by forming a peptide bond ( amide bond ). in angiopep - 1 or angiopep - 2 , the amino - terminal ( in position 1 ) and the lysines ( at position 10 and 15 ) were able to react with activated - taxol . therefore , multiple combinations of conjugates was found to occur by the addition of 1 , 2 or 3 taxols to the peptide depending on the molar ratio used ( fig3 ). the whole conjugation was analyzed by hplc and conjugation was confirmed by mass spectra ( maldi - tof ). taxol was found to be releasable from the carrier by the cleavage of the ester bond by esterases . conjugates were therefore efficiently produced by combining the carrier with an anticancer drug . in an exemplary embodiment of the present invention , the production of the txlan2 ( 3 : 1 ) conjugate , was carried out by directly adding 1 mole equivalent of angiopep - 2 to a solution of 2 . 5 moles equivalent of 2 ′- nhs - taxol . the reaction was performed in 68 % dmso in ringer solution ( ph 7 . 3 ), for 1 hr at 12 ° c . and after removing the cold bath , for about 22 hrs at room temperature ( fig4 ). angiopep - 2 , 2 ′- nhs - taxol and txlan2 ( 3 : 1 ) conjugate are shown on the chromatogram by arrows . aliquots of the reaction were sampled and analyzed by hplc after 25 min , 2 hrs 15 min , 5 hrs and 23 hrs as indicated in fig4 . the peaks of angiopep - 2 , 2 ′- nhs - taxol and txlan2 ( 3 : 1 ) conjugate are shown by arrow on the chromatogram . results of fig4 illustrate the disappearance of angiopep - 2 and 2 ′- nhs - taxol during the reaction mainly to the profit of the txlan2 ( 3 : 1 ) conjugate . this mixture of products was separated by hydrophobic chromatography on a rpc 300 mm column with a flow rate at 4 ml / min using akta - explorer ( fig5 ). for the peak that corresponds to the txlan2 ( 3 : 1 ) conjugate , fractions were pooled , analyzed by hplc and ms . in fig5 , the upper chromatogram corresponds to the running reaction at t = 23 hrs whereas the lower one corresponds to the txlan2 ( 3 : 1 ) conjugate which has been confirmed by mass spectrometry ( mw 5107 ) after akta purification . to evaluate the brain uptake of angiopep in vivo , the initial rate of transport for [ 125 i ]- angiopep into mouse brain parenchyma was measured using in situ brain perfusion as described herein . mouse brain was perfused for the indicated times with either [ 125 i ]- angiopep - 2 or [ 14 c ]- inulin . after perfusion , the brain was further perfused for 60 sec with ringer solution to wash the excess of radiolabeled molecules and then the right hemisphere was isolated on ice before being subjected to capillary depletion . aliquots of homogenates , supernatants , pellets and perfusates were taken to measure their contents in [ 125 i ]- angiopep - 2 or [ 14 c ]- inulin . results obtained for the accumulation for these molecules into the brain parenchyma are illustrated in fig6 . the accumulation of [ 125 i ]- angiopep - 2 increased as a function of time and is higher than that of the vascular marker , [ 14 c ]- inulin . we further compared the initial brain uptake after a 5 min perfusion for [ 125 i ]- aprotinin , [ 125 i ]- transferrin and [ 125 i ]- angiopeps ( fig7 ) ( 1 : 1 ). results show that angiopep and aprotinin have a highest initial transport rate than transferrin . in an in vitro assay , taxol ( unconjugated ) was shown herein to block the proliferation of glioblastoma cells ( u - 87 ) with ic50 value of around 10 nm ( fig8 ). the effect of taxol conjugated with the carrier described herein on the proliferation of various cell lines was then evaluated and compared to unconjugated taxol ( referred as taxol ). as shown in table 3a , the ic50 values obtained for the taxol - angiopep - 2 ( txlan2 ) conjugate were very similar to that of unconjugated taxol in many cancer cells . endothelial cells from rat brain ( rbe4 ) were less sensitive than the tested cancer cell lines . overall , these results indicate that the potency of conjugates to block cell proliferation in vitro is similar to the unconjugated taxol . for comparison purposes , results obtained were expressed in term of taxol concentration . most of theses cells ( u - 87 , u - 118 , nci - h460 , a549 ) express lrp . this data is however unavailable for rbe4 cells . the anti - proliferatice activity of the conjugate against cancer cells in vitro was further assessed . in this assay , cancer cells ( u87 and u118 ) were exposed for 48 hrs to taxol ® and txlan2 ( 3 : 1 ) conjugate . incorporation of [ 3 h ]- thymidine in u87 and u118 cells decreased as a function of drug concentrations . the values required to inhibit cell proliferation by 50 % ( ic50 ) were expressed . results obtained from the proliferation assays indicate that the ic50 values required for the inhibition of cancer cell proliferation are expressed in nm and demonstrate that txlan2 ( 3 : 1 ) conjugate is 3 times more potent than paclitaxel , and are in the same range when reported in paclitaxel equivalent ( table 3b ). the capacity of txlan2 ( 3 : 1 ) conjugate to block the proliferation of other cancer cell types was also estimated . lung cancer cells ( nci - h460 ) as well as the breast cancer cell line ( mda - mb231 , mda - mb - 468 , hcc - 1954 , bt - 474 ) in hepatocarcinomas ( sk - hep1 ) and glioblastomas ( u - 87mg ) were also very sensitive to txlan2 ( 3 : 1 ) conjugate ( table 3b ). in order to determine whether the conjugates of the present invention were p - gp substrates or not , mdck cells were stably transfected with human mdr1 ( mdck - mdr1 ) and were subsequently incubated with unconjugated - anticancer drug or with the conjugates of the present invention . in a first experiment , mdck - mdr1 cells were incubated with 3 h - vinblastine ( 3 h - vbl ), rhodamine , 3 h - taxol , 125 i - taxol - angiopep - 1 ( 125 i - txlan1 ), 125 i - taxol - angiopep - 2 ( 125 i - txlan2 ) for 1 hr at 37 ° c . in the presence or absence of 10 μm of cyclosporine a ( csa ); a p - gp competitive inhibitor ( fig9 a ). after the incubation , cells were washed and accumulation of radioactivity inside the cells or intracellular fluorescence was quantified . the increased in the accumulation of these drugs is expressed in term of x - fold compared to their respective control measured in the absence of csa . thus , the control value for each drug was set to 1 - fold . in another experiment , the ability of the conjugates to accumulate in cells overexpressing p - gp was monitored ( fig9 b ). mdck - mdr1 cells were incubated with 50 nm of either 3 h - taxol , 125 i - taxol - angiopep - 1 ( 125 i - txlan1 ) or 125 i - taxol - angiopep - 2 ( 125 i - txlan2 ) for 2 hrs at 37 ° c . after the incubation , the cells were washed and the radioactivity accumulated in cells was quantified . the results were expressed as drug accumulation in pmole / 120 min . as shown in fig9 a , the accumulation of [ 3 h ]- taxol increased by 15 - fold in the presence of the p - gp competitive inhibitor ; cyclosporin a ( csa ). the accumulation of rhodamine and [ 3 h ]- vinblastine also increased by 7 . 5 - fold and 10 - fold respectively in the presence of csa . these results show that taxol , rhodamine and vinblastine are p - gp substrates . however , the lack of csa effect on the accumulation of both [ 125 i ]- taxol - angiopep - 1 and [ 125 i ]- taxol - angiopep - 2 conjugates , indicates that they are not p - gp substrates . the accumulation of both conjugates , in the absence of csa , was at least 11 - fold higher than of [ 3 h ]- taxol ( fig9 b ). these later results strongly confirm that both conjugates bypass the action of p - gp since p - gp is not able to expulse them from the cells . these results additionally demonstrate that the presence of a carrier in conjugation with an anticancer drug increases the potency of the drug . therefore , the carriers described herein are useful for the transport and / or accumulation of drugs inside a cell and are especially useful for drugs which are usually expulsed by p - gp ( i . e ., drugs which are p - gp substrates ). the impact of conjugation of the drug to the carrier on drug distribution was evaluated by administering either 3 h - taxol ( 5 mg / kg ) or 125 i - taxol - angiopep - 1 ( txlan - 1 ) ( 10 mg / kg , equivalent to 5 mg of taxol / kg ) to mice . the unconjugated anticancer drug and the conjugates were injected intra - veinously ( i . v .) in mice as a bolus . tissues were collected at different times ( 0 . 25 , 0 . 5 , 1 and 4 hrs ) and homogenized . in order to quantify the amount of 3 h - taxol , tissue homogenates were digested with tissue solubilizer ( soluble ) and 10 ml of liquid scintillator was then added to samples . the amount of the 125 i - labeled conjugate , in the different tissues was measured after tca precipitation . radioactivity associated with the tissues was therefore quantified . the area under the curve ( auco - 4 ) was estimated using the prism software and was plotted for the different tissues ( fig1 ). results of fig1 a indicate that the auco - 4 values obtained for the conjugate are higher than that of taxol in various tissues including the brain , kidney , liver and the eyes which indicates a higher accumulation of the conjugate in these tissues compared to the unconjugated drug . more particularly , results presented in fig1 b indicate that the accumulation of the conjugate is much higher than unconjugated drug in the lung . results of a similar experimentation conducted with the taxol - angiopep - 2 conjugate are summarized in table 4 below . although there is difference with results obtained for the txlan - 1 conjugate , the conjugate of table 4 . also accumulates in the lungs , brain and liver more efficiently than unconjugated taxol . the kinetics of taxol and taxol - angiopep - 1 accumulation in the lung is also presented in fig1 . results clearly show that the amount of the conjugate measured in the lungs at different times is much higher than for the unconjugated drug . moreover , we also observed that the accumulation of the conjugate in the lung is also much higher than its concentration in the serum ( plasma ) at various times ( fig1 ). results presented in fig1 , 11 and 12 , strongly indicate that the conjugation of an anticancer drug ( e . g ., taxol ) to the carrier of the present invention ( e . g ., angiopep - 1 or 2 ) modifies the biodistribution of the anticancer drug and its pharmacokinetics . the ability of conjugate to inhibit tumor growth was next evaluated in an in vivo model ( fig1 a ). u - 87 cells were therefore subcutaneously implanted in the right flank of mice and on day 3 post - implantation , mice were injected with the vehicle ( dmso / ringer : 80 / 20 ; control ), taxol ( 5 mg / kg ) or taxol - angiopep - 2 ( 10 mg / kg ; equivalent to 5 mg of taxol / kg ( 3 taxol : 1 angiopep - 2 )). we observed that the tumor growth inhibition was more pronounced in mice treated with the conjugate than in mice treated with the unconjugated anticancer drug . in fact at day 17 post - implantation , tumor growth was inhibited by more than 75 % by the conjugate whereas tumor growth was inhibited by only 34 % using the unconjugated drug ( table 5 ). these results show that the conjugates described herein are more efficient than unconjugated taxol at inhibiting tumor growth in vivo . overall , a 2 . 2 - fold tumor growth inhibition level was measured for the conjugate compared to the unconjugated drug . in vivo studies were conducted to determine whether txlan2 ( 3 : 1 ) conjugate could inhibit the growth of hepatocarcinoma cells ( sk - hep 1 ) that have been implanted subcutaneously . for these in vivo models , nude mice received a subcutaneous injection of 2 . 5 × 10 6 human sk - hep 1 cells in their right flank . different treatments were started once the size of the implanted tumor reach approx . 200 mm 3 . animals received treatment txlan2 ( 3 : 1 ) conjugate or vehicle by peritoneal injections ( i . p .). txlan2 ( 3 : 1 ) conjugate was administered at 80 mg / kg by ip injection ( txlan2 ( 3 : 1 ) conjugate was taken from 2 different batch stored in different conditions ). in fig1 b treatments are indicated by black arrows . treatments were given twice a week for 5 treatments maximum at the dose indicated of 80 mg / kg . fig1 b shows that txlan2 ( 3 : 1 ) conjugate when administered i . p ., shows high efficacy in inhibiting the growth of hepatocarcinomas . this type of cancer is usually not sensitive to taxol ®. in fig1 , lung cancer cells ( nci - h460 ) were incubated for 24 hrs with either free taxol ( 30 nm ) or txlan2 conjugate ( 10 nm ; equivalent to 30 nm of taxol ). after cells were labeled for β - tubulin by using a secondary antibody linked to fitc . pictures were taken in visible and fluorescence modes . these results indicate that both taxol and taxol - angiopep conjugate have similar effect on β - tubulin leading to its polymerization . moreover , as indicated in fig1 , the addition of taxol and taxol - angiopep conjugate induce a blockade of nci - h460 cell in g2 / m phase . results obtained for the β - tubulin polymerization and cell cycle suggest that txlan conjugate has a similar mechanism of action on cancer cells than taxol . it was previously shown in international patent application no . pct / ca2004 / 00011 , that the receptor - associated protein ( rap ) inhibited transcytosis of aprotinin in an in vitro model of the blood brain barrier . according to these data we proposed that the low - density lipoprotein related receptor ( lrp ) is involved in the penetration of aprotinin into the brain . similar inhibition of angiopep transport across an in vitro model of the blood - brain barrier was also obtained ( data not show ) suggesting that transcytosis of angiopep across brain endothelial cell also involved lrp . lrp is a heterodimeric membrane receptor of 600 kda composed of two subunits ; the subunit - α ( 515 kda ) and the subun it β ( 85 kda ). immunodetection of lrp was then performed to assess whether this receptor is expressed in human primary brain tumors such as glioblastomas and in human brain metastasis from breast , lung and melanoma cancers ( fig1 ). briefly , equal amount of protein homogenates from human primary brain tumors ( glioblastomas ) or human brain metastasis were separated by gel electrophoresis . after electrophoresis , proteins were transferred to pvdf membrane and lrp was immunodetected by using a monoclonal antibody directed against the subunit - α obtained from cedarlane laboratories ( hornby , on , canada ). lrp was visualized by a secondary antibody directed against mouse igg linked to horseradish peroxidase and chemiluminescence reagents . under the experimental conditions used , the subunit a of lrp was immunodetected at 515 kda in glioblastoma u - 87 cells . lrp was also detected in all human primary brain tumors and human brain metastases ( fig1 ). in contrast , megalin ( lrp2 ) was detected in only one brain metastasis of the lung ( not shown ). the expression of lrp in the different patient biopsies may explain in part why we previously observed a higher accumulation of taxol - aprotinin conjugate in brain tumors . overall , since lrp may be involved in the transport of the carrier described herein , these results indicate that the conjugates may also target cells and tumors which express this receptor . in order to determine whether aprotinin and angiopep transcytosis could involve lrp , their impact on the uptake of the receptor - associated protein ( rap ), an endogenous ligand for lrp , was determined ( fig1 a ). the uptake of rap was measured in fibroblasts expressing lrp ( mef - 1 ) and in fibroblasts that do not express lrp ( pea - 13 ) ( fig1 a and 17b ). the addition of aprotinin inhibited the transport of [ 125 i ]- rap in positive lrp cells in a dose - dependent manner . in contrast , the rap uptake in negative lrp cells was almost unaffected by these aprotinin concentrations . in fig1 b the difference between the uptake of [ 125 i ]- rap measured in mef - 1 and pea - 13 was calculated and plotted as a function of aprotinin concentration . these results show that a portion of the lrp - dependent uptake of rap could be reduced by aprotinin indicating that aprotinin could interact with this receptor . in a different experiment ( fig1 ), the uptake of [ 125 i ]- rap was also measured in the presence of an excess of aprotinin and angiopep . results show that both aprotinin and angiopep affect the lrp - dependent accumulation of [ 125 i ]- rap . in summary , data obtained for the conjugates described herein indicate that the conjugation of anticancer drugs to the carrier allows the anticancer drug to escape from p - gp action and therefore increase their potency ( when conjugated with the carrier ). these conjugates are active in vitro at inhibiting cancer cell proliferation . moreover , results obtained on in vivo tumor growth indicate that the conjugation of anticancer drug to the carrier may increase their efficiency by bypassing p - gp , possibly targeting the receptor lrp or by modifying the pharmokinetics or biodisponibility of the unconjugated drug . taken together , data described herein indicates that the conjugates may be used against primary tumors including breast , lung and skin cancers as wells as metastasis originating from primary tumors . preliminary assays performed to assess the solubility of the different txlan conjugates indicated that all conjugates had a low solubility in aqueous solution ( e . g ., in ringer / hepes solution ) due to the highly hydrophobic nature of taxol . however , all of the conjugates were very soluble in dimethyl sulfoxide ( dmso )/ ringer ( 80 %/ 20 %). different strategies were thus assessed to increase their solubility and to reduce the amount of dmso necessary for their solubilization . interestingly , we were able to completely remove dmso from the formulation by using the solubilizer agent solutol ® hs15 ( basf ). for example , txlan2 ( 3 : 1 ) at 5 mg / ml was efficiently solubilized in 20 % solutol ® hs15 and ringer / hepes solution ph 5 . 5 . as this agent has been approved for several drugs applications for intraveinous ( i . v .) and intraperitoneal ( i . p .) administration , its use provides a commercial advantage to the formulations of the present invention . formulations of the present invention may thus comprise , for example , a ) taxol - angiopep conjugates , b ) solutol ® hs15 and c ) an aqueous solution or buffer ( e . g ., ringer / hepes solution at a ph of 5 to 7 ). the concentration of solutol ® hs15 in the formulation may reach , for example , 30 %. concentration higher than 30 % may also be useful . the concentration of conjugate may be determined based upon the dose required for efficiently treating a patient . for tissue distribution and blood kinetic studies , iodinated [ 125 i ]- conjugates ( i . e ., [ 125 i ]- txlan conjugates ) and [ 3 h ]- taxol were used . briefly , txlan2 conjugates ( 1 mg ) were radioiodinated using iodobeads and txl -[ 125 i ]- an2 . conjugate was then purified using a column containing resource rpc resin . free iodine was removed by washing the column thoroughly with 20 % acetonitrile . during column washes radioactivity was counted to assess the decrease in free iodine . the txl -[ 125 i ]- an2 conjugate was then pulled - down by a 100 % acetonitrile wash . acetonitrile was then evaporated and the iodinated conjugate was diluted in 100 % dmso ( 100 μl ). an aliquot of the radioiodinated conjugate was then injected in hplc and fractions were collected to verify that the radioactivity was associated to the fractions corresponding to the conjugates . blood kinetics were assessed after intravenous (( i . v .) tail vein ), intraperitoneal ( i . p .) and subcutaneous ( s . c .) injections performed on awake mice ( fig1 ). briefly txlan2 ( 3 : 1 ) conjugate was diluted in dmso / ringer - hepes ( 80 / 20 ) or in solutol ®/ ringer - hepes ( 20 / 80 ), txl -[ 125 i ]- an2 . injections of cd - 1 mice with the formulations were then performed to obtain a 10 mg / kg concentration . after injections blood fractions ( 50 μl ) were collected at the tail end and radioactivity was directly assessed . using the same protocol , taxol blood kinetic was also determined using [ 3 h ]- taxol . taxol was dissolved in dmso / ringer - hepes ( 80 / 20 ) at a concentration allowing a 5 mg / kg injection and [ 3 h ]- taxol was then added ( 2 . 5 μci / injection ). after injections blood fractions were collected at the tail end , scintillation cocktail was added and radioactivity was counted in a packard counter . results of this experiment are illustrated in fig1 a , fig1 b and in fig1 c and are summarized in table 6 below . in summary , results of fig1 and table 6 show that txlan2 bioavailability is much higher than taxol bioavailability . for example , the auc ( 0 - 24hrs ) txlan2 / auc ( 0 - 24hrs ) taxol is 169 ( i . e ., 203 . 3 / 1 . 2 ). in terms of taxol , the auc ( 0 - 24hrs ) txlan2 / auc ( 0 - 24hrs ) taxol is 84 . 7 ( i . e ., 101 . 65 / 1 . 2 ). since there is three taxol molecules on each molecule of angiopep - 2 , the amount of taxol represents about 0 . 5 of angiopep &# 39 ; s molecular weight ( i . e ., 3 × 854 / 5301 ). therefore the auc of the conjugate ( i . e ., 203 ) has to be multiplied by 0 . 5 in order to be expressed in term of taxol . in addition the blood biodisponibility of txlan2 conjugates is equivalent after intravenous and intraperitoneal injections whereas this is not the case for taxol . finally , results of fig1 and table 6 indicate that the blood biodisponibility of txlan2 is higher when solutol ® is used as solubilizer compared to dmso . txlan2 tissue distribution was evaluated in normal cd - 1 mice after tail vein intravenous injection of 10 mg / kg txlan2 solubilized in solutol ®/ ringer - hepes ( 20 %/ 80 %) or in dmso / ringer - hepes ( 80 / 20 ). briefly cd - 1 mice were injected via the tail vein with a formulation of txlan2 solubilized in solutol ® or dmso and also containing tx1 -[ 125 i ]- an2 . at predetermined time points a blood sample was collected and anesthetized mice were perfused with cold pbs . tissues were then excised and radioactivity was counted in a gamma counter . results of fig2 show that the use of solutol ® allows a higher distribution of txlan2 ( 3 : 1 ) conjugate in most tissues . a direct comparison of the toxicity of paclitaxel versus txlan2 ( 3 : 1 ) conjugate was made on beagle dogs , using iv injection of 2 . 5 mg / kg of paclitaxel vs 5 mg / kg of txlan2 ( 3 : 1 ) conjugate . four dogs were treated in each cohort . the following observation was made : during initial infusion , paclitaxel was not well tolerated , as opposed to txlan2 ( 3 : 1 ) conjugate which was very well tolerated . later on , the paclitaxel group lost weight during days 2 and 3 and recovered . no significant weight loss for txlan2 ( 3 : 1 ) conjugate . these biological observations demonstrate that at an equivalent molecular dose of taxol ®, txlan2 ( 3 : 1 ) conjugate does not trigger bone marrow toxicity as opposed to paclitaxel alone . the more favorable toxicity profile than paclitaxel will allow administration of txlan2 ( 3 : 1 ) conjugate at a higher dosage than taxol ®, thus further increasing the concentration of active drug to the tumor . single infusions of 0 , 100 , 200 , 400 , 850 mg / m 2 ( 14 - 120 mg / kg of txlan2 ( 3 : 1 ) conjugate ) in rats ( n = 3 / sex / group ): dose - dependent hematological effects ( decreased platelets , wbcs and reticulocytes ) observed at all dose levels — maximum effects on day 4 with recovery thereafter some decreases in body weight gain ( 10 - 15 %) at 850 mg / m2 clinical chemistry normal , no remarkable macroscopic findings maximum tolerated dose ( mtd ) determined at 400 mg / m 2 or 56 mg / kg single infusions of 0 , 100 , 200 , 400 mg / m 2 ( 5 - 20 mg / kg of txlan2 ( 3 : 1 ) conjugate ) in dogs ( n = 1 / sex / group ): transient anaphylactoid reactions ( face and head swelling ) to solutol dose - dependent hematological effects high dose male and female dogs sacrificed on day 4 mid dose not well tolerated by female ( poor food consumption for − 1 week ) mtd determined to be at 200 mg / m 2 or 20 mg / kg twice weekly infusions of 0 , 25 , 75 , 150 mg / m 2 for 2 weeks ( 4 doses total ) in rats ( n = 3 / sex / group ): dose - dependent hematological effects ( platelets , wbcs , reticulocytes , hb ) 1 high dose female found dead on day 10 ( 2 days post 3rd dose ); 1 high dose male sacrificed on day 15 ( 4 days post 4th dose )— both rats had low hematological values infusion twice a week at 75 mg / m 2 is well tolerated for 2 weeks . twice weekly infusions of 0 , 25 , 75 , 150 mg / m 2 for 2 weeks ( 4 doses total ) in dogs ( n = 1 / sex / group ): dose - dependent hematological effects ( platelets , wbcs , reticulocytes , hb ) high dose female found dead on day 7 and high dose male sacrificed on day 7 ( poor food consumption and body deterioration ) infusion twice a week at 75 mg / m 2 is well tolerated for 2 weeks . txlan2 ( 3 : 1 ) conjugate is well tolerated and as indicated in table 8 is better tolerated than paclitaxel or abraxane . in an attempt to evaluate the distribution of txlan2 ( 3 : 1 ) conjugate in a brain tumor model , nude mice were intracerebrally implanted with nci - h460 lung cancer cells . ten days after implantation , mice weight loss was significant indicating that the brain tumors were well established . taxol , txlan2 ( 3 : 1 ) and txlan2 ( 2 : 1 ) tissue distributions were evaluated ( fig2 ), as precedently described . mice were thus given an intravenous injection of either taxol ( 5 mg / kg ) solubilized in dmso or txlan2 ( 3 : 1 ) ( 10 mg / kg ) or txlan2 ( 2 : 1 ) ( 12 . 5 mg / kg ) each solubilized in solutol ®. after 10 minutes , mice were perfused on ice using cold pbs , organs were collected and radioactivity was measured . to evaluate the difference of accumulation between normal brain and brain tumor , brains were cut in half with the right hemisphere ( site of injection of the tumor cells ) corresponding to the tumoral brain and the left hemisphere to the normal brain . results of fig2 a and fig2 b show that txlan2 ( 3 : 1 ) conjugates present a higher distribution in brain tumor compared to normal brain ( 2 - fold increase ) whereas no difference is observed for taxol distribution between normal and tumoral brain . txlan2 ( 3 : 1 ) conjugate distribution is much higher than taxol distribution in brain tumor ( 10 - fold increase ) and was also higher than txlan2 ( 2 : 1 ) distribution ( 4 . 5 - fold ). in vivo studies were conducted to determine whether the improved formulation comprising the taxol - angiopep conjugate could inhibit lung cancer cell ( nci - h460 ) growth or glioblastoma cells ( u87 ) growth in an in vivo model of mice implanted subcutaneously with these cancer cells . briefly , mice received a subcutaneous injection of 2 . 5 × 10 6 human u87 glioma cells or nci - h460 cells . when tumor growth was observed , mice received treatment with free taxol , taxol - angiopep conjugates or vehicle by i . v . or i . p . injections . treatments were then administered twice a week until animals were sacrificed . mice were monitored every day for clinical symptoms and weight loss . tumor volume was estimated with a kaliper and the following equation ( tumor volume = π / 2 ×( length ( mm )× width 2 ( mm )). in the first subcutaneous tumor growth study , nci - h460 cells were implanted in mice right flank ( fig2 a ). mice received the vehicle , taxol or taxol - angiopep - 2 ( 3 : 1 ) conjugate formulation by i . v . injections in the tail vein or i . p . injections . conjugates were administered at an equivalent of 10 mg / kg of taxol . results presented in fig2 show that the improved formulation of txlan2 ( 3 : 1 ) conjugate containing 20 % solutol ® hs15 in ringer / hepes solution ( ph 5 . 5 ) caused a much stronger inhibition of nci - h460 tumor growth than taxol . these results are also summarized in table 9 below . these results indicate that the txlan conjugates are more potent than taxol at inhibiting tumor growth in an in vivo setting . in addition , similar results where obtained whether the conjugate was administered i . v . or i . p . finally , similar results where also obtained txlan conjugates comprising 2 or 3 taxol molecules . in a further study , the effect of txlan2 ( 3 : 1 ) conjugate formulations on s . c . nci - h460 or u87 growth was evaluated . mice were treated by i . p . injections with the improved formulation at 20 mg / kg / day for five consecutive days or by infusion with the implantation of alzet mini - osmotic pump at a dose of 2 mg / kg / day for 14 days . as shown in fig2 a and fig2 b , the response of mice to txlan2 ( 3 : 1 ) conjugate formulation was higher when mice received the improved formulation by infusion . these in vivo experiments clearly show the efficacy of the improved formulation against tumor growth of glioblastoma or lung cancer cells . similar experiments also indicate the efficacy of these improved formulations in prolonging survival of animals ( data not shown ). the content of each publication , patent and patent application mentioned in the present application is incorporated herein by reference . although the present invention has been described in details herein and illustrated in the accompanying drawings , it is to be understood that the invention is not limited to the embodiments described herein and that various changes and modifications may be effected without departing from the scope or spirit of the present invention .

US-201514635856-A

a non - clouding , shelf - stable tea concentrate is prepared by lowering the ph of a freshly - prepared concentrate to between 2 . 9 and 3 . 5 , chilling the concentrate to between 30 ° and 45 ° f ., clarifying the concentrate to remove precipitate , and then elevating the ph of the clarified concentrate to between about 3 . 9 and 4 . 3 . preferably the freshly prepared concentrate is prepared by using water which is at least 99 % deionized .

this invention is directed to a process for clarifying a concentrated tea extract such that the resulting liquid concentrate will remain clear for long periods of time at ambient temperature . the process of this invention is also advantageous since the concentrate will be adjusted in ph to a level which inhibits microbial growth . as a result of increased microbial stability , the tea concentrate of this invention does not need the high levels of preservatives , such as conventionally employed in the art , and will not have any undesirable flavor &# 34 ; burn &# 34 ; caused by the presence of high preservative levels . according to the process of this invention an aqueous tea concentrate is prepared for treatment . this concentrate may either be a fresh brewed concentrate , such as obtained by infusing tea leaf material with hot water or a reconstituted concentrate , such as obtained by dissolving dried tea powder in water . the prepared aqueous concentrate will have a soluble solids content of about 8 to 24 %, typically 12 to 18 %, by weight and a ph of about 4 . 7 to 5 . 5 . the ph of the aqueous concentrate is then reduced to a range of from about 2 . 9 to 3 . 5 , preferably 3 . 1 to 3 . 3 . the lowered ph may be effected by addition of one or more food acceptable acids which will not impart any off - flavor to the tea beverages produced from the concentrated tea extract of this invention . tannic acid , phosphoric acid , citric acid and hydrochloric acid are among the acids which may be used either alone or in combination . typically , a mixture of acids will be employed so as to reduce the negative effects to an inconsequential level that might be produced with the use of a single acid . tannic acid which is a natural component of tea is a preferred component of the acid ingredient added to the tea concentrate . phosphoric acid is another preferred acid as it provides some sequestering functionality and is free adverse flavor effects . the temperature of the ph lowered concentrate is maintained at a temperature of from 30 ° to 45 ° f . (- 1 . 1 ° to 7 . 2 ° c . ), preferably 32 ° to 38 ° f . ( 0 ° to 3 . 3 ° c .) for a period of at least one hour , preferably at least two hours . during this chill and hold step , agitation will be present but minimal in order to promote precipitation of acid and / or cold - water insoluble tea components . the precipitate has been found to be comprised of insoluble caffeine tannate and caffeine polyphenol complexes . the resulting precipitate is separated from the liquid phase of the concentrate by any suitable means such as decanting , filtration or centrifugation alone or in combination . centrifugation is a preferred step and equipment such as westfalia ™ clarifiers are suitable for use in this invention . removal of the precipitate will typically result in a 5 to 20 % reduction in level of the solids contained in the concentrate . the clarified concentrate is thereafter elevated to a ph of about 3 . 9 to 4 . 3 preferably from about 4 . 0 to 4 . 2 such as through the addition of various food - approved alkaline materials . stability of the tea concentrate appears to be optimum at a ph of about 4 . 1 . an aqueous solution or slurry of sodium hydroxide , potassium hydroxide and / or ammonium hydroxide is useful for this purpose . various artificial and / or natural flavors may be added to the concentrate and this is preferably done after the ph is raised in order to avoid interactions which would affect the flavors . a low level of preservatives may be added to the concentrate to ensure the desired degree of stability is attained . via the process of this invention , a high level of clarity is preserved for a minimum of six months at storage conditions for from 60 ° to 80 ° f . ( 15 . 6 ° to 26 . 7 ° c .). the concentrate also possesses excellent tea flavor as judged by experienced tasters . it has also been found that improved results in terms of clarity are obtained if the water used to produce the aqueous tea concentrate is water that has been deionized . the use of ordinary tap water appears to result in the formation of fine insoluble material which is not readily removed during clarification . in the absence of metal ions such as calcium and magnesium , high molecular weight insolubles are formed which are easily removed via standard clarification techniques . the use of a regenerable mixed bed ion - exchange resin system in a conventional manner , such as any of the well - known column systems , is suitable for use in this invention . preferably , the water will be at least 99 % deionized . a suitable deionizer is mixed bed deionizer ( model 2951 ) from millipore ™ ( richfield , n . j . 07657 ) which employs both anionic and cationic resins of the rohm & amp ; hass company ( ir - 120 and ira - 410 , respectively ). this invention is further described having reference at the following examples . the efficiency of clarifying a tea concentrate at a reduced ph of about 3 . 3 was demonstrated in the following experiment . two samples of aqueous tea concentrate were prepared as follows : ______________________________________ingredient sample i sample ii______________________________________spray dried tea solids 76 . 25 g 76 . 25 gdeionized water 421 . 00 g 421 . 00 gtannic acid 2 . 75 g 2 . 75 gphosphoric acid 4 . 3 g 8 . 85 g ( 75 % aqueous solution ) ph 4 . 1 3 . 3______________________________________ the concentrates of samples i and ii were held for 18 hours at 40 ° f . ( 4 . 4 ° c .) after which each sample was centrifuged for 20 minutes in a centrifuge operating at 2100 rpm . supernatants were collected and the sample ii effluent was adjusted to 4 . 1 ph by the addition of 0 . 16 g of naoh pellets . the effluents were held at 70 ° f . ( 21 . 1 ° c .) for 60 hours at which time the level of insolubles contained in each of the concentrates was measured as 2 % ( by volume ) for sample i and only 0 . 8 % ( by volume ) for sample ii thus establishing the benefit of the ph adjustment procedure of this invention . the efficiency of using deionized water for preparing the tea concentrate which is to be clarified at a lowered ph is demonstrated in the following experiment . two samples of aqueous tea concentrate were prepared using the following formulation with sample i using deionized water ( at least 99 % deionized ) and sample ii using tap water . ______________________________________ingredient grams weight % ______________________________________water 421 84 . 2spray dried tea solids 58 11 . 6tannic acid 21 4 . 2______________________________________ both concentrates which had a ph of 4 . 5 were held at 40 ° f . ( 4 . 4 ° c .) for 18 hours and then centrifuged as in example 1 . the supernatants were collected , held at 70 ° f . ( 21 . 1 ° c .) for a day and analyzed for insolubles . sample i was found to contain only 0 . 2 % ( by volume ) of insolubles and appeared clearer than sample ii which contained 1 . 0 % ( by volume ) of insolubles and appeared murky . a high - quality , non - clouding tea concentrate was prepared in accordance with this invention and the following procedure . into a batching tank which is equipped with agitating means , the following ingredients were added in sequence 25 , 808 . 5 pounds of deionized water ( about 110 ° f . ( 43 . 3 ° c . ), 118 . 3 pounds of tannic acid , 3 , 552 . 4 pounds of spray dried tea solids , and 520 . 9 pounds of phosphoric acid ( 75 % solution ) resulting in a solution which has a ph of 3 . 2 and a solid level of 15 . 6 % by weight . mixing is continued for about one hour to ensure complete dissolution of solids and then , under minimal agitation , the solution is chilled to about 35 ° f . and held for a minimum of two - hours . the resulting mixture is then decanted and centrifuged which yielded a solution having a solids concentration of 13 . 5 % by weight . the thus clarified solution was then adjusted to a ph of 3 . 9 with 173 . 4 pounds of a 50 % solution of naoh . sodium benzoate and potassium sorbate were added as preservatives and natural and artificial flavors were also aded which resulted in a ph of 4 . 1 , a solids level of 14 % by weight and a preservative level of 0 . 29 % by weight . the concentrate remains clear for a minimum of 6 months at a temperature of 60 ° f . ( 15 . 6 ° c . ).

US-6012387-A

this buckle fastener for ski boots or other sports footwear comprises a closing wireform adapted to be tensioned by a latch . the latch is pivoted to the end of an arm having its other end pivoted to one boot portion . in the closed position the latch is locked by a hook cooperating with the pivot pin connecting the arm to the boot . means are provided on the latch for releasing this hook to open the fastener .

the fastener illustrated in the drawings comprises a latch 1 pivotally connected by means of pivot pins 2 and 3 to one end of a pair of parallel arms 4 , 5 having their other ends pivotally connected by means of another pivot pin 6 to the lateral wings of a support 7 secured to one lateral portion 8 of a ski boot comprising another lateral portion 9 and a third portion or tongue 10 covering the registering opposite edges of said lateral portions 8 and 9 . the latch 1 is a fork - shaped member having a rod 11 pivotally connected between its prongs about a pivot pin 12 . the rod 11 comprises a screw - threaded extension 11a engaged by a tapped hole formed in a holder 13 to which a buckle or wireform 14 is pivotally connected , this wireform 14 being adapted to engage one notch of a rack forming catch 15 secured by rivet means to the other lateral portion 9 of the boot . a compass spring 16 mounted about the pin 12 constantly urges the latch 1 and rod 11 towards the boot . mounted in a recess formed in latch 1 which has a width corresponding substantially to the distance between the two prongs of latch 1 is a hook 17 pivoted about a pin 18 and provided with an upper arm 17a extending towards the adjacent end of latch 1 and bearing against the end of an auxiliary lever 19 fulcrumed about a pin 20 to said adjacent end of latch 1 , said auxiliary lever having an integral extension 19a engageable by the user &# 39 ; s finger for controlling the release of the fastener . another compass spring 21 is mounted about the pin 18 and its ends bear against the latch 1 and hook 17 , respectively , in order to bias this hook 17 against the end of auxiliary lever 19 . in the closed position shown in fig2 and 4 the hook 17 engages and pivot pin 6 of arms 4 and 5 . to open the device , the user lifts the latch by engaging the extension 19a of the auxiliary lever , thus causing the hook to pivot and releasing same from pivot pin 6 . thus , the user can open the device as shown in fig3 . in this open position the rod 11 of latch 1 is urged against the boot surface by compass spring 16 . when the user releases the latch , the end thereof is also caused to engage the boot by the same spring 16 . in this position , the device , though open , occupies little space . in all cases , the arms 4 and 5 do not tilt away from the boot ( that is , to the right as seen in fig3 ) and the rod 11 , with its wireform 14 , is positively prevented from protruding from the boot surface and on the contrary remains in relatively close contact therewith without any risk of hitting other objects and being damaged . to reclose the device , the wireform 14 is re - engaged into the proper notch of hook 15 and the latch 1 is moved towards the boot surface . during this movement , the cam face 17b of hook 17 slides on the surface of pin 6 and the hook 17 is engaged under this pin 6 . it is clearly apparent from fig4 that the pin 2 for pivoting the latch 1 to its support arms 4 , 5 overlies the central portion 10 of the boot and that the coupling member consisting of rod 11 and wireform 14 is relatively short ; in fact , it is obvious that this coupling member would be considerably longer if the latch were fulcrumed about pivot pin 6 as in the case of latches according to the prior art . moreover , the latch locking action is completely independent of the inclination of support 7 with respect to the latch . the device can be released completely from the central tongue 10 of the boot . of course , many modifications and changes may be brought to the buckle fastener according to this invention without departing from the basic principle thereof . thus , for example , the hook 17 may be adapted to slide instead of pivoting . in this case , it may be released by actuating a push member or any other suitable and known means , for example two movable members mounted on either side of the latch and coupled to a bar rigid with the hook . besides , the latch and the pivoted arms could be designed differently ; for example , the arms could be pivoted inside instead of outside the latch , as shown . in a modified form of embodiment , the hook 17 could be pivotally mounted to support 7 , for example about pivot pin 6 , for engagement inside the latch 1 . in this case , the hook could be released in the same manner as that illustrated in fig2 . in this modified form of embodiment , as in the preceding one , the pivot pin 6 acts both as a pivot means to the arms and as a lock bolt .

US-39083882-A

a method of unplugging hay and forage equipment , including the steps of identifying a plug , substantially simultaneously activating unplugging devices , unplugging the equipment , and returning the unplugging devices to position of normal operation . the identifying step includes identifying a plug in the equipment caused by the material entering the equipment . the activating step includes activating substantially simultaneously a plurality of unplugging devices . the returning step includes returning the plurality of unplugging devices to their normal operating positions .

referring now to the drawings and , more particularly , to fig1 - 3 , there is illustrated a hay or foraging system 10 that includes a tractor 12 towing a baler 14 . while baler 14 is being illustrated herein , it is understood that baler 14 is a hay or foraging device 14 that could include square or round balers for either dry or silage material , forage harvesters , mowers , flail chopping devices , hay conditioners , and windrowers , each of which encounter and process bulk crop material and have a crop inlet which can be plugged . a plug 16 is illustrated where the flow of material has clumped or some foreign matter is substantially blocking the operation of the feeding mechanisms of baler 14 . the handling of plug 16 is a focus of the present invention . tractor 12 has a pto 18 that provides power to at least some of the mechanisms of baler 14 . tractor 12 additionally includes an actuator 20 , a display 22 , and an activation button 24 . pto 18 may be disengaged by action of actuator 20 that may be incorporated into elements of tractor 12 , and which may be under the control of a controller associated with tractor 12 . the controller associated with tractor 12 may receive a signal from baler 14 causing actuator 20 to disengage and even brake power takeoff unit 18 . a display 22 alerts the operator that a plug 16 has been encountered or display 22 may additionally indicate that a plug 16 has been cleared . additionally , display 22 can display the operating positions of various aspects of baler 14 . activation button 24 allows the operator to initiate an unplugging sequence to remove plug 16 from baler 14 . the phrase “ removing plug 16 from baler 14 ” also incorporates the processing of plug 16 so that the crop material is processed within baler 14 or removed from baler 14 or a combination thereof . activation button 24 may also include a function commanding baler 14 to reposition mechanisms therein into a normal operating position . baler 14 includes a frame or chassis 26 , a tongue 28 , a baffle 30 , knives 32 , a drop floor 34 , belts 36 , a rotor drive 38 , and a pickup header 40 . side sheet 42 is schematically shown in fig3 and would exist on another embodiment of a baler to control the pressure encountered by a plunger of a square baler as it presses hay into a square bale . actuators 44 - 56 are respectively associated with these operational elements of baler 14 , as illustrated in fig3 . crop material enters baler 14 along material flow path 58 and is picked up by pickup header 40 and travels between baffle 30 and progresses on to knives 32 and drop floor 34 on its way to a bale forming chamber . a controller 60 interacts with actuators when a plug is detected to substantially simultaneously actuate several of the elements of baler 14 including some combination at least of baffle 30 , knives 32 , drop floor 34 , belts 36 ( or side sheet 42 ), rotor drive 38 , pickup header 40 and power takeoff 18 . advantageously , the simultaneous moving of these elements and the removal of power supplied by way of power takeoff 18 all work to clear plug 16 from interfering with the operation of tractor 12 and baler 14 . controller 60 may be an electronic control system that interacts with selective control valves ( scv ) or it may be some other combination of control that interacts with actuators 20 and 44 - 56 . now , additionally referring to fig4 and 5 , there is illustrated some hydraulic schematics to operate functions of baler 14 including the bale tension cylinders and gate release cylinders shown in fig4 as well as a hydraulic circuit to engage knives 32 , drop floor 34 , and pickup 40 when substantially simultaneously activated . it should be understood that this substantially simultaneous operation causes a quick response to the presence of plug 16 . the nearly simultaneous or simultaneous movement of these elements can include the activation of a sequential movement of some portions in the event that one element is better moved before another and that such a sequential operation is initiated by the substantially simultaneous movement initiated by controller 60 . controller 60 is interfaced with the scv valves of fig4 and 5 and the hydraulic cylinders illustrated in fig4 and 5 correspond to corresponding actuators of fig3 . during normal operation , tractor 12 pulls baler 14 , which encounters the crop material that enters along material flow path 58 making its way to the bale forming chamber . when plug 16 is encountered , controller 60 substantially simultaneously activates a plurality of actuators 44 , 46 , 48 , 50 , 52 , and 52 . this action causes the following elements to respond : baffle 30 is moved away from material flow 58 ; knives 32 drop away from material flow 58 ; drop floor 34 moves away from material flow path 58 ; tension on belt 36 is reduced ; rotor drive 38 may be stopped or reversed ; and pickup header 40 may be moved with its intake mechanism slowed , stopped , or reversed , thereby affecting the amount of flow along material flow path 58 . additionally , power takeoff 18 may be disengaged from powering baler 14 to thereby prevent the overloading of tractor 12 . power takeoff 18 may be re - engaged to move plug 16 while the previous elements are in their previously described position to reduce the influence of plug 16 on the normal operation of baler 14 . once plug 16 has been removed or otherwise dissipated in the system , controller 60 then utilizes actuators 44 , 46 , 48 , 50 , 52 , and 54 to respectively move baffle 30 , knives 32 , drop floor 34 back into their operating position and to increase the tension of operating level of belt 36 and to engage rotor drive 38 and pickup head 40 so that they are respectively placed in a normal operating mode for the reception of crop material . actuator 20 is activated to engage power takeoff 18 so that mechanical power again is restored to baler 14 so that the operations of baler 14 can resume . the movement of these elements can be substantially simultaneous so that baler 14 can quickly resume normal operating functions . controller 60 activates any combination of the mechanisms that also serve as unplugging devices , previously mentioned , simultaneously and additionally include either instructions to back up baler 14 conveyed to the operator by way of display 22 or an automatic function in which baler 14 is automatically reversed . when unplugging is completed , the device is returned to normal operating positions . another example includes a precutter type feeding system with an electro - hydraulic control . first , a plug occurs at the entrance of the material to baler 14 or along the path of material flow 58 . the operator pushes activation device 24 causing controller 60 to disengage pto 18 by utilizing actuator 20 . substantially simultaneously , a solenoid is energized to divert hydraulic pressure to the low pressure circuit of belt tensioner 50 in the form of actuator 50 and additionally energizes solenoids in parallel scv circuits for moving pickup 40 , knives 32 , and drop floor 34 . in this operation , the operator only actuates a single control such as activation device 24 or it may be in the form of a single scv lever to thereby position all of the devices to relieve restrictions along material flow path 58 . at this point , actuator 20 is activated causing power takeoff 18 to be engaged to feed the plug through or away from baler 14 . the operator or controller 60 then activates an scv to return all of the unplugging devices to their normal operating position and continue to bale . with the use of electrical or electronic sensors and actuators , electronic scv hydraulics , and / or electronic pto controls , several of these steps are done without operator activation . the present invention includes certain advantages including there are fewer steps for the operator that are needed for the removal of plug 16 . this allows a less skilled operator to be productive with baler 14 . there is less wasted time in the moving the devices to an unplugging position and can also include positions that are additionally used to service the elements , such as for the replacement or sharpening of knives 32 . another advantage is that elements of baler 14 are not inadvertently positioned during a plug clearing operation , such as the positioning of knives 32 during the unplugging operation . the unplugging operation that results from the present invention includes a more positive unplugging of baler 14 by relieving crop restrictions in several areas of the feeding system simultaneously . this not only relieves areas of plugging but it also diverts available pto drive power to areas where it is most needed . for example , tractor 12 may be limited to 150 pto horsepower with 50 horsepower being used to form a round bale and 100 horsepower being used to feed through a crop slug . when a crop slug forms a plug and is stuck in the feeding mechanism , it may exceed the 100 horsepower that is available causing the baler or tractor clutch to disengage or to kill the tractor engine . if the tension of belt 36 is reduced , then only 20 horsepower is needed to rotate the bale , rather than 50 , thereby allowing a total of 130 horsepower to be available to feed the slug through the feeder . specific to a round baler 14 , bale forming belts are tensioned during bale growth with the belt tension being proportional to bale density but it is also proportional to the power consumption to form and rotate the bale in the bale forming chamber . as such , reducing belt tension reduces belt power consumption , thereby enhancing the ability of baler 14 to deal with plug 16 . having described the preferred embodiment , it will become apparent that various modifications can be made without departing from the scope of the invention as defined in the accompanying claims .

US-46441209-A

method and device for detecting life - threatening pneumothorax caused by air in the thoracic or chest cavity by passive auditory detection using an array of transducers placed on the patient &# 39 ; s chest and operatively connected to a data processing unit . the unit is programmed to filter out sounds not in the harmonic of the bubbling air associated with a pneumothorax . in addition to passive auditory detection ultrasound techniques and radio active gas detection , are shown to be used .

one embodiment of the device utilizes ultrasound and is illustrated generally in fig1 . the ultrasound technique is used to detect an unnatural pocket of air in the thoracic cavity . a low - frequency ultrasound unit 10 is coupled into the patient &# 39 ; s chest cavity 12 by a probe 14 . probe 14 is designed to detect air through bone . the key component of the probe is the circuitry that processes the signal . the reflection from the chest is analyzed and presented to the user either auditorily or visually . for example , a display unit as shown in fig8 can be adapted for display of the ultrasound results . when the ultrasound reflects from the density boundaries internal to the body , the strength of the reflection in association with the time that the reflection is received will allow the system / user to determine the nature of the boundary . the strongest reflections occur at boundaries of fluid and air such as would be experienced when a pneumothorax is encountered by the sound beam . the next strongest would occur at the boundary with bone . see fig2 . due to the boundary with bone always occurring between the region of surface contact and the region of interest , the gain applied to the reflected signal would be compensated to normalize the loss as the reflections behind this region would have to transgress it twice . compensation in this will increase the sensitivity of the system to the nature of the tissue and interfaces behind the bone . the system will always be able to do this automatically as it will get a very strong and clear indication of when the bone is between the area of contact and the intended area of interest . since the bone will be encountered before the area of interest , the time component of when the signal is received can be used to “ blank ” the output to the user to exclude this information . this will allow only the information from behind the bone to be presented for evaluation . time filtering the return echo in this way will dramatically simplify the user interpretation of the tissue behind the bone for the air / fluid boundary . a preferred embodiment of the present invention can be referred to generally as the passive auditory detection device . in the event of pneumothorax , the leak will generate a pocket of gas by leaking air to the space between the lung and its surrounding tissue environment . this leaking of air has a characteristic sound with a distinct harmonic as it bubbles through the interstitial fluids and space . the preferred embodiment is specifically designed to detect this sound . there are two main components of the passive auditory detection device , a non - disposable hardware or central processing unit , indicated generally as numeral 20 in fig9 that is used to interpret and process signals and the disposable transducer component 22 , that is attached to the patient . central processing unit 20 , that can include generic digital signal processing chips , can be a conventional pc , as shown , or a handheld device ( not shown ). the novel transducer 22 of the present invention includes a series of two ( 2 ) to five ( 5 ) or more transducers 24 on a self - adhesive patch 25 and wired in parallel , for example with wires 26 to the central processor 20 . the patch 25 with transducers 24 is adhered to the patient &# 39 ; s chest . signals from the individual transducers 24 are combined algebraically as shown in fig2 to attenuate artifact noise such as room noise and patient movement . the array of transducers 24 allows for the localization of the pneumothorax within the chest cavity as will be explained below . the central processing unit 20 includes software , which is written to perform the functions graphically illustrated in fig1 a through 4b . the basic function of the software is to receive a digital sound signal received from transducers 24 in such a way as to detect the presence of a pneumothorax . the software processes a digital sound signal by filtering out frequencies far away from a set point , which is the frequency of air bubbling out of the lung . the transducers 24 algebraically eliminate motion artifact and room noise , as shown in fig4 . the software also shifts the frequencies to maximize the auditory detection of the pneumothorax . the software is written to analyze the resultant sound pattern and decide the likelihood of pneumothorax based upon probabilities . the software uses data obtained during product development using either a neural network , genetic algorithms , or rule - based decision making . for gross location of a suspected area , a filtered electronic listening device will be used which couples high - sensitivity listening device to the exterior of the body ( ex . transducers 24 ). this device is tuned to reject frequencies above and below the most prominent harmonic of the bubbling sound , as stated above . it also uses two or more transducers configured only a small distance apart . the signals from these transducers will be combined algebraically ( as shown in fig4 ) to greatly attenuate the room noise and patient movement artifacts . the bubbling noise will be maximum when it is closer to one of the transducers than the other ( s ). in this way , the array of transducers can be “ focused ” to an area of interest and greatly reject the extraneous noises of the room and the movement over the chest cavity . additionally , the filtering of the signal before presentation to the user will allow large low - frequency sounds such as the heart to be attenuated allowing the gain for the audio spectrum of interest to be increased . this will produce a listening device which is far superior to the conventional stethoscope that is currently available . for example , a frequency domain audio signal provided to the uses is illustrated in fig7 . once an area of suspected pneumothorax is detected , the mode of the listening device can be switched to the spectral shift mode . in this mode , the sound received in the ranges which are not well transmitted through a normal stethoscope are shifted into the prime audio range ( 1 kc to 5 kc ). the range select allows shifting of sound that would normally fall beyond the range of most human hearing (& gt ; 15 kc ) into the range of peak human hearing ( 1 kc to 5 kc ). ( see fig3 ). this is done in a simple mixer circuit utilizing a variable beat frequency oscillator ( bfo ) mixer and filter arrangement to shift and select the desired range of frequencies . this should allow the user to quite clearly hear and recognize the bubbling sound associated with the pneumothorax . the listening device can be set into any number of pre - arranged filtering or spectrum shifting configurations to optimize the information gathered for diagnosing many internal problems . for instance , it could be optimized to listen to the heart or to listen to the valves of the heart . it could be optimized to listen to the joints to diagnose ligament or cartilage problems . it could filter out other sounds , enhancing the effectiveness of doppler flow analyses for vascular or blood vessel abnormalities . these pre - selected optimized configurations would augment the capability to manually select a pass - band and a spectrum shift . the manual operation allows the sophisticated user the ability to get the most out of the listening device . a display monitor , as shown in fig8 can be used to allow the user to visually monitor a patient and would provide information in addition to the information derived from the described passive listening embodiment . this information may include a visual output corresponding to the patient &# 39 ; s breathing pattern , graphically showing any abnormalities that may be from a pneumothorax . additionally , the information retrieved from the multi - sensor array can be simply processed to provide stereo image presentation allowing the user to perceive directionality and depth . ( see fig5 and 8 ). this would be particularly useful to diagnose knee , hip , shoulder , or elbow joint pain and dysfunction . the device can accommodate numerous transducer arrays and thus allows positioning of the arrays on either side of the area of interest . an example of this could be anterior and posterior placements . in summary , this device will allow the user to hear , locate and characterize sounds within the body that were previously in - audible or too heavily masked by other sounds as to be useful . the third embodiment of the invention utilizes a mildly radioactive ideal gas such as xenon . the patient inspires a quantity of the gas mixed with air and then holds their breath . the patient then “ bares down ” abdominally to increase the pressure in the chest cavity . this will force some of the radioactive gas through any existing pneumothorax and into the pocket of gas which is being created . the patient then expires normally . after a couple of normal breaths , a device which consists of a simple radiation detector , is passed over the patient &# 39 ; s chest . a low level of background radiation will be detected as some of the xenon has been retained in the lung and some has been distributed systemically through the blood . ( see fig6 ). in the event that a pneumothorax exists , a pocket of radiation greater than the background level will be easily identifiable with the radiation detecting probe . in general , and with all illustrated embodiments , processed signals will be analyzed by on - board microprocessor ( s ) and / or digital signal processor ( s ), to provide clinically relevant information for patient care . these interpretations might provide the user with a “ yes / no ” indication of a specific condition , or alternatively , could determine that further testing was necessary to evaluate for this condition ( see fig1 ). for example , , the invention might determine that chest signals were uninterpretable or inadequate for interpretation , and that a chest radiograph was necessary to determine if a pneumothorax was present . in another embodiment , the invention might communicate the probability of the presence of a pneumothorax due to the processed signal content , and advise that a chest radiograph was necessary , for instance , if the probability rose above the fiftieth percentile . in orthopedic applications , signal characteristics and / or location might point to a specific bony or soft tissue injury , such as a tear ( full or partial ) of the medial collateral ligament of the knee . the invention will include a visual display designed to clearly convey these interpretations to the user ( see fig3 ). variations or modifications to the subject matter of this invention , and the structure and usefulness of the pneumothorax detector of this invention , may occur to those skilled in the art upon reviewing the disclosure herein . such variations or modifications , if within the spirit of this invention , are intended to be encompassed within the scope of the invention as described . the description of the preferred embodiment , as shown and analyzed herein , is done so for illustrative purposes only .

US-32285099-A

this invention provides a capless retractable cosmetic dispenser applicable to all types of cosmetic fluids and capable of self - sealing and substantially preventing vapor fluid from evaporating through the valve when the applicator is in the retracted position . the retractable dispenser includes a front cowling with an opening to allow the applicator to move in and out of the opening . adjacent to the opening and within the front cowling is a valve capable of moving linearly within the front cowling . the valve substantially seals the cosmetic fluid and applicator from outside air and the release of vapor pressure from within the valve when the applicator is in a retracted position .

[ 0033 ] fig1 illustrates the cross - sectional view of the retractable dispenser 100 in a retracted position . in the retracted position , the applicator 101 is within the enclosure 102 with the front end 103 of valve 206 substantially forming a seal , and the back end 104 of valve 206 substantially forming a seal around the rod 105 . the enclosure 102 stores the fluid material that the applicator 101 comes in contact with , when the applicator is within the enclosure 102 . in the retracted position , as the cosmetic fluid evaporates from the enclosure 102 , the vapor is substantially sealed within the enclosure 102 . [ 0034 ] fig2 illustrates the cross sectional view of the retractable dispenser 100 in the protracted position . the retractable dispenser 100 includes a front cowling 211 that holds a valve 206 , a gear 200 that works with the plunger 201 and the rear cowling 202 to lock the plunger 201 and gear 200 in the retracted position or the protracted position . to extend the applicator 101 outside the opening 203 , the plunger 201 is activated or pushed towards the rear cowling 202 . this causes the valve 206 within the front cowling 211 to move towards opening 203 compressing compression member 205 , valve 206 continues to move toward pre - opener 207 until slit 208 is forced over pre - opener 207 , the applicator 101 passes through the wiper 209 and through the opening 203 . the compression spring 210 resist against the pushing force until the gear 200 engages and locks in the protracted position . the applicator 101 is now ready for the user to apply the fluid . in use , the applicator 101 removes a portion of the fluid material within enclosure 102 each time the applicator 101 is protracted . it is therefore a tendency of applicator 101 to form a hollow cavity within enclosure 102 that will be devoid of the fluid material , particularly when of a paste - like consistency such as mascara and lip moisturizer . in order to keep the fluid material within enclosure 102 in contact with applicator 101 , it is desirable to have the applicator 101 rotate within the enclosure 102 each time the retractable dispenser 100 is retracted and protracted . this desired rotation is accomplished by the protraction and retraction mechanisms . in addition , each time the applicator 101 is protracted and retracted , fluid movement member 212 attached to rod 105 moves fluid material to areas devoid of fluid material within enclosure 102 . this movement of fluid material by the fluid movement member 212 within enclosure 102 allows the fluid material to remain in contact with the applicator 101 . [ 0035 ] fig3 illustrates the interior components of the retractable dispenser 100 . the retractable dispenser 100 includes a compression member 205 , a tension device 1100 , a fluid movement member 212 , a compression spring 210 , a gear 200 , a plunger 201 , a cover 302 , and a rear cowling 202 . in addition , the retractable dispenser includes a valve 206 adapted to fit within the front cowling 211 adjacent to the pre - opener 207 . the valve 206 has a front end 103 and a back end 104 forming an enclosure 102 within the valve 206 . the enclosure 102 is adapted to receive the applicator 101 to substantially seal the applicator 101 from the outside air and prevent the release of vapor pressure from within the enclosure 102 when the applicator 101 is in a retracted position . the applicator 101 is coupled to a rod 105 along a longitudinal axis 301 . the applicator 101 may be in the nature of a twisted - in - wire - brush , miniature comb , preformed swab , sponge applicator , flocked applicator and the like . [ 0036 ] fig4 illustrates an enlarged cross sectional view of the valve 206 in relation to the front cowling 211 in the retracted position . the front cowling 211 also includes a wiper 209 incorporated into the pre - opener 207 . the wiper 209 is provided with an opening 203 , the opening 203 is dimensioned to be generally smaller than the size of the applicator 101 . the wiper 209 , as is well known in the art of cosmetic dispensers , functions to remove excess cosmetic fluid from the applicator 101 as the applicator 101 moves through the opening 203 . in accordance with the preferred embodiment , the opening 203 in the wiper 209 is also sized in conjunction with the rod 105 to provide close tolerance there between , while allowing relative free sliding movement of the rod 105 through the opening 203 . in addition , the engagement of the wiper 209 with the rod 105 will create a seal when the dispenser is in the protracted state . [ 0037 ] fig5 illustrates a retractable dispenser 100 in a protracted position with an applicator 101 extending from the front cowling 211 . the front cowling 211 has an opening 203 to allow the applicator 101 to move between a protracted position and a retracted position . the retractable dispenser 100 also has a rear cowling 202 with a rear opening 500 at the back end to allow a plunger 201 to extend between the protracted position and the retracted position . in the protracted position , the plunger 201 is pressed down relative to the rear barrel 202 that causes the applicator 101 to extend through the opening 203 and extend from the front cowling 211 . [ 0038 ] fig6 illustrates the retractable dispenser 100 in a retracted position where the applicator 101 is inside the front barrel 211 . in the retracted position , the plunger 201 further extends from the rear barrel 202 that causes the applicator 101 to retract into the front cowling 211 by moving back into the opening 203 . as such , by activating the plunger 201 between the retracted and protracted positions , the applicator 101 is moved correspondingly between the retracted and protracted positions as well . [ 0039 ] fig7 illustrates a perspective view of the valve 206 with the front end 103 and the back end 104 . the front end 103 may have a concaved shape profile with a slit 208 that opens to allow the pre - opener 207 to enter . the concave shape profile provides support around the slit 208 to enhance proper closure of the slit 208 when the applicator 101 moves back into the valve 206 . the width of the slit 208 may extend from edge to edge of the circumference 700 . in this example , the circumference 700 of the front end 103 may be circular . [ 0040 ] fig8 illustrates an enlarged cross sectional view of the front cowling 211 with the valve 206 forced over pre - opener 207 , the applicator 101 extended past the front end 103 and through the slit 208 . the valve 206 may be made of a material that is durable and flexible so that the slit 208 will not wear out after many cycles of the pre - opener 207 moving in and out of the slit 208 . the material should have low permeability to vapor and air to seal the applicator 101 . the type of material used depends on the type of fluid that is used . for water - based fluids with a lower evaporation rate than an alcohol - based fluid , silicone may be used to form the valve 206 , but tpe ( thermoplastic elastomer ), natural rubber , synthetic rubber ( e . g . isoprene ), and tpv ( thermoplastic vulcanizate ) material including butyl rubber crossed linked with polypropylene are also preferred . a variety of methods may be used to form the valve 206 such as injection molding , blow molding , extrusion molding , and other methods known to one skilled in the art . for alcohol - based fluids with higher evaporation rate , butyl rubber and synthetic rubber ( e . g . isoprene ), may be compression molded or other methods known to one skilled in the art may be used to form the valve 206 . alternatively , the valve 206 may be formed from thermoplastic elastomer with thermoplastic rubber that has low permeability to vapor . in addition , the valve 206 may be formed from thermoplastic elastomer and treated with fluorine to further reduce permeation . [ 0042 ] fig9 illustrates a cross sectional view of a valve 206 formed from a single piece of elastomeric material . most preferably , the radius of curvature of the front end 103 is between 0 millimeters and 4 millimeters . in addition , a further dimension that is most preferable is the thickness of the concaved shape profile of the front end 103 , may be between about 0 . 3 millimeters and about 2 millimeters . these dimensions have been found to be very important in providing flexion of the front end 103 and opening and closing of slit 208 . [ 0043 ] fig1 illustrates a valve 206 having a recess 1000 around the front end 103 adapted to receive a tension device 1100 ( fig1 ). as the applicator 101 retracts into the enclosure 102 and the compression member 205 urges the valve 206 off the pre - opener 207 , the tension device 1100 applies compression force to the slit 208 to add additional pressure to close the slit 208 . a variety of tension devices may be used around the front end 103 , such as an elastic band and a ring . fig1 illustrates a tension device 1100 made of metal or plastic to apply compression force to the front end 103 . in addition , the compression member 205 may be adapted to provide compression force to the slit 208 . with the tension device 1100 , the front end 103 may have other configurations . fig1 illustrates the tension device 1100 around the front end 103 having a substantially flat face . [ 0045 ] fig1 is a cross sectional view of the valve 206 constructed from three separate components , the front seal 1300 , rear seal 1301 and sleeve 1302 . [ 0046 ] fig1 illustrates the front seal 1300 having a recess 1000 around the front end 103 adapted to receive a tension device 1100 . the front seal 1300 is inserted into the sleeve 1302 , where the tabs 1303 are adapted to engage with the slots 1304 in the sleeve 1302 . the circumference around the front seal 1300 may be about the same or slightly greater than the inner diameter of the sleeve 1302 to form a seal . the rear seal 1301 is inserted into the sleeve 1302 , where the tabs 1305 are adapted to engage with the slots 1306 in the sleeve 1302 . the circumference around the rear seal 1301 may be about the same or slightly greater than the inner diameter of the sleeve 1302 to form a seal . [ 0047 ] fig1 illustrates the back end 104 of the valve 206 . the back end 104 has a hole 1500 adapted to receive the rod 105 with the applicator 101 attached . as the applicator 101 moves between the retracted and protracted positions , the rod 105 correspondingly moves axially in and out of the hole 1500 . the edges 1501 around the hole 1500 may be beveled to minimize the friction between the back end 104 and the rod 105 . the rod 105 forms a seal with the back end 104 . the circumference around the rod 105 may be about the same or slightly greater than the hole 1500 in the back end 104 to form a seal . while various embodiments of the invention have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible within the scope of this invention . accordingly , the invention is not to be restricted except in light of the attached claims and their equivalents .

US-79649204-A

a convertible backpack assembly for carrying items therewithin , yet providing a readily adaptable assembly for conversion into a beach - type chair . the assembly includes a front panel which is disposed generally parallel to a back panel when the assembly is in a backpack configuration . the front panel is rigidly attached to a base . the back panel is pivotally mounted to the base . armrests are provided which extend forwardly from the back panel when the assembly is converted from a backpack configuration to a chair configuration . when the assembly is in the chair configuration , the armrests are adjustable to move the back panel between reclined and an upright positions . webbing material is disposed over the frame portions to define the front and the back of the backpack as well as the back and seat of the chair . a bag made of a material such as canvas is placed between the front and back panels when the assembly is in the backpack configuration .

referring now to the drawings in detail , and particularly to fig1 a , 1b , 1c and 2 , there is shown a convertible backpack assembly 10 in its backpack and chair configurations , respectively . fig1 a is a schematic view of a person carrying the backpack using hand straps . as shown in fig1 b , the convertible backpack assembly is adapted to be carried on the back of a person by means of straps 76 , 77 ( only strap 76 is shown in fig1 b ). fig1 c depicts the unit being carried over one shoulder by a shoulder strap 100 . the integrity of the backpack configuration is maintained by two separable buckles 82 , 83 . the buckles are released , after an internal bag 88 is removed to allow the unit to convert to a chair with arms , as shown in fig2 . the bag 88 is disposed within the backpack frame and holds various sundries which a user might desire to carry such as food , drinks , cooler , blanket , radio , sun umbrella , a towel , a book , and / or suntan lotion , etc . the backpack is designed to comfortably carry large and heavy loads over a distance . the particular details of the chair are discussed in detail below . referring now to fig3 and 4 , there is shown a convertible backpack assembly in its backpack and chair configurations , respectively . as readily seen in the figures , the left and right sides of the assembly are mirror images of one another . the convertible backpack assembly 10 includes a front frame panel 12 which is an inverted u - shape , and manufactured preferably from tubular aluminum or steel . the front panel 12 has two side bars 14 , 15 and a front frame cross member 16 . the lower ends of the side bars 14 , 15 are respectively rigidly attached to frame bases 18 and 19 , disposed on each side of the assembly . the frame base 18 is shown in detail in fig8 . the back frame panel 11 is made up of two side bars 32 , 33 and a back frame cross member 34 . the lower end of the side bars 32 , 33 are pivotally - connected to the base member 18 and 19 by base pins 36 . the location of the pivot points on the side bars 32 , 33 is such that when the assembly is in the backpack configuration the back frame panel 11 stands perpendicular to the ground and rests upon the ends of the side bars 32 , 33 , as shown in fig3 . a one piece web envelope 17 is wrapped around the front and back frame panels 12 and 11 . attached to the web 17 are a pair of flexible handles 80 , 81 , one at the center of each of the front and back cross members 16 , 34 . the handles 80 , 81 enable a person to pick up the assembly conveniently when it is in the backpack configuration . additionally , releasable fasteners 82 - 85 are attached to the webbing on the upper portion of each side bar 32 , 33 , 14 , 15 , respectively . the fasteners keep the front and back panels from separating while the assembly is being used as a backpack . of course , any suitable fastener for such a purpose may be used . as shown in fig3 and 5 , shoulder straps 76 , 77 are attached to the front side of the assembly . the shoulder straps are omitted from fig4 for clarity . one end of each strap 76 , 77 is attached to the front frame panel cross member 16 by pins 76a and 77a , respectively . the other ends of the straps 76 , 77 are connected to frame bases 18 , 19 , respectively , by loops 46 and 47 . the straps can be adjusted in a manner well known to those skilled in the art . an armrest 50 is pivotally attached to side bar 32 of the back panel by a pin 58 . the opposite end of the armrest carries a bracket 52 at its under side . the bracket 52 attaches the armrest to the armrest post and provides a means to recline the back panel . as shown in fig7 the bracket 52 is affixed to the armrest by screws 52a and extends substantially perpendicular to the underside of the armrest . an elongate slot 60 in the bracket 52 which extends in a lengthwise direction with respect to the armrest is adapted to slidably receive a pin 59 . the pin 59 is mounted on the upper end of the armrest bracket 40 and secures the armrest to the armrest bracket . the chair is able to move between an upright and a reclined position when the pin slides in the slot . the slot 60 has two smaller slots 60a , 60b which extend towards the armrest . as shown in solid lines , the pin is adapted to be locked in the slot ( 60b , as shown ) when the chair is upright . when he / she desires to recline , the user simply leans forward slightly and lifts the armrest and the pin travels the distance of the elongate slot 60 . once the pin in the location shown in dashed lines in fig7 the chair is in a fully reclined position . when the pin is in the slot 60a the chair is in an intermediate reclined position . the armrest posts 40 , 41 are pivotally connected to the front frame panel side bars 14 , 15 by pins 48 , 49 , respectively . as apparent by an inspection of fig4 and 5 , the armrest posts are canted outward with respect to the seat . the outward canting increases the comfort of the chair for large people . a front cross tube 42 which rests on the ground when the device is in the chair configuration connects the lower ends of the armrest posts 40 , 41 . similarly , a rear cross tube 43 connects the frame base members 18 , 19 . as shown in fig6 the front and rear cross tubes have arcuate bends 42a , 43a , respectively , in their middle portions which generally conform to the shape of a person &# 39 ; s back . when the chair is moved from the backpack configuration shown in fig3 to the chair configuration shown in fig2 and 4 , the back frame panel 11 pivots away from the front frame panel on pins 36 . with reference to fig3 the pins 36 , 58 , 59 and 48 form the pivot points for a four bar linkage which enables the structure smoothly to change configuration between a backpack and a chair . when changing from a backpack to a chair , the side bar 32 pivots counterclockwise with respect to the base 18 on a pin 36 . as the side bar 32 moves in the counterclockwise direction , the armrest pivots about hinge 58 and causes the bracket 52 and associated pin 59 to pull the armrest post 40 counterclockwise with respect to the front panel 12 . a retaining wire 44 is attached to each armrest post at 44a and sidebars 14 and 15 at 44b , respectively , and limits the rotational movement of the armrest post about the front panel 12 . the length of the retaining wire is sufficient to stop the rotational movement of the armrest post when the assembly is in its chair configuration and prevent the chair from collapsing . additionally , when the assembly is in its reclined chair configuration , the lower ends of side bars 32 and 33 of the back panel 11 engage the bends of the base members 72 ( described in detail below ). as shown in fig6 an inner container 88 made of canvass or other similar material is provided to carry articles within the backpack assembly . the inner container 88 has front and back panels 90 and 91 , and side panels 92 and 93 and a bottom 94 . flexible handles 95 and 96 are sewn to the tops of the front and back panels 90 and 91 to enable the contents of the backpack to be conveniently carried when removed from between the panels 11 and 12 . additionally , loops 97 , 98 are provided on the side panels of the bag , which are adjacent the fastening members 82 - 85 . the straps are positioned so that the fastening members can pass through the loops to keep the container from collapsing when the structure is in the backpack configuration and prevent the container 88 from being accidentally dislodged from the front and back panels . fig8 shows the right base member 18 . a similar base member 19 is provided on the left side of the assembly ( see fig6 ). the base members 18 , 19 define the rear legs of the assembly in the chair configuration , and support the front side of the assembly when the assembly is in the backpack configuration and resting on a support surface . the base member is a one piece sheet metal form which is bent about a radius at 70 to form two generally parallel plates 72 , 73 . tabs 74 , 75 are provided on each plate 72 , 73 . the bent tabs 74 , 75 can be welded together at 86 . obviously , many different means may be used to connect them . the base member 18 is rigidly attached to the upright support 14 by rivets 78 . of course one skilled in the art will recognize the variety of means which may be used to rigidly attach the support 14 to the base member 18 . the rivets and welds increase the strength of each base , and thus , the strength of entire assembly . a strap 110 is removably attached to the forward ends of arms 50 and 51 by fasteners 111 . the strap 110 provides a convenient way to carry the convertible chair across one shoulder . each base member is provided with a large hole 72a at its center portion to reduce the overall weight of the assembly while maintaining the desired strength and rigidity . the front side bars 14 and 15 are securely engaged by welding or other suitable means within the side portions of the base members such that the base members extend over approximately one third the length of the front side bars . from the foregoing description , the many advantages of the present invention will be evident . when in the chair configuration , the structure provides a comfortable seat with arms and affords the user with the ability to select upright or reclined positions . the chair may very quickly and conveniently be converted to a backpack by closing the back and seat of the chair ( the back and front panels 11 and 12 ) to the position shown in fig6 . the shoulder straps , if detached , may easily be reconnected to the frame as shown in fig5 . when the frame is closed , the carved configurations 42a and 43a of the cross tubes 42 and 43 provide comfortable supports for the backpack against the back of the person carrying it . the container 88 may very easily be slipped into position between the two panels 11 and 12 with its bottom 94 resting on the sling area 100 disposed between the lower ends of the two panels . the fastener 82 - 85 are inserted through the loops 97 and 98 on the side panels 92 and 93 of the container to retain it in place when the backpack is carried about . the container 88 can very quickly be removed from the backpack frame by unhooking the fasteners and slipping them out of the loops . the overall shape of the backpack is very comfortable when worn on the back of a person because its overall shape and dimensions are designed to accommodate the physique of the average person . in the preferred embodiment illustrated , the backpack is approximately 9 inches deep , 22 inches high and 20 inches wide . the limited depth equal to approximately half the height of panels 11 and 12 provides excellent balance for the assembly . it will be evident to those skilled in the art that numerous modifications of the structure may be made without departing from the spirit of this invention . therefore , it is not intended that the scope of this invention be limited to the specific embodiment shown and described . rather , it &# 39 ; s scope is to be determined by the appended claims and their equivalents .

US-49645095-A

disclosed is a golf coach box , including a batting box and an arch swing plane sliding rail . one end of the swing plane sliding rail is rotatably fixed to the batting box and the other end thereof is connected via a telescopic connecting mechanism to the batting box . the beneficial effect of the present application as compared with the prior art is : the batting box is additionally provided with the swing plane sliding rail , used to simulate a swing plane during batting , thereby having a function of guiding a user to swing correctly during a batting process .

the following describes the present application in detail in combination with the preferable specific embodiments with reference to the accompanying drawings . as shown in fig1 to fig4 , a golf coach box in this embodiment includes a batting box 1 and a swing plane sliding rail 2 . the batting box takes a circular shape on the whole and the swing plane sliding rail 2 takes an arch shape on the whole . a lifter pin base 101 is fixed to one end of an outer edge of the batting box . a lifter pin 1001 is mounted , capable of being lifted up and down , in the lifter pin base 101 . a free end of the lifter pin 1001 is connected to a lifter pin connecting plate 1002 provided at a central point of the swing plane sliding rail 2 . the swing plane sliding rail 2 is provided with telescopic rod retaining pins at positions close to both ends thereof , and is detachably connected via the retaining pins to a free end of a telescopic rod 102 . the other end of the telescopic rod 102 is connected to retaining pins separately provided at two side edges of the batting box 1 . after the swing plane sliding rail 2 and the batting box 1 are connected via the telescopic rod , an included angle between the swing plane sliding rail 2 and the batting box 1 can be adjusted conveniently by adjusting a telescoping degree of the lifter pin 101 and the telescopic rod 102 . the included angle preferably has a maximum value of 65 ° and a minimum value of 0 ° ( in non - use state when the included angle is 0 °), thereby adapting to batting requirements for different clubs . swing plane sliding rail reset fixation mechanisms 103 are further provided on the two side edges of the batting box 1 . when it is unnecessary to use the swing plane sliding rail 2 , the swing plane sliding rail 2 may be reset and fixed to the outer edge of the batting box by detaching the telescopic rod 102 and moving the lifter pin 1001 , so that this coach box can serve as a training box for the user to conduct batting without the swing plane sliding rail . the method for using the swing plane sliding rail of the golf coach box of the present application is : a user correctly grips a club and stands on the batting box 1 , erects a portion of the club near a club head on the swing plane sliding rail 2 , and sways the club up and down along the swing plane sliding rail 2 to bat a ball during the swing , so as to master swing concepts . as shown in fig4 and fig5 , the swing plane sliding rail 2 of the present application includes a swing plane sliding rail body formed by an outer guard plate 201 , an inner guard plate 202 and a square tube 203 , a square rubber shock absorption pad 204 , a nylon strip track 205 , a swing rhythm display 206 , and a u - shaped groove 210 , a recess 209 . the outer guard plate 201 is wider than the inner guard plate 202 . the outer guard plate 201 and the inner guard plate 202 are connected and fixed to each other via the square tube 203 . after the fixation , the u - shaped groove 210 is formed above the square tube 203 . the width of the square rubber shock absorption pad 204 is approximate to the opening width of the u - shaped groove 210 , so that the square rubber shock absorption pad can be just clamped in the u - shaped groove 210 . the height of the square rubber shock absorption pad 204 is greater than the depth of the u - shaped groove 210 , so that an upper end of the square rubber shock absorption pad 204 is higher than top ends of the inner guard plate 202 and the outer guard plate 201 after the square rubber shock absorption pad 204 is clamped in the u - shaped groove 210 . the upper end of the square rubber shock absorption pad 204 is provided with the recess 209 for mounting the nylon strip track 205 . the nylon strip track 205 is fixed in the recess 209 with elasticity of the square rubber shock absorption pad 204 . the swing rhythm display 206 includes a plurality of led indicator lights . the led indicator lights are arranged on a lower end of the inner guard plate 202 and may be fixed thereto via the inner guard plate 202 or the square tube 203 . in practice , the led indicator lights may also be mounted at an inner side of the outer guard plate 201 . on - off control of all the plurality of led indicator lights is performed by the same control chip . a swing rhythm is indicated by controlling lighting - up and lighting - off of the led lights . for example , all the led indicator lights are turned on in advance and then are turned off from a top end of the swing plane sliding rail 2 in sequence , and a swinger controls a club and a swing speed so that the club is always maintained at a joint between a turned - off led light and a turned - on led light . to satisfy training requirements , different lighting - off speeds may be set in the control chip . in a further solution , a control chip with a remote receiver may be adopted and the remoter is utilized to switch among different lighting - off speeds , so as to facilitate user &# 39 ; s operations . the nylon strip track 205 is preferably made of a nylon material with a smooth surface . in this embodiment , a transparent or a semi - transparent hollow nylon strip track is adopted , a flexible neon line 208 ( also referred to as an electroluminescent ( el ) wire ) passes through the hollow of the nylon strip track 205 , and a battery is utilized to supply power to the el wire . during use in night , the el wire is turned on , so that a user can clearly view a swing track thereof . the el wire is preferably an el wire which takes a green appearance and emits green light . the function of the square rubber shock absorption pad 204 lies in buffering a pressure of the club on the swing plane sliding rail 2 and reducing abrasion of the club caused by the swing plane sliding rail 2 . in this embodiment , segmentation marks with different color patterns are coated on the inner guard plate and the outer guard plate of the swing plane sliding rail . the segmentation marks include one or more of a start swing segment mark , a back swing segment mark , a down swing segment mark , a release segment mark , a batting segment mark and a forward swing segment mark , used for prompting a user to master a swing arc and control a carry of the ball . as shown in fig1 , fig2 , fig3 , and fig6 , in this embodiment , the body of the batting box 1 is formed by a batting mat 104 , a lifter disk 105 , a base plate 106 , a lifter mechanism , and an organ - type dust shield 107 . the lifter disk 105 is a steel plate taking a circular shape on the whole . the batting mat 104 is placed on the lifter disk 105 . a lifter pin connecting plate 207 is provided on one side of the lifter disk 105 . the side of the lifter disk 105 where the lifter pin connecting plate 207 is provided is rotatably connected to one side of the base plate 106 . the lifter mechanism is provided between the lifter disk 105 and the base plate 106 and is used to control ascending and descending of the lifter disk 105 , so that a certain slope angle is formed for the lifter disk 105 with respect to the horizontal plane . the lifter mechanism may adopt various lifter mechanisms which are well known by persons skilled in the art , as long as the effect that a certain slope angle is formed for the lifter disk 105 with respect to the horizontal plane can be achieved . as shown in fig6 , in this embodiment , the lifter mechanism adopts a cam lifter device . a dc motor 005 is utilized to drive sector cams 002 to rotate to control a distance between the lifter disk 105 and the base plate 106 , so as to achieve ascending and descending of the lifter disk 105 . the following describes the specific structure of the cam lifter device . three bracket bearings 003 are fixed on the base plate 105 separately . the three bracket bearings 003 are positioned at the same straight line . a cam shaft 004 is fixed by the three bracket bearings 003 . one end of each of two sector cams 002 is separately fixed on each of two ends of the cam shaft 004 . four rolling wheels are mounted on a sector surface of each sector cam 002 separately . the rolling wheels are used to press against a lower surface of the lifter disk , so that a transmission connection between the sector cams 002 and the lifter disk is formed . the cam shaft 004 is driven to rotate by the dc motor 005 via a chain 006 . a gear reducer 007 is further provided between the dc motor 005 and the chain 006 . the dc motor 005 is powered by a 12 - v dc power supply 001 and is controlled by a breakpoint brake 010 to turn on or off . the lifter principle of the lifter mechanism is : the lifter disk 105 is stabilized on the base plate 006 by depending on support of the rolling wheels on the two sector cams 002 . moreover , a difference in contact position and angle between the rolling wheels on the sector cams 002 and the lifter disk 105 may cause a difference in distance between the lifter disk 105 and the cam shaft 004 , namely , a difference in distance between the lifter disk 105 and the base plate 106 . therefore , when the dc motor 005 drives the cam shaft 004 and further drives the cams 002 to rotate , contact positions between the cams 002 and the lifter disk 105 also change accordingly , and further a lifter effect is formed . the lifter mechanism further includes synchronizing wheels 017 and belts . the synchronizing wheels 017 are provided on the cam shaft 004 in a sleeve way . one end of each belt is fixed to each synchronizing wheel 017 and the other end thereof is fixed to the lifter disk 105 . a proper length is set for the belts , so that the belts may be rolled up around the synchronizing wheels 017 due to rotation of the cam shaft 004 when the lifter disk 105 descends , and that the belts are unrolled due to rotation of the cam shaft 017 when the lifter disk 105 ascends , where the length of the belts after the unrolling is equal to the distance between the lifter disk and the base plate , thereby preventing the lifter disk 105 from entirely departing from the base plate 106 due to an external force no matter where the lifter disk is located . in this embodiment , the lifter mechanism is further provided with a low level control switch 011 and a high level control switch 012 , used to control forward rotation and reverse rotation of the dc motor 005 , so as to control ascending and descending of the lifter disk . power supply input ends of the low level control switch 011 and the high level control switch 012 both are electrically connected to an output end of a lifter controller 013 . the lifter controller 013 controls on - off of the low level control switch 011 and the high level control switch 012 . a power supply input end of the lifter controller 013 is connected to the dc power supply 001 . a buzzer 014 and a buzzer 015 are provided respectively between the lifter controller 013 and the low level control switch 011 and between the lifter controller 013 and the high level control switch 012 and are used to prompt that ascending and descending are being performed . a lifter indicator light 016 is electrically connected to the lifter controller 013 . when the lifter controller 013 works , the lifter indicator light 016 emits light to prompt that the lifter mechanism is performing the ascending and descending . in specific implementation , a remote device may be adopted to control the lifter controller 013 , so as to facilitate user &# 39 ; s operations . as shown in fig3 , in this embodiment , a rotating disk 108 and at least two rotating wheels 109 are provided at the bottom of the base plate 106 of the batting box 1 . a lower surface of the rotating disk 108 is positioned at the same horizontal plane with grounding points of the rotating wheels 109 . the batting box 1 is placed on an indoor floor or an outdoor grass sod via the rotating disk 108 without fixation with an auxiliary facility , thereby achieving mobility of the coach box . since the lower surface of the rotating disk 108 and the grounding points of the rotating wheels 109 are positioned at the same horizontal plane , rotation of the batting box 1 can be achieved as long as the batting box 1 is slightly pushed without uplifting the whole batting box 1 . moreover , the collaboration between the rotating disk and the lifter mechanism may enable the batting box to simulate at least nine different batting slopes . as shown in fig3 , two laser addressing devices 110 are further provided in parallel on the base plate 106 of the batting box 1 . the laser addressing devices 110 adopt laser addressing devices whose light paths can be adjusted , and preferably , adopt laser addressing devices which emit green light beams , so as to guide user &# 39 ; s practice of a stance during batting setup and a club face during target addressing . the difference between this embodiment and embodiment 1 only lies in the design of the base plate and the rotating disk . the base plate of embodiment 1 still seems slightly cumbersome although the base plate can achieve rotation of the batting box 1 through collaboration between the rotating disk and the rotating wheel . the design of the base plate in this embodiment makes the rotation of the batting box lighter , more convenient , and safer . as shown in fig7 and fig8 , in this embodiment , the base plate 106 is a circular steel plate . the base plate is fixed on a rotating disk . the rotating disk includes an upper support tray 1061 and a lower support tray 1062 , the upper support tray 1061 being rotatably fixed to the lower support tray 1062 . the specific structure of the base plate is described below . the lower support tray 1062 is an eight - claw - shaped steel frame , formed by eight support arms connected to an octangle steel plate , where a central position of the octangle steel plate is provided with a bearing base 1063 , and an end of each support arm is provided with a roller 1064 . the upper support tray 1061 is also an eight - claw - shaped steel frame , formed by eight support arms 1067 connected to an octangle steel plate , where a central position of the upper support tray 1061 is provided with a bearing 1065 corresponding to the bearing base 1063 , and a circular rail 1066 corresponding to the roller 1064 is fixed on each support arm . an upper support arm 1061 and a lower support arm 1062 may be connected together in a relative rotating manner through collaboration between the bearing 1065 and the bearing base 1063 and between the roller 1064 and the rail 1066 . an upper surface of the upper support arm 1061 is connected to the base plate 1061 in a fixation way . the rotation of the batting box can be achieved as long as the batting box is slightly pushed when it is necessary to rotate the batting box . it is necessary to further provide a gyration braking mechanism between the upper support tray 1061 and the lower support tray 1062 , used to fix a relative position between the upper support tray 1061 and the lower support tray 1062 when it is unnecessary to rotate the batting box . the braking mechanism may be achieved by adopting a plurality of forms . for example : corresponding pin holes are provided on the upper support tray 1061 and the lower support tray 1062 , and when it is unnecessary to rotate , the braking can be achieved by passing a pin through the corresponding pin holes provided on the upper support tray 1061 and the lower support tray 1062 at the same time . the above content further describes the present application in the specific preferable embodiments in detail , but it cannot be considered that the specific embodiments of the present application are only limited to the above description . person skilled in the art to which the present application belongs may make some equivalent replacements or obvious variations without departing from the inventive concept of the present application , and the performance and uses are the same , all of which should fall into the protection scope of the present application .

US-201113825062-A

swimming goggles includes a frame body , lenses , buckles disposed at opposite end portions of the frame body , and a head strap passed through the buckles . the frame body forms shielding portions at outer sides of the frame body . the buckles have bases and operating devices being shielded by the shielding portions . the operating devices are operated through the shielding portions so as to adjust the head strap and prevent a wearer &# 39 ; s hair from being snapped and provide a comfort wearing .

referring to fig1 to 4c , swimming goggles 1 of the present invention comprises : a frame body 2 , lenses 30 , 31 , buckles 4 disposed at opposite end portions of the frame body 2 , and a head strap 5 passed through the buckles 4 ( as shown in fig9 , the head strap 5 forms a plurality of serrated grooves 50 ). the frame body 2 has left and right frames 20 , 21 , a nose bridge 22 interconnecting the left and right frames 20 , 21 , and padding portions 23 , 24 attached to the left and right frames 20 , 21 , respectively , wherein the first and second frame 20 , 21 , the nose bridge 22 , and the padding portions 23 , 24 are integrally formed and made of thermal plastic rubber ( tpr ), and the padding portions 23 , 24 are thinner than the left and right frames 20 , 21 for providing a soft contact when wearing . furthermore , shielding portions 25 are integrally formed on outer sides of the left and right frames 20 , 21 , respectively , and are intended to shield and hide the buckles 4 behind the shielding portions 25 ( as shown in fig2 ). each of the shielding portions 25 integrally forms oval humps 26 protruding outwardly of upper and lower portions of the shielding portion 25 , respectively . the oval humps 26 are intended for facilitating manually operation . peripheral portions of the lenses 30 , 31 are formed with a plurality of injection holes 301 , 311 and two connecting holes 302 , 312 , respectively . the two connecting holes 302 , 312 are disposed on portions of the lenses 30 , 31 far away from the nose bridge 22 , for being connected with the buckles 4 and providing a preliminary position of the buckles 4 . referring to fig1 in combination with the fig5 to 8 and 8 a , the buckles 4 are made of polycarbonate ( pc ), nylon resin , or thermoplastic polyurethane . each buckle 4 comprises a base 40 and an operating device 41 , wherein the base 40 comprises first and second casings 401 , 402 connectable with each other . the first casing 401 has a hollow portion 403 formed therein and a pivot portion 404 formed at a side of the first casing 401 . the pivot portion 404 consists of a shaft 405 and pivot holes 406 for receiving opposite ends of the shaft 405 , and the pivot portion 404 is configured to allow the head strap 5 to pass therethrough . furthermore , a connecting arm 407 extends laterally from the first casing 401 towards the lenses 30 , 31 , and is provided with two pegs 408 corresponding to and inserted in the connecting holes 302 , 312 of the lenses 30 , 31 in order for preliminarily positioning the first casings 401 on the lenses 30 , 31 . the first casing 401 forms multiple assembling holes 409 at upper and lower sides thereof . the second casing 402 is disposed at a side of the hollow portion 403 and intended to operate with the operating device 41 . the second casing 402 is provided with multiple pillars 42 protruding outwards of upper and lower sides of the second casing 402 so as to be inserted in the assembling holes 409 and to connect the first and second casings 401 , 402 . particularly , the second casing 402 has two guiding elements 44 spaced apart from each other , and a positioning slot 43 formed between the two guiding elements 44 . each of the operating devices 41 comprises a first arm 411 and a second arm 412 , the first and second arms 411 , 412 cooperatively forming a substantially t shape such that one end 414 of the first arm 411 integrally connected to a middle portion of the second arm 412 , and another end of the first arm 411 is formed with an engaging portion 413 which extends outwardly from opposite sides of the first arm 411 . the first arm 411 is movably disposed in the positioning slot 43 with the engaging portion 413 engaged with the two guiding elements 44 in such a way that the engaging portion 413 is capable of moving along surfaces of the two guiding elements 44 in conjunction with the first arm 411 to disengage the serrated grooves 50 of the head strap 5 ( as shown in fig9 ). the second arm 412 has an arc shape and operating portions 415 , 416 formed on opposite ends of the second arm 412 . the operating portions 415 , 416 are located in alignment with each other in a same axial direction , and each of the operating portions 415 , 416 has a shape corresponding to the oval hump 26 so as to completely fit to the oval hump 26 . referring to fig1 in combination with fig2 and fig8 a , the present invention in assembly , firstly , the first and second casings 401 , 402 are connected with the assembling holes 409 and the pillars 42 . then , the operating device 41 of the buckle 4 is disposed inside the shielding portion 25 where the operating portions 415 , 416 perfectly fit in the oval humps 26 and are exposed outside of the first casing 401 , and the engaging portions 413 of the first arm 411 engage with the two guiding elements 44 and expose to the positioning slot 43 ( as shown in fig8 a ). next , the pegs 408 of the connecting arm 407 are inserted in the connecting holes 302 , 312 of the lenses 30 , 31 . finally , through the injection molding technique the left and right frames 20 , 21 , the nose bridge 22 , the padding portions 23 , 24 , the connecting arms 407 , and the injection holes 301 , 311 and the connecting holes 302 , 312 of the lenses 30 , 31 are all formed integrally . referring to fig2 , because the buckles 4 are disposed in and shielded by the shielding portions 25 , the buckles 4 are not likely to contact a wearer &# 39 ; s head and snap the wearer &# 39 ; s hair . referring to fig8 a and fig9 , to adjust the head strap 5 , it is only needed to press the oval humps 26 concurrently ( as indicated by the arrows ) to further press the operating portions 415 , 416 , whereby the second arm 412 deforms accordingly and bends towards the connecting arm 407 . as a result , the first arm 411 moves in conjunction with the second arm 412 , and the engaging portion 413 moves along the surfaces of the two guiding elements 44 towards the connecting arm 407 so as to disengage the serrated grooves 50 of the head strap 5 , whereby the head strap 5 is allowed to move through the pivot portion 404 . likewise , when the oval humps 26 are not being pressed , the second arm 412 returns to a previous state of not bending , and the engaging portion 413 moves back along the surfaces of the two guiding elements 44 to engage the serrated grooves 50 . it is understood that the invention may be embodied in other forms within the scope of the claims . thus the present examples and embodiments are to be considered in all respects as illustrative , and not restrictive , of the invention defined by the claims .

US-201213476286-A

the present invention provides a method for detection or determination of vitamin c by luminescence that employs a redox - responsive fluorogenic probe consisting of porphyrin or phthalocyanine with a nitroxide radical , or that employs a liposome preparation comprising the said redox - responsive fluorogenic probe . the present method can overcome the problems of prior art methods , and in particular , are applicable for bioimaging to allow elucidation of the behavior of vitamin c in vivo .

a porphyrin or a phthalocyanine with a nitroxide radical ( s ) according to the present invention is a porphyrin or a phthalocyanine comprising a nitroxide radical ( s ) in part of its chemical structure ( for example , as an axial ligand , as a ring fused to the porphyrin or phthalocyanine ring , or as a substituent on the porphyrin or the phthalocyanine ring ). according to the present invention , the terms “( a ) porphyrin ( s )” and “( a ) phthalocyanine ( s )” refer to “ porphyrin or derivatives thereof ” and “ phthalocyanine or derivatives thereof ”, respectively . thus , for the purpose of the present invention , the terms “ porphyrin ” and “ phthalocyanine ” include porphyrin and phthalocyanine as well as their analogs naphthalocyanine , 5 , 10 , 15 , 20 - tetraazaporphyrin , subphthalocyanine and superphthalocyanine , and substituted derivatives thereof . once the unpaired electrons of the nitroxide radical ( s ) is lost ( they lose their radical nature ), the compounds of the present invention exhibit increased luminescence intensity in the range of high permeability to biological tissue (& gt ; 650 nm ). the porphyrin or phthalocyanine with a nitroxide radical ( s ) of the present invention is preferably a compound of the following formula i : in formula i or ii , x is n or cr ′, where r ′ is a hydrogen atom , a c 1 - 18 alkyl group , an aryl group or a nitrogen - containing heterocyclyl group . x is preferably n . also in formula i or ii , m is h 2 ( i . e . the compound is metal - free ) or an atom selected from elements of groups 2 - 4 or groups 8 - 15 of the periodic table such as mg , al , si , sc , ti , cu , zn , ga , ge , y , zr , ru , rh , pd , ag , cd , in , sn , la , ce , lu , hf , os , ir , pt , au , hg , tl , th or u . preferably , m is an atom selected from elements of group 2 or groups 12 - 15 of the periodic table such as mg , al , si , zn , ga , ge , cd , in or sn . more preferred are compounds wherein m is an atom selected from elements of group 14 of the periodic table , with m most preferably being si , and two axial ligands l are present , such as a complex of the following formula iii : in formula iii , x has the same definition as in formulas i and ii , and it is preferably n . specifically , it is preferably a ( phthalocyaninato ) silicon complex with a nitroxide radical ( s ) as an axial ligand ( s ). in formula i or ii , the nitroxide radical ( s ) may be present as the axial ligand ( s ) l if m is an atom selected from elements of groups 2 - 4 or groups 8 - 15 of the periodic table , or in formula i , it may be present as the substituent r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 or r 8 on the porphyrin or phthalocyanine ring . one of the axial ligands l 1 and l 2 in the compound of formula iii is a nitroxide radical . a nitroxide radical as such an axial ligand or a substituent may be a group comprising & gt ; n — o ., but it is preferably of the following formula iv : in formula iv , y together with n forms a 5 - to 6 - membered , saturated or partially unsaturated , nitrogen - containing hetero ring , where the two atoms adjacent to the & gt ; n — o . group are tertiary carbon atoms , and the nitrogen - containing hetero ring optionally includes an additional n or o atom . the nitroxide radical is preferably a group comprising a 5 - to 6 - membered , saturated or partially unsaturated , nitrogen - containing hetero ring structure selected from 2 , 2 , 6 , 6 - tetramethyl - 1 - piperidinyloxy ( tempo ), 2 , 2 , 5 , 5 - tetramethyl - 1 - pyrrolidinyloxy ( proxyl ), 4 , 4 - dimethyl - 3 - oxazolidinyloxy ( doxyl ) or nitronylnitroxide ( nn ). in formula iv , z is a single bond or a spacer to the central atom m of the complex or the porphyrin or phthalocyanine ring , such as — o —, —( ch 2 ) 1 - 18 —, — co —, — coo —, — oco —, — nh —, — nhco — or — conh —, or a combination thereof . alternatively , the nitroxide radical in formula i or ii may be present as a ring fused to the porphyrin or phthalocyanine ring . specifically , r 1 and r 2 , r 3 and r 4 , r 5 and r 6 and / or r 7 and r 8 in formula i “ form an aromatic ring or a nitrogen - containing hetero ring together with the carbon atoms to which they are bonded , may form a ring containing a nitroxide radical ( s ) together with two adjacent ring atoms of the aromatic ring or the nitrogen - containing hetero ring ”, which means that a 5 - to 6 - membered , saturated or partially unsaturated , nitrogen - containing hetero ring comprising & gt ; n — o . group , where the two atoms adjacent to the & gt ; n — o . group are tertiary carbon atoms , is further formed together with two adjacent ring atoms of the aromatic ring or the nitrogen - containing hetero ring which r 1 and r 2 , r 3 and r 4 , r 5 and r 6 and / or r 2 and r 8 form together with the carbon atoms to which they are bonded . a preferred ring is a 5 - to 6 - membered , saturated or partially unsaturated , nitrogen - containing hetero ring such as tempo , proxyl , doxyl or nn as mentioned above . tempo or proxyl is especially preferred . similarly , the phrase “ when n is 2 , the two adjacent groups of each ra , rb , rc and rd may form a ring containing a nitroxide radical ( s ) together with the ring atoms to which they are bonded ” for formula ii means that each of ra , rb , rc and / or rd , together with the two adjacent ring atoms , form a 5 - to 6 - membered , saturated or partially unsaturated , nitrogen - containing hetero ring comprising & gt ; n — o . group , where two atoms adjacent to the & gt ; n — o . group are tertiary carbon atoms , and the nitrogen - containing hetero ring may include an additional n or o atom . a preferred ring is a 5 - to 6 - membered , saturated or partially unsaturated , nitrogen - containing hetero rings such as tempo , proxyl , doxyl or nn as mentioned above . tempo or proxyl is especially preferred . the following is an example of such compound of formula ii : where m has the same definition as above . such compound can be prepared by the method described in anthony g . m . barrett , et al ., tetrahedron 63 ( 24 ), 5244 - 5250 ( 2007 ), for example . in formula i of the present invention , r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 and r 8 are , independently of one another , a hydrogen atom , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group , an aryl group , a nitrogen - containing heterocyclyl group or a nitroxide radical , or r 1 and r 2 form an aromatic ring or a nitrogen - containing hetero ring together with the carbon atoms to which they are bonded , and the aromatic ring or the nitrogen - containing hetero ring is unsubstituted or substituted with one or more substituents selected from the group consisting of a halogen atom , a hydroxyl group , a sulfo group , a carboxyl group , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group , — s ( o ) 0 - 2 — c 1 - 18 alkyl , —( och 2 ch 2 ) 1 - 8 — o — c 1 - 6 alkyl , an aryl group and a nitrogen - containing heterocyclyl group , or may form a ring containing a nitroxide radical ( s ) together with two adjacent ring atoms of the aromatic ring or the nitrogen - containing hetero ring , r 3 and r 4 form an aromatic ring or a nitrogen - containing hetero ring together with the carbon atoms to which they are bonded , and the aromatic ring or the nitrogen - containing hetero ring is unsubstituted or substituted with one or more substituents selected from the group consisting of a halogen atom , a hydroxyl group , a sulfo group , a carboxyl group , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group , — s ( o ) 0 - 2 — c 1 - 18 alkyl , —( och 2 ch 2 ) 1 - 8 — o — c 1 - 6 alkyl , an aryl group and a nitrogen - containing heterocyclyl group , or may form a ring containing a nitroxide radical ( s ) together with two adjacent ring atoms of the aromatic ring or the nitrogen - containing hetero ring , r 5 and r 6 form an aromatic ring or a nitrogen - containing hetero ring together with the carbon atoms to which they are bonded , and the aromatic ring or the nitrogen - containing hetero ring is unsubstituted or substituted with one or more substituents selected from the group consisting of a halogen atom , a hydroxyl group , a sulfo group , a carboxyl group , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group , — s ( o ) 0 - 2 — c 1 - 18 alkyl , —( och 2 ch 2 ) 1 - 8 — o — c 1 - 6 alkyl , an aryl group and a nitrogen - containing heterocyclyl group , or may form a ring containing a nitroxide radical ( s ) together with two adjacent ring atoms of the aromatic ring or the nitrogen - containing hetero ring , or r 7 and r 8 form an aromatic ring or a nitrogen - containing hetero ring together with the carbon atoms to which they are bonded , and the aromatic ring or the nitrogen - containing hetero ring is unsubstituted or substituted with one or more substituents selected from the group consisting of a halogen atom , a hydroxyl group , a sulfo group , a carboxyl group , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group , — s ( o ) 0 - 2 — c 1 - 18 alkyl , —( och 2 ch 2 ) 1 - 8 — o — c 1 - 6 alkyl , an aryl group and a nitrogen - containing heterocyclyl group , or may form a ring containing a nitroxide radical ( s ) together with two adjacent ring atoms of the aromatic ring or the nitrogen - containing hetero ring . the phrase “ r 1 and r 2 form an aromatic ring or a nitrogen - containing hetero ring together with the carbon atoms to which they are bonded ” means that r 1 and r 2 , together with the two carbon atoms of the pyrrole ring portion to which they are bonded , form an aromatic ring such as a benzene or naphthalene ring , or a 5 - to 6 - membered , saturated , partially unsaturated or unsaturated ring containing at least one nitrogen atom , preferably one or two nitrogen atoms , such as a pyridine or pyrazine ring . the same definitions found in “ r 3 and r 4 ”, “ r 5 and r 6 ”, “ r 7 and r 8 ” are the same as stated above . the compounds of formula ii of the present invention correspond to compounds of formula i wherein each of r 1 and r 2 , r 3 and r 4 , r 5 and r 6 and r 7 and r 8 forms a benzene ring together with carbon atoms to which they are bonded . in formula ii , therefore , ra , rb , rc and rd are , independently of one another , a halogen atom , a hydroxyl group , a sulfo group , a carboxyl group , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group , — s ( o ) 0 - 2 — c 1 - 18 alkyl , —( och 2 ch 2 ) 1 - 8 — o — c 1 - 6 alkyl , an aryl group or a nitrogen - containing heterocyclyl group , or when n is 2 , two adjacent groups of each ra , rb , rc and rd may form a ring containing a nitroxide radical ( s ) together with ring atoms to which they are bonded , and each n is independently 0 , 1 , 2 , 3 or 4 . the complexes of formula iii of the present invention correspond to compounds of formula ii wherein m is si ( silicon ) having axial ligands l 1 and l 2 , at least one of which is a nitroxide radical . in formula iii , therefore , ra ′, rb ′, rc ′ and rd ′ are , independently of one another , a halogen atom , a hydroxyl group , a sulfo group , a carboxyl group , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group , — s ( o ) 0 - 2 — c 1 - 18 alkyl , —( och 2 ch 2 ) 1 - 8 — o — c 1 - 6 alkyl , an aryl group or a nitrogen - containing heterocyclyl group , and each n is independently 0 , 1 , 2 , 3 or 4 . throughout the present specification and claims , the term “ a halogen atom ” refers to fluorine , chlorine , bromine or iodine , unless otherwise specified . preferably , it is chlorine . the term “ a c 1 - 18 alkyl group ”, unless otherwise specified , means a straight - chain or branched - chain , saturated hydrocarbon group having 1 - 18 carbon atoms , either alone or in combination with other terms . as examples there may be mentioned methyl , ethyl , n - propyl , iso - propyl , n - butyl , iso - butyl , sec - butyl , tert - butyl , n - pentyl , n - hexyl , n - heptyl , n - octyl , decyl , dodecyl , octadecyl and the like . c 1 - 8 alkyl groups are preferred . also , unless other specified , the term “ a c 1 - 18 alkoxy group ” refers to “ a c 1 - 18 alkyl group ” as described above bonded through an oxygen atom , or in other words a c 1 - 18 alkyl - o - group . as examples there may be mentioned methoxy , ethoxy , n - propoxy , iso - propoxy , n - butoxy , iso - butoxy , sec - butoxy , tert - butoxy , n - pentyloxy , n - hexyloxy , n - heptyloxy , n - octyloxy , decyloxy , dodecyloxy , octadecyloxy and the like . c 1 - 8 alkoxy groups are preferred . similarly , unless other specified , the term “ a tri ( c 1 - 18 alkyl ) silyloxy group ” refers to a group wherein the three “ c 1 - 18 alkyl ” portions , which may be the same or different , is selected from “ a c 1 - 18 alkyl group ” described above . as examples of such tri ( c 1 - 18 alkyl ) silyloxy groups there may be mentioned trimethylsilyloxy , triethylsilyloxy , tri - iso - propylsilyloxy , tri - n - hexylsilyloxy , decyl - dimethylsilyloxy , dimethyl - octadecylsilyloxy and the like . unless other specified , the term “— s ( o ) 0 - 2 — c 1 - 18 alkyl ” includes — s — c 1 - 18 alkyl , — s ( o )— c 1 - 18 alkyl and — s ( o ) 2 — c 1 - 18 alkyl . preferred groups are — s — c 1 - 8 alkyl , — s ( o )— c 1 - 8 alkyl and — s ( o ) 2 — c 1 - 8 alkyl , such as methylthio or ethylthio . the term “—( och 2 ch 2 ) 1 - 8 o — c 1 - 6 alkyl ” refers to an ethyleneglycol group with 1 - 8 oxyethylene ( och 2 ch 2 ) units . it is preferably —( och 2 ch 2 ) 2 - 4 o — c 1 - 6 alkyl , such as 3 , 6 , 9 - trioxadecyloxy , for example . also , unless other specified , the term “ an aryl group ” refers to a monovalent group of aromatic mono - or poly - carbocyclic compound having 6 - 14 carbon atoms , either alone or in combination with other terms . as examples there may be mentioned phenyl , naphthyl , anthryl , phenanthryl , and the like . “ an aryl group ” may be unsubstituted or substituted with one or more substituents selected from the group consisting of a halogen atom , a hydroxyl group , a sulfo group , a carboxyl group , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group and a phenyl group . preferred aryl group is phenyl or naphthyl . similarly , unless other specified , the term “ a nitrogen - containing heterocyclyl group ” refers to a monovalent group of a 5 - to 6 - membered , saturated , partially unsaturated or unsaturated ring containing at least one nitrogen atom , preferably one or two nitrogen atoms , either alone or in combination with other terms . “ a nitrogen - containing heterocyclyl group ” may be unsubstituted or substituted with one or more substituents selected from the group consisting of a halogen atom , a hydroxyl group , a sulfo group , a carboxyl group , a c 1 - 18 alkyl group , a c 1 - 18 alkoxy group and a phenyl group , or may form an onium from by an addition of proton or a c 1 - 8 alkyl group to the at least one nitrogen atom . preferred nitrogen - containing heterocyclyl group is pyridyl , pyrazinyl or an onium compound thereof ( n - methyl - pyridiniumyl , for example ). table 1 below lists representative examples of the porphyrins or the phthalocyanines with a nitroxide radical ( s ) to be used as fluorogenic probes according to the invention . the ( phthalocyaninato ) silicon complexes r1 - r6 shown in table 1 as examples of the present invention can be produced by the methods described in references mentioned above ( see k . ishii et al ., j . porphyrins phthalocyanines 3 , 439 - 443 ( 1999 ); k . ishii et al ., j . am . chem . soc . 123 ( 4 ), 702 - 708 ( 2001 ); k . ishii et al ., j . phys . chem . a 105 ( 28 ), 6794 - 6799 ( 2001 ); and k . ishii et al ., j . phys . chem . a 108 ( 16 ), 3276 - 3280 ( 2004 ), for example ) or the procedures described in the examples given below . a person skilled in the art can produce any porphyrin or phthalocyanine with a nitroxide radical ( s ) according to the present invention , and particularly a compound of formula i , ii or iii , based on these methods and common technical knowledge . a liposome preparation of the present invention is a preparation comprising such a porphyrin or phthalocyanine with a nitroxide radical ( s ) encapsulated into closed vesicles ( liposomes ) composed of lipid bilayers . for example , a liposome preparation of the present invention may comprise a porphyrin or phthalocyanine with a nitroxide radical ( s ) according to the present invention encapsulated into unilamellar or multilamellar liposomes formed from a phospholipid , such as an egg yolk - or soybean - derived natural phospholipid , or a synthetic phospholipid such as dimyristoylphosphatidylcholine , distearoylphosphatidylcholine or dipalmitoylphosphatidylcholine . it may be in fine particulate form , or in solution or suspension form containing fine particles . the liposome preparation can be produced by a method known to those skilled in the art or a procedure described in the examples given below . an auxiliary agent other than the active ingredients , such as a saccharide ( lactose , mannitol or the like ), neutral lipid ( cholesterol , a triglyceride or the like ) or a charged lipid ( phosphatidic acid , stearylamine or the like ) may be added , or any membrane modification of the liposomes according to known method may also be conducted in order to impart desired properties . the method for detection and determination of vitamin c by luminescence according to the present invention comprises ( 1 ) a step of contacting a fluorogenic probe or liposome preparation according to the present invention with a sample under irradiation with excitation light at a wavelength of 650 nm or greater ; and ( 2 ) a step of monitoring the luminescence . the sample may be prepared by first preparing a solution or suspension of a ( putatively ) vitamin c - containing specimen in water , a buffering solution or an organic solvent that can dissolve vitamin c , such as methanol , or a mixture of the foregoing , to a suitable concentration , or if the specimen is a liquid , by using it directly or after appropriate pretreatment . the method for detection and determination of vitamin c by luminescence according to the present invention includes monitoring of the increase in luminescence intensity that occurs when a fluorogenic probe of the present invention , i . e . a porphyrin or phthalocyanine with a nitroxide radical ( s ), is contacted with vitamin c to reduce the nitroxide radical and convert it to a reduced form not having the unpaired electron ( that is , the luminescence quenching effect of the nitroxide radical is lost ) ( see the schematic of reaction system shown in fig2 ). it is a feature of the present invention that the increase in luminescence intensity occurs in a range of high permeability to biological tissue (& gt ; 650 nm ) ( see fig7 , for example ). thus , the excitation light may be set to a wavelength of 650 nm or greater , and preferably near the maximum excitation wavelength of the reduced form , and the emitted light may also be monitored near the maximum fluorescence wavelength of the reduced form . the method for determination of vitamin c according to the invention further comprises ( 2 ) a step of monitoring luminescence and measuring the time - profile of luminescence intensity ; and ( 3 ) determining the concentration of vitamin c in the sample . we have found that a correlation exists between vitamin c concentration and the reaction rate constant calculated from the time - profile of the luminescence intensity ( see examples 1 - 4 below ). vitamin c is a two - electron reducing agent , but since the first electron reduction is the rate - determining step , the reaction between vitamin c and the fluorogenic probe consisting of a porphyrin or phthalocyanine with one nitroxide radical in methanol , for example , can be understood as a second order reaction ( pseudo - first - order reaction ), while the reaction between vitamin c and a fluorogenic probe consisting of a porphyrin or phthalocyanine with two nitroxide radicals can be understood as the consecutive reaction . we have confirmed that when a liposome preparation comprising a fluorogenic probe consisting of a porphyrin or phthalocyanine with 1 or 2 nitroxide radicals is used , both can be understood as second order reactions ( pseudo - first - order reactions ). a person skilled in the art , therefore , can analyze the time - profile of luminescence intensity with an appropriate reaction rate equation to calculate the rate constant . thus , the method for determining vitamin c according to the present invention is a very simple method that allows the rate constant to be calculated based on analysis of the time - profile of luminescence intensity , so that the concentration can be determined using a calibration curve . the methods for detection and determination of vitamin c can be applied as methods for detecting vitamin c in vivo . the method for detection of vitamin c in vivo , according to the present invention , comprises ( 1 ) a step of administering a liposome preparation of the present invention to a subject ; and ( 2 ) a step of irradiating the subject with excitation light of wavelength of 650 nm or greater and monitoring the luminescence . we have already reported that a ( phthalocyaninato ) silicon complex having a nitroxide radical as an axial ligand , incorporated into liposomes , reaches the intracellular space and is minimally affected by oxidation - reduction in vivo ( see k . ishii et al ., free radical biology & amp ; medicine 38 , 920 - 927 ( 2005 ); and k . ishii et al ., seisan kenkyu vol . 602 ( 2008 ), p . 160 - 163 , for example ). evidence provided in the present specification confirms that the liposome preparation reacts with vitamin c and exhibits an increase in luminescence intensity in a range of high permeability to biological tissue . a fluorogenic probe or liposome preparation of the present invention , therefore , is fully expected to be applicable for biofluorescent imaging of vitamin c . preparation of complexes r1 and r2 ( see fig1 or table 1 ) dihydroxy ( tetra - tert - butyl phthalocyaninato ) silicon ( sipc ( oh ) 2 ) ( r0 listed in table 1 ) can be obtained by the method described in macromolecules , 11 ( 1 ), 186 - 191 ( 1978 ). sipc ( oh ) 2 ( 50 mg ) and 2 , 2 , 6 , 6 - tetramethyl - 4 - piperidinol - 1 - oxyl ( 430 mg , cat .- no . 176141 , purchased from sigma - aldrich co . ; hereinafter referred to as “ 4 - hydroxy - tempo ”) were heated to reflux for 48 hours in toluene , in the presence of calcium chloride ( 2 g ). after cooling the obtained mixture , it was purified by basic alumina and gel filtration chromatography ( bio - beads sx - 1 , purchased from bio - rad ), to obtain complexes r1 and r2 at yields of 40 % and 15 %, respectively . r1 elemental analysis ( c 57 h 66 n 9 o 3 si ): r2 elemental analysis ( c 66 h 82 n 10 o 4 si ): complex r3 was obtained at a yield of 37 % in the same manner as preparation example 1 , except that 3 - hydroxy - 2 , 2 , 5 , 5 - tetramethyl - 1 - pyrrolidinyloxy [ hereinafter referred to as “ 3 - hydroxy - proxyl ”; prepared from 3 - carbamoyl - 2 , 2 , 5 , 5 - tetramethyl - 1 - pyrrolidinyloxy ( cat .- no . c5151 , purchased from sigma - aldrich co .) by the method described in e . g . rozantsev et . al ., tetrahedron 21 , 491 ( 1965 )] was used instead of 4 - hydroxy - tempo , and the reflux time was 24 hours . uv - vis ( λ / nm ( ε / 10 4 )) 685 . 0 ( 28 . 0 ), 651 . 0 ( 3 . 76 ), 612 . 0 ( 4 . 41 ), 360 . 0 ( 8 . 90 ); elemental analysis ( c 56 h 64 n 9 o 3 si ): complex r4 was obtained at a yield of 19 % in the same manner as preparation example 1 , except that 3 - hydroxy - proxyl was used instead of 4 - hydroxy - tempo and the reflux time was 42 hours . uv - vis ( λ / nm ( ε / 10 4 )) 682 . 5 ( 26 . 0 ), 651 . 5 ( 3 . 45 ), 613 . 5 ( 4 . 19 ), 359 . 5 ( 8 . 69 ); elemental analysis ( c 64 h 78 n 10 o 4 si ): sipc ( oh ) 2 and 4 - carboxy - 2 , 2 , 6 , 6 - tetramethylpiperidine - 1 - oxyl ( cat .- no . 382 , 000 , purchased from sigma - aldrich co . ; hereinafter referred to as “ 4 - carboxy - tempo ”) were heated to reflux for 24 hours in pyridine . after cooling the obtained mixture , it was purified by neutral alumina and gel filtration chromatography ( bio - beads sx - 1 or sx - 8 , purchased from bio - rad ), to obtain complex r5 at a yield of 9 %. uv - vis ( λ / nm ( ε / 10 4 )) 685 . 5 ( 24 . 2 ), 656 . 0 ( 3 . 33 ), 616 . 5 ( 3 . 72 ), 362 . 5 ( 7 . 64 ); elemental analysis ( c 58 h 66 n 9 o 4 si ): complex r6 was obtained at a yield of 15 % in the same manner as preparation example 4 , except that 3 - carboxy - 2 , 2 , 5 , 5 - tetramethyl - 1 - pyrrolidinyloxy ( cat .- no . 253324 , purchased from sigma - aldrich co . ; hereinafter referred to as “ 3 - carboxy - proxyl ”) was used instead of 4 - hydroxy - tempo . uv - vis ( λ / nm ( ε / 10 4 )) 685 . 0 ( 23 . 6 ), 653 . 0 ( 3 . 61 ), 616 . 5 ( 3 . 77 ), 362 . 0 ( 7 . 75 ); elemental analysis ( c 57 h 64 n 9 o 4 si ): ( 1 ) a 5 . 6 × 10 − 6 m solution of complex r1 obtained in preparation example 1 in methanol was prepared . ( 2 ) 64 mm , 16 mm , 8 mm and 4 mm solutions of vitamin c in methanol were prepared . ( 3 ) in a glass cell there were placed 1 . 8 ml of the solution obtained in the above ( 1 ) and a microstir bar , and the mixture was stirred with a stirrer ( 1000 r . p . m ). ( 4 ) the stirred mixture was irradiated with a diode laser ( manufactured by yamaki ; ldx - 2615 - 650 - to3 ; wavelength : 650 nm ) as excitation light , the luminescence was monitored at 680 nm using a spectrometer ( manufactured by jasco co . ; ct - 25tp ) and a photomultiplier ( manufactured by hamamatsu photonics k . k . ; r928 ), while adding 0 . 2 ml of the vitamin c methanol solution obtained in the above ( 2 ), and the time - profile of luminescence intensity was measured . during this time , the angle and positional relationship were adjusted so that the optical fibers did not capture diffuse reflection from the microstir bar . ( 5 ) the data were used for analysis at least 300 seconds after addition of the vitamin c , in consideration of contribution of non - uniform diffusion . the luminescence intensity time profiles are shown in fig3 . the data from at least 300 seconds after vitamin c addition were used for analysis of the pseudo - first - order reaction , to obtain a reaction rate constant . a positive correlation was found between the reaction rate constant and vitamin c concentration ( fig4 ). this indicated that vitamin c can be precisely quantified by this method . vitamin c determining experiment using complex r1 ( in liposome aqueous solution ) ( 1 ) the quantity of 0 . 15 mg ( 1 . 58 × 10 − 7 mol ) of complex r1 obtained in preparation example 1 was determined using the absorption spectrum . ( 2 ) 20 . 9 mg ( 2 . 86 × 10 − 5 mol ) of dipalmitoylphosphatidylcholine ( dppc ) was dissolved in 3 . 6 ml of chloroform . ( 3 ) r1 was placed in a round - bottom flask and 180 μl of thf was added . a chloroform solution containing the liposomes obtained in the above ( 2 ) was then added , and the solvent was removed with an evaporator . ( 4 ) after adding 2 . 0 ml of pbs ( phosphate buffered saline , d - pbs (−)) and 0 . 5 g of glass beads to the dried solid , the mixture was placed in a vortex mixer and subjected to ultrasonic treatment at 50 ° c . for 1 hour . ( 5 ) after cooling , it was subjected to centrifugal separation ( 3500 r . p . m , 10 minutes , 4000 r . p . m , 10 minutes , at room temperature ) to obtain a supernatant solution as the target product . ( 6 ) 64 mm , 32 mm , 16 mm , 8 mm 4 mm and 2 mm solutions of vitamin c in pbs ( phosphate buffered saline , d - pbs (−)) were prepared . ( 7 ) the solution of the above ( 5 ) was diluted with pbs ( phosphate buffered saline , d - pbs (−)) in such a way that the absorbance at a peak wavelength is about abs = 0 . 5 , 1 . 35 ml of the diluted solution and a microstir bar were placed in a glass cell , and the mixture was stirred with a stirrer ( 1000 r . p . m ). ( 8 ) the stirred mixture was irradiated with a diode laser ( manufactured by yamaki ; ldx - 2615 - 650 - to3 ; wavelength : 650 nm ) as excitation light , the luminescence was monitored at 690 nm using a spectrometer ( manufactured by jasco co . ; ct - 25tp ) and a photomultiplier ( manufactured by hamamatsu photonics k . k . ; r928 ), while adding 0 . 15 ml of the vitamin c pbs solution obtained in the above ( 6 ), and the time - profile of luminescence intensity was measured . during this time , the angle and positional relationship were adjusted so that the optical fibers did not capture diffuse reflection from the microstir bar . the luminescence intensity time profiles are shown in fig5 . the exponential increase in luminescence intensity was successfully observed , as in the methanol solution . ( 1 ) a 5 × 10 − 6 m solution of complex r2 obtained in preparation example 1 in methanol was prepared . ( 2 ) a 64 mm solution of vitamin c in methanol was prepared . ( 3 ) in a glass cell there were placed 1 . 35 ml of the solution obtained in the above ( 1 ) and a microstir bar , and the mixture was stirred with a stirrer ( 1000 r . p . m ). ( 4 ) the stirred mixture was irradiated with a diode laser ( manufactured by yamaki ; ldx - 2615 - 650 - to3 ; wavelength : 650 nm ) as excitation light , the luminescence was monitored at 686 nm using a spectrometer ( manufactured by jasco co . ; ct - 25tp ) and a photomultiplier ( manufactured by hamamatsu photonics k . k . ; r928 ) while adding 0 . 15 ml of the vitamin c methanol solution obtained in the above ( 2 ), and the time - profile of luminescence intensity was measured . during this time , the angle and positional relationship were adjusted so that the optical fibers did not capture diffuse reflection from the microstir bar . vitamin c determining experiment using complex r2 ( in liposome aqueous solution ) ( 1 ) the quantity of 0 . 175 mg ( 1 . 58 × 10 − 7 mol ) of complex r2 obtained in preparation example 1 was determined using the absorption spectrum . ( 2 ) 20 . 9 mg ( 2 . 86 × 10 − 5 mol ) of dppc was dissolved in 3 . 6 ml of chloroform . ( 3 ) r2 was placed in a round - bottom flask and 180 μl of thf was added . a chloroform solution containing the liposomes obtained in the above ( 2 ) was then added , and the solvent was removed with an evaporator . ( 4 ) after adding 2 ml of pbs ( phosphate buffered saline , d - pbs (−)) and 0 . 5 g of glass beads to the dried solid , the mixture was placed in a vortex mixer and subjected to ultrasonic treatment at 50 ° c . for 1 hour . ( 5 ) after cooling , it was subjected to centrifugal separation ( 3500 r . p . m , 10 minutes , at room temperature ) to obtain a supernatant solution as the target product . ( 6 ) 128 mm , 64 mm , 16 mm , 8 mm , 4 mm and 2 mm solutions of vitamin c in pbs ( phosphate buffered saline , d - pbs (−)) were prepared . ( 7 ) the solution of the above ( 5 ) was diluted with pbs ( phosphate buffered saline , d - pbs (−)) in such a way that the absorbance at a peak wavelength is about abs = 1 . 4 , 1 . 35 ml of the diluted solution and a microstir bar were placed in a glass cell , and the mixture was stirred with a stirrer ( 1000 r . p . m ). ( 8 ) the stirred mixture was irradiated with a diode laser ( manufactured by yamaki ; ldx - 2615 - 650 - to3 ; wavelength : 650 nm ) as excitation light , the luminescence was monitored at 686 nm ( 700 nm for 12 . 8 mm ) using a spectrometer ( manufactured by jasco co . ; ct - 25tp ) and a photomultiplier ( manufactured by hamamatsu photonics k . k . ; r928 ), while adding 0 . 15 ml of the vitamin c pbs solution obtained in the above ( 6 ), and the time - profile of luminescence intensity was measured . during this time , the angle and positional relationship were adjusted so that the optical fibers did not capture diffuse reflection from the microstir bar . the luminescence intensity time profiles are shown in fig6 . a correlation was found between vitamin c concentration and luminescence intensity . also , a 500 % increase in luminescence intensity , which was a change in luminescence intensity considered sufficient for bioimaging , was observed ( fig7 ). in addition , the time - profile of luminescence intensity could be fit to a pseudo - first - order reaction , and a correlation between vitamin c concentration and reaction rate constant was seen in the low concentration range ( fig8 ). it is therefore expected to be applied to fluorescence bioimaging of vitamin c in cells used for research . ( 1 ) a solution of complex r2 liposomes prepared by steps ( 1 )-( 5 ) in the above example 4 ( hereinafter referred to as “ r2 liposomes ”) was diluted 10 - fold with dmf , the amount of the photosensitizer ( complex r2 ) encapsulated into the liposomes was calculated from the absorbance of the absorption spectrum to determine the concentration , and the concentration was adjusted . ( 2 ) hela cells ( 2 × 10 4 cells / cm 2 , purchased from health sciences research resources bank ) of 5 ml of medium were inoculated into a 6 cm dish , and then cultured in an incubator for 24 hours . a solution of r2 liposome in pbs ( phosphate buffered saline , d - pbs (−)) was adjusted to 2 × 10 − 6 m and was added to the dish , and culturing was continued for 20 hours . ( 3 ) the medium was removed , washing was performed twice with pbs ( phosphate buffered saline , d - pbs (−)), and then 5 ml of a medium ( 5 ml of mem non - essential amino acids solution , 5 ml of antibiotic , 10 ml of 1m hepes and 50 ml of fbs ( fetal bovine serum ) were added to 500 ml of eagle &# 39 ; s minimal essential medium ) was added , and then the concentration of vitamin c in the media was adjusted to 12 . 8 mm by adding 0 . 55 ml of solution of vitamin c in pbs ( phosphate buffered saline , d - pbs (−)). ( 4 ) the luminescence was periodically observed with a fluorescence microscope ( manufactured by leica ; irb ) and a ccd camera ( manufactured by leica ; dfc350fx ) ( excitation light : 590 - 650 nm , monitoring wavelength : 664 - 734 nm ) using a cut filter ( manufactured by leica ; y5 ) and the image was recorded . ( 5 ) the obtained fluorescence microscope image was used to analyze the luminescence intensity time profile with image processing software ( imagej ). a cell line without addition of vitamin c after adding r2 liposomes was observed in the same manner as above , but virtually no luminescence was seen even after 24 hours ( fig9 a ). in the vitamin c - added cell line , however , a significant change in the luminescence was seen after addition , with strong luminescence being confirmed even after 240 minutes ( fig9 b ). fig1 shows the luminescence intensity time profile as analyzed using image processing software . this experiment demonstrated a reproducible exponential change in luminescence intensity , and successful bioimaging of vitamin c in cells . the rate of cellular uptake or intracellular reduction of a nitroxide radical ( s ) by vitamin c in vivo is reflected in the quantitative data of the intracellular luminescence intensity time profile based on image analysis , and this is expected to help elucidate the in vivo function of vitamin c . ( 1 ) a solution of r2 liposome was prepared by steps ( 1 )-( 5 ) of the above example 4 . ( 2 ) 1 m solution of hydrogen peroxide in pbs ( phosphate buffered saline , d - pbs (−)) was prepared . ( 3 ) the solution in the above ( 1 ) was diluted 10 - folds with pbs ( phosphate buffered saline , d - pbs (−)), and 1 . 5 ml of said diluted solution and a microstir bar were placed in a glass cell and stirred with a stirrer ( 1000 r . p . m ). ( 4 ) the stirred mixture was irradiated with a diode laser ( manufactured by yamaki ; ldx - 2615 - 650 - to3 ; wavelength : 650 nm ) as excitation light , the luminescence was monitored at 695 nm using a spectrometer ( manufactured by jasco co . ; ct - 25tp ) and a photomultiplier ( manufactured by hamamatsu photonics k . k . ; r928 ), while adding 0 . 015 ml of solution of hydrogen peroxide in pbs ( phosphate buffered saline , d - pbs (−)) obtained in the above ( 2 ), and the time - profile of luminescence intensity was measured . during this time , the angle and positional relationship were adjusted so that the optical fibers did not capture diffuse reflection from the microstir bar . ( 5 ) as a control , the procedure in the above ( 4 ) was repeated using 8 mm solution of vitamin c in pbs ( phosphate buffered saline , d - pbs (−)), instead of the solution of hydrogen peroxide in pbs ( phosphate buffered saline , d - pbs (−)). this experiment was conducted to examine the effect of hydrogen peroxide , known to be a vitamin c by - product in the presence of the serum protein albumin , on the fluorogenic probes of the present invention . the 10 mm hydrogen peroxide solution added to the r2 liposomes in this experiment corresponds to 67 times the amount of hydrogen peroxide generated by 2 mm ascorbic acid in the presence of fbs . the luminescence intensity time profiles are shown in fig1 . the experiment demonstrated that hydrogen peroxide has no reactivity for the fluorogenic probes of the present invention . it was thus shown that reaction between the fluorogenic probes of the present invention and vitamin c is not affected by byproduct ( hydrogen peroxide ), or in other words , that the method of the present invention allows fluorescence bioimaging of vitamin c alone as a target . ( 1 ) the r2 liposomes prepared by steps ( 1 )-( 5 ) in the above example 4 were diluted 10 - fold with dmf , the amount of the photosensitizer ( complex r2 ) encapsulated into the liposomes was calculated from the absorbance of the absorption spectrum to determine the concentration , and the concentration was adjusted . ( 2 ) hela cells ( 2 × 10 4 cells / cm 2 , purchased from health sciences research resources bank ) of 5 ml of medium were inoculated into a 6 cm dish , and then cultured in an incubator for 24 hours . a solution of r2 liposome in pbs ( phosphate buffered saline , d - pbs (−)) was adjusted to 2 × 10 − 6 m and was added to the dish , and culturing was continued for 20 hours . ( 3 ) the medium was removed , washing was performed twice with pbs ( phosphate buffered saline , d - pbs (−)), and then 5 ml of a medium ( 5 ml of mem non - essential amino acids solution , 5 ml of antibiotic , 10 ml of 1m hepes and 50 ml of fbs ( fetal bovine serum ) were added to 500 ml of eagle &# 39 ; s minimal essential medium ) was added , and then the concentration of dehydroascorbic acid in the media was adjusted to 12 . 8 mm by adding 0 . 55 ml of solution of dehydroascorbic acid in pbs ( phosphate buffered saline , d - pbs (−)). ( 4 ) the luminescence was periodically observed with a fluorescence microscope ( excitation light : 590 - 650 nm , monitoring wavelength : 664 - 734 nm ) using a cut filter ( manufactured by leica ; y5 ), and the image was recorded . dehydroascorbic acid is the oxidized form of vitamin c ( ascorbic acid ), and it is known to be rapidly reduced and converted to vitamin c when taken up into cells . this experiment was conducted to examine whether fluorescence bioimaging with a fluorogenic probe of the present invention allows real time observation of intracellular reduction of dehydroascorbic acid . fig1 ( a ) and fig1 ( b ) show fluorescence microscope images of cell lines 2 minutes and 180 minutes , respectively , after addition of dehydroascorbic acid . an increase in luminescence of the fluorogenic probe in the cells was observed after addition of dehydroascorbic acid ( change occurred from fig1 ( a ) to fig1 ( b ) ). real time observation of intracellular reduction of dehydroascorbic acid was therefore successful . also , quantitative analysis of the luminescence intensity time profiles based on image analysis , in the same manner as for vitamin c , is expected to allow determination of the intracellular uptake rate and intracellular reduction rate of dehydroascorbic acid . the results described above demonstrate that ( 1 ) luminescence intensity increases after addition of vitamin c in liposome aqueous solution and methanol solution , ( 2 ) the reaction rate of a fluorogenic probe ( complex ) of the present invention is in a positive correlation with vitamin c concentration , and ( 3 ) the rate of increase in luminescence of a fluorogenic probe ( complex ) of the present invention matches the spin disappearance rate according to esr . we therefore successfully developed a novel method of determining vitamin c in both hydrophilic and hydrophobic solvents . moreover , the present methods are superior to existing methods because ( 1 ) both excitation light and luminescence are observed in a range of high permeability to biological tissue (& gt ; 650 nm ), ( 2 ) luminescence is increased in aqueous liposome solutions which are biological membrane models , thus indicating potential for in vivo applications , ( 3 ) aqueous liposome solutions with complex r2 , for example , exhibit a luminescence intensity increase ratio sufficient for fluorescence microscopy , with a maximum 500 % increase , ( 4 ) in methanol , complex r1 exhibits an increase of about 150 % and r2 an increase of about 6300 %, which are high luminescence intensity ratios , ( 5 ) by replacing the tempo radical of r1 with proxyl radical , which is known to have an even higher fluorescent quantum yield ratio than r0 , an even higher luminescence intensity ratio is exhibited , while association effects can be eliminated by replacing the hydroxy group of the axial ligand with a trialkylsiloxy group , so that easy adjustment of luminescence intensity can be made by simple chemical modification which increases the luminescence intensity , ( 6 ) ( phthalocyaninato ) silicon complex encapsulated into liposomes ( a liposome preparation of the invention ) reaches the intracellular space and exhibits a reproducible consecutive reaction - type time profile for luminescence intensity , ( 7 ) since the liposome preparation of the invention is not affected by the various reducing substances in cells , specific detection and determination of vitamin c is possible , and ( 8 ) the reaction rate is slower than existing fluorogenic probes , so that it is suited for quantitation of pharmacological concentrations necessary for cancer treatment ( 0 . 3 - 20 mm ) ( confirmed at 0 . 4 mm - 6 . 4 mm ); therefore , the methods are expected to allow fluorescence bioimaging of vitamin c that has not been hitherto possible , for greater elucidation of the in vivo function of vitamin c . the methods of the invention are therefore useful for detection and determination of vitamin c . in particular , the methods of the invention allow detection of vitamin c in vivo , which has not been possible to date , to potentially realize in vivo fluorescence bioimaging of vitamin c ( in cells , for example ) for research so that significant advances can be made in elucidating the in vivo function of vitamin c .

US-72629410-A

the substituted heteroaryl compounds of this invention are good fungicides . in particular , they possess especially good activity against bean powdery mildew .

the compounds of the present invention wherein x is oxygen or sulfur and alk is not an α - branched - chain alkylene group are conveniently prepared according to the following synthetic scheme : ## str12 ## wherein r , r 1 , r 2 and alk are as defined above ; w is a halogen , b is a base , b 2 is an acid scavenger ( a base ), rd is a reducing agent and a is an alkylene group 1 carbon shorter in length than the resulting alk group . reaction ( 1 ) is conducted by adding approximately 2 equivalents of a base , iv , to ii . the reaction is done in the liquid phase employing an organic solvent such as ethanol , methanol , and the like , or alternatively water . preferably , the base employed is an inorganic base . suitable inorganic bases include , for instance , sodium hydride , sodium methoxide , metallic sodium , and the like . after addition of iv , an approximately equimolar amount of iii is added to the system . reaction pressure is not critical and for convenience , the reaction is generally conducted at atmospheric pressure . the reaction is generally conducted at from 0 ° c . to 100 ° c ., although preferably at from 40 ° c . to 70 ° c ., and is generally complete from within 1 to 48 hours . the resulting intermediate , v , is isolated by conventional procedures such as extraction , filtration , chromatography , distillation , or alternatively , used in reaction ( 2 ) without purification and / or isolation . reaction ( 2 ) is conducted by adding an essentially equimolar amount of carbonyldiimidazole , vi , to v . the reaction is conducted in the liquid phase using an inert anhydrous organic solvent such as chloroform , methylene chloride , dimethoxyethane , toluene , and the like . reaction pressure is not critical and for convenience , the reaction is generally conducted at atmospheric pressure . the reaction is generally conducted at from 0 ° c . to 100 ° c ., although preferably at room temperature , and is generally complete from within 1 to 24 hours . the resulting carboxylic acid imidazolide , vii , may be isolated by conventional procedures such as extraction , filtration , chromatography , distillation , and the like . alternatively and preferably , the resulting intermediate is not isolated from the reaction solution , but is used directly in reaction ( 3 ). reaction ( 3 ) is conducted by adding an essentially equimolar amount of the appropriate primary amine , viii , to vii . the reaction is conducted in the liquid phase using an inert anhydrous organic solvent such as chloroform , methylene chloride , dimethoxyethane , toluene , and the like . preferably , the reaction solution is the same as was employed in reaction ( 2 ) with the appropriate amine , viii , merely added to the system after completion of reaction ( 2 ). reaction pressure is not critical and for convenience , the reaction is generally conducted at atmospheric pressure . the reaction is generally conducted at from 0 ° c . to 100 ° c ., although preferably at room temperature , and is generally complete from within 1 to 24 hours . the resulting amide , ix , is isolated by conventional procedures such as extraction , filtration , chromatography , distillation , or alternatively , used in reaction ( 4 ) without purification and / or isolation . alternatively , ix may be prepared according to reaction ( 2a - 3a ) by adding a solution of the acid chloride corresponding to v to a solution of viii . the acid chloride va is prepared from the acid v by techniques known to the art , such as treatment with thionyl chloride . the reaction is conducted in the presence of b 2 ( iva ), an acid scavenger such as triethylamine , pyridine , an alkylamine , sodium carbonate , or the like . the reaction is conducted in the liquid phase using an inert organic solvent such as methylene chloride , chloroform , dioxane , toluene , and the like . the reaction is carried out at a temperature of about - 50 ° c . to about 100 ° c ., preferably from about 0 ° c . to about 25 ° c . after the addition is complete , the reaction mixture is allowed to return to room temperature . the reaction is generally complete within about 0 to about 48 hours after the addition is complete . the resulting amide ix is isolated by conventional procedures such as extraction , filtration , chromatography , distillation , or alternatively used in reaction ( 4 ) without further purification or isolation . reaction ( 4 ) is a conventional reduction of the amide to the amine . in preparing compounds of this invention , the carbonyl of the amide is reduced to the methylene group ; the reaction is conveniently conducted by adding an essentially equimolar amount of a reducing agent , rd , to ix . the reaction is conducted in the liquid phase employing an inert anhydrous organic solvent such as toluene , benzene , and the like . suitable reducing agents include , for instance , lithium aluminum hydride , borane , borane methyl sulfide , and the like . preferably , due to the ease in handling the reagent , borane methyl sulfide is employed as the reducing agent . however , when r 1 is a group susceptible to an undesired reaction with borane or borane methyl sulfide ( such as allyl , propargyl , and the like ), the preferred reducing agent is lithium aluminum hydride . reaction pressure is not critical and for convenience , the reaction is conducted at atmospheric pressure . the reaction is generally conducted at from 0 ° c . to 110 ° c ., although preferably at from 30 ° c . to 70 ° c ., and is generally complete from within 1 to 24 hours . the resulting amine , xi , is isolated by conventional procedures such as extraction , filtration , chromatography , distillation , or alternatively , used in reaction ( 5 ) without purification and / or isolation . reaction ( 5 ) is conducted by first preparing reagent xii . xii is prepared by adding an essentially equimolar amount of carbonyldiimidazole to the appropriate acid , r 2 co 2 h wherein r 2 is as defined above . the reaction is conducted in the liquid phase using an inert anhydrous organic solvent such as chloroform , methylene chloride , dimethoxyethane , toluene , and the like . reaction pressure is not critical and for convenience , the reaction is generally conducted at atmospheric pressure . the reaction is generally conducted at from 0 ° c . to 100 ° c ., although preferably at room temperature , and is generally complete from within 1 to 24 hours . the resulting reagent , xii , may be isolated by conventional procedures such as extraction , filtration , chromatography , distillation , and the like . alternatively and preferably , the reagent is not isolated from the reaction solution but an essentially equimolar amount of the amine , xi , is added to the system . reaction pressure for this reaction is not critical and for convenience , the reaction is generally conducted at atmospheric pressure . after addition of xi , the reaction is generally conducted at room temperature and is generally complete from within 1 to 24 hours . the product , ia , is then isolated by conventional procedures such as extraction , filtration , chromatography , distillation , or alternatively , used in reaction ( 6 ) without purification and / or isolation . alternatively , product ia may be prepared by reaction ( 5a ) using the acid chloride xiii corresponding to r 2 co 2 h . acid chloride xiii may be conveniently prepared by combining approximately equimolar amounts of r 2 co 2 h and thionyl chloride . the reaction is conducted in the liquid phase using an inert organic solvent such as methylene chloride , toluene , chloroform , and the like . it is preferred to conduct the reaction in the presence of a catalyst amount of dimethylformamide . the reaction mixture is heated to reflux and refluxed for about 0 to about 24 hours . the mixture is stirred until gas evolution ceases . after the temperature of the mixture returns to room temperature , xiii may be used in reaction ( 5a ) without purification or isolation . since xiii is susceptible to hydrolysis , minimal handling of it is preferred . reaction ( 5a ) is conducted by combining xiii , with xi and iva . the reaction is conducted in the liquid phase using an inert organic solvent such as methylene chloride , chloroform , toluene and the like . suitable acid scavengers , b 2 ( iva ), include bases such as triethylamine , pyridine , an alkylamine , sodium carbonate , and the like . the reaction is carried out at a temperature of about - 25 ° c . to about 100 ° c ., preferably from about 0 ° c . to about 25 ° c ., and may be conveniently carried out at room temperature . the reaction is generally complete within about 0 to about 24 hours . product ia is then isolated by conventional procedures such as extraction , filtration , chromatography , distillation , or alternatively , used in reaction ( 6 ) without purification and / or isolation . reaction ( 6 ) is conducted by adding an essentially equimolar amount of phosphorus pentasulfide , xiii , to i . the reaction is conducted in the liquid phase using an inert anhydrous organic solvent such as toluene , tetrahydrofuran , and the like . preferably , the system is exposed to microwave radiation in order to facilitate the dispersion of phosphorus pentasulfide into solution . reaction pressure is not critical and for convenience , the reaction is generally conducted at atmospheric pressure . the reaction is generally conducted at from 15 ° c . to 100 ° c ., although preferably it is conducted at the ambient temperature and is generally complete from within 1 to 48 hours . the product is then isolated by conventional procedures such as extraction , filtration , chromatography , distillation , and the like . the compounds of this invention wherein x is oxygen or sulfur and alk is an α - branched - chain alkylene group are conveniently prepared acccording to the following synthetic scheme : ## str13 ## wherein r and r 1 and b are as defined above ; w is a halogen ; ac is an acid ; u is an alkylene group and t is an alkyl group such that the sum of the number of carbon atoms in u and t is one carbon less than the number in alk ; and rd 2 is a reducing agent . reaction ( 7 ) is conducted by adding approximately equimolar amounts of ii and xv to iv in solvent . the reaction is done in the liquid phase employing an organic solvent such as ethanol , methanol , and the like . preferably , the base employed is an inorganic base . suitable inorganic bases include , for instance , sodium hydride , sodium methoxide , metallic sodium , and the like . reaction pressure is not critical and for convenience , the reaction is generally conducted at atmospheric pressure . the reaction is generally conducted at from about 25 ° c . to about 100 ° c ., although preferably at from about 60 ° c . to about 78 ° c ., and is generally complete within about 2 to about 48 hours . the resulting intermediate , xv is isolated by conventional procedures such as extraction , filtration , chromatography , or distillation . reaction ( 8 ) is conducted by adding an excess of viii and xvii to a stirred mixture of xv in solvent . the reaction is conducted in the liquid phase employing an inert anhydrous organic solvent such as methanol , ethanol , acetonitrile , and the like . suitable reducing agents include those which are relatively mild and selective and include for instance , sodium cyanoborohydride , sodium borohydride , and the like . the preferred reducing agent is sodium cyanoborohydride . after the addition is complete , the system is acidified to a ph of about 5 to 6 using acid xviii , preferably a non - aqueous acid such as hydrogen chloride gas . the reaction is generally conducted at from about 0 ° c . to about 50 ° c ., and for convenience , it may be conducted at ambient temperature . the reaction is generally complete within about 1 to about 24 hours . the resulting amine xia may be isolated by conventional procedures such as extraction , filtration , chromatography , and the like , or used without purification and / or isolation is reaction ( 5 ). the amine xia is then converted to the compounds of this invention as outlined in reactions ( 5 ) and ( 6 ). the compounds of this invention wherein x represents a direct linkage between alk and r are conveniently prepared by starting with the appropriate reagent v and following reactions ( 2 ) through ( 6 ). alternatively , these compounds may be prepared from the appropriate 3 - phenyl , 3 - substituted phenyl , or α - and / or β - substituted cinnamic acid as the starting material for reaction ( 2 ). reaction ( 3 ) is then conducted as above . however , in reaction ( 4 ), an additional equivalent of boron methyl sulfide is required in order to saturate the vinylic group . after reaction ( 4 ), the synthesis is accomplished through reactions ( 5 ) and ( 6 ) as described above . the compounds of the invention are effective in controlling fungal infections . some of the compounds of this invention are particularly effective in controlling powdery mildew fungal infections caused by the organism erysiphe polygoni . some of the compounds of this invention are also useful for controlling leaf blights caused by organisms such as phytophthora infestans conidia , alternaria solani conidia , and septoria apii . some of the compounds of this invention are also useful for controlling fungal infections caused by uromyces phaseoli tipica , plasmopara viticola , and piricularia oryzae . however , some fungicidal compounds of this invention may be more fungicidally active than others against particular fungi . when used as fungicides , the compounds of the invention are applied in fungicidally effective amounts to fungi and / or their habitats , such as vegetative hosts and non - vegetative hosts , e . g ., animal products . the amount used will , of course , depend on several factors such as the host , the type of fungus , and the particular compound of the invention . as with most pesticidal compounds , the fungicides of the invention are not usually applied full strength , but are generally incorporated with conventional , biologically inert extenders or carriers normally employed for facilitating dispersion of active fungicidal compounds , recognizing that the formulation and mode of application may affect the activity of the fungicide . thus , the fungicides of the invention may be formulated and applied as granules , as powdery dusts , as wettable powders , as emulsifiable concentrates , as solutions , or as any of several other known types of formulations , depending on the desired mode of application . wettable powders are in the form of finely divided particles which disperse readily in water or other dispersants . these compositions normally contain from about 5 % to 80 % fungicide , and the rest inert material , which includes dispersing agents , emulsifying agents and wetting agents . the powder may be applied to the soil as a dry dust , or preferably as a suspension in water . typical carriers include fuller &# 39 ; s earth , kaolin clays , silicas , and other highly absorbent , readily wettable , inorganic diluents . typical wetting , dispersing or emulsifying agents include , for example : the aryl and alkylaryl sulfonates and their sodium salts ; alkylamide sulfonates , including fatty methyl taurides ; alkylaryl polyether alcohols , sulfated higher alcohols and polyvinyl alcohols ; polyethylene oxides ; sulfonated animal and vegetable oils ; sulfonated petroleum oils ; fatty acid esters of polyhydric alcohols and the ethylene oxide addition products of such esters ; and the addition products of long - chain mercaptans and ethylene oxide . many other types of useful surface - active agents are available in commerce . the surface - active agent , when used , normally comprises from 1 % to 15 % by weight of the fungicidal composition . dusts are freely flowing admixtures of the active fungicide with finely divided solids such as talc , natural clays , kieselguhr , pyrophyllite , chalk , diatomaceous earths , calcium phosphates , calcium and magnesium carbonates , sulfur , lime , flours , and other organic and inorganic solids which act as dispersants and carriers for the toxicant . these finely divided solids have an average particle size of less than about 50 microns . a typical dust formulation useful herein contains 75 % silica and 25 % of toxicant . useful liquid concentrates include the emulsifiable concentrates , which are homogeneous liquid or paste compositions which are readily dispersed in water or other dispersant , and may consist entirely of the fungicide with a liquid or solid emulsifying agent , or may also contain a liquid carrier such as xylene , heavy aromatic naphthas , isophorone , and other nonvolatile organic solvents . for application , these concentrates are dispersed in water or other liquid carrier , and are normally applied as a spray to the area to be treated . other useful formulations for fungicidal applications include simple solutions of the active fungicide in a dispersant in which it is completely soluble at the desired concentration , such as acetone , alkylated naphthalenes , xylene , or other organic solvents . granular formulations , wherein the fungicide is carried on relatively coarse particles , are of particular utility for aerial distribution or for penetration of cover - crop canopy . pressurized sprays , typically aerosols wherein the active ingredient is dispersed in finely divided form as a result of vaporization of a low - boiling dispersant solvent carrier , such as the freons , may also be used . all of those techniques for formulating and applying fungicides are well known in the art . the percentages by weight of the fungicide may vary according to the manner in which the composition is to be applied and the particular type of formulation , but in general comprise 0 . 5 % to 95 % of the toxicant by weight of the fungicidal composition . the fungicidal compositions may be formulated and applied with other active ingredients , including other fungicides , insecticides , nematocides , bactericides , plant - growth regulators , fertilizers , etc . a further understanding of the invention can be had in the following non - limiting examples . wherein , unless expressly stated to the contrary , all temperature ranges refer to the centigrade system and the term &# 34 ; ambient &# 34 ; or &# 34 ; room temperature &# 34 ; refers to about 20 ° c . to 25 ° c . the term &# 34 ; percent &# 34 ; refers to gram moles . the term &# 34 ; equivalent &# 34 ; refers to a quantity of reagent equal in moles , to the moles of the preceding or succeeding reagent recited in that example in terms of finite moles or finite weight or volume . also , unless expressly stated to the contrary , geometric isomer and racemic mixtures are used as starting materials and correspondingly , isomer mixtures are obtained as products . compounds which were prepared in accordance with examples 1 through 22 below are found in tables i to iv . preparation of 2 , 4 , 6 - trichlorophenoxyacetic acid 2 , 4 , 6 - trichlorophenol , 100 . 7 gm , was added to 250 ml of ethanol . 228 . 6 ml of a 25 % solution of sodium methoxide ( 2 equivalents ) in methanol was then added to the system . the system was stirred at room temperature for approximately 1 hour . afterwards , 69 . 5 gm of bromoacetic acid was added an the system then heated to reflux . after 18 hours , an additional equivalent of sodium methoxide in methanol ( 114 . 3 ml ) was added as well as 34 . 7 gm of bromoacetic acid . the system was continued at reflux for 12 hours . the reaction was then stopped and the solvent removed by stripping . the resulting solid was washed with water and then with ether . concentrated hcl was next added to the solid precipitate and the system was left standing for 12 hours . afterwards , the product was filtered , washed with water and air dried . toluene was then added to the product . the toluene was removed by stripping and any remaining water was azeotroped off with the toluene . 74 . 4 gm of 2 , 4 , 6 ,- trichlorophenoxyacetic acid was recovered . ( a ) 2 , 4 , 6 - trichlorophenoxyacetic acid , 47 . 5 gm , was added to 300 ml of methylene chloride along with 30 . 3 gm of carbonyldiimidazole . the system was stirred overnight to give the carboxylic acid imidazolide . ( b ) 15 . 4 ml of n - propylamine was then added to the system . the system was then stirred at room temperature for an additional 20 hours . the reaction was stopped and the organic solution was washed first with a dilute hcl solution , then with a sodium bicarbonate solution and then with water . the methylene chloride was removed by stripping to give the n -( n - propyl )- 2 , 4 , 6 - trichlorophenoxyacetamide . a solution of 2625 gm ( 9 . 62 moles ) 2 , 4 , 6 - trichlorophenoxyacetic acid chloride in methylene chloride ( total solution weight 5403 gm ) was added to a solution of 1251 gm ( 21 . 17 moles ) n - propylamine in 7 . 6 l methylene chloride in a 22 - liter flask over a period of 2 hours . during the addition , the temperature of the system was maintained at about 5 ° c . to 7 ° c . using a dry ice / isopropyl alcohol bath . during the addition , some white solids precipitated . after the addition was complete , the cooling bath was removed allowing the temperature of the system to rise to 10 ° c . over 25 minutes . the system temperature was then raised to 23 ° c . over 10 minutes by use of a warm water bath . sample nmr and ir spectra indicate the reaction was complete . after removal of the warming bath , the methylene chloride solution was washed 3 times with 4 l water . the aqueous layer and organic layers were separated and the organic phase was dried over 150 gm magnesium sulfate . the organic solution was stripped until the weight reached about 3 kg . while the system was still in the hot water bath , 3 . 5 l hexane was added , giving a clear solution . the system was then cooled to 20 ° c ., giving a very thick slurry of crystals . the crystals were filtered and washed with 2 l hexane . air drying gave 2102 gm . the mother liquor and hexane washings were stripped to give 450 gm of a brown oil which solidified upon cooling . recrystallization from hexane ( about 900 ml ), followed by filtering the crystals , washing the crystals with hexane ( about 500 ml ), and air drying gave an additional 342 gm of the product . n -( n - propyl )- 2 , 4 , 6 - trichlorophenoxyacetamide , 44 . 0 gm , was added to 250 ml of toluene . 28 ml of borane methyl sulfide [ bh 3 . ( ch 3 ) 2 s ] ( 2 equivalents ) was then slowly added to the system . the system was heated at approximately 60 ° c . for 15 hours at which time reaction completion was checked by ir spectroscopy . 200 ml of methanol was then slowly added to the system . after addition of the methanol , the system was acidified by bubbling in hcl gas . afterwards , the system was refluxed for 1 hour . the solvent was then removed by stripping . the resulting oil was dissolved in methanol which was then stripped . the oil was next dissolved in methylene chloride . the organic solution was washed with a sodium hydroxide solution and then with water . the methylene chloride was removed by stripping to give 36 . 3 gm of the n -( n - propyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether , as a yellow oil . ( a ) 2 - pyrazine carboxylic acid , 2 . 5 gm , was added to 10 ml of methylene chloride . 3 . 2 gm of carbonyldiimidazole was added to the system . the system was stirred at room temperature for 3 hours to give the 2 - pyrazine carboxylic acid imidazolide . ( b ) n -( n - propyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether , 5 . 6 gm , was then added to the system . the system was stirred at room temperature for 16 hours . the reaction was then stopped and the methylene chloride solution was washed with a sodium bicarbonate solution , then with a dilute solution of hydrochloric acid and finally with water . the methylene chloride solution was dried over magnesium sulfate and the methylene chloride removed by stripping to give 6 . 2 gm of the n -( n - propyl ), n -( 2 - pyrazinylcarbonyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether as a yellow oil , listed as compound no . 3 in table i . ( a ) 2 - pyrazine carboxylic acid , 104 . 3 gm , and 105 . 9 gm thionyl chloride were added to 800 ml methylene chloride and 5 ml dimethylformamide . the system was heated to reflux , at which point gas evolution took place . the system was stirred at reflux until gas evolution ceased , after about 5 hours , to give the 2 - pyrazine carboxylic acid chloride . the solution was cooled to room temperature and transferred to a dropping funnel for use in step ( b ) without further isolation . ( b ) to a solution of 214 . 9 gm of n -( n - propyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether , the product of example 3 , and 84 . 84 gm triethylamine in 800 ml methylene chloride , the acid chloride of step ( a ) was added dropwise at room temperature . after the addition was complete , the reaction mixture was stirred 10 minutes . the reaction mixture was then washed with water , then a 5 % sodium bicarbonate solution , and then with water again . the mixture was dried over magnesium chloride and stripped to give 254 gm of an oil which solidified upon standing to give a solid with a melting point of 58 °- 61 ° c . 2 , 6 - dichlorothiophenol , 50 gm , was added to 250 ml of ethanol . 63 . 8 ml of a 25 % solution of sodium methoxide ( 2 equivalents ) in methanol was then added to the system . the system was stirred at room temperature for approximately 3 hours . afterwards , 20 ml of bromoacetic acid was added and the system then heated to reflux . the system was continued at reflux for 16 hours . the reaction was then stopped and the solvent removed by stripping . the resulting material was dissolved with basic aqueous solution and then washed with methylene chloride . concentrated hcl was next added to the aqueous solution to acidify it . the product was extracted with methylene chloride . the methylene chloride solution was stripped and triturated with hexane . the product was then filtered , washed with water and air dried to yield 55 . 3 gm of the title compound . ( a ) 2 , 6 - dichlorothiophenoxyacetic acid , 55 . 3 gm , was added to 250 ml of methylene chloride along with 37 . 8 gm of carbonyldiimidazole . the system was stirred overnight at room temperature to give the carboxylic acid imidazolide . ( b ) 19 . 1 ml of n - propylamine was then added to the system . the system was then stirred at room temperature for an additional 65 hours . the reaction was stopped and the organic solution was washed first with a dilute hcl solution , then with a sodium bicarbonate solution and then with water . the methylene chloride was removed by stripping to give 33 . 7 gm of the n -( n - propyl )- 2 , 6 - dichlorothiophenoxyacetamide . n -( n - propyl )- 2 , 6 - dichlorothiophenoxyacetamide , 33 . 7 gm , was added to 250 ml of tetrahydrofuran . 34 . 4 ml of borane methyl sulfide ( 3 equivalents ) was then slowly added to the system . the system was heated at approximately 55 ° c . for 18 hours at which time reaction completion was checked by ir spectroscopy . 200 ml of methanol was then slowly added to the system . after addition of the methanol , the system was acidified by bubbling in hcl gas . afterwards , the system was refluxed for 1 hour . the solvent was then removed by stripping . the resulting oil was dissolved in methanol which was then stripped . the oil was next dissolved in methylene chloride . the organic solution was washed with a sodium hydroxide solution and then with water . the methylene chloride was removed by stripping to give 28 . 2 gm of the n -( n - propyl ) 2 - aminoethanethiol 2 , 6 - dichlorophenylthioether . ( a ) 3 - pyridine carboxylic acid , 2 . 5 gm , was added to 10 ml of methylene chloride . 3 . 2 gm of carbonyldiimidazole was added to the system . the system was stirred at room temperature for 16 hours to give the 3 - pyridine carboxylic acid imidazolide . ( b ) n -( n - propyl ) 2 - aminoethanethiol 2 , 6 - dichlorophenylthioether , 5 . 3 gm , was then added to the system . the system was stirred at room temperature for 24 hours . the reaction was then stopped and the methylene chloride solution was washed with a sodium bicarbonate solution , and then with water . the methylene chloride solution was dried over magnesium sulfate and the methylene chloride removed by stripping to give 3 . 5 gm of the n -( n - propyl ), n -( 3 - pyridylcarbonyl ) 2 - aminoethanethiol 2 , 6 - dichlorophenylthioether as a yellow oil , listed as compound no . 11 in table i . ( a ) 2 , 6 - dichlorocinnamic acid , 50 gm , was added to 500 ml of methylene chloride along with 37 . 3 gm of carbonyldiimidazole . the system was stirred overnight at room temperature to give the carboxylic acid imidazolide . ( b ) 18 . 9 ml of n - propylamine was then added to the system . the system was then stirred at room temperature for an additional 24 hours . the reaction was stopped and the organic solution washed first with a dilute hcl solution , then with a sodium bicarbonate solution and then with water . the methylene chloride was removed by stripping to give 41 . 1 gm of the n -( n - propyl )- 2 , 6 - dichlorocinnamide . n -( n - propyl )- 2 , 6 - dichlorocinnamide , 41 . 1 gm , was added to 300 ml of toluene and 12 . 9 ml of tetrahydrofuran . 63 . 5 ml of borane methyl sulfide ( 4 equivalents ) was then slowly added to the system . the system was heated at approximately 110 ° c . for 18 hours at which time reaction completion was checked by ir spectroscopy . 100 ml of methanol was then slowly added to the system . after addition of the methanol , the system was acidified by bubbling in hcl gas . afterwards , the system was refluxed for 1 hour . the solvent was then removed by stripping . the resulting oil was dissolved in methanol which was stripped . the oil was next dissolved in methylene chloride . the organic solution was washed with a sodium hydroxide solution and then with water . the methylene chloride was removed by stripping to give 41 . 0 gm of n -[ 3 -( 2 , 6 - dichlorophenyl ) propyl ], n -( n - propyl ) amine as a light yellow soft solid . ( a ) 3 - pyridine carboxylic acid , 2 . 5 gm , was added to 10 ml of methylene chloride . 3 . 2 gm of carbonyldiimidazole was added to the system . the system was stirred at room temperature for 18 hours to give the 3 - pyridyl carboxylic acid imidazolide . ( b ) n -[ 3 -( 2 , 6 - dichlorophenyl ) propyl ], n -( n - propyl ) amine , 4 . 9 gm , was then added to the system . the system was stirred at room temperature for 24 hours . the reaction was then stopped and the methylene chloride solution was washed with a sodium bicarbonate solution and then with water . the methylene chloride solution was dried over magnesium sulfate and the methylene chloride removed by stripping . the residue was chromatographed to give 1 . 0 gm of the n -[ 3 -( 2 , 6 - dichlorophenyl ) propyl ], n -( n - propyl ) nicotine amide . listed as compound no . 22 in table iii . ( a ) 2 , 4 , 6 - trichlorophenoxyacetic acid , 20 . 3 gm , was added to 150 ml of methylene chloride along with 13 . 0 gm of carbonyldiimidazole . the system was stirred overnight at room temperature to give the carboxylic acid imidazolide . ( b ) 6 . 0 ml of allylamine was then added to the system . the system was then stirred at room temperature for an additional 24 hours . the reaction was stopped and the organic solution was washed first with a dilute hcl solution , then with a sodium bicarbonate solution and then with water . the methylene chloride was removed by stripping to give the n - allyl - 2 , 4 , 6 - trichlorophenoxyacetamide . n - allyl - 2 , 4 , 6 - trichlorophenoxyacetamide , 14 . 6 gm , was added to 100 ml of anhydrous tetrahydrofuran . the solution was cooled to about 10 ° c . with an ice bath . then lithium aluminum hydride , 1 . 86 gm , was added slowly . the resulting mixture was stirred in the cold and allowed to warm to room temperature overnight . the mixture was heated at reflux for 6 hours , then again stirred at room temperature overnight . then 2 ml water , 2 ml of 15 % naoh solution and 6 ml of water were added sequentially . the mixture was filtered through a pad of celite and the filtrate stripped to yield 10 . 6 gm of n - allyl ethanolamine 2 , 4 , 6 - trichlorophenylether as an oil . ( a ) 3 - pyridine carboxylic acid , 3 . 7 gm , was added to 100 ml of methylene chloride . 4 . 9 gm of carbonyldiimidazole was added to the system . the system was stirred at room temperature for 16 hours to give the 3 - pyridine carboxylic acid imidazolide . ( b ) n - allyl ethanolamine 2 , 4 , 6 - trichlorophenylether , 6 . 3 gm , was then added to the system . the system was stirred at room temperature for 24 hours . the reaction was then stopped and the methylene chloride solution was washed with a sodium bicarbonate solution and then with water . the methylene chloride solution was dried over magnesium sulfate and the methylene chloride removed by stripping to give the crude n - allyl , n -( 3 - pyridylcarbonyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether . the product was purified by preparation of a hydrogen chloride salt . listed as compound no . 32 in table iv . ( a ) 3 - pyridine carboxylic acid , 3 . 1 gm , was added to 50 ml of methylene chloride . 4 . 0 gm of carbonyldiimidazole was added to the system . the system was stirred at room temperature for 2 hours to form the 3 - pyridine carboxylic acid imidazolide . ( b ) n -( n - propyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether , 6 . 3 gm , was then added to the system . the system was stirred at room temperature for 18 hours . the reaction was then stopped and the methylene chloride was washed with a sodium bicarbonate solution and then with water . the methylene chloride solution was dried over magnesium sulfate and the methylene chloride removed by stripping to give 3 . 0 gm of the n -( n - propyl ), n -( 3 - pyridinylcarbonyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether . if desired , the crude compound may be further purified by recrystallization from hexane . listed as compound no . 1 in table i . ( a ) 3 - pyridine carboxylic acid , 338 gm ( 2 . 75 moles ) and 446 gm ( 2 . 75 moles ) of carbonyldiimidazole were combined in 2 . 5 l methylene chloride . the system was heated gradually to reflux and stirred for a total of 11 / 2 hours , at which time the system temperature was at methylene chloride reflux and carbon dioxide evolution had ceased , to give the 3 - pyridine carboxylic acid imidazolide . ( b ) to the above methylene chloride solution , 777 gm ( 2 . 75 moles ) n -( n - propyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether , the product of example 3 , was added and the system stirred at a gentle reflux over the weekend . the reaction was then stopped and the methylene chloride solution washed sequentially with water , then 5 % hcl , then water , then 5 % sodium bicarbonate solution , and then water again . the methylene chloride solution was dried over magnesium sulfate and stripped to give 775 gm of crude product , a yellow cake . the crude product was recrystallized from isopropyl alcohol ( about 2 ml per gm crude product ) to give a white solid with a melting point of 104 °- 106 ° c . elemental analysis for c 17 h 17 n 2 o 2 cl 3 showed : calculated % c 52 . 6 , % h 4 . 4 , and % n 7 . 2 ; found % c 52 . 13 , % h 4 . 65 , and % n 7 . 16 . ( a ) 5 - pyrimidyl carboxylic acid , 1 . 9 gm , was added to 30 ml of methylene chloride . 2 . 4 gm of carbonyldimidazole was added to the system . the system was stirred at room temperature for 3 hours to form the 5 - pyrimidyl carboxylic acid imidazolide . ( b ) n -( n - propyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether , 4 . 2 gm , was then added to the system . the system was stirred at room temperature for 18 hours . the reaction was then stopped and the methylene chloride was washed with a sodium bicarbonate solution , then with dilute hcl ( ph about 3 ) and then with water . the methylene chloride solution was dried over magnesium sulfate and the methylene chloride removed by stripping to give 3 . 1 gm of the n -( n - propyl ), n -( 5 - pyrimidylcarbonyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether . listed as compound no . 2 in table i . ( a ) 1 - methyl - 5 - imidazole carboxylic acid , 7 . 0 gm , was added to 50 ml of methylene chloride . 5 . 2 gm of carbonyldiimidazole was added to the system . the system was stirred at room temperature for 18 hours to give the 1 - methyl - 5 - imidazolyl carboxylic acid imidazolide . ( b ) n -( n - propyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether , 5 , 6 gm , was then added to the system . the system was stirred at room temperature for 24 hours . the reaction was then stopped and the methylene chloride was washed with a sodium bicarbonate solution and then with water . the methylene chloride solution was dried over magnesium sulfate and the methylene chloride removed by stripping to give 3 . 8 gm of the n -( n - propyl ), n -( 1 - methyl - 5 - imidazolylcarbonyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether . listed as compound no . 12 in table i . n -( n - propyl ), n -( 3 - pyridylcarbonyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether , 7 . 8 gm , was dissolved in 50 ml of tetrahydrofuran . 4 . 4 gm of phosphorus pentasulfide ( p 2 s 5 ) was added to the system . the system was exposed throughout to microwave radiation in order to aid in the dispersion of the phosphorus pentasulfide . the system was stirred at about 10 ° c . for 1 hour . then an additional 4 . 4 gm of p 2 s 5 was added to the system and the reaction continued for an additional 3 hours . afterwards , the system was filtered ; the solvent was removed by stripping and the residue chromatographed to give 2 . 1 gm of the n -( n - propyl ), n -( 3 - pyridylthiocarbonyl ) ethanolamine 2 , 4 , 6 - trichlorophenylether . listed as compound no . 17 in table i . a stirred mixture of 39 . 4 gm ( 0 . 2 moles ) 2 , 4 , 6 - trichlorophenol , 17 . 6 ml ( 0 . 2 moles ) 90 % chloroacetone and 45 . 6 ml ( 0 . 2 moles ) 25 % sodium methoxide in methanol in 200 ml ethanol was heated to reflux and refluxed overnight . the reaction was then stopped and the solvent stripped . the residue was then taken up in methylene chloride . the organic solution was washed first with dilute sodium hydroxide and then water . the methylene chloride was stripped and the residue dried under vacuum to give 42 . 7 gm of product , a brown solid . to a stirred mixture of 12 gm ( 0 . 048 moles ) of the product of example 19 in methanol ( about 50 ml ), 19 . 7 ml ( 0 . 24 moles ) n - propylamine and 2 . 3 gm ( 0 . 036 moles ) sodium cyanoborohydride were added . to that mixture a few grams of 3a molecular sieve were added to scavenge water . hydrogen chloride was was bubbled through the mixture until the ph was about 5 - 6 . the reaction mixture was then allowed to stir at room temperature over the weekend . after filtering off the solids , the filtrate was stripped . the residue was taken up in methylene chloride . the methylene chloride solution was basified with 50 % sodium hydroxide and then washed twice with water . the methylene chloride was filtered off through magnesium sulfate . stripping and drying gave 8 . 0 gm of the product , a brown oil . elemental analysis for c 12 h 16 nocl 3 showed : calculated % c 48 . 60 , % h 5 . 39 , and % n 4 . 72 ; found % c 48 . 14 , % h 5 . 81 , and % n 4 . 13 . ( a ) nicotinic acid , 1 . 1 gm , was added to 10 ml chloroform . to that mixture , 1 . 5 gm carbonyldiimidazole was added . the resulting mixture was then stirred at room temperature overnight to give nicotinic acid imidazolide . ( b ) the product of example 20 , 2 . 8 gm , was then added to the system and the resulting mixture was heated to light reflux and stirred for about 18 hours . the reaction was then stopped and the chloroform solution was washed with a sodium bicarbonate solution and then with water . the chloroform solution was filtered off through magnesium sulfate , and the chloroform removed by stripping . drying of the residue under vacuum gave 2 . 6 gm of the product , a brown oil , listed as compound no . 20 in table i . elemental analysis for c 18 h 19 n 2 o 2 cl 3 showed : calculated % c 53 . 81 , % h 4 . 73 , and % n 6 . 97 ; found % c 51 . 61 , % h 5 . 08 , and % n 7 . 05 . ( a ) 2 - pyrazine carboxylic acid , 1 . 3 gm was added to 10 ml chloroform . 1 . 7 gm of carbonyldiimidazole was added to the system . the system was stirred overnight at room temperature to give the 2 - pyrazine carboxylic acid imidazolide . ( b ) 3 . 1 gm of the product of example 20 was then added to the system . the system was heated to light reflux and stirred at reflux overnight . the reaction was then stopped , and the chloroform solution was washed with a sodium bicarbonate solution and then with water . the chloroform was filtered through magnesium sulfate , stripped and the residue dried under vacuum to give 2 . 8 gm of the product , a brown oil , listed as compound no . 21 in table i . elemental analysis for c 17 h 18 n 3 o 2 cl 3 showed : calculated : % c 50 . 69 , % h 4 . 47 and % n 10 . 44 ; found % c 49 . 73 , % h 4 . 72 , and % n 9 . 81 . by following the procedures of examples 1 to 22 and using the appropriate starting materials and reagents , the following compounds are prepared : the compounds of the invention were tested for the control of the bean powdery mildew organism erysiphe polygoni . seedling bean plants were sprayed with a 250 - ppm solution of the test compound in acetone , water and a nonionic emulsifier . the sprayed plants were then inoculated 1 day later with the organism . the plants were maintained for 10 days at temperatures of 68 ° f . at night with daytime temperatures of 72 ° f . to 80 ° f . ; relative humidity was maintained at 40 % to 60 %. the percent disease control provided by a given test compound was based on the percent disease reduction relative to the untreated check plants . the results are tabulated in table v . compounds of the invention were tested for the preventative control of the tomato late blight organism phytophthora infestans . five - to six - week - old tomato ( cultivar bonny best ) seedlings were used . the tomato plants were sprayed with a 250 - ppm suspension of the test compound in acetone , water and a nonionic emulsifier . the sprayed plants were then inoculated 1 day later with the organism , placed in an environmental chamber and incubated at 66 ° f . to 68 ° f . and 100 % relative humidity for at least 16 hours . following the incubation , the plants were maintained in a greenhouse for approximately 7 days . the percent disease control provided by a given test compound was based on the percent disease reduction relative to untreated check plants . the results are tabulated in table v . the celery late blight tests were conducted using celery ( utah ) plants 11 weeks old . the celery late blight organism was septoria apii . the celery plants were sprayed with 250 - ppm solutions of the candidate toxicant mixed with acetone , water and a nonionic emulsifier . the plants were then inoculated with the organism and placed in an environmental chamber and incubated at 66 ° f . to 68 ° f . in 100 % relative humidity for an extended period of time ( approximately 48 hours ). following the incubation , the plants were allowed to dry and then were maintained in a greenhouse for approximately 14 days . the percent disease control provided by a given candidate toxicant is based on the percent disease reduction relative to untreated check plants . the results are reported in table v . compounds of the invention were tested for the control of the tomato early blight organism alternaria solani conidia . tomato ( variety bonny best ) seedlings of 6 - to 7 - weeks old were used . the tomato plants were sprayed with a 250 - ppm solution of the test compound in an acetone - and - water solution containing a small amount of a nonionic emulsifier . the sprayed plants were inoculated 1 day later with the organism , placed in the environmental chamber and incubated at 66 ° f . to 68 ° f . and 100 % relative humidity for 24 hours . following the incubation , the plants were maintained in a greenhouse for about 12 days . percent disease control was based on the percent disease development on untreated check plants . the compounds tested and the results are tabulated in table v . the compounds of the invention were tested for the control of the grape downy mildew organism plasmopara viticola . detached leaves , between 70 mm and 85 mm in diameter , 7 - week - old vitis vinifera cultivar emperor grape seedlings were used as hosts . the leaves were sprayed with a 250 - ppm solution of the test compound in acetone . the sprayed leaves were dried , inoculated with a spore suspension of the organism , placed in a humid environmental chamber and incubated at 66 ° f . to 68 ° f . and about 100 % relative humidity . after incubation for 2 days , the plants were then held in a greenhouse 7 to 9 days ; then the amount of disease control was determined . the percent disease control provided by a given test compound was based on the percent disease reduction relative to untreated check plants . the results are tabulated in table v . the leaf rust test was made using pinto beans . the pathogen was uromyces phaseoli tipica . the pinto bean plants were sprayed with a 250 - ppm solution of the test compound in an acetone - water mixture containing a nonionic emulsifier . the treated plants were inoculated thereafter with the pathogen and then incubated in an environmental chamber for approximately 20 hours at 100 % relative humidity and a temperature of 68 ° f . to 70 ° f . the plants were then removed from the chamber , allowed to dry , and then maintained in a greenhouse at a 60 % to 80 % relative humidity . the rate of infection on the leaves was made after about 14 days . the percent disease control provided by a given test compound was based on the percent disease reduction relative to untreated check plants . the results are reported in table v . compounds of this invention were tested for control of the rice blast organism piricularia oryzae , using 10 - to 14 - day - old rice plant seedlings ( calrose m - 9 variety ). seedling plants were sprayed with a 625 - ppm solution of the test compound in acetone , water and a nonionic emulsifier ( ortho x - 77 spreader ). the sprayed plants were inoculated 1 day later with the organism in an environmental chamber . after inoculation , the plants were kept in an environmental chamber for about 48 hours under conditions of about 72 ° f . to 75 ° f . and about 100 % relative humidity . following the incubation period , the plants were placed in a greenhouse with a temperature of about 72 ° f . and maintained with bottom watering for about 12 to 16 days . the percent disease control provided by a given test compound is based on a comparison of the percentage disease relative to the percent disease development on the untreated check plants : ## equ1 ## the results are tabulated in table v . table i__________________________________________________________________________compounds of the formula : ## str22 ## analysiscompound carbon hydrogen nitrogenno . z x r r . sup . 2 calc . found calc . found calc . found form m . p . __________________________________________________________________________1 o o ## str23 ## ## str24 ## 52 . 66 51 . 46 4 . 42 4 . 34 7 . 23 7 . 41 light brown 80 °- 82 ° c . 2 o o ## str25 ## ## str26 ## 49 . 44 49 . 04 4 . 15 4 . 26 10 . 81 10 . 19 light yellow 68 °- 73 ° c . 3 o o ## str27 ## ## str28 ## 49 . 44 47 . 35 4 . 15 4 . 09 10 . 81 9 . 92 oil 4 o o ## str29 ## ## str30 ## 57 . 79 57 . 55 5 . 14 5 . 32 7 . 93 7 . 91 oil 5 o o ## str31 ## ## str32 ## 70 . 35 68 . 33 7 . 97 8 . 40 12 . 31 11 . 47 oil 6 o o ## str33 ## ## str34 ## 74 . 08 72 . 24 8 . 29 9 . 13 8 . 23 7 . 30 oil 7 o o ## str35 ## ## str36 ## 54 . 24 52 . 28 4 . 84 4 . 88 11 . 86 11 . 37 oil 8 o o ## str37 ## ## str38 ## 57 . 79 54 . 83 5 . 14 5 . 52 7 . 93 7 . 25 oil 9 o o ## str39 ## ## str40 ## 52 . 66 52 . 18 4 . 42 5 . 12 7 . 23 6 . 10 oil 10 o o ## str41 ## ## str42 ## 52 . 66 52 . 63 4 . 42 5 . 32 7 . 23 5 . 87 oil 11 o s ## str43 ## ## str44 ## 55 . 28 55 . 71 4 . 91 5 . 16 7 . 59 7 . 74 oil 12 o o ## str45 ## ## str46 ## 49 . 18 48 . 00 4 . 64 5 . 19 10 . 75 9 . 36 oil 13 o o ## str47 ## ## str48 ## 54 . 24 53 . 93 4 . 84 5 . 00 11 . 86 12 . 40 light yellow 60 °- 62 ° c . 14 o o ## str49 ## ## str50 ## 73 . 58 74 . 00 8 . 03 8 . 79 8 . 58 8 . 70 oil 15 o o ## str51 ## ## str52 ## 69 . 69 69 . 96 7 . 69 8 . 39 12 . 83 12 . 95 oil 16 o o ## str53 ## ## str54 ## 69 . 69 70 . 97 7 . 69 8 . 17 12 . 83 12 . 61 oil 17 s o ## str55 ## ## str56 ## 50 . 56 53 . 46 4 . 24 5 . 08 6 . 94 6 . 23 oil 18 s o ## str57 ## ## str58 ## 47 . 47 46 . 80 3 . 98 3 . 95 10 . 38 10 . 14 yellow 85 °- 87 ° __________________________________________________________________________ c . table ii__________________________________________________________________________compounds of the formula : ## str59 ## analysiscompound carbon hydrogen nitrogenno . x alk r . sup . 2 calc . found calc . found calc . found form m . p . __________________________________________________________________________19 o ch . sub . 2 ch . sub . 2 ch . sub . 2 ## str60 ## 53 . 81 58 . 33 4 . 77 5 . 67 6 . 97 8 . 00 oil 20 o ## str61 ## ## str62 ## 53 . 81 51 . 61 4 . 73 5 . 08 6 . 97 7 . 05 brown oil 21 o ## str63 ## ## str64 ## 50 . 69 49 . 73 4 . 47 4 . 72 10 . 44 9 . 81 brown oil__________________________________________________________________________ table iii__________________________________________________________________________compounds of the formula : ## str65 ## com - analysispound carbon hydrogen nitrogenno . z alk r r . sup . 2 calc . found calc . found calc . found form m . p . __________________________________________________________________________22 o ch . sub . 2 ch . sub . 2 ch . sub . 2 ## str66 ## ## str67 ## 61 . 54 58 . 42 5 . 94 6 . 18 7 . 98 7 . 04 oil 23 o ## str68 ## ## str69 ## ## str70 ## 78 . 36 67 . 43 9 . 15 8 . 55 7 . 95 6 . 34 oil 24 o ## str71 ## ## str72 ## ## str73 ## 74 . 75 67 . 52 8 . 84 8 . 33 11 . 89 8 . 38 oil 25 o ch . sub . 2 ch . sub . 2 ch . sub . 2 ## str74 ## ## str75 ## 57 . 96 56 . 52 5 . 44 5 . 95 11 . 93 11 . 00 oil 26 o ch . sub . 2 ch . sub . 2 ch . sub . 2 ## str76 ## ## str77 ## 57 . 96 55 . 44 5 . 44 5 . 64 11 . 93 11 . 35 oil 27 o ch . sub . 2 ch . sub . 2 ch . sub . 2 ## str78 ## ## str79 ## 61 . 54 58 . 56 5 . 74 5 . 99 7 . 98 7 . 72 oil 28 o ch . sub . 2 ## str80 ## ## str81 ## 55 . 56 56 . 14 4 . 66 4 . 97 12 . 96 14 . 51 yellow solid 83 °- 85 ° c . 29 o ch . sub . 2 ## str82 ## ## str83 ## 59 . 47 59 . 08 4 . 95 5 . 06 8 . 67 8 . 98 yellow solid 93 °- 95 ° __________________________________________________________________________ c . table iv__________________________________________________________________________compounds of the formula : ## str84 ## analysiscompound carbon hydrogen nitrogenno . x r . sup . 1 r r . sup . 2 calc . found calc . found calc . found form m . p . __________________________________________________________________________30 o ch . sub . 2 ch . sub . 2 oh ## str85 ## ## str86 ## 49 . 31 48 . 31 3 . 88 3 . 81 7 . 19 6 . 37 oil 31 o ch . sub . 2 ch . sub . 2 oh ## str87 ## ## str88 ## 46 . 11 46 . 12 3 . 61 3 . 68 10 . 76 10 . 48 oil 32 o ch . sub . 2 chch . sub . 2 ## str89 ## ## str90 ## 52 . 94 51 . 62 3 . 92 3 . 56 7 . 26 6 . 45 oil 33 o ch . sub . 2 ch . sub . 2 och . sub . 2 ch . sub . 3 ## str91 ## ## str92 ## 51 . 75 52 . 70 4 . 58 4 . 76 6 . 71 6 . 82 oil 34 o ch . sub . 2 ch . sub . 2 och . sub . 2 ch . sub . 3 ## str93 ## ## str94 ## 48 . 76 49 . 05 4 . 33 4 . 46 10 . 03 10 . 33 oil 35 o ch . sub . 2 ch . sub . 3 ## str95 ## ## str96 ## 51 . 42 49 . 98 4 . 05 3 . 86 7 . 50 7 . 52 oil 36 o ch . sub . 2 ch . sub . 3 ## str97 ## ## str98 ## 48 . 08 46 . 43 3 . 77 3 . 81 11 . 21 10 . 07 oil__________________________________________________________________________ table v______________________________________fungicidal activitycompound % controlno . gbm tlb clb teb br bpm rb______________________________________1 50 0 46 96 0 100 862 3 0 93 98 0 100 383 13 0 62 94 19 100 754 17 0 38 96 0 100 905 28 0 17 36 0 94 -- 6 0 10 0 50 0 98 -- 7 13 0 15 0 3 21 08 0 0 45 40 3 50 09 19 0 9 0 50 0 1010 9 11 0 32 29 0 011 13 0 0 60 0 58 2912 19 18 45 36 29 100 013 10 4 80 97 0 81 -- 14 0 0 85 67 0 100 6415 0 0 15 67 0 44 2916 7 0 38 83 0 50 3617 4 0 62 87 0 100 10018 43 0 85 -- 0 54 -- 19 30 10 38 0 0 70 9620 7 0 0 -- 23 93 021 67 0 0 -- 23 71 022 7 0 38 88 0 44 023 0 7 29 33 0 100 024 7 4 17 8 0 72 025 0 0 8 29 0 28 026 13 4 10 0 3 11 2127 0 0 35 57 3 82 7128 3 4 30 27 7 92 029 27 0 0 50 0 48 -- 30 54 7 32 17 0 33 031 29 0 0 42 0 0 032 41 0 0 0 4 033 18 0 54 52 0 88 034 7 0 15 0 0 0 3835 41 0 98 30 0 100 9636 45 0 50 0 0 75 0______________________________________ gdm -- grape downy mildew ( plasmopara viticola ) tlb -- tomato late blight ( phytophthora infestans ) clb -- celery late blight ( septoria appii ) teb -- tomato early blight ( alternaria solani conidia ) br -- bean rust ( uromyces phaseoli tipica ) bpm -- bean powdery mildew ( erysiphe polygoni ) rb -- rice blast ( piricularia oryzae )

US-43924382-A

a gemstone cut with a table facet , where the gemstone receives existing light from around the viewer and the facets on the bottom of the diamond effectively reflect the existing light back into the eyes of the beholder in such a manner as to maximize light performance and to provide specific optical performance .

referring to the drawings in particular , fig1 shows a side view of a gemstone , not necessarily drawn to scale . the gemstone has a girdle portion 10 in a square or rectangular shape and having rounded corners 18 , fig2 . the length to width ratios for rectangular stones are preferably less than 1 . 10 : 1 . a crown portion 12 extends from one side of the girdle portion 10 , and a pavilion portion 14 extends from another side of the girdle portion 10 . the crown portion 12 and pavilion portion 14 are on diametrically opposite sides of the girdle portion 10 . the crown portion 12 and the pavilion portion 14 have a plurality of facets . the girdle portion 10 can optionally be smooth or faceted . the crown facets include , a table facet 16 , four crown main facets 20 , and four crown corner facets 22 . each of the four crown corner facets 22 is arranged in the area of one of the four rounded corners 18 of the girdle portion 10 . the crown main facets 20 and crown corner facets 22 are alternately arranged around the table facet 16 with each of the crown main facets 20 being arranged between two of the crown corner facets 22 . the crown facets also include eight crown star facets 24 arranged between the table facet 16 , the crown main facets 20 , and the crown corner facets 22 . one of these crown star facets 24 is arranged between , and is adjacent , each adjacent pair of corner crown facets 22 and corner main facets 20 . each crown star facet 24 is also adjacent to one edge of the table facet 16 . the crown facets also include sixteen crown half facets or crown girdle facets 26 arranged around the table facet 16 and directly adjacent to the girdle portion 10 . two of these crown half facets 26 are arranged between each adjacent pair of crown corner facets 22 and crown main facets 20 . each of these crown half facets 26 is also directly adjacent to either a crown main facet 20 or a crown corner facet 22 . the pavilion facets include four pavilion main facets 28 and four pavilion corner facets 30 . each of the four pavilion corner facets 30 is arranged in the area of one of the four rounded corners 18 of the girdle portion 10 . the pavilion main facets 28 and pavilion corner facets 30 are alternately arranged around the pavilion portion 14 with each of the pavilion main facets 28 being arranged between two of the pavilion corner facets 30 . the pavilion facets also include sixteen pavilion half facets or pavilion girdle facets 32 arranged around the pavilion portion 14 and directly adjacent to the girdle portion 10 . two of these pavilion half facets 32 are arranged between each adjacent pair of pavilion main facets 28 and pavilion corner facets 30 . each of these pavilion half facets 32 is also directly adjacent to either a pavilion main facet 28 or a pavilion corner facet 30 . the pavilion portion 14 can also have a culet 34 . in order to produce the optical pattern of a maltese cross 36 , as shown in fig4 , under the table facet 16 , the crown and pavilion facets are arranged in specific angular ranges with respect to a plane of the girdle portion 10 . these angles depend on the refractive index of the gemstone . for a diamond gemstone , the facets would be preferably arranged in the following ranges : crown main facets 20 : 38 - 42 . 5 degrees ( fig5 for example of upper limit + 1 degree ); crown corner facets 22 : 37 - 42 . 6 degrees ( fig9 for example of upper limit + 1 degree ); crown star facets 24 : 28 - 36 . 5 degrees ( fig7 for example of upper limit + 1 degree ); crown half facets 26 : 44 . 8 - 53 . 1 degrees ( fig9 for example of lower limit − 1 degree , fig5 for example of upper limit + 1 degree ); pavilion main facets 28 : 39 . 3 - 41 . 9 degrees ( fig1 for example of lower limit − 1 degree , fig6 for example of upper limit + 1 degree ), ( preferably 40 . 4 - 40 . 9 degrees ); pavilion corner facets 30 : 35 . 5 - 40 degrees ( fig8 for example of lower limit − 1 degree ); and pavilion half facets 32 : 38 - 46 . 5 degrees ( fig8 for example of lower limit − 1 degree , fig6 for example of upper limit + 1 degree ). to further produce the optical pattern of a maltese cross , it is preferable for the table facet to be 48 - 52 % of the width of the diamond , the lower half facet length to be 50 % (+/− 5 %) with respect to length from the edge of the girdle to the cullet , and the star facet / upper half facet ratio to be 45 %- 55 % (+/− 5 %) with respect to table edge - to - girdle length . the pavilion facets on the bottom of a diamond will function as either mirrors ( reflectors of light , good ) or windows ( leakers of light , bad ). an important step in the optical design is ensuring that the pavilion ( bottom facets ) are effectively reflecting light back to the viewer . another important step in the optical design is ensuring that the crown of the diamond draws in its reflections from the brightest resources in the environment . the present invention is designed for the majority of its reflections from the 45 - 75 ° angular spectrum . several of the preferred embodiments of the gemstone in diamond are shown in fig5 & amp ; 6 , 7 & amp ; 8 , and 9 & amp ; 10 . in fig5 and 6 , the slope angles are shown for each facet . in fig7 through 10 , the top angular measurement shown in each facet is the slope angle , and the bottom angular measurement is the index angle . the index angle shows the position of the facet around the stone . these actual angles can vary by approximately plus or minus one degree in these embodiments . the dimensions of the table facet and the culet are also shown . all of the facets in each type of facet can either have the same slope angle , or a slightly different slope angle as shown in the drawings . another embodiment of a gemstone cut in accordance with the present invention is shown in fig1 - 13c . fig1 illustrates a top view of said gemstone which shows the overall shape of the girdle portion 10 having four sides 17 and four corners 18 , and a series of facets positioned on the gemstone &# 39 ; s crown portion . in particular , the crown portion includes an eight - sided table facet 16 which includes eight vertices . the table facet 16 is positioned such that a line drawn through midpoints of two directly opposing sides 17 will pass over or near two directly opposing vertices of the table facet . note that due to the inherent difficulties of attaining perfect or near - perfect symmetry during gemstone cutting , the reference of the line passing near two directly opposing vertices of the table facet serves to differentiate the positioning of the table facet 16 as shown in fig1 ( also shown in fig1 , 5 , 7 , 9 , 14 , and 17 ) from an embodiment where a line drawn through midpoints of two directly opposing sides 17 will pass over or near the midpoints of two directly opposing sides of the table facet . the crown portion further includes four crown main facets 20 and four crown corner facets 22 . each of the four crown main facets 20 is positioned between the table facet 16 and one of the sides 17 such that it substantially extends between about one of the vertices of the table facet 16 and about the midpoint of the respective side 17 . each of the four crown corner facets is positioned between the table facet 16 and one of the corners 18 such that it substantially extends between about one of the vertices of the table facet 16 and about the midpoint of the respective corner 18 . both the crown main facets 20 and crown corner facets 22 are illustrated as having a substantially kite shape . the crown main 20 and corner 22 facets are arranged in an alternating fashion such that no two crown main facets 20 are immediately adjacent to one another and no two crown corner facets 22 are immediately adjacent to one another . the crown further includes eight crown star facets 24 which have a triangular shape , and are positioned between the table facet 16 and a sets of one crown main 20 and one crown corner 22 facet . the crown additionally includes sixteen crown half facets 26 which have a triangular shape . each of the sixteen crown half facets 26 is positioned between the girdle portion 10 , another crown half facet 26 , and a crown main facets 20 or a crown corner facets 22 . the gemstone of the currently described embodiment further includes a pavilion portion shown in fig1 . this pavilion portion is positioned diametrically opposite of the crown portion with the girdle portion 10 being positioned there between , and tapers inward towards a point of convergence 34 as it extends away from the girdle portion 10 . it includes four pavilion main facets 28 and four pavilion corner facets 30 . each of the four pavilion main facets 28 is positioned between one of the sides 17 of the girdle portion and the point of convergence 34 such that it substantially extends between about the midpoint of the respective side 17 and about the point of convergence 34 . each of the four pavilion corner facets 30 is positioned between the one of the corners 18 of the girdle portion and the point of convergence 34 such that it substantially extends between about the midpoint of the respective corner 18 and about the point of convergence 34 . both the pavilion main facets 28 and pavilion corner facets 30 are illustrated as having a substantially kite shape . the pavilion main 28 and corner 30 facets are arranged in an alternating fashion such that no two pavilion main facets 28 are immediately adjacent to one another and no two pavilion corner facets 30 are immediately adjacent to one another . the pavilion portion further includes sixteen pavilion half facets 32 each of which forms a triangular shape and is positioned between the girdle portion 10 , another pavilion half facet 32 , and a pavilion main facets 28 or a pavilion corner facets 30 . each of the pavilion half facets 32 includes a side 40 that extends from the girdle portion 10 substantially towards the point of convergence 34 ( for the sake of clarity , not all sides 40 are denoted in the figures ). in an embodiment , the length of each side ( also commonly referred to within the relevant art as pavilion half facet lengths ) is from about 60 % to about 69 % of the total length from the girdle portion 10 to the point of convergence 34 . in another embodiment , the length of each side ( pavilion half facet lengths ) is less than or equal to about 85 % of the total length from the girdle portion 10 to the point of convergence 34 . those of ordinary skill in the relevant art are familiar with the concept of pavilion half facet lengths and are aware that the lengths referenced above and measured along the girdle plane . in other words , the end - points of the respective lengths are projected onto the girdle plane and the measurements are taken thereafter . in another embodiment , the pavilion half face lengths 40 are long enough to extend under the table facet 16 when the gemstone is viewed from above . the extension of the pavilion half facet lengths ( and consequently some portions of the pavilion half facets ) under the table facet has an effect on the production of a particular optical pattern under the table facet when the gemstone is viewed from above . for example , when the pavilion half facets do not extend under the table facet , the user ( when looking through the table facet ) observes the presence of the four pavilion main and the four pavilion corner facets all joined at the point of convergence . the four pavilion main facets generally produce an appearance of a maltese cross having its arms extend vertically and horizontally ( relative to the orientation of fig1 - 13c ). each of those arms includes two straight sides which extend from the point of convergence to the edge of the table facet . on the other hand , when portions of the pavilion half facets extend under the table facet , the user ( when looking through the table facet ) then observes not only the four pavilion main and four pavilion corner facets , but also those portions of the pavilion half facets which protrude under the boundaries of the table facet . the presence of the pavilion half facets has the effect of clipping the corners of the arms of the maltese cross which are opposite of the point of convergence . in other words , now the four pavilion main facets produce a cross in which each arm - side extending from the point of convergence to the edge of the table facet includes two subsections which form some non - 180 degree angle at their point of joinder . for the purposes of this specification , such a cross may be referred to as a “ modified maltese cross .” an example of a presence of a modified maltese cross underneath the table facet is illustrated in fig1 a , 13b , and 13c . fig1 a illustrates a top - down view of a gemstone with the outlines of the crown facets being shown in solid lines and the outlines of the pavilion facets being shown in dashed lines , fig1 b illustrates the same top - down view the modified maltese cross outlines being shown in dot - dash lines , and fig1 c illustrates a detailed view of the pavilion facet shown in fig1 b . as shown in the figures , the arrangement of the four pavilion main facets 28 and the four pavilion corner facets 30 produce two crosses . the first cross is produced by the four pavilion main facets 28 and includes four arms 42 . the second cross is produced by the four pavilion corner facets 30 and includes four arms 44 . both crosses &# 39 ; arms 42 and 44 extend outwardly from the point of convergence 34 towards the boundaries 46 of the table facet 16 . each arm 42 , 44 includes two arm sides 48 which extend between the point of convergence 34 and one of the table facet sides 46 . each arm side 48 includes a first subsection 50 and a second subsection 52 , where the first subsection 50 is adjacent to about the point of convergence 34 . these two subsections 50 , 52 are joined together at a joinder point 54 , with non - 180 degree angle θ being formed between the two subsections . the presence of the joinder point 54 and the arm sides 48 being comprised of two subsections 50 , 52 is the result of the pavilion half facet lengths 40 extending underneath the table facet 16 . consequently , the far corners 56 of the cross arms 42 , 44 are clipped by the portions of the pavilion half facets 32 which extend under the table facet 16 . note that for the sake of clarity , not every single element is labeled in the figures . for example , while only two joinder points 54 are illustrated in fig1 c , it is understood that such a joinder point is present between all first and second subsections 50 , 52 . in an embodiment , the ratio of the lengths of the first subsection 50 to the second subsection 52 is greater than or equal to about 2 : 1 . in another embodiment , the ratio of the length of the first subsection 50 to the second subsection 52 is greater than or equal to about 1 : 1 . in still another embodiment , the ratio of the length of the first subsection 50 to the second subsection 52 is greater than or equal to about 3 : 1 . in still yet another embodiment , the maximum width of the table facet 16 is less than or equal to about 60 % of the maximum width of the girdle portion 10 . in still yet another embodiment , the maximum width of the table facet 16 is between about 48 % and about 55 % of the maximum width of the girdle portion 10 . the design of fig1 and 12 can be executed on a variety of gemstones including a diamond . since different gemstones exhibit different refractive indices , obtaining a particularly desired level of optical performance requires at least some of the gemstone &# 39 ; s facets to be positioned at certain predetermined angles chosen specifically for the gemstone &# 39 ; s refractive index . when executing the design of fig1 and 12 on a diamond , a particular range of angular arrangements for the design &# 39 ; s facets has been found to produce a particular level of optical performance . in one embodiment , these angular measurements are as follows ( note that these angles are expressed with respect to the girdle plane ): crown main facets 20 : 38 - 42 . 5 degrees ; crown corner facets 22 : 37 - 42 . 6 degrees ; crown star facets 24 : 28 - 36 . 5 degrees ; crown half facets 26 : 44 . 8 - 53 . 1 degrees ; pavilion main facets 28 : 39 . 3 - 41 . 9 degrees , ( preferably 40 . 4 - 40 . 9 degrees ); pavilion corner facets 30 : 35 . 5 - 40 degrees ; and pavilion half facets 32 : 37 - 46 . 5 degrees . average angle of the four crown main facets 20 : 38 - 42 . 5 degrees ; average angle of the four crown corner facets 22 : 37 - 42 . 6 degrees ; average angle of the eight crown star facets 24 : 28 - 36 . 5 degrees ; average angle of the sixteen crown half facets 26 : 44 . 8 - 53 . 1 degrees ; average angle of the four pavilion main facets 28 : 39 . 3 - 41 . 9 degrees , ( preferably 40 . 4 - 40 . 9 degrees ); average angle of the four pavilion corner facets 30 : 35 . 5 - 40 degrees ; and average angle of the sixteen pavilion half facets 32 : 37 - 46 . 5 degrees . in an embodiment , a diamond cut in accordance with the present invention and having a modified maltese cross under the table facet may exhibit optical performance such that a majority of the cut diamond reflects incident light impinging on the cut diamond at an angle between 45 and 75 degrees with respect to the girdle plane , when the cut diamond is viewed from above . in an embodiment , a diamond cut in accordance with the present invention and having a modified maltese cross under the table facet may exhibit optical performance such that at least 65 % of the diamond &# 39 ; s surface area , when viewed from above , reflects incident light impinging on the cut diamond at an angle between 45 and 75 degrees with respect to the girdle plane . in an embodiment , a diamond cut in accordance with the present invention and having a modified maltese cross under the table facet may exhibit optical performance such that the majority of the portions of the pavilion main facets which produce the appearance of the modified maltese cross reflect incident light impinging on the cut diamond at an angle between 45 and 75 degrees with respect to the girdle plane , when the cut diamond is viewed from above . in an embodiment , a diamond cut in accordance with the present invention and having a modified maltese cross under the table facet may exhibit optical performance such that the majority of the portions of the pavilion main facets which produce the appearance of a first modified maltese cross and the majority of the portions of the pavilion corner facets which produce the appearance of a second modified maltese cross reflect incident light impinging on the cut diamond at an angle between 45 and 75 degrees with respect to the girdle plane , when the cut diamond is viewed from above . in an embodiment , a diamond cut in accordance with the present invention and having a modified maltese cross under the table facet may exhibit optical performance such that its “ light performance ” grade is “ ideal ” or “ ideal 0 ,” as determined by the american gem society &# 39 ; s ® performance grading software ®. fig1 and 15 show a top and a bottom view , respectively , of a diamond cut in accordance with an embodiment of the present invention and having a modified maltese cross under the table facet . each of these figs denotes the angle of the respective facet with respect to the girdle portion . the angles shown can vary by approximately plus or minus one degree . a corresponding angular spectrum evaluation tool result for this example is shown in fig1 . those of ordinary skill will be familiar with the use of the angular spectrum evaluation tool to quantify the results of a gemstone &# 39 ; s optical performance and the evaluation of such results . accordingly , those skilled in the art will recognize that a majority of the cut diamond represented in fig1 reflects incident light impinging on the diamond at an angle between 45 and 75 degrees with respect to the girdle plane , when the diamond is viewed from above . furthermore , those skilled in the art will recognize that the majority of the portions of the pavilion main facets which produce the appearance of the modified maltese cross reflect incident light impinging on the diamond at an angle between 45 and 75 degrees with respect to the girdle plane , when the diamond is viewed from above . in addition , the cut diamond represented in fig1 may achieve a grade of “ ideal 0 ” on the american gem society &# 39 ; s ® light performance scale . fig1 and 18 show a top and a bottom view , respectively , of a diamond cut in accordance with an embodiment of the present invention and having a modified maltese cross under the table facet . each of these figs denotes the angle of the respective facet with respect to the girdle portion . a corresponding angular spectrum evaluation tool result for this example is shown in fig1 . from this result , those skilled in the art will recognize that a majority of the cut diamond represented in fig1 reflects incident light impinging on the diamond at an angle between 45 and 75 degrees with respect to the girdle plane , when the diamond is viewed from above . furthermore , those skilled in the art will recognize that the majority of the portions of the pavilion main facets which produce the appearance of the modified maltese cross reflect incident light impinging on the diamond at an angle between 45 and 75 degrees with respect to the girdle plane , when the diamond is viewed from above . in addition , the cut diamond represented in fig1 may achieve a grade of “ ideal 0 ” on the american gem society &# 39 ; s ® light performance scale . the cut gemstones of the present invention are not limited to only the above described facets . additional facets can be included , especially to complete an enclosed volume . furthermore , it should be understood that references to a majority include an entirety . note that while this invention has been described in terms of several embodiments , these embodiments are non - limiting ( regardless of whether they have been labeled as exemplary or not ), and there are alterations , permutations , and equivalents , which fall within the scope of this invention . in addition , the various embodiments of the present invention should not be considered as mutually exclusive . furthermore , it should be understood that any optical performance results shown herein are not intended to be limiting of the present invention . instead , these results are to be understood as exemplary , illustrating the generalized representation of the optical performance of the present invention according to only some of the embodiments . it should also be noted that there are many alternative ways of implementing the methods and apparatuses of the present invention . it is therefore intended that claims that may follow be interpreted as including all such alterations , permutations , and equivalents as fall within the true spirit and scope of the present invention .

US-201414264046-A

the present invention is directed to an intraocular lens , an intraocular lens system and a method of producing and / or implanting the lens or system in an eye wherein at least one intraocular lens includes a coating that aids in resisting interlenticular opacification . the material of the coating is preferably hydrophilic or super - hydrophobic .

the present invention is predicated upon the provision of at least one intraocular lens ( iol ) and preferably two iols that have a coating for aiding in the prevention of opacification , particularly interlenticular lens opacification ( ilo ). the iol [ s ] typically form an intraocular lens system such as a dual optic or piggyback lens system . the coating is typically formed of a hydrophilic or super - hydrophobic material for aiding in the resistance or prevention of ilo . unless otherwise specifically stated , percentages of materials as used herein are weight percentages ( w / w ). fig1 illustrates an exemplary intraocular lens system 10 in accordance with an aspect of the present invention . the system 10 includes a first intraocular lens 12 and a second intraocular lens 14 . as used herein , the terms “ first ” and “ second ” as they are used to indicate a lens of the system are merely used to indicate one of the lenses as opposed to the other . these terms are not intended to suggest any order such as order of implantation , unless otherwise specifically stated . each of the lenses 12 , 14 includes a body 18 defining an outer surface 20 and a coating 24 disposed upon a region 28 of that outer surface 20 . the coatings 24 of the lenses 12 , 14 can aid in the prevention of ilo as is discussed further below . each of the lenses 12 , 14 also includes haptics 32 extending outwardly from the bodies 18 of the lenses 12 , 14 . each coating 24 of each of the lenses 12 , 14 faces and opposes the outer surface 20 of the other of the lenses 12 , 14 . this is particularly the case after both lenses have been implanted within an eye . the intraocular lenses 12 , 14 define an interlenticular space 36 therebetween and the coatings 24 of the lenses 12 , 14 are both located directly adjacent and at least partially define the interlenticular space 36 . in the embodiment shown in fig1 , each of the lenses 12 , 14 has its own coating 24 . however , it is contemplated that only one of the lenses may have a coating while the other lens may be uncoated . this configuration is shown in fig2 . this may be the case , for example , when the intraocular system includes a set of piggyback lenses for which a first uncoated lens has already been implanted and a second coated lens is implanted as an adjustment to the first lens . in the embodiment of fig1 , the coating 24 of each lens 12 , 14 is disposed upon a region 28 of the body 18 and more particularly is disposed only upon one of two opposing sides 40 , 42 of the body 18 . it is contemplated , however , that the coating may be disposed upon other regions of the body or the entirety of the body of the lens . the term “ region ” as used herein is intended to mean only a portion of the body . however , the suggestion that the coating covers or is disposed upon a region of the outer surface of the body is not intended to restrict the coating from being located on other portions of the body unless it is specifically stated that the coating is only disposed upon that region . in instances where the coating is selectively disposed upon only a region of the iol , it is generally preferred that the region be a substantial portion of the outer surface of the body of the iol . preferably , that substantial portion is at least 20 %, more preferably at least 40 % and even possibly at least 60 % of the outer surface of the body . the substantial portion is typically less than 90 % and more typically less than 80 % of the outer surface of the body . the aforementioned percentages are taken as percentages of total surface area of the body . the outer surface of the body is considered exclusive of any outer surface area of the haptics . of course , the haptics may also be coated , but are not considered part of the body . in one preferred embodiment , the coating is formed as a ring about only a peripheral region of the iol body as shown in fig3 . in such an embodiment , the peripheral region may be on only one side of the iol or on both sides . it is contemplated that a second iol in a system according to the present invention could have a ring shaped coating that is configured to oppose and face the ring shaped coating of fig3 or such second iol may have an alternative coating shape such as a coating covering one entire side of its body . the body , the haptics or both of any of the intraocular lenses according to the present invention are preferably formed of a hydrophobic material . such hydrophobic material will typically have a contact angle that is no greater than 90 degrees , more typically no greater than 85 degrees and even possibly no greater than 80 degrees . such material will also typically have a contact angle that is at least 50 degrees and more typically at least 60 degrees and even possibly at least 65 degrees . unless stated otherwise , contact angles for the materials of the present invention are determined in accordance with young &# 39 ; s equation as discussed in physical chemistry of surfaces ( sixth edition ), adamson , arthur w . et al ., chapter x , pgs . 352 - 354 . the material of the body , the haptics or both is preferably an acrylate based material . acrylate based materials are defined as having a substantial portion of acrylate monomers , which are preferably of formulation 1 below : y is nothing , o , s , or nr wherein r is h , ch 3 , c n h 2n + 1 ( n = 1 - 10 ), iso - oc 3 h 7 , c 6 h 5 , or ch 2 c 6 h 5 ; ar is any aromatic ring which can be unsubstituted or substituted with ch 3 , c 2 h 5 , n - c 3 h 7 , iso - c 3 h 7 , och 3 , c 6 h 11 , c 6 h 5 , or ch 2 c 6 h 5 ; suitable monomers of structure ( i ) include , but are not limited to : 2 - ethylphenoxy methacrylate ; 2 - ethylphenoxy acrylate ; 2 - ethylthiophenyl methacrylate ; 2 - ethylthiophenyl acrylate ; 2 - ethylaminophenyl methacrylate ; 2 - ethylaminophenyl acrylate ; phenyl methacrylate ; phenyl acrylate ; benzyl methacrylate ; benzyl acrylate ; 2 - phenylethyl methacrylate ; 2 - phenylethyl acrylate ; 3 - phenylpropyl methacrylate ; 3 - phenylpropyl acrylate ; 4 - phenylbutyl methacrylate ; 4 - phenylbutyl acrylate ; 4 - methylphenyl methacrylate ; 4 - methylphenyl acrylate ; 4 - methylbenzyl methacrylate ; 4 - methylbenzyl acrylate ; 2 - 2 - methylphenylethyl methacrylate ; 2 - 2 - methylphenylethyl acrylate ; 2 - 3 - methylphenylethyl methacrylate ; 2 - 3 - methylphenylethyl acrylate ; 24 - methylphenylethyl methacrylate ; 2 - 4 - methylphenylethyl acrylate ; 2 -( 4 - propylphenyl ) ethyl methacrylate ; 2 -( 4 - propylphenyl ) ethyl acrylate ; 2 -( 4 -( 1 - methylethyl ) phenyl ) ethyl methacrylate ; 2 -( 4 -( 1 - methylethyl ) phenyl ) ethyl acrylate ; 2 -( 4 - methoxyphenyl ) ethyl methacrylate ; 2 -( 4 - methoxyphenyl ) ethyl acrylate ; 2 -( 4 - cyclohexylphenyl ) ethyl methacrylate ; 2 -( 4 - cyclohexylphenyl ) ethyl acrylate ; 2 -( 2 - chlorophenyl ) ethyl methacrylate ; 2 -( 2 - chlorophenyl ) ethyl acrylate ; 2 -( 3 - chlorophenyl ) ethyl methacrylate ; 2 -( 3 - chlorophenyl ) ethyl acrylate ; 2 -( 4 - chlorophenyl ) ethyl methacrylate ; 2 -( 4 - chlorophenyl ) ethyl acrylate ; 2 -( 4 - bromophenyl ) ethyl methacrylate ; 2 -( 4 - bromophenyl ) ethyl acrylate ; 2 -( 3 - phenylphenyl ) ethyl methacrylate ; 2 -( 3 - phenylphenyl ) ethyl acrylate ; 2 -( 4 - phenylphenyl ) ethyl methacrylate ; 2 -( 4 - phenylphenyl ) ethyl acrylate ; 2 -( 4 - benzylphenyl ) ethyl methacrylate ; and 2 -( 4 - benzylphenyl ) ethyl acrylate , and the like . it is contemplated that the first and second iols of a system can be formed of substantially identical material , but may be formed of different materials . preferably , the material of both iols of the system are acrylate based , however , it is possible for one to be acrylate based while another may be formed of a different material ( e . g ., a silicone based material ). in such circumstances , the acrylate based iol will typically include a coating according to the present invention while the other iol of different material may or may not include a coating . the material of the body and / or haptics is typically formed from at least 30 %, more typically at least 70 % and even possibly at least 95 % acrylate monomers . the material of the body and / or haptics is typically formed from no greater than about 99 . 9 % acrylate monomers . these acrylate based materials are typically mixed with a curing agent and / or a polymerization initiator so that the materials may be cured to form the iols . as such , it will be understood that these monomers are linked to form polymers in the finished iols . examples of acrylate - based lenses are , without limitation , described in u . s . pat . nos . 5 , 922 , 821 ; 6 , 313 , 187 ; 6 , 353 , 069 ; and 6 , 703 , 466 , all of which are fully incorporated herein by reference for all purposes . the coating is preferably formed of a hydrophilic material or a super - hydrophobic material . a suitable hydrophilic material will typically have a contact angle that is no greater than 50 degrees , more typically no greater than 45 degrees and even possibly no greater than 35 degrees . such material will typically have a contact angle that is at least 5 degrees . a hydrophilic coating can also be formed of a hydrogel material . in such an embodiment , functionalized hydrogel precursors of hydrogel materials such as polyacrylic acid ( paa ), polyvinyl acetate ( pva ), polyvinyl pyrrolidone ( pvp ), polyethylene glycol ( peg ), polyether imide ( pei ), combinations thereof or the like may be coated upon the outer surface of the iol body . the precursors can then be cross - linked by ultraviolet and / or visible light , plasma , radiation , heat energy or the like to form the coating of hydrogel material . a suitable super - hydrophobic material for the coating will typically have a contact angle that is at least 90 degrees , more typically at least 100 degrees and even more possibly at least 130 degrees . such material will typically have a contact angle no greater than 177 degrees . when the coating is formed of a super - hydrophobic material , silicone based materials are typically quite desirable . silicone based materials are those materials that include a substantial portion of silicon or silicon monomers ( e . g ., silane or siloxane ). when silicone based , the material of the coating typically is formed from at least 30 %, more typically at least 60 % and even possibly at least 80 % silicone monomers . in such embodiment , the material of the coating is typically formed from no greater than about 99 . 9 % silicone monomers . examples of silicone materials are , without limitation , described in u . s . pat . nos . 5 , 420 , 213 ; 5 , 494 , 946 ; 7 , 033 , 391 ; and 7 , 071 , 244 , all of which are fully incorporated herein by reference for all purposes . silicone based coatings can be formed upon the body of the iol using various techniques . in one embodiment , silicon monomers ( e . g ., silane or siloxane monomers ) can be coated on the outer surface of the body by plasma deposition or polymerization onto the surface of the body . in another embodiment , plasma treatment ( e . g ., oxygen or water plasma treatment ) can be employed to introduce hydroxyl groups onto the outer surface of the iol body followed by a silanization treatment . in yet another embodiment , a surface modifying agent containing silicone block copolymer can be blended with the acrylate material prior to casting and curing of the iol . as an alternative to silicone , super - hydrophobic materials with even greater hydrophobicity ( e . g ., contact angles of at least 130 degrees ) may be used . these super - hydrophobic coatings can be formed using continuous or , more preferably , modulated plasma deposition / polymerization treatment of perfluorocarbons monomers , which can then be cross - linked to form a polytetrafluoroehtylene ( ptfe ) coating . as an alternative , benzene moieties can be attached to the iol body outer surface by direct fluorination to form a super - hydrophobic coating . as another alternative , plasma treatment ( e . g ., oxygen or water plasma treatment ) can be used to introduce hydroxyl groups onto the outer surface of the iol body followed by a fluorinated silanization treatment . as an alternative or addition to a hydrophilic or super - hydrophobic coating , it is contemplated that a coating may be formed of bioactive agents . as one example , natural or synthetic molecules that modulate or inhibit protein adsorption and / or cell adhesion can be attached to the outer surface of the body to form a modified surface coating ( e . g ., a modified surface that preferentially adsorb serum albumin ). as another example , pharmacological agents such as immunosuppressants , mtor inhibitors or the like can be attached or otherwise coated on the outer surface of the iol body to form a coating that prohibits or inhibits lens epithelial cell ( lec ) growth . it is also contemplated that a coating may only cover a peripheral region ( e . g ., a peripheral edge ) of the lens body and , for example , may form a ring about the lens body and / or may extend radially outwardly from the peripheral region . still further , it is contemplated that the coating may be formed as a separate solid film ( e . g ., an annular disc shape film ) that is then disposed over the surface of the lens body and preferably attached ( e . g ., adhered ) thereto . lens systems of the present invention can be implanted in the eye according various protocols . typically a first lens is implanted followed by a second lens . it is contemplated , however , that two lenses may be implanted at least partially simultaneously . both lenses may be implanted in the capsular bag or one may be located in the capsular bag while the other is outside of the capsular bag . in one preferred embodiment , a first lens is implanted in the capsular bag and then , upon discovery that the first lens is not providing the desired visual performance , a second lens is implanted in the sulces of the eye . such lenses are typically referred to as piggy - back lenses . as example of such lenses are shown in fig4 . as can be seen , a first lens 50 is disposed in the capsular bag and is without a coating . however , a second lens 52 , which has been implanted later in the sulces does include a coating 54 in accordance with the present invention . generally , for piggy - back lens systems , the lens implanted in the sulces or the second lens implanted will be the only lens to include a coating since the lens in the capsular bag will have been implanted without the knowledge that a second lens would necessarily be implanted . of course , it would be possible for the first implanted lens 50 ( i . e ., the lens in the capsular bag ) to also include a coating , particularly if there is a likelihood that a second piggyback lens will be implanted later . in the embodiment shown , the coating 54 is in opposing facing relation to an outer side surface 56 of the first lens 50 and directly adjacent an interlenticular space 58 between the lenses . in another preferred embodiment , a first lens is implanted in the capsular bag and then a second lens is implanted in the capsular bag and connected to the first lens to form a dual optic intraocular lens system ( e . g ., an accommodative system ). as can be seen in fig5 , a first lens 60 having positive power is implanted and a second lens 62 having negative power is implanted . they are then attached to each other with attachment members 64 ( e . g ., interlocking haptics or other members ) to form a dual optic accommodative intraocular lens system . as can also be seen , both of the lenses 60 and 62 having coatings 66 , 68 on only one side of the lenses 60 , 62 and those coatings 66 , 68 are in opposing facing relation to each other and adjacent an intralenticular space 70 . the entire contents of all cited references in this disclosure are specifically incorporated herein by reference . further , when an amount , concentration , or other value or parameter is given as either a range , preferred range , or a list of upper preferable values and lower preferable values , this is to be understood as specifically disclosing all ranges formed from any pair of any upper range limit or preferred value and any lower range limit or preferred value , regardless of whether ranges are separately disclosed . where a range of numerical values is recited herein , unless otherwise stated , the range is intended to include the endpoints thereof , and all integers and fractions within the range . it is not intended that the scope of the invention be limited to the specific values recited when defining a range . other embodiments of the present invention will be apparent to those skilled in the art from consideration of the present specification and practice of the present invention disclosed herein . it is intended that the present specification and examples be considered as exemplary only with a true scope and spirit of the invention being indicated by the following claims and equivalents thereof .

US-87486310-A

an electronic endoscope of the present invention includes a video - scope having an image sensor , a video - processor , to which a proximal end of the video - scope and a monitor are respectively connected , a character and mark generation controller , and an area - image changer . the character and mark generation controller generates character signals and indicator - mark signals , and then feeds the character signals and the indicator - mark signals to the monitor . the image - area changer changes a size of an image - area of the object image displayed on the screen of the monitor to another size , thus the object image is selectively displayed within one of plural image - areas on the screen in accordance with a size change of the image - area . the characters and mark generation controller includes a display - position adjuster that determines display - positions of the character information and the indicator - mark on the basis of a reference table , in which a correspondence relationship between each of the image - area and each of the display - positions of the character information and the indicator - mark is indicated .

hereinafter , the preferred embodiment of the present invention is described with reference to the attached drawings . fig1 is a block diagram of an electronic endoscope of the embodiment . this endoscope is used when an operation , an inspection or a treatment regarding an organ , such as a stomach , is performed . the electronic endoscope includes a video - processor 20 and a video - scope 10 . the video - scope 10 is a flexible conduit , and is detachably connected to the video - processor 20 . a monitor 49 is also connected to the video - processor 20 . during an operation , a proximal end 18 of the video - scope 10 is connected to the video - processor 20 , and a distal end of the video - scope 10 is inserted into the body - cavity . when the video - scope 10 is connected to the video - processor 20 , data associated with a type of video - scope 10 is read from an eeprom ( electronic erasable programmable rom ) 19 and then fed to a cpu ( central processing unit ) 30 . the electronic endoscope is controlled by the cpu 30 . the video - scope 10 includes a light guide 14 extended therethrough , formed as a bundle of optical fibers . when the proximal end 18 of the video - scope 10 is connected to the video - processor 20 , an incidence end 14 a of the light guide 14 is optically connected to a lamp 22 , such as a halogen lamp , controlled by a lamp driver circuit 23 . thus , light emitted from the lamp 22 , is directed to the incidence end 14 a of the light guide 14 via a condenser lens 24 , and then radiates from the distal end of the light guide 14 toward an object s via a diffusion lens 15 . a stop ( diaphragm ) 25 is provided between the lamp 22 and the incidence end 14 a of the light guide 14 , and is driven by a stepping motor ( not shown ), which rotates by a driving - signal output from a driver circuit 28 . the stop 25 is used for adjusting a quantity of light directed from the lamp 22 to the incidence end 14 a of the light guide 14 . namely , the stop 25 is used for adjusting a quantity of the illuminating - light radiating from the distal end of the light guide 14 . a ccd ( charge - coupled - device ) 13 , which is an image sensor , is provided at the distal end of the video - scope 10 . when an object s is illuminated by the illuminating - light , light reflected from the object s is focused on the ccd 13 via an optical lens 12 , so that the object image is formed on the ccd 13 . photoelectric conversion devices ( not shown ) are provided on the ccd 13 , and red ( r ), green ( g ), and blue ( b ) color mosaic - filter elements are provided in front of the photoelectric conversion devices . namely , in this embodiment , one chip color method is applied . the object image , formed on the ccd 13 , is converted into electrical image - pixel signals corresponding to predetermined colors by the photoelectric conversion devices . these analog image - pixel signals , corresponding to a frame , are successively read from the ccd 13 to an image - processing circuit 21 via a connector 16 , i . e ., the object image is scanned . in this embodiment , a ntsc color method is applied as a color - television video - standard . therefore , one frame worth of the analog image - pixel signals is scanned at regular time - intervals of { fraction ( 1 / 30 )} sec . however , other color - television methods may be used in alternative embodiments . in the image - processing circuit 21 , one frame worth of the analog image - pixel signals , output from the ccd 13 in order , is separated into analog image - pixel signals corresponding to the red r , analog image - pixel signals corresponding to green g , and analog image - pixel signals corresponding to blue b , respectively . then , the analog image - pixel signals , corresponding to each color ( r , g , b ), are amplified and converted into digital image - pixel signals , respectively . further , the digital image - pixel signals are subjected to various image - processes , such as a reset noise removal and gamma - correction , etc . one frame of luminance signals are successively generated on the basis of the digital image - pixel signals , and then fed to the cpu 30 . the stop 25 is controlled by the cpu 30 on the basis of the luminance signals . the digital image - pixel signals are converted into analog image - pixel signals again in the image - processing circuit 21 , and are further converted into the video signals , in short , ntsc signals . the video signals are output from the image - processing circuit 21 to the monitor 49 . character - code is fed from the cpu 30 to a crtc ( cathode ray tube controller ) 32 to display character information , such as patient &# 39 ; s name , age etc , on the monitor 49 . in the crtc 32 , character signals corresponding to the character information displayed on the monitor 49 are generated , and the character signals are output from the crtc 32 . similar to the character information , pointer signals corresponding to a pointer , which is an indicator - mark for pointing to a specific portion in the object image displayed on the monitor 49 ( for example , a diseased portion ), is generated in the crtc 32 . the character signals and the pointer signals are superimposed on the video signal output from the image - processing circuit 21 , and then the video signal including the character signals and the pointer signals is fed to the monitor 49 . one frame worth of the video signals are successively output to the monitor 49 at regular time - intervals of { fraction ( 1 / 30 )} sec , thus the object image is displayed on the monitor 49 , as a moving picture . timing - control signals corresponding to an output - timing of the character and pointer signals output from the crtc 32 are fed from the cpu 30 to the crtc 32 , thus the character information and the pointer are displayed at a predetermined position on the monitor 49 , respectively . a timing generator ( not shown ), for synchronizing the image - pixel signals read from the ccd 13 , the video signals output from the image - processing circuit 21 and the character and pointer signals output from the crtc 32 , is provided in the video - processor 20 . thus , clock pulse signals are fed from the timing generator to the ccd 13 , the image - processing circuit 21 and the crtc 32 by a clock frequency . a panel switch 27 includes an up - switch 27 a , a down - switch 27 b and an auto / manual switch 27 c . when the up - switch 27 a and / or the down - switch 27 b are operated by an operator to set a level of brightness of the object image displayed on the monitor 49 , operation - signals are input to the cpu 30 , and thus the brightness of the object image is adjusted . the auto / manual switch 27 c is operated by an operator for selecting a method of an adjustment of the brightness . when a keyboard 26 is operated , an operation - signal , regarding the object image and the character information and so on , is input to the cpu 30 . in this embodiment , an image - area , which is a displaying - area of the object image displayed on the monitor 49 , can be enlarged by operating the keyboard 26 . in this case , magnifying video signals , corresponding to an enlarged object image on the monitor 49 , are obtained by an interpolation processing , which is well known , in the image - processing circuit 21 , and are then fed to the monitor 49 . when the object image on the monitor 49 is enlarged , the character and pointer signals are output from the crtc 32 by a timing corresponding to the enlarged object image , thus the character information and the pointer are displayed at a position corresponding to the enlarged object image , respectively . in the cpu 30 , a rom 33 which is a nonvolatile memory 33 , a ram 34 which is a volatile memory , and a rtc ( real time clock ) 31 are provided . in the rom 33 , a reference table , representing display - positions of the character information and the pointer , is stored as data . in the ram 34 , a part of the display - positions of the character information and the pointer , which is read from the reference table , is temporarily stored . then , the display - positions of the character information and the pointer on the monitor 49 are determined on the basis of the display - positions stored in the rom 33 and the ram 34 . further , a list of patients who have been examined using the electronic endoscope is also stored in the ram 34 as data . a current time and date are read from the rtc 31 , and the character - code corresponding to the current date and time is fed to the crtc 32 . thus , the time and date are displayed on the monitor 49 . fig2 to 4 are views of display - positions of the character information and the pointer . fig2 is a view showing pictures displayed on a screen of the monitor 49 . fig3 is a view showing the keyboard 26 . fig4 is a view showing the reference table . in this embodiment , two kinds video - scopes , type a of the video - scope 10 and a type b of the video - scope 10 can be connected to the video - processor 20 . further , regarding the image - area of the object image on the screen , a normal - display or a magnification - display can be selected by operating a f 8 ( function 8 ) key 52 on the keyboard 26 ( see fig3 ). the image - area of the object image on the screen is changed by operating the f 8 key 52 . a picture p 1 , shown in fig2 indicates a picture displayed on the screen w of the monitor 49 in a case where the type a of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display . the body - cavity image is displayed within a normal image - area ia . then , the character information , namely , a patient &# 39 ; s name ch 1 , an id number ( patient &# 39 ; s registration number ) ch 2 , a patient &# 39 ; s age ch 3 , a patient &# 39 ; s sex ch 4 , a doctor &# 39 ; s name ch 5 , a scope - name ch 6 , which is a code - name of the video - scope 10 connected to the video - processor 20 , a date ch 7 and a time ch 8 are respectively displayed at a position on the screen w with the object image . further , the pointer p pointing to a diseased - portion q is displayed in the normal image - area ia . the pointer p is displayed and erased by operating a f 4 ( function 4 ) key 53 ( see fig3 ), as described below . a shifting of the pointer p on the screen w is performed by operating an up - shift key 50 u , a down - shift key 50 d , a right - shift key 50 r , and a left - shift key 50 l , shown in fig3 . during an operation , the display - state is usually set to normal - display . a size of the normal image - area ia depends on a number of the pixels of the ccd 13 in the type a of the video - scope 10 . when a character key 54 on the keyboard 26 ( see fig3 ) is operated , a letter corresponding to a position , at which a cursor c is displayed ( herein , “ d ” in the doctor &# 39 ; s name ch 5 ), is replaced to other letter corresponding to the operated character key , as described later . then , the position of cursor c is shifted to rightward by one letter worth ( herein , “ r ” in the doctor &# 39 ; s name ch 5 ). the shifting of the position of the pointer p and the cursor c is performed by operating an enter key 51 , the up - shift key 50 u , the down - shift key 50 d , the right - shift key 50 r , and the left - shift key 50 l ( see fig3 ). when the f 8 key 52 is depressed by the operator in a case where the object image is displayed within the normal image - area ia , the display - state is changed to magnification - display , shown in the picture p 1 ′ in fig2 as described later . thus , the size of the normal image - area ia is enlarged to a large - sized magnifying image - area ia ′, within which the object image is displayed . the magnifying image - area ia ′ is located at a center portion of the screen w . in accordance with the size - change of the image - area , character information is displayed at corner portions of the screen w . a position of each item of character information is shifted beyond the magnifying image - area ia ′ on the screen w , such that the character information overlaps the object image within the magnifying image - area ia ′ as little as possible . on the other hand , the display - position of the pointer p is not changed when the display - position of the pointer p is within the magnifying image - area ia ′. inversely , when the f 8 key 52 is depressed by the operator in a case where the object image is displayed within the magnifying image - area ia ′, the display - state is returned to the normal - display . therefore , the magnifying image - area ia ′ is again changed to the normal - image - area ia , and the display - positions of the character information are shifted to the original display - positions , respectively . on the other hand , the position of the pointer p is not changed when the display - position of the pointer p is within the normal image - area ia . however , when the position of the pointer p is beyond the normal image - area ia or the magnifying image - area ia ′ in a case where the size - change of the image - area is performed , the position of the pointer p is shifted within the normal image - area ia or the magnifying image - area ia ′, as described later . when the type b of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , the object image is displayed within a normal image - area ib , as shown in picture p 2 on the screen w in fig2 . note that , as shown in fig2 the normal image - area ib is different from the normal image - area ia because of the difference between the ccd 13 in the type a of the video - scope 10 and the ccd 13 in the type b of the video - scope 10 . similarly to the type a of the video - scope 10 , when the f 8 key 52 is depressed by the operator in a case where the object image is displayed within the normal image - area ib , the display - state is changed to the magnification - display , as shown in a picture p 2 ′ in fig2 . thus , the size of the normal image - area ib is enlarged to a large - sized magnifying image - area ib ′, within which the object image is displayed . in accordance with the size - change of the image - area , the character information is displayed at corner portions of the screen w . similarly to the type a of the video - scope 10 . when the f 8 key 52 is depressed by the operator in a case where the object image is displayed within the magnifying image - area ib ′, the display - state is returned to normal - display . the reference table t , shown in fig4 represents x - y coordinates of each item of the character information and the pointer p . as shown in fig2 a x - y coordinate system is defined with respect to the screen w of the monitor 49 , and an origin of the x - y coordinate system is positioned at the upper left - most corner of the screen w . note that , values of x - coordinates ascend from a left - position to right - position . on the other hand , values of y - coordinates ascend from an upper - position to a lower - position . in the reference table t , the character information is arranged by item ( the patient &# 39 ; s name ch 1 , the patient &# 39 ; s age ch 2 , . . . , the time ch 8 ), and x - y coordinates ( x , y ) of 8 items are respectively represented . in this embodiment , x - y coordinates , corresponding to four image - areas , are prepared for each item . namely , x - y coordinates ( x , y ) corresponding to the type a of the video - scope 10 and the normal - display , x - y coordinates ( x , y ) corresponding to the type a of the video - scope 10 and the magnification - display , x - y coordinates ( x , y ) corresponding to the type b of the video - scope 10 and the normal - display , and x - y coordinates ( x , y ) corresponding to the type b of the video - scope 10 and the magnification - display are represented in the reference table t . note that , the x - y coordinates ( x , y ) indicate a position of a head letter in each item . for example , when the type a of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , the x - y coordinates of the patient &# 39 ; s name ch 1 is “( 1 , 1 )”, which is a position of a letter “ p ”, as shown in fig2 . the reference table t is stored in the rom 33 ( shown in fig1 ) as data in advance . namely , x - y coordinates - data is stored in addresses of the rom 33 . herein , the x - y coordinates ( x , y ) are represented by using a 10 - columns 8 - rows array h as given by following formula : note that , an item variable cp corresponds to the items . for example , the patient &# 39 ; s age ch 3 corresponds to the item variable cp of “ 3 ”. on the other hand , a display - position variable vs corresponds to a x - coordinate or a y - coordinate corresponding to the four image - areas . for example , when the type b of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , the display - position variable vs of the x - coordinate is “ 3 ”, and the display - position variable vs of the y - coordinate is “ 4 ”. the array h is utilized in the source code ( programming language ), and corresponds to the address in the rom 33 . namely , the x - y coordinates ( x , y ) are stored in the array h in the source code . when the type b of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , the x - y coordinates ( x , y ) of the doctor &# 39 ; s name chs is : further , in this embodiment , when the type of the video - scope 10 and the display - state are determined , as described later , corresponding x - y coordinates - data is read from the rom 33 and then temporarily stored in the ram 34 ( shown in fig1 ). herein , the x - y coordinates ( x , y ) stored in the ram 34 are represented by using a 10 - columns 2 - rows array h , corresponding to addresses in the ram 34 , as follows : for example , when the type b of the video - scope 10 is connected to the video - processor 20 and the display - state is the magnification - display , the x - y coordinates ( x , y ) of the item variable cp of “ 5 ” ( doctor &# 39 ; s name chs ) are : note that , the array h [ cp , 1 ] indicates the x - coordinate of the item corresponding to the item variable cp , and the array h [ cp , 2 ] indicates the y - coordinate of the item corresponding to the item variable cp . while the display - state is not changed or the exchange of the video - scope 10 is not performed , the character information is displayed on the screen in accordance with the x - y coordinates stored in the array h . when the display - state is changed or the exchange of the video - scope 10 is performed , as described later , corresponding x - y coordinates - data is read from the array h and stored in the array h . thus , the x - y coordinates ( x , y ) in the array h are rewritten . then , the character information is displayed on the basis of the x - y coordinates ( x , y ) newly stored in the array h . in the reference table t , a minimum limitation - position of the pointer a min corresponding to the item variable “ 9 ” and a maximum limitation - position of the pointer a max . corresponding to the item variable “ 10 ” are also represented . as shown in fig2 and 4 , x - y coordinates ( x , y ) of the minimum and maximum limitation - position of the pointer a min and a max indicate corner - positions of one of the image - areas ia , ia ′, ib , ib ′. note that , the x - y coordinates ( x , y ) of the minimum and maximum limitation - position of the pointer a min and a max respectively represent a head position of the pointer of an arrow . as mentioned above , the pointer p should be displayed within the image - area of the object image . therefore , when the display - state is changed or the exchange of the video - scope 10 is performed , the display - position of the pointer p is determined depending upon the maximum limitation - position of the pointer a max and the minimum limitation - position of the pointer a min , such that the display - position of the pointer p is not beyond the image - area of the object image . in this embodiment , the pointer p is shifted to a boundary of the image - area when the display - position of the pointer p is beyond the image - area by the size - change of the image - area , as described later . the x - y coordinates ( x , y ) regarding above the display - positions of the pointer p is also stored in the array h and further the array h . in this way , the display - positions of the character information and the pointer p are determined depending upon the reference table t . note that , as shown in fig2 when the display - state is magnification - display , a number of letters , which can be displayed in each column on the screen w , of the type a of the video - scope 10 is different from that of the type b of the video - scope 10 ( see pictures p 1 ′ and p 2 ′) here , the number of letters of the type a of the video - scope 10 is “ 42 ”, while , the number of letters of the type b of the video - scope 10 is “ 35 ”. this difference is because the number of pixels of the ccd 13 provided in the type a of the video - scope 10 is different from that of the ccd 13 provided in the type b of the video - scope 10 , as is conventionally well known . namely , the clock frequency , output from the timing generator ( not shown in fig1 ) to the ccd 13 , differs in accordance with the number of the pixels of the ccd 13 , i . e ., the type of the video - scope 10 when the display - state is the magnification - display . therefore , for example , as shown in fig4 the x - y coordinates “( 35 , 29 )” of the date ch 7 in the type a of the video - scope 10 is different from the x - y coordinates “( 26 , 30 )” of the date ch 7 in the type b of the video - scope 10 , though the display - position of the date ch 7 in the type a of the video - scope 10 and the display - position of the date ch 7 in the type b of the video - scope 10 are substantially the same on the screen w , as shown in the pictures p 1 ′ and p 2 ′ of fig2 . fig5 is a view showing a main routine regarding operations of the electronic endoscope as a whole . when electric power is turned on , the main routine is started . in step 101 , the x - y coordinates ( x , y ) stored in the array h , the stop 25 and so on , are subjected to an initial setting , respectively . in step 102 , a processing regarding a displaying of the time and the date is performed . in step 103 , a processing regarding the video - scope 10 is performed . in step 104 , other processing , for example , a level of the brightness of the light source 19 is adjusted in accordance with the operation of the panel switches 27 . these operations of the electronic endoscope are executed until the electric power is turned off . in steps 102 to 104 , subroutines , as described later , are respectively performed . fig6 is a view showing an interrupt routine regarding the operation of the keyboard 26 , as described later . this interrupt processing interrupts the operations of the electronic endoscope shown in fig5 . fig7 is a subroutine of step 102 in fig5 . in step 201 , it is determined whether or not data regarding the time and the date , read from the rtc 31 , has changed compared to a preceding date and time , read at a preceding processing . namely , it is determined whether or not one second has passed compared to the preceding processing . when the time has passed by more than one second , the process goes to step 202 . on the other hand , when the time has not passed by more than one second , this subroutine is terminated . in step 202 , the date ( a year , a month , a day ) ch 7 is displayed on the screen w on the basis of the x - y coordinates ( x , y ) stored in the array h . for example , when the type a of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , the date ch 7 is displayed such that a head numeral “ 1 ” in the date ch 7 is located at ( 24 , 9 ), as shown in fig2 . note that , the x - coordinate “ 24 ” and the y - coordinate “ 9 ” is respectively stored in the array h [ 7 , 1 ] and the array h [ 7 , 2 ]. in step 203 , the real time ( hour , minute , second ) ch 8 is displayed on the screen w on the basis of the x - y coordinates ( x , y ) stored in the array h , similarly to the date ch 8 . after the time and the date are displayed at the determined position , this subroutine is terminated , and the process then returns to step 102 of fig5 . fig8 is a view showing a subroutine of step 103 in fig5 . in step 301 , it is determined whether or not the video - scope 10 is newly connected to the video - processor 20 . when it is determined that the video - scope 10 is newly connected to the video - processor 20 , namely , the exchange of the video - scope 10 has been performed , the process goes to step 302 . in step 302 , it is determined whether the video - scope 10 , which has been newly connected to the video - processor 20 , is the type a of the video - scope 10 . note that , this determination is based on the data , read from the eeprom 19 in the video - scope 10 ( shown in fig1 ). when it is determined that the connected video - scope 10 is the type a , the process goes to step 303 . in step 303 , it is determined whether or not a display variable vr is 0 . namely , it is determined whether the display - state before the exchange of the video - scope 10 is the normal - display . the display variable vr indicates the normal - display or the magnification - display . when the display variable vr is 1 , the display - state is the magnification - display , while , when the display variable vr is 0 , the display - state is the normal - display . when it is determined that the display variable vr is 0 at step 303 , the process goes to step 304 . in step 304 , the object image is displayed within the image - area ia . further , the display - positions of the character information are determined from the reference table t . namely , the x - y coordinates ( x , y ) stored in the array h [ cp , 1 ] and the array h [ cp , 2 ], corresponding to the type a of the video - scope 10 and the normal - display , is read , and then temporarily stored in the array h [ cp , 1 ] and the array h [ cp , 2 ]. then , the process goes to step 305 . in step 305 , each item of character information is displayed at the determined position on the basis of the x - y coordinates ( x , y ) stored in the array h [ cp , 1 ] and the array h [ cp , 2 ], as shown in the picture p 1 displayed on the screen w in fig2 . at this time , the scope - name of the type a of video - scope 10 . is displayed . after the character information is displayed , this subroutine is terminated , and then the process returns to step 103 in fig5 . when it is determined that the display variable vr is 1 at step 303 , namely , the display - state is the magnification - display , the process goes to step 306 . in step 306 , the object image is displayed within the image - area ia ′. further , the display - positions of the character information are determined , similarly to step 304 . note that , in this case , the x - y coordinates ( x , y ), stored in the array h [ cp , 3 ] and the array h [ cp , 4 ], corresponding to the type a of the video - scope 10 and magnification - display , is read and then temporarily stored in the array h [ cp , 1 ] and the array h [ cp , 2 ]. then , the process goes to step 307 . in step 307 , each item of character information is displayed at the determined position on the basis of the x - y coordinates ( x , y ) stored in the array h [ cp , 1 ] and the array h [ cp , 2 ], as shown in the picture p 1 ′ displayed on the screen w in fig2 . after the character information is displayed , this subroutine is terminated , and then the process returns to step 103 in fig5 . on the other hand , when it is determined that type b of the video - scope 10 is newly connected to the video - processor 20 at step 302 , the process goes to step 308 . in step 308 , it is determined whether or not the display variable vr is 0 . when it is determined that the display variable vr is 0 , namely , the display - state is the normal - display , the process goes to step 309 . in step 309 , the object image is displayed within the image - area ib . further , the display - positions of the character information are determined from the reference table t . namely , the x - y coordinates ( x , y ) stored in the array h [ cp , 5 ] and the array h [ cp , 6 ], corresponding to the type b of the video - scope 10 and the normal - display , is read , and then temporarily stored in the array h [ cp , 1 ] and the array h [ cp , 2 ]. then , the process goes to step 310 . in step 310 , each item of character information is displayed at the determined position on the basis of the x - y coordinates ( x , y ) stored in the array h [ cp , 1 ] and the array h [ cp , 2 ], as shown in the picture p 2 displayed on the screen w in fig2 . at this time , the scope - name of the type b of video - scope 10 is displayed . after the character information is displayed , this subroutine is terminated , and then the process returns to step 103 in fig5 . when it is determined that the display variable vr is 1 at step 308 , namely , the display - state is magnification - display , the process goes to step 311 . in step 311 , the object image is displayed within the image - area ib ′. further , the display - positions of the character information are determined , similarly to step 309 . note that , in this case , the x - y coordinates ( x , y ) stored in the array h [ cp , 7 ] and the array h [ cp , 8 ], corresponding to the type b of the video - scope 10 and magnification - display , is read and then temporary stored in the array h [ cp , l ] and the array h [ cp , 2 ]. then , the process goes to step 312 . in step 312 , each of character information is displayed at the determined position on the basis of the x - y coordinates ( x , y ) stored in the array h [ cp , 1 ] and the array h [ cp , 2 ]), as shown in the picture p 2 ′ displayed on the screen w in fig2 . after the character information is displayed , this subroutine is terminated , and then the process returns to step 103 in fig5 . when it is determined that the video - scope 10 is not newly connected to the video - processor 20 at step 301 , the process goes to step 313 . in step 313 , it is determined whether the video - scope 10 is detached from the video - processor 20 . when it is determined that the video - scope 10 is detached from the video - processor 20 , the process goes to step 314 . in step 314 , the object image and the scope - name of the video - scope 10 are erased from the screen w . at this time , the object image is not displayed on the screen w . then , this subroutine is terminated and the process returns to step 103 of fig5 . on the other hand , when it is determined that the video - scope 10 is not detached from the video - processor 20 , namely , the video - scope 10 is not changed , the subroutine is terminated and then the process returns to step 103 of fig5 . as mentioned above , when the exchange of the video - scope 10 is performed , the display - positions of the character information are determined depending upon the corresponding x - y coordinates ( x , y ) stored in the array h . fig9 is a view showing the interrupt routine of fig6 in detail . when any key on the keyboard 26 is operated , this routine is started . in step 401 , it is determined whether the pointer display variable vm is 0 , namely , whether the pointer p is not displayed on the screen w of the monitor 49 . note that , the pointer display variable vm is 1 when the pointer p is displayed , while the pointer display variable vm is 0 when the pointer p is not displayed . when the keyboard 26 is manipulated while the pointer p is displayed on the screen w , steps 415 to 427 are performed . on the other hand , when the keyboard 26 is manipulated while the pointer p is not displayed on the screen w , steps 402 to 414 are performed . when it is determined that the pointer display variable vm is 0 at step 401 , the process goes to step 402 . in step 402 , it is determined whether or not one of the character keys 54 ( shown in fig3 ) on the keyboard 26 is operated by the operator . when it is determined that one of the character keys 54 is operated , the process goes to step 403 , wherein a processing corresponding to the character keys 54 is performed . then , this interrupt routine is terminated . on the other hand , when it is determined that none of the character keys 54 are operated at step 402 , the process goes to step 404 . in step 404 , it is determined whether or not the enter key 51 ( shown in fig3 ) on the keyboard 26 is operated by the operator . when it is determined that the enter key 53 is operated , the process goes to step 405 , wherein a processing corresponding to the enter key 53 is performed . then , this interrupt routine is terminated . on the other hand , when it is determined that the enter key 53 is not operated at step 404 , the process goes to step 406 . in step 406 , it is determined whether or not the up - shift key 50 u ( shown in fig3 ) on the keyboard 26 is operated . when it is determined that the up - shift key 50 u is operated , the process goes to step 407 , wherein a processing corresponding to the up - shift key 50 u is performed . then , this interrupt routine is terminated . on the other hand , when it is determined that the up - shift key 50 u is not operated at step 406 , the process goes to step 408 . in step 408 , it is determined whether or not the down - shift key 50 d ( shown in fig3 ) on the keyboard 26 is operated . when it is determined that the down - shift key 50 d is operated , the process goes to step 409 , wherein a processing identical to step 405 is performed . then , this routine is terminated . on the other hand , when it is determined that the down - shift key 50 d is not operated at step 408 , the process goes to step 410 . in step 410 , it is determined whether or not the f 4 key 53 ( shown in fig3 ) on the keyboard 26 is operated . when it is determined that the f 4 key 53 is operated , the process goes to step 411 , wherein a processing corresponding to the f 4 key 53 is performed . then , the interrupt routine is terminated . on the other hand , when it is determined that the f 4 key 53 is not operated at step 410 , the process goes to step 412 . in step 412 , it is determined whether or not the f 8 key 52 ( shown in fig3 ) on the keyboard 26 is operated . when it is determined that the f 8 key 52 is operated , the process goes to step 413 , wherein a processing corresponding to the f 8 key 52 is performed . then , the interrupt routine is terminated . on the other hand , when it is determined that the f 8 key 52 is not operated at step 412 , the process goes to step 414 . in step 414 , a processing regarding other keys ( for example , esc key ) on the keyboard 26 is performed . then , this interrupt routine is finished . when it is determined that the pointer display variable vm is 1 at step 401 , namely , the pointer p is displayed on the screen w , the process goes to step 415 . in step 415 , it is determined whether or not the up - shift key 50 u on the keyboard 26 is operated . when it is determined that the up - shift key 50 u is operated , the process goes to step 416 . in step 416 , the pointer p is shifted upward along a y - direction by one coordinate worth only when a following formula ( 5 ) is satisfied regarding the display - position of the pointer p . note that , a value of the y - coordinate of the pointer p is denoted by “ vy ”, and the y - coordinate of the minimum limitation - position of the pointer a min is stored in the array h [ 9 , 2 ]). for example , when the type a of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , as shown in fig4 the formula ( 6 ), which corresponds to the formula ( 5 ), is : when the formula ( 5 ) is satisfied , the pointer p is shifted upward by one coordinate worth . in other words , the value of the y - coordinate vy is decremented by 1 . for example , the pointer p , the y - coordinate of which is “ 20 ”, is shifted to the position of y - coordinate “ 19 ”. if the formula ( 5 ) is not satisfied , the pointer p is not shifted such that the display - position of the pointer p remains within the image - area . after step 416 is executed , the interrupt routine is terminated . on the other hand , when it is determined that the up - shift key 50 u is not operated at step 415 , the process goes to step 417 . in step 417 , it is determined whether or not the down - shift key 50 d in the keyboard 26 is operated . when it is determined that the down - shift key 50 d is operated , the process goes to step 418 . in step 418 , the pointer p is shifted downward along the y - direction by one coordinate worth only when a following formula ( 7 ) is satisfied regarding the display - position of the pointer p . the y - coordinate of the maximum limitation - position of the pointer a max is stored in the array h [ 10 , 2 ]. for example , when the type a of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , formula ( 8 ), which corresponds to the formula ( 7 ), is : when the formula ( 7 ) is satisfied , the pointer p is shifted downward by one coordinate worth . in other words , the value of the y - coordinate vy is incremented by 1 . for example , the pointer p , the y - coordinate of which is “ 20 ”, is shifted to the position of the y - coordinate “ 21 ”. if the formula ( 7 ) is not satisfied , the pointer p is not shifted . after step 418 is executed , the interrupt routine is terminated . on the other hand , when it is determined that the down - shift key 50 d is not operated at step 417 , the process goes to step 419 . in step 419 , it is determined whether or not the left - shift key 50 l in the keyboard 26 is operated . when it is determined that the left - shift key 50 l is operated , the process goes to step 420 . in step 420 , the pointer p is shifted leftward along a x - direction by one coordinate worth , only when a following formula ( 9 ) is satisfied regarding the display - position of the pointer p . a value of the x - coordinate of the pointer p is denoted by “ vx ”, and the x - coordinate of the minimum limitation - position of the pointer a min is stored in the array h [ 9 , 1 ]. for example , when the type a of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , as shown in fig4 formula ( 10 ), which corresponds to the formula ( 9 ), is : when the formula ( 9 ) is satisfied , the pointer p is shifted leftward by one coordinate worth . in other words , the value of the x - coordinate “ vx ” is decremented by 1 . for example , the pointer p , the x - coordinate of which is “ 17 ”, is shifted to the position of x - coordinate “ 16 ”. if the formula ( 9 ) is not satisfied , the pointer p is not shifted . after step 420 is executed , the interrupt routine is terminated . on the other hand , when it is determined that the left - shift key 50 l is not operated at step 419 , the process goes to step 421 . in step 421 , it is determined whether or not the right - shift key 50 r in the keyboard 26 is operated . when it is determined that the right - shift key 50 r is operated , the process goes to step 422 . in step 422 , the pointer p is shifted rightward along the x - direction by one coordinate worth only when a following formula ( 11 ) is satisfied regarding the display - position of the pointer p . the x - coordinate of the minimum - limitation - position of the pointer a max is stored in the array h [ 10 , 1 ]. for example , when the type a of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , formula ( 12 ), corresponds to the formula ( 11 ), is : when the formula ( 11 ) is satisfied , the pointer p is shifted rightward by one coordinate worth . in other words , the value of the x - coordinate vx is incremented by 1 . for example , the pointer p , the x - coordinate of which is “ 15 ”, is shifted to the position of the x - coordinate “ 16 ”. if the formula ( 11 ) is not satisfied , the pointer p is not shifted . after step 422 is executed , the interrupt routine is terminated . on the other hand , when it is determined that the right - shift key 5 or is not operated at step 421 , the process goes to step 423 . in step 423 , it is determined whether or not the f 4 key 53 on the keyboard 26 is operated . when it is determined that the f 4 key 53 is operated , the process goes to step 424 , wherein the pointer p is erased from the screen w of the monitor 49 , and further the pointer display variable vm is set to 0 . then , the interrupt routine is terminated . on the other hand , when it is determined that the f 4 key 53 is not operated at step 423 , the process goes to step 425 . in step 425 , it is determined whether or not the f 8 key 52 on the keyboard 26 is operated . when it is determined that the f 8 key 52 is operated , the process goes to step 426 , wherein a processing corresponding to the f 8 key 52 is performed . then , the interrupt routine is terminated . on the other hand , when it is determined that the f 8 key 52 is not operated at step 425 , the process goes to step 427 . in step 427 , the process equal to step 414 is performed , and then the interrupt routine is terminated . note that , in step 426 , as described later , the display - position of the pointer p is adjusted . as mentioned above , the process for operating the keyboard 26 is performed at steps 401 to 427 . then , as described later , subroutines are performed at steps 403 , 405 , 407 , 409 , 411 , 413 , 426 , respectively . fig1 is a subroutine of step 403 in fig9 . this subroutine is performed when one of the character keys 54 is depressed . in step 501 , it is determined whether the item variable cp is 0 , namely , whether the cursor c is not displayed on the monitor 46 . the item variables 1 to 6 correspond to the patient &# 39 ; s name ch 1 through to the scope - name ch 6 of the character information respectively . when the item variable cp is 0 , the cursor c is not displayed . when it is determined that the item variable cp is not 0 , the process goes to step 502 . in step 502 , a letter corresponding to the depressed character key among the character keys 54 is input at a position corresponding to the display - position of the cursor c . then , at step 503 , a cursor position variable cu is incremented by 1 , thus the cursor c is shifted rightward by one letter worth note that , the cursor position variable cu corresponds to a cursor &# 39 ; s display - position in each item of the character information . further note that , the cursor c is located at the head letter in each of the character information when the cursor position variable cu is 0 , as shown in the picture p 1 of fig2 . after the letter is input and the cursor c is shifted , the subroutine is terminated and then the process returns to step 403 in fig9 . in this way , the character information is rewritten by operating the character keys 54 . on the other hand , when it is determined that the item variable cp is 0 at step 501 , this subroutine is terminated and the process returns to step 403 in fig9 . fig1 is a &# 39 ; subroutine of steps 405 and 409 in fig9 . as described above , this subroutine is performed when the enter key 51 or the up - shift key 50 u is depressed . in step 601 , it is determined whether the item variable cp is 6 , namely , whether the cursor c is located at the scope - name of the video - scope ch 6 on the screen w . when it is determined that the item variable cp is 6 , the process goes to step 602 , wherein the item variable cp is set to 0 . then the process goes to step 604 . on the other hand , when it is determined that the item variable cp is not 6 at step 601 , the process goes to step 603 , wherein the item variable cp is incremented by 1 . for example , when the item variable cp is 5 corresponding to the doctor &# 39 ; s name ch 5 , the item variable cp is set to 6 , corresponding to the scope - name ch 6 . then , the process goes to step 604 . in step 604 , the cursor c is shifted to a position of the item corresponding to the item variable cp , which is set to at step 602 or step 603 , and further the cursor position variable cu is set to 0 . namely , the cursor c is shifted to the head letter in the item corresponding to the item variable cp , which is set at step 602 or 603 . fig1 is a subroutine of step 604 in fig1 . in step 701 , it is determined whether or not the item variable cp is 0 , namely , whether the item variable cp is set to 0 at step 602 in fig1 . when it is determined that the item variable cp is 0 , the process goes to step 702 , wherein the cursor c is erased from the screen w of the monitor 46 . then , this subroutine is terminated . on the other hand , when it is determined that the item variable cp is not 0 , the process goes to step 703 . in step 703 , it is determined whether or not the item variable cp is 1 , namely , whether the item variable cp is set to 1 at step 603 in fig1 . when it is determined that the item variable cp is 1 , the process goes to step 704 , wherein the cursor c is displayed at the position corresponding to the head letter in the patent &# 39 ; s name ch 1 . note that , the x - y coordinates ( x , y ) of the head letter position is stored in the array h . for example , when the type b of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , as shown in the picture p 2 of fig2 the x - y coordinates ( x , y ) of the position of the cursor c is : on the other hand , when it is determined that the item variable cp is not 1 at step 703 , the process goes to step 705 . in steps 705 to 714 , the value of the item variable cp is determined , similarly to step 703 , and then the cursor c is displayed depending upon the item variable cp , similarly to step 704 . note that , the display - position of the cursor c is in accordance with the x - y coordinates ( x , y ) stored in the array h as following : for example , when it is determined that the item variable cp is 3 at step 707 in a case where the type a of the video - scope 10 is connected to the video - processor 20 and the display - state is the normal - display , as shown in the picture p 1 of fig2 the cursor c is displayed at following display - position at step 708 : in this way , the cursor c is shifted to the head letter in the next item when the enter key 51 or the down - shift key 50 d is depressed . for example , when the enter key 51 is depressed in a case where the cursor c is located at the doctor &# 39 ; s name ch 5 , the cursor c is shifted to the head letter in the scope - name ch 6 . at this time , the display - position of the cursor c is determined in accordance with the x - y coordinates ( x , y ) stored in the array h . after the cursor c is displayed at the determined position , this subroutine is terminated , and the process returns to step 604 in fig1 . fig1 is a subroutine of step 407 in fig9 . as described above , this subroutine is performed when the up - shift key 50 u is depressed . in step 801 , it is determined whether or not the item variable cp is 0 , namely , whether the cursor c is not displayed on the screen w . when it is determined that the item variable cp is 0 , the process goes to step 802 , wherein the item variable cp is set to 6 . then , the process proceeds to step 804 . on the other hand , when it is determined that the item variable cp is not 0 , the process goes to step 803 , wherein the item variable cp is decremented by 1 . for example , when the item variable cp is 5 corresponding to the doctor &# 39 ; s name ch 5 , the item variable cp is set to 4 , corresponding to the patient &# 39 ; s sex ch 4 . then , the process proceeds to step 804 . in step 804 , the cursor c is shifted to the item corresponding to the item variable cp , which is set at step 802 or 803 . then , the cursor position variable cu is set to 0 . namely , the cursor c is displayed at a position corresponding to the head letter in the character information . note that , steps 701 to 714 shown in fig1 is performed at step 804 , similarly to step 604 in fig1 . after the cursor c is shifted , this subroutine is terminated and then the process returns to step 407 in fig9 . in this way , the cursor c is shifted to the head letter in the next item when the up - shift key sou is depressed , similarly to the enter key 51 or the down - shift key 50 d . note , the shifting - direction of the up - shift key 50 u is opposite to the shifting - direction of the enter key 51 or the down - shift key sod . fig1 is a subroutine of steps 413 and 426 in fig9 . as described above , this subroutine is performed when the f 8 key 52 is depressed . in step 901 , it is determined whether or not the display variable vr is 0 , namely , whether the f 8 key 52 on the keyboard 26 is depressed when the display - state is the normal - display . when it is determined that the display variable vr is 0 , the process goes to step 902 . in step 902 , the display variable vr is set to 1 , namely , the display - state is changed to the magnification - display . then , the process proceeds to step 903 . in step 903 , it is determined whether or not the type a of the video - scope 10 is connected to the video - processor 20 . when it is determined that the type a of the video - scope 10 is connected to the video - processor 20 , the process goes to step 904 . in step 904 , the object image is displayed within the magnifying image - area ia ′, as shown in the picture p 1 ′ of fig2 . further , the x - y coordinates ( x , y ) of the character information are determined on the basis of the reference table t . namely , the x - y coordinates ( x , y ), corresponding to the type a of the video - scope 10 and the magnification - display , are read from the array h , and then temporarily stored in the array h . in this case , the x - y coordinates ( x , y ) are : the above x - y coordinates ( x , y ) are temporarily stored in the array h [ cp , 1 ] and the array h [ cp , 2 ]. then , the process proceeds to step 910 . on the other hand , when it is determined that the type b of the video - scope 10 is connected to the video - processor 20 at step 903 , the process goes to step 905 . in step 905 , the object image is displayed within the magnifying image - area ib ′ , as shown in the picture p 2 ′ of fig2 . further , the x - y coordinates ( x , y ) of the character information are determined on the basis of the reference table t . namely , the x - y coordinates ( x , y ), corresponding to the type b of the video - scope 10 and the magnification - display , are read from the array h , and then temporarily stored in the array h . in this case , the x - y coordinates ( x , y ) are : the above x - y coordinates ( x , y ) are temporarily stored in the array h [ cp , 1 ] and the array h [ cp , 2 ]. then , the process proceeds to step 910 . when it is determined that the display variable vr is 1 at step 901 , namely , whether the f 8 key 52 on the keyboard 26 is depressed when the display - state is the magnification - display ( vr = 1 ), the process goes to step 906 . in step 906 , the display variable vr is set to 0 , namely , the display - state is changed to the normal - display . then , the process proceeds to step 907 . in step 907 , it is determined whether or not type a of the video - scope 10 is connected to the video - processor 20 . when it is determined that the type a of the video - scope 10 is connected to the video - processor 20 , the process goes to step 908 . in step 908 , the object image is displayed within the normal image - area ia , as shown in the picture p 1 of fig2 . further , the x - y coordinates ( x , y ) of the character information are determined on the basis of the reference table t . namely , the x - y coordinates ( x , y ), corresponding to the type a of the video - scope 10 and the normal - display , are read from the array h , and then temporarily stored in the array h . in this case , the x - y coordinates ( x , y ) are : the above x - y coordinates ( x , y ) are temporarily stored in the array h [ cp , 1 ] and the h [ cp , 2 ]. then , the process proceeds to step 910 . on the other hand , when it is determined that the type a of the video - scope 10 is not connected to the video - processor 20 at step 907 , the process goes to step 909 . in step 909 , the object image is displayed within the normal image - area ib , as shown in the picture p 2 of fig2 . further , the x - y coordinates ( x , y ) are determined on the basis of the reference table t . namely , the x - y coordinates ( x , y ), corresponding to the type b of the video - scope 10 and the normal - display , are read from the array h , and then temporarily stored in the array h . in this case , the x - y coordinates ( x , y ) are : the above x - y coordinates ( x , y ) are temporarily stored in the array h [ cp , 1 ] and the array h [ cp , 2 ]. then , the process proceeds to step 910 . in step 910 , all of the character information , displayed on the screen w before the depression of the f 8 key 52 , is erased from the screen w . then , at step 911 , each of the character information is newly displayed at the determined position in accordance with the x - y coordinates ( x , y ), set at one of step 904 , step 905 , step 908 and step 909 . after the character information is newly displayed , this subroutine is terminated . fig1 is a subroutine of step 411 in fig . . 9 . this subroutine is performed when the f 4 key 53 is depressed . further , this subroutine is also performed when step 426 in fig9 and step 103 in fig5 are performed . namely , steps 951 to 954 are performed when the exchange of the video - scope 10 is performed or when the change of the image - area is executed . herein , the subroutine is referred to as “ pointer subroutine ”. at step 951 , it is determined whether or not the pointer p can be displayed within the image - area . namely , it is determined whether or not a display - position , at which the pointer p is displayed before the erasing by the f 4 key 53 , the exchange of the video - scope or the change of the image - area , is within the image - area . step 951 is performed on the basis of the x - y coordinates ( x , y ) stored in the array h [ 9 , 1 ], the array h [ 9 , 2 ] and the array h [ 10 , 1 ], the array h [ 10 , 2 ]. when it is determined that the pointer p can be displayed within the image - area , the process goes to step 952 , wherein the pointer p is displayed as before . then , the process proceeds to step 954 . on the other hand , when it is determined that the pointer p cannot be displayed within the image - area at step 951 , the display - position of the pointer p is changed such that the pointer p can be displayed within the image - area , at step 953 . for example , when the magnification - display is changed to the normal - display by depressing the f 8 key 52 when the type b of the video - scope 10 is connected to the video - processor 20 and the pointer p is displayed at a position of ( 28 , 15 ), within in the image - area ib ′, step 951 is performed on the basis of the x - y coordinates ( x , y ) stored in the array h [ 9 , 1 ], the array h [ 9 , 2 ] and the array h [ 10 , 1 ], the array h [ 10 , 2 ], corresponding to the x - y coordinates ( x , y ) stored in the array h [ 9 , 5 ], the array h [ 9 , 6 ] and the array h [ 10 , 5 ], the array h [ 10 , 6 ] ( see fig4 ). as the display - position of ( 28 , 15 ) is beyond the normal - image - area ib , the pointer p is shifted to a position of ( 21 , 15 ) on the basis of the x - coordinate “ 21 ” stored in the array h [ 10 , 1 ], so that the pointer p is displayed on the boundary of the image - area ib . after the pointer p is shifted at step 953 , the process goes to step 954 . in step 954 , the pointer display variable vm is set to 1 , which indicates that the pointer p is displayed , and then the pointer subroutine is terminated . as described above , the display - positions of the character information and the pointer p are adjusted in accordance with the size - change of the image - area . the display - positions of the character information are adjusted in accordance with the exchange of the video - scope , as shown at steps 301 to 312 in fig8 and in accordance with the size - change of the image - area , as shown at steps 901 to 911 in fig1 . also , the display - position of the pointer p is adjusted as shown at steps 951 to 954 in fig1 . generally , in the conventional electronic endoscope , when the display - position of each item is determined , processing , which determines the type of the video - scope and determines whether the display - state is the normal - display or the magnification - display , is performed for each item , one by one . for example , after the display - position of the patient &# 39 ; s name ch 1 is determined by performing the above process , the display - position of the id number ch 2 is determined by performing the processing , similarly to the patient &# 39 ; s name ch 1 . on the other hand , in this embodiment , the display - positions of the character information ( all of items ) and the pointer p are determined from the reference table t . at this time , the corresponding x - y coordinates ( x , y ) of the character information and the pointer p , stored in the array h ( rom 33 ), are read and then temporarily stored in the array h ( ram 34 ). thus , each item of the character information is displayed in accordance with the x - y coordinates ( x , y ) stored in the array h , and further the display - position of the pointer p is adjusted on the basis of the x - y coordinates ( x , y ) stored in the array h . namely , the character information and the pointer p can be displayed without performing a processing , which determines the type of the video - scope 10 and further determines the display - state by each item . as a consequence , the processing - speed regarding a displaying of the character information and the pointer p improves . as described above , generally , when the display - state is the magnification - display , the number of letters , which can be displayed in each column on the screen w , of the type a of the video - scope 10 is different from that of the type b of the video - scope 10 . namely , the x - y coordinates ( x , y ) of the character information and the pointer p are different depending upon the type of the video - scope 10 in a case where the display - state is the magnification - display . accordingly , when the input of the letter and the shifting of the position of the cursor c and the pointer p are performed , the x - y coordinates ( x , y ) of the inputted letter , the cursor c and the pointer p are different depending upon the type of the video - scope 10 . therefore , conventionally , the type of the video - scope 10 is determined and the display - state is determined every time the letter is newly rewritten , the cursor c is shifted , or the pointer p is shifted . however , in this embodiment , when the input of the letter and the shifting of the position of the cursor c and the pointer p are performed , the x - y coordinates ( x , y ) of the character information and the pointer p , corresponding to the image - area selected by the operator , is stored in the ram 34 , in short , the array h . thus , the input of the letter and the shifting of the position of the cursor c and the pointer p are performed without performing the processing , which determines the type of the video - scope 10 and determines the display - state . in a modification , only character information may be displayed on the basis of the reference table t . finally , it will be understood by those skilled in the art that the foregoing description is of preferred embodiment of the device , and that various changes and modifications may be made to the present invention without departing from the spirit and scope thereof . the present disclosure relates to subject matters contained in japanese patent application no . 10 - 370172 ( filed on dec . 25 , 1998 ) which is expressly incorporated herein , by reference , in its entirety .

US-47138099-A

the system monitors a user &# 39 ; s key physical movements when performing a particular activity , such as a golf swing , and signals visually and / or aurally when a single error is / are committed , for the purpose of encouraging faster learning of fundamentally sound physical skills . mental conditioning is achieved when the effects of repeatedly listening to the specially constructed and authored audio conditioning programs during practice sessions and games are combined with the above described physical monitoring effects of the system . better physical execution of a selected technique or skill results , and the user experiences the benefits of mental conditioning on his / her playing performance .

referring now more particularly to the drawings , there is shown in fig1 and 3 a preferably portable ground - based sensor unit or base unit 10 constructed in accordance with the principles of the invention . the base unit 10 comprises a housing 12 which may be either portable or permanently stationed . it may be powered using batteries , or by plugging the unit into an electrical outlet , as desired . the base unit 10 is positioned so that a golfer 14 preparing to swing at a golf ball stands in front of the unit as shown in fig1 and 3 . typically , the setting will be a golf driving range or other location where the golfer can actually strike a golf ball , but it could also be in a training location , including indoors , where the golfer simulates striking the golf ball or hits a plastic practice ball . a suitable sensor 16 is disposed on a front side of the unit 10 , facing the golfer 14 , which is preferably an infrared sensor . the golfer 14 wears an emitter device 18 which communicates along a line of sight with the sensor 16 . in a preferred embodiment , the emitter 18 is part of a headband or small earpiece transmitter . one example of a type of sensor / emitter system which could be employed in the invention is disclosed in u . s . pat . no . 6 , 730 , 047 to socci et al ., which is herein expressly incorporated by reference . as the golfer 14 is preparing to swing , a golf ball is placed in a desired location within a ball placement zone 20 in front of a ball detection sensor 22 , which may also comprise an infrared sensor , of a similar type as is employed as the above described sensor 16 . more particularly , the ball detection sensor 22 is a transmitter / receiver pair matched in frequency . of course , each of the sensors 16 and 22 may alternatively comprise any other sensor known in the art or which will be known in the future for performing the described functions . once the ball detection sensor 22 detects the presence of a ball within the ball placement zone 20 , a “ ball indicator ” light 24 , or other suitable visual or aural indicator , is actuated to let the golfer 14 know that the system has detected the ball , and the operating cycle has been initiated . a “ golfer ready ” indicator light 26 , or other suitable visual or aural indicator , is actuated when the sensor 16 detects a beam emitted by the emitter 18 , indicating that the golfer is in his / her setup position and is properly positioned to begin his / her swing . in operation , as noted above , the golfer 14 places a ball in the ball placement zone 20 to indicate to the unit 10 an intention of hitting . at the same time , the golfer takes his / her set - up stance and tilts his / her head to look at the ball . at this point , the ball detection sensor 22 detects the ball in the ball placement zone 20 and initiates a microcontroller in the unit 10 , which in turn starts a counter within the unit 10 . once the ball is detected , the unit controller will expect a signal from the emitter 18 on the golfer &# 39 ; s head within a predetermined time limit . when the sensor 16 detects a signal from the emitter 18 , both the ball indicator light 24 and the “ golfer ready ” indicator light 26 are actuated . once both of the indicators 24 and 26 are actuated , the system is adapted so that the ball must be hit by the golfer &# 39 ; s club before the golfer moves his / her head sufficiently that the contact between sensor 16 and emitter 18 is broken . if sensor / emitter contact is broken , it is an indication that the golfer improperly over - rotated his / her head during the swing . this will cause suitable alarms to be actuated to alert the golfer of his / her error . a visual alarm , together with other desired information , may be displayed on a screen 28 visible to the golfer from the striking position . this visual alarm may be informational , or a series of flashing lights , or the like . additionally , or alternatively , an audible alarm may be sounded in the earpiece 18 of the golfer , and / or on the unit 10 itself . even when contact between sensor 16 and emitter 18 is being maintained during the golfer &# 39 ; s swing , the inventive system provides for the option of displaying on screen 28 various messages , such as reminders , tips , encouragement , etc . in one favored embodiment , a set of messages flash on the display 28 in steady rhythm , to subconsciously assist the golfer &# 39 ; s swing tempo . suitable repeatedly flashed messages may include “ swing easy ” and “ head down ”. a visible unit swing counter , on the display screen 28 , displays the number of successful swings the golfer has completed without breaking sensor contact between sensor 16 and emitter 18 . as noted above , a counter increments every time a ball is detected in the ball placement zone 20 . the counter resets to zero when a swing is attempted during which the golfer &# 39 ; s head turns sufficiently to break sensor contact . the counter function provides feedback to the golfer concerning whether he / she is improving , and also allows for competitive fun as golfers can compete against themselves or other golfers to see how many successful swings they can execute in a row . now with reference to fig4 and 5 , a modified and presently preferred embodiment of the portable base unit 10 is shown . this unit is similar to that described in connection with fig1 and 3 , but incorporates additional advantageous features and functions . the device 10 comprises an elongated track portion 30 on which is mounted the housing 12 . advantageously , the track 30 can be positioned adjacent to a golfer location , as in fig1 and 3 , and then the housing 12 can be further positioned along the track 30 , by moving the housing 12 along the track , as shown , in order to adapt the location of the unit for different types of shots ( e . g . short iron shots where the ball is placed back in the stance or woods shots where the ball is placed forward in the stance ) without the necessity of relocating the entire unit 10 . fig4 and 5 are substantially identical , except that in fig4 the housing 12 has been moved to a distal location along the track 30 and in fig5 the housing has been moved to a more proximal location along the track 30 . it is within the scope of the present invention for the housing 12 to be motorized for movement along the track 30 , or , alternatively , to be movable manually by the golfer as desired . typically , in order to reduce costs , the housing is manually movable along the track 30 and includes convenient apertures so that the golfer may merely insert his / her golf club into the aperture to effect the desired movement . the housing 12 may be mounted on bearings , castors , wheels , or the like , for facilitating movement along the track 30 . like reference numerals in the embodiment of fig4 and 5 , to those in the embodiment of fig1 and 3 denote like elements with equivalent functions as described above , and will not be further described herein . an additional feature of the present invention is a timing control 32 for permitting the golfer to set a time interval in intervals of seconds . the timer provides for a digital display with a countdown function . the golfer can see the actual time he / she took to strike the ball . the display will also indicate , by stopping the countdown timer , the point when the golfer moved his / her head sufficiently so that contact was lost between the sensor 16 and emitter 18 , causing an alarm , as described above . the timer automatically resets to the selected time by the golfer within a preset time after the ball is hit or the golfer &# 39 ; s head moves before the ball is hit . another feature of the timer is to limit the time the golfer has to strike the ball to a predetermined period , set by the golfer , in countdown mode , after which the unit deactivates if the ball has not been struck . in such an instance , the ball must be removed and placed again in the ball placement zone in order to activate the unit . an advantage of this feature is to discipline the golfer to develop a more timely swing pattern . the present invention has an additional feature in that it is capable of receiving and playing back audio programming designed to assist the golfer as he / she is practicing his / her swing . a representative menu 34 for this audio programming is illustrated in fig6 . three different controls are provided for utilizing this feature , which has been identified by the inventors as a “ swing thoughts ” feature . control switch 36 permits the user to select a particular professional player as listed in the first column of the audio menu 34 of fig6 if desired . control switch 38 permits the user to select audio appropriate to the type of shot he / she wishes to practice , as shown in the second column of the audio menu 34 of fig6 . control switch 40 permits the user to select audio related to the portion of the swing the golfer wishes to work on , as shown in the third column of the audio menu 34 of fig6 . of course , these features are variable , and the menu items identified in each of the three menu columns are variable . in general , audio instructions help the users to mentally picture or envision how to correctly perform a particular skill , or component parts thereof , from a remote , ground - based , or personally worn audio program delivery storage and interactive switching unit . there is also nothing critical about the choice of three different menu columns or control switches . there could be more or fewer selections , and the means of selection could be different . rather than the illustrated toggle switches on the track portion 30 , a wireless control unit could be used , or any other suitable selection means . in fig2 there is schematically illustrated a presently preferred embodiment of an audio module 42 constructed in accordance with the principles of the present invention . the inventive concept is that a web site is operated which provides suitable audio programming for use with the inventive system . the web site makes available to those accessing the site , upon authorization , the current audio programming for download . the user downloads the audio programming onto their personal computer or other memory device , and , ultimately , the flash memory 44 in the audio module 42 . the audio module 42 is then inserted into a suitable port on the base unit 10 so that the current audio programming may be downloaded onto the base unit 10 for use by the golfer . more particularly , in one presently preferred embodiment , a subscriber to the inventive system will be provided with a host personal computer program which may be utilized to acquire the above described audio programming from the aforementioned supported website . a periodic subscription to the website is offered because the audio programming is regularly updated , by adding additional professional golfers , tips , philosophies , and the like , all designed to assist the golfer in improving his game and his enjoyment of the game . the currently downloaded audio programming may be downloaded directly onto the flash memory 44 of the audio module 42 , via a usb 2 . 0 port or other suitable technology , or it may be downloaded onto an alternative memory device ( such as the pc &# 39 ; s internal hard drive ) and then transferred onto the flash memory 44 . typically , the audio file is an encrypted compressed file , so that it is only playable on an authorized device . the module 42 may be plugged into a suitable port on the device 10 in order to permit the device 10 to utilize the audio programming contained therein . the module 42 is adapted for decrypting the audio file for direct audio play . the hardware module , when inserted into the target equipment , will play upon demand of an internal control signal . more particularly , the audio module 42 includes a micro controller 46 , a usb interface 48 , a reset circuit 50 , and a digital - to - analog converter 52 . the hardware module preferably comprises audio file playback , usb support , 3 - des decryption ( 192 bit encryption ), key management , and error management . the pc host software , mentioned above , includes a device driver for hardware usb interface , a dll software component for device management , and a v - basic program comprising usb download management , ftp transfer of the file from the website , a secure billing information handler , and website audio selection . the complete audio program menu ( apm ) of units ( apu &# 39 ; s ) or any number of pre - selected audio program units may be delivered to the user in any desired sequence or in a predetermined order in several technologically sophisticated ways . for example , as noted above , they can be downloaded from the internet , and stored in an audio module 42 . they can alternatively be stored in a data carrier / player , such as an mp3 player , owned and operated by the user , or from a static , remote , or portable personally carried device . another option is to deliver the program wirelessly from a digital player or from the internet to multiple players simultaneously via a private local area voice netwoar available only to those who wear headset devices capable of receiving the broadcast program . still another option is to deliver the programs wirelessly from an instructor speaking specifically to an individual or group of individuals during a training or new skill acquisition session . other optional features of the present invention include an ability , with appropriate sensors , to detect club head angle as the club head passes through the ball placement zone , and to convey a suitable message on the display screen 28 to the golfer regarding the detected angle . additionally , sensors may be employed which enable the golfer to know , via appropriate display , how far behind the ball the club head struck the ground , to encourage striking down on the ball , rather than hitting the ball fat . in the event that a user wishes to use the inventive unit without actually striking a ball ( indoors , for example ), an optional feature is an actuator which the user can initiate for simulating the detection of a ball in the ball placement zone to initiate operation of the device . while the aforementioned inventive systems and methods are disclosed , in presently preferred embodiments , as being related to the sport of golf , it will be appreciated by those skilled in the art that the inventive concepts taught herein are equally applicable , with suitable adaptation , to any number of other sports , such as , for example , tennis , baseball , basketball , squash , skiing , and many others . accordingly , although exemplary embodiments of the invention have been shown and described , it is to be understood that all the terms used herein are descriptive rather than limiting , and that many changes , modifications , and substitutions may be made by one having ordinary skill in the art without departing from the spirit and scope of the invention .

US-84438910-A

a lavage solution for intestinal tract which is easily applied in a treatment conducted prior to endoscopy of the intestines , surgery of the intestines and the like and hardly generates foam upon actual use and is stable as a pharmaceutical preparation is disclosed . the lavage solution for intestinal tract is an emulsified liquid mainly consisting of water - soluble high - molecular compound and electrolyte and an antifoaming agent of a silicone type .

appropriate examples of the water - soluble high - molecular weight compound which is one of the main components of the lavage solution according to the present invention are polyethylene glycol , dextran , dextrin , hydroxyethyl starch , polydextrose , gum arabic , pullulan , pectin and carboxymethyl cellulose . polyethylene glycol is particularly preferred . the electrolyte which is another main component of the lavage solution according to the present invention can be any electrolyte that is suitable for administration to humans . examples of the electrolyte are sodium sulfate , potassium chloride , sodium chloride and sodium bicarbonate . as a result of the addition of an si - containing antifoaming agent , the lavage solution according to the present invention hardly generates foam . the si - containing antifoaming agent used in the present invention is a so - called silicone - type antifoairing agent that is known as a pharmaceutical additive or as a food additive and can be appropriately selected from silicone resin and silicone oil . among them , dimethyl polysiloxane is particularly preferred . it is preferred that the antifoaming agent is contained in the lavage solution in an amount of 0 . 2 - 400 mg / liter . in the lavage solution according to the present invention , it is preferred that the amounts of water - soluble high - molecular weight compound and the ions of the electrolyte are selected from the following compositional ranges . ______________________________________water - soluble high - molecular weight compound 10 - 160 g / liter na . sup .+ 30 - 150 meq / liter k . sup .+ 3 - 20 meq / liter cl . sup .- 20 - 70 meq / liter hco . sup . 3 - 10 - 30 meq / liter so . sub . 4 . sup . 2 - 0 - 100 meq / liter______________________________________ incidentally , the lavage solution according to the present invention may be appropriately compounded with sweeteners such as sodium salt of saccharine , perfumes such as fruit essence and the like for improving the drinkability thereof . the lavage solution according to the present invention may be prepared , for example , in a liquid form as follows . the si - containing antifoaming agent is added to the water - soluble high - molecular weight compound and the electrolyte in an amount within the above - mentioned ranges , and mixed well with an amount of water which is sufficient to make a total volume of , for example , one liter together with other additives , if necessary . it is also possible to use the lavage solution according to the present invention by dissolving a dosage form such as a powder , granules and fine granules upon practical use . in order to illustrate the present invention , methods of preparing the lavage solution according to the present invention will be described in the following examples . then a test example for showing the effects and an acute toxicity test example of the lavage solution according to the present invention will be described as well . dimethyl polysiloxane ( 14 mg ) was added to a powdery composition consisting of 118 g of polyethylene glycol 4000 powder ( polyethylene glycol powder having a molecular weight of 4000 ), 2 . 93 g of sodium chloride , 1 . 485 g of potassium chloride , 3 . 37 g of sodium bicarbonate and 11 . 37 g of sodium sulfate and the composition was well mixed to prepare a cleaning composition for the intestinal tract in the form of a powder . then said cleaning composition for the intestinal tract in powder form was placed in a two - liter bottle , an appropriate amount of water was added thereto , the mixture was well shaken to dissolve the composition completely and additional water was added to make a total volume of two liters whereupon an emulsified liquid agent ( i . e ., lavage solution according to the present invention ) for one administration was prepared . dimethyl polysiloxane ( 14 mg ) was added to 118 g of polyethylene glycol 4000 powder and the composition was well mixed . then , to the mixture were added 2 . 93 g of sodium chloride , 1 . 485 g of potassium chloride , 3 . 37 g of sodium bicarbonate and 11 . 37 g of sodium sulfate to prepare a cleaning composition for the intestinal tract in powder form . this cleaning composition for the intestinal tract in powder form was subjected to the same treatment as in example 1 to prepare an emulsified liquid agent for one administration . dimethyl polysiloxane ( 14 mg ) was added to a powdery composition consisting of 2 . 93 g of sodium chloride , 1 . 485 g of potassium chloride , 3 . 37 g of sodium bicarbonate and 11 . 37 g of sodium sulfate and the mixture was mixed well . then 118 g of polyethylene glycol 4000 powder was added thereto to prepare a cleaning composition for the intestinal tract in powder form . this cleaning composition for the intestinal tract in powder form was subjected to the same treatment as in example 1 to prepare an emulsified liquid agent for one administration . a powdery composition consisting of 118 g of polyethylene glycol 4000 powder , 2 . 93 g of sodium chloride , 1 . 485 g of potassium chloride , 3 . 37 g of sodium bicarbonate and 11 . 37 g of sodium sulfate was placed in a two - liter bottle , an appropriate amount of water was added thereto followed by shaking so that the powdery composition was completely dissolved therein and additional water was added thereto to make a total volume of two liters . to this solution was added 14 mg of dimethyl polysiloxane followed by mixing by means of shaking . however , it was not easy to prepare a stable emulsified liquid agent in which dimethyl polysiloxane was dispersed . each of 40 ml of an emulsified liquid agent of a cleaning composition for the intestinal tract prepared in the same manner as in example 1 ( amount of dimethyl polysiloxane added : 10 , 25 , 50 , 95 , 190 , 380 and 750 mg ) or a commercially available lavage solution for the intestinal tract ( prepared by dissolving a powdery composition consisting of 118 g of polyethylene glycol 4000 powder , 2 . 93 g of sodium chloride , 1 . 485 g of potassium chloride , 3 . 37 g of sodium bicarbonate and 11 . 37 g of sodium sulfate in water to make two liters ; i . e ., a comparative solution ) was charged in a 100 - ml measuring cylinder equipped with a ground stopper . to each of these reagents was added 10 ml of a foaming medium containing 0 . 25 w / v % of hydroxyethyl cellulose and 0 . 01 w / v % of sodium lauryl sulfate . the measuring cylinder was stoppered and shaken 20 times to generate foam . the measuring cylinder was allowed to stand for 15 seconds and the volume of the foam that remained on the liquid surface was measured . the test was repeated 10 times with each solution . the results are shown in fig1 . it will be apparent from fig1 that the lavage solution according to the present invention significantly reduced the generation of foam as compared with the comparative solution . in fig1 the plots are average values and the mark means **&# 34 ; p & lt ; 0 . 01 &# 34 ; as compared with the comparative group . each of 0 . 4 ml of an emulsified liquid agent prepared in the same manner as in example 1 from a cleaning composition for the intestinal tract ( amount of dimethyl polysiloxane added : 0 . 14 , 0 . 42 , 1 . 4 , 4 . 2 , 14 and 42 mg ), a commercially available lavage solution for intestinal tract which was the same as that in test example 1 ( a comparative solution ) or water ( a control ) was placed in a test tube and mixed with 0 . 4 ml of 1 % bsa solution prepared by dissolving bovine serum albumin manufactured by sigma in a physiological saline solution to an extent of 1 w / v %. air was introduced at the rate of 3 . 3 ml / minute for 60 seconds from a polyethylene tube using an infusion pump ( manufactured by nipuro ) to generate foam and the height ( mm ) from the liquid surface to the top end of the foam was measured . the test was repeated 5 times with each solution . the results are shown in fig2 . it is apparent from fig2 that the lavage solution according to the present invention significantly reduced foam generation as compared with the comparative group and the control group . in fig2 the plots are average values , the mark ** means &# 34 ; p & lt ; 0 . 01 &# 34 ; as compared with the comparative group and the mark ## means &# 34 ; p & lt ; 0 . 01 &# 34 ; as compared with the control group . each of an emulsified liquid agent prepared in the same manner as in example 1 from the cleaning composition for the intestinal tract ( adding amount of dimethyl polysiloxane : 412 . 37 mg / liter ) and a commercially available lavage solution for the intestinal tract which was the same as that in test example 1 was orally administered to male sd strain rats ( six weeks age ) at a dose of 20 ml / kg every 30 minutes for four times . after the administration , the general state of the rats was observed every one hour and , from the next day , once daily for 14 days . in addition , body weight was checked on the day of the administration and on the first , third , seventh and fourteenth days from the administration . therefor -- each test group consisted of 5 rats . results of the body weight measurements are given in fig3 . in both groups , a diarrhea symptom was noted in all cases after 3 ˜ 5 hours from the administration but this symptom recovered on the next day of the administration and , until the 14th day after that , no abnormal observation was noted . the diarrhea symptom which was noted in all of the cases in both groups was due to a pharmacological effect and it is unlikely that there was a toxic action . as is apparent from fig3 there was no significant difference between the body weight therefor gain between the groups . accordingly , there is no difference in terms of toxicity between the lavage solution prepared in the acute toxicity test example of the present invention and that which is commercially available . the lavage solution for intestinal tract according to the present invention is capable of significantly reducing foam generation as compared with commercially available products and is extremely useful for observation and measurement of the intestines after cleaning the intestinal tract .

US-14849298-A

a computer display system for real time display of digital movie frames , derived from 24 bit , bit mapped graphic images formed of pixels and 32 bit floating point z values , and sprites which can interact with the movie frames . the system displays movies comprised of a compressed image frame , and a value limited , posterized , and compressed z frame . the incorporation of the novel z frame allows for 24 different levels of interactive , real time clipping of the sprites with the background image frame . the apparatus of an image frame associated with the z frame can also allow for two separate movies comprised of image frames and z frames to be superimposed with precedence clipping between the two independent movies in real time .

referring now to the drawings in which like reference characters designate like or corresponding parts throughout the several views , there is shown in fig1 a map of a three dimensional virtual environment . defining such a map is the first step in constructing a three dimensional virtual environment . the purpose of the a map is to define those areas within the virtual environment onto which the character can move , and those areas onto which the character is not allowed to move . the map is constructed of an array of blocks 10 . the shaded blocks 30 represent areas on the map on which there can be no character movement , and the open blocks 10 represent areas on the map on which there can be movement . in a common application , the shaded blocks 30 represent buildings , and the open blocks 10 represent streets and alleys , or other open areas between the buildings . in this example the map is a grid that is ten blocks long and ten blocks wide . it will be appreciated that this is for representative purposes only , and that an actual map , while it could be of any size , would probably be considerably larger . once the map of the environment is laid out , artists create the facade for each visible side of each building . this is done using software specifically created for such work , such as soft image , alias , or wave front . while any computer platform could be used to create these images , a silicon graphics indigo extreme is used in the preferred embodiment . next the building facades are placed on the map , and a three dimensional virtual environment is created from the two dimensional depictions . lighting is added to the model , and texture is added to such things as the ground and sky . after the model has been created , a virtual camera is driven through the model , taking pictures of every possible view along the way . while the term camera is used throughout this discussion , it will be appreciated that there is no camera used in a real sense , but the virtual camera is a series of software routines running on the graphics workstation , that creates a graphic image based on the computer model which has been created . before taking the pictures , a step size , or in other words a minimum resolution of movement in the z axis , must be determined . the step size determines how many steps are taken , and hence how many images of the model are displayed , when moving between the center points 20 of two adjacent blocks 10 . any number from one step upwards can be used . use of just a single step , however , would make movement from one block 10 to the next very jerky . while the motion from one block 10 to the next becomes smoother as the number of steps used increases , this also increases the number of image frames that must be displayed by the system , and likewise which must be stored , and also decreases the amount of time in which the movie frames must be cycled , or the motion will appear to slow down commensurately . in the preferred embodiment the minimum resolution of movement in the z axis is one - quarter block , or four steps per block . as depicted in fig2 this means that four images need to be created , in addition to the current view a - a &# 39 ;, to depict movement from one block 10 to the next adjacent block 10 . this movement is represented in fig2 by successively displaying views a - a &# 39 ; through e - e &# 39 ; in such a manner as to give the appearance of motion . not only must movement from one block 10 to the next be accounted for , but images representing a turn from a view along one side of the block 10 to an adjacent side of the same block 10 must be generated for each open block 10 in the environment model , as depicted in fig3 . while the step size , or rotation increment , for this motion could again be any number , four different views are used in the preferred embodiment , in addition to the current view a - a &# 39 ;, to represent a ninety degree rotation within a block 10 . this movement is represented in fig3 by successively displaying views a - a &# 39 ; through e - e &# 39 ; in such a manner as to give the appearance of rotation . once the above decisions are made , and the information is programmed into the graphics workstation , the virtual camera is driven through the model , taking pictures at every step and every rotation possible within each open block 10 . when the camera sees a view , such as that depicted in fig4 it can see along as many blocks 10 as have been created along that axis of the map . by definition , the depth of an image is along the z axis . of course , all of this information is not required because , just as with normal sight , blocks 10 that are too far away in the model cannot be seen by an operator when depicted on a screen , even if the computer can see them , because the detail would be too small . for this reason , and to save the time required to render an image of the model with such detail , and to save the data space associated with this unnecessary information , the camera is told to only record a certain number of blocks 10 , and to ignore all of the other blocks 10 in the line of sight past that . in the preferred embodiment the camera can see a total distance of six blocks 10 . however , since the picture is being taken from the center point 20 of a block 10 , a length of six blocks 10 extends to the center point 20 of the seventh block 10 . as the camera creates an image , it starts by drawing those elements found in the first block 10 , then the second block 10 , then the third , and so on . of course , some of the elements drawn from the first block 10 will mask , or overwrite , some of those elements in the subsequent blocks 10 if proper perspective is preserved . this is analogous to a building that is closer to us hiding part of another building that is farther away . in addition , some of the elements of each block 10 will logically mask some of the other elements of the same block 10 , which masking must be preserved in the recorded image if the image is to be a realistic perspective rendering of a three dimensional view . the camera does this by associating a z value to each pixel that is to be recorded in the image . the z value for each pixel is created by the rendering software . at the time when the elements of the virtual environment are modeled , they do not exist merely as bit mapped , two dimensional images , but as mathematical models . every point on a curve or line , and every point on a surface that covers the element defining lines , has been calculated and positioned by the modeling software . because this is done in a virtual three dimensional environment , the rendering software is able to use the modelling equations to determine the distance between any two points in the environment . a z value is a measure of the distance between a given pixel and the virtual camera location . all pixels in the blank image with which the camera starts are assigned an arbitrarily large value , representing a back plane which any other pixel brought in as a part of the image can overwrite . all the z values for each pixel brought into the image are kept in a data structure called a z buffer . as each pixel of each element in the model is brought into the image by the camera , the z value associated with that pixel is compared to the z value in the z buffer for the pixel that is already in that position in the image . if the z value for the new pixel is less than the z value for the pixel already in that position , it means that the new pixel is logically closer than the old pixel , and so the old pixel should not be seen behind the new pixel . the new pixel is drawn into the image , overwriting the old pixel , and the z value for the new pixel is placed in the associated position in the z buffer , overwriting the z value for the old pixel . if the new pixel brought into the image by the camera has a z value that is greater than the z value for the old pixel that is already in that position in the image , it means that the old pixel is logically in front of the new pixel , and thus the new pixel should not be visible in front of the old pixel . thus the new pixel and its z value are discarded , and the old pixel is left visible in the image , and the z value for the old pixel is left intact in the z buffer . for the first pixel brought into the image , the z value associated with the pixel will definitely be less than the arbitrarily large z value assigned all the starting pixels of the back plane present in the starting image , and so the first pixel will overwrite the back plane pixel in the corresponding location , and the z value for the first pixel will overwrite the arbitrarily large z value in the z buffer corresponding to that location . this procedure will proceed for every pixel of every element of each block 10 in the virtual environment that is to be brought into the image . when this process is complete , there will be a perfect perspective image present in the image buffer used by the camera to assemble the image , and a complete z buffer filled with z values . for every single pixel of the image present in the image buffer , there will be a corresponding z value in the z buffer , which is a measure of the depth of that particular pixel in the image . the pixels in a bit mapped image produced by such a process are represented by 24 bits of color data . the z values are represented by 32 bits of depth data . the purpose of this rendering process is to produce an image in the image buffer for subsequent use . fig5 depicts one such grayscale image , showing the perspective nature of the image . fig6 is a representation of the z buffer for the image of fig5 using shades of gray to depict the z value for each pixel in the image . in this example , used for explanatory purposes only , larger z values , representing pixels with a greater depth , are depicted in darker shades of gray , and smaller z values , representing pixels with smaller depth , are depicted in lighter shades of gray . in the preferred embodiment 24 bits of color data is greater than what is required , or even usable by many systems , and so instead of using the more than 16 million colors which this represents in the image , 256 colors are used instead , which can be represented by 8 bits . this reduces the size of a typical image from about 400 kilobytes in size to about one third of that size . not only does this make the image easier to store because of the reduced storage requirements , but it decreases the amount of time necessary to subsequently display the image , because the computer has only one third of the data to move from the storage device to the display device . in the preferred embodiment the image will also be compressed . according to the present invention , the z values in the z buffer are used to provide depth information about the image that will later be used in interacting sprites with the image . however , the z buffer holds more data than is used in the preferred embodiment . as each z value is represented by 32 bits , a typical z buffer may be approximately 0 . 5 megabytes in size . there are two main reasons why this data is not used in its entirety in the preferred embodiment , both relating to the size the z buffer . first , since the image itself was reduced to approximately 130 kilobytes before compression , the z buffer , if it is used in its entirety , represents an overhead four times the size of the actual image . this is large given the number of images usually required to produce a movie , and the storage space usually available . second , and again because of the size of the z buffer , any use of the z values in their entirety would use considerable processor time , with a resultant decrease in the speed at which images could be displayed , given a particular processor and processor speed . however , in a preferred embodiment according to the present invention , the z values in the z buffer are used to create new z values that can be stored in less memory , do not have a large overhead penalty , and may be used more quickly than the original z values . according to the present invention , the z values in the z buffer are first depth limited . this requires that any z value greater than a first constant be set to equal the first constant . in the preferred embodiment , this constant is determined by the product of a first and a second predetermined value . the first predetermined value is 256 in the preferred embodiment . the value of 256 is chosen because , when working with the image rendered on the silicon graphics workstation of the preferred embodiment , use of this value makes tracking position locations within the image easier for purposes which are not directly related to the disclosure of this invention . thus , any z value in the z buffer greater than 1 , 536 is set to equal 1 , 536 . this results in a z buffer containing values ranging from as small as zero to as great as 1 , 536 . this is still more information than is required , and so the z buffer is posterized . during posterization , the z values in the z buffer , which may now range nearly contiguously from zero to 1 , 536 , will be stratified into a smaller number of discrete levels . in the preferred embodiment , this will be done by dividing each z value by a second constant , and then rounding off the resultant number to the nearest whole number , which can be represented by 8 bits . the second constant is determined by dividing a third predetermined value by a fourth predetermined value . again in the preferred embodiment , the third predetermined value is chosen to be 256 , for the same reasons for choosing that value for the first predetermined value , as outlined above . the fourth predetermined value is chosen to be four , because this is the number of steps that was chosen in moving from one block 10 to another , or in other words is the minimum resolution of movement in the z axis as expressed in steps per block . in the preferred embodiment the fourth predetermined number is not chosen to be less than the number of steps . it should be appreciated that the values chosen in the above examples , of 256 , 6 , 256 , and 4 , are not required by the present invention , and that any value could be used in the calculations , depending on the particular requirements of the resultant data structure . thus , by depth limiting and posterizing the z values , the z buffer has decreased in size from 0 . 5 megabytes to something just over 130 kilobytes , for a savings of 75 %. in fig7 there is depicted a gray scale representation of the depth limited , posterized z buffer . when compared to the continuously graded representation of the z buffer in fig6 the distinct depth levels of a depth limited , posterized z buffer represented in fig7 are easily discerned . the z values in the resultant z buffer of the preferred embodiment will now range from 1 to 24 . this is exactly how many steps are present in each image taken by the camera , as seen in fig4 remembering that each image will see a total of six blocks , and that there are four steps within each block . from the above discussion it is observed that the z depth of every image in a movie is twenty - four steps , and the z value of every sprite is a whole number from one to twenty - four . thus the z depth resolution of the movie and the sprite are equal to each other , and equal to a single step . when motion begins , it is synchronized with the z depth of view , and each step is taken at precisely the minimum resolution of the z depth in the movie and the sprite . in the preferred embodiment , the z buffer will be further reduced in size by using run length encoding on a row by row basis . because the only valid numbers for the z values are those from 1 to 24 , many of the z values in a row will be the exact same number as the value in the position either immediately before it or immediately after it in the row . thus the z values in a row can be represented by the actual number , followed by the number of subsequent z values in that row that have the same value . by using run length encoding on the z buffer , its size can typically be further reduced from something just over 130 kilobytes , to something in the neighborhood of 10 kilobytes , for a total size reduction of about 98 %. this represents an overhead for each image , in an uncompressed form , of just under 10 %, which does not significantly impact performance . each of the images generated by the virtual camera are placed in compressed form in a data structure called an image frame . the z values in their depth limited , posterized , and compressed form are placed into a z frame . added to the beginning of the z frame is an index header , that gives the location in the z frame for the start of the z values for each row of the image frame . the image frame and its associated z frame are put into a single data structure called a movie frame . all of the movie frames required to depict the movement from the center point 20 of an open block 10 to the center point 20 of an adjacent block 10 are placed in a single data structure called a movie . similarly , all of the movie frames required to depict a 90 ° rotation about the center point 20 of an open block 10 are also placed in a single movie data structure . as shown in fig2 even though the step size and rotation increment have been set at four , in the preferred embodiment , five images are used to depict a forward movement from one block to the next , or a 90 ° rotation . this is because a fully detailed image of the position prior to movement , represented by view a - a &# 39 ;, is included at the beginning of each movie . thus the second movie frame , represented by view b - b &# 39 ;, contains the image frame of the image at the first step , and the fifth movie frame , represented by view e - e &# 39 ;, contains the image frame of the image at the fourth and final step . fig3 shows , in a manner similar to that of fig2 the five views contained in a movie of a 90 ° rotation about a center point 20 . when finished , there will be hundreds , and typically even thousands , of movies representing movement from each center point 20 of each open block 10 , back and forth in each linear movement direction possible , and representing four 90 ° rotations in each direction about each center point 20 in the virtual environment . as depicted in fig8 at run time , when the operator presses a key representing to the system the command to play a movie 50 depicting a movement or rotation , the appropriate movie 50 is moved from the storage device to a memory location . the first movie frame 60 within the movie 50 is processed first . the image frame 70 is moved to an image buffer 80 in memory , and the associated z frame 90 is moved to a z buffer 100 in memory . in the image buffer 80 , the image frame 70 is manipulated . in the preferred embodiment the manipulation would include , in part , decompressing the compressed image frame 70 . after manipulation , the image frame 70 is moved to the display buffer 110 . it will be appreciated that throughout this discussion , the term &# 34 ; buffers &# 34 ; may refer to either discrete devices , or preferably to predetermined memory locations in ram in a computer . when data is &# 34 ; moved &# 34 ; or &# 34 ; transferred &# 34 ; from one location to another , it will be appreciated that it may be physically moved to another device , or preferably moved to a new location in ram , or pointers indicating the location of different data structures may be updated , or memory locations may be redefined . after the manipulated image frame 70 has been loaded into the display buffer 110 , the system determines which sprites 120 , if any , are to be displayed . according to a preferred embodiment of the present invention , the sprites 120 will represent other moving elements , such as a walking cowboy , within the virtual environment . in the preferred embodiment , the sprites are under program control . the sprites 120 to be displayed are loaded into a sprite buffer 130 . in the preferred embodiment , each sprite 120 has associated with it a single z value 140 that represents the entire sprite 120 . in other applications a sprite 120 could have numerous z values 140 associated with portions of the sprite 120 , or a single sprite 120 could be comprised of several contiguous sprites 120 , each having a different z value 140 associated with it . each individual pixel within the image frame 70 has a z value associated with it . the sprites 120 are sorted in descending order according to z value 140 . thus the sprite 120 with the highest z value 140 will be tested for display first . for each sprite 120 which has been identified for display , the system determines the location in the display buffer 110 where the sprite 120 is to be positioned . the sprites 120 identified for display may have been displayed with the image frame 70 that was in the display buffer 110 immediately proceeding the image frame 70 currently in the display buffer 110 . they may occupy the same location within the display buffer 110 as previously calculated , if they are standing still relative to the image frame 70 , or they may have a new location within the display buffer 110 if they are moving relative to the image frame 70 . similarly , the system may determine that with the loading of the current image frame 70 into the display buffer 110 , a new sprite 120 is now visible . this could be because the sprite 120 came into view during a rotation , or because forward movement brought the sprites 120 which had been outside of the six block depth of view within the six block depth of view . after a sprite 120 location is determined , the single z value 140 that represents the depth of every pixel in the sprite 120 will be compared to the compressed z values in the z buffer 100 that are associated with the pixels of the image frame 70 in the display buffer 110 that occupy the same positions as the pixels of the sprite 120 to be displayed . this will be done on a pixel by pixel basis . for example , the location in the display buffer 110 of the left most pixel in the top most row of the first sprite 120 to be displayed will be determined . the z value 140 for the sprite 120 will be compared against the z value in the z buffer 100 that is associated with the pixel of the image frame 70 in the display buffer 110 that is in the same position as that first sprite 120 pixel . if the z value 140 for the sprite 120 is less than the z value for the image frame 70 pixel , then that is an indication that the depth of the sprite 120 pixel is less than the depth of the image frame 70 pixel , and that the sprite 120 pixel should be visible from this perspective on top of the image frame 70 pixel , or in other words , that the sprite 120 pixel should clip the image frame 70 pixel . if this is the case , then the system will copy the sprite 120 pixel into the display buffer 110 , over - writing the pixel of the image frame 70 that had previously occupied that position . if , on the other hand , the z value 140 for the sprite 120 is greater than the z value in the z buffer 100 associated with the pixel of the image frame 70 located in that same position in the display buffer 110 , it is an indication that the depth of the sprite 120 pixel is greater than the depth of the image frame 70 pixel , and that the image frame 70 pixel should be visible from this perspective on top of the sprite 120 pixel , and the image frame 70 pixel will clip the sprite 120 pixel . thus , the image frame 70 pixel will be left in the display buffer 110 , and the sprite 120 pixel will be discarded . if the z value 140 for the sprite 120 is equal to the z value in the z buffer 100 associated with the pixel of the image frame 70 located in that same position in the display buffer 110 , it is an indication that the depth of the sprite 120 pixel is equal to the depth of the image frame 70 pixel , and in the preferred embodiment the image frame 70 pixel will clip the sprite 120 pixel . thus , the image frame 70 pixel will be left in the display buffer 110 , and the sprite 120 pixel will be discarded . this procedure continues for each pixel of each sprite 120 to be displayed in the display buffer 110 . the procedure progresses in a similar manner for all the subsequent sprites to be displayed . should there be a sprite already written into the display buffer in the position located for a new sprite , the new sprite will over write the old sprite . this is done based on the prior sorting of sprites by z value . therefore , it is already known that subsequently displayed sprites have clipping precedent over previously displayed sprites . since the image frame in the display buffer has twenty - four different depth levels as enumerated by the z values in the z buffer , it is possible for sprites to clip at twenty - four different levels . this means that a single sprite may be partially clipped by several different elements of the image frame , and at the same time , the sprite itself may partially clip several other elements of the image frame . this is illustrated by the image in fig9 showing a cowboy sprite 170 . as can be seen , the cowboy 170 clips several elements in the image , but is clipped itself by the post 180 . this is because those pixels of the cowboy 170 that can be seen have an associated z value that is less than the z values associated with those pixels of the image frame which are not visible behind the cowboy 170 . similarly , the z value for the cowboy 170 is greater than the z values associated with the pixels of the post 180 that is visible in front of the cowboy 170 . after all sprites 120 have either been written in to the display buffer 110 , or discarded , the display buffer 110 is displayed on a display 160 . as soon as this is accomplished , the process of transferring the next movie frame in the movie occurs , with the image frame being loaded into the image buffer , and the z frame being loaded into the z buffer . the image frame is again manipulated and moved into the display buffer , and sprites , either the same ones as displayed before , whether adjusted for movement or not , or new ones , are compared and added to the display buffer as appropriate . this cycle continues until all the movie frames of the movie called for by the operator instruction to the system have been displayed . if there has been no operator instruction to the system which correlates to a movement , either forward or rotational , then the image frame of the last movie frame of the last movie called for will remain in the display buffer and depicted on the display . however , the sprite interaction with the image frame will continue . for example , a cowboy may walk across the image frame . at a rate commensurate with the rate at which the image frames of a movie are depicted during a move , the last image frame moved to the image buffer will be moved to the display buffer , and the sprites will be clipped in as appropriate to support their motion . thus while apparently standing still upon a certain block 10 in the virtual environment , the sprites will appear to move about the scene depicted . still present will be the twenty - four different depth levels for clipping the sprites . a flow chart of this process is depicted in fig1 . for example , as a sprite is controlled to appear to move toward the foreground of the display , an increasingly larger sprite will be clipped into the display buffer , giving the appearance of an object that grows larger as it comes closer . during this movement process , the sprite may initially be clipped behind certain elements of the image frame that are logically closer , but as the forward movement of the sprite continues , the sprite may clip in front of some of those same image frame elements , indicating that the relative position of the sprite is now closer than that of some of the elements in the image frame , and yet still be clipped behind other elements in the image frame . although there is only a single data structure for each sprite , sprites can be scaled under program control to a size appropriate to maintain the perspective nature of the sprite within the image displayed . thus a sprite in the foreground of the display will be scaled to a larger size by the program than a sprite in the background of the display . the program will assign a z value to the scaled sprite commensurate with the degree of scaling . this z value is assigned before the clipping process between the sprite and the image frame begins . in this manner there is provided by a preferred embodiment of the present invention an ability for moving sprites to interact with either static or moving images depicting background scenes in a highly intricate manner not before achievable . as will be appreciated from the above discussion , the speed at which each of the individual steps of the loading , comparison , and display cycle can be accomplished is of utmost importance . if any one of the steps takes an undue length of time , there will be pauses in the display of the images . these pauses will destroy the effect of fluid motion in either a movie translation or rotation , or a sprite motion . thus throughout the process , everything that can reasonably be done to enhance the speed of the system is of great value . while the z values associated with the image frame were compressed to save storage space and reduce the amount of data needed to be transferred , there was found with the z frame compression a speed benefit if the z frame was left compressed during the comparison cycle , and not decompressed before use as traditional wisdom would dictate . during the process of comparison of the sprite z value to the z values of all underlying pixels in the display buffer , the system is aware of the current row of the image frame on which it is working . remembering that there is a header index of rows at the beginning of the z frame , when the system needs to compare the z values , it need only consult the header and can then immediately jump to the proper spot in the z frame for the current row . then , due to the compression afforded by the run length encoding , the system needs to only check a few values to determine the associated z value for the image frame , instead of scrolling across individually enumerated z values for each pixel in the image frame . in this manner both the step of decompressing the z frame , and the added steps of using uncompressed z values are saved . while preferred embodiments of the present invention have been described above , it will be appreciated by those of ordinary skill in the art that the invention is capable of numerous modifications , rearrangements and substitutions of parts without departing from the spirit of the invention .

US-33384794-A

outerwear that substantially protects the wearer from the elements during extended athletic activity events and is sufficiently inexpensive to be considered disposable , and a method for using the outerwear in such events wherein the events include a defined route , such method comprising distributing the outerwear to participants in the events , providing a plurality of containers along the event route , using the containers to collect the outerwear that is discarded by participants , and recycling the discarded outerwear . the outerwear is preferably made of a lightweight single layer of nonwoven microporous material , which is non - restricting , wind resistant , water repellant yet breathable , and provides sufficient protection under most conditions so as to eliminate a need for extra layers , and may include a first portion embodying a jacket and a second portion embodying pants wherein each portion may include one or more of the following : zippers , snaps , buttons , velcro or the like , perforations , and elastic members for gathering the material to provide a snug fit against the wearer . the outerwear can be marked with indicia to promote a particular athletic event or a product , service , or sponsor .

referring to fig1 , disposable outerwear 10 is shown , including jacket 14 and pants 18 . disposable outerwear 10 provides warmth , wind resistance , water repellency , low weight and breathability , among other things . in one exemplary embodiment , jacket 14 and pants 18 are preferred to be made from a material including fine , continuous fibers of 100 % high - density polyethylene that are randomly distributed and nondirectional . the material may be , for example , tyvek ® spunbonded olefin manufactured by e . i . du pont de nemours and company . however , the material is not to be restricted to tyvek ®, and other materials that possess the same or similar features and / or benefits of tyvek ® may also be used to make jacket 14 and pants 18 . the material may be virgin or recycled . however , jacket 14 and pants 18 are generally made with a single layer of recycled tyvek ® material to reduce the materials cost , and because only a single layer is typically required to provide the above - mentioned features and / or benefits in many applications . referring now to fig2 , jacket 14 is sized and shaped to cover a wearer &# 39 ; s upper body , and includes sleeves 30 , cuffs 34 , collar 22 , waist 42 and closure device 26 for fastening opposite sides of the jacket 14 . as shown , the closure device 26 takes the form of a zipper , however , other closure devices , such as buttons , snaps or velcro , may be used . zipper 26 is secured to opposite sides of the jacket 14 by sewing , gluing , welding , or other suitable method . however , when manufacturing jackets and pants from recycled tyvek ®, which is often in the form of used and discarded lab coats , there are often unwanted materials , such as buttons or snaps , or blemishes that must be removed . these unwanted portions of material are cut away using a serging machine , which simultaneously cuts and sews material . the serging process is an unusual way to sew in a zipper and is not customarily used for this purpose . therefore , a customized sewing foot was developed to accommodate the simultaneous cutting of unwanted fabric and the sewing in of the zipper 26 . the foot is used to guide the material past the cutting blade and sewing needle and made to fit according to the specific size of the zipper 26 . elastic waistline 42 is formed by stitching a conventional elastic member such as a rope , ribbon , or band along the bottom of jacket 14 . elastic waistline 42 provides a taper to jacket 14 and a snug yet comfortable fit against the waist of an individual wearing jacket 14 . in addition to providing a more stylish or esthetically pleasing appearance , the elastic waistline 42 snugly seals the bottom of jacket 14 against the individual , thereby minimizing billowing and unwanted airflow through the jacket 14 . the jacket 14 includes sleeves 30 having elastic wrist cuffs 34 at ends of sleeves 30 . elastic wrist cuffs 34 are formed by stitching a conventional elastic member such as a rope , ribbon , or band along the ends of sleeves 30 . elastic wrist cuffs 34 provide a taper to sleeves 30 and a snug yet comfortable fit against the wrists of an individual wearing jacket 14 . elastic wrist cuffs 34 also help prevent unwanted airflow through jacket 14 by sealing the open ends of sleeves 30 against the individual &# 39 ; s wrists . further , elastic wrist cuffs 34 help prevent unwanted moisture from entering jacket 14 through sleeves 30 . the elastic member of the waistline 42 may , in some constructions , have a different size , shape or elasticity than the elastic member of wrist cuffs 34 to provide a different fit at the waist as compared to the wrists . for example , wrist cuffs 34 may be less elastic than waistline 42 to provide a more comfortable and less restrictive feel to jacket 14 . alternatively , one or more of the foregoing elastic members may be omitted to provide a desired fit and price . for example , an individual may prefer to tuck the jacket into the pants . in this example , the elastic member of the waistline 42 is not necessary and may be omitted altogether , thereby reducing the cost of the outerwear 10 . as shown in fig3 , pants 18 , include a groin portion 50 and pair of leg portions 54 extending from the groin portion 50 . the groin portion 50 is secured to an individual &# 39 ; s waist by elastic waistline 58 . elastic waistline 58 is formed by affixing a conventional elastic member such as a rope , ribbon , or band along the open end of groin portion 50 . elastic waistline 58 provides a taper to the groin portion 50 and a snug yet comfortable fit against the waist of an individual wearing pants 18 . elastic waistline 58 also helps prevent unwanted airflow through pants 18 by sealing the open end of groin portion 50 against the individual &# 39 ; s waist . further , elastic waistline 58 helps prevent unwanted moisture such as precipitation from entering pants 18 through the groin portion 50 . the pants 18 may also include elastic ankle cuffs 66 formed in the bottom of leg portions 54 . elastic ankle cuffs 66 are formed by stitching conventional elastic members such as ropes , ribbons , or bands along the open ends of leg portions 54 . elastic ankle cuffs 66 provide a taper to leg portions 54 and a snug yet comfortable fit against the ankles of an individual wearing pants 18 . elastic ankle cuffs 66 also help prevent unwanted airflow through pants 18 by sealing the open ends of leg portions 54 against the individual &# 39 ; s ankles . further , elastic ankle cuffs 66 help prevent unwanted moisture from entering pants 18 through leg portions 54 . the elastic member of the waistline 58 may , in some constructions , be a different size , shape or elasticity than the elastic member of the ankle cuffs 66 to provide a different fit at the waist as compared to the ankles . for example , ankle cuffs 66 may be less elastic than waistline 58 to provide a more comfortable feel to pants 18 , or waistline 58 may be more elastic to prevent pants 18 from falling down during rigorous activity by an individual wearing pants 18 . the elastic ankle cuffs 66 may be omitted because some individuals prefer to have unrestrictive , open cuffs . furthermore , open cuffs advantageously allow a wearer to more easily remove the pants when wearing shoes . in addition , when the elastic ankle cuffs 66 are omitted , the leg portions 54 of the pants 18 may include markings disposed on the leg portions 54 to facilitate customization of the length of the leg portions 54 by the wearer . for example , the pants 18 may be produced with relatively long leg portions 54 and sold as “ one size fits most ”, and the markings may indicate typical pant lengths so the wearer may cut , roll , or otherwise shorten the leg portions 54 to achieve a desired fit . to further facilitate removal of the outerwear 10 , the jacket 14 and pants 18 may each include a quick removal means . the quick removal means may be embodied by any one or more of the various aforementioned closure devices 26 , or perforations . since the outerwear 10 is substantially tear resistant , the jacket 14 and pants 18 may be provided with one or more perforated portions so the wearer may rip or tear away the outerwear 10 for relatively quick and easy removal . this quick and easy removal is especially desirable in the case of pants 18 . removal of pants such as sweatpants and warm - up pants often requires that a runner stop from running , and either remove their shoes , or balance on one foot at a time to pull each leg out of the leg portions 54 . referring to fig3 , perforations 80 are provided along the sides of pants 18 to facilitate quick and easy tearaway removal . although the wearer may render the jacket 14 and / or pants 18 not - reusable by ripping , tearing , or otherwise destructively removing the outerwear 10 along perforations 80 , the outerwear 10 is replaceable at a relatively low cost . moreover , the destructively removed outerwear 10 may be discarded , collected or otherwise reclaimed , and recycled into outerwear 10 among other things . although the perforations 80 are shown along the sides of pants 18 , it is contemplated that perforations 80 may be disposed elsewhere on the outerwear 10 to provide the wearer with a means to customize the outerwear 10 . for example , one or more perforations 80 may encircle the sleeves 30 so that one or more lengths of the sleeves 30 may be removed to create a variable length short - sleeved or sleeveless jacket 14 . similarly , one or more perforations 80 may encircle the leg portions 54 so that one or more lengths of the leg portions 54 may be removed to create a variable length short - legged pants 18 ( e . g ., shorts ). in addition , venting perforations 80 may be disposed on portions of the outerwear 10 where improved ventilation may be advantageous ( e . g ., torso , armpits , etc .) if the wearer desires ventilation in any such areas , the corresponding venting perforations 80 may be ripped open . moreover , perforations 80 may be a suitable substitute for a closure device 26 such as the zipper shown in fig2 to reduce the cost of producing the outerwear 10 . furthermore , an inexpensive closure device 26 ( e . g ., snaps , velcro , etc .) may be used in combination with the foregoing perforations 80 to permit reclosure of the outerwear 10 after it is tom apart . the illustrated jacket 14 and pants 18 are contemplated for use as a disposable layer of outerwear for an individual participating in an athletic or sporting event or activity . for example , jacket 14 and pants 18 may be worn by an individual participating in an extended - length athletic activity such as a marathon . in other examples , jacket 14 and pants 18 are appropriate for cycling , climbing , hiking , cross - country skiing , sailing , boating and other physical activities . jacket 14 and pants 18 insulate the individual by keeping body heat in , while repelling water , deflecting wind , and keeping cold air out . jacket 14 and pants 18 are lightweight and microporous to allow perspiration from the individual &# 39 ; s body to evaporate and escape from jacket 14 and pants 18 . jacket 14 and pants 18 are also tear resistant and puncture resistant . they resist damage from contact with foreign objects that may be encountered during sporting events , such as tree branches , bushes , or the like . although jacket 14 and pants 18 offer some of the features and / or benefits found on more expensive , high - performance “ technical ” outerwear , jacket 14 and pants 18 are generally lighter weight than technical outerwear , and may be manufactured at a substantially reduced cost , especially when recycled material is used . as a result , jacket 14 and pants 18 may be sold at a price that permits them to be considered for one - time , disposable or expendable use . a runner in a marathon may purchase jacket 14 and pants 18 for one - time use during the marathon and discard select parts or all of jacket 14 and pants 18 during the marathon whenever the runner &# 39 ; s comfort needs change . although sufficiently inexpensive to be disposable , jacket 14 and pants 18 are durable enough to be washed and worn repeatedly , rather than disposing them after one - time use . discarded jackets 14 and pants 18 may thus be collected by the event organizers or others , and thereafter sent to the manufacturer to be redeemed for a salvage value and recycled for future use . due to the low price , many participants may choose to discard the jacket 14 and / or pant 18 relatively soon after the beginning of the event . however , the breathability and extremely low weight provide the participants with the options of wearing jacket 14 and / or pants 18 for longer periods of time , tying the jacket 14 and / or pants 18 around the participant &# 39 ; s waist , or otherwise carrying them along for the remaining duration of the event without substantially encumbering performance . in addition , the jacket 14 and pants 18 may each be compacted to a relatively small size . for example , the jacket 14 may be folded , rolled , or otherwise compacted upon itself and “ balled up ” within one of the sleeves 30 , similar to balling up a pair of socks . the additional advantage of compactibility provides a participant with the option of placing the outerwear 10 in a fanny pack or an included pouch , thereby making them available for future use , such as at the end of a race or other future events . the pouch ( not shown ) may include a zipper , fold - over flap , or the like to retain the outerwear 10 therein , and additionally , the pouch may advantageously include a lanyard , loop , hook , or the like to attach the pouch to the participant . for example , upon completion of an event , runners may become chilled and stiffen up when they are warming down and are no longer generating superfluous body heat . the compacted outerwear may be uncompacted from a fanny pack or pouch and worn to retain body heat . in another example , the outerwear 10 may be distributed to participants upon completing an event . during the event , a plurality of drop - off recycling containers may be disposed along the route to permit participants to discard parts or all of jacket 14 and pants 18 directly into the recycling containers rather than discarding them on the ground for event organizers or others to clean up afterwards . the outerwear 10 may be collected and recycled for reuse as disposable outerwear , among other things . in this way , the outerwear 10 may reduce event clean up costs and additionally may be kept out of the solid waste stream . the protective outerwear of the present invention may be manufactured for and marked with a logo , design , or other indicia relative to a particular sporting or promotional event , such as , for example , a marathon , half marathon , cycling event , or golf outing . it is known that event sponsors generally enjoy a positive effect on their images in the view of the event participants and a greater degree of loyalty . further , sponsors may enjoy increased sales of the sponsors &# 39 ; products and services on account of their association with the event . to that end , jacket 14 and pants 18 may include artwork and / or company logos ( e . g ., event sponsor logos ), or other indicia to serve as a promotional , marketing , or advertising medium . moreover , the aforementioned outerwear storage pouch may also be similarly or otherwise marked . preferred embodiments of this invention are described herein . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context .

US-3989308-A

an ultrasound imaging system includes a probe with a transducer array with at least one transducer element that transmits ultrasound signal and receives echo signals produced in response thereto . the system further includes a console with a controller that controls the at least one element to transmit the ultrasound signals and receive the echo signals , and an echo processor that processes the received echoes and generates images indicative thereof . the system further includes a user interface with at least one control for interacting with the console . the user interface includes at least one recessed physical feature that facilitates identifying , through sense of touch , an operation activated by the at least one control .

fig1 schematically illustrates an ultrasound ( us ) imaging system 102 . the system 102 includes a probe 104 with a one - dimensional ( 1d ) or two - dimensional ( 2d ) transducer array 106 with at least one transducer element 108 . suitable configurations include , but are not limited to , linear , curved ( e . g ., concave , convex , etc . ), circular , etc . the system 102 includes an ultrasound scanner console 110 that controls excitation of the probe 104 , receives and processes ultrasound data from the probe 104 , and generates images to display . the system 102 includes a user interface 112 with at least one control for interacting with the console 110 . as described in greater detail below , in one non - limiting instance , the user interface 122 includes at least one recessed physical feature that facilitates identifying , through sense of touch ( or haptics ), an operation activated by the at least one control . the system 102 includes at least one display region 114 that displays images generated by the console 110 . as described in greater detail below , in one non - limiting instance , the display region 124 includes a screen with a cover lens optically bonded thereto , which may improve image quality relative to a configuration in which the optical bonding is omitted . fig2 illustrates a top down view looking into an example of the user interface 122 . the illustrated user interface 122 includes a flat touch panel 202 , in which predetermined regions thereof evoke actions in response to being actuated by simple or multi - touch gestures of the screen with one or more fingers , a stylus , a glove , etc . suitable touchscreen panels includes , but are not limited to , resistive , projected capacitive , surface acoustic wave , infrared , optical , or piezoelectric . the touchscreen can be , but is not limited to , a screen ( e . g ., liquid crystal display ( lcd ), thin film transistor liquid crystal display ( tft lcd ), organic light - emitting diode ( oled ) etc .) with a cover lens ( e . g . made of glass ) optically bonded thereto , which may mitigate parallax relative to a configuration in which the optical bonding is omitted . the illustrated touch panel 202 further includes a plurality of touch sensitive controls 204 . in the illustrated example , the touch sensitive controls 204 include n sets of controls 206 1 , 206 2 , . . . , 206 n , collectively referred to herein as sets of controls 206 , where n is an integer equal to or greater than one . the first set of controls 206 1 includes m controls 208 1 , . . . , 208 m , ( collectively referred to as controls 208 ), where m is an integer equal to or greater than one . the second set of controls 206 2 includes l controls 210 1 , . . . , 210 l , ( collectively referred to as controls 210 ), where l is an integer equal to or greater than one . the third set of controls 206 n includes k controls 212 1 , . . . , 212 k , ( collectively referred to as controls 212 ), where k is an integer equal to or greater than one . as described herein , the user interface 122 includes at least one recessed physical feature that facilitates identifying , through sense of touch , an operation activated by the n sets of controls 206 1 , 206 2 , . . . , 206 n . with respect to fig2 , the user interface 122 includes a recessed physical feature in connection with each of the of touch sensitive controls 204 . this is shown in greater detail in fig3 and 5 respectively in connection with the n sets of controls 206 1 , 206 2 , . . . , 206 n . initially referring to fig3 , a cross sectional view of the touch panel 202 and the control 208 1 along line a - a of fig2 is illustrated . the touch panel 202 has a thickness 302 and a major surface 304 . the control 208 1 has a thickness 306 ( which is less than the thickness 302 of the touch panel 202 ), a flat recess surface 308 and a diameter 310 , and is located in a recess 312 in the major surface 304 . a transition surface 314 extends from the major surface 304 into the touch panel 202 to the flat recess surface 308 , forming the recess 312 . with the configuration of fig3 , the at least one recessed physical feature includes the transition surface 314 and the flat recess surface 308 . the transition surface 314 and the flat recess surface 308 facilitate identifying a location of the control 208 1 and the flat recess surface 308 identifies the control 208 1 . for example , in the illustrated embodiment , the transition surface 314 and the flat recess surface 308 facilitates identifying the control 208 1 as a touch pad area . as discussed herein , the touch pad area can be used to control a cursor displayed in the display region 124 , for example , cursor movement . turning to fig4 , a cross sectional view of the touch panel 202 and the control 210 1 along line b - b of fig2 is illustrated . again , the touch panel 202 has the thickness 302 and the major surface 304 . the control 210 1 includes a first recess 402 , which is located in the major surface 304 , and a second recess 404 , which is located in the first recess 402 . the first recess 402 has a first thickness 406 ( which is less than the thickness 302 of the touch panel 202 ), a first recess surface 408 , and a first protrusion 410 . the second recess 404 has a second thickness 412 ( which is less than the first thickness 406 of the first recess 402 ) and a second recess surface 414 . a first transition 416 extends from the major surface 304 into the touch panel 202 to the first recess surface 408 , forming the first recess 402 . the protrusion 410 is located in the first recess 402 , spaced apart from the first transition surfaces 416 by a non - zero distance . a second transition surface 418 extends from the first recess 402 further into the touch panel 202 to the second recess surface 414 , forming the second recess 404 . with the configuration of fig4 , the at least one recessed physical feature includes the first transition 416 and the protrusion 410 , which facilitate identifying a location of a first sub - control of the control 210 1 and , in particular , a rotary or other control , which is located in the first recess 402 , between the first transition 416 and the protrusion 410 . the rotary control is actuated by sliding an object on the first recess surface 408 . the at least one recessed physical feature further includes the second transition 418 , which facilitates identifying a location of a second sub - control of the control 210 1 and , in particular , a push button or other control , which is located in the second recess 404 , within the second transition 418 . the push button control is actuated by pushing down on the second recess surface 414 . the illustrated control 210 1 is a multi - function control . the illustrated control 210 1 includes two sub - controls ; however , in another embodiment , the control 210 1 includes more than two sub - controls . next at fig5 , a cross sectional view of the touch panel 202 and the control 212 1 along line c - c of fig2 is illustrated . again , the touch panel 202 has the thickness 302 and the major surface 304 . the control 212 1 includes a first recess 502 , which is located in the major surface 304 , and a second recess 504 , which is located in the first recess 502 . the first recess 502 has a first thickness 506 ( which is less than the thickness 302 of the touch panel 202 ) and a first recess surface 508 , and the second recess 504 has a second thickness 510 ( which is less than the first thickness 506 of the first recess 502 ) and a second recess surface 512 . a first transition 514 s extend from the major surface 304 into the touch panel 202 to the first recess surface 508 , forming the first recess 502 . a second transition surface 516 extends from the first recess 502 further into the touch panel 202 to the second recess surface 512 , forming the second recess 504 . with the configuration of fig5 , the at least one recessed physical feature includes the first transition 514 , the first recess surface 508 , the second transition 516 , and the second recess surface 512 of the second recess 504 , which facilitate identifying a location of the control 212 1 and , in particular , a push button or other control , which is located in the second recess 504 , within the second transition 516 . the push button control is actuated by pushing down on the second recess surface 512 . fig6 illustrates the top down view of fig2 , in which the n sets of controls 206 1 , 206 2 , . . . , 206 n are configured as discussed in connection with fig3 and 5 . however , it is to be appreciated that the sets of controls 206 1 , 206 2 , . . . , 206 n can include more or less controls and / or similar or different controls . furthermore , the illustrated geometry of the controls in non - limiting . for example , other shapes ( e . g ., elliptical , rectangular , etc .) and / or relative sizes are contemplated herein . moreover , the n sets of controls 206 1 , 206 2 , . . . , 206 n may include textured surfaces . for example , the rotary or other control of the sets of controls 206 2 may include roughness , which facilitates sliding a finger along the surface and mitigating having the finger stick to the surface . likewise , one of more of the other sets of controls 206 1 , 206 2 , . . . , 206 n may or may not have roughness . fig7 and 8 illustrate an example of the display region 114 of the console 110 and / or an example of the user interface 112 . the display region 114 includes a screen 704 with a cover lens 702 . the screen 704 and the cover lens 702 are coupled via an optical coupling 706 . the optical coupling 706 has a refractive index that substantially matches a refractive index of the screen 704 and the cover lens 702 . for example , wherein the refractive index of the screen 704 is approximately 1 . 5 and the refractive index of the cover lens 702 is approximately 1 . 5 , a suitable refractive index of the optical coupling 706 is 1 . 5 . the screen 704 can be a lcd , a tft - lcd , an oled , and / or other screen . the material 706 can be a liquid , a gas , a gel , a glue ( e . g ., silicon or other ), a laminate , a plastic , a foil , and / or other optical coupling with suitable optical properties , that is , for matching the refractive index of the screen 704 and / or cover lens 702 . as shown in fig7 , external light 708 traverses the cover lens 702 / optical coupling 706 interface 710 and the optical coupling 706 / the screen 704 interface 712 with no or substantially little reflection . as shown in fig8 , emitted light 802 from the screen 704 traverses the screen 704 / the optical coupling 706 interface 712 and the optical coupling 706 / the cover lens 702 interface 710 with no or substantially little reflection . as a result , features visually displayed on the screen 704 and under the cover lens 702 are seen by the user on the cover lens 702 over the actual location of the features visually displayed on the screen 704 . this is in contrast to a configuration in which the optical coupling 706 is omitted and air resides between the screen 704 and the cover lens 702 , where the features seen by the user on the cover lens 702 are shifted ( parallax ) from the actual location of the features visually displayed on the screen 704 . fig9 and 10 show embodiments in which the optical coupling 706 is omitted . in this embodiment , air 900 is located between the cover lens 702 and the screen 704 . as shown , external light 902 refracts at the cover lens 702 / air 900 interface 904 and off the air 900 / the screen 704 interface 906 . likewise , emitted light 1002 refracts at the screen 704 / air 900 interface 906 and at the air 900 / the cover lens interface 904 . fig1 illustrates a method in accordance with the embodiments disclosed herein . it is to be appreciated that the order of the following acts is provided for explanatory purposes and is not limiting . as such , one or more of the following acts may occur in a different order . furthermore , one or more of the following acts may be omitted and / or one or more additional acts may be added . at 1104 , a user interface is interfaced with the ultrasound console . as discussed herein , the user interface includes at least one control for interacting with the console , wherein the user interface includes at least one recessed physical feature that facilitates identifying , through sense of touch , an operation activated by the at least one control . at 1106 , a display region is interfaced with the ultrasound console . as discussed herein , the display region includes a screen , a cover lens and an optical coupling there between , wherein a refractive index of the optical coupling is approximately the same of a refractive index of the cover lens and a refractive index of the screen . at 1108 , a transducer probe is interfaced with the ultrasound console . at 1110 , the transducer probe is used to scan an object or subject under control of the console , wherein an operator of the system controls at least one operation via the user interface and generated images are displayed via the display region . the application has been described with reference to various embodiments . modifications and alterations will occur to others upon reading the application . it is intended that the invention be construed as including all such modifications and alterations , including insofar as they come within the scope of the appended claims and the equivalents thereof .

US-201313748653-A

the present invention relates to bis compounds and pharmaceutically acceptable salts thereof . the present invention also relates to pharmaceutical compositions comprising these compounds and to their use as a medicament for the treatment and / or prevention of a disease , disorder or condition in which modulation of microsomal prostaglandin e synthase - 1 activity is beneficial , such as pain , inflammation and cancer .

the definitions set forth in this application are intended to clarify terms used throughout this application . the term “ herein ” means the entire application . as used herein , the term “ c 1 - 4 - alkyl ”, used alone or as a suffix or prefix , is intended to include both branched and straight chain saturated aliphatic hydrocarbon groups having from 1 to 4 carbon atoms . examples of c 1 - 4 - alkyl include methyl , ethyl , n - propyl , i - propyl , n - butyl , i - butyl , sec - butyl and tert - butyl . as used herein , the term “ c 1 - 4 - alkoxy ”, used alone or as a suffix och prefix , refers to a c 1 - 4 - alkyl radical , which is attached to the remainder of the molecule through an oxygen atom . examples of c 1 - 4 - alkoxy include methoxy , ethoxy , n - propoxy , i - propoxy , n - butoxy , i - butoxy , sec - butoxy and tert - butoxy . as used herein , the term “ fluoro - c 1 - 4 - alkyl ”, used alone or as a suffix or prefix , is intended to include both branched and straight chain saturated aliphatic hydrocarbon groups , having at least one fluoro substituent and having from 1 to 4 carbon atoms . examples of fluoro - c 1 - 4 - alkyl include , but are not limited to , fluoromethyl , difluoromethyl , trifluoromethyl , 1 - fluoroethyl , difluoroethyl , trifluoroethyl , fluoropropyl , difluoropropyl , trifluoropropyl , fluorobutyl , difluorobutyl and trifluorobutyl . as used herein , the term “ c 3 - 7 - cycloalkyl ”, used alone or as suffix or prefix , denotes a cyclic saturated alkyl group having a ring size from 3 to 7 carbon atoms and includes cyclopropyl , cyclobutyl , cyclopentyl , cyclohexyl and cycloheptyl . as used herein , the term “ halogen ” or “ halo ”, used alone or as suffix or prefix , is intended to include bromine , chlorine , fluorine or iodine . as used herein , the term “ optional ” or “ optionally ” means that the subsequently described event or circumstance may but need not occur , and that the description includes instances where the event or circumstance occurs and instances where it does not . as used herein , “ pharmaceutically acceptable ” is employed herein to refer to those compounds , materials , compositions , and / or dosage forms which are , within the scope of sound medical judgment , suitable for use in contact with the tissues of human beings and animals without excessive toxicity , irritation , allergic response , or other problem or complication , commensurate with a reasonable benefit / risk ratio . as used herein , the phrase “ protecting group ” means temporary substituents protecting a potentially reactive functional group from undesired chemical transformations . examples of such protecting groups include esters of carboxylic acids , silyl ethers of alcohols , and acetals and ketals of aldehydes and ketones , respectively . the field of protecting group chemistry has been extensively reviewed ( see , e . g . jarowicki , k . ; kocienski , p . perkin trans . 1 , 2001 , issue 18 , p . 2109 ). as used herein , “ pharmaceutically acceptable salts ” refer to forms of the disclosed compounds , wherein the parent compound is modified by making acid or base salts thereof . examples of pharmaceutically acceptable salts include , but are not limited to , mineral or organic acid salts of basic residues such as amines ; alkali or organic salts of acidic residues , such as carboxylic acids ; and the like . the pharmaceutically acceptable salts include the conventional non - toxic salts or the quaternary ammonium salts of the parent compound formed , for example , from non - toxic inorganic or organic acids . such conventional non - toxic salts include those derived from inorganic acids such as hydrochloric acid . the pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods . generally , such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent , or in a mixture of the two ; generally , non - aqueous media like diethyl ether , ethyl acetate , ethanol , isopropanol , or acetonitrile are used . a variety of compounds in the present invention may exist in particular geometric or stereoisomeric forms . the present invention takes into account all such compounds , including tautomers , r - and s - enantiomers , diastereomers , ( d )- isomers , ( l )- isomers , the racemic mixtures thereof , and other mixtures thereof , as being covered within the scope of this invention . additional asymmetric carbon atoms may be present in a substituent such as an alkyl group . all such isomers , as well as mixtures thereof , are intended to be included in this invention . the compounds herein described may have asymmetric centers . compounds of the present invention containing an asymmetrically substituted atom may be isolated in optically active or racemic forms . it is well known in the art how to prepare optically active forms , such as by resolution of racemic forms , by synthesis from optically active starting materials , or synthesis using optically active reagents . when required , separation of the racemic material can be achieved by methods known in the art . all chiral , diastereomeric and racemic forms are intended , to be included in the scope of the invention , unless the specific stereochemistry or isomeric form is specifically indicated . as used herein , “ tautomer ” means other structural isomers that exist in equilibrium resulting from the migration of a hydrogen atom . for example , keto - enol tautomerism occurs where the resulting compound has the properties of both a ketone and an unsaturated alcohol . as used herein , the phrase “ compounds or pharmaceutically acceptable salts ” include hydrates and solvates thereof . compounds and salts described in this specification may be isotopically - labelled compounds ( or “ radio - labelled ”). in that instance , one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number typically found in nature ( i . e ., naturally occurring ). examples of suitable isotopes that may be incorporated include 2 h ( also written as “ d ” for deuterium ), 3 h ( also written as “ t ” for tritium ), 11 c , 13 c , 14 c , 13 n , 15 n , 15 o , 17 o , 18 o , 18 f , 35 s , 36 cl , 82 br , 75 br , 76 br , 77 br , 123 i , 124 i , 125 i and 131 i . the radionuclide that is used will depend on the specific application of that radio - labelled derivative . for example , for in vitro receptor labelling and competition assays , compounds that incorporate 3 h or 14 c are often useful . for radio - imaging applications 11 c or 18 f are often useful . in some embodiments , the radionuclide is 3 h . in some embodiments , the radionuclide is 14 c . in some embodiments , the radionuclide is 11 c . and in some embodiments , the radionuclide is 18 f . compounds of the present invention may be administered orally , parenteral , buccal , vaginal , rectal , inhalation , insufflation , sublingually , intramuscularly , subcutaneously , topically , intranasally , intraperitoneally , intrathoracically , intravenously , epidurally , intrathecally , intracerebroventricularly and by injection into the joints . the optimum dosage and frequency of administration will depend on the particular condition being treated and its severity ; the age , sex , size and weight , diet , and general physical condition of the particular patient ; other medication the patient may be taking ; the route of administration ; the formulation ; and various other factors known to physicians and others skilled in the art . the quantity of the compound to be administered will vary for the patient being treated and will vary from about 100 ng / kg of body weight to 100 mg / kg of body weight per day . for instance , dosages can be readily ascertained by those skilled in the art from this disclosure and the knowledge in the art . thus , the skilled artisan can readily determine the amount of compound and optional additives , vehicles , and / or carrier in compositions and to be administered in methods of the invention . for preparing pharmaceutical compositions from the compounds of this invention , inert , pharmaceutically acceptable carriers can be either solid or liquid . solid form preparations include powders , tablets , dispersible granules , capsules , cachets , and suppositories . a solid carrier can be one or more substances , which may also act as diluents , flavoring agents , solubilizers , lubricants , suspending agents , binders , or tablet disintegrating agents ; it can also be an encapsulating material . compounds of the present invention can be prepared as a free base or a pharmaceutically acceptable salt thereof by the processes described below . throughout the following description of such processes it is understood that , where appropriate , suitable protecting groups will be added to , and subsequently removed from the various reactants and intermediates in a manner that will be readily understood by one skilled in the art of organic synthesis . conventional procedures for using such protecting groups as well as examples of suitable protecting groups are for example described in protective groups in organic synthesis by t . w . greene , p . g . m wutz , 3 rd edition , wiley - interscience , new york , 1999 . all solvents used were of analytical grade and commercially available anhydrous solvents were routinely used for reactions . starting materials used were available from commercial sources , or prepared according to literature procedures . room temperature refers to 20 - 25 ° c . solvent mixture compositions are given as volume percentages or volume ratios . microwave heating was performed in a biotage creator , initiator or smith synthesizer single - mode microwave cavity producing continuous irradiation at 2450 mhz . it is understood that microwaves ( mw ) can be used for the heating of reaction mixtures . thin layer chromatography ( tlc ) was performed on merck tlc - plates ( silica gel 60 f 254 ) and spots were uv visualized . straight phase flash column chromatography (“ flash chromatography ”) was manually performed on merck silica gel 60 ( 0 . 040 - 0 . 063 mm ), or automatically using an isco combiflash ® companion ™ system using redisep ™ normal - phase flash columns using the solvent system indicated . phase separation was optionally performed on an isolute ® phase separator . nmr spectra were recorded on a 400 - 600 mhz nmr spectrometer fitted with a probe of suitable configuration . spectra were recorded at room temperature unless otherwise stated . chemical shifts are given in ppm down - and upfield from tms ( 0 . 00 ppm ). the following reference signals were used in 1 h - nmr : tms δ 0 . 00 , or the residual solvent signal of dmso - d 6 δ 2 . 49 , cd 3 od δ 3 . 30 , acetone - d 6 2 . 04 or cdcl 3 δ 7 . 25 ( unless otherwise indicated ). resonance multiplicities are denoted s , d , t , q , m , br and app for singlet , doublet , triplet , quartet , multiplet , broad and apparent , respectively . in some cases only diagnostic signals are reported . high pressure liquid chromatography ( hplc ) was performed on a reversed phase ( rp ) column . a linear gradient was applied using for example mobile phase a ( 10 mm nh 4 oac in 5 % ch 3 oh or 5 % ch 3 cn ( aq . ), or 0 . 1 % nh 3 ( aq .) or 0 . 1 % formic acid ( aq .)) and b ( ch 3 oh or ch 3 cn ). mass spectrometry ( ms ) analyses were performed in positive and / or negative ion mode using electrospray ionization ( esi +/−) and / or atmospheric pressure chemical ionization ( apci +/−). gas chromatography ( gc ) was performed on a gc equipped with a mass spectrometer ( ms ) or a flame ionization detector ( fid ). the ms ion source was either an electron impact ( ei ) or a chemical ionization ( ci , reactant gas methane ). for separation , a capillary column was used for example db - 5ms , ( j & amp ; w scientific ). a linear temperature gradient was applied . preparative chromatography was run on a waters fractionlynx system with an autosampler combined automated fraction collector ( waters 2767 ), gradient pump ( waters 2525 ), column switch ( waters cfo ) and pda ( waters 2996 ). column ; xbridge ® prep c8 10 μm obd ™ 19 × 300 mm , with guard column ; xterra ® prep ms c8 10 μm 19 × 10 mm cartridge . a gradient of a ( 95 % 0 . 1 m nh 4 oac in milliq water and 5 % mecn ) in b ( 100 % mecn ) or a gradient of a ( 95 % 0 . 1 m nh 4 oac in milliq water and 5 % meoh ), a ( 0 . 2 % nh 3 in milliq water ) or a ( 0 . 2 % formic acid in milliq water ) in b ( 100 % meoh ) was applied for lc - separation at flow rate 20 ml / min . preparative chiral chromatography for separation of isomers was run on for example an laprep ® system using the specified column and mobile phase system . supercritical fluid chromatography ( sfc ) was performed on a straight phase column . an isocratic flow was applied using mobile phase a ( co 2 ) and for example mobile phase b ( meoh , etoh or ipa ). high pressure liquid chromatography ( hplc ) was performed on a straight phase column . a linear gradient or isocratic flow was applied using for example mobile phase a ( heptane ) and b ( etoh or ipa ). for accurate mass measurements , hrms was performed on a waters synapt - g2 mass spectrometer equipped with a lockspray source and connected to an acquity uplc system with a pda detector and an acquity uplc beh c18 column . the measured mass confirmed the elemental composition within 3 ppm . compounds have been named using cambridgesoft medchem eln v2 . 2 or acd / name , version 10 . 0 , or 10 . 06 , or version 12 . 01 , software from advanced chemistry development , inc . ( acd / labs ), toronto on , canada , www . acdlabs . com , or lexichem , version 1 . 9 , software from openeye . tert - butylamine ( 5 . 0 ml , 47 . 58 mmol ) was added dropwise to a cooled ( 0 ° c .) solution of 2 - fluorobenzenesulfonyl chloride ( 2 . 50 ml , 18 . 88 mmol ) in dichloromethane ( 15 ml ) and the resulting mixture was stirred at 0 ° c . for 1 h and at room temperature for 1 h . water and ethyl acetate was added and the aqueous phase was extracted with ethyl acetate . the combined organic phases were washed with water and brine , dried over sodium sulfate and the solvent was evaporated , yielding the title compound ( 4 . 37 g , 100 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 11 ( s , 9h ), 7 . 34 - 7 . 38 ( m , 1h ), 7 . 38 - 7 . 43 ( m , 1h ), 7 . 64 - 7 . 70 ( m , 1h ), 7 . 77 ( br . s ., 1h ), 7 . 82 ( m , j = 7 . 60 , 7 . 60 , 1 . 70 hz , 1h ); ms ( es − ) m / z 230 [ m − h ] − . a mixture of n - tert - butyl - 2 - fluorobenzenesulfonamide ( 18 . 0438 g , 78 . 01 mmol ), methanesulfonamide ( intermediate 1 , 11 . 2341 g , 118 . 10 mmol ) and potassium carbonate ( 16 . 2806 g , 117 . 80 mmol ) in sulfolane ( 70 ml ) was heated at 150 ° c . over 72 h . water was added and the resulting solid was removed by filtration . the aqueous phase was neutralized ( ph ˜ 7 . 5 ) with hydrochloric acid ( 2 m ) and extracted with ethyl acetate . the organic phase was washed with water , water / brine ( 1 : 1 ) and brine , dried over magnesium sulfate and the solvent was evaporated . purification by chromatography on silica using gradient elution 60 % etoac in heptane ., yielded the title compound ( 17 . 22 g , 72 . 0 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 11 ( s , 9h ) 3 . 17 ( s , 3h ) 7 . 32 ( s , 1h ) 7 . 60 - 7 . 71 ( m , 2h ) 7 . 89 ( d , j = 7 . 88 hz , 1h ) 8 . 01 ( s , 1h ) 8 . 72 ( s , 1h ). tert - butyldimethylchlorosilane ( 1 . 426 ml , 7 . 66 mmol ) was added to a solution of 4 - chloro - 2 - hydroxybenzaldehyde ( 1 . 0 g , 6 . 39 mmol ) and imidazole ( 0 . 652 g , 9 . 58 mmol ) in dmf ( 15 ml ) at 0 ° c . the reaction mixture was allowed to reach room temperature and stirred over 72 h . the reaction mixture was concentrated and purification by chromatography on silica using 25 % etoac in heptane , yielded the title compound ( 1 . 1 g , 64 %); 1 h nmr ( 500 mhz , chloroform - d ) δ ppm 0 . 26 - 0 . 38 ( m , 6h ) 1 . 03 ( s , 10h ) 6 . 89 ( d , 1h ) 7 . 04 ( dd , 1h ) 7 . 76 ( d , 1h ) 10 . 39 ( s , 1h ). in a 500 ml round bottle was 2 -{[ tert - butyl ( dimethyl ) silyl ] oxy }- 4 - chlorobenzaldehyde ( 26 . 5 g , 97 . 85 mmol ) dissolved in anhydrous methanol ( 170 ml ) and the solution was cooled to − 20 ° c . with an acetone - dry ice bath . sodium borohydride ( 4 . 44 g , 117 . 42 mmol ) was added in small portions , keeping the temperature at − 20 . the mixture was stirred until it reached room temperature as the ice bath expired ( 2 h ). the reaction was quenched by the addition of a solution of saturated ammonium chloride . the volume was reduced to ⅓ by evaporating the solvent . the reaction mixture was partioned between ethyl acetate and brine , the aqueous layer was extracted once more with ethyl acetate . the combined organic extracts were washed with water , brine , dried over magnesium sulfate and the resulting liquid was dried at room temperature in vacuo to yield the title compound ( 24 . 9 g , 93 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 0 . 22 ( s , 6h ) 0 . 97 ( s , 9h ) 4 . 45 ( d , 2h ) 5 . 13 ( t , 1h ) 6 . 78 ( d , 1h ) 7 . 03 ( dd , 1h ) 7 . 38 ( d , 1h ) ( 2 -{[ tert - butyl ( dimethyl ) silyl ] oxy }- 4 - chlorophenyl ) methanol ( 3 . 72 g , 13 . 63 mmol ) dissolved in dmf ( 20 ml ) added dropwise under 30 min to a cooled 0 ° c . mixture of bromine ( 0 . 734 ml , 14 . 32 mmol ) (+ an extra drop to keep a persistent reddish tint to the solution ), and triphenylphosphine ( 3 . 75 g , 14 . 32 mmol ) in dmf ( 60 ml ), under argon atmosphere . water was added and the mixture was extracted with etoac . the organic phase was washed with 10 % aq na 2 s 2 o 2 solution , dried over mgso4 and concentrated . purification by chromatography on silica using gradient elution 20 % etoac in heptane + 0 . 5 % tea , yielded the title compound ( 4 . 4 g , %). 1 h nmr ( 500 mhz , chloroform - d ) δ ppm 0 . 31 - 0 . 35 ( m , 6h ) 1 . 04 - 1 . 11 ( m , 10h ) 4 . 45 - 4 . 52 ( m , 2h ) 6 . 78 - 6 . 85 ( m , 1h ) 6 . 90 - 6 . 96 ( m , 1h ) 7 . 23 - 7 . 30 ( m , 1h ). a solution of n - tert - butyl - 2 -[( methylsulfonyl ) amino ] benzenesulfonamide ( 4 . 56 g , 14 . 89 mmol ) was treated at − 78 ° c . with lithium diisopropylamide ( 23 . 83 ml , 47 . 66 mmol ). after 10 minutes a solution of [ 2 -( bromomethyl )- 5 - chlorophenoxy ]( tert - butyl ) dimethylsilane ( 5 . 0 g , 14 . 89 mmol ) in thf ( 4 ml ) was added dropwise under 1 h . the reaction mixture was stirred at − 78 ° c ., for 2 h . the reaction mixture was quenched with brine and ethyl acetate was added . the phases were separated and the organic layer was washed with brine , dried over magnesium sulfate , filtered and concentrated under reduced pressure . purification by chromatography on silica using gradient elution 12 - 25 % etoac in heptane to yield the title compound ( 5 . 4 g ). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 0 . 10 - 0 . 27 ( m , 6h ) 0 . 90 ( s , 9h ) 1 . 07 ( s , 9h ) 2 . 92 - 3 . 01 ( m , 2h ) 3 . 39 - 3 . 52 ( m , 2h ) 6 . 78 ( d , 1h ) 6 . 96 ( dd , 1h ) 7 . 19 ( d , 1h ) 7 . 31 ( t , 1h ) 7 . 54 - 7 . 64 ( m , 1h ) 7 . 64 - 7 . 70 ( m , 1h ) 7 . 88 ( d , 1h ) 7 . 99 ( s , 1h ) 8 . 77 ( s , 1h ); ms ( es − ) m / z 559 , 561 . 563 [ m − h ] − . tetrabutylammonium fluoride ( 1 . 0 m solution in thf ) ( 0 . 727 ml , 0 . 73 mmol ) was slowly added to a solution of n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl } amino ) benzenesulfonamide ( 0 . 340 g , 0 . 61 mmol ) in thf ( 10 ml ) at 0 ° c . the reaction mixture was stirred for 2 h at 0 ° c ., quenched by addition of sat . brine solution and extracted with ethylacetate . the organic layer was washed with sat . aq . nh4cl , dried over magnesium sulfate , filtered and concentrated . purification by chromatography on silica using gradient elution 30 - 50 % etoac in heptane yielded the title compound ( 0 . 192 g , 71 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 05 - 1 . 15 ( m , 11h ) 2 . 89 - 2 . 96 ( m , 2h ) 3 . 46 - 3 . 54 ( m , 2h ) 6 . 75 ( dd , 1h ) 6 . 77 ( d , 1h ) 7 . 08 ( d , 1h ) 7 . 30 ( t , 1h ) 7 . 55 - 7 . 65 ( m , 1h ) 7 . 65 - 7 . 73 ( m , 1h ) 7 . 89 ( d , 1h ) 8 . 02 ( s , 1h ) 8 . 78 ( s , 1h ) 10 . 04 ( s , 1h ); ms ( es − ) m / z 445 , 447 , 449 [ m − h ] − . methanesulfonyl chloride ( 0 . 184 ml , 2 . 38 mmol ) was added to a cold 0 ° c . solution of 2 -( 2 - hydroxyethyl ) benzonitrile ( 0 . 175 g , 1 . 19 mmol ) and triethylamine ( 0 . 380 ml , 2 . 73 mmol ) in dichloromethane ( 10 ml ) and the reaction mixture was stirred over night at room temperature . the reaction mixture was washed with water and sat aq na2co3 solution , dried over mgso4 and concentrated , to yield the title compound ( 0 . 327 g , 122 %). the title compound was used in the next step without further purification . 1 h nmr ( 500 mhz , chloroform - d ) δ ppm 2 . 98 ( s , 3h ) 3 . 31 ( t , 2h ) 4 . 51 ( t , 2h ) 7 . 38 - 7 . 46 ( m , 2h ) 7 . 59 ( td , 1h ) 7 . 69 ( dd , 1h ). methanesulfonyl chloride ( 0 . 208 ml , 2 . 69 mmol ) was added to a cold 0 ° c . solution of 2 -( 1 - methyl - 1h - indol - 4 - yl ) ethanol ( 0 . 236 g , 1 . 35 mmol ) and triethylamine ( 0 . 431 ml , 3 . 10 mmol ) in dichloromethane ( 10 ml ). the reaction mixture was allowed to reach room temperature and stirred for 3 h . the reaction mixture was washed with water and sat . aq . na 2 co 3 solution , dried over mgso4 and the solvent was removed under reduced pressure to yield the title compound ( 0 . 348 g ) ( 102 %), and used in the next step without further purification . 1 h nmr ( 500 mhz , chloroform - d ) δ ppm 2 . 75 ( s , 3h ) 3 . 36 ( t , 2h ) 3 . 81 ( s , 3h ) 4 . 55 ( t , 2h ) 6 . 51 - 6 . 56 ( m , 1h ) 6 . 99 ( d , 1h ) 7 . 10 ( d , 1h ) 7 . 15 - 7 . 22 ( m , 1h ) 7 . 24 - 7 . 27 ( m , 1h ). potassium carbonate ( 0 . 038 g , 0 . 28 mmol ) and ( 2 - bromoethyl ) benzene ( 0 . 021 ml , 0 . 15 mmol ) were added to a solution of n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl }- amino ) benzenesulfonamide ( 0 . 062 g , 0 . 14 mmol ) in dmf ( 5 ml ) at r . t . the reaction was stirred over night . additional ( 2 - bromoethyl ) benzene ( 0 . 021 ml , 0 . 15 mmol ) and potassium carbonate ( 0 . 042 g , 0 . 31 mmol ) was added and the reaction mixture was stirred for 5 days at r . t . another portion of ( 2 - bromoethyl ) benzene ( 0 . 120 ml , 0 . 14 mmol ) was added and the reaction mixture was stirred over night . heating of the reaction mixture at 50 ° c . over night , then heated at 90 ° c . for 5 h followed by cooling to room temperature . the product mixture was later pooled with a second batch , starting from potassium carbonate ( 0 . 088 g , 0 . 63 mmol ) and ( 2 - bromoethyl ) benzene ( 0 . 077 ml , 0 . 56 mmol ), which were added to a solution of n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl } amino ) benzenesulfonamide ( 0 . 063 g , 0 . 14 mmol ) in dmf ( 5 ml ) at r . t . the reaction was stirred at 50 ° over night , heated at 90 ° c . for 5 h then cooled to room temperature . the two batches were pooled , filtered through a plug of celite . the filtrate was washed with ethylacetate and concentrated under reduced pressure . purification by chromatography on silica using gradient elution 25 - 33 % etoac in heptane yielded the title compound ( 59 . 2 mg , 38 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 08 - 1 . 15 ( m , 10h ) 2 . 82 - 2 . 97 ( m , 4h ) 3 . 41 - 3 . 48 ( m , 2h ) 4 . 12 ( t , 2h ) 6 . 89 ( dd , 1h ) 7 . 00 ( d , 1h ) 7 . 13 ( d , 1h ) 7 . 17 - 7 . 22 ( m , 1h ) 7 . 24 - 7 . 33 ( m , 5h ) 7 . 57 - 7 . 64 ( m , 1h ) 7 . 64 - 7 . 71 ( m , 1h ) 7 . 89 ( dd , 1h ) 8 . 04 ( s , 1h ) 8 . 80 ( s , 1h ); ms ( es − ) m / z 549 , 551 , 553 [ m − h ] − . a microwave vial was charged with n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl )- ethyl ] sulfonyl } amino ) benzenesulfonamide ( 206 mg , 0 . 46 mmol ), cesium carbonate ( 300 mg , 0 . 92 mmol ), 2 - methoxyphenethyl bromide ( 0 . 146 ml , 0 . 92 mmol ) and n , n - dimethylformamide ( 3 ml ). the vial was capped and heated in the microwave oven at 110 ° c . for 30 min . more cesium carbonate ( 300 mg , 0 . 92 mmol ) and 2 - methoxyphenethyl bromide ( 0 . 146 ml , 0 . 92 mmol ) were added and the mixture was heated for 30 min at 110 ° c . using mw . water was added and the mixture was extracted twice with ethyl acetate . the combined organic extracts were washed with ½ saturated brine , brine , dried over magnesium sulfate , filtered and the solvent was evaporated . purification by preparative hplc gave the title compound ( 78 mg , 29 . 1 %); ms ( es − ) m / z 579 , 581 [ m − h ] − . a microwave vial was charged with n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ]- sulfonyl } amino ) benzenesulfonamide ( 203 mg , 0 . 45 mmol ), cesium carbonate ( 296 mg , 0 . 91 mmol ), 3 - methoxyphenethyl bromide ( 0 . 143 ml , 0 . 91 mmol ) and n , n - dimethylformamide ( 3 ml ). the vial was capped and heated using mw at 110 ° c . for 3 h . additional cesium carbonate ( 296 mg , 0 . 91 mmol ) was added and the mixture was heated for 2 h at 110 ° c . in the mw . an additional 2 eq of 3 - methoxyphenethyl bromide ( 0 . 143 ml , 0 . 91 mmol ) was added and the mixture was heated at 110 ° c . for 30 min . water was added and the mixture was extracted twice with ethyl acetate . the combined organic extracts were washed with ½ saturated brine , brine , dried over magnesium sulfate , filtered and the solvent was evaporated under reduced pressure . purification by preparative hplc gave the title compound ( 62 . 0 mg , 23 . 49 %); ms ( es − ) m / z 579 , 581 [ m − h ] − . n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl } amino ) benzenesulfonamide ( 0 . 451 g , 1 . 01 mmol ) and 4 - methoxyphenethyl methanesulfonate [ cas 73735 - 36 - 1 ] ( 0 . 325 g , 1 . 41 mmol ) was dissolved in acetonitrile ( 10 ml ) and potassium carbonate ( 0 . 195 g , 1 . 41 mmol ) was added . the mixture was stirred over night at 75 ° c . the solvent was evaporated , the crude diluted with etoac and the organic phase was washed with brine , dried over mgso4 and concentrated . purification by chromatography on silica using gradient elution 12 - 50 % etoac in heptane yielded the title compound ( 0 . 207 g , 35 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 10 ( s , 9h ) 2 . 80 ( t , 2h ) 2 . 87 - 2 . 98 ( m , 2h ) 3 . 40 - 3 . 51 ( m , 2h ) 3 . 65 - 3 . 75 ( m , 3h ) 4 . 07 ( t , 2h ) 6 . 77 - 6 . 86 ( m , 2h ) 6 . 88 ( dd , 1h ) 6 . 99 ( d , 1h ) 7 . 13 ( d , 1h ) 7 . 17 ( d , 2h ) 7 . 29 ( t , 1h ) 7 . 56 - 7 . 64 ( m , 1h ) 7 . 65 - 7 . 71 ( m , 1h ) 7 . 89 ( d , 1h ) 8 . 04 ( s , 1h ) 8 . 81 ( s , 1h ); ms ( es − ) m / z 579 , 581 , 583 [ m − h ] − . the title compound was prepared following the procedure for intermediate 13 above , starting from n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl } amino ) benzenesulfonamide ( 0 . 322 g , 0 . 72 mmol ) and 2 - cyanophenethyl methanesulfonate ( 0 . 325 g , 1 . 44 mmol ) in acetonitrile ( 10 ml ) and potassium carbonate ( 0 . 140 g , 1 . 01 mmol ). purification by chromatography on silica using gradient elution 12 - 50 % etoac in heptane yielded the title compound ( 0 . 039 g , 9 . 5 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 04 - 1 . 14 ( m , 9h ) 2 . 85 - 2 . 97 ( m , 2h ) 3 . 15 ( t , 2h ) 3 . 37 - 3 . 44 ( m , 2h ) 4 . 22 ( t , 2h ) 6 . 90 ( dd , 1h ) 7 . 03 - 7 . 07 ( m , 1h ) 7 . 13 ( s , 1h ) 7 . 25 - 7 . 34 ( m , 1h ) 7 . 42 ( td , 1h ) 7 . 55 ( d , 1h ) 7 . 58 - 7 . 66 ( m , 3h ) 7 . 79 ( dd , 1h ) 7 . 88 ( d , 1h ) 8 . 02 ( s , 1h ) 8 . 78 ( s , 1h ); ms ( es − ) m / z 547 , 576 , 578 [ m − h ] − . the title compound was prepared following the procedure for intermediate 13 above , starting from n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl } amino ) benzenesulfonamide ( 0 . 357 g , 0 . 80 mmol ) and 3 - cyanophenethyl methanesulfonate [ cas 655250 - 92 - 3 ] ( 0 . 360 g , 1 . 6 mmol ) were dissolved in acetonitrile ( 10 ml ) and potassium carbonate ( 0 . 155 g , 1 . 12 mmol ) purification by chromatography on silica using gradient elution 12 - 50 % etoac in heptane yielded the title compound ( 0 . 081 g , 17 . 6 %). nmr very difficult to analyze ms ( es − ) m / z 547 , 576 , 578 [ m − h ] − . n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl } amino ) benzenesulfonamide ( 0 . 3 g , 0 . 67 mmol ) and 2 -( 4 - cyanophenyl ) ethyl methanesulfonate [ cas 119744 - 42 - 2 ] ( 0 . 227 g , 1 . 01 mmol ) was dissolved in acetonitrile ( 10 ml ) and potassium carbonate ( 0 . 139 g , 1 . 01 mmol ) was added . the mixture was stirred over night at 75 ° c . more 4 - cyanophenethyl methanesulfonate ( 0 . 57 g , 2 . 53 mmol ) in acetonitrile ( 1 ml ) and heating was continued for 6 h . reaction was heated to 100 ° c . for 6 h . the solvent was diluted with etoac and the organic phase was washed with brine , dried over mgso4 and concentrated . purification by chromatography on silica using gradient elution 0 - 50 % etoac in heptane , yielded the title compound ( 0 . 257 g 66 . 5 %); ms ( es − ) m / z 574 , 576 , 577 [ m − h ] − . ms ( es −) m / z 574 [ m − h ] − n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl } amino ) benzenesulfonamide ( 0 . 243 g , 0 . 54 mmol ) and 2 -( 1 - methyl - 1h - indol - 4 - yl ) ethyl methanesulfonate ( 0 . 345 g , 1 . 36 mmol ) was dissolved in acetonitrile ( 10 ml ) and potassium carbonate ( 0 . 105 g , 0 . 76 mmol ) was added . the mixture was stirred over night at 75 ° c . the solvent was evaporated under reduced pressure , the crude product was diluted with etoac and the organic phase was washed with brine , dried over mgso4 and concentrated . purification by chromatography on silica using gradient elution 17 - 50 % etoac in heptane , yielded the title compound ( 0 . 103 g , 31 %). ms ( es − ) m / z 602 , 604 , 606 [ m − h ] − . n - tert - butyl - 2 -({[ 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethyl ] sulfonyl } amino ) benzenesulfone ( 273 mg , 0 . 61 mmol ) and 2 -( 2 - oxo - 2 , 3 - dihydro - 1h - indol - 4 - yl ) ethyl methanesulfonate [ cas 139122 - 21 - 7 ]( 0 . 273 g , 0 . 61 mmol ) was dissolved in acetonitrile ( 10 ml ) and potassium carbonate ( 0 . 234 g , 0 . 92 mmol ) was added . the mixture was stirred over night at 75 ° c . reaction was heated for 6 h . the temperature was elevated to 100 ° c . and heating was continued for 6 h . the reaction mixture was diluted with etoac and the organic phase was washed with brine , dried over mgso4 and concentrated under reduced pressure . purification by chromatography on silica using gradient elution 0 - 50 % etoac in heptane , yielded the title compound ( 0 . 060 g , 16 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 11 ( s , 9h ), 2 . 82 ( t , j = 6 . 78 hz , 2h ), 2 . 91 - 2 . 98 ( m , 2h ), 3 . 44 - 3 . 55 ( m , 4h ), 4 . 14 ( t , j = 6 . 78 hz , 2h ), 6 . 68 ( d , j = 7 . 57 hz , 1h ), 6 . 84 ( d , j = 7 . 57 hz , 1h ), 6 . 90 ( dd , j = 8 . 20 , 1 . 89 hz , 1h ), 7 . 03 ( d , j = 1 . 89 hz , 1h ), 7 . 05 - 7 . 18 ( m , 2h ), 7 . 30 ( t , j = 7 . 57 hz , 1h ), 7 . 59 - 7 . 70 ( m , 2h ), 7 . 90 ( dd , j = 7 . 88 , 1 . 26 hz , 1h ), 8 . 05 ( s , 1h ), 8 . 81 ( s , 1h ), 10 . 36 ( s , 1h ); ms ( es − ) m / z 604 , 606 , 607 [ m − h ] − n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 - phenethoxyphenyl ) ethylsulfonamido ) benzenesulfonamide ( 0 . 058 g , 0 . 11 mmol ) was dissolved in 2 , 2 , 2 - trifluoroacetic acid ( 1 . 5 ml , 19 . 47 mmol ) and stirred for 5 h . the reaction mixture was co - evaporated with toluene , purification by preparative hplc gave the title compound ( 0 . 033 g 64 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 84 - 2 . 98 ( m , 4h ) 3 . 37 - 3 . 46 ( m , 2h ) 4 . 13 ( t , 2h ) 6 . 88 ( dd , 1h ) 7 . 00 ( d , 1h ) 7 . 13 ( d , 1h ) 7 . 17 - 7 . 24 ( m , 1h ) 7 . 24 - 7 . 36 ( m , 5h ) 7 . 55 - 7 . 69 ( m , 2h ) 7 . 81 - 7 . 95 ( m , 3h ) 8 . 95 ( s , 1h ); ms ( es − ) m / z 493 , 495 , 497 [ m − h ] − . to n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 -( 2 - methoxyphenethoxy ) phenyl ) ethylsulfonamido ) benzenesulfonamide ( 77 mg , 0 . 13 mmol ) trifluoroacetic acid ( 1 ml , 13 . 06 mmol ) was added and the mixture was stirred at room temperature for 2 h . the solvent was evaporated followed by co - evaporation with toluene ( 1 ml ). purification by preparative hplc gave the title compound ( 39 . 0 mg , 56 . 1 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 84 - 2 . 94 ( m , 4h ) 3 . 43 ( m , 2h ) 3 . 81 ( s , 3h ) 4 . 05 ( t , 2h ) 6 . 83 - 6 . 90 ( m , 2h ) 6 . 96 ( d , 1h ) 7 . 03 ( d , 1h ) 7 . 13 ( d , 1h ) 7 . 21 ( m , 2h ) 7 . 31 ( t , 1h ) 7 . 57 - 7 . 66 ( m , 2h ) 7 . 84 ( s , 2h ) 7 . 88 ( d , 1h ) 8 . 95 ( s , 1h ); ms ( es − ) m / z 523 , 525 [ m − h ] − . to n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 -( 3 - methoxyphenethoxy ) phenyl ) ethylsulfonamido ) benzenesulfonamide ( 61 mg , 0 . 10 mmol ) was trifluoroacetic acid ( 1 ml , 13 . 06 mmol ) added and the mixture was stirred at room temperature for 2 h . the solvent was evaporated followed by co - evaporation with methanol . purification by preparative hplc gave the title compound ( 32 . 0 mg , 58 . 1 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 85 ( t , 2h ) 2 . 92 ( m , 2h ) 3 . 42 ( m , 2h ) 3 . 73 ( s , 3h ) 4 . 13 ( t , 2h ) 6 . 77 ( dd , 1h ) 6 . 82 - 6 . 90 ( m , 3h ) 7 . 00 ( d , 1h ) 7 . 14 ( d , 1h ) 7 . 18 ( t , 1h ) 7 . 30 ( t , 1h ) 7 . 57 - 7 . 65 ( m , 2h ) 7 . 83 - 7 . 90 ( m , 3h ) 8 . 94 ( s , 1h ); ms ( es − ) m / z 523 , 525 [ m − h ] − . n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 -( 4 - methoxyphenethoxy ) phenyl ) ethylsulfonamido ) benzenesulfonamide ( 0 . 207 g , 0 . 36 mmol ) was dissolved in trifluoroacetic acid ( 1 . 5 ml , 19 . 47 mmol ) and stirred for 3 h . the reaction mixture was co - evaporated with toluene . purification by preparative hplc gave the title compound ( 0 . 079 g , 42 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 99 ( t , 2h ) 2 . 04 - 2 . 14 ( m , 2h ) 2 . 60 ( br . s ., 2h ) 2 . 88 ( s , 3h ) 3 . 24 ( t , 2h ) 5 . 98 - 6 . 08 ( m , 3h ) 6 . 15 ( d , 1h ) 6 . 30 ( d , 1h ) 6 . 35 ( d , 2h ) 6 . 43 - 6 . 55 ( m , 1h ) 6 . 78 ( d , 1h ) 6 . 79 - 6 . 87 ( m , 1h ) 6 . 97 - 7 . 10 ( m , 3h ) 8 . 13 ( s , 1h ); ms ( es − ) m / z 523 , 525 , 527 [ m − h ] − . n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 -( 2 - cyanophenethoxy ) phenyl ) ethylsulfonamido ) benzenesulfonamide ( 37 . 0 mg , 0 . 06 mmol ) was dissolved in trifluoroacetic acid ( 1 . 5 ml , 19 . 47 mmol ) and stirred for 4 h . the reaction mixture was coevaporated with toluene . purification by preparative hplc gave the title compound ( 0 . 020 g , 59 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 83 - 2 . 95 ( m , 2h ) 3 . 14 - 3 . 19 ( m , 2h ) 3 . 35 ( br . s ., 2h ) 4 . 23 ( t , 2h ) 6 . 89 ( dd , 1h ) 7 . 01 - 7 . 17 ( m , 2h ) 7 . 30 ( br . s ., 1h ) 7 . 41 ( td , 1h ) 7 . 51 - 7 . 67 ( m , 4h ) 7 . 78 ( dd , 1h ) 7 . 80 - 7 . 93 ( m , 3h ) 8 . 92 ( s , 1h ); m / z 518 , 520 , 522 [ m − h ] − . n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 -( 3 - cyanophenethoxy ) phenyl ) ethylsulfonamido ) benzenesulfonamide ( 0 . 079 g , 0 . 14 mmol ) was dissolved in trifluoroacetic acid ( 1 . 5 ml , 19 . 47 mmol ) and stirred for 4 h . the reaction mixture was co - evaporated with toluene . purification of the crude by prep . hplc gave ( 0 . 025 g , 36 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 83 - 2 . 92 ( m , 2h ) 2 . 96 ( t , 2h ) 3 . 36 - 3 . 44 ( m , 2h ) 4 . 18 ( t , 2h ) 6 . 89 ( dd , 1h ) 7 . 02 ( d , 1h ) 7 . 13 ( d , 1h ) 7 . 30 ( t , 1h ) 7 . 44 - 7 . 52 ( m , 1h ) 7 . 57 - 7 . 65 ( m , 3h ) 7 . 68 ( d , 1h ) 7 . 78 ( s , 1h ) 7 . 81 - 7 . 94 ( m , 3h ) 8 . 93 ( s , 1h ); ms ( es − ) m / z 518 , 520 , 522 [ m − h ] − . trifluoroacetic acid ( 1 ml , 0 . 45 mmol ) was added to n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 -( 4 - cyanophenethoxy ) phenyl ) ethylsulfonamido ) benzenesulfonamide ( 0 . 257 g , 0 . 45 mmol ) and the mixture was stirred for 2 h and then evaporated . purification by preparative hplc gave the title compound ( 0 . 042 g , 18 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 83 - 2 . 91 ( m , 2h ), 3 . 00 ( t , j = 6 . 31 hz , 2h ), 3 . 35 - 3 . 43 ( m , 2h ), 4 . 18 ( t , j = 6 . 46 hz , 2h ), 6 . 89 ( dd , j = 7 . 88 , 1 . 89 hz , 1h ), 7 . 01 ( d , j = 1 . 58 hz , 1h ), 7 . 12 ( d , j = 8 . 20 hz , 1h ), 7 . 31 ( t , j = 7 . 25 hz , 1h ), 7 . 48 ( d , j = 7 . 88 hz , 2h ), 7 . 57 - 7 . 68 ( m , 2h ), 7 . 74 ( d , j = 8 . 20 hz , 2h ), 7 . 81 - 7 . 92 ( m , 3h ), 8 . 95 ( s , 1h ); ms ( es − ) m / z 518 , 520 , 521 [ m − h ] − n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 -( 2 -( 1 - methyl - 1h - indol - 4 - yl ) ethoxy ) phenyl ) ethylsulfonamido )- benzenesulfonamide ( 0 . 100 g , 0 . 17 mmol ) was dissolved in trifluoroacetic acid ( 1 . 5 ml , 19 . 47 mmol ) and stirred for 3 h . purification by preparative hplc gave the title compound ( 0 . 033 g , 36 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 85 - 2 . 95 ( m , 2h ) 3 . 09 - 3 . 21 ( m , 2h ) 3 . 35 - 3 . 45 ( m , 2h ) 3 . 76 ( s , 3h ) 4 . 19 ( t , 2h ) 6 . 49 ( d , 1h ) 6 . 86 ( dd , 1h ) 6 . 90 - 6 . 98 ( m , 2h ) 7 . 06 ( t , 1h ) 7 . 11 ( d , 1h ) 7 . 23 - 7 . 37 ( m , 3h ) 7 . 51 - 7 . 66 ( m , 2h ) 7 . 76 - 7 . 96 ( m , 3h ) 8 . 93 ( m 1h ); ms ( es − ) m / z 546 , 548 , 550 [ m − h ] − . trifluoroacetic acid ( 1 ml , 0 . 10 mmol ) was added to n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 -( 2 -( 2 - oxoindolin - 4 - yl ) ethoxy ) phenyl ) ethylsulfonamido ) benzenesulfonamide ( 60 . 6 mg , 0 . 10 mmol ) and the mixture was stirred for 2 h and then evaporated . purification by preparative hplc gave the title compound ( 0 . 029 g , 53 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 84 ( t , j = 6 . 78 hz , 2h ), 2 . 88 - 2 . 98 ( m , 2h ), 3 . 40 - 3 . 48 ( m , 2h ), 3 . 50 ( s , 2h ), 4 . 15 ( t , j = 6 . 94 hz , 2h ), 6 . 68 ( d , j = 7 . 57 hz , 1h ), 6 . 85 ( d , j = 7 . 88 hz , 1h ), 6 . 90 ( dd , j = 8 . 20 , 1 . 89 hz , 1h ), 7 . 03 ( d , j = 1 . 89 hz , 1h ), 7 . 09 ( t , j = 7 . 72 hz , 1h ), 7 . 15 ( d , j = 8 . 20 hz , 1h ), 7 . 32 ( t , j = 7 . 57 hz , 1h ), 7 . 57 - 7 . 70 ( m , 2h ), 7 . 80 - 7 . 97 ( m , 3h ), 8 . 96 ( s , 1h ), 10 . 36 ( s , 1h ); ms ( es − ) m / z 548 , 550 [ m − h ] − . diisopropylethylamine ( 72 ml , 584 mmol ) and benzyl mercaptan ( 39 . 87 g , 321 mmol ) were added to a stirred solution of ( 3 - fluoro - 4 - nitrophenyl ) methanol ( 50 g , 292 mmol ) in dmso ( 250 ml ). the reaction mixture was heated at 80 ° c . for 3 h , then cooled to room temperature , and poured into ice - water . the precipitated solid was collected by filtration , washed with water and dried under reduced pressure to yield the title compound ( 87 g , 108 %). 1 h nmr ( 400 mhz , chloroform - d ) δ ppm 4 . 20 ( s , 2h ) 4 . 73 ( d , j = 4 . 8 hz , 2h ) 7 . 30 ( m , 4h ) 7 . 43 ( m , 2h ) 7 . 53 ( d , j = 8 hz , 1h ) 8 . 21 ( s , 1h ). a mixture of [ 3 -( benzylsulfanyl )- 4 - nitrophenyl ] methanol ( 87 g , 316 mmol ), tert - butyldiphenylchlorosilane ( 86 . 86 g , 316 mmol ) and imidazole ( 43 . 03 g , 632 mmol ) in dry dmf ( 550 ml ) was stirred at room temperature overnight . the reaction mixture was partitioned between water ( 500 ml ) and ethyl acetate ( 2000 ml ). the organic phase was separated , washed with brine ( 3 × 500 ml ), dried over anhydrous sodium sulfate and concentrated under reduced pressure . purification by chromatography on silica using gradient elution 5 - 10 % etoac in heptane , yielded the title compound ( 148 g , 99 %). 1 h nmr ( 400 mhz , chloroform - d ) δ ppm 1 . 10 ( s , 9h ) 4 . 20 ( s , 2h ) 4 . 74 ( s , 2h ) 7 . 29 - 7 . 48 ( m , 13h ) 7 . 65 ( d , j = 8 hz , 4h ) 8 . 13 ( s , 1h ) to a stirred solution of {[ 3 -( benzylsulfanyl )- 4 - nitrobenzyl ] oxy }( tert - butyl ) diphenylsilane ( 10 g , 19 . 67 mmol ) in dichloromethane ( 600 ml ) were added formic acid ( 300 ml ) and a solution of sodium chloride ( 18 g , 305 . 58 mmol ) in water ( 300 ml ). n - chlorosuccinimide ( 24 g , 179 . 07 mmol ) was then added in portions and the resulting mixture was stirred vigorously for about 1 hour until all starting material was consumed . the organic phase was separated , dried over anhydrous sodium sulfate and concentrated under reduced pressure to yield the title compound ( 10 . 2 g , 105 %), which was used in the next step without further purification . 1 h nmr ( 400 mhz , chloroform - d ) δ ppm 1 . 12 ( s , 9h ) 4 . 87 ( s , 2h ) 7 . 43 ( m , 6h ) 7 . 64 ( d , j = 8 hz , 4h ) 7 . 74 ( d , j = 8 hz , 1h ) 7 . 81 ( s , 1h ) 8 . 18 ( d , j = 8 hz , 1h ) tert - butylamine ( 36 . 5 ml , 346 mmol ) was added dropwise to a stirred solution of 5 -({[ tert - butyl ( diphenyl ) silyl ] oxy } methyl )- 2 - nitrobenzenesulfonyl chloride 4 ( 36 . 5 g , crude ) in dcm ( 300 ml ) at room temperature . the resulting mixture was stirred overnight and then water ( 250 ml ) was added . the organic layer was separated , dried over anhydrous sodium sulfate and concentrated under reduced pressure . purification by chromatography on silica using gradient elution 4 - 12 % etoac in heptanes , to yield the title compound ( 18 . 9 g , 48 % over two steps from {[ 3 -( benzylsulfanyl )- 4 - nitrobenzyl ] oxy }( tert - butyl ) diphenylsilane ( intermediate 21 )). 1 h nmr ( 400 mhz , methanol - d 4 ) δ ppm 1 . 10 ( s , 9h ) 4 . 90 ( s , 2h ) 7 . 42 ( m , 6h ) 7 . 66 ( d , j = 8 hz , 4h ) 7 . 74 ( d , j = 8 hz , 1h ) 7 . 80 ( s , 1h ) 8 . 05 ( d , j = 8 hz , 1h ). to a stirred solution of n -( tert - butyl )- 5 -((( tert - butyldiphenylsilyl ) oxy ) methyl )- 2 - nitrobenzene - sulfonamide ( 4 . 61 g , 8 . 75 mmol ) was added ammonium chloride ( 2 . 34 g , 43 . 75 mmol ) followed by zinc dust ( 4 . 61 g , 96 mmol ). the reaction mixture was heated to reflux for 2 hours , then cooled to room temperature and filtered through a pad of celite . the filtrate was concentrated under reduced pressure and the residue was partitioned between dichloromethane ( 100 ml ) and water ( 50 ml ). the organic layer was separated , washed with brine ( 50 ml ), dried over anhydrous sodium sulfate and concentrated under reduce pressure to yield the title compound ( 4 . 3 g , 99 %). 1 h nmr ( 400 mhz , chloroform - d ) δ ppm 1 . 07 ( s , 9h ) 1 . 19 ( s , 9h ) 4 . 65 ( s , 2h ) 4 . 69 ( s , 1h ) 4 . 74 ( s . 2h ) 6 . 71 ( d , j = 8 . 00 hz , 1h ) 7 . 26 ( dd , j = 8 . 00 , 2 . 00 hz , 1h ) 7 . 39 ( m , 6h ) 7 . 67 ( m , 4h ) 7 . 73 ( d , j = 2 . 00 hz , 1h ); ms ( es + ) m / z : [ m + 1 ] + 497 . 11 methanesulfonyl chloride ( 27 . 6 g , 241 mmol ) was added dropwise to a stirred mixture of 2 - amino - n - tert - butyl - 5 -({[ tert - butyl ( diphenyl ) silyl ] oxy } methyl ) benzenesulfonamide ( 57 g , 115 mmol ) and triethylamine ( 24 . 4 g , 241 mmol ) in dcm ( 200 ml ) at 0 ° c . the reaction mixture was stirred at 0 ° c . for half an hour and then at room temperature for one hour . the reaction mixture was diluted with dcm ( 700 ml ), washed with water ( 500 ml ), saturated sodium bicarbonate ( 500 ml ) and brine ( 500 ml ). the organic layer was separated , dried over anhydrous sodium sulfate and concentrated under reduced pressure to yield the title compound ( 74 . 9 g , 100 %). 1 h nmr ( 400 mhz , chloroform - d ) δ ppm 1 . 12 ( s , 9h ) 1 . 31 ( s , 9h ) 3 . 57 ( s , 6h ) 4 . 82 ( s , 2h ) 5 . 22 ( s , 1h ) 7 . 39 ( m , 7h ) 7 . 60 ( d , 1h ) 7 . 67 ( d , 4h ) 8 . 23 ( d , j = 2 . 00 hz , 1h ) 2m aqueous naoh ( 173 ml , 345 mmol ) was added to a stirred solution of 2 -[ bis ( methylsulfonyl ) amino ]- n - tert - butyl - 5 -({[ tert - butyl ( diphenyl ) silyl ] oxy } methyl ) benzenesulfonamide ( 74 . 92 g , 115 mmol ) in thf ( 270 ml ) at room temperature . the resulting mixture was stirred for 2 h , neutralized using 2m hydrochloric acid and extracted with dcm ( 2 × 500 ml ). the combined extracts were washed with water ( 500 ml ) and brine ( 500 ml ), dried over anhydrous sodium sulfate and concentrated under reduced pressure to yield the title compound ( 58 g , 88 %). 1 h nmr ( 400 mhz , chloroform - d ) δ ppm 1 . 10 ( s , 9h ) 1 . 23 ( s , 9h ) 3 . 16 ( s , 3h ) 4 . 75 ( s , 2h ) 4 . 99 ( s , 1h ) 7 . 63 ( m , 5h ) 7 . 43 ( m , 7h ) 7 . 97 ( d , j = 2 . 00 hz , 1h ) 8 . 29 ( s , 1h ); ms ( es − ) m / z : 573 . 29 [ m − 1 ] − a solution of n - tert - butyl - 5 -({[ tert - butyl ( diphenyl ) silyl ] oxy } methyl )- 2 -[( methylsulfonyl )- amino ] benzenesulfonamide ( 7 . 70 g , 13 . 40 mmol ) was treated at − 78 ° c . with lithium diisopropylamide ( 21 . 45 ml , 42 . 89 mmol ). after 10 min a solution of [ 2 -( bromomethyl )- 5 - chlorophenoxy ]( tert - butyl ) dimethylsilane ( 4 . 5 g , 13 . 40 mmol ) in thf ( 15 ml ) was added dropwise under 50 min . the reaction mixture was stirred at − 78 ° c . for 1 . 5 h then allowed to reach r . t ., stirred for 1 . 5 h . the reaction mixture was quenched with brine extraction with ethyl acetate . the organic layer was washed with brine , dried over magnesium sulfate , filtered and concentrated under reduced pressure . purification by chromatography on silica using gradient elution 12 - 20 % etoac in heptane , yielded the title compound ( 6 . 55 g , 59 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 0 . 17 ( s , 6h ) 0 . 87 ( s , 9h ) 1 . 00 - 1 . 05 ( m , 9h ) 1 . 07 ( s , 9h ) 2 . 93 - 3 . 05 ( m , 2h ) 3 . 40 - 3 . 52 ( m , 2h ) 4 . 79 ( s , 2h ), 6 . 78 ( d , 1h ) 6 . 96 ( dd , 1h ) 7 . 20 ( d , 1h ) 7 . 37 - 7 . 44 ( m , 4h ) 7 . 44 - 7 . 49 ( m , 2h ) 7 . 51 ( dd , 1h ) 7 . 60 - 7 . 68 ( m , 5h ) 7 . 98 ( s , 1h ) 8 . 01 ( s , 1h ) 8 . 73 ( s , 1h ) ms to a cold ( 0 ° c .) solution of n - tert - butyl - 2 -({[ 2 -( 2 -{[ tert - butyl ( dimethyl ) silyl ] oxy }- 4 - chlorophenyl )- ethyl ] sulfonyl } amino )- 5 -({[ tert - butyl ( diphenyl ) silyl ] oxy } methyl ) benzenesulfonamide ( 6 . 55 g , 7 . 89 mmol ) in thf ( 60 ml ) was tetrabutylammonium fluoride ( 4 . 25 ml , 11 . 84 mmol ) added . the reaction mixture was allowed to reach r . t ., stirred for 1 . 5 h , more of tetrabutylammonium fluoride ( 4 . 14 ml , 11 . 84 mmol ) was added , more tetrabutylammonium fluoride ( 4 . 14 ml , 11 . 84 mmol ) was added after 30 min stirred for another 30 min . the reaction mixture was quenched by addition of sat . brine , extracted with ethylacetate , the organic layer was washed with sat . aq . nh4cl , dried over magnesium sulfate , filtered and concentrated under reduced pressure . purification by chromatography on silica using gradient elution 25 - 50 % etoac in heptane followed by etoac 100 %, yielded the title compound ( 5 . 6 gr 99 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 03 ( s , 9h ) 1 . 09 ( s , 9h ) 2 . 88 - 2 . 99 ( m , 2h ) 3 . 42 - 3 . 55 ( m , 2h ) 4 . 79 ( s , 2h ) 6 . 70 - 6 . 81 ( m , 2h ) 7 . 08 ( d , 1h ) 7 . 38 - 7 . 44 ( m , 4h ) 7 . 44 - 7 . 54 ( m , 3h ) 7 . 59 - 7 . 69 ( m , 5h ) 8 . 01 ( d , 2h ) 8 . 74 ( s , 1h ) 10 . 06 ( s , 1h ); ms ( es − ) m / z 713 , 715 , 717 [ m − h ] − . a mixture of n - tert - butyl - 5 -(( tert - butyldiphenylsilyloxy ) methyl )- 2 -( 2 -( 4 - chloro - 2 - hydroxyphenyl ) ethylsulfonamido ) benzenesulfonamide ( 1 . 2 g , 1 . 68 mmol ), cesium carbonate ( 2 . 459 g , 7 . 55 mmol ) and ( 2 - bromoethyl ) benzene ( 1 . 031 ml , 7 . 55 mmol ) in n , n - dimethylformamide ( 10 ml ) was heated in mw at 110 ° c . for 1 h 30 min . the solvent was evaporated and the crude product was taken up in water / ethyl acetate . the aqueous phase was extracted twice with ethyl acetate . the combined organic extracts were washed with ½ saturated brine , brine , dried over magnesium sulfate , filtered and the solvent was evaporated under reduced pressure . purification by chromatography on silica using gradient elution 5 - 50 % etoac in heptane , yielded the title compound ( 0 . 940 g , 68 . 4 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 02 ( s , 9h ) 1 . 10 ( s , 9h ) 2 . 84 ( t , 2h ) 2 . 89 - 2 . 95 ( m , 2h ) 3 . 40 - 3 . 45 ( m , 2h ) 4 . 11 ( t , 2h ) 4 . 73 ( s , 2h ) 6 . 89 ( dd , 1h ) 7 . 00 ( d , 1h ) 7 . 12 - 7 . 19 ( m , 2h ) 7 . 23 ( d , 4h ) 7 . 38 - 7 . 43 ( m , 4h ) 7 . 44 - 7 . 52 ( m , 3h ) 7 . 59 - 7 . 65 ( m , 5h ) 8 . 01 - 8 . 05 ( m , 2h ) 8 . 76 ( s , 1h ); ms ( es − ) m / z 817 , 819 [ m − h ] − . tetrabutylammonium fluoride ( 1m in thf ) ( 4 . 59 ml , 4 . 59 mmol ) was added to n - tert - butyl - 5 -({[ tert - butyl ( diphenyl ) silyl ] oxy } methyl )- 2 -[({ 2 -[ 4 - chloro - 2 -( 2 - phenylethoxy ) phenyl ] ethyl }- sulfonyl ) amino ] benzenesulfonamide ( 0 . 94 g , 1 . 15 mmol ) in anhydrous tetrahydrofuran ( 20 ml ). the mixture was stirred at room temperature over night . the solvent was evaporated and the crude product was dissolved in ethyl acetate . the organic phase was washed with water , brine , dried over magnesium sulfate , filtered and the solvent was under evaporated reduced pressure . purification by chromatography on silica using gradient elution 5 - 100 % etoac in heptane , yielded the title compound ( 0 . 565 g , 85 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 1 . 10 ( s , 9h ) 2 . 86 - 2 . 94 ( m , 4h ) 3 . 38 - 3 . 43 ( m , 2h ) 4 . 12 ( t , 2h ) 4 . 48 ( d , 2h ) 5 . 39 ( t , 1h ) 6 . 89 ( dd , 1h ) 7 . 00 ( d , 1h ) 7 . 12 ( d , 1h ) 7 . 18 - 7 . 22 ( m , 1h ) 7 . 25 - 7 . 28 ( m , 4h ) 7 . 51 ( dd , 1h ) 7 . 62 ( d , 1h ) 7 . 87 - 7 . 88 ( m , 1h ) 7 . 99 ( s , 1h ) 8 . 75 ( s , 1h ); ms ( es −) m / z 579 . 58 [ m − h ] − . n - tert - butyl - 2 -( 2 -( 4 - chloro - 2 - phenethoxyphenyl ) ethylsulfonamido )- 5 -( hydroxymethyl )- benzenesulfonamide ( 372 mg , 0 . 64 mmol ) was dissolved in trifluoroacetic acid ( 1 . 5 ml , 19 . 47 mmol ) and stirred for 2 . 5 h . the reaction mixture was coevaporated with toluene . purification by preparative hplc gave the title compound ( 0 . 024 g , 7 . 2 %). 1 h nmr ( 500 mhz , dmso - d 6 ) δ ppm 2 . 90 ( t , 4h ) 3 . 35 - 3 . 46 ( m , 2h ) 4 . 13 ( t , 2h ) 4 . 47 ( d , 2h ) 5 . 39 ( br . s ., 1h ) 6 . 88 ( dd , 1h ) 7 . 00 ( d , 1h ) 7 . 12 ( d , 1h ) 7 . 17 - 7 . 23 ( m , 1h ) 7 . 28 ( d , 5h ) 7 . 51 ( d , 1h ) 7 . 60 ( d , 1h ) 7 . 82 ( m , 2h ) 7 . 86 ( m 1h ) 8 . 89 ( m , 1h ); ms ( es − ) m / z 523 , 525 , 527 [ m − h ] − . compounds were tested as inhibitors of microsomal prostaglandin e synthase activity in microsomal prostaglandin e synthase assays and whole cell assays . these assays measure prostaglandin e2 ( pge2 ) synthesis , which is taken as a measure of prostaglandin e synthase activity . microsomal prostaglandin e synthase biochemical assays used microsomal prostaglandin e synthase - 1 in microsomal preparations . the source of the microsomes can be for example interleukin - 1β - stimulated human a549 cells ( which express human mpges - 1 ) or sf9 cells transfected with plasmids encoding human mpges - 1 cdna . the whole blood assay [ described by patrignani , p . et al , journal of pharmacology and experimental therapeutics , 1994 , vol . 271 , pp 1705 - 1712 ] was used as the whole cell assay for testing the compounds . whole blood provides a protein and cell rich environment for the study of biochemical efficacy of anti - inflammatory compounds , such as prostaglandin synthase inhibitors . to study the inhibitory activities of these compounds , human blood was stimulated with lipopolysaccharide ( lps ) for typically 16 hours to induce mpges - 1 expression , after which the concentration of produced pge2 was measured by competitive - immuno assay ( homogeneous time - resolved fluorescence , htrf ) as read out for effectiveness against mpges - 1 - dependent pge2 production . a solution of test compound was added to a diluted microsome preparation containing human mpges - 1 and pre - incubated for 15 minutes in potassium phosphate buffer ph 6 . 8 with cofactor glutathione ( gsh ). corresponding solutions without test compound were used as positive controls , and corresponding solutions without test compound and without microsomes were used as negative controls . the enzymatic reaction was then started by addition of the substrate pgh2 in an organic solution ( dry acetonitrile ). the typical reaction conditions of the enzymatic reaction were thus : test compound : ranging from 60 μm to 0 . 002 μm , or zero in positive and negative controls ; potassium phosphate buffer ph 6 . 8 : 50 mm ; gsh : 2 . 5 mm ; mpges - 1 - containing microsomes : 2 μg / ml ( sample and positive controls ) or 0 μg / ml ( negative control ); pgh2 : 10 . 8 μm ; acetonitrile : 7 . 7 % ( v / v ); dmso : 0 . 6 % ( v / v ). the reaction was stopped after one minute by adding an acidic solution ( ph 1 . 9 ) of ferric chloride and citrate ( final concentrations 7 mm and 47 mm respectively ), by which the pgh2 was sequestered ( the pgh2 is reduced to mainly 12 - hydroxy heptadecatrineoic acid ( 12 - hht ) which is not detected by the subsequent pge2 detection step ). the resulting solution was then ph neutralized by addition of potassium phosphate buffer , prior to diluting an aliquot of the resulting solution in a weak potassium phosphate buffer ( 50 mm , ph 6 . 8 ) containing 0 . 2 % bsa ( w / v ). [ adapted from jacobsson et al ., proc . natl . acad . sci . usa , 1999 , vol . 96 , pp . 7220 - 7225 ] the pge2 formed was quantified by use of a commercial htrf based kit ( catalogue # 62pg2pec or # 62p2apec from cisbio international ). 100 % activity was defined as the pge2 production in positive controls subtracted by the pge2 production in the negative controls . ic50 values were then determined using standard procedures . data from this assay for representative compounds is shown in the table below . the potency is expressed as ic50 and the value indicated is an average of at least n = 2 . the data indicate that the compounds of the invention are expected to possess useful therapeutic properties . human blood collected from human volunteers in heparinized tubes was incubated with 100 μm acetyl salicylic acid , in order to inhibit the constitutively expressed cyclooxygenase ( cox )- 1 / cox - 2 enzymes , and then stimulated with 0 . 1 μg / ml lps to induce the expression of enzymes along the cox - 2 pathway , e . g . cox - 2 and mpges - 1 . 100 μl of this blood was added to the wells of a 384 - well plate containing 1 μl dmso solutions of compounds typically in the final concentration range 316 μm to 0 . 01 μm . naproxen was used as reference compound . the mix was incubated at 37 ° c . for 16 hours . plasma was harvested by centrifugation and stored at − 70 ° c . until further analysis of pge2 levels . for the calculations , the 0 %- activity value was represented by blood treated with acetyl salicylic acid , lps and the reference compound ( 1 mm naproxen ). the 100 %- activity value was represented by blood treated with aspirin , lps and dmso . [ reference : patrignani , p . et al , journal of pharmacology and experimental therapeutics , 1994 , vol . 271 , pp 1705 - 1712 ]. the pge2 formed was quantified , after dilution in a weak potassium phosphate buffer ( 50 mm , ph 6 . 8 ) containing 0 . 2 % bsa ( w / v ), by use of a commercial htrf based kit ( catalogue # 62pg2pec or # 62p2apec from cisbio international ). ic50 values were then determined using standard procedures . the results show that the novel bis ( sulfonamide ) compounds are selective inhibitors of the microsomal prostaglandin e synthase - 1 enzyme . the compounds have an improved potency and selectivity .

US-201515529701-A

solid betaine products having good treatment , fluidity and moisture resistance properties are prepared by arranging a hydrophobic , moisture - proof layer of a fluidity - improving anti - agglomeration agent on the surfaces of glycine betaine anhydride or monohydrate crystals or particles . animal feeds containing these betaine products are described .

the invention relates to a solid betaine product which contains a fluidity improver and / or anti - agglomeration agent . in accordance with the invention , a hydrophobic , moisture - proof layer is arranged on the surface of particles . the solid betaine product refers to a crystalline or ground product . the particle size of the crystalline product is 0 . 05 to 2 . 0 mm , preferably on the average about 0 . 3 to 0 . 6 mm . preferably , the crystalline product does not contain practically any dustlike substance , i . e . particles with the diameter of less than about 0 . 01 mm . the particle size of the ground product is 1 to 100 μm . the hydrophobic layer on the surface of the particles may consist of a metallic salt of a fatty acid , such as calcium or magnesium stearate , or hydrophobic silica . additionally , a substance which enhances said hydrophobic substance to adhere to or spread onto the surface of betaine particles may be present on the surface of the crystals . suitable substances that enhance the adhesion or spreading of the hydrophobic substance comprise fats , oils , fat - like substances , such as lecithins and waxes , and water - insoluble substances , such as cellulose derivatives and silicone derivatives . in accordance with the invention , a new betaine product can be produced , for example , by mixing the blend of betaine and a hydrophobic , moisture - proof substance . in the method of the invention , various mixers can be used . when only powdery hydrophobic substance is used , suitable mixers comprise various batch mixers or continuous mixers , such as drum mixers or helical / screw mixers . mixing time depends on the power of the mixer , and also on the batch size . the object is that the hydrophobic substance mixes as evenly as possible with the betaine . in the ideal case , the powder forms a monomolecular layer on the surface of the product . preferably , the smallest betaine crystals are screened out before a treatment with the hydrophobic substance . when a binding agent is added to the powdery hydrophobic substance , spray granulators or fluidized bed drying / coating devices can be used in the method of the invention , in addition to various batch mixers and continuous mixers . various grinders , such as an air jet grinder or a turbo mill or some other mill useful for grinding sugar crystals , can be used in the method of the invention . the betaine is thus ground with the powdery hydrophobic substance , and the obtained powdery product flows freely and it will not agglomerate . in accordance with one preferred method of the invention , melted , hot ( e . g . about 40 ° c . higher than the melting point ) fat is first sprayed onto the surface of the betaine crystals . it is preferable to use a hydrogenated fat with a high melting point , whereby a product is obtained , which retains good fluidity ( does not become viscous ) even at tropical temperatures . other fats / oils can also be used ( depending on the use of the product ). when using oils that are fluid at room temperature , no heating is needed . when using fats with a high melting point , it is preferable to preheat the betaine crystals close to the melting point of the fat . this facilitates the forming of a layer as even as possible . thereafter the surface of the warm crystal coated with fat is ‘ powdered ’ with a hydrophobic substance . managing the processing conditions is critical ( temperatures ) in order that even and comprehensive protection is achieved , and the product does not stick to the walls of the equipment or elsewhere , and the product remains single , flowable crystals ( no agglomeration ). instead of spraying the fat , another technique may also be used , in which the betaine particles and the solid fat flakes , et cetera , are first mixed together . thereafter , the blend is heated to exceed the melting point of the fat while it is continuously being mixed . the fat treatment may be carried out by using a mixer with the possibility of adding liquid ( spray nozzle systems ) or a spray granulator or devices of the type of fluidized bed drier / coater . useful substances that enhance the adhesion or spreading of the hydrophobic substance include , for example , the following : revel s ( acetylized monoglyceride , hydrogenated soy oil ); melting point 63 ° c . ; manufactured by loders croklaan , holland e . g . lecithins of metarin product line ; manufactured by lucas mayer , germany e . g . pharsil mk silicone emulsion ; manufactured by : wacker chemie gmbh , germany betaine anhydride ( nutristim , manufactured by cultor oy ; quantity 50 kg , granule size 0 . 27 to 1 . 0 mm ) was introduced into a drum mixer ( forberg f - 60 , manufactured by fa . halvor forberg a / s , norway ) and 3 kg calcium stearate ( ceasit leviss , manufactured by barlocher , germany , particle size 99 % & lt ; 71 μm ) was added thereto . mixing was carried out at room temperature for about three minutes . the obtained product had good fluidity , and it remained fluid for at least three hours at a temperature of 30 ° c ., the relative air humidity being 95 %. into a continuous screw mixer ( length of the mixing worm 4 m , diameter 400 mm , two mixing points in the screw , manufactured by siirtoruuvi oy , finland ) were fed betaine anhydride ( nutristim , manufactured by cultor oy ; granule size 0 . 27 to 1 . 0 mm ) 5 , 000 kg / hour and 6 % calcium stearate ( ceasite leviss , manufactured by barlocher , germany ; particle size 99 % & lt ; 71 μm ) through an additive dispenser ( accurate , manufactured by accurate dry material feeders inc ., usa ). mixing was carried out continuously in the mixing helix / screw . temperature was 20 ° c . and duration of mixing in the mixing helix was two minutes . the obtained product had good fluidity and it remained fluid at least for three hours at a temperature of 30 ° c ., the relative air humidity being 95 %. betaineanhydride ( nutristim , manufactured by cultor oy ; quantity 47 . 5 kg , granule size 0 . 27 to 1 . 0 mm ) was introduced into a drum mixer ( forberg f - 60 , manufactured by fa . halvor forberg a / s , norway ) and preheated to 55 ° c . thereafter 2 . 5 kg hot ( 100 ° c .) fat ( revel - s , manufactured by loders croklaan , holland ) was added by spraying ( nozzle size 4004 , pressure 3 bar ) and simultaneously mixing ( for 1 . 3 minutes ). finally , 1 kg calcium stearate ( ceasit leviss , manufactured by bärlocher , germany ; particle size 99 % & lt ; 71 μm ) was added , and the blend was cooled to 30 ° c . and mixed for 3 . 7 minutes . the obtained product &# 39 ; s solubility in water was poor and fluidity was good : it remained fluid at least for three hours at a temperature of 30 ° c ., the relative air humidity being 95 %. the test was conducted in the same way as in example 1 , but instead of calcium stearate , hydrophobic silica ( sipernat d 17 , manufactured by degussa , germany ; average granule size 10 μm ) was used . the obtained product was very fluid , and it remained fluid at least for three hours at a temperature of 30 ° c ., the relative air humidity being 95 %. the test was conducted in the same way as in example 3 , but instead of calcium stearate , hydrophobic silica ( sipernat d 17 , manufactured by degussa , germany ; average granule size 10 μm ). the obtained product &# 39 ; s solubility in water was poor and fluidity was good : it remained fluid at least for three hours at a temperature of 30 ° c ., the relative air humidity being 95 %. betainemonohydrate ( technical quality , manufactured by cultor oy ; quantity 47 . 5 kg , granule size 0 . 25 to 1 . 25 mm ) was introduced into a drum mixer ( forberg f - 60 , manufactured by fa . halvor forberg a / s , norway ) and preheated to 55 ° c . thereafter , 1 . 5 kg hot ( 100 ° c .) fat ( revel - s , manufactured by loders croklaan , holland ) was added by spraying ( nozzle size 4004 , pressure 3 bar ) and simultaneously mixing ( for 1 . 3 minutes ). finally , 1 . 5 kg calcium stearate ( ceasit leviss , manufactured by barlocher , germany ; particle size 99 % & lt ; 71 μm ) was added , and the blend was cooled to 30 ° c . and mixed for 3 . 7 minutes . the obtained product &# 39 ; s solubility in water was poor and fluidity was good . the test was conducted in the same way as in example 6 , but instead of calcium stearate , hydrophobic silica ( sipernat d 17 , manufactured by degussa , germany ; average particle size 10 μm ) was used . the obtained product had good fluidity and it remained fluid at least for three hours at a temperature of 30 ° c ., the relative air humidity being 95 %. betaineanhydride ( betafin bp , manufactured by cultor oy ; particle size 0 . 05 to 1 . 0 mm ) was fed into a continuous air jet grinder ( pulva fp micronization , manufactured by oy finnpulva ab ); simultaneously , hydrophobic silica ( aerosil r 972 , manufactured by degussa ; average particle size 16 nm ) was also fed into the grinder . the total quantity of betaineanhydride was 400 kg and that of silica 4 kg ( 1 %). the average grinding fineness of the obtained product was less than 20 μm , the product was very fluid and it did not agglomerate .

US-42461700-A

the present invention is directed to adhesive / hemostatic formulations of 2 - alkoxyalkyl cyanoacrylate , an absorbable liquid or solid polymeric modifier , and a general stabilizer against premature anionic polymerization of cyanoacrylates . the present adhesive formulations are useful as tissue adhesives / sealants , hemostatic agents , or as a means of patching and anastomotic coupling of damaged organs .

this invention deals with absorbable tissue adhesive / sealant formulations that are stabilized against premature anionic polymerization based on combinations of 2 - cyanoacrylate ester and one or more absorbable liquid or compliant solid copolyester modifier of the types disclosed in u . s . pat . nos . 5 , 350 , 798 and 6 , 299 , 631 , in the presence of one or more miscible acidic compounds or precursors thereof including either phosphorus - containing compounds such as phosphoric acid , pyrophosphoric acid , and polyphosphoric acid , or monobasic organic sulfonic acids such as p - toluene sulfonic acid , methanesulfonic acid , trifluoroacetic acid , at a concentration that exceeds 1 ppm . one specific aspect of this invention deals with adhesive / sealant formulations of 2 - methoxypropyl cyanoacrylate and one or more amorphous or low - crystallinity polyaxial copolyesters , such as those described in u . s . pat . no . 6 , 462 , 169 and pyrophosphoric acid as the stabilizer . another specific aspect of this invention deals with adhesive / sealant formulations of 2 - methoxypropyl cyanoacrylate and one or more absorbable , hydrogel - forming , self - solvating liquid copolyesters of those described in u . s . pat . no . 6 , 413 , 539 , after acylation of the hydroxyl end - groups of their chains and pyrophosphoric acid . another aspect of this invention deals with stabilized cyanoacrylates used as absorbable or non - absorbable tissue adhesives or as industrial adhesives , wherein the cyanoacrylate components can be one or a combination of these used as tissue adhesives / sealants or an industrial adhesive and the stabilizer being one or more of the acidic compounds or a precursor of acidic compounds . among cyanoacrylate formulations suitable for stabilization are those comprising methyl cyanoacrylate , ethyl cyanoacrylate , isopropyl cyanoacrylate , n - propyl cyanoacrylate , n - butyl cyanoacrylate , isobutyl cyanoacrylate , isooctyl cyanoacrylate , and n - octyl cyanoacrylate . another aspect of this invention deals with minimizing or eliminating the chance of premature polymerization of cyanoacrylates or their formulations upon transfer to the application site during their use in a typical industrial application or use as tissue adhesives / sealants , wherein stabilization against premature polymerization is achieved through modifying the surface of the delivery apparatus in direct contact of the cyanoacrylate . a more specific aspect of this invention deals with a polymeric catheter or container made of polyethylene , polypropylene , or any similar polymer capable of surface sulfonation or phosphonylation to introduce covalently bonded acid groups on the cyanoacrylate - contacting surface as described in u . s . pat . nos . 5 , 558 , 517 and 5 , 491 , 198 . accordingly , the delivery device used to administer the cyanoacrylate - based system will be phosphonylated or sulfonated to introduce covalently bonded sulfonic or phosphonic groups on the contacting surface that will prevent premature anionic polymerization of the cyanoacrylate components . another aspect of this invention deals with radiochemical sterilization ( described in u . s . pat . no . 5 , 422 , 068 ) of packaged cyanoacrylate formulations using a combination of 5 to 7 . 5 kgy of gamma radiation and radiolytically generated gaseous formaldehyde , wherein the liquid formulation is contained in an ampoule with a tapered neck made of a suitable polymer , such as polyethylene and enclosed in a hermetically sealed , secondary package containing a gas permeable fabric pouch containing radiolytically labile polyformaldehyde ( as a precursor of formaldehyde ). radiochemically sterilized cyanoacrylate formulations , such as that of methoxypropyl cyanoacrylate , containing an absorbable copolyester modifier and stabilized against premature polymerization were shown to be fully sterile and , hence , suitable for internal surgical applications . another aspect of this invention is a method of delivering radiochemically sterilized cyanoacrylate formulation for internal or external applications at surgical or wound repair sites . another aspect of this invention is the use of radiochemically sterilized cyanoacrylate formulation endoscopically through polymeric delivery catheters or devices whose cyanoacrylate - contacting surface is chemically modified to introduce an acid group , such as phosphonic or sulfonic ones . another aspect of this invention deals with a cyanoacrylate - based composition colored with an organic dye . further illustrations of the present invention are provided by the following examples , which deal with the preparation of typical polymeric modifiers and their incorporation in tissue adhesive formulations with different cyanoacrylates in the presence of small amounts of polyphosphoric acid ( ppa ) as the stabilizer . a copolyester of polyethylene glycol 400 ( peg - 400 ) was prepared by end - grafting the peg - 400 ( 15 g ) with a 60 / 40 molar ratio of dl - lactide / glycolide ( 85 g ) at 150 ° c . in the presence of a catalytic amount of stannous octanoate until practically complete conversion is achieved . the resulting gf was isolated , purified , and characterized as described in u . s . pat . no . 6 , 413 , 539 . the purified product was then acylated by treating with a four - fold excess ( based on mn determined by gpc ) of acetic anhydride at 120 ° c . for four hours . unreacted anhydride and the acetic acid by - product were removed by distillation under reduced pressure above 80 ° c . the acetylated gf ( ac - gf ) was characterized for identity ( ir and nmr ) and molecular weight ( gpc ). a polyaxial polymeric initiator was first prepared by copolymerization of 5 / 20 / 25 ( molar ) of glycolide ( g ), ε - caprolactone ( cl ), and trimethylene carbonate ( tmc ) in the presence of stannous octoate and trimethyl propane as a catalyst and monomeric initiator , respectively , as described in u . s . pat . no . 6 , 462 , 169 . the polyaxial polymeric initiator was then grafted with 1 - lactide ( ll ) to yield a segmented , partially crystalline polymer comprising sequences derived from g , cl , tmc , and ll at a ratio of 5 / 20 / 25 / 50 . the segmented copolymer was isolated and purified as per u . s . pat . no . 6 , 467 , 169 , and then characterized for identity ( ir and nmr ) molecular weight ( gpc ) and thermal properties ( dsc ). preparation of an 85 / 15 tissue adhesive formulations of undyed methoxypropyl cyanoacrylate ( mpc ) and ac - gf . in a predried glass reactor equipped for mechanical stirring , ac - gf ( 5 . 3 g from example 1 ), and an equal amount of mpc ( 5 . 3 g ) containing small amounts of pyrophosphoric acid ( 2 mg ), were mixed under a dry nitrogen atmosphere . the mixture is then heated to 110 ° c . and maintained at that temperature until complete mixing is achieved . the mixture was then cooled to 60 ° c . and an additional amount of mpc ( 24 . 7 g ) was added and the mixing continued for about one hour and then allowed to reach room temperature to yield a uniform clear liquid . this was characterized for identity by infrared and adhesive strength using the fabric peel test [ as described by j . d . kline et al ., sixth world biomaterials congress , trans . soc . biomat ., iii , 1062 ( 2000 )]. this was conducted as in example 3 with the exception of mixing d & amp ; c violet # 2 at 0 . 05 % concentration with the final liquid formulation . in a predried glass reactor equipped for mechanical stirring , pax ( 20 g from example 2 ) and mpc ( 20 g ) containing a small amount of pyrophosphoric acid ( 8 mg ) were mixed under a dry nitrogen atmosphere . the mixture is then heated to 110 ° c . and maintained at that temperature until complete mixing is achieved . the mixture was then cooled to 60 ° c . and an additional amount of mpc ( 360 g ) was added and the mixing continued for about one hour and allowed to cool to room temperature to yield a uniform clear liquid . the product was characterized as described in example 3 . this was conducted as in example 5 with the exception of mixing d & amp ; c violet # 2 t 0 . 05 % concentration with the final liquid formulation . this was conducted as in example 5 with the exception of using 7 . 5 g of pax ( from example 2 ) and 7 . 5 g of mpc containing 2 . 5 mg pyrophosphoric acid in the first stage , and 235 g of mpc in the second stage . polyethylene ampoules with tapered nicks were filled under dry nitrogen with undyed aliquots ( 0 . 2 ml ) of the formulation from example 7 . eighteen of these ampoules were packaged under dry nitrogen atmosphere in a hermetically sealed secondary package containing a porous , heat - sealed polyester pouch containing 200 mg of unstabilized polyformaldehyde powder ( celcon m - 90 ). the secondary package and its contents were radiochemically sterilized using 5 kgy at a dose rate of 32 kgy / hour . the sterilized formulation was tested for identity ( by ir ), adhesive property ( using the fabric peel test as in example 3 ), and for sterility . using standard microbiological assays , the liquid formulation and the surface of the sealed ampoule were tested after more than one month post - irradiation , and were shown to be sterile . the adhesive strength of the sterilized formulation was slightly lower than that of the same formulation before sterilization . preparation of undyed 97 / 3 tissue adhesive formulations of ethyl cyanoacrylate ( ec ) and ac - gf . this was conducted as in example 7 with the exception of using ethyl cyanoacrylate instead of mpc . the shelf stability at 4 ° c . of the formulations of examples 3 through 9 at 3 , 6 , 9 , or 12 months were tested in terms of changes in typical group frequencies ( using ir ) and adhesive strength ( using the fabric peel test ). no discernable changes in properties were observed for all formulations , which exhibited acceptable one - year shelf stability . although the present invention has been described in connection with the preferred embodiments , it is to be understood that modifications and variations may be utilized without departing from the principles and scope of the invention , as those skilled in the art will readily understand . accordingly , such modifications may be practiced within the scope of the following claims . moreover , applicant hereby discloses all subranges of all ranges disclosed herein . these subranges are also useful in carrying out the present invention .

US-30007602-A

an agricultural crop harvester &# 39 ; s feeding and gathering units are driven by a power source on the harvester through a sheave assembly journaled on a countershaft mounted towards the rear of the feeding unit . power is thence transmitted by a variable ratio v - belt drive to a speed reducing and direction reversing planetary gear unit mounted forwardly on the feeding unit and finally to the gathering and feeding mechanisms by drives of conventional design . in the variable ratio v - belt drive , the effective diameter of a split sheave output portion of the countershaft sheave assembly is selectively adjusted hydraulically while , in inverse response , the effective diameter of a spring loaded variable driven split sheave , integral with the planetary gear unit , adjusts automatically . in addition , the driven sheave is provided with a coaxial cam arrangement responsive to changes in torque transmitted so that its effective diameter also adjusts automatically to provide appropriate belt tension . interposing a speed reducing planetary gear unit in the drive system following the v - belt drive makes possible the use of comparatively higher belt speeds and smaller sheave diameters and facilitates provision of a selectively reversible drive to the gathering and feeding units . the reversed speed of rotation of the output of the planetary unit is substantially lower than its forward speed .

the invention is embodied in a self - propelled combine having a main separator body indicated generally in fig1 by the numeral 10 , mounted on a pair of forward drive wheels 12 and steerable rear wheels 14 . an elevated operator &# 39 ; s station 16 is mounted at the front of the separator body 10 . a forward mounted header indicated generally by the numeral 18 is pivoted on a horizontal transverse pivot ( not shown ) at the front of the separator body 10 for vertical adjustment by conventional means . the header includes a feeding unit indicated generally by the numeral 20 and a gathering unit indicated generally by the numeral 22 . a transversely oriented internal combustion engine 24 indicated in schematic outline only in fig1 is mounted towards the front of the separator body 10 and has an output power shaft 26 extending from the left - hand side of the separator body . a belt - type drive system indicated in its entirety by the numeral 28 is disposed on the left side of the combine and transmits power from the engine power shaft 26 to the header 18 . the belt drive system 28 includes a primary countershaft 30 mounted on the combine body 10 and connected to the engine power shaft 26 by a primary countershaft belt drive indicated generally by the numeral 32 . a movable countershaft assembly 34 is mounted on the left - hand side of the feeding unit 20 approximately coaxial with the transverse pivot of the header 18 and is connected to the primary countershaft 30 by a header transfer drive indicated generally by the numeral 36 . a header drive shaft 38 is mounted transversely beneath the forward end of the feeding unit 20 as shown most clearly in fig2 . the header drive shaft 38 is connected to the movable countershaft 30 by a header drive indicated generally by the numeral 40 in fig1 and 2 . final drives to the feeding unit 20 and the gathering unit 22 are taken from the header drive shaft 38 by conventional means such as the platform drive 42 indicated schematically in fig1 . the feeding unit 20 shown in schematic outline in fig2 includes a pair of opposite upright side walls 44 , a top wall 46 and a bottom wall 48 . the movable countershaft assembly 34 , shown in detail in fig3 includes a frame 50 for mounting it on the left - hand side wall 44 of the feeding unit . a tubular brace 52 extends between the frame 50 and the left - hand side wall 44 and reinforces the mounting of the countershaft assembly 34 on the feeding unit . a threaded insert 54 fixed in the end of the brace 52 and equipped with adjusting nuts 56 engages the frame 50 and in conjunction with slots ( not shown ) in the mounting between the frame and the side wall 44 provide for adjustment of center distance between the countershaft assembly 34 and the header drive shaft 38 . the frame 50 embraces a sheave assembly 58 journaled on the countershaft 60 which is secured in the frame by cap screws 62 and 63 . the sheave assembly 58 includes an axially fixed portion 64 and an axially adjustable portion 66 . the fixed sheave portion 64 includes an inner hub 68 journaled by bearing 70 mounted on a shouldered sleeve 72 carried against the frame 50 at the inner end of the countershaft 60 . a sheave 74 is concentrically mounted on the inner hub 68 and secured by cap screws 76 . the sheave 74 includes a v - belt groove 78 in which rides the v - belt 80 of the header transfer drive 36 . integral with the sheave 74 is a sheave element 82 comprising an inclined face of a conventional v - belt groove . a cylindrical bore 84 in the fixed sheave 74 is concentric with the countershaft 60 and surrounds an axially extending portion of the inner hub 68 which bears a plurality of axially aligned radially extending ribs 86 . an end portion 88 of the countershaft 60 is of increased diameter , and has an inwardly facing radial wall 90 . a sleeve 92 with stepped bores closely fitting the shaft 60 and end portion 88 and having an internal radial wall 94 is slidably disposed on the shaft so that a variable chamber 96 is formed , the opposite ends of the chamber being defined by the radial walls 90 and 94 of the shaft and sleeve respectively . an approximately radial threaded hole 98 in the sleeve 92 communicates with the chamber 96 . a hydraulic hose 100 threaded into the hole 98 connects the chamber 96 with a source of hydraulic pressure on the combine ( not shown ). a single - acting hydraulic cylinder is thus constituted with the shaft 60 and its stepped end portion 88 serving as a fixed cylinder rod and piston and the sleeve 92 acting as a moving cylinder . oil sealing between the sliding parts is effected by annular seals 102 and 104 carried in grooves in the sleeve 92 and a bellows - type seal 106 connected between the end portion 88 of the shaft 60 and the sleeve 92 protects the exposed portion of the &# 34 ; cylinder rod &# 34 ;. a snap ring 108 carried in a groove 110 on the shaft 60 limits axial movement of the sleeve 92 in one direction . engagement between the radial step faces 90 and 94 of the shaft and sleeve respectively limits movement in the opposite direction . the axially adjustable sheave portion 66 is journaled on the sleeve 92 by a bearing 112 which abuts shoulders 114 and 116 of the sleeve 92 and sheave portion 66 respectively on opposite sides of the bearing . a hollow generally cylindrical hub portion 118 of the sheave portion 66 engages the axially fixed sheave portion 64 closely fitting and extending substantially the full length of the bore 84 for sliding movement therein . extending generally radially inwards from the hub portion 118 is a plurality of lugs 120 loosely engaging the ribs 86 so as to permit axial movement but prevent any substantial relative rotation between the axially fixed sheave portion 64 and the axially adjustable sheave portion 66 . a conventional v - belt groove face 122 integral with the axially adjustable sheave element 66 is concentric with and has an inclination equal and opposite to that of the corresponding v - belt groove face 82 on the fixed sheave portion 64 , and together the two faces constitute the groove of a sheave of variable effective diameter . a v - belt 124 of the header drive 40 rides in this groove and transmits power from the movable countershaft assembly 34 to the header drive shaft 38 via a transmission assembly indicated in its entirety by the numeral 126 , coaxial with and drivingly engaging the header shaft 38 . the transmission assembly 126 , best shown in fig4 is mounted on the left - hand side wall 44 of the feeding unit towards its forward end by a bracket assembly 128 shown only in fig2 and disposed so that the header drive shaft 38 lies transversely immediately beneath the bottom wall 48 of the feeding unit . the transmission assembly 128 combines , in an integrated unit , a planetary transmission indicated generally by the numeral 130 and a sheave assembly indicated generally by the numeral 132 . the sheave assembly 132 , driven by the v - belt 124 , is of the variable effective diameter torque sensing or torque responsive type and includes an axially fixed sheave element 134 and an axially adjustable sheave element 136 . a compression spring 138 carried between a spring retainer 140 and the movable sheave element 136 biases that element axially towards the fixed sheave element 134 in the direction of increasing effective diameter . the torque sensing or torque responsiveness of the sheave assembly 132 depends upon control of relative rotation between the two sheave elements 134 and 136 and is effected by a cam assembly 142 annularly contained between them . a torque sensing mechanism of this type is fully described in u . s . pat . no . 3 , 881 , 370 issued to vogelaar et al and sharing a common assignee with the present application and will not be described in detail here . suffice it to say that the cam assembly 142 is so disposed between the sheave elements 134 and 136 that any tendency for relative rotation between the two sheave halves results in a cam action biasing the axially adjustable sheave element 136 toward sheave element 134 . the sheave assembly 132 is rotatably carried on the header drive shaft 38 by a hub - like extension 144 of an input sun gear 146 journaled on the shaft 38 by a pair of bearings 148 . the sheave assembly 132 is drivably keyed and secured to the input gear hub 144 by a key 150 and set screws 152 respectively . as previously mentioned , the transmission assembly 126 is mounted on the side wall 44 of the feeding unit 20 by means of the bracket assembly 128 . the planetary transmission 130 includes a generally annular bell - shaped gear housing 154 which includes the actual attaching points ( not shown ) of the transmission assembly 126 to the bracket assembly 128 . the inner end of the gear housing 154 includes a bearing housing 156 and the outer end has an annular flange 158 . a boss 160 having a bore 162 parallel to the header drive shaft and communicating with the interior of the gear housing 154 extends axially from the rearward side of the gear housing adjacent the bearing housing 156 . a pinion carrier 164 closes the bell mouth of the gear housing 154 and includes a cover portion 166 secured to the flange 158 of the gear housing 154 by a plurality of fasteners 168 and , extending axially from the cover portion 166 , a pinion carrier structure 170 . the gear housing 154 and the pinion carrier 164 together form a gear housing assembly through which the header drive shaft 38 rotatably extends carried by bearings 172 and 174 , housed in the bearing housing 156 of the gear housing and in a central bore of the pinion carrier 164 respectively . annularly interposed between the bearings and the shaft are a shaft hub 176 and the input gear hub 144 respectively . a woodruff key 178 drivingly connects the shaft hub 176 to the shaft . an enlarged diameter portion of the shaft hub 176 extends within the gear housing 154 and includes external splines 180 and a snap ring groove 182 intersecting the splines . the pinion carrier structure 170 includes a plurality of bores 184 carrying a plurality of pins 188 on which are journaled , by a plurality of bearings 190 , pinion gears 192 each including as integral parts a first planetary pinion 194 immediately adjacent the pinion carrier cover and drivably engaging the input sun gear 146 and a second planetary pinion 196 immediately adjacent the first . the second planetary pinions 196 drivably engage and carry a ring gear assembly 198 which includes a ring gear 200 and a concentrically dished clutch plate 202 secured to the ring gear by a plurality of fasteners 204 . the ring gear assembly is free to float in the gear housing 154 , its movement being limited radially only by the engagement of the ring gear 200 with the second planetary pinions 196 and axially by the confinement of the clutch plate 202 between adjacent faces 206 and 208 of the gear housing 154 and pinion carrier structure 170 respectively . an output sun gear 210 is interposed , concentric with the header drive shaft 38 , between the shaft hub 176 and the input sun gear 146 and includes a spur gear portion 212 drivably engaging the second planetary pinions 196 and , immediately adjacent the shaft hub 176 , a hub - like extension 214 bearing external splines 216 matching those ( 180 ) of the shaft hub 176 . the output sun gear 210 has an internal bore 218 exceeding the diameter of adjacent portions of the header drive shaft 38 and is maintained in position radially only by its engagement with the teeth of the second planetary pinions 196 and axially by its close confinement between the shaft hub 176 and the input sun gear 146 . an internally splined shifting collar 220 is slidably carried on the matching splines of the shaft hub 176 and is axially disposable so that the internal splines selectively also engage ( as shown in fig4 ) or disengage the external splines 216 of the output sun gear 210 so that the shaft hub 176 is selectively coupled to or uncoupled from the output sun gear 210 . an increased diameter outer portion of the shifting collar 220 bears an external splined section 222 matching internal splines of the clutch plate 202 and the inner end of the shifting collar has an external annular groove 224 . the shifting collar 220 is also disposable axially so that the internal splines of the clutch plate 202 selectively drivably engage ( as shown in fig5 ) or disengage the matching external splines 222 of the shifting collar so that the shaft hub 176 is selectively coupled to or uncoupled from the ring gear assembly 198 . a shifting assembly 226 has a shaft portion 228 slidably disposed in the bore 162 of the boss 160 of the gear housing 154 . the shaft 228 extends into the gear housing 154 and carries a shifter plate 230 which engages the external groove 224 of the shifting collar 220 . as indicated in fig2 the shifter assembly 226 is connected through a linkage 232 and push - pull control cable assembly indicated generally by the numeral 234 to a control handle 236 at the combine operator &# 39 ; s station 16 . as previously stated , the header drive shaft 38 extends transversely beneath the feeding unit 20 . its right - hand end ( not shown ) extends beyond the right - hand side wall 44 of the feeding unit and is journaled adjacent its end in a bearing supported by the feeding unit 20 . final drives to the feeding and gathering units are taken from the shaft 38 by conventional means including chain or splined couplers , a typical chain coupler half 238 being shown in fig4 retained on the header drive shaft 38 by cap screw 240 . a header drive arrangement , using splined couplers in the header drive shaft is disclosed in u . s . pat . no . re . 26 , 512 issued to rohweder and sharing a common assignee with the present application . in typical harvesting operation the engine 24 is run at a constant speed and hence the sheave assembly 58 of the movable countershaft assembly 34 driven by the engine through the fixed ratio primary countershaft and header transfer belt drives 32 and 36 respectively , also rotates at a constant speed . the gathering and feeding units are driven from the sheave assembly 58 by the v - belt 124 running in the adjustable width v - belt groove formed by the axially fixed sheave element 64 and the axially adjustable element 66 . the combine operator selectively adjusts the width of the groove so as to vary the linear speed of the belt 124 and hence the operating speeds of the gathering and feeding units according to crop conditions . to increase operating speed , the operator manipulates a hydraulic control ( not shown ) to admit oil under pressure to hydraulic cylinder chamber 96 . shaft 60 and sleeve 92 behave as a single acting hydraulic cylinder with the rod remaining stationary while the body ( sleeve 92 ) carrying the movable sheave element 66 is biased towards the fixed sheave element 64 in the direction of increasing effective diameter , effectively reducing groove width and forcing the belt 124 outwards so as to increase belt speed . when the hydraulic pressure is released , belt tension pulls the belt radially inwards so as to force the sheave sections apart expelling hydraulic oil from the chamber 96 and reducing the effective diameter of the sheave so as to reduce belt speed . it will be noted that the close fitting telescoping engagement of the hub portion 118 of the movable sheave half 66 with the bore 84 of the axially fixed sheave portion 64 is of such axial extent in relation to hub diameter that the two sheave portions are mutually supporting with regard to radial alignment so that two axially separated bearings , 70 and 112 , rather than the conventional three bearings , are sufficient to support the countershaft sheave assembly 58 stably on the countershaft 60 . the transmission assembly 126 is thus driven at variable speed by the v - belt 124 engaging the groove formed between the axially fixed sheave element 134 and the axially movable sheave element 136 . in operation , the center distance between the countershaft assembly 34 and the transmission assembly 126 is fixed and , v - belt 124 being relatively inelastic , changes in the effective diameter of the selectively adjusted drive sheave of the countershaft assembly 34 must result in approximately equal and opposite changes in the effective diameter of the driven sheave 132 of the transmission assembly 126 . in the latter , the compression spring 138 biases the movable sheave element 136 towards the fixed sheave element 134 in the direction of increasing effective diameter . however , when the chamber 96 of the hydraulic actuator is pressurized , forcing the belt 124 to run at a greater effective diameter at the countershaft , the spring 138 is overcome forcing the sheave halves apart and allowing the belt to seek a smaller effective diameter on the driven sheave , thus increasing its speed . basic belt tension is set before going to the field by loosening the fasteners ( not shown ) securing the movable countershaft assembly 34 to the side 44 of the feeding unit and adjusting the center distance between the sheaves by means of the nuts 56 on the threaded portion 54 of brace 52 . under heavy load operating conditions an increase of belt tension is desirable and this is achieved automatically through the action of the torque responsive cam assembly 142 . if , when the gathering and feeding units are heavily loaded , belt 124 tends to slip , the slipping will result in relative rotational motion between the sheave elements 134 and 136 such that cam action will bias sheave element 136 towards sheave element 134 so as to increase the effective diameter of the driven sheave and hence increase belt tension . input to the planetary transmission 130 is through the input sun gear 146 which is keyed to the driven sheave assembly 132 , gear and sheave assembly being journaled as a unit on header drive shaft 38 . for normal ( forward ) harvesting operation , the operator , by means of operating handle 236 , moves the shifting collar 220 to the position shown in fig4 which drivingly connects the output sun gear 210 with the header drive shaft 38 so that the shaft is driven through the planetary pinion 192 and output gear 210 at a speed considerably slower than that of the sheave assembly 132 , a preferred speed reduction ratio being between 21 / 2 and 3 : 1 . to drive the gathering and feeding units in the reverse direction , for example to clear a blockage , the operator moves the shifting collar 220 to the position shown in fig5 whence the ring gear assembly 198 is drivingly connected to the header drive shaft 38 . drive is now transmitted from the input sun gear 146 through the planetary pinion 192 and the ring gear 198 so that shaft 38 is driven in a reverse direction , a preferred gear ratio being such that reverse speed is approximately half of normal forward or harvesting speed . if desired , the reversing capability may be made optional . if the planetary transmission is to be used for forward , speed reducing drive only the ring gear assembly 198 and shifting collar controls are omitted and a snap ring is fitted in groove 182 of the shaft hub 176 so as to hold the shifting collar 220 in the position shown in fig4 .

US-85302477-A

a belted absorbent article having an absorbent structure and a pair of opposed belt halves attached to the absorbent structure via a respective joint . the joint between each belt half and the absorbent structure is designed such that when each belt half is subjected to a tension force of 35 n acting along the belt half and the direction of applied tension creates an angle to the transverse axis of the absorbent structure , the following minimum average release times of each belt half from the absorbent structure are attained : when α = 10 °, t & gt ;& gt ; 720 seconds ; when α = 20 °, t & gt ;& gt ; 330 seconds ; when α = 25 °, t & gt ;& gt ; 240 seconds ; when α = 30 °, t & gt ;& gt ; 180 seconds ; and when α = 40 °, t & gt ;& gt ; 75 seconds .

in the drawings , reference numeral 10 generally denotes a belted absorbent article according to the present invention . the expression “ belted ” implies that the article is provided with means which pass around at least a portion of the waist of a wearer when worn and which means meet to thereby secure the article around the waist of the wearer . in the present invention , these means are belt halves 12 , 14 . preferably , the invention is to be practised on a disposable article . in this respect , the term “ disposable ” means any article which is not intended to be laundered and which is normally discarded once removed from the wearer . in addition to the belt halves 12 , 14 , the belted absorbent article further comprises an absorbent structure 16 extending about a first longitudinal axis 18 . thus , when the article is being worn , the first longitudinal axis will generally bisect the wearer into a left hand side and a right hand side when viewed from above . the absorbent structure 16 includes a topsheet 20 , a backsheet 22 and an absorbent batt 24 disposed between the topsheet and the backsheet . the specific components used to form the absorbent structure may be any of the types commonly used for such purposes . for example , a suitable topsheet 20 may be any soft flexible non - irritating liquid permeable material , such as woven or nonwoven webs of natural fibres ( e . g . wood or cotton fibres ), synthetic fibres ( e . g . polyester or polypropylene fibres or coform fibres ), combinations of natural and synthetic fibres , apertured films or porous foams . preferably , the topsheet 20 is manufactured from a nonwoven spunbonded polypropylene material having a basis weight of less than 20 g / m 2 . nevertheless , when the topsheet comprises a nonwoven web , the nonwoven web may instead be carded , wet - laid , meltblown , hydroformed or hydroentangled . the backsheet 22 is impervious to liquids and is preferably manufactured from a thin plastic film such as polyethylene , polypropylene , polyvinyl - chloride , or the like , or composite materials such as a film coated nonwoven material . the absorbent core 24 may be made in widely varying sizes and shapes and may comprise any suitable wettable hydrophilic fibres such as cellulosic fibres , possibly blended with synthetic polyolefin fibres . in certain embodiments , the absorbent core 24 may comprise a mixture of superabsorbent hydrogel - forming particles mixed with the hydrophilic fibres . the topsheet 20 and the backsheet 22 are connected together , either directly or indirectly , using any suitable known means . for example , the topsheet and the backsheet can be affixed directly to each other in selected areas using continuous or patterned layers of adhesive . the adhesive layer or layers may be sprayed or extruded in lines or dots . as is most clearly apparent from fig2 the absorbent structure has a transverse axis t dividing the structure into a front panel 26 terminating in a front end region 28 and a rear panel 30 terminating in a rear end region 32 . the absorbent structure is delimited by opposed longitudinal edges 34 and opposed transverse edges 36 . projecting from its opposed longitudinal edges 34 , the front end region 28 displays fastening tabs 38 . in a manner which will be explained in greater detail below , the fastening tabs 38 form part of a fastening system and are arranged to cooperate with corresponding parts of the fastening system on the belt halves 12 , 14 . although the fastening tabs 38 are shown projecting from the longitudinal edges 34 of the front panel of the absorbent structure 16 , it is to be understood that the tabs may instead project from the transverse edge 36 . in a further alternative embodiment , the fastening tabs 38 may be in the form of one or more patches affixed to the topsheet 20 on the front panel 26 . each belt half extends about a respective longitudinal axis ( hereinafter referred to as the second longitudinal axis ) 40 , 42 , with the belt halves being joined to the absorbent structure 16 such that the two belt halves 12 , 14 extend generally perpendicularly with respect to the first longitudinal axis 18 of the absorbent structure 16 . accordingly , in the shown embodiment , the two belt halves 12 , 14 extend generally perpendicularly from the longitudinal edges 34 at the rear end region 32 of the rear panel 30 of the absorbent structure 16 . it is , however , to be understood that the belt halves may be manufactured such that they form an angle to either the first longitudinal axis 18 or to the longitudinal edges 34 . the belt halves may be made of any suitable material or material combinations . in an exemplary embodiment , the belt halves are made from a laminate of an embossed transparent polypropylene film and a thermobonded nonwoven web of 30 g / m 2 basis weight . for improved wearer comfort , the belt halves are attached to the absorbent structure such that , when worn , the nonwoven web faces the wearer . in another embodiment , the belt halves may be made exclusively of nonwoven material . depending on the intended size of the wearer , each belt half 12 , 14 has a transverse extension of typically 10 to 12 cm and a longitudinal extension ( i . e . the extension beyond the longitudinal edge 34 of the absorbent structure ) of , for example , 35 cm . the belt halves are preferably identical , though it is to be understood that the absorbent article of the present invention may also have belt halves or different length and / or width . the inside surface , i . e . that surface of the belt half facing the wearer when worn , of one belt half ( belt half 14 in fig2 ) is provided with a first fastening means 44 for releasable engagement with a complementary second fastening means 46 on the outer surface of the other belt half 12 to thereby allow the belt to be secured around the waist of the wearer . the actual type of belt fastening means may be any of those known in the art , for example a hook - and loop system , an adhesive system , a system of buttons and button - holes , etc . irrespective of the type of fastening system employed , the fastening system should be capable of allowing adjustment of the tension of the belt halves around the waist of the wearer . thus , in the embodiment shown on fig2 the first fastening means is a patch of hook material while the second fastening means is a strip of loop material extending over a significant length of the belt half 12 . it will of course be apparent to the skilled person that more than one patch of hook material may be used and that the strip of loop material may be a plurality of smaller patches of loop material . the surface of the belt halves remote from the wearer when worn , i . e ., the outer surface of the belt halves , is provided with means ( not shown ) forming a part of the fastening system of the absorbent article . the means on the belt halves is complementary to , and therefore dependent on , the type of fastening tab 38 employed in the front end region 28 of the front panel 26 . thus , if the fastening tabs 38 are adhesive tabs , at least a region of the outer surface of the belt halves 12 , 14 should be capable of releasable engagement of the adhesive tabs . in the case in which the outer surface of the belt halves is a plastics film , it is advantageous to provide a reinforced so - called landing zone or zones for the tabs to engage with . if the fastening tabs 38 are hook tabs of a hook - and - loop fastening system , the outer surface of the belt halves will be provided with , or made from , a loop material for engagement with the hook fastening tabs . another possibility is that the outer surface of the belt halves is provided with patches of hook material for engagement with loop material of the topsheet 20 or patches of loop material attached to the topsheet in the front end region 28 of the front panel 26 . in a manner known per se in the art , the absorbent article of the present invention may be provided with elasticated leg cuffs to thereby provide improved sealing of the article around the legs of the wearer when worn . as is most clearly shown in fig2 and 3 , the absorbent structure 16 is provided with elastic ribbons 48 or strands affixed between the topsheet 20 and the backsheet 22 . the elastic ribbons extend from an area in the rear end region 32 remote from the transverse edge 36 along a path generally parallel to the longitudinal edges 34 of the absorbent structure to an area in the front end region 28 remote from its transverse edge 36 . in the illustrated embodiment , three elastic ribbons 48 or strands are shown for each leg cuff . the person skilled in the art will , however , appreciate that the actual number of elastic ribbons may be varied , as may their size . thus , although the ribbons are illustrated as threads , it will be appreciated that strips of elastic material may be used instead . each belt half 12 , 14 is attached to the absorbent structure 16 at the rear end region 32 of the rear panel 30 by a respective joint , generally denoted by reference numeral 50 . one example of a joint 50 which may be used in the absorbent article of the present invention is illustrated in fig3 . it is to be understood that , although the joint will be described below only with reference to one belt half 14 , an identical joint may be used for the other belt half 12 . a length 52 of the belt half 14 is attached to the absorbent structure 16 at the rear end region 32 between the topsheet 20 and the backsheet 22 . the length 52 of the belt half thus sandwiched between the topsheet and backsheet will vary depending on the size of the absorbent article , but is typically between 8 and 10 cm . when , and in what order , the belt half is attached to the topsheet and backsheet will depend on the chosen manufacturing process . the belt half 14 is generally spaced a short distance , for example about 1 cm , from the transverse edge 36 of the absorbent structure and , prior to being worn , the longitudinal axis 42 of the belt half may extend substantially parallel to the transverse edge . thus , in the illustrated embodiment , the longitudinal axis of the belt half extends parallel to the transverse axis t of the absorbent structure . the joint 50 between the belt half 14 and the rear end region 32 comprises two spaced substantially parallel lines of attachment 54 between the belt half and the backsheet 22 . the line of attachment 54 adjacent the longitudinal edge 34 of the absorbent structure 16 may be spaced a short distance from the longitudinal edge . this line of attachment is generally narrower than the line of attachment remote from the longitudinal edge 34 of the absorbent structure . the two spaced lines of attachment 54 generally extend from the transverse edge 36 of the rear end region parallel to the longitudinal axis 18 of the absorbent structure across the entire width of the belt half and slightly beyond . although the lines are shown to be continuous , it is to be understood that they may instead comprise intermittent lines of attachment . preferably , the lines of attachment 54 are adhesive bond lines , though any attachment methods , such as thermal or ultrasonic bonding , may be employed . the two spaced substantially parallel lines of attachment 54 at least partially delimit a non - attached longitudinally extending region 56 between the belt half 14 and the backsheet 22 . this non - attached region 56 permits the elastic ribbons 48 or strands of the elasticised leg cuffs to snap back during manufacture . thus , free ends of the elastic ribbons 48 or strands reside in the non - attached longitudinally extending region 56 . to firmly anchor the elastic ribbons 48 within the absorbent structure 16 , the joint 50 between the belt half 14 and the rear end region 32 further comprises a region 58 of attachment between the backsheet 22 and the belt half . the region 58 of attachment extends between the two spaced substantially parallel lines of attachment 54 over the elastic ribbons 48 . advantageously , the region 58 of attachment extends in the longitudinal direction beyond the point at which the two spaced parallel lines of attachment 54 terminate . the joint 50 between the belt half 14 and the rear end region 32 may further comprise at least one region of bonding between the belt half and the topsheet 20 . such region may comprise substantially the entire surface of the belt half which lies adjacent the topsheet 20 . this region of bonding may be suitably achieved by spray bonding the topsheet to the belt half . in accordance with the present invention , the joint 50 is designed to meet certain minimum requirements . the present inventors have discovered that , for the absorbent article to function satisfactorily , the joint 50 should be capable of withstanding a certain tension force applied to the belt halves at a certain angle α to the transverse axis of the absorbent structure for a certain minimum period of time . thus , and in a manner which will be explained in greater detail below , the joint is subjected to a test procedure such that , and as illustrated in fig4 a portion of the absorbent structure 16 is secured to a test rig , generally denoted reference numeral 60 , and a load of 35 n is applied to the belt half 14 while the belt half external of the absorbent structure 16 is maintained at a predetermined angle α to the transverse axis of the absorbent structure . the time up to failure of the joint , i . e . when the belt half completely dissociates from the absorbent structure , is measured . the time to failure is hereinafter referred to as the release time of the joint . in accordance with the present invention , the minimum average release times of the joint should be : in a preferred embodiment of the invention , the following minimum average release times ( t ) of each belt half from the absorbent structure are attained : in a more preferred embodiment of the invention , the following minimum average release times ( t ) of each belt half from the absorbent structure are attained : in a further embodiment of the invention , the following minimum average release times ( t ) of each belt half from the absorbent structure are attained : in accordance with a most preferred embodiment of the invention , the following minimum average release times ( t ) of each belt half from the absorbent structure are attained : the minimum average release times are established in the following manner . with reference to fig5 a section of the rear panel 30 including the joint 50 is cut out from the absorbent structure 16 . a first cut line 62 is made parallel to the longitudinal axis 18 of the absorbent article at least 45 mm from the end edge of the belt half 14 nearest the longitudinal axis 18 . the first cut line 62 extends beyond the lower edge , i . e . the edge nearest the transverse axis t of the absorbent article , of the belt half 14 by at least 45 mm . the first cut line intersects a second cut line 64 extending parallel to the transverse axis t of the absorbent article at least 45 mm from the lower edge of the belt half 14 . the thus cut out section of the absorbent structure 16 including the joint 50 is then clamped in the test rig 60 which will be described in greater detail in the following . with reference to fig6 the test rig 60 comprises a rectangular base plate 66 to which a rotatable plate 68 is mounted . a pair of clamps 70 spaced at 90 ° to each other are mounted on the rotatable plate 68 . with reference to fig4 the rotatable plate 68 can be rotated with respect to the rectangular base plate 66 such that suitable values of the angle α are obtainable . the test rig 60 is provided with locking means to enable the rotatable plate to be locked at angular positions at which desired values of α are obtained . the rectangular base plate 66 may be provided with holes 72 to enable the base plate to be maintained in a vertical position on a frame ( not shown ) or the like . dimensions and constructional details of the test rig 60 will be apparent from the attached fig7 to 14 . the method for establishing the minimum average release times is the following . sections are cut out from fifty identical absorbent articles . in order to avoid the influence of aging of the articles on the test results , the articles should be no more than 6 months old , i . e ., the test is to be performed on articles which have been manufactured during the past six months . the cut out section of a first absorbent structure 16 is secured by the clamps 70 to the test rig 60 , as shown in fig4 . the orientation of the cut out section must be such that the clamps 70 clamp the cut out section along lines parallel to the transverse axis t and the longitudinal axis 18 of the absorbent article . in fig4 the edges of the belt half 14 within the absorbent structure 16 are parallel to the transverse and longitudinal axes respectively . thus , these edges are parallel to , and spaced from the clamps 70 . in order to ensure that the clamps do not contact the belt half 14 , a spacing of about 1 cm may be employed . the rectangular base plate 66 is held vertically and the rotatable plate 68 is rotated until an angle α of 10 ° is attained . the rotatable plate is locked at this position and a weight is clamped to the free end of the belt half 14 . the weight is slowly released until it applies a tension to the belt half . the weight is then allowed to hang freely . the weight and clamp together apply a force of 35 n to the belt half . as soon as the weight is allowed to hang freely , a stop watch is started . as soon as the belt half completely dissociates from the absorbent structure , i . e ., when the weight hits the floor , the stop watch is stopped and the elapsed time is noted . the above procedure is repeated for nine further cut out sections at α = 10 °. for the next ten cut out sections , the above procedure is repeated for α = 20 °. batches of ten cut out sections are then subjected to the above procedure , but for α = 25 °, 30 ° and 40 °. the above procedure was conducted on a belted absorbent article to ensure that its joint 50 between each belt half and the absorbent structure is sufficiently strong . the following results were obtained ( note that the elapsed time is given in minutes and seconds ): the above example relates to a belted absorbent article in which the belt halves are substantially rectilinear , i . e ., the upper and lower longitudinal edges of the belt halves are substantially parallel to the second longitudinal axis 42 . thus , the angle α may be determined either by measuring the angle as shown in fig4 or by measuring the angle subtended by the second longitudinal axis 42 . in cases in which the belt halves are non - rectilinear , i . e ., the belt halves are curved , the angle α is determined by hanging the load of 35 n from the remote end of the belt half such that the load acts along the longitudinal axis of the belt half and determining the mid - point of the belt half between its upper and lower longitudinal edges at the joint 50 . a vertical line will thus be attained between the mid point and the load . the angle that this vertical line subtends to the transverse axis t of the absorbent article corresponds to the angle α . the invention is not restricted to the embodiments described above and shown in the drawings , but may be varied within the scope of the appended claims . for example , the topsheet 20 of the absorbent structure 16 may be provided with so - called standing gathers to assist in retaining bodily wastes within the confines of the absorbent structure .

US-90265601-A

an apparatus for treating solid tumors having at least one hollow needle having at least one perforation , at least one ground electrode , a pump for delivering a chemotherapeutic agent through the perforation in the hollow needle , one or more power supplies connected to the hollow needle and the ground electrode capable of delivering a pulse of alternating current between the hollow needle and the ground electrode of at least 1000 volts and no more than 1 millisecond duration , a direct current between the hollow needle and the ground electrode between about 1 ma and 100 ma , and a second alternating current having a frequency range between about 1 mhz and 1000 mhz .

for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitations of the inventive scope is thereby intended , as the scope of this invention should be evaluated with reference to the claims appended hereto . alterations and further modifications in the illustrated devices , and such further applications of the principles of the invention as illustrated herein are contemplated as would normally occur to one skilled in the art to which the invention relates . the present invention uses a combination of hyperthermia , chemotherapy and irreversible electroporation ( ire ) to take advantage of their synergism and delivers them sequentially and / or simultaneously to the local tumor area using a relatively simple device , which may thereby avoid surgery and extensive hospital treatment . as used herein , hyperthermia is the distribution of heat energy into tumor tissue . while not meant to be limiting , hyperthermia is typically not homogeneous because tumor histology shows heterogeneity . preferably , but not meant to be limiting , hyperthermia as practiced by the present invention heats at least a portion of the tumor tissue to at or slightly above 42 ° c ., where tumor blood flow decreases and microenvironments are hypoxic and of low ph . as used herein , chemotherapy with electrophoresis means the use of an electrical field to deliver a chemotherapeutic agent to a tumor . in the present invention , a chemotherapeutic agent is delivered into the vicinity of the tumor by positive pressure through a hollow needle , and then a dc current - driven electrophoresis electrode is used to drive the chemotherapeutic agent inside the tumor . as used herein , irreversible electroporation ( ire ) is defined as the application of short ( microsecond to millisecond ) high voltage electric pulses that permanently alter the cell &# 39 ; s transmembrane potential , thereby changing cell homeostasis and causing cell death . while not meant to be limiting , the “ cut - off ” point between reversible and irreversible electroporation is about 600 v / cm , depending upon pulse frequency / number / mode of delivery . also while not meant to be limiting , increasing the average pore size in cell membranes to 250 nm is generally sufficient to cause irreversible electroporation ( ire ). 1 ) a chemotherapeutic delivery system including a power source for electrophoretic transport of the chemotherapeutic agent , 2 ) a power source for uhf field generation , 3 ) a power source for ire ablation , and 4 ) a pistol for their application within or around the tumor . the power source for each of electrophoretic transport of the chemotherapeutic agent , uhf field generation , and ire ablation may be combined into a single power source . in a clinical application , an exemplary method of the present disclosure begins by delivering a local anesthetic to the tumor area using conventional means . the ground electrode ( s ) of the exemplary apparatus are then inserted into the patient &# 39 ; s tissue . the uhf electrodes are then activated inside the needles to heat the tumor tissues to approximately 45 ° c . for a duration of between 0 . 5 and 1 minute . sensors may be provided in each electrode to calculate temperatures around and inside the tumor , and the power supply may be configured to automatically shut off the power supply if temperature exceeds a certain threshold , for example , 45 ° c . once temperature has achieved a certain threshold , for example , and not meant to be limiting , 40 ° c ., the pump begins delivering a chemotherapeutic agent through needle ( s ) surrounding the tumor . preferably , this delivery process continues for about 5 minutes . also preferably , but not meant to be limiting , the chemotherapeutic agent is delivered in 60 second “ pulses ” to help achieve even saturation . as will be evident to those having ordinary skill in the art , the chemotherapeutic agent may be a combination of one or more molecules that are shown to kill cancer cells . as such , as used herein , the term “ chemotherapeutic agent ” should be understood to encompass chemotherapeutic agents either alone or in combination with other chemotherapeutic agents . upon temperature stabilization at a predetermined threshold , for example but not meant to be limiting , 44 ° c ., and initial drug saturation of the tumor , the ire generator is then activated , and irreversible electroporation begins using the hollow needle and the ground electrode . this results in non - thermal ablation , and the effect on local healthy tissues is minimized because the ground electrode is inside the tumor . immediately upon ire electrode activation , the dc current is imposed between the hollow electrode and the ground electrode , thereby electrophoretically driving the drug through tissues and towards the ground electrode . this step allows drug penetration deep into tumor tissue . preferably , both ire and uhf electrical fields are imposed for the remaining duration of the procedure , for example , between 7 and 10 minutes . upon removal of the needle electrode , the injection site is sanitized and a surgical bandage is applied . preferably , the central puncture ( where the hollow electrode was installed ) is not closed , but a sterile drainage tube is inserted to enable passive drainage . the drainage tube , in place for about 3 - 5 days , for example , helps ensure removal of necrotic debris . antibiotic is administered to the patient to prevent infection . the entire procedure can be repeated if a biopsy of the treated area reveals residual viable tumor . fig1 illustrates the manipulator portion of an exemplary device used in an exemplary embodiment of the present disclosure . as shown in fig1 , the device includes a hollow needle 1 , which is contained within a manipulator 2 . an ultrasound imager 3 is mounted on the front of the manipulator 2 . a fluid line 4 is provided to allow the flow of the chemotherapeutic agent from the pump ( not shown in this figure ) through the hollow needle 1 . an electrical connection 5 provides power from the power supply ( not shown in this figure ) to the hollow needle 1 and also provides communication between the computer ( not shown in this figure ), the servo drive 7 , and the ultrasound imager 3 . the trigger 6 is used to activate the servo drive 7 to inject the hollow needle 1 into a patient . fig2 shows the manipulator 2 of fig1 in operation . as shown in the figure , the hollow needle 1 contained within the manipulator 2 is inserted into a patient 8 . the ultrasound imager 3 is flush with patient 8 thereby allowing the operator 9 to have an accurate , real time image of the tumor ( not shown in this figure ) inside of the patient 8 . fig3 is an illustration of the ground electrode 9 of the present disclosure . as shown in fig3 , the ground electrode 9 is inserted into the tumor 11 . also shown in fig3 , in some aspects , the ground electrode 9 may have multiple prongs 10 to distribute the electrical pathway throughout the tumor 11 . fig4 is an illustration of the ground electrode 9 and multiple hollow electrodes 1 in one embodiment of the present disclosure . as shown in fig4 , the ground electrode 9 is inserted into the tumor 11 , and multiple hollow electrodes 1 are inserted in the surrounding tissue through which the chemotherapeutic agent 12 can be released . fig5 is an illustration of the complete apparatus of the present invention . as shown in fig5 , the computer 13 , power supply 14 , and pump 15 are all contained within the control unit 16 which is attached to the manipulator 2 by electrical connection 5 and fluid line 4 . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character . only certain embodiments have been shown and described , and all changes , equivalents , and modifications that come within the spirit of the invention described herein are desired to be protected . any experiments , experimental examples , or experimental results provided herein are intended to be illustrative of the present invention and should not be considered limiting or restrictive with regard to the invention scope . further , any theory , mechanism of operation , proof , or finding stated herein is meant to further enhance understanding of the present invention and is not intended to limit the present invention in any way to such theory , mechanism of operation , proof , or finding . thus , the specifics of this description and the attached drawings should not be interpreted to limit the scope of this invention to the specifics thereof . rather , the scope of this invention should be evaluated with reference to the claims appended hereto . in reading the claims it is intended that when words such as “ a ”, “ an ”, “ at least one ”, and “ at least a portion ” are used there is no intention to limit the claims to only one item unless specifically stated to the contrary in the claims . further , when the language “ at least a portion ” and / or “ a portion ” is used , the claims may include a portion and / or the entire items unless specifically stated to the contrary . likewise , where the term “ input ” or “ output ” is used in connection with an electric device or fluid processing unit , it should be understood to comprehend singular or plural and one or more signal channels or fluid lines as appropriate in the context . finally , all publications , patents , and patent applications cited in this specification are herein incorporated by reference to the extent not inconsistent with the present disclosure as if each were specifically and individually indicated to be incorporated by reference and set forth in its entirety herein .

US-201313919613-A

a tansdermal delivery device for effectively treating seasonal allergic rhinitis and chronic idiopathic urticariain in humans is disclosed and methods thereof .

transdermal delivery of active agents is measured in terms of “ relative release rate ” or “ flux ”, i . e ., the rate of penetration of the active agent through the skin of an individual . skin flux may be generally determined from the following equation : where j is the skin flux , p is the permeability coefficient and c is the concentration gradient across the membrane , assumed to be the same as the donor concentration . m represents the amount of drug entering the blood stream . the variable dm / dt represents the change in the amount of drug entering the blood stream over time . it is well understood in the art of transdermal delivery systems that in order to maintain a desired flux rate for a desired dosing period , it is necessary to include an overage of active agent in the transdermal delivery system in an amount that is substantially greater than the amount to be delivered to the patient over the desired time period . for example , to maintain the desired flux rate for a three day time period , it is considered necessary to include much greater than 100 % of a three - day dose of an active agent in a transdermal delivery system . this overage is necessary for creating a concentration gradient by means of which the active agent migrates through the layers of the transdermal delivery system to the desired site on a patient &# 39 ; s skin . the remainder of the active agent remains in the transdermal delivery system . it is only the portion of active agent that exits the transdermal delivery system that becomes available for absorption into the skin . the total amount of active agent absorbed into the patient &# 39 ; s blood stream is less than the total amount available . the amount of overage to be included in a transdermal delivery system is dependent on these and other factors known to the skilled artisan . it has been found that it is possible to treat seasonal allergic rhinitis and chronic idiopathic urticaria according to the present invention by providing a transdermal delivery system containing a sufficient amount of loratadine to provide a desired relative release rate for at least about 3 days , and after single administration ( application ) of the transdermal dosage form , leaving the dosage form on the skin for approximately a 3 to 8 day time period , thereby resulting in the flux being maintained over the prolonged period and effective blood plasma levels and management of seasonal allergic rhinitis or chronic idiopathic urticaria being maintained over the prolonged period . preferably , the desired flux is maintained at least about 5 , preferably at least about 7 days after application of the transdermal delivery system . transdermal dosage forms used in accordance with the invention preferably include a backing layer made of pharmaceutically acceptable material which is impermeable to loratadine . the backing layer preferably serves as a protective cover for the active agent , e . g . loratadine and may also provide a support function . examples of materials suitable for making the backing layer are films of high and low density polyethylene , polypropylene , polyvinylchloride , polyurethane , polyesters such as poly ( ethylene terephthalate ), metal foils , metal foil laminates of such suitable polymer films , textile fabrics , if the components of the reservoir cannot penetrate the fabric due to their physical properties and the like . preferably , the materials used for the backing layer are laminates of such polymer films with a metal foil such as aluminum foil . the backing layer can be any appropriate thickness which will provide the desired protective and support functions . a suitable thickness will be from about 10 to about 200 microns . desirable materials and thickness will be apparent to the skilled artisan . in certain preferred embodiments , the transdermal dosage forms used in accordance with the invention contain a polymer matrix layer . generally , the polymers used to form the biologically acceptable polymer matrix are those capable of forming thin walls or coatings through which pharmaceuticals can pass at a controlled rate . a non - limiting list of exemplary materials for inclusion in the polymer matrix includes polyethylene , polypropylene , ethylene / propylene copolymers , ethylene / ethylacrylate copolymers , ethylene vinyl acetate copolymers , silicones , rubber , rubber - like synthetic homo -, co - or block polymers , polyacrylic esters and the copolymers thereof , polyurethanes , polyisobutylene , chlorinated polyethylene , polyvinylchloride , vinyl chloride - vinyl acetate copolymer , polymethacrylate polymer ( hydrogel ), polyvinylidene chloride , poly ( ethylene terephthalate ), ethylene - vinyl alcohol copolymer , ethylene - vinyloxyethanol copolymer , silicones including silicone copolymers such as polysiloxane - polymethacrylate copolymers , cellulose polymers ( e . g ., ethyl cellulose , and cellulose esters ), polycarbonates , polytetrafluoroethylene and mixtures thereof . preferred materials for inclusion in the polymer matrix layer are silicone elastomers of the general polydimethylsiloxane structures , ( e . g ., silicone polymers ). preferred silicone polymers cross - link and are pharmaceutically acceptable . other preferred materials for inclusion in the polymer matrix layer include : silicone polymers that are cross - linkable copolymers having dimethyl and / or dimethylvinyl siloxane units which can be crosslinked using a suitable peroxide catalyst . also preferred are those polymers consisting of block copolymers based on styrene and 1 , 3 - dienes ( particularly linear styrene - isoprene - block copolymers of styrene - butadiene - block copolymers ), polyisobutylenes , polymers based on acrylate and / or methacrylate . the polymer matrix layer may optionally include a pharmaceutically acceptable cross - linking agent . suitable crosslinking agents include , e . g ., tetrapropoxy silane . preferred transdermal delivery systems used in accordance with the methods of the present invention include an adhesive layer to affix the dosage form to the skin of the patient for a desired period of administration , e . g ., about 3 to about 8 days . if the adhesive layer of the dosage form fails to provide adhesion for the desired period of time , it is possible to maintain contact between the dosage form with the skin by , for instance , affixing the dosage form to the skin of the patient with an adhesive tape , e . g , surgical tape . it is not critical for purposes of the present invention whether adhesion of the dosage form to the skin of the patient is achieved solely by the adhesive layer of the dosage form or in connection with a peripheral adhesive source , such as surgical tape , provided that the dosage form is adhered to the patient &# 39 ; s skin for the requisite administration period . the adhesive layer preferably includes using any adhesive known in the art that is pharmaceutically compatible with the dosage form and preferably hypoallergenic , such as polyacrylic adhesive polymers , acrylate copolymers ( e . g ., polyacrylate ) and polyisobutylene adhesive polymers . in other preferred embodiments of the invention , the adhesive is a pressure - sensitive contact adhesive , which is preferably hypoallergenic . the transdermal dosage forms which can be used in accordance with the present invention may optionally include a permeation enhancing agent . permeation enhancing agents are compounds which promote penetration and / or absorption of the loratadine into the blood stream of the patient . a non - limiting list of permeation enhancing agents includes polyethylene glycols , surfactants , and the like . alternatively , permeation of loratadine may be enhanced by occlusion of the dosage form after application to the desired site on the patient with , e . g . an occlusive bandage . permeation may also be enhanced by removing hair from the application site by , e . g . clipping , shaving or use of a depilatory agent . another permeation enhancer is heat . it is thought that heat enhancement can be induced by , among other things , using a radiating heat form , such as an infrared lamp , onto the application site after application of the transdermal dosage form . other means of enhancing permeation of loratadine such as the use of iontophoretic means are also contemplated to be within the scope of the present invention . a preferred transdermal dosage form which may be used in accordance with the present invention includes a non - permeable backing layer made , for example , of polyester ; an adhesive layer made , for example of a polyacrylate ; and a matrix containing the loratadine and other desirable pharmaceutical aids such as softeners , permeability enhancers , viscosity agents and the like . the active agent may be included in the device in a drug reservoir , drug matrix or drug / adhesive layer . preferably , the active agent is loratadine or a pharmaceutically acceptable salt thereof . certain preferred transdermal delivery systems also include a softening agent . suitable softening agents include higher alcohols such as dodecanol , undecanol , octanol , esters of carboxylic acids , wherein the alcohol component may also be a polyethoxylated alcohol , diesters of dicarboxylic acids , such as di - n - butyladiapate , and triglycerides particularly medium - chain triglycerides of the caprylic / capric acids or coconut oil , have proved to be particularly suitable . further examples of suitable softeners are multivalent alcohols , for example , levulinic acid , cocprylic acids glycerol and 1 , 2 - propanediol which can also be etherified by polyethylene glycols . a loratadine solvent may also be included in the transdermal delivery systems of the present invention . preferably , the solvents dissolve the loratadine to a sufficient extent thereby avoiding complete salt formation . a non - limiting list of suitable solvents include those with at least one acidic group . particularly suitable are monoesters of dicarboxylic acids such as monomethylglutarate and monomethyladipate . other pharmaceutically acceptable compounds which may be included in the reservoir or matrix include : solvents , for example alcohols such as isopropanol ; permeation enhancing agents such as those described above ; and viscosity agents , such as cellulose derivatives , natural or synthetic gums , such as guar gum , and the like . in preferred embodiments , the transdermal dosage form includes a removable protective layer . the removable protective layer is removed prior to application , and consists of the materials used for the production of the backing layer described above provided that they are rendered removable , for example , by a silicone treatment . other removable protective layers , for example , are polyltetra - fluoroethylene , treated paper , allophane , polyvinyl chloride , and the like . generally , the removable protective layer is in contact with the adhesive layer and provides a convenient means of maintaining the integrity of the adhesive layer until the desired time of application . the composition of the transdermal dosage forms used in accordance with the invention and the type of device used are not considered critical to the method of the invention , provided that the device delivers the active agent , e . g . loratadine , for the desired time period and at the desired flux rate and / or the desired delivery rate of the transdermal dosage form . certain transdermal dosage forms for use in accordance with the present invention are described in u . s . pat . no . 5 , 240 , 711 ( hille , et . al . ; assigned to lts lohmann therapie - systeme gmbh & amp ; co . ), hereby incorporated by reference . such transdermal delivery systems may be a laminated composite having an impermeable backing layer containing loratadine , e . g ., instead of buprenorphine , and optionally a permeation enhancer combined with a pressure - sensitive adhesive . a preferred transdermal dosage form in accordance with the &# 39 ; 711 patent includes : ( i ) a polyester backing layer which is impermeable to the drug ; ( ii ) a polyacrylate adhesive layer ; ( iii ) a separating polyester layer ; and ( iv ) a matrix containing loratadine , a solvent for the loratadine , a softener and a polyacrylate adhesive . the loratadine solvent may or may not be present in the final formulation . the transdermal delivery device described therein includes a backing layer which is impermeable to the active substance , a pressure - sensitive adhesive reservoir layer and optionally , a removable protective layer . preferably , the reservoir layer includes about 10 to about 95 %- wt polymeric material , about 0 . 1 to about 40 %- wt softener , about 0 . 1 to about 30 %- wt loratadine . a solvent for the loratadine base or pharmaceutically acceptable salt thereof may be included as about 0 . 1 to about 30 %- wt . the transdermal delivery system may also be prepared in accordance with the disclosure of international patent application no . wo 96 / 19975 ( hille , et . al . ; assigned to lts lohmann therapie - systeme gmbh ), hereby incorporated by reference , where loratadine is substituted for buprenorphine as an active agent . in this device , the loratadine transdermal delivery device contains resorption - promoting auxiliary substances . the resorption - promoting auxiliary substance forms an undercooled mass . the delivery system contains 10 % loratadine base , 10 - 15 % acid ( such as levulinic acid ), about 10 % softener ( such as oleyoleate ); 55 - 70 % polyacrylate ; and 0 - 10 % polyvinylpyrollidone ( pvp ). alternatively , the transdermal device may be a reservoir system . a reservoir system transdermal drug delivery patch comprises several different components . an exemplary construction includes a backing layer , an active drug and optional permeation enhancing solvent gel , a membrane , a skin contact adhesive layer , and a protective release coated liner film . characteristics of each component are set forth below : backing film : this layer is exposed to the external environment when the system is worn on the skin surface . it is impervious to penetration of the active drug contained within the system preventing the escape of the active drug through the backing film . the backing film serves as barrier layer . moisture , soaps , lotions and other elements are prevented from entering the system and diluting the active ingredients or altering the release characteristics of the system . the active drug and solvent are contained within the system to perform its designated function . the backing film also forms one half of the chamber which contains the active drug reservoir . the backing film must be capable of being suitably attached to the membrane in order to form the reservoir chamber . typical attachment methods include thermal , ultrasonic polymer heat seal or welding , and adhesive bonding . necessary mechanical properties include a low compliance for conformability to the skin surface and elasticity to allow for movement with the skin surface . typical thickness is in the range of 0 . 5 - 25 . 0 mil . a wide range of homogenous , woven , and non - woven polymer or composite materials are suitable as backing films . membrane : the membrane in combination with the backing film forms the chamber which contains the active drug reservoir . the membrane is attached to the backing film , and provides a support surface for the skin contact adhesive . the membrane can be a homogenous polymer film , or a material with a porous structure . the membrane may also be designed to control the transport rate of the active drug and / or the permeation enhancing solvent . necessary mechanical properties include a low compliance for conformability to the skin surface and elasticity to allow for movement with the skin surface . typical thickness is in the range of 0 . 25 - 30 . 0 mil and more preferably in the range of 0 . 5 to 25 . 0 mils . a wide range of homogenous , porous , woven , and non - woven polymer or composite materials are suitable as membranes and known in the art . active drug reservoir : the active drug is combined with a liquid vehicle to fill the reservoir chamber . a range of solvents can be used for the liquid vehicle . the solvents can be chosen to optimize skin permeation of the active ( enhancers ) or to optimize the permeation characteristics of the membrane or the adhesion of the skin contact adhesive . a viscosity increasing agent is often included in the vehicle to aid in the handling and system manufacturing process . the composition of the vehicle must be compatible with the other components of the system . the vehicle may be in the form of a solution , suspension , cream , lotion , gel , physical mixture or emulsion . this list is not meant to be exhaustive . skin contact adhesive : the system is affixed to the skin with a skin contact adhesive . the adhesive may cover the entire surface of the system membrane , be applied in an intermittent pattern , or only to the perimeter of the system . the adhesive composition must be of materials suitable for skin contact without creating intolerable adverse effects such as excessive skin irritation or sensitization . adequate adhesion to the membrane and skin are also necessary . the adhesive must also possess enough cohesive integrity to remain completely on the membrane upon removal of the system . the adhesive is applied in a thickness to provide a weight of 0 . 025 to 50 . 0 mg / cm 2 , more preferably 0 . 25 to 1 . 0 mg / cm 2 and most preferably 0 . 3 to 0 . 6 mg / cm 2 . typical materials include silicone , polyisobutylene ( pib ), and acrylates dissolved in organic solvents , aqueous emulsions , or directly applied by hot melt processing . release coated liner film : the liner film is removed from the system before application to the skin surface . the liner film serves the function as a protective barrier to the skin contact adhesive prior to use . the coating on the liner provides a release capability for the adhesive , allowing separation of the liner from the adhesive . a coating is not necessary if the liner material is readily removed from the adhesive without disrupting the reservoir system . typical thickness is in the range of 0 . 5 - 25 . 0 mil . a wide range of homogenous , woven , and non - woven paper , polymer or composite materials are suitable as liner films . release coatings are typically composed of paraffin , polyethylene , silicone or fluorocarbons . in other embodiments , the transdermal delivery system may be a plaster such as that described in u . s . pat . no . 5 , 225 , 199 to hidaka et al ., hereby incorporated by reference . such plasters include a film layer including a polyester film of about 0 . 5 to about 4 . 9 μm thickness , about 8 to about 85 g / mm strength , respectively in the two directions intersecting substantially at right angles , about 30 to about 150 % elongation , in the two directions intersecting substantially at right angles and an elongation ratio of a to b of about 1 : 0 to about 5 . 0 , wherein a and b represent data in two directions intersecting at right angles , and a is greater than b and wherein the polyester film includes about 0 . 01 to about 1 . 0 % by weight , based on the total weight of the polyester film , of solid fine particles in which the average particle size is about 0 . 001 to about 3 . 0 μm and an adhesive layer which is composed of an adhesive containing transdermally absorbable drugs ; wherein the adhesive layer is laminated on the film layer over the surface in about 2 to about 60 μm thickness . the average particle size is substantially not more than 1 . 5 times the thickness of the polyester film . the transdermal delivery system used in the present invention may also be prepared in accordance with u . s . pat . no . 5 , 879 , 701 , issued mar . 9 , 1999 to audett , et al ., hereby incorporated by reference , wherein solubilization enhancer compositions are provided which facilitate transdermal administration of basic drugs from transdermal systems composed of nonpolar adhesive materials . the solubilization enhancing composition is particularly useful in facilitating the administration of basic drugs using transdermal systems worn for at least four days containing drug reservoirs comprised of nonpolar materials such as polyisobutylene adhesives or the like . the solubilizing enhancing composition itself is preferably a liquid which is an isomeric acid mixture . examples of suitable solubilizers include , but are not limited to , oleic acid dimer and neodecanoic acid , with oleic acid dimer particularly preferred . the solubilizer constitutes at least about 0 . 10 wt . % of the reservoir , and preferably represents on the order of 0 . 25 wt . % to 1 . 0 wt . % of the reservoir . the amount of enhancer composition present in the drug formulation will depend on a number of factors , e . g ., the strength of the particular enhancer composition , the desired increase in skin permeability , and the amount of drug which is necessary to deliver . the adult oral dosage for loratadine is 10 mg / day . the bioavailability for the drug is 20 %, expressed as fraction , 0 . 20 of the oral dose made available to the blood stream from gastrointestinal absorption . a release rate for a loratadine transdermal delivery system was calculated from this data . 0 . 20 of the oral 10 mg daily dose provides 2 . 0 mg of loratadine available into the blood stream . therefore , an equal dose is required to be delivered transdermally . 2 . 0 mg / day is converted to 2000 mcg / 24 hours . this would require delivery of 83 . 3 mcg / hour . the largest desirable surface area for a transdermal patch is about 40 cm 2 . dividing 83 . 3 mcg / hour / 40 cm 2 by 40 , yields a release rate of 2 . 1 mcg / hour / cm 2 of transdermal patch surface area . to account for drug elimination , further pharmacokinetic data and physiological data was required . the plasma concentration at steady state for loratadine is 0 . 002 mcg / ml . the physiological clearance rate is 196 , 000 ml / hour . the dosing rate is obtained from the product of the steady state concentration of loratadine and a representative clearance rate . this product is 392 mcg / hour . the largest desirable surface area for a transdermal patch is about 40 cm 2 . dividing 392 mcg / hour / 40 cm 2 by 40 , yields a release rate of 9 . 8 mcg / hour / cm 2 of transdermal patch surface area . one of skill would expect a larger input rate or flux to maintain a steady state concentration in consideration of the loss of drug in the plasma due to elimination . a confirmatory calculation for flux requires further pharmacokinetic parameters . the volume of distribution for loratadine is 1 , 660 , 000 ml and the half - life is 8 . 4 hours . the elimination rate constant is 0 . 693 / half - life . the product of steady state concentration , volume of distribution and elimination rate constant yields a rate of 274 mcg / hour . the largest desirable surface area for a transdermal patch is about 40 cm 2 . dividing 274 mcg / hour / 40 cm 2 by 40 , yields a release rate of 6 . 85 mcg / hour / cm 2 of transdermal patch surface area . any type of transdermal delivery system may be used in accordance with the methods of the present invention so long as the desired pharmacokinetic and pharmacodynamic response ( s ) are attained over at least 3 days , e . g ., from about 5 to about 8 days . preferable transdermal delivery systems include e . g ., transdermal patches , transdermal plasters , transdermal discs , iontophoretic transdermal devices and the like . the following examples illustrate various aspects of the present invention . they are not to be construed to limit the claims in any manner whatsoever . the following general method is used in the following examples in which the transdermal device tested is a matrix system ( device ): step 1 : preparation of the active drug vehicle / solvent / adhesive matrix . active drug is combined with the liquid vehicle components and the adhesive components using appropriate mixing techniques well known in the art . simple mechanical mixers , motionless mixers , homogenizers , high shear mixers , and magnetic mixing devices can be employed . step 2 : preparation of the active drug / adhesive matrix coated liner . active drug / adhesive matrix coating is done with continuous web based equipment on a commercial scale . small sheet batches can be made readily in the lab manually . a mechanism for applying a controlled thickness coating of the active drug / adhesive matrix onto the liner is employed . if solvent - based adhesives are used , a procedure for driving off the solvent and drying the active drug / adhesive matrix is employed . the open surface of the active drug / adhesive matrix on the liner must be protected during processing . a second intermediate liner can be used to cover this active drug / adhesive matrix surface . step 3 : laminating of the membrane to active drug / adhesive and / or liner . the membrane is typically applied on line after solvent removal on a commercial scale . this avoids the need for a second liner . a separate web and a heat and / or pressure lamination station bonds the two layers . the membrane provides a non - stick surface to the open side of the adhesive and allows for further processing in a roll form . the following general method is used in the following examples in which the transdermal device tested is a reservoir system ( device ): step 1 : preparation of the adhesive coated liner . adhesive coating is done with continuous web based equipment on a commercial scale . small sheet batches can be made readily in the lab manually . a mechanism for applying a controlled thickness coating of the adhesive onto the liner is employed . if solvent - based adhesives are used , a procedure for driving off the solvent and drying the adhesive is employed . the open surface of the adhesive on the liner must be protected during processing . a second intermediate liner can be used to cover this adhesive surface . step 2 : laminating of the membrane to adhesive and / or liner . the membrane is typically applied on line after solvent removal on a commercial scale . this avoids the need for a second liner . a separate web and a heat and / or pressure lamination station bonds the two layers . the membrane provides a non - stick surface to the open side of the adhesive and allows for further processing in a roll form . step 3 : preparation of the active vehicle / solvent combination . active drug is combined with the liquid vehicle components using appropriate mixing techniques well known in the art . simple mechanical mixers , motionless mixers , homogenizers , high shear mixers , and magnetic mixing devices can be employed . other ingredients are also incorporated at this time . these may include permeation enhancers and viscosity thickeners , for example . step 4 : finalizing the delivery system utilizing the form , fill and seal process incorporating the reservoir and backing film . this process can be carried out in either a horizontal or vertical plane . the horizontal mode requires a thickened viscosity of the reservoir vehicle , while the vertical mode can handle liquid vehicles of minimal viscosity . in the horizontal mode a dispensing head places a fixed volume drop of the drug vehicle onto the surface of the membrane . the backing film is then placed over the drop of vehicle , and then bound to the membrane to enclose the active / vehicle . a heated die is commonly used to form a heat seal welded bond . in web based systems a die cutting and packaging station often follows . the test methods utilized in the following examples involves the use of a permeation cell . several permeation cell designs are available for in - vitro permeation testing . these include “ franz cells ”, “ valia - chien cells ”, and “ bronaugh cells ”. each cell design shares several common characteristics . all cells are made with a definable surface area for permeation . all cells contain two chambers and a clamping mechanism to hold the test membrane positioned between the two cell chambers . several exemplary test membranes include mouse skin and human cadaver skin . the membrane may be oriented in either the horizontal or vertical plane based on the cell special arrangement . one chamber serves as a reservoir ( donor ) for the drug to be tested , the second is a place where the permeated drug is accumulated ( receptor ). the receptor is often chosen to mimic the physiological conditions found beneath the membrane in - vivo . in the case where a complete transdermal system is the donor , it is clamped between the two chambers and only the receptor chamber is filled . calculation of the permeation rate ( j ) requires knowledge of the concentration ( c ) of the drug in the receptor chamber , the permeation area ( a ), sampling interval ( t ) and the receptor volume ( v ). the equation below is typical : only the drug concentration and testing time vary in typical experiments . the drug concentration is determined by any appropriate analytical technique such as high performance liquid chromatograpy , gas chromatograpy , or ultraviolet spectrophotometry . other considerations in the testing system may include temperature control systems , receptor stirring systems , flow through receptor chambers , and automated sampling equipment utilizing pumps and fraction collectors . partial receptor sampling protocols have been used in situations where the sensitivity of the analytical method for determining the drug concentration was less than optimal . cells valia chien membrane human cadaver skin a ( cm2 ) 0 . 636 v ( ml ) 4 . 0 receptor ethanol / water 40 / 60 sampling points 6 , 24 , 48 , 72 , 120 , 144 , 168 hours sampling mode : partial , 0 . 6 ml per point , replace with fresh receptor . a loratadine drug reservoir formulation was prepared having the formulation set forth in table 1a below : the formulation of table 1a was prepared and incorporated into a permeation testing apparatus according to the following procedure : 1 . loratadine is dissolved with ethanol and water and the solution is placed into the donor cell . 2 . the ethylvinylacetate membrane is placed against the donor cell . 3 . thereafter , the human cadaver skin is placed between the membrane and the receptor cell and the apparatus is secured . the formulation of example 1 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 1 - 1 , 1 - 2 , 1 - 3 ) were conducted giving the results listed in table 1b below : based on the permeation results of example 1 , listed in table 1b , the averages of the three calculated and the flux results listed in table 1c below were obtained : a loratadine reservoir and adhesive formulation was prepared having the formulation set forth in table 2a below : the formulation of table 2a was prepared and incorporated into a permeation testing apparatus according to the following procedure : 1 . loratadine is dissolved with ethanol and water and the solution is placed into the donor cell . 2 . the polyethylene membrane is coated with a silicone adhesive and placed against the donor cell . the adhesive coated membrane is positioned opposite from the donor cell . 3 . thereafter , the human cadaver skin is placed between the adhesive coated polyethylene membrane and the receptor cell and the apparatus is secured . the formulation of example 2 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 2 - 1 , 2 - 2 , 2 - 3 ) were conducted giving the results listed in table 2b below : based on the permeation results of example 2 , listed in table 2b , the following flux results listed in table 2c below were obtained : a loratadine active drug / adhesive matrix formulation was prepared having the formulation set forth in table 3a below : the formulation of table 3a was prepared and incorporated into a permeation testing apparatus according to the following procedure : 1 . loratadine is dispersed in the requisite amount of ethyl acetate and adhesive solution to form the active drug / adhesive matrix . 2 . the active drug / adhesive matrix is applied to a backing layer and dried . 3 . thereafter , the patch is applied to the human cadaver skin affixed to the receptor cell . the formulation of example 3 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ) and the membrane was a human cadaver skin membrane . three permeation tests ( 3 - 1 , 3 - 2 , 3 - 3 ) were conducted giving the results listed in table 3b below : based on the permeation results of example 3 , listed in table 3b , the averages of all three calculated and the flux results listed in table 3c below were obtained : a loratadine active drug / adhesive matrix formulation was prepared having the formulation set forth in table 4a below : the formulation of table 4a was prepared and incorporated into a permeation testing apparatus according to the same procedure as in example 3 , using duro - tak 87 - 6430 as the adhesive solution . the formulation of example 4 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 4 - 1 , 4 - 2 , 4 - 3 ) were conducted giving the results listed in table 4b below : based on the permeation results of example 4 , listed in table 4b , the averages of all three test were calculated and the flux results listed in table 4c below were obtained : a loratadine active drug / adhesive matrix formulation was prepared having the formulation set forth in table 5a below : the formulation of table 5a was prepared and incorporated into a permeation testing apparatus according to the same procedure as in example 3 , using duro - tak 87 - 8298 as the adhesive solution . the formulation of example 5 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). two permeation tests ( 5 - 1 , 5 - 2 ) were conducted giving the results listed in table 5b below : the average of the two permeation tests of example 5 was calculated and is listed in table 5c based on the permeation results of example 5 , listed in table 5b , the following flux results listed in table 5d below were obtained : a loratadine active matrix / adhesive matrix formulation was prepared having the formulation set forth in table 6a below : the formulation of table 6a was prepared and incorporated into a permeation testing apparatus according to the same procedure as in example 3 . the formulation of example 6 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 6 - 1 , 6 - 2 , and 6 - 3 ) were conducted giving the results listed in table 6b below : based on the permeation results of example 6 , listed in table 6b , the following flux results listed in table 6c below were obtained : a loratadine active drug / adhesive matrix formulation was prepared having the formulation set forth in table 7a below : the formulation of table 7a was prepared and incorporated into a permeation testing apparatus according to the same procedure as in example 3 , using ma - 24 + mineral oil as the adhesive solution and without the use of ethyl acetate . the formulation of example 7 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 7 - 1 , 7 - 2 , and 7 - 3 ) were conducted giving the results listed in table 7b below : based on the permeation results of example 7 , listed in table 7b , the following flux results listed in table 7c below were obtained : a active drug / adhesive matrix formulation was prepared having the formulation set forth in table 8a below : the formulation of table 8a was prepared and incorporated into a permeation testing apparatus according to the same procedure as in example 3 . the formulation of example 8a was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 8 - 1 , 8 - 2 , and 8 - 3 ) were conducted giving the results listed in table 8b below : based on the permeation results of example 8 , listed in table 8b , the following flux results listed in table 8c below were obtained : a active drug / adhesive matrix formulation was prepared having the formulation set forth in table 9a below : the formulation of table 9a was prepared and incorporated into a permeation testing apparatus according to the same procedure as in example 3 . the formulation of example 9a was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 9 - 1 , 9 - 2 , and 9 - 3 ) were conducted giving the results listed in table 9b below : based on the permeation results of example 9 , listed in table 9b , the following flux results listed in table 9c below were obtained : a active drug / adhesive matrix formulation was prepared having the formulation set forth in table 10a below : the formulation of table 10a was prepared and incorporated into a permeation testing apparatus according to the same procedure as in example 3 . the formulation of example 10a was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 10 - 1 , 10 - 2 , and 10 - 3 ) were conducted giving the results listed in table 10b below : based on the permeation results of example 10 , listed in table 10b , the following flux results listed in table 10c below were obtained : a active drug / adhesive matrix formulation was prepared having the formulation set forth in table 11a below : the formulation of table 11a was prepared and incorporated into a permeation testing apparatus according to the same procedure as in example 3 using transcutol p as an additional solvent . the formulation of example 11a was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 11 - 1 , 11 - 2 , and 11 - 3 ) were conducted giving the results listed in table 11b below : based on the permeation results of example 11 , listed in table 11b , the averages of the permeation tests were calculated and the flux results listed in table 11d below were obtained : a active drug / adhesive matrix formulation was prepared having the formulation set forth in table 12a below : the formulation of table 12a was prepared and incorporated into a permeation testing us according to the same procedure as in example 3 using lauryl alcohol as an additional solvent . the formulation of example 12a was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 12 - 1 , 12 - 2 , and 12 - 3 ) were conducted giving the results listed in table 12b below : based on the permeation results of example 12 , listed in table 12b , the averages of the permeation tests were calculated and the flux results listed in table 12d below were obtained : a loratadine reservoir and active drug / adhesive matrix formulation was prepared having the formulation set forth in table 13a below : the formulation of table 13a was prepared and incorporated into a permeation testing apparatus according to the following procedure : 1 . loratadine is dissolved with ethanol and water and the solution is placed into the donor cell . 2 . loratadine is dispersed in the adhesive solution and ethyl acetate solvent to form the active drug / adhesive matrix . 3 . the polyethylene membrane is coated with active drug / adhesive matrix and placed against the donor cell and dried . the coated surface of the membrane is positioned opposite from the donor cell . 4 . thereafter , the human cadaver skin is placed between the coated membrane surface and the receptor cell and the apparatus is secured . the formulation of example 13 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 13 - 1 , 13 - 2 , and 13 - 3 ) were conducted giving the results listed in table 13b below : based on the permeation results of example 13 , listed in table 13b , the averages of the permeation test were calculated and the flux results listed in table 13d below were obtained : a loratadine reservoir and active drug / adhesive matrix formulation was prepared having the formulation set forth in table 14a below : the formulation of example 14 was prepared and incorporated into a permeation testing apparatus according to the procedure as in example 13 . the formulation of example 14 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 14 - 1 , 14 - 2 , and 14 - 3 ) were conducted giving the results listed in table 14b below : based on the permeation results of example 14 , listed in table 14b , the averages of the permeation tests were calculated and the flux results listed in table 14d below were obtained : a loratadine reservoir and active drug / adhesive matrix formulation was prepared having the formulation set forth in table 15a below : the formulation of table 15a was prepared and incorporated into a permeation testing apparatus according to the following procedure : 1 . loratadine is dissolved with ethanol and water , klucel hf is added and the solution is placed into the donor cell . 2 . loratadine is dispersed in the adhesive solution and ethyl acetate solvent to form the active drug / adhesive matrix . 3 . the polyethylene membrane is coated with active drug / adhesive matrix and placed against the donor cell and dried . the coated surface of the membrane is positioned opposite from the donor cell . 4 . thereafter , the human cadaver skin is placed between the coated membrane surface and the receptor cell and the apparatus is secured . the formulation of example 15 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 15 - 1 , 15 - 2 , and 15 - 3 ) were conducted giving the results listed in table 15b below : based on the permeation results of example 15 , listed in table 15b , the averages of the permeation tests were calculated and the flux results listed in table 15d below were obtained : a loratadine reservoir and active drug / adhesive matrix formulation was prepared having the formulation of table 16a below : the formulation of example 16 was prepared and incorporated into a permeation testing apparatus according to the procedure as in example 15 . the formulation of example 16 was tested using a permeation cell with a definable surface area for permeation . the receptor of the permeation cell was ethanol : water ( 40 : 60 ). three permeation tests ( 16 - 1 , 16 - 2 , and 16 - 3 ) were conducted giving the results listed in table 16b below : based on the permeation results of example 16 , listed in table 16b , the averages of the permeation tests were calculated and the flux results listed in table 16d below were obtained : in vitro skin permeation studies with cadaver skin quantitatively predict the pharmacokinetics and extent of drug absorption from the transdermal delivery dosage form . matching in vitro skin donors to the in vivo population improves the correlation . further improvements in this correlation are achieved by matching application sites . it will be readily apparent that various modifications to the invention may be made by those killed in the art without departing from the scope of this invention . for example , many different transdermal delivery systems may be utilized in order to obtain the relative release rates and plasma levels described herein . further , it is possible that mean values for plasma concentrations over a particular patient population for a particular described time point along the dosing interval may vary from the plasma concentration ranges described herein for that time point . such obvious modifications are considered to be within the scope of the appended claims .

US-4560701-A

a uterus maneuvering apparatus comprising a lengthwise elongated boom , and a strut carried at one end of the boom to be pivoted relative to the boom , the strut and boom adapted to be inserted via the vaginal canal to locate the strut to project in the uterine cavity ; actuator structure associated with the boom and strut for effecting controlled pivoting of the strut and worm gear mechanism through which drive to effect said pivoting is effected . control structure may be provided for controlling the actuator structure , and including a servo system having an extra - corporeal manual control structure , for coupling between the manual control structure and actuator structure , the coupling including electrical signal transmission structure .

in fig1 the instrument 10 includes a tip in the form of a strut 11 movable about two axes 12 and 13 ( x and y axes ) for maneuvering the uterus 14 into which it has been inserted . the patient &# 39 ; s abdominal cavity is seen at 15 , and a laparoscope 16 projects into that cavity . a light source 17 , on or associated with the laparoscope , illuminates the pelvic organs . the surgeon or physician normally stands adjacent the patient to look downwardly toward 16 and 17 ; and he / she is , therefore , at a distance , or remote from , the end 18a of the longitudinally elongated , narrow housing or boom 18 of the uterine manipulator projecting into and from the vaginal entrance 19 . boom 18 supports strut 11 , for rotation about axes 12 and 13 ; and merely as illustrative , a rotor 20 is pinned at 21 to the end of the boom to pivot about x axis 12 , and one end of the strut 11 is connected to the rotor to rotate therewith . an elongated actuator member 22 is connected with the rotor at 22a , in offset relation to 21 , i . e ., to &# 34 ; crank &# 34 ; the rotor 20 about axis 12 , as member 22 is moved longitudinally endwise . a linear actuator 23 is connected to member 22 , at the end of the instrument outside the patient &# 39 ; s body . actuator 23 is in turn carried by the rotary actuator 24 supported for rotation by a base 25 . the latter is adjustably fixed in position by a clamp 26 or other means holding base 25 to a table 27 . other devices to support actuator 24 for rotation about axis 13 may be employed . actuator 24 is connected to the boom 18 to support it for rotation about axis 13 , as actuator 24 controllably rotates , clockwise or counterclockwise , about y axis 13 . fig1 shows two joysticks 30 and 31 supported on a carrier 32 , as at the location of the physician . the two joysticks are pivotally supported , as at 30aand 31a , and are pivotable to control the strut rotation about x axis 12 , ( i . e ., up and down ) and boom rotation about y axis 13 . a servo system is provided , as indicated at 33 , for coupling between the manual control means ( i . e ., joysticks 30 and 31 , for example ) and the actuator means ( i . e ., 23 and 24 , for example ). the coupling includes electrical signal transmission means , indicated at 40 , in the form of a radio signal transmission link . radio transmitter 41 , at the manual control location , and receiver 42 , at the location of the actuators , transmits position control signals or data for reception at the actuators , to position the latter . am or fm may be used , such transmission and reception circuitry being known . a feedback signal transmitter 43 at the location of the actuators transmits feedback signals for reception by a receiver 44 at the location of the control joysticks . fig3 shows one basic form of an analog servo system , with a joystick - controlled input shaft 50 , and an output - controlled shaft 51 ( rotary or linear actuator ), which corresponds to the output member of the actuator 23 or 24 . a wiper 54 on the shaft 50 variably engages a resistance 55 of a potentiometer 56 , to derive a position control signal on lead 57 fed to comparator 58 . similarly , a wiper 59 on the actuator output shaft 51 is moved by the latter to variably engage a resistance 60 of a potentiometer 61 , to derive a shaft position - determined feedback signal on the feedback loop 62 , and also fed to the comparator 58 . the differencing output of the latter is transmitted at 63 to the actuator 24 to drive it forward or backward until the controlled position of shaft 51 ( i . e ., of boom 18 ) corresponds to the controlling position of the joystick . the radio communication link , including circuitry , is indicated at 65 . a similar servo is provided for the second joystick controlling the position of the actuator 23 that angularly positions the strut 11 in the uterus . suitable dc amplification may be provided in association with the actuators to drive step - motors , or pulse motors , associated with such actuators in response to control signal reception . the radio link at 65 may be replaced by elongated , flexible wires that extend to the actuators 23 and 24 , from the comparator ; and in that event , a dc amplifier may be associated with the comparator . analog or digital servo systems may be employed . fig1 also shows a duct 70 extending along the boom 18 for controllably conducting examination or treatment fluid to the uterus . for example , a colored fluid ( such as methylene blue , in saline aqueous solution ) can be injected for observation . similarly , an inflation air duct 71 may extend along the boom 18 for controllably conducting such air or gas to a balloon 72 at the middle of the strut , to be inflated in the uterus , as may be desired , for example to hold the apparatus element 11 positioned in the uterine cavity . a crt screen is shown at 80 to display the output of the laparoscope 16 , i . e ., showing the position of the uterus ; and the surgeon may merely operate the joysticks to maneuver the uterus to desired position , as displayed at 14a on the screen . scope 16 typically includes fiber optical elements , connected to the crt or its circuitry . fig2 shows a single joystick 90 replacing the dual joysticks 30 and 31 , to simplify operation and control . joystick 90 rotates about dual axes indicated at x and y , to control the two actuators . in fig1 an adjustable support may be provided for base 25 to adjust along three perpendicular axes , for patient comfort . see for example adjustable jackscrew 94 , to tilt the base , as for example relative to the patient undergoing examination . a usable servo positioning control system , with radio link , is sold by futaba corporation of america , 4 studebaker , irvine , calif . such control systems are used to radio control model airplanes . in fig6 a boom 118 supports strut 111 for rotation about x axis 112 and y axis 113 . axis 113 is defined by boom 118 , the boom carrying the strut and being itself rotatable about axis 113 . see arrows 185 . a rotor 120 carries the strut 111 and is pivotally connected at 121 to the distal end of the boom , as via a bracket 108 . an elongated rotary actuator link 122 extents within the boom 118 , to rotate about axis 113 and thereby effect rotation of the rotor 120 and strut 111 about axis 112 . worm gear elements 181 and 182 are operatively located between link 122 and the rotor to effect such controlled rotation of the strut about axis 112 and to hold or maintain the strut in angular position ( relative to the boom ) to which it has been rotated . see in this regard spiral thread 181 defined by the end of link 122 , and gear teeth 182 on the rotor 120 and meshing with thread 181 . link 122 is rotatable clockwise and counterclockwise about axis 113 , to rotate strut 111 clockwise and counterclockwise about axis 112 . referring to fig4 and 5 , an electrically responsive rotary actuator 124 is carried by the housing or frame 186 ; and a worm gear drive 197 is coupled between 124 and the rotary boom 118 . drive 197 includes a shaft 198 rotated by actuator or motor 124 , spiral worm thread 198a on shaft 198 , worm gear 199 on boom 118 extents within the housing , and gear teeth 199a on 199 and meshing with worm thread 198a . a knob 194 on shaft 198 extends at the housing exterior , to be grasped and rotated manually , to controllably rotate shaft 198 and override the motor 124 , if and when desired . actuator means is associated with the strut 111 ( as via rotary link 122 ) for effecting controlled pivoting thereof , as referred to . the actuator means preferably includes worm gear mechanism through which such controlled pivoting is effected , and to selected &# 34 ; held &# 34 ; position about axes 112 and 113 . see in this regard the provision of an electrically responsive actuator 123 carried by housing or frame 186 , and a worm gear drive 187 coupled between 123 and the rotary link 122 , such as a shaft extending within the housing . drive 187 includes a shaft 188 rotated by rotary actuator or motor 123 , spiral worm thread 188a on shaft 188 , worm gear 189 on link 122 extents within the housing , and gear teeth 189a on 189 and meshing with worm thread 188a . a knob 193 on shaft 188 extends at the exterior of the housing , to be grasped and rotated manually to controllably rotate shaft 188 and override the motor 123 , if and when desired . fig7 shows the worm and gear elements 160 and 161 of a worm gear drive in greater detail . an inflatable balloon 164 is carried by the strut , as also referred to above . also , treatment liquid may be supplied to the end of the strut for dispensing , as at 210 , via duct 165 on the boom and coupled at 166 to the strut to flow within a strut passage 167 . overrides 193 and 194 may be operated if the motors 123 and 124 are deactivated , or otherwise fail , or if joystick control of the motor , as described above in conjunction with drives 123 and 124 is insufficient for any reason . note radio antennae 142a and 142b associated with the motors and corresponding to 42 described above . bearings for the shafts 188 and 198 are indicated at 144 - 147 . bearing supports for the boom 118 are seen at 148 and 149 . a bearing support for link 122 is seen at 150 . the link also has rotary support at the bore 118a of the boom . the servo control system of fig1 - 3 is applicable to fig4 - 7 . strut 111 may have removable connection at 183 with the rotor 120 , enabling attachment of a new strut to the rotor each time the apparatus is to be used . a device , such as a clamp 26 , is usable to hold the housing 186 at a selected angle relative to horizontal , as on table 27 , for application of the boom and strut to a patient . see also set height adjustment at 94 .

US-50489995-A

a pet chew toy has a body which is formed from an elastic plastic / elastomer and has an opening extending into an associated internal cavity in the body into which treats larger than the opening can be inserted due to the elasticity of the material and returned therein due to the relaxed size of the opening . chewing by the pet fragments the treats and allows the smaller fragments to fall out through the opening . the opening can be slots , rounded holes , or other openings to vary the technique needed to extract the treats from the toy .

in the following detailed description , certain specific terminology will be employed for the sake of clarity and a particular embodiment described in accordance with the requirements of 35 usc 112 , but it is to be understood that the same is not intended to be limiting and should not be so construed inasmuch as the invention is capable of taking many forms and variations within the scope of the appended claims . referring to fig1 - 6 , a first embodiment of a pet chew toy 10 according to the invention is shown therein . this embodiment comprises a body of a general “ wishbone ” shape , having an elongated hollow straight stem portion 12 terminating in a hollow enlarged knob end 14 , and a pair of hollow curved elongated branch portions 16 both integral with one end of the stem portion 12 , the branches 16 also both terminating in hollow enlarged knob ends 18 . the pet chew toy 10 is preferably molded from a tough abrasion resistant plastic such as a tpu ( thermoplastic polyurethane ) or a tpe ( thermoplastic elastomers ) to withstand abrasion and sustained chewing by dogs or other pets . the plastic used must be formulated so that the outer portions of the chew 10 are readily flexed inwardly by the pet in biting down on the chew toy 10 . each of the straight stem portion 12 , the enlarged ends 14 , branches 16 and enlarged ends 14 and 18 thereof are hollow , having pairs of internal cavities , each on one side of a common internal partition ( fig2 ). the pairs of internal cavities 12 a , 14 a , 16 a and 18 a are defined by opposing pairs of curved walls 12 b , 14 b , 16 b and 18 b extending towards each other and over the respective cavities 12 a , 14 a , 16 a and 18 a . a pair of central slots 12 c and 16 c extend between each of the outer pairs of walls 12 b and 16 b opening into a respective cavity 12 b , 16 b . the enlarged ends 14 , 18 have rounded pairs of openings 14 c and 18 c extending into the respective cavities 14 a , 18 a . the slots 12 c and 16 c and holes 14 c and 18 c are smaller than the cavities 12 a , 14 a , 16 a and 18 a with which they are associated such as to enable treats inserted therein to be retained . the pairs of walls 12 b , 14 b , 16 b and 18 b can be readily pulled apart to allow insertion of a treat 22 larger than the slots or holes or the larger treats may also be inserted by being pushed in through the same , stretching of the plastic allowing passage of the treat . the pet chewing on the toy 10 will cause the walls 12 b , 14 b , 16 b and 18 b to be compressed inwardly to crush the treats 22 into smaller pieces which can then drop out through the various slots and holes to be able to be eaten by the pet . the relatively gross deformations of the walls 12 b , 14 b , 16 b and 18 b caused by chewing enhance the cleaning action on the pet &# 39 ; s teeth and also stimulation of the pet &# 39 ; s gums . the differing shapes of the slots and holes require different techniques to extract the treats , lengthen the time of interest in the toy . fig7 - 11 show a “ dog bone ” shape form of the body of a chew toy 24 according to a second embodiment of the invention , with a hollow curved elongated portion 26 at the middle , and hollow rounded end portions 28 , 30 , 32 , 34 , attached at each end of the elongated portion 26 . a single cavity 36 extends within the elongated portion 26 with a single slot 38 defined between two curved walls 40 , 42 extending towards each other and opening into the cavity 32 . each hollow rounded end portion 28 , 30 , 32 , 34 has a rounded cavity 44 , 46 , 48 , 50 defined therein with a large circular opening 52 , 54 , 56 , 58 opening into each respective cavity from the top of the chew toy 24 . a small venting opening 60 , 62 , 64 , 66 is at the back of each end portion 28 , 30 , 32 , 34 to prevent a vacuum from being crated . curving walls extend around each large opening 52 , 54 , 56 , and 58 . the flexibility of each of the walls 40 , 42 and around each large opening allows pushing insertion of a larger sized treat by stretching of the plastic material . a compression of the walls 40 , 42 crushes the treats to allow the fragments to drop out in a similar fashion to the first described embodiment . fig1 - 15 show a body of a star pattern chew toy 68 , in which a hollow flattened spherical central portion 70 is surrounded by a ring of smaller hollow flattened spherical portions 72 a - 72 h . the spherical portions 70 , 72 a - 72 h are approximately shaped as spheres which are flattened somewhat as can be seen in fig1 and 15 . each has an interior cavity 74 , 76 a - 76 h large circular opening 78 , 80 a - 80 h in the top allows access to the associated cavity 74 , 76 a - 76 h . the exterior top wall 32 of each rounded portion 70 , 72 a - 72 h arches over the associated interior cavity 74 , 76 a - 76 h at the top thereof . treats larger than the openings 78 , 80 a - 80 h can be inserted into these openings 74 , 76 a - 76 h therein due to the flexibility and stretchability of the wall 80 ? ?, 82 a - 82 h . smaller vent openings 86 , 88 a - 88 h are also included to prevent development of a vacuum . rounded protrusions 90 extending from the outer diameter are provided in alternate portions 72 a , 72 c , 72 e , 72 g to create features for tooth cleaning . a fanciful fish shaped embodiment of a chew toy 92 is shown in fig1 - 19 which has hollow flattened spherical portions 94 and 96 similar to those of chew toy 68 but molded into a circular solid portion 98 . a hollow tail portion 100 has slotted openings 102 extending into a cavity 102 . a solid “ eye ” 104 and small mouth ridge 106 add to the fanciful fish shape . fig2 - 22 show a ring shaped chew toy 108 having an upper ring cavity 110 and lower ring cavity 112 separated by an intermediate web 115 . annular slots 114 , 118 with spaced partially circular enlarge vents 116 , 120 allow treats to be inserted into the annular cavities 110 and 112 by stretching of the flexible walls of the ring shaped surface , and protrusions 122 can be provided . fig2 - 27 depict a curved stick form of a chew toy 124 . this embodiment combines a hollow end 126 which has an internal cavity 128 with an oval opening 130 into which treats 132 can be inserted to be held in the cavity . the flexible wall 134 can be easily crushed by the pet chewing on the toy to enable fragments to drop out through the opening 130 as in the other embodiments . the chew toy 124 has a slotted portion 136 at the other end which is formed with a central slot 138 on each side . a pair of flexible plastic walls 140 is angled towards each other to create an enlarged bottom of the slot 138 to retain inserted treats 132 therein . again , the dog in biting on the toy 124 can collapse the walls down to crush the treats 138 and allow the fragments to easily pass out of the narrow part of the slot .

US-201414149865-A

a display apparatus includes : a plate - like display apparatus main body ; a leg portion whose upper end is rotatably connected to a rear surface of the display apparatus main body and whose lower end is opened to thereby support the rear surface of the display apparatus main body ; and an urging mechanism arranged between the display apparatus main body and the leg portion and urging the leg portion so as to open the leg portion .

in the following , a best mode for carrying out the present invention will be described by way of example . the following embodiment is only given by way of example , and the present invention is not restricted thereto . fig1 is a perspective view , as seen from the front side , of a display apparatus 1 according to an embodiment of the present invention . fig2 is a perspective view , as seen from the rear side , of the display apparatus 1 of the embodiment of the present invention . as shown in fig1 and 2 , the display apparatus 1 of the embodiment has a display apparatus main body 2 and a leg portion 3 . in the embodiment , the display apparatus 1 is supposed to be a photo frame for displaying a photograph . however , the display apparatus 1 of the present invention is not restricted to a photo frame , and may also be a signboard or the like . as shown in fig1 and 2 , the display apparatus main body 2 has a frame 4 , a protective glass 5 , a rear plate 6 , and claws 7 , and is formed so as to be capable of accommodating a photograph or the like . as shown in fig2 , the leg portion 3 is formed of a plate having a necktie - shaped external configuration . fig3 shows how the display apparatus main body 2 and the leg portion 3 are connected together by a hinge 8 . as shown in fig3 , the upper end portion of the leg portion 3 is connected to the rear plate 6 at the rear of the display apparatus main body 2 through the intermediation of the hinge 8 . the leg portion 3 can rotate about the rotation shaft of the hinge 8 , and through the rotation , the leg portion 3 can be opened and closed . by opening the leg portion 3 , it is possible to support the display apparatus main body 2 from behind . further , by closing the leg portion 3 , it is possible to diminish the depth dimension of the display apparatus 1 . fig4 shows the hinge 8 connecting the display apparatus main body 2 and the leg portion 3 and a torsion spring 9 ( which corresponds to the “ urging mechanism ” of the present invention ) mounted to the hinge 8 . the hinge 8 having the torsion spring 9 as shown in fig4 is generally called a “ spring hinge ”. as shown in fig3 , the hinge 8 to which the torsion spring 9 is mounted is arranged between the display apparatus main body 2 and the leg portion 3 , with a torsional force being applied to the torsion spring 9 . thus , the leg portion 3 receives the torsional force due to the torsion spring 9 , and is urged in the opening direction to be brought into the open state . as shown in fig3 , between the display apparatus main body 2 and the leg portion 3 , there is provided a lock mechanism 10 for stopping the rotation of the leg portion 3 due to the torsion spring 9 , causing the leg portion 3 to be locked at a predetermined position suitable for supporting the rear surface of the display apparatus main body 2 . in the lock mechanism 10 , a distal end portion 11 of the leg portion 3 , which is situated still higher than the position thereof where the hinge 8 is connected , abuts the rear surface of the display apparatus main body 2 , whereby the rotation of the leg portion 3 is stopped . fig5 shows how the display apparatus main body 2 is raised by a hand 12 . since the display apparatus 1 is equipped with the torsion spring 9 urging the leg portion 3 so as to open it , the leg portion 3 is not closed even in the state in which the display apparatus main body 2 is raised . thus , the display apparatus can be easily placed on a table or the like without having to open the leg portion 3 by the hand 12 . since the leg portion 3 is not closed even when the display apparatus main body 2 is raised , the display apparatus 1 does not easily fall even when it is returned to the showcase by the customer , who has taken it up by the hand 12 when it is on sale at the store . fig6 shows the display apparatus 1 as accommodated in a box 13 . the leg portion 3 is urged by the torsion spring 9 with a minimum requisite force for opening the leg portion 3 . here , if the urging force due to the torsion spring 9 were too strong , a strong force would be required when closing the leg portion 3 . further , to maintain the leg portion 3 in the closed state , it would be necessary to provide a member or the like for locking the leg portion 3 in the closed state . here , in the display apparatus 1 of the present invention , there is focused on the difference in weight between the display apparatus main body 2 and the leg portion 3 . that is , the display apparatus main body 2 , which is formed by the frame 4 , the protective glass 5 , etc ., is heavier than the leg portion 3 , which is simply formed by a plate - like member . in view of this , as the torsion spring 9 , there is adopted a spring which , while imparting to the leg portion 3 an urging force large enough to open the leg portion 3 in the free state in which the display apparatus 1 is raised , only gives an urging force of up to a magnitude which allows the leg portion to be closed by the weight of the display apparatus 1 both in a state in which the display apparatus 1 is placed on a horizontal surface of an object such as a table or an accommodating box such that the surface ( rear surface ) of the display apparatus where the leg portion 3 is arranged is on the lower side , and in a state in which the display apparatus 1 is hung on a wall surface . as a result , as shown in fig6 , it is possible to cause the leg portion 3 to be closed due to the weight of the display apparatus main body 2 solely by accommodating the display apparatus 1 in the box 13 . the leg portion 3 is opened and closed solely by putting the display apparatus in and out of the box 13 without having to perform the operation of opening and closing the leg portion 3 , so the display apparatus can be handled very easily . further , also when hanging the display apparatus 1 on a wall , the leg portion 3 is closed due to the weight of the display apparatus main body 2 , so the display apparatus 1 can be hung on the wall as it is without having to perform the operation of opening and closing the leg portion 3 . as described above , in the display apparatus 1 of the embodiment , the leg portion 3 is urged so as to be opened . the leg portion is maintained in the open state unless a predetermined force is applied thereto , and can be easily closed , so the handling of the leg portion 3 is facilitated . while in the embodiment the urging mechanism is constructed by the torsion spring 9 , it is also possible to adopt a compression spring , an extension spring , a plate spring , or the like . the disclosures of japanese patent application no . jp2006 - 291185 filed on oct . 26 , 2006 including the specification , drawings and abstract are incorporated herein by reference .

US-92482407-A

a harness for the alleviation of back strain has members passing over the shoulders and around the thoraric region with attachments to a pivotable tension equalizing plate whereby the lumbar or lower back region is supported and a balance between the anterior and posterior muscle groups is attained .

the purposes of the taylor harness are : ( 1 ) to strengthen the abdominal and anterior sublumbar thoracic and pelvic muscle groups and ( 2 ) to serve as an aid in lifting heavy material objects from any hip - flexed position to the standing position . both purposes may be accomplished simultaneously . the taylor harness consists of six continuous but separating component parts . these are ( 1 ) padded shoulder harness with velcro ® snap latch buckles , ( 2 ) a fulcrum type tension equalizing plate , ( 3 ) elastic rubber back bands with covers , ( 4 ) leg straps having knee and ankle supports with velcro ® or snap latch buckles , ( 5 ) thigh leg bands with supports and belt , and ( 6 ) a crotchless long legged brief shorts with velcro ® or snap latch fasteners . the functional application of the component parts of the taylor harness are used to accomplish the above stated purposes as follows : ( 1 ) the leg straps cross the shoe soles of the user in front of the heel of the shoe . they then extend upward on the medial and lateral aspects of each ankle , and up each leg to the gluteal area . at a point adjacent to each ankle these straps are stabilized with adjustable ankle straps with pads . at a point just above the ankle these leg straps have snaps and / or vertical slits in each through which passes another padded strap . this second padded strap circles the ankle and is fastened on the upper part of the front of the foot at shoe lace level with velcro ® or snap fasteners . this padded strap , as it circles the foot above the ankle prevents the vertical straps from developing slack as they pass under the shoe sole in front of the heel of the shoe . the leg straps extend upward on the medial and lateral aspect of each leg . at a point just below and just above the knee of each leg they , have slits or snaps in each through which pass padded straps . these padded straps encircle the leg above and below the knee and are fastened with velcro ® or snaps on the anterolateral aspect of each leg . from the knee the vertical leg straps extend upward to a point just below the gluteal bulge . at this point each of the two vertical straps on each leg is attached to the ventral portion of the elastic back bands with adjustable snap locks , velcro ®, or other fasteners . an alternate ventral anchoring system to the leg strap system is the upper thigh system . these upper thigh bands consist of two bands four to eight inches wide that encircle each thigh two to three inches ventral to the crotch . these thigh bands are fastened on the anterolateral aspect of each thigh with velcro ® fasteners . these bands are each supported by two narrow belts , which extend upward from the anteromedial and posterolateral aspect of each upper thigh band to their attachments to a narrow velcro ® fastened waist belt . this waist belt and four descending belts prevent the upper thigh bands from slipping down the thighs . these upper thigh bands are used as posterior anchors for the elastic rubber back bands when it would not be practical to use the leg strap anchor system . a second alternate ventral anchoring system to the leg strap system is the crotchless long - legged brief shorts sytem , henceforth (“ cllb ”). shorts are made of leather , nylon or any of a number of other materials . the shorts cover the waist down to the lower thigh area . they separate into a front and rear half along a separating and attachment line from top to bottom on both sides from the lateral waist , lateral hip and lateral thigh . they are fastened at these same separating lines with velcro ® or snap latch fasteners . these shorts are crotchless from the upper pubic area ventrally , posteriorly and then dorsally to a point above the split of the buttocks . these shorts serve as a ventral attaching point via velcro ® or snap latch fasteners of the cllb for some users with certain dress limitations and or comfort variations . the elastic or rubber back bands are dual and run parallel as they travel upward from their attachments to the vertical leg straps , crotchless long - legged brief shorts , or upper thigh bands ventral to the gluteal bulge . these elastic back bands are covered with soft leather , fabric or nylon slide boots that protect the user from friction between skin or clothing and the elastic back bands . the slide boots cover the entire length of the elastic back bands and are attached to the shoulder harness via elastic cuffs at the tension equalizing plate in the upper - posterior thoracic area just below the shoulder blades . the slide boots are attached ventrally , with elastic cuffs , to the vertical leg straps in the gluteal area . the slide boots have a strap attached to each of their medial slides in the area of the fourth or fifth lumbar vertebrae . these belly straps transverse laterally from their medial attachments to the slide boots , encircle the lower abdomen and are attached to each other with velcro ® or snaps in the anterior abdomen . these straps serve to either separate or pull together the elastic rubber back bands as they pass over the gluteal , lumbar and thoracic areas . when attached , the belly straps pull the elastic rubber back bands together for lifting and / or for exercising . with the belly straps unfastened , the elastic rubber back bands and their slide boots may be slipped off the gluteus and on to the lateral sides of the hips . in this lateral hip position the user can sit , bend , and put all parts of the taylor harness into position for use or make adjustments , without there being pressure on the elastic rubber back bands . the elastic rubber back bands are attached , ventral to the shoulder blades , in the upper posterior thoracic area to the tension equalizing plate . the tension equalizing plate functions to equalize the tension on the elastic rubber back bands as the user walks , bends , or lifts . the tension equalizing plate is an inverted triangular shape snapped apparatus with three points of attachment . the tension equalizing plate is attached to the shoulder harness at one of its points and to the top of each elastic rubber back band at its other two points . the tension equalizing plate ( tep ) has a heavy friction pad underneath it on which it pivots . this pad is to prevent friction between the skin or clothing of the user as the tep pivots as a fulcrum to equalize the tension of the elastic rubber back bands as the user walks . the tep has slotted adjustment points at the attachment point of the elastic rubber back bands . these slotted adjustment points on the tep allow for compensation in elastic rubber back band tension to be made for users of differing heights and strides as they walk . the padded shoulder harness forms a “ v ” configuration on the back of the user in the area of the shoulder blades . it is at the ventral portion of this “ v ” configuration that the elastic rubber back bands are attached to the shoulder harness via the tension equalizing plate with velcro ® and adjustable snap buckles . the two top straps of the “ v ” pass over the shoulders between the neck and the scapulo - humeral joints upwardly and forwardly . they then pass ventrally and posteriorly under the arms over the lateral aspect of the rib cage , to the center of the back where they cross in the vicinity of the last thoracic vertebra . they pass under the elastic rubber back bands at their point of crossing and continue anteriorally around the rib cage and are attached in front near the ventral sternal area with velcro ® and or snap buckles . the taylor harness accomplishes its stated purposes because it takes advantage of the fact that the anatomical measured distance between a point at the top of the shoulders and a point below the buttocks or gluteus is three to ten inches shorter in the standing position than it is when bent over or in the hip - flexed position , depending on the height and weight of the individual . the application of elastic bands , via a stable shoulder harness to a stable point at the bottom of the foot or upper thigh , makes it possible to store energy expended in bending the body at the sacrofemoral and vertebral joints . this energy thus stored in the elastic rubber bands is in turn utilized to assist the posterior thoracic , lumbar and pelvic muscles in the lifting process . in essence what the taylor harness does is shift part of the workload of the lifting process from those posterior muscle groups of the shoulders , rib cage , spinal column , pelvis , and upper thighs , as we bend from the “ pelvic extended ” position and lift from the “ pelvic flexed ” position , to those anterior muscle groups of the thoracic cage , shoulders , the abdomen , the spinal column , pelvic and thigh . by wearing the taylor harness “ part time ” the maintenance of a balance of muscle tone in all muscle groups mentioned is attained and maintained . a balance in muscle tone in the spinal musculature , especially in the lumbar area is essential if spinal nerve irration is to be alleviated or prevented . with the poor physical condition of most people today , the use of the taylor harness part time , would retone anterior muscle groups , that are seldom used , and as a result would aid in treating and greatly reduce the incidence of lumbrosacral disc syndrome . these conditions are a result of an imbalance in muscle tone of the anterior and posterior muscle groups . this imbalance of muscle tone causes the rupture of the posterior side of the annulas fibrosa , a narrowing of the intervertebral space , thus the pinching of colateral nerves and spinal cord pressure . the industrial applications , for workers bending and lifting , would be greatly reduced if workers were fitted with and wore the taylor harness part time on the job . the taylor harness would be invaluable in the treatment of those individuals already experiencing an episode of lumbar disc rupture . although velcro ® is described here , other fasteners , such as snaps , buttons , buckles and the like may also be used . the straps are principally nylon or leather , but other materials may be equally substituted . the tep is normally reinforced fiberglass or metal but plastic or other material can also be used . in fig1 a and 1b with leg band anchor the shoulder harness 10 is shown back 10 a and front 10 b attached to the tep 12 at 13 with flexible friction pad 14 , and elastic back bands 16 with covers . shoulder harness release belt 18 is a continuation at 20 of shoulder harness 10 b and crosses the lateral rib cage to the posterior thoracic area where it crosses itself and proceed anteriorally around the abdominal wall and is fastened at 22 . the elastic band release belt 24 is attached to back band slip covers at 26 and buckles at 28 . leg band supports 30 are for use with the thigh bands 38 , are attached to a leg band support belt 32 at 34 , leg band support belt buckles at 39 , and are attached to thigh bands 36 at attachment points 38 . in fig2 a and 2b with foot anchor shoulder harness 10 a and 10 b is attached to tep 12 at 13 with friction pad 14 , elastic back bands of rubber or other elastomer 21 with leather , cloth , or knit covers , having elastic cuffs 41 . shoulder harness release belt 18 is a continuation of shoulder harness 10 a and 10 b at 20 held fastened at 22 . elastic band release belt 24 is fastened at 28 and attached to elastic back band cover 19 at 26 . elastic back bands 21 are attached to vertical leg bands 45 at 44 with fasteners 43 . lower knee straps 46 with fasteners 50 are attached to vertical leg straps 45 at 48 . upper knee straps 42 are attached to leg bands 45 at 44 and backed at fasteners 41 . ankle straps 52 with fasteners 54 are attached to elastic leg straps 45 at 56 . leg bands 45 are attached to foot anchor wear plate 58 at 60 . fig3 a and 3b depict the upper thigh band system , the crotchless long legged brief comprising two bands 61 and 62 which encircle each thigh two to three inches ventral to the crotch . these thigh bands are fastened at 64 to belts 72 and 70 and fastened together at 66 . belts 72 and 70 are attached to tep 12 . fig4 shows a detail of tep 12 with shoulder harness 10 a attachment point 13 , flexible friction pad 14 and elastic back bands 16 attached at 71 . fig5 is a cross - section of elastic back bands 16 with cover 19 . fig6 depicts the foot anchor wear plate 58 fastened to vertical leg straps 45 at 60 . fig7 depicts a cross - section of wear plate 58 with clamp 82 holding the two halves together and vertical leg straps 45 .

US-1816198-A

this invention relates to a method for enhancing the bioavailability of a therapeutically active compound of the formula or a geometric isomer , a stereoisomer , a pharmaceutically acceptable salt , an ester thereof or a metabolite thereof , wherein said compound is administered orally to the individual in connection with the intake of food .

although it is previously known that certain lipophilic drugs may benefit from administering the drug in connection with food intake , the strength of the effect of food intake upon the ospemifene bioavailability obtained in the present investigations was very surprising . particularly compared to the behaviour of other serms , the food effect on ospemifene is remarkable . it was found ( anttila m ., 1997 ) that the intake of food did not have any positive effect on the bioavailability of toremifene , which like ospemifene also has a low aqueous solubility . it was observed that food intake in fact retarded the absorption of toremifene . it has also been reported that the administration of raloxifene , another serm , together with a standardized high - fat meal increases the absorption of raloxifene slightly , but that it does not lead to clinically meaningful changes in systemic exposure . while food intake causes only a 20 % increase of raloxifene absorption , the effect on ospemifene absorption is a 2 - 3 fold increase . the term “ food ” shall be understood to cover any edible foodstuff having a nutritional value as an energy supplier . thus the food can be solid , semisolid or liquid substance comprising one or more of the basic ingredients carbohydrates , fats and proteins . surprisingly , a high percentage of fats or a high energy value in the food intake is not crucial for obtaining a high bioavailability for ospemifene . neither is the amount of food intake crucial for the beneficial effect . it is believed that the secretion of bile acids may play an important role in the improved bioavailability , and therefore any foodstuff being capable of causing secretion of bile acids is expected to work . the drug is considered to be administered in connection with the intake of food if the drug is administered at a time point shortly before the start of the food intake , during the food intake or in a relatively short time after the food intake is completed . a preferable time range is defined to begin 1 hour before starting the food intake and to end 2 hours after starting the food intake . more preferably , the drug is administered at a time point which is in the range defined to begin at a time point during the food intake and to end 1 hour after the food intake was started . most preferably , the drug is administered during the food intake or at a time point which is no later than 0 . 5 hour after starting the food intake . the method of enhancing the bioavailability of ospemifene and related compounds according to this invention is particularly useful when treating women during or after the menopause . however , the method according to this invention is not restricted to women in this age group . the term “ metabolite ” shall be understood to cover any ospemifene or ( deaminohydroxy ) toremifene metabolite already discovered or to be discovered . as examples of such metabolites can be mentioned the oxidation metabolites mentioned in kangas ( 1990 ) on page 9 ( tore vi , tore vii , tore xviii , tore viii , tore xiii ), especially tore vi and tore xviii , and other metabolites of the compound . the most important metabolite of ospemifene 4 - hydroxyospemifene , which has the formula the use of mixtures of isomers of compound ( i ) shall also be included in this invention . the method of enhancing bioavailability is useful in any application of ospemifene , especially when the compound is used for treatment or prevention of osteoporosis or for treatment or prevention of symptoms related to skin atrophy , or to epithelial or mucosal atrophy . a particular form of atrophy which can be inhibited by administering of ospemifene is urogenital atrophy . symptoms related to urogenital atrophy can be divided in two subgroups : urinary symptoms and vaginal symptoms . as examples of urinary symptoms can be mentioned micturation disorders , dysuria , hematuria , urinary frequency , sensation of urgency , urinary tract infections , urinary tract inflammation , nocturia , urinary incontinence , urge incontinence and involuntary urinary leakage . as examples of vaginal symptoms can be mentioned irritation , itching , burning , maladorous discharge , infection , leukorrhea , vulvar pruritus , feeling of pressure and postcoital bleeding . according to previous data , the optimal clinical dose of ospemifene is expected to be higher than 25 mg daily and lower than 100 mg daily . a particularly preferable daily dose has been suggested in the range 30 to 90 mg . at the higher doses ( 100 and 200 mg daily ), ospemifene shows properties more similar to those of tamoxifen and toremifene . due to the enhanced bioavailability according to the method of this invention , it can be predicted that the same therapeutical effect can be achieved with doses lower those recommended earlier . the invention will be disclosed more in detail in the following non - restrictive experimental section . two clinical studies were carried out in order to assess the bioavailability of ospemifene in healthy male subjects after intake of high caloric content ( 860 kcal ) and high - fat breakfast compared to bioavailability of ospemifene administered in fasted condition ( study a ). in a separate study ( study b ), the bioavailability of ospemifene after intake of low caloric content ( 300 kcal ), low - fat breakfast was assessed and the results were compared to those obtained in study a ( i . e . ospemifene bioavailability after intake of high caloric , high - fat breakfast or after ospemifene administering in fasted condition ). in study a , 24 healthy male volunteers ( mean age 23 . 8 years , mean bmi 22 . 8 kg / m 2 ) received single oral doses of 60 mg ospemifene , once under fed condition after consuming a standardised high - fat , high caloric breakfast , and once after an overnight fast . blood samples for pharmacokinetic assessments were drawn during 72 hours at each study period . a washout period between the two treatments was at least 2 weeks . the breakfast consisted of the following ingredients : two eggs fried in butter ( 50 g ), two strips of bacon ( 34 g ), two slices of toast with butter ( 50 g ), 60 g hash brown potatoes and 240 ml of whole milk ( percentage of fat = 3 . 5 %). the meal provided approximately 150 , 170 and 540 kcal from protein , carbohydrate and fat , respectively . following an overnight fast of at least 10 hours at the study site , the subjects were given the test meal described above 30 minutes before ospemifene dosing ( 60 mg tablet ). the meal had to be consumed over the 30 minutes , immediately followed by administration of ospemifene . following an overnight fast of at least 10 hours at the study site , the subjects were given one ospemifene tablet ( 60 mg ) with 240 ml of water . no food was allowed for at least 4 hours after the ospemifene dose . a substantial effect of food intake was observed on the bioavailability of ospemifene and its main metabolite 4 - hydroxy - ospemifene . fig1 shows the mean serum concentration of ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open circles ) and after a high caloric , high - fat meal ( filled circles ). the results of this study showed clearly that the ospemifene bioavailability was enhanced by concomitant ingestion of ospemifene and a meal . due to the surprising and promising results of this study it was decided to carry out a second study ( study b below ) to find out the effect of a low caloric , low - fat meal on the bioavailability of ospemifene . in study b , 12 healthy male volunteers ( mean age 23 . 8 years , mean bmi 22 . 3 kg / m 2 ) of the 24 subjects in study a were subjected to ospemifene administering in combination with the intake of a low caloric , low - fat meal . the results were compared to those obtained in study a for the same individuals . the composition of the light breakfast ( approximately 300 kcal ) was as follows : two slices of toast with margarine ( 5 g , fat content 60 %), 6 slices ( 30 g ) of cucumber , 240 ml skimmed ( non - fat ) milk and 100 ml orange juice . the test meal provided approximately 50 , 180 and 70 kcal from protein , carbohydrate and fat , respectively . following an overnight fast of at least 10 hours at the study site , the subjects were given the test meal described above 30 minutes before ospemifene dosing ( 60 mg tablet ). the meal had to be consumed over the 30 minutes , immediately followed by administration of ospemifene . fig2 shows the mean serum concentration of ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open circles ; data obtained from study a ); after a high caloric , high - fat meal ( filled circles ; data obtained from study a ) and after a low caloric , low - fat meal ( stars ). fig3 shows the mean serum concentration of the ospemifene metabolite 4 - hydroxy - ospemifene versus time following the administration of 60 mg ospemifene tablet in fasted condition ( open triangles ; data obtained from study a ); after a high caloric , high - fat meal ( filled triangles ; data obtained from study a ) and after a low caloric , low - fat meal ( crosses ). the results of this study showed clearly that the bioavailability of ospemifene was also enhanced by concomitant ingestion of ospemifene and a low caloric , low - fat meal . although the fat content of the low - fat meal was much lower than that of the high - fat meal , the bioavailabity of ospemifene was only slightly lower for the low - fat meal . therefore it can be concluded that the effect of food on the ospemifene bioavailability is not dependent on the fat content of the meal ingested . instead , stimulation of bile flow due to meal ingestion may enhance the solubilisation of ospemifene . it will be appreciated that the methods of the present invention can be incorporated in the form of a variety of embodiments , only a few of which are disclosed herein . it will be apparent for the expert skilled in the field that other embodiments exist and do not depart from the spirit of the invention . thus , the described embodiments are illustrative and should not be construed as restrictive . anttila m . effect of food on the pharmacokinetics of toremifene . eur j cancer , 1997 ; 33 , suppl 8 : 1144 , 1997 . kangas l . biochemical and pharmacological effects of toremifene metabolites . cancer chemother pharmacol 27 : 8 - 12 , 1990 . kauffman r f , bryant h u . selective estrogen receptor modulators . drug news perspect 8 : 531 - 539 , 1995 .

US-201514971252-A

the present invention relates to a shoe and preferably according to the preferred embodiments to a self - closing mechanism within the shoe . the shoe optionally has an inbuilt mechanical fastening system which operates via insertion of the foot into the shoe which depresses an embedded releasing mechanism in the shoe which pulls closed the fastening - cords of the shoe top tightly around the wearer &# 39 ; s foot . subsequently a lever operated by the companion shoe situated on the back of the shoe body acts as a loosening mechanism enabling removal of the shoe from the wearer &# 39 ; s foot .

the present invention is a shoe with a self - closing mechanism for receiving a foot of a user . the principles and operation of the self - closing mechanism according to the present invention may be better understood with reference to the drawings and the accompanying description . referring now to the drawings , fig1 illustrates an isometric view of a lace - less shoe 10 in the closed condition . a sport or athletic shoe is shown here in the diagram only for simplicity &# 39 ; s sake as this lace - less mechanism can be designed to fit many types of shoe . the preferred embodiments shown here are only examples of numerous positions associated with the shoe that the tensioning and closing mechanisms can be placed . this shoe preferably has a main shoe portion 19 which includes a sole 17 , an upper part 15 , the release lever track 14 and on this is the release lever itself 12 . the release lever 12 is attached to the connecting cord 16 , which runs through the release lever track 14 the continuation of which passes under the guiding rod 21 in the back of the heel section of the sole 13 . from here the connecting cord passes through the releasing mechanism 18 to join up with the serrated connecting cord 20 . this combination of connecting cord to a serrated connecting cord is only one example of numerous means of catching the connecting cord onto the actuator . the releasing mechanism in this variation of the preferred embodiments includes the serrated connecting cord 20 , the connecting cord 16 , the release lever track 14 and the release lever 12 . the serrated connecting line 20 is connected to the back end 25 of the tensioning element 22 which is also connected to the fastening - cords 26 . the front end 23 of the tensioning element 22 is anchored by an anchoring element 27 into the front part of the sole 17 and therefore is immovable . the fastening - cords , or any other similar performing material 26 run through the fastening - cord tracks 24 in the sole 17 , shown here as only one example of numerous possible locations , the bottom of which is embedded in the sole 17 and from which at least one fastening - cord track 24 run upwards through both sides of the shoe until the division between the main shoe 19 and the upper portion of the shoe 15 . the fastening - cords 26 complete a circuit through the upper portion 15 of the shoe . the upper portion of the shoe 15 opens either manually by the wearer or by a resilient element associated with the upper portion as shown in fig5 & amp ; 6 . fig2 is a side - view of the lace - less shoe 10 in the open condition . the connecting cord 16 is joined with the serrated connecting line 20 . the serrated connecting line 20 passes through the release mechanism 18 where it is held in place . the serrated connecting line 20 is connected to the back end 25 of the tensioning element 22 now in a stretched position , which is also connected to the fastening - cords 26 . the fastening - cords 26 run through the fastening - cord tracks 24 the bottom of which is embedded in the sole 17 and from which a number of individual fastening - cord tracks 24 run upwards through both sides of the shoe until the division between the main portion 19 of the shoe and the upper potion 15 . the fastening - cords 26 complete a circuit through the upper portion 15 . fig3 is a side - view of the lace - less shoe , the present invention in the open position with parts in section and portions cut away to reveal an optional the internal resilient element 29 embedded into the upper portion 15 of the shoe in the concave open position . the upper portion 15 of the shoe is configured to mate the main portion of the shoe and may be consistent in constitution or have parts of it cut away in a sandal like form . this is an example of many types of resilient elements . the release lever 12 is in the depressed position , which stretches the tensioning element . this releases the plurality of fastening - cords 26 , with an optional number of 3 fastening cords , shown here . the released slack is taken up by the upper portion 15 of the shoe as a result of the resilient element 29 returning to its biased concave position . in operation , the shoe has reached the open position by the wearer preferably using his companion shoe to depress the release - lever 12 . this in turn pulls the connecting cord 16 , which pulls the serrated connecting cord 20 through the actuator 18 and becomes caught on a catch within the actuator 18 . this simultaneously stretches the tensioning element shown here in a preferred embodiment as a rubber strip 25 . stretching the tensioning element 25 results in loosening of the fastening cords . the released slack is taken up by the upper portion 15 of the shoe as a result of the resilient element 29 returning to its biased concave position resulting in the opening of the shoe . the shoe described in the preferred embodiments is closed by the wearer placing a foot in the shoe and depressing the actuator , which releases the connecting cords 16 & amp ; 20 . the rubber strip 25 retracts simultaneously pulling the connecting cords 16 & amp ; 20 and the plurality of fastening cords 26 towards the front end of the shoe . this results in the closing of the upper part of the shoe 19 around the foot of the wearer . fig4 is an additional view illustrating the relationship between the fastening cords 26 and the upper portion of the shoe 15 . fig5 is an isometric view of a closed lace - less shoe revealing a variant implementation of the tensioning element . in this example the tensioning element 25 and the releasing mechanism 18 are associated with the release - lever track 14 . the connecting cord 16 is attached to the release lever 12 which is attached to the catch 28 which runs up and down on the release lever track 14 . the tensioning element , which is in this variation of the preferred embodiments , is illustrated as a helical tension spring 25 is shown in its biased form . the mode of operation in this variation of the preferred embodiments illustrated here is similar to the mode of operation to the variant described in fig3 with some of the exceptions being the tensioning element 25 being a helical tension spring and the actuator of the releasing mechanism 18 being embedded in the hind section of the shoe and not embedded in the sole . fig6 is an isometric view of an open lace - less shoe illustrating the stretched tensioning element 25 held in position by the catch 28 held in position by the releasing mechanism 18 . the shoe is closed by the placing of foot inside the shoe which displaces the catch 28 from the releasing mechanism 18 resulting in the tensioning of the tensioning element 25 deployed around a shaft simultaneously serving as the release - lever track 14 which pulls the connecting cords 26 to result in closing the shoe over the wearer &# 39 ; s foot . the mode of operation in this variation of the preferred embodiments illustrated here is similar to the mode of operation to the variant described in fig3 with some of the exceptions being the tensioning element 25 being a helical tension spring and the actuator of the releasing mechanism 18 being embedded in the hind section of the shoe and not embedded in the sole . fig6 is an isometric view of an open lace - less shoe illustrating the stretched tensioning element 25 held in position by the catch 28 held in position by the releasing mechanism 18 . the shoe is closed by the placing of foot inside the shoe which displaces the catch 28 from the releasing mechanism 18 resulting in the tensioning of the tensioning element 25 deployed around a shaft simultaneously serving as the release - lever track 14 which pulls the connecting cords 26 to result in closing the shoe over the wearer &# 39 ; s foot . it will be appreciated that the above descriptions are intended only to serve as examples , and that many other embodiments are possible within the spirit and the scope of the present invention .

US-70595500-A

medical devices , such as endoprostheses , and methods of making the devices are described . in some embodiments , a medical device includes a body of interconnected bands and connectors forming an elongated tubular structure having an inner luminal wall surface and an outer abluminal wall surface and defining a central lumen or passageway . the inner luminal wall surface and side wall surface of the bands and connectors forming transverse passageways through the elongated tubular structure can bear a coating of hydrophilic material and the outer abluminal wall surface of the tubular structure can bear a coating of hydrophobic material .

referring to fig1 a , stent 10 having a body of interconnected bands 12 and connectors 11 forming an elongated tubular structure is shown . referring to fig1 b , the cross - section of the body of stent 10 shows that the stent has an inner luminal surface 13 , side wall surface 14 and an outer abluminal surface 15 . the surfaces 13 , 14 and 15 bear a coating 16 of titanium (+ y ) oxide (− x ) ( ti x o y ) e . g ., titanium dioxide ( tio 2 ). coating 16 of luminal surface 13 and side wall surface 14 further includes biomolecules 17 . coating 16 of abluminal surface 15 further includes biomolecules 18 . stent 10 can be produced in a variety of ways . for example , referring to fig2 , a method 20 of producing stent 10 with selectively coated surfaces is described . stent 10 is generated ( step 21 ). surfaces 13 , 14 and 15 of stent 10 are coated with ti x o y ( step 22 ), e . g ., hydrophilic ti x o y , e . g ., superhydrophilic ti x o y , e . g ., superhydrophilic tio 2 , resulting in coating 16 . stent 10 is then be exposed to conditions sufficient to cause the ti x o y coating 16 to become hydrophobic ( step 23 ), e . g ., by placing stent 10 in a dark environment for a couple of days or by a process called “ wet - rubbing ” ( see , e . g ., kamei et al ., surf . science 463 : l609 - 12 , 2000 ), in which a superhydrophilic surface is turned to a hydrophobic surface by removal of the surface hydroxyl groups . selected surfaces of stent 10 are then exposed to conditions sufficient to cause coating 16 of the selected surfaces to become hydrophilic , e . g ., superhydrophilic ( step 24 ), e . g ., by exposure to ultraviolet light . for example , referring to fig3 a , a source of ultraviolet light 30 can be placed generally on the luminal side of stent 10 , e . g ., inside stent 10 . light source 30 illuminates luminal surface 13 and side wall surface 14 bearing ti x o y coating 16 . such illumination will cause coating 16 to become superhydrophilic . while light source 30 illuminates surfaces 13 and 14 , abluminal surface 15 bearing coating 16 is blocked from exposure , e . g ., with a mandrel . thus , after sufficient illumination , the resulting stent 10 bears coating 16 that is superhydrophilic on luminal surface 13 and side walls surface 14 , and hydrophobic on abluminal surface 15 . in another embodiment , illustrated in fig3 b , a source of ultraviolet light 30 can be placed generally on the abluminal side of stent 10 . light source 30 illuminates the abluminal surface 15 that bears coating 16 of ti x o y . while light source 30 illuminates surface 15 , surfaces 13 and 14 are blocked . thus , after sufficient illumination , the resulting stent 10 bears coating 16 that is hydrophilic on abluminal surface 15 and hydrophobic on luminal surface 13 and side surface 14 . both the light exposure , e . g ., ultraviolet light exposure , and wet - rubbing can be carried out on a selective micro - scale , vastly expanding the range of hydrophilic and hydrophobic regions of stent 10 that can be realized . other patterns , in addition to the ones described above can be realized . for example , coating 16 of both luminal surface 13 and abluminal surface 15 can be turned hydrophilic with selective light exposure . in another example , only portions of coating 16 of any of the surfaces 13 , 14 and / or 15 may be turned hydrophilic . the possible patterns are numerous . further referring to fig2 , stent 10 bearing coating 16 that is selectively hydrophilic and hydrophobic is then coated , e . g ., by dipcoating , gas - assisted spraying , electrostatic spraying , electrospinning , or roll - coating , in desired substances compatible with desired biomolecules 17 and 18 ( step 25 ). for example , stent 10 can be coated , e . g ., dipped in a non - polar solution containing a biomolecule , e . g ., paclitaxel in xylene ( e . g ., up to 1 % by weight of paclitaxel ) and optionally a polymer , e . g ., poly ( styrene - b - isobutylene - b - styrene ) ( sibs ). non - polar solution and biomolecule adhere to non - illuminated surfaces bearing hydrophobic coating 16 . the stent can be dried and the process repeated , building layers upon the hydrophobic surfaces . in another embodiment , stent 10 can be further coated , e . g ., dipped in a polar solution containing another biomolecule , e . g ., heparin . the polar solution will adhere to illuminated surfaces bearing hydrophilic coating 16 . in yet another embodiment , stent 10 can be coated , e . g ., by dipcoating , gas - assisted spraying , electrostatic spraying , electrospinning , or roll coating , in a solution that includes a combination of both polar and non - polar solvents with respectively dissolved biomolecules and , optionally , polymers . in this embodiment , the polar solvent will adhere to the hydrophilic regions of stent 10 , while the non - polar solvent will adhere to the hydrophobic regions of stent 10 . the resulting stent 10 will have surfaces selectively coated with multiple biomolecules . thus , in one embodiment , stent 10 bears coating 16 of hydrophilic ti x o y . stent 10 is left in the dark for a time sufficient for coating 16 to become hydrophobic . next , luminal surface 13 and side wall surface 14 are illuminated with uv light source 30 , turning them superhydrophilic . such luminal surface 13 and side wall surface 14 bearing hydrophilic coating 16 are coated with polar solutions and biomolecules , e . g ., heparin . the abluminal wall surface 15 bearing hydrophobic coating 16 , on the other hand , is coated with non - polar solutions and biomolecules , e . g ., paclitaxel , e . g ., paclitaxel and binder polymer , e . g ., sibs . in one embodiment , stent 10 can be coated with a solution that includes a combination of both polar and non - polar solvents with respectively dissolved biomolecules and , optionally , polymers . in another embodiment , stent 10 bears coating 16 of hydrophilic ti x o y . stent 10 is left in the dark for a time sufficient for it to become hydrophobic . next , abluminal wall surface 15 bearing coating 16 is illuminated with uv light source 30 , turning it superhydrophilic . luminal surface 13 and side wall surface 14 bearing coating 16 are coated with non - polar solutions and biomolecules . the abluminal surface 15 is coated with polar solutions and biomolecules . in one embodiment , stent 10 can be coated with a solution that includes a combination of both polar and non - polar solvents with respectively dissolved drugs and , optionally , polymers . as discussed supra , in another embodiment , rather than illuminating the entire luminal surface 13 and side wall surface 14 bearing coating 16 or the entire abluminal surface 15 ( in step 24 of fig2 ), selected regions of any of surfaces 13 , 14 and 15 may be illuminated , and selected regions may be coated in desired polar and non - polar solutions . any number and variation of coating patterns is possible . referring to fig4 , another method of generating a selectively coated stent 10 is illustrated . stent 10 is generated ( step 41 ). surfaces 13 , 14 and 15 of stent 10 are coated with ti x o y ( step 42 ), e . g ., hydrophilic ti x o y , e . g ., superhydrophilic ti x o y , e . g ., superhydrophilic tio 2 , resulting in coating 16 . stent 10 is then exposed to conditions sufficient to cause the ti x o y coating 16 to become hydrophobic ( step 43 ), e . g ., by placing stent 10 in a dark environment for a few days . surfaces 13 , 14 and / or 15 or selected portions of surfaces 13 , 14 and 15 of stent 10 bearing coating 16 are then exposed to conditions sufficient to cause the coating 16 to become hydrophilic , e . g ., superhydrophilic , e . g ., by uv illumination ( e . g ., xe lamp , 20 minutes exposure time ) ( step 44 ). selected surfaces exposed to uv illumination can include the entire surfaces 13 , 14 and 15 bearing coating 16 . selected surfaces that have been exposed to uv illumination are subsequently exposed to conditions sufficient to cause coating 16 to become hydrophobic ( step 45 ). the conditions can include wet - rubbing selected surfaces , e . g ., luminal and abluminal surfaces , or any other combination of surfaces , with either a glass , a steel or a paper surface ( see , e . g ., kamei et al .). again , both the wet - rubbing and the uv exposure can be done on a selective micro - scale , vastly expanding the range of patterns of hydrophobic and hydrophilic regions that can be realized . further referring to fig4 , stent 10 is coated , e . g ., by dipcoating , gas - assisted spraying , electrostatic spraying , electrospinning or roll - coating , in desired substance ( s ) ( step 46 ). one interesting application of wet - rubbing is that it allows just the surface to be turned from a hydrophilic porous ti x o y coating into a hydrophobic surface , while leaving the buried ( underlying ) porous structure hydrophilic . this can enable coating stent 10 with various combinations of polar and non - polar solvents with different dissolved drugs and / or polymers to create contrasting coating composition from top to bottom inside of the porous ti x o y coating . in one embodiment , stent 10 can be coated , e . g ., by dipcoating , gas - assisted spraying , electrostatic spraying , electrospinning or roll - coating , in a non - polar solution containing biomolecules , e . g ., paclitaxel , e . g ., paclitaxel and binder polymer , e . g ., sibs , and in a polar solution containing biomolecules , e . g ., heparin , e . g ., heparin and polymer . in another embodiment , stent 10 can be coated , e . g ., by dipcoating , gas - assisted spraying , electrostatic spraying , electrospinning or roll - coating , in a solution that includes a combination of both polar and non - polar solvents with respectively dissolved biomolecules , e . g ., drugs , and , optionally , polymers . in another embodiment , once stent 10 has been coated with desired biomolecules and / or polymers , a second porous coating of ti x o y can be applied . in this embodiment , ti x o y can be applied without the use of high - temperature step . ti x o y can be applied , e . g ., via microwave - assisted deposition . in this embodiment , biomolecules on the stent , e . g ., paclitaxel , can diffuse through the pores of the second ti x o y layer . in another embodiment , hydrophilic biomolecules can be packaged into hydrophobic lipid capsules ( e . g ., liposomes ) and applied to hydrophobic coating 16 . further referring to fig4 , step 42 of method 40 can include coating selected regions stent 10 with ti x o y that is nano - porous , e . g ., meso - porous or micro - porous , and other selected regions with ti x o y that is generally smooth , i . e ., not nano - porous . in one embodiment , the regions coated with nano - porous coating can be luminal and side wall surfaces 13 and 14 , while the regions with smooth coating can be abluminal wall surfaces 15 . in another embodiment , the regions with nano - porous coating can be abluminal wall surfaces 15 , while the regions with smooth coating can be luminal and side wall surfaces 13 and 14 . entire stent 10 coated with nano - porous and smooth ti x o y can then be exposed to conditions sufficient for coating 16 to become superhydrophilic , e . g ., by uv irradiation ( step 44 ). entire stent 10 can then be exposed to conditions sufficient to cause selected regions of coating 16 to become hydrophobic , e . g ., by placing stent 10 in dark conditions for a certain timeframe , e . g ., a number of days or weeks ( step 45 ). in step 45 , the regions coated with nano - porous ti x o y will remain superhydrophilic ( see , e . g ., gu , app . phys . lett . 85 ( 21 ): 5067 - 69 , 2004 ), while the regions coated with smooth ti x o y will become hydrophobic . the resulting stent 10 can be coated e . g ., by dipcoating , gas - assisted spraying , electrostatic spraying , electrospinning or roll - coating , in desired substance ( s ) ( step 46 ). stent 10 can be coated with polar solutions , non - polar solutions or solutions containing a combination of polar and non - polar solvents , containing compatible biomolecules and / or polymers , as discussed above . in use , stent 10 can be used , e . g ., delivered , using a catheter delivery system . catheter systems are described , e . g ., in wang u . s . pat . no . 5 , 195 , 969 , hamlin u . s . pat . no . 5 , 270 , 086 , and raeder - devens u . s . pat . no . 6 , 726 , 712 . stents and stent delivery are also exemplified by the radius ® or symbiot ® systems , available from boston scientific scimed , maple grove , minn . stent 10 bearing more than one type of a biomolecule , e . g ., biomolecules 17 and 18 , can deliver the biomolecules to , e . g ., a blood vessel . biomolecules 17 and 18 can target various cells of the blood vessels , e . g ., endothelial cells or smooth muscle cells . as discussed , coating 16 of stent 10 can include ti x o y , preferably , titanium dioxide . titanium dioxide , also known as titanium ( iv ) oxide or titania is the naturally occurring oxide of titanium , chemical formula tio 2 . tio 2 occurs in a number of forms : rutile , anatase , brookite , titanium dioxide ( b ) ( monoclinic ), titanium dioxide ( ii ), and titanium dioxide ( h ). carp et al ., prog . solid state chem . 32 : 33 - 177 , 2004 . tio 2 coatings are known to be blood - compatible . maitz et al ., boston scientific corporation internal report , 2001 ; tsyganov et al ., surf . coat . tech . 200 : 1041 - 44 , 2005 . blood - compatible substances show only minor induction of blood clot formation . tio 2 in both rutile and anatase phases shows low platelet adhesion . implantation of phosphorus in the top surface of the rutile phase ( e . g ., at an ion density of about 2 % to about 5 %) decreases platelet adhesion to tio 2 . maitz et al . morphology , crystal structure and doping of ti x o y coating 16 are some elements that need to be taken into account when making and using stent 10 . ti x o y coating 16 of stent 10 can be a crystal ( anatase or rutile structure ). crystal structure is photoactive . crystal structure also has porosity or roughness that facilitates adhesion and storage of biomolecules 17 and 18 , that can be placed on coating 16 alone or in combination with polymers and / or other biomolecules . coating 16 can also be amorphous ( karuppuchamy et al ., vacuum 80 : 494 - 98 , 2006 ) or be a combination of one or more of the following phases : anatase , rutile , brookite , amorphous , monoclinic , titanium (+ y ) oxide (− x ) ( ii ) and / or titanium (+ y ) oxide (− x ) ( h ). instead of using pure ti x o y for coating , phosphorus can be embedded at a low percentage ( e . g ., about 0 . 5 to about 5 %) into the ti x o y layer ( e . g ., using plasma immersion process ) to increase blood compatibility of the coating . maitz et al . in other embodiments , coating 16 can be a combination of ti x o y and iridium oxide ( irox ); or a combination of ti x o y and ruthenium oxide ( ruox ); or a combination of ti x o y , irox and ruox . ruox and irox can decrease any potential inflammation ongoing in the cells surrounding stent 10 in the body , because these compounds can catalyze breakdown of by - products of stressed cells . in one embodiment , ti x o y coating 16 can be doped , e . g ., with iron ( fe ), carbon ( c ), nitrogen ( n ), bismuth ( bi ), vanadium ( v ) or their combination . fe - doping enhances ti x o y conversion rate of photoinduced hydrophilicity and reduces the rate of conversion from hydrophilic to hydrophobic state . yu et al ., mat . chem . phys . 95 : 193 - 96 , 2006 . bi - and / or v - doping can decrease the water contact angle , while bi - v - doping can enhance maintenance of a low water contact angle under dark conditions . hong et al ., mat . lett . 60 : 1296 - 1305 , 2006 . c - doping has also been reported to influence hydrophilic properties of tio 2 . irie et al , thin solid films 510 : 21 - 5 , 2006 . a number of techniques can be used to deposit ti x o y coating 16 on stent 10 , including sol - gel routes and cathodic electrodeposition . karuppuchamy et al ., solid state ionics 151 : 19 - 27 , 2002 ; karuppuchamy et al ., mat . chem . phys . 93 : 251 - 54 , 2005 ; hattori et al ., langmuir 15 : 5422 - 25 , 1999 . many deposition techniques utilize a high - temperature processing step ( e . g ., heating to about 400 ° c .) to turn deposited film into crystal structure . if such a high - temperature step is undesirable ( e . g ., if the stent already has a coating of thermo - sensitive elements , such as certain polymers , microelectromechanical systems ( mems ), or biomolecules ), microwave - assisted deposition of ti x o y can be used . vigil et al ., langmuir 17 : 891 - 96 , 2001 , gressel - michel et al ., j . coll . interf . science 285 : 674 - 79 , 2005 . in one method of microwave - assisted deposition , anatase particles are synthesized directly in suspension using a microwave reactor and the particles ( of about 70 nm in diameter ) are deposited by a dipcoat process at room temperature . gressel - michel et al . chemical bath deposition is another method that avoids a high - temperature step in ti x o y deposition . pathan et al ., app . surf . science 246 : 72 - 76 , 2005 . as mentioned above , hydrophilic ti x o y coating 16 will turn hydrophobic when left in the dark . yu et al . ; karuppuchamy et al ., 2005 . ti x o y coatings , however , are known to switch from hydrophobic to superhydrophilic when exposed to ultraviolet ( uv ) light illumination . this effect exists not only in the anatase and rutile phases ( yu et al . ), but also in the amorphous phase ( karuppuchamy et al , vacuum 80 : 494 - 98 , 2006 ). ti x o y is also a photocatalyst under uv light , but the photocatalytic effect only exists in the anatase phase . a superhydrophilic surface can contact water with an angle of less than 5 °. the superhydrophilic effect of ti x o y is larger for nano - porous structure , e . g ., meso - porous structure ( that with pore diameters between 20 and 500 angstroms ) due to the enlarged surface area ( yu et al ., j . photochem . photobiol . a , 148 : 331 - 39 , 2002 ) and micro - porous structure . thus , exposure of hydrophobic ti x o y coating 16 to uv light source 30 ( e . g ., 365 nm , 5 mwcm − 2 ) will switch the material back to superhydrophilic . the source of uv light 30 for illuminating stent 10 bearing ti x o y coating 16 can be , e . g ., fibers coupled to high - power diode lasers . the fibers can be fitted with diffusers that allow sideways radiation . when fibers or plastic rods or sheets are notched , light is reflected out from the opposite side of the material . light uniformity is achieved by increasing the notch depth and frequency , as the distance from the light source increases . rotating this fiber inside stent 10 can provide uniform illumination in all directions . instead of rotating the fiber , a threaded notch can be generated that will illuminate all directions without the need for rotation . fibers can be obtained from , e . g ., polymicro ( www . polymicro . com ). silica fibers offer good uv transmission . the fibers can be , e . g ., about 600 μm to about 2 mm in diameter . as discussed , placing stent 10 coated with hydrophilic , e . g ., superhydrophilic , ti x o y , e . g ., superhydrophilic tio 2 , in the dark will turn ti x o y coating 16 hydrophobic . in some embodiments , however , it may be desirable to store ( e . g ., in the dark , e . g ., in packaging ) stents coated with hydrophilic , e . g ., superhydrophilic ti x o y , without its turning hydrophobic . reversal from superhydrophilic to hydrophobic surface can be prevented by using a nano - porous ( inverse - opal ) structure of ti x o y gu , app . phys . lett . 85 ( 21 ): 5067 - 69 , 2004 . in one embodiment , a layer of organic compound , e . g ., alkyl silane , aryl silane and / or fluoroalkyl silane , can be deposited over the hydrophobic ti x o y . for example , a layer of octadecylsilane or octadecylphosphonic acid over the hydrophobic ti x o y coating 16 can enhance the superhydrophobic state and stability of coating 16 . balaur et al ., electrochem . communic . 7 : 1066 - 70 , 2005 . coating 16 in this embodiment can be turned hydrophilic , e . g ., superhydrophilic , by uv light illumination , as desired . stent 10 can include ( e . g ., be manufactured from ) metallic materials , such as stainless steel ( e . g ., 316l , biodur ® 108 ( uns s29108 ), and 304l stainless steel , and an alloy including stainless steel and 5 - 60 % by weight of one or more radiopaque elements ( e . g ., pt , ir , au , w ) ( perss ®) as described in us - 2003 - 0018380 - a1 , us - 2002 - 0144757 - a1 , and us - 2003 - 0077200 - a1 ), nitinol ( a nickel - titanium alloy ), cobalt alloys such as elgiloy , l605 alloys , mp35n , titanium , titanium alloys ( e . g ., ti - 6al - 4v , ti - 50ta , ti - 10ir ), platinum , platinum alloys , niobium , niobium alloys ( e . g ., nb - 1zr ) co - 28cr - 6mo , tantalum , and tantalum alloys . other examples of materials are described in commonly assigned u . s . application ser . no . 10 / 672 , 891 , filed sep . 26 , 2003 ; and u . s . application ser . no . 11 / 035 , 316 , filed jan . 3 , 2005 . other materials include elastic biocompatible metal such as a superelastic or pseudo - elastic metal alloy , as described , for example , in schetsky , l . mcdonald , “ shape memory alloys ”, encyclopedia of chemical technology ( 3rd ed . ), john wiley & amp ; sons , 1982 , vol . 20 . pp . 726 - 736 ; and commonly assigned u . s . application ser . no . 10 / 346 , 487 , filed jan . 17 , 2003 . in some embodiments , materials for manufacturing stent 10 include one or more materials that enhance visibility by mri . examples of mri materials include non - ferrous metals ( e . g ., copper , silver , platinum , or gold ) and non - ferrous metal - alloys containing superparamagnetic elements ( e . g ., dysprosium or gadolinium ) such as terbium - dysprosium , dysprosium , and gadolinium . alternatively or additionally , stent 10 can include one or more materials having low magnetic susceptibility to reduce magnetic susceptibility artifacts , which during imaging can interfere with imaging of tissue , e . g ., adjacent to and / or surrounding the stent . low magnetic susceptibility materials include those described above , such as tantalum , platinum , titanium , niobium , copper , and alloys containing these elements . stent 10 can be of a desired shape and size ( e . g ., coronary stents , aortic stents , peripheral vascular stents , gastrointestinal stents , urology stents , and neurology stents ). depending on the application , stent 10 can have a diameter of between , e . g ., about 1 mm to about 46 mm . in certain embodiments , a coronary stent can have an expanded diameter of from about 2 mm to about 6 mm . in some embodiments , a peripheral stent can have an expanded diameter of from about 5 mm to about 24 mm . in certain embodiments , a gastrointestinal and / or urology stent can have an expanded diameter of from about 6 mm to about 30 mm . in some embodiments , a neurology stent can have an expanded diameter of from about 1 mm to about 12 mm . an abdominal aortic aneurysm ( aaa ) stent and a thoracic aortic aneurysm ( taa ) stent can have a diameter from about 20 mm to about 46 mm . stent 10 can be balloon - expandable , self - expandable , or a combination of both ( e . g ., u . s . pat . no . 5 , 366 , 504 ). stent 10 can include a releasable biomolecule , e . g ., a therapeutic agent , drug , or a pharmaceutically active compound , such as described in u . s . pat . no . 5 , 674 , 242 , u . s . application ser . no . 09 / 895 , 415 , filed jul . 2 , 2001 , and u . s . application ser . no . 10 / 232 , 265 , filed aug . 30 , 2002 . the therapeutic agents , drugs , or pharmaceutically active compounds can include , for example , anti - proliferative agents , anti - thrombogenic agents , antioxidants , anti - inflammatory agents , immunosuppressive compounds , anesthetic agents , anti - coagulants , and antibiotics . specific examples of such biomolecules include paclitaxel , sirolimus , everolimus , zotarolimus , picrolimus and dexamethasone . a number of embodiments have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the disclosure . accordingly , other embodiments are within the scope of the following claims .

US-76377007-A

a golf glove having improved fit and gripping features is disclosed herein . the golf glove of the present invention includes gripping features permanently disposed on one or more of the fingers , preferably the front surfaces of the ring and little fingers , and also includes an expandable slit that extends from an opening and that helps the golf glove expand to receive a golfer &# 39 ; s hand and then retract so that the glove fits comfortably on the golfer &# 39 ; s hand .

a preferred embodiment of the golf glove of the present invention is shown in fig1 - 2 . as shown in these figures , the golf glove 10 comprises a front or palm - side section 20 and a back or dorsal section 30 , which combine to form a hand body section 41 , and which include extensions that combine to form a little finger section 42 , a ring finger section 44 , a middle finger section 46 , an index finger section 48 , and a thumb section 50 . the golf glove 10 further includes one or more fourchettes 25 disposed between the front and back sections 20 , 30 on each of the finger sections 42 , 44 , 46 , 48 and the thumb section 50 . though the golf glove 10 may be made from any material known to a person of ordinary skill in the art , the material of at least one of the front section 20 , back section 30 , and fourchettes 25 preferably has elastic properties that allow the golf glove 10 to fit securely around the hand of a golfer without uncomfortably constricting the hand . the material used to make the back section 30 preferably is a mesh or two - way knit fabric to provide breathability and elasticity , while the material of the front section 20 and the fourchettes 25 preferably is real or synthetic leather to provide friction between the gloved hand and the golf club head during play . in the preferred embodiment , and as shown in fig1 , the back section 30 is formed from a plurality of materials that are stitched or otherwise connected to each other to cover most of the dorsal side of a golfer &# 39 ; s hand . in this embodiment , the back section 30 of the hand body section 41 , the ring finger section 44 , the middle finger section 46 , and the index finger section 48 is composed of a honeycomb mesh fabric 33 , the back section 30 of the little finger section 42 is composed of a less elastic mesh fabric 35 , and a more elastic mesh fabric 34 extending connects the honeycomb mesh fabric 33 and the less elastic mesh fabric 35 and extends from the opening to a point between the little finger section 42 and the ring finger section 44 . the front and back sections 20 , 30 of the thumb section 50 preferably are composed of a non - elastic material , and most preferably a leather or synthetic leather material . the front section 20 of the golf glove 10 of the present invention preferably is also composed of one or more non - elastic materials . in the preferred embodiment , and as shown in fig2 , the front sections 20 of the hand body 41 ( i . e ., the palm covering ), the thumb section 50 , the index finger section 48 , the middle finger section 46 , and at least half of the ring and little finger sections 44 , 42 are composed of a leather material . the front sections 20 of the upper portions 42 a , 44 a of the little and ring finger sections 42 , 44 are preferably composed of a different , inelastic material , such as suede , to increase the friction created between these portions of the glove 10 and a golf club during use . the front sections 20 of these upper portions 42 a , 44 a further comprise raised gripping features 100 , shown in fig2 , 3 a , and 3 b , which increase the friction between the golf glove 10 and the golf club during use and provide added control for the golfer using the little and ring fingers . in the preferred embodiment , the raised gripping features 100 are composed of a silicon material , but may be made of any other high - friction material known to a person of ordinary skill in the art . the gripping features 100 preferably are printed onto the material of the front section 20 , but in alternative embodiments may be affixed to the material in any way known in the art . as shown in fig3 a and 3b , the gripping features 100 preferably are disposed on the front sections 20 of the upper portions 42 a , 44 a of the little and ring finger sections 42 , 44 in any pattern desired by the manufacturer or the golfer , which can add to the overall aesthetic appeal of the glove to consumers . in other embodiments , the gripping features 100 may be disposed on part or all of the front sections 20 of different finger or thumb sections 46 , 48 , 50 , or all finger and thumb sections 42 , 44 , 46 , 48 , 50 of the golf glove 10 . the golf glove 10 further comprises an opening 60 sized to receive a golfer &# 39 ; s hand , and a slit 70 extending from the opening 60 into the back section 30 of the golf glove 10 that allows the opening 60 to expand sufficiently for a golfer to pull the golf glove 10 onto his or her hand . the slit 70 is preferably triangular in shape , but may be circular , elliptical , or any other shape desired by a golfer or manufacturer , as long as it effectively helps the opening 60 expand as needed . in alternative embodiments , this slit 70 may extend into the front section 20 of the glove or may be disposed at a point at which the front section 20 meets the back section 30 . as shown in fig1 , the slit 70 preferably extends into the back section 30 proximate the thumb section 50 . the slit 70 preferably includes piping 75 along its edges to maintain its overall shape , and this piping 75 preferably extends around the opening 60 of the golf glove 10 for aesthetic purposes and also to prevent the material of the golf glove 10 from fraying during use . a sweat band 65 composed of absorbent material preferably is affixed to the interior surface of one or more of the front section 20 or the back section 30 of the glove 10 proximate the opening 60 to prevent sweat from accumulating within the glove 10 or dripping down the golfer &# 39 ; s wrist or hand during play . the sweat band 65 preferably extends from one side of the slit 70 , around the circumference of the opening 60 , and terminates at the other side of the slit 70 , but in alternative embodiments may extend only part of the way around the opening 60 . the sweat band 65 also is preferably made of an elastic material that helps the opening expand and contract around a golfer &# 39 ; s hand as the golfer pulls the golf glove 10 on . an expansion portion 80 made of elastic material is disposed within the opening 72 created by the slit 70 to allow the slit to open to receive a golfer &# 39 ; s hand and then return to its original configuration . while the expansion portion 80 may be constructed as described in u . s . pat . no . 7 , 480 , 944 and enclosed or encased within a sleeve portion ( not shown ), it is preferably attached directly to an interior surface of the front or back sections 20 , 30 as close to the edge of the slit 70 as possible to reduce the overall weight of the golf glove 10 . the expansion portion 80 also preferably closes the entire opening 72 created by the slit 70 to prevent dirt and debris from entering the golf glove 10 during use . a pull tab 90 formed from highly graspable material such as silicon , ridged plastic , microfiber , or suede , is provided proximate the opening 60 on an exterior surface of the front or back sections 20 , 30 , and preferably on the front section 20 of the golf glove 10 . this pull tab 90 provides a golfer with a surface to grip while pulling on the golf glove 10 . from the foregoing it is believed that those skilled in the pertinent art will recognize the meritorious advancement of this invention and will readily understand that while the present invention has been described in association with a preferred embodiment thereof , and other embodiments illustrated in the accompanying drawings , numerous changes , modifications and substitutions of equivalents may be made therein without departing from the spirit and scope of this invention which is intended to be unlimited by the foregoing except as may appear in the following appended claims . therefore , the embodiments of the invention in which an exclusive property or privilege is claimed are defined in the following appended claims .

US-201514623240-A

this invention relates generally to patient monitoring systems and more particularly concerns devices and systems used to monitor bed patients in hospital or other care - giving environments . in accordance with a first aspect of the instant invention , there is provided a pressure sensitive mat which has been completely sealed around its exterior edges . the interior of the mat is kept in communication with the atmosphere by way of a section of flexible tubing which encloses the attached electrical line . one end of the tubing is sealed inside of the mat and the other end is open to the atmosphere , thereby providing a passageway for air to reach the interior of the mat . this arrangement , however , protects the interior of the mat from exposure to fluids near the perimeter of the mat and allows the mat - portion of the invention to be completely submersed without adverse effect , if that should become necessary .

turning first to fig1 wherein the general environment of the instant invention is illustrated , in a typical arrangement a sensing mat 100 is placed on a hospital bed 20 where it will lie beneath a weight - bearing portion of the reclining patient &# 39 ; s body , usually the buttocks and / or shoulders . it should be noted at the outset , however , that although the language that follows is largely confined to illustrations involving bed - type sensors , the range of application of the instant invention is much broader and could include chair sensors , potty sensors , and any other type of pressure - sensitive switch that is used in a patient monitoring environment where invasion by fluids is a concern . generally speaking , the mat 100 / monitor 50 combination works as follows . when a patient is placed atop the mat 100 , the patient &# 39 ; s weight compresses the mat 100 and closes an electrical circuit , which closure is sensed by the attached electronic patient monitor 50 through electrical line 10 and connector 40 ( fig2 ). when the patient attempts to leave the bed , weight is removed from the sensing mat 100 , thereby breaking the electrical circuit . the patient monitor 50 senses the change in electrical continuity and signals the caregiver per its pre - programmed instructions . note that additional electronic connections not pictured in this figure might include a monitor 50 to nurse - call - station connection , a monitor 50 to computer connection , and an a / c power cord — although the monitor 50 can certainly be configured to be battery operated . fig2 contains a schematic drawing of a prior art pressure sensitive patient mat . as is indicated in that figure , a typical pressure sensitive mat 100 includes upper and lower non - conductive outer members 220 and 240 ( fig3 ), respectively , which serve to protect the interior from contact with the environment . these members are usually made of a flexible impermeable electrically non - conductive material such as plastic , with polyester being the preferred material . these two members are separated by an internal non - conductive spacer 260 , which has at least one aperture therethrough 250 . in fig2 the central spacer 260 is shown in phantom because it is hidden from view within the assembled product . as is further indicated in fig3 the typical pressure sensitive switch is a “ sandwich ” type arrangement with the two outer members surrounding the inner non - conductive spacer 260 . the perimeters of the upper 220 and lower 240 members are conventionally sealed together by a heat activated adhesive ( such as polyethylene ) or by some form of pressure sensitive adhesive . affixed to the inner surface of each of the outer members 220 and 240 is a conductive layer ( 320 and 340 , respectively ) which , for safety purposes , preferably does not extend to the edges of the mat . as should be clear , pressure on the mat 100 tends to urge the conductive faces 320 and 340 into contact through aperture 250 , thereby completing an electrical circuit . when pressure is released , the central spacer 260 , which is preferably constructed of a compressible and resilient material , expands and pushes the conductive layers apart . as is suggested in fig2 when the electrical line 10 enters the mat it is typically separated into two electrically isolated elements , one of which is placed in electrical communication with the conductive layer 320 atop of the spacer 260 and the other which is placed in electrical communication with the conductive layer 340 underneath the spacer . as is generally illustrated in fig3 the central spacer 260 usually fits loosely within an envelope formed by the two outer layers 220 and 240 . this arrangement allows air to move freely throughout the interior of the mat 100 . fluid communication between the interior of the mat and the atmosphere is typically provided in the form of one or more breaches in the seal between the upper 220 and lower 240 members . these breaches are created during the manufacturing process and provide a means for the mat 100 to “ breathe ” when compressed . a first natural breach occurs at the point where electrical line 10 enters the mat between the upper 220 and lower 240 mat members . typically , the mat material fits loosely around the electrical line 10 , thereby providing a ready passageway for air ( and fluids ) to enter and exit the mat . where more airways are needed , it is possible to create gaps between the outer members along their common perimeter . one way of doing this involves placing a piece of monofilament line between the upper 220 and 240 members before they are sealed . after the two members have been sealed together , the line is withdrawn , leaving behind a small gap 230 in the seal between the layers . a first preferred embodiment of the instant mat is illustrated in fig4 which contains a plan view of the device . as is illustrated there , the mat portion of the sensor 400 is configured in a “ sandwich ” arrangement as has been described above . however , the instant embodiment differs from the prior art in that it contains a separate open - ended “ breathing tube ” 420 which loosely encloses the electrical line 10 . this tube 420 enters the mat between the upper 220 and lower 240 members . the upper 220 and lower 240 members may now be completely sealed along their perimeters , including where the tube 420 / electrical line 10 combination enters the mat 400 . when pressure is applied to the mat 400 , the air inside of the mat 400 is pushed toward and out of the breathing tube 420 , thereby allowing the mat 400 to compress . similarly , when pressure is removed , air returns from the atmosphere to the interior of the mat 400 via the same conduit , thereby allowing the mat 400 to quickly expand to its un - weighted configuration which separates the upper 220 and lower 240 members . fig5 illustrates a preferred embodiment of the breathing tube 420 in cross section . as can be seen in this figure , tube 420 is sized so that the electrical line 10 fits loosely therein , thereby providing at least a partially unobstructed air passageway . the breathing tube 420 is preferably round or oval , although obviously the precise shape of the tube 420 is unimportant , so long as an air - tight seal may be created around the perimeter of the tube 420 where it enters the mat 400 between the two outer mat members . within electrical line 10 will typically be found two or more electrically isolated conductors 510 , with the use of a four - conductor wire being a common arrangement . it should be apparent that the number of electrical conductors 510 that might be found within the electrical line 10 is unimportant to the practice of the instant invention . as has been described previously , it is customary to use two of these conductors 510 to establish separate electrical communications between the monitor 50 and the upper 320 and lower 340 conducting members inside of the mat . in operation , the sensing portion of the instant invention 400 may be completely submerged without risk of fluid invasion , so long as the outer terminus of the breathing tube 420 ( i . e ., the end nearest the connector 40 ) is kept clear of the fluid . further , the instant mat 400 may be fully compressed and then released while held under water without risk of drawing fluid into its interior , provided that the perimeter has been completely sealed . finally , in a patient monitoring situation where there has been a release of fluid into the bed or chair , the mat 400 can be cleaned and reused without endangering its structural integrity . fig7 contains another preferred arrangement . in this variation , the tube 420 and electrical wire 10 run roughly in parallel into the mat 700 . a cross sectional view of this arrangement may be found in fig6 a and 6b , these two figures differing only in the size of the breathing tubes 420 and 620 attached thereto . this configuration of breathing tube / electrical conductors 510 is sometimes referred to as a “ multi - lumen ” cable by those skilled in the art . of course , the diameter of the breathing tube 420 is unimportant to the operation of the instant invention , except that it should be large enough to convey sufficient air into and out of the interior of the mat 700 to allow it to be readily compressed and then expanded again . the best tube 420 diameter will ultimately depend on the specifics of the mat to which it is attached and will need to be determined empirically for each type of mat . fig8 contains still another variation , wherein the electrical line 10 and the breathing tube 420 enter the mat 800 independently . as should be clear from this figure , this arrangement suffers from the disadvantage that two different breaches of the mat perimeter would need to be sealed . however , having the electrical line 10 and breathing tube 420 separated might be advantageous in some circumstances . finally , it should be noted and remembered that although it is preferable that the mat be completely sealed along its perimeter except where the breathing tube penetrates it , that is not strictly required . the breathing tube acts to assist in reinflation of the any sort of mat when weight is removed therefrom , so it would also be useful with a conventional mat which is not hermetically sealed . however , if the mat is not completely sealed along its perimeter there is a risk that fluid will enter the interior of the mat through those breaches , as has been a problem in the past . clearly , many variations of this and the previous arrangements are possible and have been specifically contemplated by the instant inventor . although the preceding text has occasionally referred to the sensor of the instant invention as a “ bed ” mat that was done for purposes of specificity only and not out of any intention to limit the instant invention to that one application . in fact , the potential range of uses of this invention is much broader than bed - monitoring alone and might include , for example , use with a chair monitor , urinal monitor , or other pressure sensitive patient monitor application which is configurable as a binary switch , a binary switch being one that is capable of sensing at least two conditions and responding to same via distinct electronic signals . in the preferred embodiment , those two conditions would be the presence of weight on the switch . additionally , it should be noted that the use of the term “ binary ” is not intended to limit the instant invention to use only with sensors that can send only two signal types . instead , binary switch will be used herein in its broadest sense to refer to any sort of sensor that can be utilized to sense the condition or location of a patient , even if that sensor can generate a multitude of different signals . thus , it is apparent that there has been provided , in accordance with the invention , a patient sensor and method of operation of the sensor that fully satisfies the objects , aims and advantages set forth above . while the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art and in light of the foregoing description . accordingly , it is intended to embrace all such alternatives , modifications and variations as fall within the spirit of the appended claims .

US-79200101-A

methods , systems , and apparatuses are provided for attaching tissue , for example to bone . for example , devices are provided for anchoring filament to tissue or bone . suture anchors are provided , and multi - component suture anchors are provided with sutures and components that fit together through an interference fit .

fig1 a shows a cutaway view of a suture anchor according to the invention . the anchor comprises an anchoring element 10 , which is adapted to be embedded in a bone tunnel or in soft tissue , and comprises an axial channel 12 . in the embodiment shown , element 10 comprises a series of ridges 14 on its outer surface , which aid in securing the element , for example , in a bone tunnel . it will be understood that the ridges 14 are not a necessary element of the anchor , and may be omitted if desired . the anchor 10 further comprises an insertion stem 16 . when the anchor is in the deployed position shown in fig1 a , the insertion stem 16 is held within the axial channel 12 , e . g ., by interference fit . in preferred embodiments , the insertion stem 16 is slightly larger than the axial channel 12 , so that the stem 16 forces the anchoring element 10 to expand when it is inserted therein , thereby securing the anchor firmly in the bone tunnel . the anchor further comprises a filament 18 , e . g ., a suture , disposed between the anchoring element 10 and the insertion stem 16 . in the preferred embodiment shown in fig1 a and 1 b , the insertion element comprises a suture channel 20 . this channel guides the suture 18 , and holds it in compression against the anchoring element 10 . the configuration of anchoring element 10 , insertion stem 16 , and suture 18 can be seen clearly in fig1 b , which shows a cross - sectional view of the anchor at the point indicated by the arrows of fig1 a . the mild compression of the suture 18 in the channel 20 provides a frictional resistance to prevent movement of the suture when tension is applied to one of its free ends 22 . this frictional resistance is overcome when a tension greater than the threshold tension is applied to a free end of the suture . the suture 18 may then slide longitudinally through the channel 20 , allowing the length of the free ends 22 to be adjusted . it will be understood that the configuration of suture 18 in fig1 represents only one of many possible embodiments of the invention . in particular , it will often be preferable to pass the suture between the insertion stem 16 and the anchoring element 10 multiple times , for example , in order to form a loop segment . in other embodiments of the invention , the compression of the suture may be stronger , so that the threshold tension which would be necessary to move the suture is close to or exceeds the breaking strength of the suture . in such embodiments , the length of the free ends is no longer adjustable once the compression on the suture is applied . in one such embodiment , the suture ( or other filament ) may be formed with a small loop at one end , which is used to secure the suture to the anchor . this embodiment is illustrated in fig2 a and 2 b ; the former depicting a cross - section of the anchor along the axis of symmetry ; and the latter depicting a transverse section . the head of suture 18 comprises a small loop 28 ; e . g ., disposed at the distal end of the anchor . the suture passes between the insertion stem 16 and the anchoring element 10 , forms a loop segment 26 , and passes back between the insertion stem and the anchoring element . the suture then passes through head loop 28 , back up between the insertion stem 16 and the anchoring element 10 , and ends in free end 22 . the loop segment 26 can be tightened by pulling free end 22 , and loosened by pulling the loop segment 26 itself . because of the mechanical advantage afforded by looping of the suture , the force required to loosen the suture by pulling on loop 26 is twice the force required to tighten the suture by pulling on free end 22 . in the embodiment shown , the suture passes through two channels 23 , 25 in the anchor 16 ; one of these channels 25 could be eliminated so that the suture would pass around the head of the anchor . fig3 a and 3 b illustrate a different embodiment of the anchor , in which the suture is secured by a small knot 27 rather than a loop . fig3 a is a plan view of the anchor , and fig3 b is a longitudinal cross - section . fig4 a - 4 c illustrate a deployment process for the anchors shown in fig1 and 2 . only a portion of the suture is shown in fig4 a - 4 c ; preferably , the suture will be looped in the fashion shown in fig2 or fig3 . fig4 a shows an anchor placed in bone tunnel 32 , connected to deployment apparatus 34 . fig4 b illustrates the insertion element 16 being pulled into the axial channel 12 of anchoring element 10 . tension is applied to the stem of insertion element 16 ( in the direction shown by arrow a ) by the colleted stem - pulling portion of the deployment device 34 , while the anchoring element 10 is held substantially immobile within bone hole by the anchor - holding portion of that device . these forces act to move the insertion element 16 in the direction of arrow a such that larger diametered portion of insertion element is pulled into the axial channel 12 of anchoring element 10 . as a result , the wall of the anchoring element 10 expands outwardly and into the walls of the bone hole 32 . as shown in fig4 c , the insertion stem is pulled proximally through the axial bore 12 , until further motion is retained by abutment of flange 36 with the distal end of anchoring element 10 . at this point , the deployment device continues to exert tension on the stem 16 , causing frangible portion 38 to shear . this facilitates removal of the excess portion of the stem 16 and , likewise , disengages the deployment device 34 . the suture 18 can be adjusted by pulling firmly on free end 22 . the suture anchors of the invention can be provided in a variety of sizes and materials , depending on the intended application . for example , a typical anchor intended to be embedded in the shoulder blade , for use in repair of the rotator cuff of an adult , might have a length in the range of 8 - 15 mm and a diameter in the range of 3 - 6 mm . such an anchor might be capable , for example , of holding a # 2 suture with a threshold force in the range of 25 - 35 lbs . ( as it is used herein , the term “ threshold force ” describes a pulling force above which a filament moves longitudinally through an anchor , and below which the filament substantially does not move through the anchor ). it is generally desirable for the anchor to consist of biocompatible material , e . g ., implant grade high density polyethylene , low density polyethylene ( pe 6010 and pe 2030 ), polypropylene ( 13r9a and 23m2 : all made by rexene , dallas , tex .) or surgical implant grade steel . in some embodiments , the anchor may comprise a bioabsorbable material , e . g ., poly - 1 - lactide or a lactide - glycolide composition . in an exemplary embodiment of the methods of the invention , the anchor illustrated in fig3 a and 3 b can be used to repair a torn rotator cuff by reattachment of the rotator cuff to the scapula . an anchor such as that illustrated in fig3 a , which holds a loop of suture by interference fit , is embedded in a tunnel drilled , for example , in the scapula . the loop of suture and the free end of the suture extend out from the scapula at the proximal end of the anchor . when the anchor is disposed in the bone tunnel , a portion of the torn rotator cuff is passed through the suture loop . the loop is then tightened by pulling with a force greater than the threshold force on the free end of the suture . this tightens the loop , drawing the tissue against the anchor and securing it to the bone without knotting the suture . the free end of the suture may then be trimmed , if desired . the invention may be used with various anchor designs , depending on the nature of the surgical repair . in particular , designs similar to those described in u . s . application ser . no . 08 / 813 , 914 , now u . s . pat . no . 5 , 935 , 129 , e . g ., at fig5 and in the accompanying text , and in u . s . application ser . no . 08 / 814 , 149 , now u . s . pat . no . 5 , 911 , 721 , and in the accompanying text , both of which are incorporated herein by reference , may be adapted to hold a suture in accordance with the teachings herein . other embodiments of the invention will be apparent to those skilled in the art from a consideration of the specification or practice of the invention disclosed herein . for example , while the invention has been described primarily in the contexts of securing soft tissue to bone and of repairing tears in soft tissue , it may also be used to secure or repair cartilage , ligaments , or other tissues . it is intended that the specification and examples be considered as exemplary only , with the true scope and spirit of the invention being indicated by the following claims .

US-5255705-A

a photocurable composition is provided which includes al having bottom and side walls which define a chamber a photocurable material disposed in - the chamber . the wall circulmacribe the bottom wall and includes a rant so that the side wall will substantially attenuate nic radiation while minimally attenuating visible light ng an approximating spectral wavelength greater than nanometers . by that arrangement , the level of the ocurable material may be visualized through the side while still providing sufficient attenuation of nic radiation to provide for long term storage of the ocurable material without substantial curing thereof .

a packaged photocurable composition according to one embodiment of the invention is illustrated in fig1 and is designated by the numeral 10 . the packaged photocurable composition 10 broadly includes a vial 12 and a photocurable material 14 therein . the vial 12 includes a bottom wall 20 from which extends an elastic side wall 16 circumscribing the bottom wall to define a generally cylindrical internal chamber 18 therein . the photocurable material 14 is received within the internal chamber 18 . the side wall 16 has an upper section 17 shaped to form a neck portion 22 that terminates in an outlet 26 . the neck portion 22 is provided with a threaded section 24 for coupling to a conventional threaded closure cap . the closure cap ( not shown ) has a dispensing opening and a closure for selectively covering that opening . a similar closure cap is described in u . s . pat . no . 5 , 328 , 058 , and such could be applied to the vial 12 . other types of dispensing outlets and closure caps may also be utilized . the vial 12 , including the elastic side wall 16 with its upper section 17 , and the bottom wall 20 are preferably integrally molded and made of a polymeric material . the photocurable material 14 is dispensed from the vial 12 by displacing portions of the side wall 16 from an initial position , such as where opposing sides of the vial are substantially parallel , to a position where the sides are displaced so as to be closer together . the sides of the vial 12 are sufficiently elastic to substantially return to their initial position once the finger pressure of a user is released . thus , in order for the vial 12 to be squeezable , the polymeric material from which it is formed should havp a flexural modulus that is preferably less than 200 , 000 kg / cm 2 , and more preferably less than approximately 20 , 000 kg / cm 2 , and most preferably less than 2 , 000 kg / cm 2 . referring additionally to fig1 a , the side wall 16 has a thickness d that is preferably in the range of approximately 0 . 005 - 0 . 1 inches ( 0 . 12 - 2 . 5 mm ), and more preferably in the approximating range of 0 . 01 - 0 . 06 inches ( 0 . 25 - 1 . 5 mm ). most preferably , side wall 16 should have a thickness dimension d in the approximating . range of 0 . 010 . 03 inches ( 0 . 25 - 0 . 75 mm ). as will be discussed in following paragraphs , it is important that the wall thickness be substantially uniform throughout the side wall 16 . therefore , as the side wall transitions to the upper section 17 , both the wall thickness c of the radiused portion 15 and the thickness b and a of the upper wall section 17 that transitions inwardly to form the outlet 26 should all be substantially equal to the thickness d . thus , for a vial having a nominal thickness of 0 . 020 inches for the dimension d , the dimensions a , b and c should not vary more than ± 0 . 005 inches in order to maintain a proper level of electromagnetic radiation absorption and transmissivity . the flexural modulus and the thickness of the elastic side wall portions 16 are selected to enable opposed sections of the wall portion 16 to be readily squeezed together by finger pressure . as the opposed sections are squeezed together , free space in the chamber 18 is reduced and the photocurable material 14 in the chamber 18 is expelled through the outlet 26 . the polymeric material from which the vial 12 is formed is sufficiently elastic to enable the squeezed sections thereof to fully self - recover from the deformed state to the original state of the vial , once the finger pressure is released , thereby re - assuming the normal , generally cylindrical configuration thereof . as will be discussed in following paragraphs , another attribute of the polymeric material utilized for vial 12 is its transmissivity of visible light , allowing a user to ascertain the level of the photocurable material 14 disposed in chamber 18 . suitable polymeric materials for making the vial 12 include blow molded low density polyethylenes (“ ldpe ”) such as no . 5104 from chevron , high density polyethylene (“ hdpe ”), polyvinyl chloride (“ pvc ”), poly ( ethylene glycol - co - cyclohexane - 1 , 4 - dimethanol terephthalate ) (“ petg ”), or poly ( ethylene terephthalate ) (“ pet ”). the selected polymeric material must also be compatible with the photocurable material 14 and not unduly degrade over an extended period of time . the photocurable material 14 is a liquid or semi - liquid material that is curable upon exposure to selective actinic radiation , i . e ., wavelengths of light ( electromagnetic radiation ) that effects curing in the material . examples of photocurable material include dental ( including orthodontic ) adhesives and primers , luting cements , crown build - up material and sealants . such materials have a photoinitiator ( such as camphor quinone (“ cpq ”) ) that initiates curing when exposed to actinic radiation , which may be a portion of the electromagnetic spectrum having a wavelength less than 500 nm . the photocurable material 14 may also be a non - dental material such as a medical preparation or a composition intended for household , commercial or industrial application . the viscosity of the photocurable material must be within a range of values to be easily dispersed by squeezing portions of the side wall 16 , and flow to the bottom of the chamber 18 without substantially coating the internal surface of the side wall , and thereby inhibiting visualization of the remaining portion of the photocurable material in the vial 12 . photocurable material 14 should have an absolute viscosity less than or equal to approximately 100 centipoise . with respect to kinematic viscosity , photocurable materials having viscosities within the approximating range of 120 - 1200 centistokes have been successfully utilized in the instant invention . the vial 12 and in particular , the side wall 16 preferably transmits less than approximately 1 . 0 % of actinic radiation , and more particularly , transmits less than approximately 0 . 5 % of actinic radiation . most preferably , less than approximately 0 . 2 % of actinic radiation is transmitted through the side wall 16 . as a result , the photocurable material 14 is able to remain in the chamber 18 for an extended period of time without unduly curing therein . however , at least one upright portion of the side wall 16 must be capable of transmitting light having wavelengths greater than 500 nm , in order to transmit sufficient light in the visible spectrum to allow a user to see the photocurable material 14 therethrough , which photocurable material may be a transparent liquid . in that way , the level of the material 14 in chamber 18 can be determined . as an example , if the photocurable material 14 is a dental adhesive that includes the photoinitiator that comprises cpq , the adhesive will begin to cure when exposed to light having wavelengths approximating 470 n . preferably , the wall material of the vial containing the dental adhesive blocks the passage of most of the light having such a wavelength , as well as light having wavelengths relatively close thereto . in such example , the wall portions preferably transmit less than approximately 1 . 0 % of light having wavelengths in the range of 400 nm to about 500 nm . in order to achieve the necessary wavelength sensitive transmittance , colorants such as pigments and / or dyes are useful for making the polymeric material absorb selective wavelengths of impinging electromagnetic radiation . the amount of colorant necessary per unit of polymeric material to provide the desired protection will vary depending on a number of factors , such as the particular colorant selected , the thickness of the wall sections of the vial , the uniformity of the wall sections of the vial , the wavelength of light to be absorbed and the capacity of the non - colorant treated polymeric material to absorb the light in the wavelengths to be filtered . a suitable colorant for the dental adhesive vial mentioned above is a colorant having a manufacturer &# 39 ; s identification no . 70344 hcp from teknor color company . the colorant is in the orange portion of the visible light portion of the electromagnetic spectrum . while colorants in the red portion of the spectrum have been found to suitably block actinic radiation , such as wavelengths less than 500 nm , they do not transmit sufficient visible light having wavelengths greater than 500 nm to allow a user to easily visualize the level of the photocurable material 14 within the vial 12 . on the other hand , colorants within the yellow portion of the visible light spectrum transmit sufficient light having wavelengths greater than 500 nm , but do not sufficiently attenuate wavelengths less than 500 nm . it is a necessary requirement to substantially attenuate actinic radiation while minimally attenuating visible light having an approximating spectral wavelength greater than 500 nm , and colorants in the orange wavelengths have been found to meet that criteria . the vial 12 may be made , for example , by mixing 6 % by weight of the colorant with 94 % of the ldpe “ carrier ” resin . the resultant mixture is then mixed with ldpe ( such as no . 5104 , from chevron ) at a “ let - down ” ratio of 5 : 1 ( i . e ., a ratio of five parts ldpe to one part carrier and colorant mixture by volume ). more accurately , the overall mixture of colorant and resin should have a colorant concentration of approximately 1 %. preferably , the carrier resin has a slightly lower melting temperature than the melting temperature of the remaining quantity of ldpe , to facilitate mixing . a suitable carrier resin is yukalon lm - 30 from mitsubishi petro . the amount of electromagnetic radiation attenuation is also dependent upon the thickness of the material through which the radiation passes . for vial 12 , the side wall 16 has a thickness through which the electromagnetic radiation passes . the thicker the side wall 16 is , the greater the attenuation effect . however , as the vial 12 is intended to be a “ squeeze bottle ” the wall thickness cannot be so thick as to impede the displacement of opposing sides of the vial using only finger pressure . thus , once a vial polymeric material and thickness has been selected , it then becomes critical that the wall thickness remain substantially uniform throughout the contours of the vial . as the upper section 17 of the side wall 16 is contoured to form the neck 22 of the vial and terminate in the outlet 26 , there are several radiused bends in the cross - sectional contour of the vial . it is important that these radiused regions have substantially the same thickness as the unradiused portions thereof , in order not to attenuate less actinic radiation therethrough , or attenuate too much light in the wavelengths greater than 500 nm . thus , the thickness of the vial radiuses a and c should be substantially equal to the wall thickness b and d . similarly , the thickness of the side wall 16 where it interfaces with the bottom wall 20 should have a thickness which is not less than the minimum end of the side wall thickness tolerance . a packaged composition 10 a according to another embodiment of the invention is illustrated in fig2 and 3 . the packaged composition 10 a includes a vial 12 a and a photocurable material 14 a therein . preferably , the vial 12 a and the photocurable material 14 a are the same or similar to the vial 12 and photocurable material 14 previously discussed , except for the differences noted in the paragraphs that follow . as a consequence , a detailed description of such previously discussed items will not be repeated . as shown in fig2 and 3 , the elastic side wall 16 a of the vial 12 a includes a label 30 a that extends around the circumference of the vial 12 a , and extends longitudinally along the length of the vial from a portion adjacent the bottom 20 a to a position substantially adjacent the beginning of the upper section 17 a of side wall 16 a . the label 30 a includes a first section 32 a that is opaque or substantially opaque to the passage of light , especially light having wavelengths in the visible spectrum . the label 30 a may also include a second section 34 a that is transparent or translucent to light having wavelengths in the visible spectrum . both of the sections 32 a and 34 a may be formulated to block the passage of all or at least a substantial portion of actinic radiation . the label 30 a may be made of any of a number of suitable materials , including polymeric film stock . examples of suitable material include polyethylene labels from flexcon company , inc . optionally , the label 30 a can be made of a co - extruded polyethylene film wherein the first section 32 a is made of an extruded mixture of polyethylene and black , white or other pigment , while the second section 34 a is simultaneously extruded from a stream of polyethylene without such pigment . as another alternative , the label 34 a may be made of transparent or translucent polyethylene film and a quantity of ink applied to the first section 34 a to render it opaque to the passage of light in the visible light spectrum . as a further option , the second section 34 a is eliminated to define a gap between opposing edges of the label 30 a , with the photocurable material 14 a being viewed through the gap between opposing end portions of the label 30 a . the window created between the opposing edges of the label 30 a , or through the unpigmented section 34 a of label 30 a enhances the contrast between the photocurable material and the air space above the photocurable material in the internal chamber 18 . as many of the photocurable materials which may be packaged in vial 12 are substantially transparent , it is important that a contrasting background be created for viewing the height of the photocurable material within the vial 12 . for vials 12 a of small size , it is currently not technically feasible to co - mold the vial itself with a single portion thereof having a substantially transparent or translucent portion and a remaining portion being substantially opaque to visible light . therefore , for such vials of small size , it is critically important that the label produce a substantially opaque section which occupies more than 50 % of the circumference of the vial for providing contrast to view the photocurable material through a remaining portion of the circumference of the vial , i . e . the portion 34 a . although not shown in the drawings , one side of the label 30 a is coated with a pressure - sensitive adhesive to firmly secure the label 30 a to the upright side wall 16 a . an example of a suitable adhesive is a 0 . 0008 inch ( 0 . 04 mm ) thick layer of a permanent acrylic adhesive ( no . v - 157 from flexcon ). preferably , where the label 30 a includes a transparent portion 34 a , adjacent end sections of the label 30 a overlap in order to reduce the likelihood of flagging and assure that the end portions of the label 30 a tightly adhere to the side wall 16 a . as previously discussed , the label 30 a enhances the visibility of the level of the photocurable material 14 a in the vial 12 a when the user is viewing the photocurable material 14 a through the second portion 34 a of label 30 a , or through the gap between end portions of the label 30 a . advantageously , since the first section 32 a also hinders transmission of actinic radiation , there is less likelihood than an undue amount of actinic radiation will reach the photocurable material 14 a . another embodiment of the invention is shown in fig4 and 5 , wherein a packaged composition 10 b includes a vial 12 b and a photocurable material 14 b . both the vial 12 b and the photocurable material 14 b are preferably identical to the vial 12 and photocurable material 14 previously described , except for the differences set out below . the vial 12 b includes a float or element 40 b that is received in the chamber 18 b . the element 40 b has a density less than the density of the photocurable material 14 b , and as a result floats in the photocurable material 14 b . the element 40 b is visible through the side wall 16 b that transmits light in a portion of the visible light spectrum , and thereby enhances the user &# 39 ; s ability to determine the level or amount of photocurable material 14 b in the chamber 18 b . prefqrably , the element 40 b has dimensions along two axes that are smaller than the dimensions of the outlet 26 b so that the element 40 b can be inserted into the chamber 18 b through the outlet 26 b after the vial 12 b is manufactured . as an example , if the chamber 18 b of the vial 12 b has an internal diameter of 0 . 64 inches ( 1 . 6 cm ), the element 40 b may have overall dimensions of 0 . 25 × 0 . 50 inches ( 6 . 4 × 13 mm ) and a thickness of 0 . 06 inches ( 1 . 5 mm ). as illustrated in fig5 the element 40 b preferably has an overall generally oval - shaped configuration in plan view . preferably , the element 40 b has a thickness in the approximating range of 0 . 01 - 0 . 06 inches ( 0 . 25 - 1 . 5 mm ). the flat shape and relatively small thickness of the element 40 b helps the element return to a horizontal orientation after the vial 12 has been inverted and then returned to the upright vertical orientation as depicted in the figures . moreover , the flat shape of element 40 b tends to cast a more distinct shadow than a float having , for example , a spherical shape , and as a result is relatively easy to see through the side wall 16 b . further , the element 40 b may have a central hole 42 b . the hole 42 b improves fluid flow of the photocurable material 14 b to the outlet 26 b when the vial 12 b is inverted during a dispensing operation . the element 40 b is made of a material that is inert to the photocurable material 14 b . a suitable material for element 40 b that is inert to many photocurable materials is polyethylene . the element 40 b could be a liquid , a semi - liquid ( gel or paste ) or a solid material that is either hollow or not hollow , including materials which are foamed . another embodiment of the invention is depicted in fig6 wherein a packaged composition 10 c includes a vial 12 c and a photocurable material 14 c , the latter of which is identical to the photocurable material 14 described previously . the vial 12 c has a generally oval - shaped overall configuration in plan view . a threaded neck portion 22 c of the vial 12 c is identical to the neck portion 22 , and may receive a cap of the type previously described . the vial 12 c has an upright side wall 16 c which includes a first section 32 c that is preferably covered or at least substantially covered with a coating . preferably , the coating is opaque or at least substantially opaque to the passage of light in the visible spectrum as well as in the actinic spectrum . an example of a suitable coating is an ink that in applied by pad printing or screen printing technique and preceded by a flame treatment to insure good adhesion of the ink to the vial 12 c . the upright side wall 16 c includes a second portion 34 c which lacks or substantially lacks the coating that is applied to the first section 32 c . as a consequence , the second section 36 c transmits more light in the visible spectrum than the light transmitted to the first section 32 c , but still blocks actinic radiation by virtue of the colorant added to the polymeric material of the vial . additionally , the vial 12 c includes a float or element 40 c that is received in the chamber . the element 40 c is somewhat similar to the element 40 b , but is longer in length in order to better match the shape of the chamber in plan view . the first section 32 c , the second section 34 c and the element 40 help the user determine the level of photocurable material 14 c in the chamber . those skilled in the art may recognize that a variety of alternatives are possible to the presently preferred embodiments described in detail above . for example , the shape of the vial may have another configuration , such as a configuration similar to squeezable tubes or squeezable containers of other configurations , and could be made of polymeric materials and colorants different from those materials and colorants previously set forth . furthermore , the outlet could be open or covered with a sponge , brush , swab or other type of applicator . accordingly , the scope of the invention should not be deemed limited by the specific descriptions mentioned above , but only by a fair reading of the claims that follow along with their equivalents .

US-45243499-A

a method for interferential current stimulation by complex active regions , in which the method is adapted to generate low frequency interference active regions formed of staggered electric flux lines by disposing electrodes to stimulate specific parts of a human body by supplying electricity is provided . the method includes following steps : providing a power supply section configured to supply power having two different frequencies including a first frequency power source and corresponding electrical wires thereof and a second frequency power source and corresponding electrical wires thereof ; and providing an electrode disposing section configured to provide plural electrodes respectively connected to the first frequency power source and the second frequency power source via the corresponding electrical wires , and interfere each other for generating plural low frequency active regions provided for stimulating a specific part of the human body to achieve the effect of curing various symptoms and muscle trainings .

reference will now be made in detail to the present preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers are used in the drawings and the description to refer to the same or like parts . the method for interferential current stimulation by complex active regions of the present embodiment generates two low frequency active regions based on the configuration of six pieces of electrodes and corresponding electrical wires thereof , in which the arrangement position of the electrodes change along with the subject part or organs of the human body , such that the joint surface of the active regions may have an appropriate angle for attaching a specific site to be stimulated . moreover , based on the interferential current stimulation method using six pieces of electrodes , a third low frequency active region can be formed by adding two additional electrodes , therefore , the variety of applications for the interferential current stimulation method on each part of the body in the present embodiment can be achieved with advantageous effects as describe in detail below . as shown in fig1 a , 1b , 1c and 1d , fig1 a illustrates a schematic diagram of interferential current stimulation active regions for stimulating a fetus abdominis area and a back muscle area . since the shape of the retus abdominis area 11 and the back muscle area 12 are slender , only a single low frequency active region cannot fully cover these areas . the present method utilizes six pieces of electrodes to form two low frequency active regions for fully covering the retus abdominis area and the back muscle area . fig1 b and 1c illustrate schematic diagrams of an interferential current stimulation method using six pieces of electrodes respectively applied to a retus abdominis area and a back muscle area . fig1 d illustrates an electrode power supply wiring diagram for the retus abdominis area and the back muscle area . referring to fig1 d , both ends of the first frequency power source 2 a are electrically connected , via the corresponding electrical wires , to the first electrode 31 and the second electrode 32 , respectively , in which the first electrode 31 is further connected to the third electrode 33 so as to generate the first electric flux line 3 a and the second electric flux line 3 b . in addition , both ends of the second frequency power source 2 b are electrically connected , via the corresponding electrical wires , to the fourth electrode 34 and the fifth electrode 35 , respectively , in which the fourth electrode 34 is further connected to the sixth electrode 36 so as to generate the third electric flux line 3 c and the fourth electric flux line 3 d . the first electric flux line 3 a and the third electric flux line 3 c interfere each other for generating a first low frequency active region 41 . also , the second electric flux line 3 b and the fourth electric flux line 3 d interfere each other for generating a second low frequency active region 42 . the first low frequency active region 41 and the second low frequency active region 42 are vertically arranged when attaching the human body so as to stimulate the retus abdominis area 11 or the back muscle area 12 of the human body 1 . in addition to stimulate the retus abdominis area 11 and the back muscle area 12 , the core muscle also includes levator ani muscles 13 , in which the levator ani muscles 13 have significant functions in the movements , postures and shaping of the human body . in particularly , for office workers who sit in offices all day without exercising and with poor postures , such muscles are likely to develop hack pains and obesity . core muscle trainings are able to improve postures and eliminate the back pains . as shown in fig2 a , 2b and 2c , based on the electrodes configuration for stimulating the retus abdominis area 11 and the back muscle area 12 , the present embodiment further provides the seventh electrode 37 and the eighth electrode 38 for interfering the original electrodes to generate the third low frequency active region 43 and stimulate the levator ani muscles 13 of the human body 1 . fig2 a illustrates a schematic diagram of current stimulation active regions for stimulating a retus abdominis area and levator ani muscles . fig2 b illustrates a side view of interferential current stimulation electrode positions and active regions thereof for stimulating a retus abdominis area and levator ani muscles . fig2 c illustrates an electrode power supply wiring diagram for a retus abdominis area and levator ani muscles . in the present embodiment , the seventh electrode 37 and the eighth electrode 38 are respectively powered by the first frequency power source 2 a and the second frequency power source 2 b via the corresponding electrical wires ; and the seventh electrode 37 and the eighth electrode 38 are respectively disposed on both sides beneath a hip area of the human body 1 . the fifth electric flux line 3 e is formed by the seventh electrode 37 and the third electrode 33 , and the sixth electric flux line 3 f is formed by the eighth electrode 38 and the sixth electrode 36 . the fifth electric flux line 3 e and the sixth electric flux line 3 f interfere each other for generating a third low frequency active region 43 provided for stimulating the levator ani muscles 33 of the human body 1 . the interferential current stimulation method of the present embodiment can also be applied to joint portion 14 of the human body . common degenerative joint diseases include the symptoms of pains and swelling . in general , the painful points of the joint portion 14 are the painful points around the front knee cap . most swellings often occur at the arteries and lymph within the joint portions , and these portions are at the medial joint 14 b . therefore , low frequency active region is required to cover the portions of the lateral joint 14 a and the medial joint 14 b . as shown in fig3 a , 3b and 3c , fig3 a illustrates a schematic diagram of interferential current stimulation active regions for stimulating a joint portion , and fig3 b and 3c respectively illustrate a front view and a side view of interferential current stimulation electrode positions and active regions covered perpendicular to the interferential current stimulation for joint portions . as shown in fig3 d , 3e and 3f , fig3 d illustrates an interferential current stimulation power supply wiring diagram for stimulating a joint portion , fig3 e illustrates an interferential current stimulation power supply wiring diagram for stimulating specific positions on a lateral joint , and fig3 f illustrates an interferential current stimulation power supply wiring diagram for stimulating specific positions on medial joint , in which the first electrode 31 , the second electrode 32 , the fourth electrode 34 , and the fifth electrode 35 are respectively disposed on a plurality specific positions within a lateral joint 14 a area of the human body 1 , and the third electrode 33 and the sixth electrode 36 are respectively disposed on a plurality specific positions within a medial joint 14 b area of the human body 1 . the fifth electric flux line 3 e is formed by the third electrode 33 and the first electrode 31 , and the sixth electric flux line 3 f is formed by the sixth electrode 36 and the fourth electrode 34 . the fifth electric flux line 3 e and the sixth electric flux line 3 f interfere each other for generating a third low frequency active region 43 provided for stimulating lymph and blood at the joint portion 14 of the human body , in which the joint portion 14 includes knees , shoulders , wrists and ankles , etc . in addition , women at work nowadays are often lack of exercises , leading to weaknesses in the lower abdomen 11 b and the levator ani muscles 13 , discomfort in excretion and urination as well as unfit body shapes . furthermore , malposition and dystocia during pregnancy often occur in women with weak levator ani muscles . therefore , since the interferential current stimulation active regions of the present embodiment can stimulate the lower abdomen 11 b and the levator ani muscles 13 , the effects of shrinking the lower abdomen 11 b and to strengthen levator ani muscles 13 can be achieved . also , the effects of weight - loss and beautifying figure can be achieved . as shown in fig4 a , 4b and 4c , fig4 a illustrates a schematic diagram of interferential current stimulation active regions for stimulating lower abdomen and levator ani muscles , fig4 b illustrates a side view of interferential current stimulation electrode positions and active regions thereof for stimulating lower abdomen and levator ani muscles , and fig4 c illustrates an electrode power supply wiring diagram for lower abdomen and levator ani muscles . the first electrode 31 , the second electrode 32 , the fourth electrode 34 , and the fifth electrode 35 are respectively disposed on a plurality of specific positions within a periphery area of the lower abdomen 11 b of the human body 1 , so that the periphery area of the lower abdomen 11 b can be stimulated by the first low frequency active region 41 . in addition , the third electrode 33 and the sixth electrode 36 are respectively disposed on both sides beneath the hip area of the human body 1 for stimulating the levator ani muscles 13 of the human body 1 . a common rehabilitation method for postpartum recovering is to assist the contraction movement of the uterus 15 in order to enhance the metabolism and to eliminate unnecessary hormones as well as to repair damages from giving birth . by strengthening the levator ani muscles 13 , urinary incontinences and the falling of uterus 15 can be prevented . moreover , it is also important to shrink the lower abdomen 13 in body shaping and to improve waist pains . consequently , the lower abdomen 11 b , uterus 15 and the levator ani muscles 13 all need to be treated with interferential current stimulations at the same time . as shown in fig5 a , 5b , 5c , 5d , 5e and 5f , based on the electrodes configuration for stimulating the lower abdomen 11 b and the levator ani muscles 13 , the present embodiment further provides the seventh electrode 37 and eighth electrode 38 in order to form a third low frequency active region 43 for stimulating uterus 15 . fig5 a illustrates a schematic diagram of interferential current stimulation active regions for stimulating lower abdomen , uterus and levator ani muscles . fig5 b illustrates a side view of interferential current stimulation electrode positions and active regions thereof for stimulating lower abdomen , uterus and levator ani muscles . fig5 c illustrates an electrode power supply wiring diagram for lower abdomen , uterus and levator ani muscles . fig5 d illustrates an electrode power supply wiring diagram for lower abdomen . fig5 e illustrates an electrode power supply wiring diagram for levator ani muscles . fig5 f illustrates an electrode power supply wiring diagram for uterus . the seventh electrode 37 and the eighth electrode 38 are respectively powered by the first frequency power source 2 a and the second frequency power source 2 b via the corresponding electrical wires . the seventh electrode 37 and the eighth electrode 38 are respectively disposed on both sides at a sacrum and coccyx area of the human body 1 . a fifth electric flux line 3 e is formed by the seventh electrode 37 and the second electrode 32 , and a sixth electric flux line 3 f is formed by the eighth electrode 38 and the fifth electrode 35 . the fifth electric flux line 3 e and the sixth electric flux line 3 f interfere each other for generating a third low frequency active region 43 provided for stimulating the uterus area 15 of the human body 1 . according to medical researches , approximately half of all postnatal women have dysmenorrhea . dysmenorrhea would generate pain not only at the abdomen 11 a but also waist area . the interferential current stimulation method is able to relieve pains , activate cells around uterus 15 and enhance metabolisms of lymph as well as blood and eliminate prostaglandin or other unnecessary hormones associated with the pain . as shown in fig6 a , 6b and 6c , fig6 a illustrates a schematic diagram of interferential current stimulation active regions for stimulating uterus and levator ani muscles , fig6 b illustrates a side view of interferential current stimulation electrode positions and active regions thereof for stimulating uterus and levator ani muscles , and fig6 c illustrates an electrode power supply wiring diagram for uterus and levator ani muscles . the second electrode 32 and the fifth electrode 35 are respectively disposed on both sides at lower abdomen 11 of the human body 1 and the first electrode 31 and the fourth electrode 34 are respectively disposed on both side at a sacrum and coccyx area of the human body 1 , so that the uterus area 15 of the human body can be stimulated by the first low frequency active region 41 . the third electrode 33 and the sixth electrode 36 are respectively disposed on both sides beneath the hip area of the human body 1 , so that levator ani muscles 13 of the human body 1 can be stimulated by the second low frequency active region 42 . moreover , the pelvic dysfunctions refer to injuries or weakness of pelvic floor muscles and urinary , excretory malfunctions , falling of uterus 15 , incontinences , or even sexual disorders caused by the disorders of pudendal nerves of coccyx area . typically , various types of interferential current stimulations needs to be applied to the uterus 15 , the levator ani muscles 13 and the pudendal nerves of coccyx area 16 in order to improve the muscles at these areas of the body . as shown in fig7 a , 7b , 7c , 7d , 7e and 7f , based on the electrodes configuration for stimulating the uterus 15 and the levator ani muscles 13 , the present embodiment further provides a first switching switch 330 and a second switching switch 360 , configured to switch the power sources having different frequencies for the third electrode 33 and the sixth electrode 36 , in which the electric flux line established between the third electrode 33 and the fourth electrode and the electric flux line established between the sixth electrode 36 and the first electrode 31 interfere each other , so as to form a third low frequency active region 43 for stimulating pudendal nerves 16 of the sacrum and coccyx . fig7 a illustrates a schematic diagram of interferential current stimulation active regions for stimulating uterus , levator ani muscles and pudendal nerves of sacrum and coccyx . fig7 b illustrates a side view of interferential current stimulation electrode positions and active regions thereof for stimulating uterus , levator ani muscles and pudendal nerves of the sacrum and coccyx . fig7 c illustrates a power switching schematic diagram of electrodes for stimulating uterus and levator ani muscles . fig7 d illustrates a perspective view of current stimulation electrode positions and active regions thereof for stimulating pudendal nerves of sacrum and coccyx . fig7 e illustrates a power switching schematic diagram of electrodes for stimulating uterus and pudendal nerves of sacrum and coccyx . fig7 f illustrates corresponding electrodes and active regions thereof of uterus . the third electrode 33 further includes a first switching switch 330 and corresponding electrical wires , and the third electrode 33 is switched to be powered by the second frequency power source 2 b when the first switching switch is switched from the first switching circuit 33 a to the second switching circuit 33 b . the sixth electrode 36 further includes a second switching switch and corresponding electrical wires , and the sixth electrode 36 is switched to be powered by the first frequency power source 2 a when the second switching switch is switched from the third switching circuit 36 a to the fourth switching circuit 36 h . in addition , the second electrode 32 further includes a first cut - off switch 320 and corresponding electrical wires , and the first frequency power source 2 a stops to supply power to the second electrode 32 when the first cut - off switch 320 is switched from a first switching position 32 a to a second switching position 32 b . the fifth electrode 35 further includes a second cut - off switch 350 and corresponding electrical wires , and the second frequency power source 2 b stops to supply power to the fifth electrode 35 when the second cut - off switch 350 is switched from the third switching position 35 a to the fourth switching position 35 b . the cut - off switches of the second electrode 32 and the fifth electrode 35 are turned - on when the switching switches of the third electrode 33 and the sixth electrode 36 are turned - on , so that a fifth electric flux line 3 e is formed by the sixth electrode 36 and the first electrode 31 and a sixth electric flux line 3 f is formed by the third electrode 33 and the fourth electrode 34 . the fifth electric flux line 3 e and the sixth electric flux line 3 f interfere each other for generating a third low frequency active region 43 provided for stimulating pudendal nerves 16 of sacrum and coccyx . to sum up , the objective of the present invention is to provide an interferential current stimulation system . in comparison to the known interferential current stimulation methods , the present invention requires the addition of only two to four electrodes configured in said interferential current stimulation system in order to form a plurality of low - frequency active regions . the key feature relies in the formation of specific shapes and angles at the joints of a plurality of active regions matching with different angles and sides of a single organ or a plurality of organs in order to widely cover organs acting on a plurality of interferential current stimulations as well as to achieve the effect of curing various symptoms and muscle trainings by attaching electrodes onto specific portions of the body . the above electrode fixing methods can be used on the specific positions of pelvic girdles , protective gears and flexible fabrics . an effective interferential current stimulation therapy is in progress correctly when these fixtures are put on . it will be apparent to those skilled in the art that various modifications and variations can be made to the structure of the invention without departing from the scope or spirit of the invention . in view of the foregoing , it is intended that the invention cover modifications and variations of this invention provided they fall within the scope of the following claims and their equivalents .

US-201615392179-A

a respiratory protective hood design that aligns rigid components of the respiratory protective hood into a predetermined geometric configuration suitable for a visor to overlay without causing the visor to crease while in the packaged state . an exhalation unit abuts two filtration units on each side to create a substantially uniform surface area over which a visor is disposed while in a packaged state .

turning to fig1 , exhalation unit 30 and filtration unit 20 a - b form a u - shaped platform around folded nose cup 80 . nose cup 80 in an unfolded state is generally triangular with a nose bridge at the top and lower , lateral extensions that cover either side of the wearer &# 39 ; s mouth . in the embodiment shown , the top nose bridge is first folded downward then each lateral extension is folded to the center so that nose cup 80 fits within the u - shape void . inhalation valve 90 b is shown on the right lateral extension of nose cup 80 . another valve , inhalation valve 90 a is on the left lateral extension ( not shown due to folded configuration of nose cup 80 ). nose cup 80 is fluidly coupled to exhalation unit 30 which encloses an exhalation check valve ( not shown ) to prevent inhalation of unfiltered air . exhalation unit 30 preferably also includes a baffled purge zone that reduces or prevents contaminated air from reaching and challenging exhalation valve 145 . for simplicity , the hood and visor are not shown in fig1 so that the internal components are viewable . however , inlet opening 40 a on filtration unit 20 a is either external or flush with the hood outer layer . ambient , contaminated air passes through inlet opening 40 a and passes through filtration unit 20 a to remove contaminates before passing through exit opening 50 a ( fig5 ) to the interstitial space within hood 100 ( fig4 ). an advantage of this embodiment of the invention is that the elongated surface area of inlet grid 40 a and exit grid 50 a reduce breathing resistance and thus enhance long - term comfort and wearability . in addition , introducing fresh , filtered area into the interstitial space within the hood helps keep the hood cooler and reduces moisture accumulation . as the wearer inhales , the filtered air in the interstitial space passes through inhalation valves 90 a and 90 b located on the lateral sides of nose cup 80 . inhalation valves 90 a and 90 b have integrated check valves thereby permitting only fluid flow from the interstitial space within the hood to nose cup 80 . exhaled air within nose cup 80 is blocked from entering the interstitial space within the hood by the check valves . in fig2 , the invention is partially deployed . nose cup 80 is still in a folded configuration but filtration units 20 a - b are angled away from exhalation unit 30 thereby widening the void created by the u - shaped configuration of the packaged state . exit opening 50 b may extend the length of filtration unit 20 b . therefore , when filtration unit 20 b is angled away from exhalation unit 30 , more surface area of exit opening 50 b is exposed to the interior of the hood thus lowering breathing resistance . in fig3 , the invention is in a full deployed where wherein nose cup 80 has unfolded to its normal state , ready to engage the face of the wearer for respiration . inhalation valve 90 b is visible from within the interior of nose cup 80 and exhalation aperture 70 is fluidly coupled to exhalation unit 30 . in fig4 , nose cup 80 , filtration units 20 a - b and exhalation unit 30 are presented in relation to a cross - section of respiratory protective hood 100 as viewed from the rear of the hood looking forward through visor 110 . neck aperture 120 accepts the head of the wearer and fluidly seals about the neck via an elastomeric interface . fig5 is a top - down view of an embodiment of the invention in a packaged state showing nose cup 80 in a folded configuration . hood 100 is seen in a cross section whereby inlet opening 40 a - b are exterior to the hood surface . in this embodiment , filtration units 20 a - b are pivotably connected to exhalation unit 30 via hinges 120 a - b . an advantage of hinges 120 a - b is that they make aligning filtration units 20 a - b and exhalation unit 30 simple for packaging and creating a uniform surface for overlaying visor 110 . visor 110 is shown on top of filtration units 20 a - b , exhalation unit 30 and folded nose cup 80 . in this embodiment , visor 110 does not overlap the outer lateral edges of filtration units 20 a - b . however , in alternative embodiments ( fig7 a - b ) overlap can be achieved within the scope of the invention . in fig6 , visor 110 is tilted upwards away from the uniform surface area created by the alignment of filtration units 20 a - b , exhalation unit 30 and folded nose cup 80 . filtration units 20 a - b pivot on hinges 120 a - b away from exhalation unit 30 . the lateral edges of nose cup 80 unfold outward and the nasal bridge of nose cup 80 unfolds upwards whereby nose cup 80 is in its deployed state . it is seen that exit openings 50 a - b open to the interstitial space within hood 100 and their disengagement from abutting exhalation unit 30 gives exit openings 50 a - b more surface area exposure to the interstitial space of hood 100 . exhaled air is discharged out exhalation port 150 from exhalation unit 30 to the exterior of hood 100 . in fig7 a , visor 110 is shown overlapping radial edges 140 a - b of filtration units 20 a - b respectively . the radial edges permit visor 110 to be larger than a single planer surface produced by abutting filtration units 20 a - b , exhalation unit 30 and folded nose cup 80 . in fig7 b , it is shown that radial edges 140 a - b extend about at least two longitudinal sides of filtration units 20 a - b whereby visor 110 encircles a single axis of the geometric configuration formed by the abutment of filtration units 20 a - b , exhalation unit 30 and folded nose cup 80 . it is important to note that visor 110 can only fold about a single axis . folding on more than one substantially perpendicular axis will produce creasing in visor 110 regardless of the use of axial edges . in fig8 , a partially section view of hood 110 is viewable with the movement of visor 110 shown from the top of filtration unit 20 a to its deployed state on a vertical plane . the unfolding direction nasal bridge of nose cup 80 is also shown . it should be noted that inlet opening 40 a is external to hood 100 while the rest of filtration unit 20 a is within the interior of hood 100 . in an alternative embodiment , the filtration units may also be affixed external to the hood or partially integrated therein . fig9 illustrates the air pathway of an embodiment of the invention wherein ambient air is first drawn through inlet openings 40 a - b which are substantially integral to the surface area of hood 100 . air is filtered through filtration units 20 a - b before passing through exit openings 50 a - b to the interstitial space within the interior of hood 100 . inhalation valves 90 a - b draw filtered into nose cup 80 which is respired and exhaled out to exhalation unit 30 . baffles create a convoluted pathway in exhalation unit 30 to establish a purge zone . exhaled air is discharged out exhalation port 150 to the exterior of hood 100 . a radio frequency identification chip 130 is affixed to exhalation unit 30 . a combination baffle - voice transmitter membrane 135 is integral to exhalation unit 30 . exhalation valve 145 permits one - way airflow from nose cup 80 through exhalation unit 30 and out exhalation port 150 . in fig1 , an embodiment of the invention incorporates harness straps to bias nose cup 80 against the face of the wearer ( not shown ). an advantage of mechanically coupling filtration units 20 a - b and exhalation unit 30 together is the straps provide a more even distribution of force when connected to filtration units 20 a - b . it should be noted that alternative embodiments within the scope of the present invention do not require or mandate that filtration units 20 a - b and exhalation unit 30 be mechanically coupled at all . however , it is preferred that at least while in the packaged state , some form of positive engagement is provided whereby filtration units 20 a - b , exhalation unit 30 and folded nose cup 80 all align to form a uniform surface area upon which visor 110 overlays to avoid creasing while maintaining a highly compact packaged state . a folding method according to an embodiment of the invention is provided in fig1 a - d . as noted above , nose cup 80 is generally triangular - shaped having a nose bridge 160 , a left lateral extension 180 and a right lateral extension 170 ( fig1 a ). nose bridge 160 is folded downward ( fig1 b ). either lateral extension ( left lateral extension 180 in this example ) is folded inward over the folded nose bridge 160 . finally , the remaining later extension ( right lateral extension 170 in this example ) is folded inward to either abut or overlap left lateral extension 180 thereby forming highly compact folded nose cup 80 . in fig1 - 13 an alternative embodiment of the invention is presented wherein filtration units 20 a - b are slideably coupled to exhalation unit 30 whereby upon deployment , filtration units 20 a - b laterally expand away from exhalation unit 30 and nose cup 80 unfolds . it will be seen that the advantages set forth above , and those made apparent from the foregoing description , are efficiently attained and since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween . now that the invention has been described ,

US-53996006-A

the present invention relates to a toaster , in particular to a recognition device of the toaster . a sliding rack which can be moved up and down is provided within a housing of the toaster , and the sliding rack is connected with a toast rack . an end of the toast rack is fixedly connected to an end of a bracket , an assembly composed of the toast rack and the bracket is hinged to the sliding rack , an end portion of the bracket is connected with the sliding rack through a spring , and a sensor is fixed to the toaster for sensing the angular displacement of the assembly . one end of the bracket is hinged to the sliding rack and the other end thereof is connected with the sliding rack through the spring . compared with the prior art , the toast rack of the present invention can be driven to rotate upwards at a certain angle about a center defined by the hinged point under the resilient force of a spring . when a bread slice is disposed into the toast rack , the toast rack is reset . the sensor can obtain a signal indicating the reset of the toast rack and transmit the signal to a control chip to control the automatic actuating mechanism of the toaster . the toaster of the present invention is simple in structure and safe in use , and is of low cost .

the present invention and various advantages thereof will be described with reference to exemplary embodiments in conjunction with the drawings . as shown in fig1 , 2 , 3 and 4 , provided is an actuating mechanism of an automatic toaster according to the present invention which includes a housing , a toaster frame 5 , a sliding rack 2 , a timer controlled by a cpu , and a core portion . in the toaster , vertical guide rails 1 are fixed at the toaster frame 5 . the sliding rack 2 is slidably coupled to the vertical guide rails 1 so that the sliding rack 2 can be moved up and down along the vertical guide rails 1 . a toast rack 7 is provided for supporting bread disposed thereon . a bracket 71 , which is disposed longitudinally , is fixedly connected to an end of the toast rack 7 . an upper end of the bracket 71 is hinged to the sliding rack 2 and a lower end thereof is connected with the sliding rack 2 through a compressive spring 15 . in the vicinity of a free end of the toast rack 7 , an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged at a rear supporting board of the toaster frame . alternatively , the infrared light emitting diode 17 and the infrared sensitive diode 18 can be arranged at a front supporting board of the toaster frame . in addition , a magnetic reed switch and a little piece of magnet can be adapted to replace the infrared light emitting diode 17 and the infrared sensitive diode 18 , respectively . a motor 6 is mounted on a side wall of a fixed board of the toaster frame 5 . the motor 6 may be embodied by a low - speed permanent - magnet synchronous non - directional motor . an output shaft 11 of the motor 6 is connected to an end of a crank 4 , which forms a crank - rocker mechanism for driving the sliding rack 2 to move up and down . an upper limit switch 8 is mounted at a left side of the fixed board and a lower limit switch 9 is mounted at a right side thereof . the output shaft 11 of the motor 6 is connected to one end of a contact 10 and a trolley wheel 12 is provided at the other end thereof . the contact 10 and one end of the crank 4 can be integrally configured as a whole . the crank 4 is hinged to a rocker 13 that is hinged to the sliding rack 2 . the upper limit switch 8 or the lower limit switch 9 may a conventional switch or a stroke switch . when no bread is disposed in a toaster slot of the toast rack 7 , the free end of the toast rack 7 is driven to rotate upwards to a certain angle about a center defined by a hinged point thereof under the resilient force of the compressive spring 15 . at this time , a transmission - reception light path constructed by the infrared light emitting diode 17 and the infrared sensitive diode 18 is positioned below the free end of the toast rack 7 . when a bread slice is disposed into the toaster slot of the toast rack 7 , the free end of the toast rack 7 can be moved downwards under the gravity of the bread slice . consequently , the transmission - reception light path constructed by the infrared light emitting diode 17 and the infrared sensitive diode 18 is positioned above the free end of the toast rack 7 . a signal is then generated when the free end of the toast rack 7 is moved downwards and blocks the infrared passing along the light path , and the signal is transmitted to the cpu of a control circuit , as shown in fig3 . the cpu determines that the toast rack 7 has been moved and thereby controls the motor 6 to rotate . the crank 4 and the contact 10 mounted to the output shaft of the motor 6 are driven to rotate for 360 degrees by the rotation of the output shaft . the sliding rack 2 can be moved downwards under a pulling force of the crank 4 and the rocker 13 mounted to the output shaft of the motor . when the sliding rack 2 reaches a lower limit position , the contact 10 exactly arrives to the position of the lower switch 9 . the trolley wheel 12 at the contact 10 contacts the lower switch 9 making it turned off . at this time , upon receiving a signal indicating that the lower switch 9 is turned off , the cpu controls a relay j 1 of the motor to make it turned off and , accordingly , the motor stops rotating . then , the cpu controls an anti - jam relay j being turned on and , accordingly , heaters are powered on to generate heat for toasting bread . at the same time , a timer is actuated by the cpu . after the bread slice is toasted for a predetermined time , the anti - jam relay j is turned off under the control of the cpu , the heaters are powered off and no heat is generated . meanwhile , the relay j 1 of the motor is turned on under the control of the cpu and , accordingly , the motor re - starts to rotate . since the sliding rack 2 is disposed at the lowest position , regardless of the rotating direction of the output shaft of the motor , the sliding rack 2 will be driven to move upwards under the pushing force exerted by the crank 4 and the rocker 13 mounted to the output shaft of the motor . when the sliding rack 2 moves upwards to the upper limit position , the contact 10 exactly arrives to the same position as the upper limit switch 8 is located . the trolley wheel 12 of the contact 10 contacts the upper limit switch 8 to make it turned off . the sliding rack 2 and the toast rack 7 lift the bread up to the upper limit position . the relay j 1 is turned off under the control of the cpu and , accordingly , the motor 6 stops rotating . at this time , the bread slice can be taken out , and the free end of the toast rack 7 tilts upwards under the resilient force of the compressive spring 15 . then , the toasting process is finished . as shown in fig5 , 6 , 7 and 8 , a middle portion or a lower end of a bracket 71 is hinged to a sliding rack 2 , and an upper end thereof is connected with the sliding rack 2 through a tension spring 16 . in the vicinity of the upper end of the bracket 71 , a pressure - controlled switch 14 is provided at a front supporting board of a toaster frame . the free end of the toast rack 7 is driven to rotate to a certain angle about a center defined by a hinged point thereof under a resilient force of the tension spring 16 . when a bread slice is disposed into a toaster slot of the toast rack 7 , the free end of the toast rack 7 is moved downwards under the gravity of the bread . subsequently , the upper end of the bracket 71 presses the pressure - controlled switch 14 and , a signal is generated indicating that the toast rack 7 has been moved . as shown in fig9 , 10 , 11 and 12 , a middle portion of a bracket 71 is hinged to a sliding rack 2 , and an upper end thereof is connected with the sliding rack 2 through a tension spring 16 . in the vicinity of a free end of the toast rack 7 , an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged at a rear supporting board of a toaster frame . the free end of the toast rack 7 is driven to rotate to a certain angle about a center defined by a hinged point thereof under the resilient force of the tension spring 16 . when a bread slice is disposed in a toaster slot of the toast rack 7 , the free end of the toast rack 7 is moved downwards under the gravity of the bread . in this case , an infrared ray passing along the light path defined by the infrared light emitting diode 17 and the infrared sensitive diode 18 is blocked by the free end of the toast rack 7 and , as a result , a signal is generated indicating that the toast rack 7 has been moved . as shown in fig1 and 14 , a middle portion of a bracket 71 is hinged to a sliding rack 2 , and an upper end thereof is connected with the sliding rack 2 through a tension spring 16 . in the vicinity of an upper end of the bracket 71 , an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged on a front supporting board of a toaster frame . the free end of the toast rack 7 is driven to rotate to a certain angle about a center defined by a hinged point thereof under the resilient force of the tension spring 16 . when a bread slice is disposed in a toaster slot of the toast rack 7 , the free end of the toast rack 7 is moved downwards under the gravity of the bread , so that an infrared ray passing along the light path constructed by the infrared light emitting diode 17 and the infrared sensitive diode 18 is blocked by the upper end of the bracket 71 and , as a result , a signal is generated indicating that the toast rack 7 has been moved . as shown in fig1 , 16 , 17 and 18 , a fixed toast rack 8 is provided with an end thereof being connected to a sliding rack 2 . the fixed toast rack 8 is hinged to a joint portion between a toast rack 7 and a bracket 71 . an end of the bracket 71 is connected with the sliding rack 2 through a tension spring 16 . in the vicinity of a free end of the toast rack 7 , an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged at a rear supporting board of a toaster frame . the free end of the toast rack 7 is driven to rotate to a certain angle about a center defined by a hinged point thereof under a resilient force of the tension spring 16 . when a bread slice is disposed in a toaster slot of the toast rack 7 , the free end of the toast rack 7 is moved downwards under the gravity of the bread . as a result , an infrared ray passing along the light path constructed by the infrared light emitting diode 17 and the infrared sensitive diode 18 is blocked by the free end of the toast rack 7 and , a signal hereby is generated indicating that the toast rack 7 has been moved . as shown in fig1 and 20 , one end of the fixed toast rack 8 is connected to the sliding rack 2 . a joint portion between a toast rack 7 and a bracket 71 is hinged to the fixed toast rack 8 at a position close to the other end of the fixed toast rack 8 . an end of the bracket 71 is connected with the fixed toast rack 8 through a tension spring 16 . in the vicinity of the sliding rack 2 and a free end of the toast rack 7 , an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged at a toaster frame . the free end of the toast rack 7 is driven to rotate to a certain angle about a center defined by a hinged point thereof under the resilient force of the tension spring 16 . when a bread slice is disposed into a toaster slot of the toast rack 7 , the free end of the toast rack 7 is moved downwards under the gravity of the bread , which renders an infrared ray passing along the light path constructed by the infrared light emitting diode 17 and the infrared sensitive diode 18 being blocked by the free end of the toast rack 7 . as a result , a signal is generated indicating that the toast rack 7 has been moved . as shown in fig2 , 22 and 23 , one end of a fixed toast rack 8 is connected to a sliding rack 2 . a joint portion between a toast rack 7 and a bracket 71 is hinged to the fixed toast rack 8 at a position close to the other end of the fixed toast rack 8 . an end of the bracket 71 is connected with the fixed toast rack 8 through a tension spring 16 . in the vicinity of a free end of the toast rack 7 , an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged at a rear supporting board of a toaster frame . the free end of the toast rack 7 is driven to rotate to a certain angle about a center defined by a hinged point thereof under a resilient force of the tension spring 16 . when a bread slice is disposed in a toaster slot of the toast rack 7 , the toast rack 7 and the bracket 71 are driven to rotate to a certain angle under the gravity of the bread , and an infrared ray passing along the light path constructed by the infrared light emitting diode 17 and the infrared sensitive diode 18 is blocked by the bracket 71 . a signal is hereby generated indicating that the toast rack 7 has been moved . as shown in fig2 and 25 , one end of a toast rack 7 , which is connected to one end of a bracket 71 , is hinged to a sliding rack 2 . the other end of the bracket 71 is connected with the sliding rack 2 through a tension spring 16 . in the vicinity of a free end of the toast rack 7 , an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged at a rear supporting board of a toaster frame . when a bread slice is disposed into a toaster slot of the toast rack 7 , the toast rack 7 and the bracket 71 rotate downwards to a certain angle under the gravity of the bread , and an infrared ray passing along the light path constructed by the infrared light emitting diode 17 and the infrared sensitive diode 18 is blocked by the toast rack 7 a signal is hereby generated indicating that the toast rack 7 has been moved . when the toast rack 7 is driven to move to a bottom portion of the toaster slot by the motor 6 , the toast rack 7 returns to its rest position . as shown in fig2 and 27 , one end of a toast rack 7 , which is connected to one end of a bracket 71 , is hinged to a sliding rack 2 . the other end of the bracket 71 is connected with the sliding rack 2 through a tension spring 16 . in the vicinity of the other end of the bracket 71 , an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged at a front supporting board of a toaster frame . when a bread slice is disposed into a toaster slot of the toast rack 7 , the toast rack 7 and the bracket 71 are driven rotate downwards for a certain angle under the gravity of the bread , and an infrared ray passing along the light path constructed by the infrared light emitting diode 17 and the infrared sensitive diode 18 is blocked by the toast rack 7 . a signal is hereby generated indicating that the toast rack 7 has been moved . when the toast rack 7 is driven to move to a bottom portion of the toaster slot by the motor 6 , the toast rack 7 returns to its rest position . as shown in fig2 and 29 , a joint portion between a toast rack 7 and a bracket 71 is hinged to a core bracket 20 disposed at a bottom board of a toaster frame . an end of the bracket 71 is connected with a core bracket 20 at the bottom board of the toaster frame through a tension spring 16 . an infrared light emitting diode 17 and an infrared sensitive diode 18 are oppositely arranged at a bottom board of the core fixed to the toaster frame . as shown in fig3 and 31 , a joint portion between a toast rack 7 and a bracket 71 is hinged to a rear supporting board 21 of a toaster frame . an end of the bracket 71 is connected with the rear supporting board 21 of the toaster frame through a spring 16 .

US-59221505-A

a sliding assembly for a furniture drawer including a c - shaped metal slide in combination with a t - shaped wooden guide , the slide being equipped with an integral , depending detent while the guide is equipped with a spring clip in a top groove receiving the slide detent so as to provide an overcomeable stop against drawer removal from an associated dresser , the bottom of the slot being generally u - shaped .

inasmuch as the instant invention is an improvement on my &# 39 ; 394 patent , i have patterned for purposes of clarity and ease of understanding drawing views and the ensuing description after those of the &# 39 ; 394 patent . in fig1 the numeral 10 designates a dresser drawer which is equipped with a front handle , as at 11 , and a c - shaped slide 12 adapted to move on a stationary guide 13 ( compare fig4 ). in fig2 the same drawer is seen , but from the rear , wherein the slide 12 is seen to be equipped with an upturned portion 14 . the upper portion of the guide 13 is generally t - shaped , while the slide 12 is generally channel shaped . in the metal channel 12 , a detent 15 projects downwardly from the top wall of the channel . thus , the detent 15 can be moved into selective engagement with a metal spring clip 16 provided on the interior upstanding face of the guide 13 . for this purpose , a slot generally designated 17 is provided in the top surface of the guide 13 to accommodate the mounting of the spring clip 16 . as seen in the lower left portion of fig3 the spring clip 16 has an intermediate raised portion 18 which coacts with the detent 15 in limiting withdrawal of the drawer 10 from its associated furniture piece . however , it is possible to overcome the resilient resistance of the spring clip 16 so that the drawer can be completely withdrawn , as by having the detent 15 force the upwardly projecting portion 18 downwardly and pass thereover -- as seen in fig5 when the guide 12 is moving to the left as indicated by the arrow . as seen best in fig5 the spring clip 16 is located adjacent the forward end of the guide 13 while the detent 15 is located adjacent the rear of the slide 12 . the detent 15 is a relatively minor upset area in the bight portion 20 adjacent integral ribs 19 . the spring clip 16 has a straight v portion , as at 18a and 18b ( see fig5 ) which terminates in a rear foot or bearing portion at 18c and 18d . at the other or forward end when installed , the spring clip 16 is equipped with a circular opening 21 which receives a wood screw 23 equipped with a head 22 . according to the instant invention , i have changed the shape of the lower portion of the slot 17 . it is now essentially rounded so as to provide a general u - shape in cross section . more particularly , the bottom of the slot 17 is defined by segmental planes as at 17a , 17b and 17c ( see fig4 ). the segments 17a , 17c are optimally inclined at an angle of about 30 ° to the segment 17b which is generally perpendicular to the vertical side walls 17d and 17e . each of the segments is about the same length . in one illustrative embodiment , the width of the slot 17 is 0 . 375 &# 34 ; and the width of the segment 17bis 0 . 156 &# 34 ;. the provision of the u - shaped groove has substantially avoided the cracking problem of the wood guide 13 of the prior art construction by eliminating stress concentrations at the bottom corners while still providing ample bearing surface for the now - narrowed foot portion 18d of the spring clip 16 ( see also fig3 ). the consequent narrowing of the spring clip 16 provides a second advantageous result in reducing the pressure in the detent 15 , thereby reducing the tendency to flatten . excellent results are obtainable when the height of the segments 17a or 17c is in the range of about 1 / 4 to about 1 / 2 the mid - plane depth of the slot . in the illustration above given , the maximum depth of the slot is 0 . 218 &# 34 ;. the narrowing of the spring clip 16 is not only relative to the prior art but also relative to the forward end portion of the spring clip 16 , i . e ., the portion containing the opening 21 which receives the wood screw 23 . now , the rear or foot portion 18d is less than half the width of the slot 17 which develops full bearing on the bottom of the slot 17 and without binding on or gouging of the segments 17a , 17c . in operation , the spring clip 16 projects above the slot bottom wall about 0 . 1 &# 34 ; so as to definitely engage the detent 15 and develop an overcomeable interferring action so as to signal the person withdrawing the drawer that it is virtually open to it smaximum extent before complete drawer withdrawal . the spring clip and slide are both advantageously made of the same gauges of metal ( about 0 . 025 &# 34 ;). this results in a slight deformation or deflection of the detent ( as well as the spring clip 16 ) to provide a definite signal yet one which , even after repeated withdrawal actions , does not damage the interferring elements . while in the foregoing specification a detailed description of an embodiment of the invention has been set down for the purpose of illustration , many variations in the details hereingiven may be made by those skilled in the art without departing from the spirit and scope of the invention .

US-69270191-A

a multi - electrode type electrocardiographic electrode structure includes a base member made of non - woven cloth , electrode and lead sections formed by using a liquid conductor printed on or impregnating the base member , the electrode section consisting of a plurality of electrodes arranged on the base member , the lead section being connected to the individual electrodes , an electrolyte material provided on the electrodes and serving to reduce the resistance of the skin of a living body , and an insulating adhesive material provided on the base member to alternate with the electrodes for permitting the electrocardiographic electrode structure to be held in close contact with the living body .

now , the construction and operation according to the invention will be described in detail in conjunction with a preferred embodiment thereof . fig1 is a perspective view showing an embodiment of the multi - electrode type electrocardiographic electrode structure according to the invention , and fig2 is a sectional view showing the electrocardiographic electrode structure shown in fig1 . reference numeral 10 designates the electrocardiographic electrode structure . the electrocardiographic electrode 10 has a base member 11 . the base member 11 has a rectangular shape , and it is made of non - woven cloth of polyethylene , polyester , polypropyrene , etc . reference numeral 12 designates electrodes for leading out a weak voltage from a living body . the electrodes 12 consists of a conductive ink in close contact with the base member 11 . it is either printed on or caused to impregnate the base member 11 . it is a conductive material in a paste - like or ink - like form , i . e ., in the liquid form , which consists of a conductive metal powder of silver , a mixture of silver and silver chloride , a mixture of silver and conductive graphite or graphite and is prepared by kneading the conductive metal powder together with a resin and a solvent . the base member 11 , on which the conductive ink is printed or which is impregnated by the conductive ink , is made of non - woven cloth . thus , it is a porous member having an irregular surface , as shown in fig3 . it is , therefore , readily permeable to the printed or impregnating conductive ink . this means that the scope of conductive inks available for selection is increased . further , the base member 11 provides an increased surface area , and the electric resistance with respect to the skin surface is reduced . further , the non - woven cloth is felt comfortably by and satisfactory applicable to the skin . reference numeral 13 designates leads , which are formed simultaneously with the electrodes 12 from the conductive ink printed on or caused to impregnate the base member 11 . these leads 13 extend along the base member 11 and are connected to the respective electrodes 12 . their other ends are connected to a connector 17 ( fig5 ). while in this embodiment three electrodes 12 and three leads 13 are provided , it is possible to provide more than three electrodes and leads . it is to be understood that the electrodes 12 and leads 13 can be formed simultaneously and integrally by merely printing the conductive ink on or causing it to impregnate the base member 11 . that is , the electrodes 12 and leads 13 need not be produced separately , so that the electrocardiographic electrode can be inexpensively manufactured . further , since the leads 13 are formed in the inside of and do not appear on the base member 11 , they will never be pulled unconsciously during the electrocardiographic measurement . reference numeral 14 designates an electrolyte material bonded to the electrodes 12 . it is a water - containing gel layer made of gelatin , agar , polyacrylamide , etc . it has considerable viscosity , and also it has electric conductivity . when it is in close contact with the skin of a living body , the electrolyte material 14 leads a weak voltage induced on the skin surface to the electrodes 12 . if the electrodes 12 were held in direct close contact with the skin surface , the weak voltage can not be measured accurately due to the contact resistance of the skin surface . for this reason , in the prior art a water - containing gel member serving to reduce the contact resistance of the skin surface is fitted in the electrocardiographic electrode for measuring the weak voltage through the water - containing gel member . however , it is very cumbersome and inefficient to fit the water - containing gell member in the electrocardiographic electrode every time the measurement of weak voltage is done . the electrolyte material 14 is provided in order to eliminate the inconvenience of fitting the water - containing gel member in each electrode 12 that would be otherwise necessary whenever the measurement is done . reference numeral 14 designates an insulating material for insulating the leads 13 , and numeral 16 an adhesive material for permitting the base member 11 to be applied to the skin m of a living body as shown in fig5 . when using the multi - electrode type electrocardiographic electrode structure 10 as described above , the electrodes 12 are held in contact with the skin m of the living body via the electrolyte material 14 , and the adhesive material 16 provided on the base member 11 is held in close contact with the skin m , as shown in fig5 . in this state , a weak voltage in the living body is led out from the electrodes 12 through the leads 13 to an electrocardiographic ( not shown ) for electrocardiographic recording . in this case , since pluralities of electrodes 12 and leads 13 are provided on a single base member 11 , the electrodes 12 with leads 13 may be applied at one time to the skin m of the living body by merely setting the base member 11 in close contact with the skin of the living body . in other words , it is possible to attach electrodes to the skin m in a shorter amount of time . as has been described in the foregoing , according to the invention electrodes and leads can be formed by merely printing a conductive material in the liquid form on or causing it to impregnate a base member made of non - woven cloth , so that it is possible to manufacture an electrocardiographic electrode structure inexpensively . further , since the electrodes and leads are formed integrally by printing or causing impregnation with the liquid conductive material , the efficiency of assembling can be improved , and an electrode having stable electric characteristics can be obtained . further , since the base member is provided with a plurality of electrodes and leads each connected to each of the electrodes , a number of electrodes can be applied to the skin of the living body in a short period of time , that is , the efficiency of attaching electrodes can be improved . further , since the base member is made of nonwoven cloth , it is very permeable to the liquid conductive material , and it has a satisfactory fitting property with respect to the skin . further , since the leads are formed by printing or causing impregnation with the liquid conductive material , they are found inside and not exposed out of the base member . thus , the possibility of unconscious pulling of leads to result in detachment of the multi - electrode type electrocardiographic electrode structure from the skin of the living body , can be eliminated . further , since an electrolyte material serving to reduce the electric resistance of the skin of the living body is provided on the electrodes , there is no need of fitting a water - containing gel member in each electrocardiographic electrode to be set in close contact with the skin . thus , the multi - electrode type electrocardiographic electrode structure can be used easily , and the operation efficiency can be improved .

US-16808988-A

a delivery system for the delivery of a salt of meptazinol which increases the bioavailability of meptanizol by an effective amount to provide analgesic relief is disclosed . one embodiment of the delivery system is a transdermal device which increases the skin flux of meptazinol by an effective amount to provide analgesic relief . also disclosed are methods of providing analgesic relief .

the present invention is directed to a delivery system which delivers a pharmacologically effective amount of meptazinol for pain or to provide analgesic relief . examples of other such delivery systems , include but are not limited to those means which enable delivery of meptazinol or salt form thereof via parenteral injection , pulmonary absorption , topical application , sublingual administration and rectal administration . parenteral injections include delivery via intravenous injection , subcutaneous injection , intramuscular injection , intraarterial injection and intrathecal injection . pulmonary absorption includes the use of inhalants and aerosols . topical administration includes administration via : ( 1 ) mucous membranes which includes but is not limited to mucous membranes of the conjunctiva , nasopharnyx , oropharynx , vagina , colon , urethra and urinary bladder ; ( 2 ) the skin ( which includes topical or transdermal delivery ); and ( 3 ) the eye . in one embodiment of the invention , the delivery vehicle is for topical administration to the skin and includes but is not limited to a transdermal device , a cream , a lotion or an ointment which delivers a pharmacologically effective amount of meptazinol for pain or to provide analgesic relief . in another embodiment of the invention the delivery vehicle is a transdermal device . the transdermal device is intended to deliver the pharmacologically effective amount of meptazinol either in a manner which : ( 1 ) controls the rate of drug delivery to the skin or ( 2 ) allows the skin to control the rate of drug absorption . the transdermal device for the transdermal delivery of an effective amount of meptazinol to provide analgesic relief comprises of : ( i ) a backing layer ; ( ii ) a reservoir layer for the salt form of meptazinol or a salt of a meptazinol precursor ; ( iii ) optionally a control membrane or non controlling microporous membrane ; ( iv ) optionally an adhesive ; and ( v ) optionally a protective peel strip ; and ( b ) a salt form of meptazinol or salt of a meptazinol precursor in an amount which results in delivery of an effective amount of meptazinol when added into the device and said device is applied to the skin ; and ( c ) a pharmaceutically effective carrier . the backing layer , reservoir layer , control membrane , adhesive and protective peel strip can be formed using conventional teachings in the art such as those referred to in u . s . pat . no . 6 , 818 , 226 ( dermal penetration enhancers and drug delivery systems involving same ); u . s . pat . no . 6 , 791 , 003 ( dual adhesive transdermal drug delivery system ); u . s . pat . no . 6 , 787 , 149 ( topical application of opioid analgesic drugs such as morphine ); u . s . pat . no . 6 , 716 , 449 ( controlled release compositions containing opioid agonist and antagonist ); u . s . pat . no . 5 , 858 , 393 ( transdermal formulation ); u . s . pat . no . 5 , 612 , 382 ( composition for percutaneous absorption of pharmaceutically active ingredients ); u . s . pat . no . 5 , 464 , 387 ( transdermal delivery device ); u . s . pat . no . 5 , 023 , 085 ( transdermal flux enhancers in combination with iontophoresis in topical administration of pharmaceuticals ; u . s . pat . no . 4 , 891 , 377 ( trandermal delivery of the narcotic analgesics etorphine and analogs ); u . s . pat . no . 4 , 654 , 209 ( preparation of percutaneous administration ), each of which is incorporated by reference . in another embodiment of the invention , the delivery device for topical administration is a transvaginal ring such as those described in u . s . pat . nos . 6 , 503 , 190 ; 6 , 394 , 094 ; 5 , 972 , 372 ; 5 , 694 , 947 ; 5 , 543 , 150 ; 3 , 920 , 805 and u . s . patent application publications 2005 - 042292 ; 2003 - 152625 and 2002 - 090390 . generally , a vaginal ring has a body dimensioned to allow for insertion into the vagina , e . g . a cylindrical shape although other shapes can also be used , and can be configured by those of ordinary skill in the art to deliver the meptazinol salts of the invention . delivery of the meptazinol in this manner may effect pain relief by virtue of the drug &# 39 ; s historically reported local anaesthetic activity — about 1 / 10 th of that of lidocaine — or by a centrally mediated mechanism . such an application could , for example , find application in the period immediately following gynaecological surgery . in a preferred embodiment of the invention , the non - controlling membrane comprises solupor 10p05a ( manufactured by dsm ) and the adhesive duro - tak 87 - 608a ( manufactured by national starch ) in which the drug is dissolved in a vehicle comprising oleic acid , dimethyl isosorbide , propylene glycol and ethanol ( in a ration of 3 : 2 : 70 : 25 , respectively ) alternatively , the transdermal device may constitute a so - called “ drug in adhesive ” or matrix patch in which the drug is intimately distributed in an appropriate pressure sensitive adhesive such as but not limited to the duro - tak polyacrylates . the transdermal device of the invention is able to provide long lasting relief and is an improvement from the prior art which require 4 - 6 dosages per day . in one embodiment of the invention , the transdermal device is able to provide up to about 8 hours of analgesic relief ; in another embodiment of the invention , the transdermal device is able to provide about 8 to about 24 hours of relief ; and in a further embodiment of the invention , the transdermal device is able to provide from about 24 hours of relief to about 168 hours of relief . given the low solubility of the free base form of meptazinol free base ( 0 . 17 mg / ml in aqueous solution ), it may be advantageous to derivatize the meptazinol to form a precursor compound which will degrade into meptazinol when traversing the layer ( s ) of the skin . therefore , another embodiment of the invention is the delivery of meptazinol transdermally which is achieved by a transdermal device which contains a precursor of meptazinol which includes but is not limited to meptazinol esters , glycosides , salts of meptazinol or mixtures thereof . precursors of meptazinol are compounds which undergo a transformation in vivo to produce meptanizol ( e . g . cleavage of an ester bond , glycolysis , formation of the free base from the salt ). meptazinol esters , ethers and glycosides of the invention are compounds of the formula ( ii ): wherein r is an acyl group , a mono -, oligo - or poly - saccharide , or salts of mono -, oligo - or poly - saccharides . ( oligosaccharide for the purpose of this invention indicates a saccharide comprised of 2 - 10 monosaccharide units which are covalently bonded together ) when r forms an ester , one embodiment of the invention is where r is a — c (═ o )— c 1 - c 12 - alkyl ; yet another embodiment is where r is — c (═ o )— c 1 - c 12 - alkyl - nr 1 r 2 wherein r 1 and r 2 are independently hydrogen or c 1 - c 4 alkyl ; yet another embodiment is where r is c (═ o )— c 1 - c 12 - alkylco 2 r 3 wherein r 3 is hydrogen , c 1 - c 4 alkyl or is a cation . in a further embodiment of the invention , r is a — c (═ o )— c 1 - c 4 - alkyl ; yet another embodiment is where r is — c (═ o )— c 1 - c 4 - alkyl - nr 1 r 2 wherein r 1 and r 2 are independently hydrogen or c 1 - c 4 alkyl ; yet another embodiment is where r is c (═ o )— c 1 - c 4 - alkylco 2 r 3 wherein r 3 is hydrogen , c 1 - c 4 alkyl or is a cation . when r forms an ether , one embodiment of the invention is where r is a substituted or unsubstituted c 1 - c 12 - alkyl or substituted or unsubstituted aryl . in another embodiment of when r is an ether , r is a substituted or unsubstituted c 1 - c 4 - alkyl or substituted or unsubstituted phenyl . in both embodiments , the substituents are selected from the group consisted of halogen , c 1 - c 4 - alkyl , and c 1 - c 4 - alkoxy . when r is a monosaccharide , one embodiment of the invention is where r is selected from the group consisting of erythrosyl , threosyl , ribosyl , arabinosyl , xylosyl , lyxosyl , allosyl , altrosyl , glucosyl , glucosylamino , mannosyl , gulosyl , idosyl , galactosyl , galactosylamino , talosyl and salts thereof ; another embodiment is where r is glucosyl , glucosylamino , galactosyl or galactosylamino and salts thereof ; and yet another embodiment of the invention is where r is glucosyl and salts thereof . when r is an oligosaccharide , one embodiment of the invention is where r is selected from the group consisting of lactose , sucrose , trehalose , lewis a trisaccharide , 3 ′- o - sulfonato lewis a , lewis b tetrasaccharide , lewis x trisaccharide , sialyl lewis x , 3 ′- o - sulfonato lewis x , lewis y tetrasaccharide and salts thereof . when r is a polysaccharide , one embodiment of the invention is where r is selected from the group consisting of chitin , chitosan , cyclodextrin , dextran and pullulan ; another embodiment of the invention is where the cyclodextrin is α -, β - or γ - cyclodextrin ; yet another embodiment of the invention is where the cyclodextrin is β - cyclodextrin , dimethyl - β - cyclodextrin or hydroxypropyl - β - cyclodextrin . as the cyclodextrin have a cavity which can accommodate the inclusion of a compound such as meptazinol , another embodiment of the invention is where the cyclodextrins described in r above can also be added to meptazinol to form an inclusion complex rather than being linked covalently . in another embodiment of the invention , the meptazinol precusor is a salt and r is hydrogen but absent , whereby the oxygen is negatively charged ; one embodiment of the invention is where the salt form is selected from the group consisting of sodium , potassium , caesium , calcium , magnesium , guanidine & amp ; n - substituted guanidine salts and acetamidine & amp ; n - substituted acetamidine salts triethylamine , pyridine , picoline , ethanolamine , triethanolamine , dicyclohexylamine , n , n ′- dibenzylethylenediamine . another embodiment of the invention is when r is hydrogen — or one of the aforementioned substituents — and the azepine nitrogen is positively charged and linked with hydrochloride , hydrobromide , sulfate , phosphate , formate , acetate , trifluoroacetate , maleate , tartrate , methanesulfonate , ethanesulphonate , benzenesulfonate , p - toluenesulfonate , naphthalene sulphonate , camphor sulfonate , arginate , alaninate , asparginate , glutamate and mixtures thereof . surprisingly , and contrary to prior notions that lower melting points ( mp ) are normally associated with improved skin permeability , the azepine salts of meptazinol do not show such a relationship . for example , meptazinol hydrochloride ( mp 184 ° c .) was a much better permeant than the maleate ( mp 102 - 104 ° c .). the hydrochloride also displayed a higher flux rate than the camsylate ( mp of 46 - 48 ° c .). furthermore , and again in contrast to prior notions in the art , additional unexpected results occurred when using salts of meptazinol for transdermal delivery . usually the free base is the preferred form of a drug for transdermal delivery due to its greater lipophilicity . for example , the skin flux of fentanyl free base is up to five times faster than the salt form . however , for meptazinol , the free base shows unexpectedly poor flux in comparison to the various salt forms . for example , meptazinol hydrochloride has a substantially greater flux than the free base . previous reports in the scientific literature have suggested that ion pairs , i . e . salts , may improve transdermal flux by virtue of beneficially enhancing the physicochemical characteristics of the molecule . such strategies have often employed lipophilic counter ions . surprisingly , in the case of meptazinol , the use of more lipophilic counter ions such as the camsylate and tosylate were less effective in improving flux than the use of salts of stronger acid such as trifluoroacetic acid or hydrochloric acid . in another embodiment of the invention , an additional analgesic can be added to the transdermal device . examples of analgesics include but are not limited to ethanol , non - steroidal anti - inflammatory drugs ( nsaids ) and other compounds with analgesic properties such as but not limited to amitriptyline and carbamazepine . in another embodiment of the invention , the pharmaceutically effective carrier includes but is not limited to a solvent such as alcohol , isopropylmyristate , glycerol monooleate or a diol such as propylene glycol , or the like . the delivery of the meptazinol or meptazinol precursor is enhanced by the use of a permeation enhancer which may also be included in the pharmaceutically effective carrier . in one embodiment of the invention , suitable permeation enhancers include but are not limited to polyunsaturated fatty acids ( pufa ) such as arachidonic acid , lauric acid , α - linolenic acid , linoleic acid and oleic acid ; dimethylisosorbide ; azones ; cyclopentadecalactone ; alkyl - 2 -( n , n - disubstituted amino )- alkanoate ester ( nexact ); 2 -( n - nonyl )- 1 , 3 - dioxaolane ( sepa ); cod - liver oil ; essential oils , glycerol monoethers derived from saturated fatty alcohols ; d - limonene ; menthol and menthol ethyl ether ; n - methyl - 2 - pyrrolidone ( nmp ); phospholipids ; squalene ; terpenes ; and alcohols such as methanol , ethanol , propanol and butanol . see e . g . pharmaceutical skin penetration enhancement , ed . walters et al ., marcel dekker , inc ., ( 1993 ); williams et al ., “ penetration enhancers ”, adv . drug deliv . rev ., vol . 56 , pgs 603 - 618 , ( 2004 ). in another embodiment of the invention , transdermal drug delivery is enhanced by iontophoresis , magnetophoresis , or sonophoresis . iontophoresis involves the delivery of charged chemical compounds across the skin membrane using an applied electrical field . see e . g . “ pharmaceutical dosage forms and drug delivery systems — chapter 10 — transdermal drug delivery systems , ointments , creams , lotions and other preparations ”, ed . by ansel et al ., williams & amp ; wilkins , page 360 , ( 1995 ). magnetophoresis involves the use of a magnetic field to enhance drug delivery to the skin . see e . g . murthy et al ., “ physical and chemical permeation enhancers in transdermal delivery of terbutaline sulphate ”, aaps pharmscitech . 2001 ; 2 ( 1 ). sonophoresis is the use of high - frequency ultrasound which serves to compromise the integrity of the stratum corneum layer and improve permeability of compounds through the skin . alternatively , in another embodiment of the invention transdermal drug delivery may be effected using various topically applied ointments , creams , or lotions . typically these may comprise oil - in - water emulsions or water - in - oil emulsions incorporating meptazinol or meptazinol precursor in one of the preferred vehicles . ointments and creams may , for example , be formulated with an aqueous or oily base with the addition of suitable thickening and / or gelling agents . lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents , stabilizing agents , dispersing agents , suspending agents , thickening agents , or coloring agents in another embodiment of the invention , the solubility ( as measured in aqueous solution ) of the meptazinol or meptazinol precursor is about 30 mg / ml to about 500 mg / ml ; in yet another embodiment of the invention , the solubility is about 50 mg / ml to about 400 mg / ml ; and in a still further embodiment of the invention , the solubility is about 75 mg / ml to about 300 mg / ml . in another embodiment of the invention , the skin flux for the delivery of the meptazinol or meptazinol precursor is about 20 to about 1000 μg / cm 2 / h ; in yet another embodiment of the invention , the skin flux for the delivery of the meptazinol or meptazinol precursor is about 50 to about 500 μg / cm 2 / h ; and in a further embodiment of the invention is about 75 to about 250 μg / cm 2 / h . in another embodiment of the invention the ph of the environment into which the meptazinol or meptazinol precursor is released is about ph 4 . 0 to about ph 7 . 0 ; in another embodiment , the ph is about 4 . 0 to about 6 . 0 ; and in a further embodiment , the ph is about 4 . 0 to about 5 . 0 . optionally , additional skin care ingredients may be combined with meptazinol or the meptazinol precursors for their art recognized effects , these include abrasives , absorbents , adhesives , antiacne agents , anticaking agents , anticareis agents , antidandruff agents , antifoaming agents , antifungal agents , antimicrobial agents , antioxidants , antiperspirant agents , antistatic agents , binders , buffering agents , bulking agents , chelating agents , colorants , corn / callus / wart removers , corrosion inhibitors , cosmetic astringents , cosmetic biocides , denaturants , depilating agents , drug astringents , emollients , emulsion stabilizers , epilating agents , exfoliants , external analgesics , film formers , flavoring agents , fragrance ingredients , humectants , lytic agents , occlusives opacifying agents , oxidizing agents , pesticides , ph adjusters , plasticizers , preservatives , propellants , reducing agents , skin - bleaching agents , skin - conditioning agents , skin protectants , slip modifiers , solvents , sunscreen agents , surface modifiers , surfactants ( including cleansing agents , emulsifying agents , foam boosters , hydrotopes , solubilizing agents , suspending agents ), suspending agents ( non - surfactant ), ultraviolet light absorbers , viscosity controlling agents , viscosity decreasing agents , viscosity increasing agents ( aqueous ), viscosity increasing agents ( non - aqueous ) and mixtures thereof . in another embodiment of the invention , use of the transdermal device described hereinabove can be used to provide analgesic effects to treat systemic or localized pain to a patient in need thereof . other advantages and characteristics of the invention will become apparent on reading the following description , given by way of non - limiting examples . using human skin in a conventional franz cell in vitro apparatus the transdermal permeation of meptazinol was measured by assaying the amount of drug in the receptor fluid beneath the skin sample at various times after application to the skin . fig1 shows that a salt of meptazinol is surprisingly more permeable than the free base form of meptazinol . fig2 shows that surprisingly meptazinol salts formed from a stronger acid , such as the hydrochloride and trifluoroacetate salt are more rapidly absorbed than are those of weaker organic acids such as the camsylate , tosylate or maleate . the data presented in table 1 below show that under the test conditions cited above , the mean flux for the various salts tested were suitable for producing concentrations of meptazinol sufficient to produce a long - lasting effect when administered to patient in need thereof . the data in table 2 was obtained using the same in vitro franz cell technique verifies that there was surprisingly no correlation between lower melting points and higher solubilities with overall skin flux rates . for example , based on prior notions in the art , meptazinol hydrochloride which has a higher melting point than meptazinol free base , would have been expected to have a worse skin flux rate but instead is several times better than the meptazinol free base . likewise , meptazinol hydrochloride which is the salt of a stronger acid , has both lower solubility and higher melting point than meptazinol camsylate , tosylate or maleate which is the salt of a weaker acid , and yet still have an unexpectedly better skin flux rate . having thus described in detail various embodiments of the present invention , it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention .

US-37728707-A