Datasets:

tharindu

/

patents

like 0

a circuit for varying the speed of a variable speed motor having a power source to provide a voltage to the motor and a diode as a means to provide a voltage drop within the circuit that is substantially independent of the amount of current to the motor . the invention may further comprise an electric toothbrush using the circuit .

the present invention will be described with respect to the use of a two speed battery - operated motor in an electric toothbrush . again , it is to be understood that other devices powered by a battery - operated motor can be provided with the unique circuit of this invention . in accordance with fig1 , a motorized toothbrush 10 includes a housing 12 with a handle portion 14 , a neck 16 and a head portion 18 . the head portion 18 contains bristles 20 which are typically supported by a brush plate 22 . a variable , high - speed motor 24 is provided for effecting oscillation or rotation of the brush plate 22 or bristles 20 . in general , some type of linkage 24 between the motor and the brush plate 22 or brushes 20 converts the rotation of the motor 24 into the movement of brush plate 22 and / or bristles 20 . it is not within the scope of the present invention to limit the type of movement of the bristles 20 or the type of linkage and linkage structure which is used to move the bristles 20 by the rotation of the motor 24 . accordingly , any and all types of movements including axial lateral movement , linear movement which is perpendicular to the axis of the brush or even rotation of the brush plate 22 or groups of bristles 20 contained in the brush head are all within the scope of the present invention . operation of the motor is provided by power such as , for example , batteries 27 and 28 . the power source although shown as two batteries can be provided by one or more rechargeable or replaceable batteries . switches 29 and 30 operate to turn the device on or off and control the speed thereof , respectively . it is preferred that the housing 12 be a one - piece unit , effectively sealed from the ingress ( or egress ) of fluids such as water or air . a one - piece construction is advantageous in allowing relatively simple , inexpensive manufacture with an airtight , waterproof seal that prolongs toothbrush life . specifically , this seal not only protects the battery and working mechanisms from moisture , thereby improving reliability , but also enhances safety and prevents battery leakage outward from the unit . each portion of the unit is preferably constructed of a polymeric material such as polyethylene . alternatively or concurrently therewith , a shell construction of a conventional high - impact resistant plastic is also desirable for minimizing risk of damage during travel . movement of brush head 18 is controlled by variable , high - speed motor 24 housed suitably in the handle portion 14 . in accordance with one aspect of the present invention , the brush head 18 is provided with soft , compact nylon bristles 20 formed in any shape . for example , bristles 20 can be provided in a cone - like shape that has not only been found highly effective for removing debris from between teeth , but also in cleaning between teeth and gums , rapid cleaning of the crown , as well as use on irregularly shaped teeth . alternatively , the brush head 18 can have a flattened shape as depicted in fig1 . this arrangement has been found desirable for debris removal , polishing and gum messaging . in another embodiment , alternatively or concurrently with either of the foregoing brush head configurations , the brush head 18 can be detachably secured to the head portion such as by a snap fit for ready removal or replacement . as indicated in fig1 , neck portion 16 can be generally fixed at a selected bend for orienting the brush head generally at an angle to the longitudinal axis of the toothbrush . such angle can enhance better contact with the teeth through out the mouth of the user . the neck portion 16 can be adjustably flexible , in whole or in part , for variable positioning of the brush head in a selected orientation relative to the handle portion . selected adjustment is preferably facilitated by a universal joint and bearing assembly interior to the neck portion and a flex cord comprising the exterior neck portion ( not shown ). in this manner , a proper angle of the brush head relative to the teeth may be maintained for effective brushing . a flexible , bendable neck portion is also advantageous for placing the toothbrush in a stowed or folded position for storage , enhanced portability or the like . an example of a flexible neck portion is disclosed in u . s . pat . no . 6 , 230 , 717 issued may 15 , 2001 , the entire content of which is herein incorporated by reference . motor 24 is preferably a conventional , low current dc motor with a capacity of at least three ( 3 ) volts , powered by a selected dc power source , e . g . batteries 27 , 28 . an objective is to provide selected constant , high speed movement with minimal slow down upon contact with the teeth or gums suitability of other relatively low current motors will be appreciated by those skilled in the art , giving consideration to the purpose for which the present invention is intended . the power source can be provided by one or more batteries 27 , 28 as shown in fig1 . any known type of power source can be used to operate motor 24 such as for an electric toothbrush as is well known in the art . the batteries can be disposable or rechargeable and are generally leak proof in that the have a relatively long life . for example , rechargeable batteries of nickel - cadmium , nickel metal hydride and lithium type can be used . conventional replaceable alkaline batteries can also be used as the power source . the variable speed , power control device for actuating movement of the brush plate 22 and / or bristles 20 can be provided by separate switches 29 and 30 as shown in fig1 or can be provided as a multi - position pivot switch which may be actuated in at least two power settings . if three - position switch is used , according to one embodiment , the switch has a first position corresponding to a first or low power setting , a second setting corresponding to a second or high power setting , and a third setting to a power off position . each power setting , in turn , corresponds to a selected brush head speed , for instance , the low power setting corresponding to a first brush head speed and the high setting to a second brush head speed . alternatively , a conventional sliding type multi - position switch may be used . if two separate switches as shown in fig1 are used , one switch 29 can be used to turn the motor on or off , while switch 30 can be used for selecting the low or high power settings . an electronic circuit 32 used to adjust the speed of the 2 - speed motor of the present invention is shown in fig2 . the circuit 32 includes a dc motor 24 , power sources 27 and 28 represented by 1 . 5 volt batteries , and switches 29 and 30 which represent an on / off switch and a high / low switch , respectively . again , power sources 27 and 28 can be provided as a single battery source , if desired . when switch 29 is in the on position and switch 32 is closed , as represented by “ speedy ” as shown in fig2 , the circuit is closed and the high speed of motor 24 is activated to move the bristles 20 at a higher oscillation or rotation , depending on the particular configuration of the brush head 18 . when switch 29 is in the on position and switch 30 is on slow speed , the circuit is completed by passage through a diode 34 which reduces the voltage through the circuit to motor 24 by approximately ⅓ . since the voltage drop through diode 34 is not dependant on the amount of current through the circuit , a consistent low speed can be achieved unlike the use of a resistor in which voltage drop across the resistor results in changes in current levels . a fuse 36 can be incorporated into circuit 32 for safety reasons so as to prevent excessive overheating . turning now to operation , a method is provided for cleaning a user &# 39 ; s teeth using a motorized toothbrush . initially , a head portion of the toothbrush is inserted in the user &# 39 ; s mouth . next , the on switch 29 is activated and a speed setting is selected by the user through switch 30 . the motor 24 in the handle portion is then engaged thereby at the high or low speed . oscillation or rotation of the brush head is effected by rotation of the motor 24 . the moving brush head is then placed in contact with at least one of the user &# 39 ; s teeth for a selected time . when a desired degree of cleaning has been achieved , the head portion is removed from the user &# 39 ; s mouth , and the motor is disengaged by use of the off switch 29 .

US-51721207-A

a method for playing an interactive computer processed golf tournament in real time via the internet . the method includes the steps of registering users via the internet and storing the user name , address , age , telephone , credit card data and club number on a library file . the method includes scheduling named tournaments , registering users via the internet as contestants in one of the named tournaments including , assigning the user a position within a flight of a first round of the named tournament , and storing the assigned position on the library file . participating contestant logins are accepted via the internet prior to each named tournament . participating contestants are provided with a scorecard display for the assigned flight including a tournament name , a countdown clock , one or more contestant scores , a cursor , and a message area . user inputs are accepted in real time via the internet from each of the participating contestants in turn for each of the holes wherein each input determines a random score for the hole . a winner of each of the flights is determined based on a total of the random scores . each winner is assigned to a position in a successive flight in a successive round and the process is repeated until the last championship round . playing a championship round includes determining a plurality of championship round winners based on the random scores and awarding prizes to the championship round winners .

described herein are embodiments of an interactive ( real time computer processed ) golf tournament system by which golf tournaments are played nationwide by means of a golf tournament integrated “ system ” installed on a server computer and made available to the worldwide web ( internet ). the “ system ” consists of integrated hardware and software installed at a particular site location which processes all tournament events from initial player tournament registration , collection of entrance fees , the determination of winners to the payment of prizes . the system is a turnkey operation and can be located at more than one site to handle more than one tournament simultaneously ( for example , five different tournaments at the same time on the same day of the week ). this would require a different website for each tournament . more than one website can be installed based on demand ( number of registrants per tournament within a particular geographical area , i . e . continental u . s ., japan , etc .) the system is self - contained and can be sold , installed and maintained on an international basis . however , in the continental united states , the preferred approach is to install and operate the system as a commercial venture by one company , however , partnerships with internet companies ( for example , aol , earthlink , etc .) are also possible to facilitate development , installation and operation of the system . each tournament will have a commercial sponsor who will provide the prize money ($ 50 , 000 minimum ). in return , the sponsor will have the tournament named after the sponser ( for example the “ wal - mart challenge ”) and will receive free advertising on the website during the duration of the tournament ( from the time of initial registration through the end of the tournament , monday through sunday ). in addition , the sponsor may , at its option , provide discounts to all tournament players . this is done by providing discount coupons to all entrants by either downloading them to the entrant &# 39 ; s site for printing or by mail . if the sponsor is a retailer , this could provide additional sales and a means by which the prize money is recovered , either partially or fully . tournaments are arbitrarily limited to 10 , 000 players although the system is designed to handle more or less than this number of players . this number is a matter of convenience and economics ( cost and expected profit ). for example , if one tournament is held each week and the entrance fee is either $ 20 . 00 or $ 25 . 00 per contestant , the yearly revenue would be : the system consists of the highest quality hardware and software available to minimize any downtime . an in - depth reliability , maintainability , availability ( rma ) analysis is required to predict system failure rates and downtime . since only one tournament is envisioned per week with an operating time of one hour maximum per tournament , this equates to only 52 operating hours per year per site for the complete system . the registration ( sign - up ) subsystem experiences more stress since it operates continuously until the registration file ( library file ) is complete for one tournament . however , since the subsystem is separate from the tournament playing subsystem , no difficulties are anticipated during the tournament . all subsystems are “ burned in ” prior to the initiation of tournament operations to identify faulty components . usually , if a failure occurs , it occurs early in the operational life of a system . any failures experienced during system ‘ burn in ’ should be analyzed for design deficiencies and design improvements made if required . system operational life is expected to be at least 25 years minimum . as shown in fig1 the system is normally configured to accept up to 10 , 000 entrants ( players ) 10 nationwide per tournament 12 . each tournament 12 consists of four ( 4 ) rounds 14 , 16 , 18 , 20 , and each round consists of ten players per flight 22 . assuming that 10 , 000 players have entered a tournament , round one will consist of 1 , 000 flights of ten entrants ; the flights are played simultaneously . after the first round 14 , the winners of the 1 , 000 flights will compete in the second round 16 . winners from flights one through ten of round one will be flight number one 14 in round two 16 , winners from flights 11 through 20 of round one will be competitors in flight two of round two , etc . therefore , round two 16 will consist of 100 flights of ten players each for a total of 1 , 000 contestants . after the second round is completed , the winners will compete in round three 18 . round three 18 will therefore consist of ten flights of ten players each . flight one will consist of the winners of flights one through ten of round two , etc . round four 20 is the final championship round and will consist of the ten winners from round three in a championship flight 24 . prizes 26 will be given to the top four finishers 28 , places one through four , although this could vary from tournament to tournament . consolation prizes , such as golf balls , may be given to the remaining entrants in the championship round . a tournament 12 is configured to be completed in a specific time period . for example , a tournament will be completed within 60 minutes from the start based on the following exemplary tournament time allocations : four seconds per player input / output ( for example , three - second player response and one second system response , i . e . number of strokes per hole calculation and display , and player selection ). four minutes between rounds one and two , two and three , and three and four for a total of 12 minutes for resolution of ties and setting up the next round . the above time allocation is typical and is shown as an example only . other time allocations can be developed . for example , there may be an intermission after the first nine holes are played during which time advertisements may be displayed for the sponsers of the tournament . the time selected for a tournament to start must accommodate different time zones . therefore , for convenience , tournaments will typically be held in geographical areas comprising a single time zone to avoid confusion , however , more time zones , for example three , can be used . the three hour time zone primarily applies to the continental united states . tournaments can be held all over the world with proper site location . it is anticipated that tournaments will be held within the geographical boundaries of a particular country due to issues such as legality , politics , taxes , etc ., although international competitions can be held by agreement . europe is an example of a location for international competition , or an international tournament could be held with the winners of individual country tournaments with the site location selected by mutual agreement . for convenience , it is expected that tournaments will be held on a weekend ( preferably sunday ). for example , a tournament can be held on a sunday afternoon and , in the continental united states , 4 pm est would be a typical starting time of a tournament , although other starting times can be used . for example if two tournaments are held on the same day at the same website , one could be held at 3 p . m . est and the other at 5 p . m . est . this would have the beneficial effect of doubling the weekly income . in order to enter tournaments an individual will connect to a website running a registration subsystem from his / her home computer . the website will preferably be available 24 hours each day , monday through saturday . the contestant wil receive a message on his screen with instructions on registering as a user of the system in order to receive a user identification ( club number ) to be used in future tournament events . the information to be provided by the prospective contestant will include but not be limited to : upon credit card number validation and processing , a message is sent to the entrant &# 39 ; s computer that the entrant &# 39 ; s registartion has been accepted and a user club number is provided for use in future tournaments , or a message is returned to the entrant that his registration has not been accepted . also , upon acceptance , the user &# 39 ; s information is entered into a tournament library file . to enter a specific tournament 12 as a contestant , a user will connect to a website running a tournament at which time he / she will either be informed that the tournament is filly subscribed and cannot accept any more contestants , or he / she will be asked to provide a user club number . information related to the procedure to be followed on the date of the tournament will also be included in the message . the user &# 39 ; s information will be retrieved from the tournament library file according to the user club number provided . the contestant is assigned a number and position within a flight 22 . the flights 22 , and positions within them , will be filled in order , i . e . flight one , position one , flight one , position two , etc . until all flights and positions are filled . when the library is filled , an “ all filled ” message , or message to that effect , is activated on the message screen and no further entries are accepted . after the tournament , the winning positions are entered into the tournament library file . all file information is transferred to a history file and retained as a historical record of the tournament . fig2 shows the structure of the tournament library file 30 . the file includes a tournament name 32 , flight number 34 , position within the flight 36 , user identification number 38 and contestant information 40 which includes the information entered in the above - described registration . on the day of the tournament , each contestant must log in at least five minutes prior to the start of the tournament by providing the above - described user club number . upon log - in , a set of simple tournament instructions will be displayed on the contestant &# 39 ; s screen , the contestant &# 39 ; s club number is automatically matched to the tournament library file and the number is verified that it exists in the file . upon verification , the contestant is sent a display which is a flight scorecard along with a flight number and his name in one of the contestant slots . this is his / her position in the assigned flight 22 . a representation of the display is shown in fig3 and partially described here and further described below with respect to contestant messages and displays . the display 42 shows the golf game layout 44 ( i . e . par 3 , 4 and 5 holes ), the contestant &# 39 ; s name 46 , the contestant &# 39 ; s position 48 in the round , and a cursor 50 which illuminates to indicate the player to play the hole . in a preferred embodiment , the possible scores ( number of strokes ) a player can receive are as follows : one through six for par 3 holes , two through seven for par 4 holes , and three through eight for par 5 holes . this represents scores from an eagle through a triple bogie for any hole . this is a typical range of scores per hole , however , any numerical range can be used . the range selected represents realistic scores one can obtain on a golf course and minimizes the possibilities of ties in a flight . all displays available to a contestant are further described below . at the start of a tournament , hole one in the hole number section 52 will be highlighted and the cursor 50 on the left of the first listed contestant ( number one ) will be illuminated . in one embodiment , contestant one has three seconds to depress the “ enter ” key on his / her computer keyboard . all other contestants , the remaining nine , are “ locked out ”, i . e . if a contestant other than the one that has the illuminated cursor next to his / her name depresses the “ enter ” key on his / her computer keyboard , nothing will happen . if contestant number one depresses the enter key within three seconds , a signal is sent to a random number generator which selects a number based on the “ par ” value of the hole . this number is entered into a score totalizer for this contestant and the number is displayed on the screen for all flight contestants to observe in a score area 54 . the score area 54 includes an out total 56 for the first nine holes , an in total 58 for the last none holes and an overall total 59 for all holes . in an alternate embodiment , instead of the contestant having three seconds to depress the “ enter ” key , the system will display a number of golf balls ( 57 ), five for example , and each golf ball will correspond to a randomly generated number . the contestant will have three seconds to select a golf ball with a pointing device such as a mouse , and the number associated with that ball will be used in place of the random number described above . the three second time limit is arbitrary as previously described . when the cursor illuminates next to contestant number two , contestant number two has three seconds to depress the enter key on his / her terminal keyboard , or select a golf ball , and the same process is repeated for contestant number two . the process is than repeated for contestants three to ten , and for the remaining 17 holes . hole number two will be highlighted when this hole is played and the process will continue for the remaining holes . if a contestant does not depress the enter key , or select a golf ball , within three seconds after the cursor illuminates , that contestant is given the highest score possible for that hole ( six for a par three hole , seven for a par four hole , and eight for a par five hole ). in addition , if a person does not log in prior to the tournament , that person will forfeit the entrance fee and will receive the maximum score for each hole in the round . at the completion of the first round , the scores of all the contestants will be totaled and displayed . the contestant with the lowest score will be highlighted and a message displayed with instructions for the next round . the display for all the losing contestants will be terminated and they will automatically be disconnected from the system . if a tie occurs at the end of a round within a flight the scores of the tied players will be highlighted and their names retained on the scorecard . all other players will be eliminated along with all scores . a sudden death hole - by - hole process for the two or more finalists will commence at hole number one when the cursor illuminates next to the first player &# 39 ; s name . the players depress the enter key to start the sudden death process . the player with the lowest score on the first hole will win the round . if a tie occurs on the first hole , the process will continue on hole number two until the tie is broken and a winner identified . all flight winners will stay on line for the start of the second round . the system will automatically construct the second round flights by assigning the 1000 winners of the first round to the 100 flights of the second round . the second round will be played in the same manner as the first round . at the completion of the second round , the system will automatically construct the third round of flights by assigning the 100 winners of the second flight to the 10 flights of the third round . at the completion of the third round , the final championship round ( fourth round ) will be constructed automatically by the system by inserting the winners of the ten flights of the third round into the final score card . the final round is played in the same manner as rounds one , two and three . at the end of this round the first second , third and fourth place winners will be identified and the prizes distributed . various messages and displays are generated by the system before and during the tournament . these are shown in sequence from fig4 through fig1 . when a contestant first connects to the website , he / she will receive a greeting message 60 as shown in fig4 along with a description of the tournament procedures , the entry fee , and any other significant information . if the person wants to enter the tournament , he / she clicks on the “ yes ” box and the entrance instructions 62 appear as show in fig5 or a message will appear that the tournament is fully booked and no other entries are being taken . the entrant inputs the information requested ( club number ) in the area provided and , if all information is validated as correct , a validation message 64 will be sent that the person has been entered into the tournament as shown in fig6 . at this point , a operational instruction message 66 is sent as shown in fig7 which includes instructions to be followed on the date of the tournament . when the contestant enters the website on the day of the tournament , a status message 68 is displayed as shown in fig8 . once the instructions are followed , the scorecard related to the round one flight to which the contestant has been assigned ( refer to fig2 ) will appear on the player &# 39 ; s screen . the scorecard format is shown in fig3 . any round one messages will be included below the scorecard . typical messages 70 are shown in fig9 . the time remaining to the start of the tournament is shown by a countdown clock 72 in the upper left - hand corner in this example . when the clock reaches 00 : 00 minutes : seconds , the first player and hole number one will be illuminated and the player will have three seconds to press the “ enter ” key , or select a golf ball , to receive a score for the first hole 74 as shown in fig1 . when player number two illuminates , the same process is followed until the tournament is completed . a completed scorecard is shown in fig1 along with a message for the winner 76 of the flight as shown in fig1 . the process continues for the remaining rounds . the championship round is shown in fig1 . as shown in fig1 , the golf tournament system consists of four main subsystems : the telecommunication subsystem 80 , the registration system 82 , the operational system 84 and the control system 86 . top - level block diagrams of the golf tournament system subsystems are provided in fig1 . the telecommunication subsystem 80 is the primary interface between the golf tournament system and the contestants . it is a high - speed signal multiplex / routing system that allows two way simultaneous communications between all 10 , 000 tournament players and the golf tournament system . the registration subsystem 82 processes and validates contestant entry information . it establishes the tournament registration library file ( data format shown in fig2 ), provides the interface between the system and the credit card billing module , and provides the basic structure for allocating the contestants to the flights for the first round . the contents of the library file will be archived after the tournament for historical purposes . the operational subsystem 84 controls the game process for each round on a per - flight basis . each flight has its own control module ; there are 1 , 000 control modules 88 as shown in fig1 and fig2 in the total system to handle 10 , 000 players simultaneously . the flight control modules 88 process the contestant &# 39 ; s inputs and activate the random number generators , produce the flight displays and determine the flight winners . the configuration of the flight module 90 is shown in fig1 . the control subsystem 86 is the master controller or central processor of the system . it provides the interfaces between all subsystems and included modules and controls all game functions . function diagrams related to system operation are shown in fig1 a - d . while the invention has been described with respect to specific embodiments by way of illustration , many modifications and changes will occur to those skilled in the art . it is therefore , to be understood that the appended claims are intended to cover all such modifications and changes which fall within the true spirit and scope of the invention .

US-99969301-A

the progress of a endovascular cardiac repair can be monitored by inserting a pressure transducer sensor using a catheter into a chamber of the heart during endovascular repair and then using a small , hand - held read out device to measure pressure easily , safely , inexpensively and accurately . in one aspect a sensor is introduced into the body by the steps of folding or rolling the sensor into a cylinder , loading it into a catheter , and deploying into the heart chamber by allowing it to unroll or unfold , either by itself or facilitated by the incorporation of a super - elastic alloy component .

the invention can perhaps be better understood by referring to the drawings . one embodiment of a sensor according to the invention is shown in fig1 , and 3 , where a disc - shaped sensor 10 comprises a capacitor disk 12 and a wire spiral 14 . fig2 is a lateral view of sensor 10 , and fig3 is a lateral view of sensor 10 in a folded configuration for insertion . the fact that sensor 10 is sufficiently flexible to be folded as shown in fig4 is an important aspect of the invention . in fig4 a ring 20 comprised of a shape memory alloy such as nitinol has been attached to , for example , with adhesive , or incorporated into , for example , layered within , a sensor 22 . fig5 is a lateral cross - sectional view of a circular sensor 30 having a ring 32 comprised of a shape memory alloy such as nitinol encompassing the outer edge 34 of sensor 30 . ring 32 preferably is attached to outer edge 34 by a suitable physiologically acceptable adhesive 36 , such as an appropriate epoxy or cyanoacrylate material . preferably the ring will be radiopaque . the size of the circular sensors of the invention will vary according to factors such as the intended application , the delivery system , etc . the circular sensors are intended to be from about 0 . 5 to about 3 cm in diameter , with a thickness of from about 0 . 05 to about 0 . 30 in . when a ring 32 is employed , the thickness of the ring , i . e ., the width of the outside surface 38 , will preferably be from about 1 . 5 to about 3 . 5 times the thickness of the sensor . fig6 and 7 each represent a lateral view of a sensor with an anchoring member . in fig6 sensor 40 has a screw / coil 42 , and in fig7 sensor 40 has an anchor 44 with umbrella - like projections 46 . when pressure is applied to the flat side 48 of sensor 40 , anchor 42 or 44 will penetrate a vessel wall , organ wall , or other substrate to cause sensor 36 to remain in a desired position or location . alternatively , an anchoring mechanism such as is shown in fig6 and 7 could be attached to ring 32 in fig5 . the pressure sensor of the invention can be manufactured using micro - machining techniques that were developed for the integrated circuit industry . an example of this type of sensor features an inductive - capacitive ( lc ) resonant circuit with a variable capacitor , as is described in allen et al ., u . s . pat . no . 6 , 111 , 520 , all of which is incorporated herein by reference . the sensor contains two types of passive electrical components , namely , an inductor and a capacitor . the sensor is constructed so that the fluid pressure at the sensor &# 39 ; s surface changes the distance between the capacitor &# 39 ; s parallel plates and causes a variation of the sensor &# 39 ; s capacitance . in a preferred embodiment the sensor of the invention is constructed by laminating several layers of material together , as shown , for example , in fig8 . a first layer 242 is fabricated from a sheet of polyimide film ( e . g . kapton , available from du pont ) upon which a micro - machined copper pattern 244 is deposited . pattern 244 preferably consists of a circular conductive segment in the center of the sheet surrounded by a spiral coil . a second layer 248 comprises a sheet of flexible adhesive through which hole 250 has been cut in the center . ( optionally there may be more than one such layer 248 .) a final layer 252 is another sheet of polyimide film with a copper pattern 254 that is a mirror image of pattern 244 . when assembled , the first , second , and third layers are aligned such that the holes in the middle adhesive layers are centered between the circular conductive segments in the middle of the two outer polyimide layers 242 and 252 . in this way a capacitor ( defined as an electric circuit element used to store charge temporarily , consisting in general of two metallic plates separated and insulated from each other by a dielectric ) is formed . at the same time , the two metal spirals on the polyimide sheets 242 and 252 form an inductor component of a miniature electrical circuit . the sensor exhibits the electrical characteristics associated with a standard lc circuit . an lc circuit is simply a closed loop with only two elements , a capacitor and an inductor . if a current is induced in the lc loop , the energy in the circuit is shared back and forth between the inductor and capacitor . the result is an energy oscillation that will vary at a specific frequency . this is termed the resonant frequency of the circuit and it can be easily calculated as its value is dependent on the circuit &# 39 ; s inductance and capacitance . therefore , a change in capacitance will cause the frequency to shift higher or lower in linear proportion to the change in the value of capacitance . as noted above , the capacitor in the assembled pressure sensor consists of the two circular conductive segments separated by an air gap . if a pressure force is exerted on these segments it will act to deform the outer polyimide sheet and move the two conductive segments closer together . this will have the effect of reducing the air gap between them which will consequently change the capacitance of the circuit . the result will be a shift in the circuit &# 39 ; s resonant frequency that will be in direct proportion to the force applied to the sensor &# 39 ; s surface . because of the presence of the inductor , it is possible to electromagnetically couple to the sensor and induce a current in the circuit . this allows for wireless communication with the sensor and the ability to operate it without the need for an internal source of energy such as a battery . thus , if the sensor is located within the chamber of the heart , it will be possible to determine the pressure within the chamber in a simple , non - invasive procedure by remotely interrogating the sensor , recording the resonant frequency and converting this value to a pressure measurement . the readout device generates electromagnetic energy that penetrates through the body &# 39 ; s tissues to the sensor &# 39 ; s implanted location . the sensor &# 39 ; s electrical components absorb a fraction of the electromagnetic energy that is generated by the readout device via inductive coupling . this coupling induces a current in the sensor &# 39 ; s circuit oscillates at the same frequency as the applied electromagnetic energy . due to the nature of the sensor &# 39 ; s electromechanical system there exists a frequency of alternating current at which the absorption of energy from the readout device is at a minimum . this frequency is a function of the capacitance of the device . therefore , if the sensor &# 39 ; s capacitance changes , so will the frequency at which it minimally absorbs energy from the readout device . since the sensor &# 39 ; s capacitance is mechanically linked to the fluid pressure at the sensor &# 39 ; s surface , a measurement of this frequency by the readout device gives a relative measurement of the fluid pressure . if calibration of the device is performed , then an absolute measurement of pressure can be made . see , for example , the extensive discussion in the allen et al . patent , again incorporated herein by reference , as well as gershenfeld et al ., u . s . pat . no . 6 , 025 , 725 , incorporated herein by reference . the pressure sensor is made of completely passive components having no active circuitry or power sources such as batteries . the pressure sensor is completely self - contained having no leads to connect to an external circuit or power source . furthermore , these same manufacturing techniques can be used to add additional sensing capabilities , such as the ability to measure temperature by the addition of a resistor to the basic lc circuit . several alternative configurations of the lc circuit design can be considered to address specific biological and manufacturing issues . for example , in one embodiment of the sensor the capacitor element consists of two plates that are separated by a suitable dielectric material , such as air , inert gas , fluid or a vacuum . to ensure the long term integrity of the sensor , various coatings could be applied to the surface or between the polymeric layers used to form the sensor . these coating can be used to provide a hermetic seal that will prevent leakage of body fluids into the cavity or permeation of the cavity material ( gas , vacuum or fluid ) out of the sensor . in an another embodiment of the invention , shown in fig9 , a sensor 270 has a multitude of capacitors 275 formed either as separate elements or as an array . in such a distributed capacitance configuration , there can be a more accurate and more sensitive measurement of pressure . it is within the scope of the invention that the frequency response to the sensor will be in the range of from about 1 to about 200 mh z , preferably from about 1 to about 100 mh z , and more preferably from about 2 to about 90 mh z , with a q factor from about 5 to about 80 , preferably from about 10 to about 70 , more preferably from about 10 to 60 . in a further embodiment of the invention there is no direct electrical connection between the two sides of the lc circuit . referring again to the sensor described in the allen et al . patent , the device is constructed using multiple layers upon lie the necessary circuit elements . disposed on the top and bottom layer are metal patterns constructed using micro - machining techniques which define a top and bottom conductor and a spiral inductor coil . to provide for an electrical contact between the top and bottom layers small vias or holes are cut through the middle layers . when the layers are assembled , a metal paste is forced into the small vias to create direct electrical connections or conduits . however , experimentation has shown that due to parasitic capacitance that is created between the top and bottom inductor coils , a vialess operational lc circuit can be created . this absence of via holes represents a significant improvement to the sensor in that it simplifies the manufacturing process and , more importantly , significantly increases the durability of the sensor making it more appropriate for use inside the human body . fig1 is a partial cross - sectional review of the sensor shown in fig8 , where first layer 242 , second layer 248 , and third layer 252 are sandwiched together . a cylindrical space 256 comprises a pressure sensitive capacitor . no via holes are present . the sensor 278 shown in fig1 comprises a first polyimide layer 280 , a second , adhesive layer 282 , and a third , polyimide layer 284 . first layer 280 has a copper pattern comprising a coil 286 and a disk 288 , and third layer 284 comprises a coil 290 and a disk 292 . a cylindrical space 296 comprises a pressure sensitive capacitor . a diode 294 connected between coils 286 and 290 creates a non - linear sensor , i . e ., a sensor where the frequency change is non - linear as compared to a change in pressure . the design of the sensor is not limited to a specific geometric configuration . in the specific example noted above the inductor component is described as a spiral coil . other embodiments of the sensor could utilize oval , rectangular or an amorphous shape . specific electrical , mechanical and biologic advantages could be obtained by employing these various geometric designs . by way of example , a rectangular shaped sensor in which the ratio of length to width was greater than four would greater lend itself to catheter based delivery as is would minimize the radius of curvature required to position the folded device within a small diameter catheter . alternatively , a more elaborate shape , such as one resembling the petals of a flower , would lend itself to more complex folding patterns that could facilitate delivery to specific areas of a chamber of the heart . in a preferred embodiment of the invention a foldable sensor is delivered to the chamber of a patient &# 39 ; s heart in the distal end of a delivery catheter . the sensor can be regularly or irregularly shaped so that outer portions of the sensor can fold to about a 90 ° angle as compared to a relatively flat , middle portion of the sensor . for example , in fig1 , a daisy or flower - shaped sensor 308 has a capacitor surface 310 connected to a wire 312 that partly follows the outer configuration of sensor 308 . petals 314 fold so that sensor 308 with a distal anchor 316 can be “ loaded ” into a catheter 318 , as shown in fig1 . when the distal end 320 of catheter 318 is in position , a pushing rod member 322 is pushed distally to cause sensor 308 to be released from catheter 318 and attach to the inner surface of the wall of a heart chamber ( not shown ). it is especially preferred that rod member 322 will be temporarily affixed to sensor 308 for at least two purposes . first , rod member 322 functions as a safety or tether wire . and second , rod member 322 will be capable of twisting or otherwise maneuvering sensor 308 so that anchor 368 will attach to the heart chamber wall . once sensor 308 is attached , rod member 322 is disengaged from sensor 308 and withdrawn proximally . another , embodiment of a sensor is shown in fig1 , where circular sensor 330 comprises flexible cut - outs 332 . the first outer layer 334 comprises a polymide substrate with a copper pattern comprising a coil 340 and several , from 2 to 6 , disks 342 to form pressure sensitive capacitors . sensor 330 also comprises at least one adhesive layer ( not shown ) and a third outer layer corresponding to the first outer layer ( not shown ). preferably sensor 330 has at least one diode connecting the copper coils of the first and third layers . the flexible cut - outs 352 facilitate , among other things , folding of sections of sensor 370 for placement in , or arrangement upon , a delivery catheter , such as in fig1 . the sections can also be folded to create either a “ z ” shape or , for example , a “ u ” shape , for other applications . it is within the scope of the invention that variously numbered and shaped cut - outs could be used for particular applications . while a preferred delivery system is described above , it is within the scope of the invention that other delivery systems could be employed . other such delivery systems are described in , for example , co - pending , commonly assigned u . s . patent application ser . no . ______ [ 24301 . 10 ], filed jan . 22 , 2002 , incorporated herein by reference . further , the invention is not limited to the implantation of a single sensor . since the biological environment within a patient &# 39 ; s heart is not necessarily homogeneous , multiple pressure sensors may be introduced into a patient &# 39 ; s heart , each being positioned at different locations . in this situation , each sensor may be designed with a unique signature ( obtained by changing the resonant frequency of the sensor ), so that the pressure measurement derived from one sensor can be localized to its specific position within the heart . when introduced into the chamber of a patient &# 39 ; s heart , the pressure sensor can provide pressure related data by use of an external measuring device . as disclosed in the allen et al . patent , several different excitation systems can be used . the readout device generates electromagnetic energy that can penetrate through the body &# 39 ; s tissues to the sensor &# 39 ; s implanted location . the sensor &# 39 ; s electrical components can absorb a fraction of the electromagnetic energy that is generated by the readout device via inductive coupling . this coupling will induce a current in the sensor &# 39 ; s circuit that will oscillate at the same frequency as the applied electromagnetic energy . due to the nature of the sensor &# 39 ; s electromechanical system there will exist a frequency of alternating current at which the absorption of energy from the readout device is at a minimum . this frequency is a function of the capacitance of the device . therefore , if the sensor &# 39 ; s capacitance changes so will the frequency at which it minimally absorbs energy from the readout device . since the sensor &# 39 ; s capacitance is mechanically linked to the fluid pressure at the sensor &# 39 ; s surface , a measurement of this frequency by the readout device can give a relative measurement of the fluid pressure . if calibration of the device is performed then an absolute measurement of pressure can be made the circuitry used to measure and display pressure is contained within a simple to operate , battery powered , hand - held electronic unit 400 , as shown in fig1 . this unit 400 also contains the antenna needed to perform the electromagnetic coupling to the sensor . the antenna may be integrated into the housing for the electronics or it may be detachable from the unit so that it can be positioned on the surface of the body 402 in proximity to the implanted sensor and easily moved to optimize the coupling between antenna and sensor . the antenna itself may consist of a simple standard coil configuration or my incorporate ferrous elements to maximize the coupling efficiency . the electronic device would feature an lcd or led display 404 designed to clearly display the recorded pressure in physiologically relevant units such as mm hg . in an alternative embodiment , the display may be created by integrating a commercially available hand - held computing device such as a palm ® or micro - pc into the electronic circuitry and using this device &# 39 ; s display unit as the visual interface between the equipment and its operator . a further advantage of this approach is that the hand - held computer could be detached from the read - out unit and linked to a standard desktop computer . the information from the device could thus be downloaded into any of several commercially available data acquisition software programs for more detailed analysis or for electronic transfer via hard media or the internet to a remote location . accordingly , the present invention provides for an impedance system and method of determining the resonant frequency and bandwidth of a resonant circuit within a particular sensor . the system includes a transmitting antenna , which is coupled to an impedance analyzer . the impedance analyzer applies a constant voltage signal to the transmitting antenna scanning the frequency across a predetermined spectrum . the current passing through the transmitting antenna experiences a peak at the resonant frequency of the sensor . the resonant frequency and bandwidth are thus determined from this peak in the current . the method of determining the resonant frequency and bandwidth using an impedance approach may include the steps of transmitting an excitation signal using a transmitting antenna and electromagnetically coupling a sensor having a resonant circuit to the transmitting antenna thereby modifying the impedance of the transmitting antenna . next , the step of measuring the change in impedance of the transmitting antenna is performed , and finally , the resonant frequency and bandwidth of the sensor circuit are determined . in addition , the present invention provides for a transmit and receive system and method for determining the resonant frequency and bandwidth of a resonant circuit within a particular sensor . according to this method , an excitation signal of white noise or predetermined multiple frequencies is transmitted from a transmitting antenna , the sensor being electromagnetically coupled to the transmitting antenna . a current is induced in the resonant circuit of the sensor as it absorbs energy from the transmitted excitation signal , the current oscillating at the resonant frequency of the resonant circuit . a receiving antenna , also electromagnetically coupled to the transmitting antenna , receives the excitation signal minus the energy which was absorbed by the sensor . thus , the power of the received signal experiences a dip or notch at the resonant frequency of the sensor . the resonant frequency and bandwidth are determined from this notch in the power . the transmit and receive method of determining the resonant frequency and bandwidth of a sensor circuit includes the steps of transmitting a multiple frequency signal from transmitting antenna , and , electromagnetically coupling a resonant circuit on a sensor to the transmitting antenna thereby inducing a current in the sensor circuit . next , the step of receiving a modified transmitted signal due to the induction of current in the sensor circuit is performed . finally , the step of determining the resonant frequency and bandwidth from the received signal is executed . yet another system and method for determining the resonant frequency and bandwidth of a resonant circuit within a particular sensor includes a chirp interrogation system . this system provides for a transmitting antenna which is electromagnetically coupled to the resonant circuit of the sensor . an excitation signal of white noise or predetermined multiple frequencies is applied to the transmitting antenna for a predetermined period of time , thereby inducing a current in the resonant circuit of the sensor at the resonant frequency . the system then listens for a return signal which radiates from the sensor . the resonant frequency and bandwidth of the resonant circuit are determined from the return signal . the chirp interrogation method for determining the resonant frequency and bandwidth of a resonant circuit within a particular sensor includes the steps of transmitting a multi - frequency signal pulse from a transmitting antenna , electromagnetically coupling a resonant circuit on a sensor to the transmitting antenna thereby inducing a current in the sensor circuit , listening for and receiving a return signal radiated from the sensor circuit , and determining the resonant frequency and bandwidth from the return signal . a representative block diagram of an electrical circuit that can be used to interrogate the sensor and determine the resonant frequency is shown in fig1 . a transmitter and receiver , i . e ., a transceiver 422 , has an antenna 424 for generating and receiving signals from a sensor 426 . transceiver 422 is an electronic or digital connection with a phase detector 430 , a microprocessor 432 , and a frequency synthesizer 434 . microprocessor 432 is in turn connected to an interface 436 such as a terminal . power supply 438 regulates and provides electrical power to the system . the present invention also provides an analog system and method for determining the resonant frequency of a resonant circuit within a particular sensor . the analog system comprises a transmitting antenna coupled as part of a tank circuit which in turn is coupled to an oscillator . a signal is generated which oscillates at a frequency determined by the electrical characteristics of the tank circuit . the frequency of this signal is further modified by the electromagnetic coupling of the resonant circuit of a sensor . this signal is applied to a frequency discriminator which in turn provides a signal from which the resonant frequency of the sensor circuit is determined . the analog method for determining the resonant frequency and bandwidth of a resonant circuit within a particular sensor includes the steps of generating a transmission signal using a tank circuit which includes a transmitting antenna , modifying the frequency of the transmission signal by electromagnetically coupling the resonant circuit of a sensor to the transmitting antenna , and converting the modified transmission signal into a standard signal for further application . the invention further includes an alternative method of measuring pressure in which a non - linear element such as a diode or polyvinylidenedifloride piezo - electric polymer is added to the lc circuit . a diode with a low turn - on voltage such as a schottky diode can be fabricated using micro - machining techniques . the presence of this non - linear element in various configurations within the lc circuit can be used to modulate the incoming signal from the receiving device and produce different harmonics of the original signal . the read - out circuitry can be tuned to receive the particular harmonic frequency that is produced and use this signal to reconstruct the fundamental frequency of the sensor . the advantage of this approach is two - fold ; the incoming signal can be transmitted continuously and since the return signal will be at different signals , the return signal can also be received continuously . the above methods lend themselves to the creation of small and simple to manufacture hand - held electronic devices that can be used without complication . one additional concern regarding devices designated for long term implantation in the human body is maintenance of electrical stability over time as the environment the sensor has been placed in changes . under this scenario the sensor &# 39 ; s accuracy may drift from its original baseline . it would thus be desirable to have available to the user of the device , a method for determining if the sensor is functioning properly and also to be able to recalibrate the device anytime after it has been implanted . this invention therefore also includes a method of using acoustic energy to challenge the sensor and determining to what degree ( if any ) sensor performance has been degraded . in this method , energy in the ultrasound range is directed towards the sensor and a measurement is made of the mechanical resonance of the sensor membrane . this same measurement can be made at point after the sensor has been implanted . by comparing the values of these two measurements a determination of the degree of change in mechanical resonance frequency can be established . this value can then be used to create a calibration factor that can be applied to the pressure reading taken post - implantation in order to adjust the measured value to reflect the actual pressure within the heart chamber . the preceding specific embodiments are illustrative of the practice of the invention . it is to be understood , however , that other expedients known to those skilled in the art or disclosed herein , may be employed without departing from the spirit of the invention of the scope of the appended claims .

US-88682904-A

a liquid soap dispensing system includes a closed soap container having a manually actuated dispensing pump carried therebeneath and being mounted on a bracket which has support fingers engageable with a lip on the container bottom for supporting it and a flexible retaining finger engageable with a groove in the top of the container for releasably holding it immovably against the bracket . a bottom wall extends from the bracket beneath the container and cooperates therewith to enclose the dispensing pump and is provided with an aperture to accommodate dispensing of soap therethrough . refill of the container is by a plastic refill squeeze - bottle with a neck closed by a membrane . the neck is inserted in a well in the top of the container , and a piercing member at the bottom of the well ruptures the membrane , whereupon soap may be squeezed from the bottle and through apertures in the well bottom , which apertures are too small to permit ready flow of soap therethrough by gravity at ambient pressure . seal flanges on the bottleneck engage the well sides to prevent soap from being squeezed up around the neck and out of the well . a latchable cover plate covers the container well and has formed therein an ashtray and cigarette holder .

referring now to fig1 through 5 of the drawings , there is illustrated a soap dispenser , generally designated by the numeral 100 , constructed in accordance with and embodying the features of the present invention . the soap dispenser 100 includes a mounting bracket , generally designated by the numeral 101 , which includes a generally flat rectangular wall 102 disposed substantially vertically in use to provide a bearing surface , and having along each of the side edges thereof an integral curved side flange 103 which projects forwardly from the wall 102 . formed in the vertical wall 102 and projecting rearwardly therefrom in a direction away from the direction in which the side flanges 103 extend , are two substantially vertically aligned generally frustoconical embossments 104 , each having an opening 105 extending therethrough centrally thereof . also formed in the wall 102 and projecting rearwardly therefrom are two part - spherical embossments 106 which are disposed substantially in horizontal alignment with each other along the line disposed substantially midway between the embossments 104 , with the embossments 106 projecting the same distance as the embossments 104 . also formed in the wall 102 adjacent to the upper edge thereof are two laterally spaced - apart substantially rectangular cutouts or openings 107 . the upper edges of the side flanges 103 join with the upper edge of the wall 102 to form a pair of shoulders 108 . integral with the wall 102 and extending laterally between the shoulders 108 is an extension flange 109 which is inclined forwardly in the same general direction as the side flanges 103 , and which is integral at the distal end thereof with an upwardly extending flange 110 which is substantially parallel to the wall 102 . the opposite side corners of the flange 110 are recessed to define two shoulders 111 , there also being provided through the flange 110 two rectangular cutouts 112 and a small circular centrally disposed opening 113 . punched from the wall 102 adjacent to the lower end thereof are two forwardly and upwardly extending support fingers 115 . integral with the bottom end of the wall 102 and extending forwardly therefrom substantially normal thereto is a wall 120 which is disposed substantially horizontally in use and is provided around the periphery thereof with an integral upturned flange 121 which is in turn integral with the side flanges 103 . integral with the wall 120 and projecting upwardly therefrom substantially normal thereto are two parallel and laterally spaced - apart pivot brackets 122 , the portion of the wall 120 between the pivot brackets 122 being cut out to define a generally rectangular opening 123 . formed in the wall 120 adjacent to the forward edge thereof and substantially midway between the side edges thereof is a circular soap discharge opening 125 , the purpose of the openings 123 and 125 being described more fully below . in use , the mounting bracket 101 is mounted on a wall 50 , generally above and closely adjacent to a sink or washbasin or the like . mounting openings or holes 51 are formed in the wall 50 and may have screw fastening inserts 52 set therein . the mounting bracket is fixedly secured to the wall 50 by means of mounting screws 55 which are passed through the openings 105 in the embossments 104 and threadedly engaged in the inserts 52 , the wall 102 being disposed substantially parallel to the surface 53 of the wall 50 , and being in contact therewith only at the embossments 104 and 106 , which serve to space the bracket 101 a slight distance from the surface 53 of the wall 50 . the dispenser 100 also includes a soap container or housing , generally designated by the numeral 130 , which is preferably formed of plastic . the container 130 is generally box - like in configuration and includes a generally rectangular front wall 131 , a pair of opposed side walls 132 , a rear wall 133 and a rectangular bottom wall 135 , the container 130 preferably being molded so that the walls 131 , 132 , 133 and 135 are all formed integrally with one another . the rear wall 133 is provided at the lateral side edges thereof with inturned forwardly inclined portions 134 , and is provided at the upper end thereof with two laterally spaced - apart rearwardly extending rectangular projections 137 . the side walls 132 have rearwardly extending portions 136 which project rearwardly beyond the rear wall 133 , whereby the rear wall 133 is recessed with respect to the side walls 132 . in addition , the rear wall 133 extends downwardly below the bottom wall 135 to form a downwardly extending portion or mounting flange 138 . similarly , the front wall 131 and side walls 132 all extend downwardly well below the bottom wall 135 and below the bottom edge of the mounting flange 138 . the walls of the container 130 cooperate to define therewithin a soap chamber , generally designated by the numeral 140 which , in use , is filled with liquid soap 141 to a predetermined level , such as 142 . formed in the bottom or outer surface of the bottom wall 135 are three cylindrical recesses 143 , positioned generally at the corners of an imaginary triangle disposed substantially centrally of the bottom wall 135 , the inner surface of the bottom wall 135 being provided with bosses 143a respectively above the recesses 143 . also formed in the inner surface of the bottom wall 135 is an elongated generally rectangular recess 144 which communicates with the space below the bottom wall 135 by a discharge conduit or opening 146 and by a supply conduit or opening 149 . the outer end of the discharge opening 146 is surrounded by a boss 146a . also extending through the bottom wall 135 substantially centrally thereof and adjacent to one end of the recess 144 is a suction conduit or opening 145 , the outer end of which is surrounded by a boss 145a . the recess 144 is covered with and closed by a filler plate 147 , so that the recess 144 does not communicate with the chamber 140 , but rather communicates only with the outside of the container 130 by means of the openings 146 and 149 . respectively captured in the recesses 143 are three nuts 148 , for a purpose to be described more fully below . mounted below the bottom wall 135 of the container 130 is a pump assembly , generally designated by the numeral 150 . the operation and construction of the pump assembly 150 is described in detail in my copending application ser . no . 620 , 179 , filed oct . 6 , 1975 and entitled &# 34 ; soap dispenser &# 34 ;, now u . s . pat . no . 4 , 018 , 363 , issued apr . 19 , 1977 , and assigned to the assignee of the present invention , the disclosure of which application is incorporated herein by reference . the pump assembly 150 includes an operating handle 151 provided with a pivot pin 152 , the opposite ends of which are respectively mounted in the pivot brackets 122 on the mounting bracket wall 120 for pivotal movement of the operating handle 151 about the axis of the pin 152 , which extends substantially horizontally above the bracket wall 120 substantially parallel thereto and to the bracket wall 102 . the handle 151 projects in use downwardly through the opening 123 in the bracket wall 120 and terminates at the lower end thereof in an enlarged gripping portion 153 . the handle 151 also includes a stop member 154 which projects rearwardly from the pin 152 above the housing wall 120 , and an actuating arm 155 which projects forwardly from the pin 152 above the bracket wall 120 and is substantially longer than the stop member 154 . the pump assembly 150 also includes a unitary pump housing 156 , which is preferably of molded construction . the pump housing 156 is provided with three apertures extending therethrough for respectively receiving three mounting screws 157 , which respectively threadedly engage the nuts 148 for fixedly securing the pump housing 156 to the bottom wall 135 of the soap container 130 . the pump housing 156 is provided with a delivery conduit 158 extending therethrough for communication with the discharge opening 146 in the container bottom wall 135 . the pump housing 156 is also provided with a large opening 159 extending therethrough generally centrally thereof for communication with both the suction opening 145 and the supply opening 149 in the container bottom wall 135 . the pump assembly 150 is also provided with an obturator diaphragm , generally designated by the numeral 160 , which is preferably formed of a flexible deformable material such as rubber or the like and , preferably , is substantially coextensive with the upper side of the pump housing 156 . the peripheral edge of the diaphragm 160 is received in an accompanying recess in the pump housing 156 , and the diaphragm 160 is securely sandwiched between the pump housing 156 and the container bottom wall 135 , the diaphragm 160 having suitable screw openings 161 therethrough for accommodating the mounting screws 157 . the diaphragm 160 has a plurality of suction apertures 162 therethrough in surrounding relationship with the suction opening 145 , and cooperating to define a central web portion which forms a suction obturator 164 disposed in use in contact with the boss 145a for closing the outer end of the suction opening 145 . similarly , the diaphragm 160 is provided with a plurality of discharge apertures 165 disposed in surrounding relationship with the supply opening 146 and cooperating to define a central web portion which forms a discharge obturator 167 disposed in use in engagement with the boss 146a for closing the discharge opening 146 . received in the opening 159 below the suction obturator 164 is a bowl 168 formed of flexible resilient material such as rubber , the bowl 168 being provided with a peripheral flange 169 which is fixedly secured to the pump housing 156 around the perimeter of the opening 159 for closing same . in operation , the soap container 130 is mounted on the mounting bracket 101 by resting the mounting flange 138 on the support fingers 115 ( see fig3 ), and the rear wall 133 of the container 130 is placed flush against the wall 102 of the mounting bracket 101 , with the rectangular projections 137 being respectively received snugly in the cutouts 107 in the bracket wall 102 , for positioning the container 130 and preventing movement thereof in directions parallel to the bracket wall 102 . when mounted in this position , the bracket wall 102 is received within the recess formed by the rearwardly extending portions 136 of the container side walls 132 so as to be substantially hidden from view , with the bottom of the flange 109 being at the level of the top edge of the container rear wall 133 . the bottom wall 120 of the mounting bracket 101 is recessed within the bottom portions of the container front wall 131 and side walls 132 , whereby the bracket bottom wall 120 is substantially concealed from view . furthermore , the bracket bottom wall 120 and the lower end of the bracket wall 102 cooperate with the container mounting flange 138 and with the bottom ends of the container walls 131 and 132 for completely enclosing the pump housing 156 , the opening 125 in the bracket bottom wall 120 being disposed immediately beneath the delivery conduit 158 of the pump housing 156 to permit delivery of liquid soap therethrough to a user . the container 130 is also provided with a top wall 170 which is fixedly secured to the upper ends of the container walls 131 , 132 and 133 for closing the upper end of the chamber 140 , the top wall 170 having angled corners 171 at the rear end thereof which are respectively substantially parallel with the inturned portions 134 of the rear wall 133 . formed in the upper surface of the top wall 170 adjacent to the rear edge thereof is a narrow groove or recess 172 . also formed in the top wall 170 is a deep cylindrical depending well , generally designated by the numeral 175 , which is provided with a generally cylindrical side wall 174 closed at the bottom end thereof by a circular bottom wall 176 . the inner surface of the side wall 174 has an upper substantially right circular cylindrical portion 178 and a lower downwardly and inwardly sloping frustoconical portion 177 , the portions 177 and 178 intersecting at a circular line 179 substantially midway between the upper and lower ends of the well 175 . integral with the bottom wall 176 of the well 175 and projecting upwardly therefrom substantially centrally thereof is a piercing member , generally designated by the numeral 180 , which comprises a cruciform arrangement of four flat blades or webs 181 , respectively provided with knife edges 182 along the upper edges thereof which are inclined upwardly and inwardly to intersect at a point 183 a slight distance above the level of the dividing line 179 . formed in the bottom wall 176 and disposed between adjacent ones of the blades 181 are four groups of refill perforations or apertures 184 which extend through the bottom wall 176 . it is a significant feature of the present invention that each of the refill apertures 184 has a cross sectional area such that liquid soap of the type to be dispensed from the dispenser 100 will not pass through the refill apertures 184 by gravity alone or , at best , will pass only very slowly therethrough . integral with the top wall 170 and projecting upwardly therefrom adjacent to the front corners thereof are two lugs or ears 185 , each being provided with an arcuate recess defining a retaining surface 186 in the forward edge thereof . pivotally secured to the inner surface of the upwardly extending flange 110 of the mounting bracket 101 , as by a rivet 188 extending through the opening 113 , is a small retaining plate 187 , preferably formed of steel or the like . the retaining plate 187 extends downwardly to a point adjacent to the bottom end of the inclined flange 109 . in use , when the container 130 is mounted on the mounting bracket 101 , after the mounting flange 138 has been set upon the support fingers 115 , as the container rear wall 133 is moved back against the bracket wall 102 , the retaining plate 107 is pivoted upwardly out of the way to permit the top wall 170 to pass thereunder , and then when the container rear wall 133 is against the bracket wall 102 the retaining plate 107 is pivoted back down into engagement with the recess 172 for cooperation with the support fingers 115 securely to hold the container 130 in place and prevent it from tipping forward . it will be understood that , when it is desired to demount the container 130 , the retaining plate 187 is pivoted back up to disengage it from the recess 172 and permit removal of the container 130 . thus , the container 130 can be readily mounted on and demounted from the mounting bracket 101 without having to handle any screws or other fasteners , and without the necessity of using any tools whatsoever . the dispenser 100 is also provided with a cover plate , generally designated by the numeral 190 , which includes a top wall 191 , a front wall 192 , a pair of opposed side walls 193 and a rear wall 194 , all integrally connected in a unitary structure . formed in the top wall 191 is a large bowl - like recess which serves as an ashtray 195 substantially centrally of the cover plate 190 , the top wall 191 also having formed therein between the ashtray 195 and the front wall 192 a plurality of flutes 196 to serve as cigarette holders . fixedly secured to the inner surface of the front wall 192 adjacent to the opposite side edges thereof are two projections 197 which are respectively adapted to be received in the arcuate recesses for engagement with the retaining surfaces 186 of the lugs 185 on the container 130 . the cover plate 190 is dimensioned so as to completely cover the top wall 170 of the container 130 , with the walls 192 through 194 having a depth sufficient to accommodate the inclined flange 109 and the upwardly extending flange 110 of the mounting bracket 101 . in use , the projections 197 are inserted in the arcuate recesses 186 of the lugs 185 , and the cover plate 190 is then pivoted down into position completely covering the top of the container 130 , as illustrated in fig3 . preferably , the cover plate 190 is provided with a lock mechanism 198 which may be provided with atch fingers 196 adapted to extend through the apertures 112 in the mounting bracket flange 110 , whereby the engagement of the latch fingers 196 with the bracket flange 110 and the engagement of the projections 197 with the lugs 185 cooperate securely to lock the cover plate 190 in place . it will be seen that when thus positioned on the container 130 , the outer surfaces of the walls 192 through 194 are respectively substantially flush with the outer surfaces of the container walls 131 and 132 and the mounting bracket wall 101 to present substantially smooth uninterrupted outer surfaces for the dispenser 100 , resulting in a clean , stylish appearance . in operation , when a user wishes to dispense soap from the dispenser 100 , he pulls the handle 151 forwardly , in the direction of the arrow in fig3 which brings the actuating arm 155 into engagement with the bowl 168 and compresses it to force the liquid soap contained therein upwardly through the supply opening 149 and the recess 144 and outwardly through the discharge opening 146 , the pressure caused by compression of the bowl 168 forcing the discharge obturator 167 away from the boss 146a to allow the liquid soap to flow from the discharge opening 146 into the pump housing 158 and thence outwardly through the delivery conduit 158 and the mounting bracket opening 125 to the hands of the user . the compression of the bowl 168 also serves to force the suction obturator 164 more tightly against the boss 145a to prevent further liquid soap from passing through the suction opening 145 into the bowl 168 . the movement of the actuating arm 155 is limited by engagement of the stop member 154 with the mounting bracket bottom wall 120 . when the handle 151 is released , the weight of the actuating arm 155 pivots the handle 151 in a clockwise direction back to its original rest position , illustrated in solid line in fig3 . this clockwise movement of the handle 151 is further facilitated by the resilience of the flexible bowl 168 , which tends to return to its normal position illustrated in fig3 pushing the actuating arm 155 along with it . this return of the bowl 168 to its initial position exerts an aspirating or suction force on the diaphragm 160 , which serves to pull the discharge obturator 167 back up into engagement with the boss 146a to close the discharge opening 146 , while at the same time pulling the suction obturator 164 away from the boss 145a to open the suction opening 145 and allow a new charge of liquid soap to flow from the chamber 140 through the suction opening 145 into the bowl 168 , thereby restoring the initial conditions in which the dispenser 100 is again ready for dispensing of another charge of liquid soap . it is a significant feature of the present invention that the only portion of the pump assembly 150 which is accessible to a user is the handle 151 , the remainder of the pump assembly 150 being completely enclosed by the container 130 and the mounting bracket 101 . this not only enhances the appearance of the dispenser 100 , but also serves to prevent a user from physically contacting the pump housing 156 and clogging the delivery conduit 158 thereof . in like manner , the cover plate 190 serves to enclose and protect the refill apertures 184 to prevent clogging thereof and to prevent contamination of the soap supply in the chamber 140 . it will be understood that the cover plate 190 also serves to provide a convenient holder for a user &# 39 ; s cigarette or other smoking material while he is washing his hands . referring now also to fig6 through 13 of the drawings , there is illustrated a refill cartridge or bottle , generally designated by the numeral 200 , for use with the dispenser 100 to provide a complete liquid soap dispensing system . the refill bottle 200 is preferably in the form of a soft plastic squeeze - bottle and is adapted to hold a refill or supply of liquid soap for refilling the soap container 130 of the dispenser 100 . the refill bottle 200 includes an elongated right circular cylindrical side wall 201 closed at one end thereof by a circular bottom wall 202 , and having integrally connected thereto at the other end thereof an inwardly sloping frustoconical top wall 203 which terminates in a flat annular flange 204 . integral with the annular flange 204 at the inner edge thereof and extending therefrom coaxially with the cylindrical side wall 201 is a short cylindrical shoulder 205 which is substantially thicker and more rigid than the walls 201 through 203 . integral with the shoulder 205 at the distal end thereof is a radially inwardly extending annular flange 206 which is integral at the inner edge thereof with an elongated cylindrical neck 207 coaxial with the side wall 201 , but being relatively thick - walled and substantially rigid , the neck 207 defining a cylindrical discharge passage 208 communicating with the interior of the refill bottle 200 . integral with the outer surface of the neck 207 and extending radially outwardly therefrom is a first annular rib or flange 210 and a plurality of second annular ribs or flanges 212 . the first flange 210 is disposed closely adjacent to the distal end of the neck 207 , and is spaced from the nearest one of the second flanges 212 by a first space 211 extending axially of the neck 207 a relatively long first predetermined distance . the second flanges 212 are equidistantly spaced apart from one another by second predetermined spaces 213 , each of which has an axial extent substantially less than that of the space 211 . adhesively secured to the neck 207 at the distal end thereof and closing the discharge passage 208 is a relatively thin circular membrane 215 impermeable to the liquid soap and which is secured across the distal end of the neck 207 after the refill bottle 200 is filled with liquid soap to prevent the soap from escaping from the refill bottle 200 . when it is desired to refill the soap container 130 of the dispenser 100 , the cover plate 190 is unlocked and removed to expose the refill well 175 . the neck 207 of the refill bottle 200 is then inserted into the well 175 of the soap container 130 , as best illustrated in fig1 and 13 . in this regard , it will be noted that the maximum outer diameter of the flanges 210 and 212 are substantially equal to the diameter of the cylindrical inner surface portion 177 of the well side wall 174 so as to be disposed in frictional engagement therewith as the neck 207 is inserted into the well 175 . as the flange 210 and the first of the flanges 212 come into contact with the inwardly sloping frustoconical portion 178 of the inner surface of the well side wall 174 , the frictional interference therebetween become greater . however , the flanges 210 and 212 , while being relatively rigid , are sufficiently flexible and resilient to permit insertion of the neck 207 all the way into the well 205 until the distal end of the neck 207 contacts the bottom wall 176 of the well 175 . it will be noted that the neck 207 is of such a length that , when the membrane 215 is in engagement with the bottom wall 176 of the well 175 , the shoulder 205 is in engagement with the upper surface of the container top wall 170 around the periphery of the well 175 . as the neck 207 is inserted into the well 175 , the point 181 of the piercing member 180 pierces and ruptures the membrane 215 closing the neck 207 of the injection bottle 200 , the piercing member 180 having a maximum outer diameter such that it is received into the discharge passage 208 of the neck 207 . when the membrane 215 is thus ruptured , the liquid soap within the injection bottle 200 is permitted to flow therethrough around the piercing member 180 and to the refill apertures 184 . as was indicated above , the liquid soap will not flow through the apertures 184 by gravity . thus , in order to inject the liquid soap through the refill apertures 184 and into the chamber 140 , the refill bottle is squeezed , thereby applying greater than ambient pressure to the liquid soap therein and forcing it through the refill apertures 184 . by reason of the interference fit between the inner surface of the well side wall 174 and the flanges 210 and 212 of the refill bottle neck 207 , these members cooperate to form a substantially fluid - tight seal which prevents the liquid soap from flowing outwardly around the neck 207 and out of the well 175 . when the refill bottle 200 has been emptied , it is removed from the well 175 and the cover plate 190 is locked back in place . thus , it will be appreciated that by reason of this unique refill arrangement , the soap container 130 may not be refilled except by the use of the special refill bottle 200 which is designed to uniquely cooperate with the well 175 . this will effectively prevent a user of the dispenser 100 from using therein any soap other than that provided by the supplier of the dispenser 100 . it will be noted that the piercing member 180 extends only a very slight distance above the frustoconical inner wall portion 178 of the well side wall 174 . thus , when the neck 207 has been inserted into the well 175 a sufficient distance for the piercing member 180 to pierce the membrane 215 , the first annular flange 210 of the neck 207 will already be coming into engagement with the frustoconical portion 178 of the inner surface of the well side wall 174 to form an effective fluid - tight seal . thus , while normally the neck 207 will be inserted into the well 175 in one quick continuous motion , even if the neck 207 should be momentarily stopped in a position half way down the well 175 , there will be no leakage of liquid soap from the well 175 . in a constructional model of the dispenser 100 , the mounting bracket 101 , the pump housing 156 ; and the cover plate 190 are all preferably formed of metal , the soap container 130 is preferably formed of transparent plastic , the diaphragm 160 and bowl 168 are preferably formed of rubber , while the injection bottle 200 is preferably formed of a translucent plastic material and the membrane 215 is preferably formed of aluminum foil . however , it will be appreciated that any other suitable materials may be used in the construction of the liquid soap dispensing system of the present invention . from the foregoing , it can be seen that there has been provided an improved liquid soap dispenser which can be readily mounted on and demounted from a wall bracket without the use of tools . there has also been provided a dispenser of the character described wherein the dispensing pump mechanism and the refill apertures are completely enclosed so as to be protected and hidden from view . in addition , there has been provided a unique liquid soap dispensing system which effectively prevents the use of unauthorized liquid soap for refilling the dispenser . while there have been described what are at present considered to be the preferred embodiments of the invention , it will be understood that various modifications may be made therein , and it is intended to cover in the appended claims all such modifications as fall within the true spirit and scope of the invention .

US-85146777-A

the present invention describes a novel treatment for neuropsychiatric disorders , including anxiety disorders , mood disorders , psychotic disorders , somatoform disorders , and neuropsychiatric symptoms resulting from movement disorders . the treatment of the present invention utilizes any agent that simultaneously act as nmda - type glutamate receptor antagonists and gaba - a receptor agonists . preferably these two activities are characteristic of a single agent , for example acamprosate . alternatively , separate agents having these activities can be combined as a compound or mixture and thereby administered together . the invention also provides for a third agent that acts as a non - competitive nmda - receptor blocking agent or ion channel blocker , that augments the effect of the primary treatment . a particularly preferred ion channel blocking agent is magnesium .

the present invention relates to treatment of any neuropsychiatric disorder ( e . g . any anxiety disorder , any psychotic disorder , any mood disorder or any somatoform disorder ) in which a major symptom is the occurrence of repetitive unwanted , intrusive or involuntary stereotyped thoughts , perceptions or behaviors . in particular , the present invention provides treatments for neuropsychiatric disorders including ptsd , ocd , and somatoform disorders , and treatment for such repetitive thoughts , perceptions , and behaviors when they occur as symptoms of other disorders including for example schizophrenia , major depression , and bipolar disorder . in one aspect of the present invention , i have discovered that an agent used for the treatment of abstinent alcoholics , and more recently for the treatment of movement disorders , ( see pending u . s . patent application , ser . no . 09 / 006 , 641 ), and not contemplated for use in treatment of neuropsychiatric disorders is effective in reducing symptoms associated with neuropsychiatric disorders . several years ago , i hypothesized that tardive dyskinesia , other neuroleptic - induced movement disorders , and spontaneous movement disorders that resemble them , represent a form of non - linear oscillation in neural circuits involving the basal ganglia , and that oscillation might be reduced by agents that block excitatory neurotransmission . pet scan studies have demonstrated increased metabolism in the globus pallidus and primary motor cortex in schizophrenic patients with td , but not in those without td ( pahl et al ., j neuropsych clin neurosci 7 : 457 , 1995 ). this suggests that td is associated with hyperactivity in a motor control circuit , which functions as a nonlinear oscillator . as noted above , i advanced the hypothesis that agents that act to reduce the gain in a motor control circuit through the striatum , can have a beneficial action on td and related movement disorders ( e . g ., tourette &# 39 ; s syndrome and tics ). gaba is an inhibitory neurotransmitter in the striatum . support for my hypothesis comes from animal evidence indicating that agents that directly or indirectly stimulate gaba receptors can decrease neuroleptic - induced dyskinesias ( gao et al . j neural transmission 95 : 63 , 1993 ; stoessl , pharmacol . biochem . behav ., 54 : 541 , 1996 ). rats with neuroleptic - induced dyskinesia demonstrate decreased striatal levels of glutamic acid decarboxylase , the rate - limiting enzyme in the production of gaba ( delfs et al ., exp . neurol ., 133 : 175 , 1995 ). i proposed , without limiting the biochemical mechanism of the invention , that drugs acting to reduce the gain in the hypothesized oscillator circuit would reduce the involuntary movements of tardive dyskinesia . gaba , glutamate , and dopamine are the principal neurotransmitters in the circuit . other neurotransmitters , including norepinephrine , serotonin , acetylcholine and endogenous opiates are hypothesized to have indirect actions on the oscillator circuit . in my co - pending patent applications , ser . nos . 08 / 861 , 801 and 09 / 193 , 892 , the teachings of which are incorporated herein by reference , i disclosed that certain antagonists of excitatory neurotransmitters are effective in treating both the movement and cognitive disorders associated with td , tardive dystonia , and related movement disorders . in the present application , i propose in a non - limiting fashion that antagonist - type drugs that act to reduce the gain in the oscillator circuit can be used to treat a wide variety of neuropsychiatric disorders that fall under a broad range of classifications . support for this hypothesis is set forth below . there are noteworthy similarities between ptsd and tics . like ptsd , tics involves the repetitive involuntary , stereotyped phenomena — thoughts and images in the case of ptsd and simple non - purposeful movements in the case of tics . in both cases , neocortical representations are activated by striatal or limbic input . tics can be temporarily suppressed with conscious effort . however , when the effort stops or when tics break through despite an effort at suppression , there often is a rebound in frequency or intensity . a similar phenomenon has been demonstrated with intrusive imagery in an experimental model of ptsd phenomena - recall by subjects of images from a distressing film ( davies m i ; clark d m : thought suppression produces a rebound effect with analogue post - traumatic intrusions . behav res ther , 36 : 571 - 82 , june 1998 ). there is also a strong association of ocd with movement disorders . ocd is associated with gilles de la tourette syndrome ( tourette syndrome , ts ), as well as with several other basal ganglia diseases including sydenham &# 39 ; s chorea and huntington &# 39 ; s disease . there is strong evidence of a link between ocd and motor tics . while estimates of the occurrence of ocd in patients with ts vary from 5 % to over 50 %, all estimates are significantly higher than the prevalence of ocd in the general population . shared clinical features between ocd and ts include “ waxing and waning of symptoms , early age at onset , ego - dystonic behavior ( i . e ., behavior contrary to an individuals conscious preferences ), worsening with depression and anxiety , and their occurrence in the same families ” ( robertson and yakely , supra ). genetic studies suggest that in some families , there is a single autosomal dominant gene that can be expressed phenotypically as ts , ocd , or both . ts is most often treated with dopamine antagonists and ocd with serotonin reuptake inhibitors ( sris ). however , the addition of dopamine antagonists can augment the therapeutic efficacy of sris in ocd , and the addition of ssris can augment the efficacy of dopamine antagonists in ts . all of these considerations support the idea that there are overlapping physiologic mechanisms for ocd and ts . both tics and ocd can be produced by the cns effects of an autoimmune reaction to infection with group a beta - hemolytic streptococcus — the pandas syndrome — pediatric autoimmune disorders associated with streptococcus . ( swedo s e , et al : pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections : clinical description of the first 50 cases . am j psychiatry , 155 : 264 - 71 , february 1998 ). similarly , traumatic brain injury can lead to the simultaneous new onset of tics and ocd symptoms ( krauss j k ; jankovic j : tics secondary to craniocerebral trauma . mov disord , 12 : 776 - 82 , september 1997 ). ocd symptoms were compared between patients with blepharospasm , a focal dystonia caused by basal ganglia dysfunction , and hemifacial spasm , a syndrome with superficially similar symptoms but due to peripheral nerve dysfunction . the blepharospasm patients had significantly more ocd symptoms on a symptom check list ( broocks , et al . : higher prevalence of obsessive - compulsive symptoms in patients with blepharospasm than in patients with hemifacial spasm . am j psychiatry , 155 : 555 - 7 , april 1998 ). ocd is not only associated with ts , but obsessive - compulsive phenomena share common clinical features with tics . both involve repetitive , stereotyped , involuntary phenomena . in the case of ocd , these are thoughts or purposeful motor sequences ( compulsive rituals ); in the case of tics they are simpler , non - purposeful movements . both involve activation of neocortical representations by limbic or striatal inputs . as noted above , there are clinical and physiological similarities between tics , the obsessions and rituals of ocd , and the intrusive thoughts and images of ptsd . although , the pathophysiologic , epidemiological and clinical association of tics and ocd is somewhat stronger than that of ptsd with tics , both ptsd and ocd can be correlated with tics . therefore , i reasoned that treatments helpful for tics would be helpful for intrusive phenomena in ptsd , and that if they were helpful in ptsd , they would also be helpful for the obsessions and compulsions of ocd . a link between movement disorders and somatoform disorders can be made through the correlation between somatoform disorders , ptsd and ocd . a few relevant studies are as follows : 1 ) rogers et al . studied the prevalence of somatoform disorders in a sample of 654 patients with anxiety disorders . thirty - six ( 5 . 5 %) of the subjects had past or current somatoform disorders . the subjects with somatoform disorders were significantly more likely to have histories of posttraumatic stress disorder ( 22 % vs . 8 %) ( rogers m r , et al . : prevalence of somatoform disorders in a large sample of patients with anxiety disorders . psychosomatics , 37 ( 1 ): 17 - 22 january - february 1996 ). 2 ) women with chronic pelvic pain not explained by a thorough gynecological evaluation were compared with controls who were either pain - free , or had pain in some other area of the body . the women with chronic pelvic pain had a much higher rate of past sexual abuse than those in either of the other two groups ( collett b j , et al . : a comparative study of women with chronic pelvic pain , chronic nonpelvic pain and those with no history of pain attending general practitioners . br j obstet gynaecol , 105 ( 1 ): 87 - 92 january 1998 ). 3 ) a study of 45 patients with pseudoseizures ( non - epileptic seizures ), with the pseudoseizure diagnosis confirmed by simultaneous video and eeg recording , revealed a 49 % prevalence of posttraumatic stress disorder ( bowman e s ; markand o n : psychodynamics and psychiatric diagnoses of pseudoseizure subjects . am j psychiatry , 153 ( 1 ): 57 - 63 january 1996 ). 4 ) a study of 442 patients with ocd revealed that 12 % had a concurrent diagnosis of body dysmorphic disorder . the authors concluded that the two disorders are “ strongly related ” ( simeon d , et al . : body dysmorphic disorder in the dsm - iv field trial for obsessive - compulsive disorder . am j psychiatry , 152 ( 8 ): 1207 - 9 august 1995 ). as noted above , subsequent studies have shown that sris , the mainstay of treatment for ocd , are efficacious in the treatment of body dysmorphic disorder . 5 ) women with chronic pelvic pain unexplained by a gynecologic evaluation show the same abnormality of hypothalamic - pituitary - adrenal regulation as seen in women with ptsd . compared with normal controls , in both cases the adrenal produces less cortisol in response to acth , and cortisol suppresses more with a low dose of dexamethasone ( heim c et al .,. : abuse - related posttraumatic stress disorder and alternations of the hypothalamic - pituitary - adrenal axis in women with chronic pelvic pain . psychosom med . 60 ( 3 ): 309 - 318 may - june 1998 ). 6 ) a study of 256 college students demonstrated a positive correlation between self - reported nervous habits and tics , their awareness of bodily sensations , and their level of anxiety . ( woods d w , et al . : habits , tics , and stuttering . prevalence and relation to anxiety and somatic awareness . behav modif , 20 ( 2 ): 216 - 25 april 1996 ) while the direction of causality is not clear , the association is compatible with the idea that a common underlying physiological disturbance may predispose individuals to both tics and amplification of somatic symptoms . taken together , studies like these suggest that trauma can lead both to ptsd and to various somatoform disorders , and often to a combination of the two . there is an overlap in symptoms between hypochrondriasis , body dysmorphic disorder , and ocd ( specifically with obsessions ). similarly , there is an overlap in symptoms between tics and ocd ( specifically with compulsions ). individuals with hypochrondriasis or body dysmorphic disorder have obsessional thoughts about illness : or about their appearance . the symptoms of tics resemble simple compulsions . in all of these conditions there are recurrent , stereotyped , unwanted , intrusive or involuntary thoughts , perceptions , or behaviors . moreover , all are associated with increased anxiety . these features suggest overlapping pathophysiology of the several conditions . the overlap in symptoms and mechanisms among the different disorders suggests that a treatment effective for ptsd , tics , and ocd would also be beneficial for somatoform disorders . based on the physiology of pain transmission and modulation one would expect somatic pain to respond to a drug with combined gaba - a agonist and nmda - glutamate antagonist properties , if the dosage of the drug were sufficient ( canavero s ; bonicalzi v : supra ). however , somatization phenomena , with their similarities to ptsd , ocd , and tics , and with their putative generation by reverberating neural loops , might respond to dosages of such a drug that would not be enough to significantly affect somatic pain transmission . in fact , the 5 patients i personally treat with acamprosate for movement disorders all have had intercurrent illnesses with pain as a symptom . none have reported analgesic effects from the dosage of acamprosate ( 333 to 666 mg ) that they take several times a day for their movement disorder . based on the considerations above , i submit that drugs with combined gaba - a agonist and nmda - glutamate antagonist effects in appropriate proportion , will relieve symptoms of somatoform disorders at non - toxic dosages , and at dosages not necessarily associated with general analgesia . of course , the effect of these drugs on symptoms other than pain is not implied at all by the animal experiments on gaba , glutamate , and spinal pain transmission . based on this experience and the above reasoning , i administered acamprosate to a patient with ptsd ( see case report 1 ). the patient enjoyed significant relief of ptsd symptoms , in a dose - related manner , without side effects . the response of ptsd symptoms was not due to a non - specific alteration of mood or anxiety level . in fact , the patient experienced relief of flashbacks , traumatic memories and emotional numbing on days when she felt depressed or anxious . improvements were experienced in the areas of the frequency of flashbacks , intrusive thoughts about traumatic events , and psychic numbing . moreover , the patient was capable of talking more freely about traumatic events and showed a reduction in self - injurious behavior and the severity of her startle response . in a previous and co - pending continuation - in part patent application , ser . no . 09 / 193 , 892 , i demonstrated that acamprosate , a combined gaba - a agonist / nmda - glutamate antagonist had marked benefit in the treatment of tics . that benefit was enhanced by the addition of magnesium . the benefit of treatment with acamprosate was also improved by addition of an nmda - glutamate antagonist ( for example memantine ). in another aspect , benefit of treatment with acamprosate could be improved by co - administration of another gaba - a agonist . one of ordinary skill in the art will recognize that magnesium , an nmda antagonist or a gaba - a agonist can be combined not only with acamprosate , but with any agent ( or combination of agents ) that has both nmda antagonist activity or gaba agonist activity . when treating movement disorders , i also observed that the synergy of gaba - a actions and nmda actions enabled the acamprosate , with or without magnesium , to provide significant therapeutic actions at non - toxic dosages . moreover , this synergy of effect was observed in the absence of a corresponding synergy of toxicity . i propose , by extension , that this synergy of beneficial effects without synergy of toxicity should occur with the combined use of gaba - a agonists and nmda - glutamate antagonists to treat neuropsychiatric disorders . in the current invention , i disclose that acamprosate , a gaba - receptor agonist that also diminishes the postsynaptic response of nmda - type receptors to glutamate can reduce or ameliorate symptoms associated with ptsd , ocd , somatoform disorders ( somatization disorder , conversion disorder , hypochondriasis , and body dysmorphic disorder ), and other neuropsychiatric disorders including depression , mania , and schizophrenia , when these disorders have symptoms involving repetitive stereotyped thoughts , perceptions , and behaviors . an important example is major depression , which frequently is associated with repetitive rumination on guilty or pessimistic themes . alternatively , acamprosate and related compounds can be used to treat symptoms , for example repetitive , unwanted involuntary or intrusive , stereotyped thoughts , perceptions or behaviors that are associated with a movement disorder . some examples of movement disorders that might display such symptoms include tourette &# 39 ; s syndrome , focal dystonia , huntington &# 39 ; s disease , parkinson &# 39 ; s disease , sydenham &# 39 ; s chorea , systemic lupus erythematosus , and drug - induced movement disorders . according to the theory of the present invention , a gaba - a agonist with concurrent antagonist effects on nmda - type glutamate transmission reduces the severity of symptoms associated with neuropsychiatric disorders , including ptsd and by extension ocd and somatoform disorders . in addition , i propose that acamprosate and other agents that both ( i ) decrease nmda - type glutamate neurotransmission , and ( ii ) increase gaba - a receptor neurotransmission are useful in the treatment of ptsd , ocd , somatoform disorder and other neuropsychiatric disorders . the class of drugs that have simultaneous , synergistic gaba - a agonism and nmda antagonism at non - toxic dosages represent a major new class of therapeutic agents for neuropsychiatric disorders . i assert the novelty of the conception of these drugs as a ‘ breakthrough ’ in psychopharmacology . the principle advanced is that many important neuropsychiatric disorders involve the abnormal activity of polysynaptic neural loops through the cortex , striatum , and thalamus . abnormal activity of these loops produce recurrent , stereotyped , and unwanted , intrusive , or involuntary thoughts , perceptions , and behaviors . limbic structures such as the amygdala and anterior cingulate region are part of these circuits , or influence them . synapses with gaba or glutamate as their principal transmitters , are part of these circuits . or , gaba and glutamate modulate traffic at two or more synapses in these circuits . an excess or deficiency in gaba in the limbic system or basal ganglia , can contribute to a neuropsychiatric disorder . because gaba - a agonism — increasing an inhibitory influence — is combined with nmda antagonism — decreasing an excitatory influence — the gain in the circuit is diminished at two or more synapses , leading to a substantial decrease in activity in the circuit as a whole . normal neural traffic not involving recurrent activity in these cortical - striatal - thalamic circuits is affected to a lesser degree than is the activity responsible for symptom production . this is true because normal traffic is not influenced at as many synapses . in addition , some of the drugs encompassed by this application may not reduce normal activity at individual synapses as much as they reduce excessive activity . the invention disclosed here has a broad scope , comprising the use of drugs with a particular combination of actions for a specific therapeutic purpose . it is obvious to one skilled in the art that a variety of different compounds and delivery systems can be employed to embody the invention . agents can be synthesized with two active moieties , one an nmda antagonist and the other a gaba - a agonist . or , agents with the desired combination of pharmacodynamic properties can be modified to improve their absorption , pharmacokinetics , or ability to cross the blood - brain barrier . agents can be delivered by a variety of delivery systems , to improve reliability of absorption or convenience of administration . acamprosate ( calcium n - acetylhomotaurinate ) is the calcium salt of n - acetylhomotaurine , a derivative of the amino acid taurine . ( taurine is aminoethanesulfonic acid . homotaurine is aminopropanesulfonic acid . acetylhomotaurine is n - acetylaminopropanesulfonic acid .) it is used clinically in the treatment of abstinent alcoholics to reduce or inhibit their craving for alcohol . acamprosate , which is chemically similar to the inhibitory neurotransmitter gaba , is a gaba agonist , particularly at gaba - a receptors . moreover , it reduces the postsynaptic response of nmda - type glutamate receptors and reduces calcium influxes through voltage - operated channels . ( wilde & amp ; wagstaff , drugs , 53 : 1039 - 53 , 1997 ). acamprosate , because of its low toxicity , is a particularly attractive drug for use in treating patients that experience intolerable side effects when treated with the medications presently available for neuropsychiatric disorders . in controlled trials for alcoholism treatment involving 3 , 338 patients , acamprosate had no severe medical or neurological side effects . indeed , the rate of subject dropout was identical in the group receiving acamprosate treatment and in the group receiving a placebo ( wilde and wagstaff , drugs , june , 53 ( 6 ): 1038 - 53 , 1996 ). many patients experience intolerable side effects from the sris , which currently are the standard treatment for acamprosate can be used either as a substitute for sris , or to augment the efficacy of sris and permit the use of lower , better - tolerated dosages . the above hypothesis regarding a motor control circuit involving gaba ( via gaba - a receptors ) and glutamate ( via nmda receptors ) implies that any drug that is a gaba - a agonist and an nmda - type glutamate antagonist can ameliorate neuropsychiatric disorders . acamprosate ( calcium n - acetylhomotaurinate ) is a specific example of such a drug for which i offer direct evidence in humans of efficacy in the treatment of ptsd . other examples of such drugs include other salts of n - acetylhomotaurine , and those derivatives of homotaurine and acetylhomotaurine that have similar effects on gaba - a and nmda - type glutamate transmission , and pro - drugs that are metabolized in the liver , blood , or brain to yield n - acetylhomotaurinate or related compounds with similar pharmacodynamic properties . accordingly , a preferred embodiment of the present invention provides derivatives of homotaurine and n - acetylhomotaurine at effective and non - toxic doses to a patient for treatment of neuropsychiatric disorders . particularly preferred are derivatives of acamprosate that are readily absorbed from the gastrointestinal tract . acamprosate is irregularly absorbed from the gi tract , in part due to the polar , hydrophilic character of the acetylhomotaurinate ion . it is well known in the art that certain derivatives of drugs may be absorbed better and more reliably because they are more lipophilic . for example , esters prepared from the acetylhomotaurinate ion would be more lipophilic , and therefore would have greater and more predictable absorption through the membranes of the intestinal mucosa . if such an ester were nontoxic and naturally metabolized in the body , for example , cleaved by enzymes in the blood , liver or the brain , it would be particularly preferred as a vehicle for reliably delivering the acetylhomotaurinate ion to the brain . furthermore , such derivatives as described above would have , in appropriate dosages , equal or greater efficacy in treating any neuropsychiatric disorder responsive to acamprosate . alternatively , the drug may be covalently attached to a lipophilic molecule for better absorption . generally , any pro - drug with improved delivery of acamprosate would also be a preferred means of delivery according to the present invention . a particularly preferred form of acamprosate would be a derivative of acamprosate with a long half - life . such a derivative of acamprosate would be clinically superior to acamprosate , because it could be taken once daily , rather than three or four times per day , as is necessary when acamprosate is used . an additional approach to lengthening the half - life of acamprosate or a related medication is to deliver it in a time - release capsule . in another preferred embodiment , a pharmaceutical agent is selected from the group of agents that act as gaba - receptor agonists and also act to decrease nmda receptor function by an indirect or modulatory mechanism such as , in a non - limiting fashion , acamprosate calcium ( calcium n - acetylhomotaurinate ), other salts of n - acetylhomotaurinate ( e . g ., magnesium n - acetylhomotaurinate or lithium n - acetylhomotaurinate ), acetylhomotaurine base , other homotaurine derivatives that have similar pharmacodynamic actions on gaba and glutamate transmission , and pro - drugs that are metabolized in the liver , blood , or brain to yield n - acetylhomotaurinate or related compounds with similar pharmacodynamic actions on gaba and glutamate transmission . in another preferred embodiment , a pharmaceutical agent is selected from the group of agents that have the ability to reduce glutamate - produced excitatory post - synaptic potentials in striatal cells , including acamprosate and the range of similar compounds and pro - drugs described previously . in other preferred embodiments , a combination of two or more pharmaceutical agents is selected such that the combination acts concurrently to augment gaba transmission ( particularly via gaba - a receptors ) and to attenuate nmda - type glutamate transmission ( e . g ., by non - competitive inhibition , or by indirect or modulatory effects on nmda receptors ). a fourth embodiment is to combine such a compound or mixture of compounds with memantine or a similar non - competitive nmda - receptor blocking agent described in detail below . the combinations may be either mixtures , covalently - bound moieties with combined action , or pro - drugs metabolized in the blood , liver , or brain to release each member of the combination . magnesium ion , which blocks calcium channels , is known to be an nmda - glutamate receptor antagonist . if a magnesium salt or chelate is given together with another nmda antagonist , the action of the latter is enhanced . in particular , the present invention sets forth that supplementation with magnesium can augment the action of acamprosate in treatment of a neuropsychiatric disorder . an efficacious drug treatment might not only treat ptsd , but might prevent it if given soon after stress . trauma victims may be identified prospectively who are at particularly high risk for developing ptsd . these include those with a history of prior trauma in childhood , as well as those with acute stress reactions . for example , a rape victim might be at risk for developing ptsd and could be administered an effective dose of acamprosate in order to prevent the development of ptsd . in another embodiment , magnesium supplementation is used in conjunction with a gaba - a agonist to may delay the onset of ptsd in a person at risk , or the onset of another neuropsychiatric disorder in a person identified as being at risk for it . in yet another embodiment , supplementation with magnesium will reduce the symptoms associated with various neuropsychiatric disorders . the present invention teaches the use of a combined nmda antagonist - gaba agonist strategy with or without magnesium administration for treating and preventing neuropsychiatric disorders . according to the present invention magnesium supplementation will augment the therapeutic effects of other nmda - type receptor antagonists and down - regulators ( see case report 5 ). in one preferred embodiment , magnesium is administered with acamprosate ( calcium n - acetylhomotaurine ) to treat neuropsychiatric disorders . in a particularly preferred embodiment , the magnesium salt of n - acetylhomotaurine and the magnesium salts of those derivatives of n - acetylhomotaurine that similarly enhance gaba transmission and diminish nmda - glutamate neurotransmission , are effective treatments for neuropsychiatric disorders . it will be recognized by those skilled in the art that for all conditions for which calcium n - acetylhomotaurinate is an effective treatment , magnesium n - acetylhomotaurinate , and the magnesium salts of those derivatives of n - acetylhomotaurine that have similar effects on gaba neurotransmission and nmda - glutamate neurotransmission , will also be effective treatments . one specific instance of such a compound is one that has two active moieties , one that is a gaba - a agonist and another that is an nmda antagonist . in the body , the compound may either remain intact , or may be metabolized into two compounds , one with gaba - a agonist activity and the other with nmda antagonist activity . alternatively , any magnesium salt or chelate may be administered with any salt of a derivative of homotaurine or n - acetylhomotaurine that has both nmda antagonist and gaba - a agonist activity , to treat neuropsychiatric disorders . in one non - limiting example , a pill containing the appropriate dose of acamprosate together with the appropriate dose of magnesium may be formulated and administered to a patient with a neuropsychiatric disorder . in other preferred embodiments , an agent that has nmda antagonist activity and gaba agonist activity is combined with the appropriate dose of magnesium in a pill . in yet another preferred embodiment , an nmda antagonist is combined with a gaba agonist at an appropriate dose of magnesium in the form of a pill . one of ordinary skill in the art will recognize that the composition of administration is not limited to a pill , but can also be a syrup , an elixir , a liquid , a tablet , a time - release capsule , an aerosol or a transdermal patch . the ratio of acamprosate to magnesium can be varied to optimize the therapeutic synergy of the two ingredients . i propose that the effective dose ranges will be similar for treatment of neuropsychiatric disorders as movement disorders , but some variation may exist and dose ranges may be determined experimentally by those having ordinary skill in the art . magnesium n - aceytlhomotaurinate ( durlach , supra ; 1980 ), with a magnesium : acetylhomotaurinate ratio of approximately 1 : 20 by weight , does not optimize the therapeutic effect of the two components for treatment of movement disorders ( see u . s . patent applications ser . nos . 09 / 006 , 641 and 09 / 193 , 892 incorporated herein by reference ). at typical therapeutic dosages of acetylhomotaurinate , the amount of magnesium is too low to have therapeutically - relevant effects on glutamate transmission . in my experience , i have had excellent therapeutic results from combining a 2 gram daily dosage of acamprosate with 1 gram of elemental magnesium , given as a salt or chelate ( see u . s . patent application ser . no . 09 / 193 , 892 ). this combination gives better relief of both td and tics than 2 grams of acamprosate alone . i have also demonstrated that a single dose of 300 mg of magnesium will augment the therapeutic effect of a single 666 mg dose of acamprosate . one of ordinary skill in the art would expect the dose ranges determined to be effective for treating movement disorders to also be effective for treating other neuropsychiatric disorders , since the hypothesized mechanism of therapeutic action is the same . allowing for variations in individual response , and variations in the intestinal absorption of both acamprosate and magnesium , i assert that the optimal ratio of mg : acetylhomotaurinate for an individual patient for treatment of neuropsychiatric disorders will be somewhere between 1 : 6 and 1 : 1 . lower ratios of magnesium to acamprosate are unlikely to boost the therapeutic effect of acamprosate significantly , and higher ratios than 1 : 1 are likely to produce magnesium toxicity ( or at least gi intolerance ) at a typical daily acamprosate dose of 2 grams . although magnesium n - acetylhomotaurinate may be slightly more efficacious than calcium n - acetylhomotaurinate for treatment of neuropsychiatric disorders , in the present application we are effectively increasing the magnesium content of acamprosate and related compounds by administering magnesium ion ( as a salt or chelate ) in combination with a salt of n - acetylhomotaurinate , because there is a significant benefit to administering a higher ratio of magnesium to acamprosate than is present in the magnesium salt of acamprosate . another aspect of the present invention involves prevention of neuropsychiatric disorders , including anxiety disorders , psychotic disorders , mood disorders and somatoform disorders , with an agent or combination of agents that have simultaneous nmda antagonist activity and gaba - a agonist activity without coadministration of magnesium . in one preferred embodiment of this aspect of the invention , such nmda antagonist / gaba - a agonist combinations are used to prevent the development or aggravation of a neuropsychiatric disorder , for example in a patient showing preliminary symptoms of a neuropsychiatric disorder . in another preferred embodiment of this aspect of the invention , the nmda antagonist / gaba - a agonist combined activities are used to prevent the development of a neuropsychiatric disorder , ( e . g ., ptsd ) following stress . in a particularly preferred embodiment , agents or combinations of agents with nmda antagonist / gaba - a agonist activity are administered to a patient at risk for developing a neuropsychiatric disorder , such as ptsd , to prevent the complications of substance abuse and somatization . specifically , the prevention of alcoholism subsequent to extreme stress is particularly desirable . alcoholism often develops as a complication of ptsd and / or following a traumatic event in a person &# 39 ; s life . in order to prevent the development of substance abuse after trauma , the patient who experienced the traumatic event is treated with an agent with combined nmda antagonist / gaba - a agonist activity shortly after the occurrence of the traumatic event . the value of acamprosate in treating abstinent alcoholics is well known . however , the use of acamprosate in preventing alcoholism in persons at risk has not been proposed hitherto . one of ordinary skill in the art will recognize that the present invention is not limited to a method of treating ptsd , ocd and other neuropsychiatric disorders with any agent that reduces nmda - type glutamate neurotransmission and increases gaba neurotransmission via direct effects on gaba and nmda receptors . the invention also comprises the use of agents that modify nmda - glutamate and gaba transmission in the same direction through indirect effects on receptors ( i . e ., via pre - synaptic effects on neurotransmitter release , allosteric modulation of the receptor site , or effects on the intracellular response to the binding of the transmitter to the receptor ), presynaptic effects on transmitter release , inhibition of gaba re - uptake , etc . it will be obvious to one skilled in the art that a range of derivatives and pro - drugs all should be therapeutically effective , as long as they have a sufficient effect on gaba - a and nmda - glutamate transmission at non - toxic dosages . any compound or mixture that shares the effects on glutamate and gaba transmission hypothesized to underlie the therapeutic effects of acamprosate is within the scope of the presently claimed invention . it does not matter how a drug , pro - drug or mixture thereof decreases nmda - glutamate neurotransmission and increases gaba neurotransmission , only that it improves symptoms associated with neuropsychiatric disorders at tolerably non - toxic ( e . g ., free from toxicity unacceptable side effects ) doses . as discussed previously , the inventive treatment can be used to treat any neuropsychiatric disorder that involves as symptoms unwanted , intrusive , or involuntary repetitive , stereotyped thoughts , perceptions , or behaviors . furthermore , the inventive treatment may be used to improve or eliminate symptoms that are consequences of such neuropsychiatric disorders , for example , cognitive dysfunction or abnormalities of motivation , mood , or impulse control . the basal ganglia , including the striatum , are a point of intersection of motor , cognitive , and emotional circuits . diseases of the basal ganglia frequently involve cognitive , emotional , behavioral , and motivational changes , as well as motor dysfunction . the limbic system , including the amygdala and anterior cingulate region can also influence this circuit . the treatments advanced in this invention are effective for the symptoms of several disorders involving dysfunction of the basal ganglia or the limbic system or circuits through them . it can be expected that these treatments will ameliorate some of the other symptoms that accompany basal ganglia and limbic system disorders . the present invention will now be illustrated by the following non - limiting example : i administered acamprosate to a 33 - year old woman with ptsd . this patient has ptsd on account of several incidents of sexual abuse in childhood and adolescence . her symptoms included intrusive imagery of episodes of abuse ( flashbacks ), intrusive thoughts about episodes of abuse ( traumatic memories ), nightmares , increased startle response , anxiety , depression , avoidance of the company of men , emotional numbing , suicidal ideation , and self - injurious or risky behavior ( e . g . cutting herself , reckless driving ). the above symptoms were not relieved by any of large number of medications , including antipsychotic drugs ( neuroleptics ), antidepressants , benzodiazepines , and antiepileptic drugs . in march of 1998 , the patient began acamprosate at a dosage of 333 mg three times a day . the dose was advanced gradually to 666 mg three times a day . on this dose , the patient had less anxiety , less suicidal ideation , fewer flashbacks of traumatic events , fewer intrusive thoughts of abuse , less psychic numbness , and greater ability to talk about the traumatic events that precipitated her ptsd . additional doses of 666 mg of acamprosate , taken as needed , relieved psychic tension , hopelessness , suicidal ideation , and psychic numbing precipitated by reminders of her trauma . the patient &# 39 ; s ptsd symptoms continued to respond to treatment with acamprosate over a 1 - year period from march , 1998 through march , 1999 . over this time , gradual dosage reductions were attempted to see whether the medication were still necessary , and if it were , to determine the minimum effective dose . her symptoms responded in a dose - related manner that was replicated several times . the response of specific ptsd symptoms to different dosages of acamprosate is now described . symptom severity was rated semi - quantitatively , based on a consensus of physician and patient regarding the intensity of symptoms during the week preceding the date of rating . the scale of symptom severity ranges from 0 to ++++, with ++++ being the most severe . 333 mg 333 mg 333 mg 333 mg three times four times five times six times a day a day a day a day flashbacks ++++ +++ ++ + intrusive thoughts +++ ++ + + about traumatic events psychic numbing +++ ++ + + ability to talk poor fair fair good freely about life events and personal issues self - injurious and ++ + 0 0 risky behavior startle response ++ + + the case report demonstrates that acamprosate is effective for treatment of ptsd at effective and non - toxic dosages . administration of acamprosate to a patient with ptsd resulted in a striking response with respect to a several recurrent thoughts , perceptions , and behaviors characteristic of ptsd , and not responsive in her case to conventional psychiatric medications . the patient &# 39 ; s response to acamprosate treatment , coupled a previously - reported case of the efficacy of acamprosate in a patient with a simple tic , provides evidence and suggestion that patients with other neuropsychiatric disorders , for example ocd and somatoform disorders , will receive similar benefit from acamprosate or similar agents or combination of agents with nmda antagonist activity and gaba - a agonist activity

US-8735702-A

a disposable table cloth for umbrella tables . the table cloth , for use by diners , card players , picnickers or other people using the table , is disposable , so that the users may simply place it flat on the table top , use the table , and dispose of the table cloth when they are finished . the table cloth has no expensive components such as velcro , elastic , ties , strings , etc , thus making for low cost . the table cloth further has a top surface which users may lay flat on the table top in order to use the table . the table cloth has a slit extending from the rim of the table cloth to a aperture through which the pole of the umbrella may sit . in addition , the table cloth has adhesive , especially tacky adhesive , used to fasten and seal the table cloth slit together .

fig1 is a plan view of a first embodiment of the disposable table cloth . this embodiment has a generally octagonal planform , however , it may be an exact or irregular polygon in alternative embodiments . table cloth 100 has aperture 102 and radial slit 104 having first edge 106 and second edge 108 . second edge 108 has thereon adhesive 112 . radial slit 104 extends entirely from aperture 102 to rim 110 . fig2 is a plan view of a second embodiment of the disposable table cloth . table cloth 200 has aperture 202 and radial slit 204 having first edge 206 and second edge 208 . second edge 208 has thereon adhesive 212 . radial slit 204 extends entirely from aperture 202 to rim 210 . fig3 is a plan view of a third embodiment of the disposable table cloth . this is the presently preferred embodiment and best mode now contemplated for carrying out the invention . table cloth 300 has aperture 302 and radial slit 304 having first edge 306 and second edge 308 . second edge 308 has thereon adhesive 312 . radial slit 304 extends entirely from aperture 302 to rim 310 . edges 306 and 308 may overlap each other when the flat sheet of table cloth 300 is laid flat upon a table . the overlap may be a first distance , allowing edge 308 to have adhesive 312 within the overlap distance such that when laid flat upon a table , adhesive 312 will contact first edge 306 and cause first edge 306 to adhere to second edge 308 , forming a non - permeable seal . to use the invention , it is unfolded or unrolled and the radial slit is opened up . then the table cloth is laid flat on the table with the aperture circumferentially disposed about the umbrella pole . the radial slit may then be closed and the opposing edges of the radial slit smoothed together and sealed with adhesive . in all three embodiments shown , the table cloth has a portion which lays flat on the table during use , so that diners may place food , beverages , utensils , or anything else upon the table top . if the invention did not sit flat onto the table top , it would not function as a useful table cloth . for the same reason , the adhesive may in preferred embodiments be substantially flat , by which is meant that the adhesive allows the flat sheet to remain flat when the first and second edges are adhered together overlapping . an advantage of adhesive , and an advantage of the present invention over the prior art , is in the ability of the first and second edges to be overlapped at the time of installation of the table cloth onto the table . if a table cloth is used on a table substantially smaller than it was dimensioned and configured to fit , it may be reduced in size simply by increasing the degree of overlap of the two edges . if one edge substantially overlaps the other , the result is that some portions of the table cloth are “ doubled over ”, but without actually creating a crease or bend in the flat table cloth . by this method , the table cloth may be fitted to a smaller table , an aspect of the adhesive embodiment not available to prior art or other embodiments featuring fasteners , ties , etc . adhesive also allows fitting the table cloth to a larger table than it was designed , dimensioned and configured to fit to . for example a round table cloth of 82 inches diameter ( 208 . 3 cm ) could be fitted to a table of diameter 86 inches by adhering the slits to the table directly and leaving an arc of table ( having a width at the edge of approximately 12 inches ( 30 cm ) or roughly 5 % of the table surface ) uncovered . while the uncovered arc and a second uncovered portion 2 inches ( 5 . 1 cm ) at the rim would be uncovered , the large part of the table would be covered . this is not preferable , but is merely an example of the flexibility of employment of the design : it may be used with tables larger and smaller than originally planned . note that in the preferred embodiments , the table cloth is used with a table to which it is designed , dimensioned and configured : it is manufactured in standard sizes designed , dimensioned and configured to fit common sizes and shapes of umbrella tables . a line of sizes of the invention may also be manufactured : one of diameter 82 inches ( 208 . 3 cm ), another of diameter 50 inches ( 127 cm ), and so on . fig4 is a partial view showing in detail a fourth embodiment of the invention . in this embodiment first edge 406 and second edge 408 of slit 404 may be seen in greater detail . in this 20 embodiment , second edge 408 has a length of adhesive 412 . however , unlike previous embodiments , adhesive 412 is considerably shorter in length than slit 404 . adhesive may also be disposed upon one or both sides of the slit , thus allowing either less expensive manufacture or a greater ability to adjust and flatten the table cloth on the table . yet another aspect of the use of adhesive is that the step of overlapping the first and second edges and sealing them may be accomplished by means of removing a backing material such as a strip of plastic or paper , thus exposing the adhesive only when needed . transfer tape may be employed in this way . fig5 is a plan view showing a fifth and much less favored embodiment of table cloth 500 of the invention in which a non - adhesive fastening system in which fastener 512 is used to secure first edge 506 to second edge 508 in order to seal shut slit 504 . the non - adhesive fasteners 512 may not extend entirely from aperture 502 to rim 510 . while fastener 512 is depicted as a circular fastening such as an inexpensive plastic button . the disadvantage of this device is that it creates an unfavorable series of bumps in the table cloth . during dining use , the bumps may cause accidents , for example , by upsetting a beverage container or cup . in addition , the bumps may be uncomfortable to individuals who eat , drink , talk or otherwise use the table with their arms resting on the flat sheet . another reason why adhesive is the presently preferred embodiment is that such a series of fasteners would be non - permeable along the slit , thus allowing gas , liquid or even solids from the table surface to reach the eating surface . this is undesirable . in an alternative and also less favored alternative embodiment of table cloth 600 , depicted in plan view in fig6 , inexpensive plastic seal 612 is used as the fastener holding the first and second edges 606 , 608 of the slit 604 together . such seals are commonly marketed on plastic bags , freezer bags and similar applications , for example under the tradename “ zip - loc ”, among others . the advantage of such a seal is that eliminates the need for the addition of transfer tape or other adhesive during manufacture : the device may be made in a single operation in which two halves ( one on each side of the slit ) are extruded and then joined on the side of the device opposite the slit . a potential advantage is that such seals may be more appealing to consumers desiring a “ modem ” device . another potential advantage would be reduced cost of manufacture in extremely large quantities in which extrusion equipment became economically attractive . one major disadvantage of this embodiment , however , and the reason why adhesive is actually preferable , is that a “ ridge ” is created down slit 604 . if the fastener 612 extends the length of slit 604 from aperture 602 to rim 610 , then the ridge will also . otherwise , the length of fastener 612 , whatever that length may be , will be ridged . this ridge will have many of the same disadvantages of faster 512 of the previous embodiment , although it would at least offer a permeable seal . yet another reason adhesive is the preferred embodiment is that adhesive such as 412 allows the size of the table cloth to be easily and instantly adjusted at the time of installation . the present invention may advantageously use materials which are thin , light , and inexpensive . any such disposable material may be used . the table cloth of one preferred embodiment is comprised of plastic having a thickness of approximately 2 mils . in general , the plastic may be from approximately ½ to approximately 15 mils in thickness . the plastic may be transparent , translucent , colorful , patterned or otherwise adorned . the plastic may be textured or smooth or textured in patterns . in the preferred embodiment , a circular sheet of 208 cm ( 82 inches ) diameter weights between 6 and 7 ounces ( circa 180 grams ), however , weight of the invention may differ depending upon size , shape , type of material used , adhesive used , size of the aperture , and other factors . the choice of plastic or other polymer may be made by one skilled in the art without undue experimentation . in other preferred embodiments , the table cloth of the present invention may be made of a polymer such as polyethylene , eva grade foam , cross - linked eva form , closed cell foams , eva / ldpe , or other polymers . ( the term “ eva ” stands for ethylene and vinyl acetate .) in one particular presently favored embodiment , the table cloth of the present invention may be made of peva , a combination of polyethylene and eva foam . in another embodiment , the present invention may comprise laminated sheets of peva foam and a fabric material such as cotton , polyester , nylon , terry , towel , non - woven fibres and so on . eva / peva / eva - ldpe foams have a number of desirable properties for the present invention . it is light , having exemplary densities such as 0 . 021 to 0 . 1 grams / cubic centimeters ( 1 . 3 to 6 lb / cubic foot ). this allows the device of the present invention to be quite light . furthermore , it is possible to manufacture it in a range of thicknesses , a fact used when making shoe in - soles which vary substantially in thickness . while in some applications ( toys , mats ) eva foams may be made up to ten centimeters or more thick , for the present invention quite thin table cloths are preferential : on the order of millimeters or mils . peva and similar laminates provide the ability to have a thin foam with strength sufficient to withstand at least one cycle of usage . in addition , disposable peva table clothes provide a further benefit in terms of feel . while peva is not a true “ memory foam ”, it nonetheless may be compressed slightly and will rebound out to original dimensions when pressure is removed . thus peva offers a very thin layer of padding atop a table . this is important for outdoor tables , some of which have irregular or weathered top surfaces . in terms of durometer readings by the “ shore ” scale , peva may have exemplary durometer readings of 15 to 50 . this measurement ( also called “ surface hardness ”) indicates a surface with a certain amount of give . this is an important property in allowing the invention to drape properly off of a table edge , allowing it to lie flat on the surface of the table , and in providing a more comfortable surface . by comparison , certain types of cross - linked polyethylene are not used in any preferred embodiments because they lack these properties , for example , by being extremely rigid . yet another favorable property of peva is the ability to accept a variety of colorful surfaces and textures . patterns may be heat transferred to peva laminate sheets or printed on by other means . yet another favorable property of peva is the lack of water absorption : certain types of eva foams may absorb only 1 % of their weight of water after hours of exposure . this is favorable in the context of table clothes , which may expect to have water spilled upon them frequently . peva also resists oil , another substance ( in the form of cooking oils , olive oils , butter , margarine , etc ) which may reasonably be expected to impact a table cloth . it is also a thermal insulator , meaning that if placed upon a very cold or hot table surface , a thin layer of insulation between diners and table will be created , thus making for a more comfortable dining experience . one final and crucial aspect of peva is that it is non - toxic . thus , food which falls upon the surface will not pick up any components which are dangerous . certain less preferred substances such as the peva relative pvc ( polyvinylchloride ) have toxic components , and may even release toxic cyanide based fumes when burned . peva , on the other hand , melts prior to burning , providing yet another safety factor . since table clothes may reasonably expect usage with candles , lights , gas lights , matches , cigarettes , cigars and similar table dressing , a substance which is entirely non - toxic is beneficial . pvc is not even legal in a number of jurisdictions including europe . fiber materials may also be used . paper is one example of a suitable fiber material for use with the present invention . as with the presently preferred plastic embodiment , alternative embodiments of paper may be quite thin or quite thick , may be colorful , patterned or otherwise adorned , may be textured or smooth or textured in patterns , and may have various weights depending upon size , shape , type of material used , adhesive used , size of the aperture , and other factors . such choices may be made by one skilled in the art without undue experimentation . paper may also be suitably treated so as to be rendered non - permeable . additional types of materials other than polymers or fiber materials may be used without departing the scope of the present invention . in general , advantageous materials will be light ( so the invention weighs only ounces and inexpensive to acquire and manufacture ( thus making for an inexpensive disposable product ). another aspect of the present invention is the use of adhesive to close the radial slit . a series of adhesive patches or a single longer line of adhesive may partially or wholly cover the length of the slit from rim to aperture . such adhesives may be patterned , randomly placed along part or all of the length of the slit , or continuous . the adhesive may be applied to one or both sides of the slit , in the same or different locations along the slit . one advantageous type of adhesive used in the preferred embodiment is two sided tape . another preferred embodiment utilizes transfer tape . when the product is made , one side of the tape may be fastened to one side of the slit while the other side of the tape may have the backing / liner left on , rendering the adhesive tape non - functional until the user elects to remove the backing / liner and apply the opposing side of the slit to the tape , thus fastening the two sides together and rendering the flat portion of the table cloth on the table top , which portion users will place food , etc , onto , a single , flat surface without wrinkles , ridges domes or other impediments to convenient use of the table top . in addition to fastening the two sides together , a continuous length of adhesive from rim to aperture may in fact seal the two edges together , thus preventing anything under the table cloth from migrating to the top of the table cloth during use and furthermore preventing anything atop the table cloth ( such as a spoon ) from accidentally ending up under the table cloth . a single length of adhesive is in fact the presently favored embodiment and best mode now contemplated for carrying out the invention . the adhesive may in other embodiments be a line or pattern of glue placed along one or both slit edges . such glue may be covered with a backing , or it may simply be activated by pressure ( for example glue capsules or nodules in a neutral matrix or an unmixed combination of two glue - sub - components which mix when pressure is applied ). in one somewhat favored alternative embodiment , the adhesive may exhibit the property of “ tackiness ” most usually associated with post - it brand sticky notes ( trademark of 3m corporation ). items closed with such tacky adhesives may be opened and resealed . in this embodiment , the user would pull the sides of the slit apart , place the table cloth flat on the table as earlier described , and reseal the edges together . as discussed previously in reference to fig5 , one less favored alternative embodiment uses the “ plastic snap ”, an inexpensive plastic snap fastener . one or more such snaps may be utilized at low cost , albeit at the cost of creating one or more “ bumps ” in the table cloth . another less favored alternative embodiment is the type of inexpensive plastic seal such as is commonly marketed on plastic bags , freezer bags and similar applications , for example under the tradename “ zip - loc ”, among others . while the invention may be sold individually , advantageously the invention may be sold in a packet of several units . in addition , the invention may be marketed and sold along with picnic supplies , barbeque supplies and so on . such cost and marketing considerations and advantages spring from the inexpensive nature of the overall product , which may be made with plastic and adhesive . the invention may also be used as a convenient garbage container after the final use is finished . instead of removing all dishes , cutlery , food and so on from the table at end of the use , users may simply leave garbage on the disposable table cloth , lift the edges , and form a convenient garbage bag . in embodiments the table cloth may be used once and disposed of , while in other embodiments the table cloth may be used several times before disposal : in the longer lasting embodiments , such disposal with garbage may only be done after the final use . the disclosure is provided to allow practice of the invention by those skilled in the art without undue experimentation , including the best mode presently contemplated and the presently preferred embodiment . nothing in this disclosure is to be taken to limit the scope of the invention , which is susceptible to numerous alterations , equivalents and substitutions without departing from the scope and spirit of the invention . the scope of the invention is to be understood from the claims accompanying the corresponding utility application to be filed at a later date .

US-42258703-A

hinged tables for swathers usually are provided with individual knife sections and the center section of this knife is difficult to drive . this invention eliminates the necessity for a center section drive by using a two section knife on a three section table with each knife section extending through one wing section and part of the center section . the knives are driven from the outer ends and are allowed to flex over the hinge area . the wing sections are provided with rigid guard bars and a flexible section of guard bars secured to the inner end of the rigid guard bar and is secured by the other end to the center of the center section by means of a swivel or sliding connection .

proceeding therefore to describe the invention in detail , reference to fig1 will show a tractor 10 ahead of which is attached a swather collectively designated 11 consisting of a header assembly which includes a center section collectively designated 12 and a wing section collectively designated 11 hingedly secured to each side of the center section along a hinge line identified by reference character 13 . inasmuch as the hinging of wing sections to center sections of swather headers is well known , it is not believed necessary to show details of the hinging mechanism except to say that it permits the wing sections to hinge upwardly and downwardly relative to the center section for approximately 12 ° upon either side of the horizontal . each wing section includes a swather canvas or table 14 driven from the tractor by conventional means ( not illustrated ) and depositing cut swath to the center section opening indicated by reference character 15 . the structure of the table assembly is conventional and reference to fig5 will show that the table components are mounted by conventional means upon a table lift frame 16 with the wing sections consisting of a rear frame member 17 and a front frame member 18 and a canvas roller 19 being journalled between the inner ends of these frame members in a conventional manner . knife means are provided in conjunction with a conventional reel ( not illustrated ) and is identified generally by reference character 20 . it consists of a pair of knife assemblies collectively designated 21 each knife assembly including a rigid cutter bar 22 secured to the front of each wing section 11 to a flanged support 23 secured in turn to the front frame member 18 of each wing section . this rigid cutter bar or guard brace terminates outboard of the hinge line 13 between the wing section and the center section and has secured to this inner end , a flexible guard brace or bar 24 which acts as a continuation of the rigid guard bar and spans the hinge line or junction between the wing section and the center section and is secured by the other or inner end thereof adjacent the center line 25 of the center section as clearly shown in fig2 and 3 . alternative means are provided to mount the inner end of this flexible bar 24 to adjacent the center of the center section and fig6 and 7 show the alternative means . in fig6 an eye member 26 is secured to the inner end of the flexible guard bar 24 and acts as a bearing and engages around a pin 27 which extends forwardly of the front member 28 of the center section and forms part of a bracket support including rear plate 29 , front plate 30 and spacing pin or attachment pin 31 . in fig2 the arrangement is similar except that instead of the eye bearing 26 being situated above the plane of the flexible bar 24 , it is situated below the plane of the bar . this eye bearing in fig2 is indicated by reference character 26a and is mounted upon a pin 32 extending through the front member 28 of the center section and through an angulated bracket 33 also extending from the center section member 28 . in fig7 the inner ends 34 of the flexible guard bar 24 is mounted for sliding movement within an apertured bracket 35 extending from the front member 28 as clearly shown . any of the mountings illustrated in fig2 or 7 permit the bar to flex if the wing sections move upwardly or downwardly relative to the horizontal or to the center section . each of the rigid guard bars or cutter bars 22 is provided with a plurality of spaced knife guards collectively designated 36 and corresponding hold - downs collectively designated 37 . fig8 and 9 show details of the guards 36 which include a cross piece 38 , a pair of spaced and parallel forwardly extending guard members 39 , and attachment lugs 40 enabling same to be secured to the guard bar 22 and to extend forwardly therefrom in spaced pairs as clearly illustrated for example in fig4 . similar guard bars are secured in a spaced relationship along the flexible guard brace or bar 24 and in fig5 the attaching apertures 41 are shown . the hold - downs are conventional and include the attaching lugs 42 and the forwardly and downwardly extending hold - down portion 43 . these are attached to the upper side of the fixed guard bar 22 and the movable guard bar 24 as clearly illustrated . the spaced and parallel forwardly extending portions 39 include the knife clearance and bearing slots 44 illustrated in fig9 which support a flexible knife section 45 which extends from adjacent the outer ends 46 of each wing section , cross the hinge line 13 to adjacent the inner end 34 of the flexible guard bar or brace 24 as clearly shown in fig2 and 4 . it will be appreciated that the flexible guard bar or brace being secured to the inner end of the rigid guard bar or brace 22 , permits the flexing to occur and that the inner end portion of the flexible knife follows this curvature yet is still mounted for reciprocation throughout its entire length . it will also be noted that the connection between the inner end of the rigid guard bar 22 and the outer end of the flexible guard bar 24 is outboard of the hinge line 13 and in fig5 a brace strap 47 spans this junction and is bolted to both sections to connect them together as one unit . it should also be noted that a crop divider 48 extends forwardly from the center of the front member 28 of the center section to divide the crop upon each side of the small area between the inner ends of the flexible knives which of course do not meet fully . reference to fig4 and 11 show means to reciprocate the flexible knives it being understood that there is one drive means adjacent the outer end of each wing section as clearly shown in fig3 . a main drive shaft 49 is operatively connected to the tractor power takeoff ( not illustrated ) and extends to a gear box 50 with secondary drive shafts 51 extending from each side thereof via universal joints 52 . these in turn lead to the wing section drive shaft 53 which in turn extend to outer gear box 54 . knife drive shafts 55 extend from these outer gear boxes 54 to the knife drive components 56 via coupling 57 . these components 56 include a housing 58 and an input drive shaft 59 extending from coupling 57 . a form of crank 60 is journalled within the housing via bearings 61 and 62 and is rotated by the input shaft 59 . an output crank 63 is journalled for rotation within bearings 64 , at the front of the member 60 and offset from the center line 65 and the crank end 66 is connected to a plate 67 secured to the outer end of the flexible knife 45 . a fixed ring gear 68 is mounted within the housing and a pinion 69 is secured to the inner end of 63 and engages the ring gear . rotation of the input shaft 59 causes rotation of the member 60 and the location and configuration of the crank 63 together with the engagement of the pinion gear 69 with the ring gear 68 causes the output crank 66 to reciprocate in a horizontal plane thus transferring rotary motion to reciprocal motion and reciprocating the knives 45 . any flexing is allowed for with the knife flexing with the flexible guard bar portions 24 . it should be pointed out that the flexible guard bars are similar in construction to a leaf spring and it should also be noted that the table hinge lines 13 must be parallel to the flat surface of the flexible bars 24 in order to permit the necessary flexing . since various modifications can be made in my invention as hereinabove described , and many apparently widely different embodiments of same made within the spirit and scope of the claims without departing from such spirit and scope , it is intended that all matter contained in the accompanying specification shall be interpreted as illustrative only and not in a limiting sense .

US-42696582-A

an article of furniture and method of using the article that satisfies leed building credits in the green building rating system , whereby the article has a main chest body having a cavity positioned on the lower portion between two support members and a trundle seat configured to be retractably positioned in said cavity .

the present invention is an article of furniture having a chest trundle combination 10 with a chest 11 and a trundle 13 . chest 11 has a first side panel 31 and a second side panel 32 and a top horizontal surface 30 . each of side panels 31 and 32 have , on their lower portion a chest leg 23 . chest 11 has a front face 35 , a plurality of chest door handles 26 each individually connected to a chest door 25 . each chest door 25 encloses , a “ cubby ,” an individual chest storage cavity 28 that is accessed when chest door 25 is pivotably opened along chest door hinges 27 . chest storage cavity 28 preferably stores shoes 29 and may as well store other desired articles . chest 11 has a chest cavity 12 of suitable size and configuration to accept trundle 13 . the inner portion of chest cavity 12 has a chest mounted trundle guide 21 on each of the two interior regions of cavity 12 bounded by chest first side 31 and chest second side 32 . trundle 13 has a female trundle guide 14 and male trundle guide 33 on each of the first trundle side 38 and second trundle side 36 . trundle 13 has trundle seat 16 that is pivotably attached to trundle 13 at trundle hinge 17 . trundle 13 also has trundle interior 20 that is divided into two sections by trundle interior divider 34 . alternatively , trundle interior 20 may be a single undivided cavity . trundle 13 also has wheels 15 attached to each trundle leg 22 . preferably , trundle 13 has four trundle legs 22 each with an attached wheel 15 . trundle 13 also has at least one trundle knob 18 for moving trundle as desired . in a preferred embodiment , trundle wheels 15 are non pivotable . however , pivotable wheels may be used if desired . trundle interior 20 is bounded by first trundle side 38 second trundle side 36 and trundle underside 24 . chest 11 has chest cavity 12 that is configured on the lower portion of chest 11 . chest cavity 12 is of sufficient size and shape to allow for the nesting of trundle 13 that retracts substantially underneath the periphery of chest 11 . preferably , cavity 12 and trundle 13 are configured and arranged to maximize the size of trundle 13 based on the available space in cavity 12 . trundle 13 extends outward from the periphery of chest 11 using wheels 15 that are attached at the bottom of each trundle leg 22 . chest 11 has a chest mounted trundle guide 21 on each of the chest first side 31 and chest second side 32 , wherein each chest mounted trundle guide 21 interacts with a complementary male trundle guide 33 that are on each of the first trundle side 38 and second trundle side 36 of trundle 13 . the complementary action of each chest mounted trundle guide 21 , male trundle guide 33 , and female trundle guide 14 , facilitate the extension of trundle 13 outward from chest cavity 12 and retraction into chest cavity 12 as desired . trundle guides 21 , 33 , and 14 , serve not only to guide the trundle in and out of the cavity as desired , but also to secure trundle 13 to chest 11 in order that trundle 13 does not move out of a suitable extension and a retraction orientation . additionally , should a user desire to move trundle 13 completely away from chest 11 , trundle guide release 19 , on either side of trundle 13 , will release trundle 13 from its secured orientation and allow the trundle to be moved completely clear of chest 11 . chest 11 is preferably configured with a plurality of chest doors 25 each with at least one chest door handle 26 . chest door 25 serves as an opening for accessing chest storage cavity 28 . chest door 25 , when closed also serves as the enclosure and final wall of chest storage cavity 28 . in a preferred embodiment chest storage cavity 28 is configured of suitable size and shape to store a typical pair of shoes 29 . additional variations include a chest with a single row having six storage cavities horizontally in a row . a configuration having two rows with five storage cavities horizontal in a row is also contemplated . the specific configuration of the columns and rows may be varied as space and design constraints dictate . while the invention has been described in its preferred form or embodiment with some degree of particularity , it is understood that this description has been given only by way of example and that numerous changes in the details of construction , fabrication , and use , including the combination and arrangement of parts and dimensions may be made without departing from the spirit and scope of the invention .

US-39603609-A

an animal water feeder having an improved flow control nozzle . the flow is controlled by the animal engaging a movably confined ball at the terminus of the nozzle . a portion of the ball is exposed . the nozzle assembly includes a tube extending downwardly from the feeder . the tube includes a valve , an actuator having at least one water passage therein an engaging pin positioned adjacent thereto , and the ball . movement of the ball opens the valve to release water which flows past the actuator to the terminus of the tube .

referring now to fig1 , the novel water feeder 10 includes a fluid reservoir 11 having an intake port 12 located on the top surface thereof . the intake port is threaded to receive cap 14 having a vent 15 therein . the feeder 10 is shown having a central encircling wire 20 about the middle of the reservoir . wire 20 has a pair of hooks 18 adjacently spaced on one side of the reservoir for attachment to a wire 19 of the animal cage . when the feeder 10 is attached to the cage , the nozzle assembly 17 extends into the cage so as to be accessible to the animal therein . the reservoir 11 is seen in fig1 as having an angled lower region 22 containing discharge port 16 therein . the reservoir can utilize containers of varying shapes depending in part on the dimensions and configuration of the cage . in the embodiment show , the angled region 22 causes the nozzle assembly 17 to extend downwardly into the cage thereby improving access thereto by a caged animal . further , the downward tilt aids in the flow of fluid through the nozzle assembly . the details of the nozzle assembly are shown in the cross - sectional view of fig2 and 7 wherein the discharge port 16 located on angled region 22 of the reservoir is threaded to receive a mating tubular fitting 24 . typically , the reservoir and fitting 24 are manufactured of molded plastic . an elongated metallic sleeve 30 is received in fitting 24 . the sleeve 30 is inwardly curved at the free end to form a retention tip 34 having a central opening . a metal ball 35 is movably retained in tip 34 with a portion thereof extending outwardly of the tip . in the preferred embodiment , a washer 27 is interposed between the discharge port 16 and the shoulder 33 of fitting 24 . the washer provides a seal between the adjacent threaded parts . a cylindrical section 26 having an upper flanged end forming washer 27 extends downwardly in sleeve 30 and is provided with the flow control member of valve 28 at the lower end . the cylindrical section includes the washer , valve and straight section therebetween and is preferably formed as a single part of molded elastomeric material . the part is shown in further detail in fig3 and 4 wherein a slit 40 extends through the valve end 41 . the valve is normally closed as shown in fig3 . in the preferred embodiment , the valve end is inwardly curved to aid in effecting a seal . the weight of water against the curved end 41 urges the edges of slot 40 toward each other in sealing engagement . an actuator 31 having an engaging pin 32 positioned adjacent the valve end 41 is movably contained within the water passage in sleeve 30 . the opposing end of the actuator rests against the ball 35 . when the ball is moved , the actuator moves to cause the engaging pin 32 to contact the valve end 41 . the contact results in the edges of the slit 40 separating to pass fluid . the valve , termed a diaphragm valve , opens when pressure is applied to one or both sides of the slit 40 . since the actuator diameter is made to approximate the inside diameter of sleeve 30 , the movement of the actuator is essentially along the axis of the sleeve and the position of the pin remains centered on the valve end . the tubular sleeve is provided with a retention tip 34 that receives the discharge control member 35 thereagainst . the member 35 is a metal ball having a diameter of the opening in the retention tip . as a result , the animal can urge the ball inwardly thereby imparting movement to the actuator . the pin 32 on the actuator contacts the valve end 41 to permit fluid to flow downwardly from the reservoir . the actuator 31 shown in fig5 and 6 is provided which a number of vanes 44 that extend radially outward to define a number of channels along with the fluid flows to the free end of sleeve 30 . the actuator is preferably formed of molded plastic . different configurations of the actuators can be used in the sleeve . an alternate embodiment is shown in fig8 and 9 wherein actuator 50 is formed with a rounded end 51 having a series of openings 53 therein . each opening 53 communicates with a fluid passage formed between adjacent vanes 54 . the rounded end 51 rests against the ball 35 in the retention tip 34 . movement of the ball along the axis of the sleeve results in an opening of the valve and a resultant flow of stored fluid . an alternate type of valve 60 is shown in fig1 and 11 . the valve is formed of molded silicone rubber with a flanged washer 61 at one end and a central cylindrical section 62 dimensioned to fit within sleeve 30 . an opening 64 is formed in the opposing end of the cylinder . a movable valve cover 65 is positioned over the opening 64 and movably secured at one edge to the cylinder wall . in the embodiment shown , the actuator 70 is provided with a pin 71 at each end . movement of the actuator causes the pin adjacent to the valve cover to raise the cover and permit fluid to flow as shown in fig1 . when the animal ceases applying force to the ball in the retention tip , the actuator returns to the position shown in fig1 and the valve is urged closed by the pressure applied by the fluid in the reservoir . the configuration of the actuator 31 and the characteristics of the flow control valve primarily determine the flow rate when the discharge control member 35 is urged inwardly . one use of the present invention is directed to caged animals wherein the member 35 is moved by the mouth or beak of the animal . in other applications in which different types of animals apply greater forces of longer duration , different actuators can be used for limiting flow rates . in any case , the absence of a force applied to member 35 causes the member to be received in the retention clip and the actuator is withdrawn from contact with the valve . the discharge control member 35 and sleeve are preferably made of stainless steel since these two parts are subject to abuse by the caged animals . however , durable molded plastic parts can be used if desired . while the foregoing description has referred to a specific embodiment of the invention , it is to be noted that modifications and variations may be made therein without departing from the scope of the invention as claimed .

US-3298805-A

a system for achieving reduction of curvature of the lumbar region of the spine associated with spondylolisthesis includes transverse plates affixed to vertebrae l4 and l5 and sacral plates affixed to opposite sides of the sacrum . these plates in combination with the longitudinal plate along the posterior anterior plane in which the spinous processes lie allows for effective reduction of the curvature and secure fixation of this region of the spine . the transverse plates include textured surfaces which allow them to mate in a manner which prevents undesirable slippage therebetween . the system is also compact and does not interfere with the paraspinal muscles which run along either side of the spinous processes .

referring to the ghost line depiction in fig1 spondylolisthesis is a condition of the lumbar region of spine 10 wherein the spinous process , lamina , and inferior articular processes of the fifth lumbar vertebrae ( and sometimes the fourth lumbar vertebrae ) are united together , but separate from the rest of the bone . this condition results in an accentuated curvature in an anterior direction ( indicated by arrow 12 ) of the lumbar region of the spine and displacement of the sacrum in a posterior direction ( indicated by arrow 16 ). as described above , correction of this curvature is achieved by pushing sacrum 14 in the anterior direction and pulling on vertebrae l4 and l5 in posterior direction 16 . referring additionally to fig2 the system formed in accordance with the present invention for fixating the lumbar region of a spine 10 and reducing spondylolisthesis includes first transverse plate 22 and second transverse plate 24 that are respectively attached to left pedicle 26 and right pedicle 28 of vertebrae l4 with respective pedicle screws 30 and 31 . third transverse plate 32 and fourth transverse plate 34 are respectively attached to left pedicle 36 and right pedicle 38 of vertebrae l5 with respective pedicle screws 40 and 41 . the system also includes , first sacral plate 42 and second sacral plate 44 that are attached to sacrum 14 adjacent the lumbosacral junction on opposite lateral sides thereof . positioned along an axis transverse to transverse plates 22 , 24 , 32 , and 34 and sacral plates 42 and 44 is longitudinal plate 46 that is concave in the posterior direction to allow for fixation of the lower lumbar region of spine 10 in the desired position . transverse plates 22 , 24 , 32 , and 34 and sacral plates 42 and 44 are connected to longitudinal plate 46 by fasteners 48 , 50 , and 52 that are described below in more detail . referring specifically to fig3 the individual components making up the system generally described above are illustrated in more detail and described below . first transverse plate 22 includes a bore 54 at left end 56 . left end 56 is rounded and bore 54 is centered therein and is sized to receive pedicle screw 30 along a first axis . pedicle screw 30 includes a primary threaded portion 5 at one end for insertion into nut 62 and a secondary threaded portion 60 at the opposite end for receiving pedicle nut 26 which secures pedicle screw 30 to first transverse plate 22 . extending in the inferior direction 63 from left end 56 is rectangular flange 64 . flange 64 provides an offset element from which elongate spaced - apart fingers 66 extend in a lateral direction substantially transverse to the first axis . spaced - apart fingers 66 are substantially equal in length and include ends opposite flange 64 that are connected by transverse end member 68 . in this manner , flange 64 , spaced - apart fingers 66 , and end member 68 define a slot 70 that passes through first transverse plate 22 . flange 64 is also canted laterally from right to left in the anterior direction 12 so that the plane in which left end 56 and flange 64 lie is different from the plane in which spaced - apart fingers 66 and end member 68 lie . left end 56 and range64 have a thickness d measured from posterior surface 72 to anterior surface 74 . spaced - apart fingers 66 and end member 68 have a thickness measured from posterior surface 72 and anterior surface 74 equal to about one - half d . in order to provide the narrow thickness of spaced - apart fingers 66 and end member 68 , a portion of anterior surface 74 is removed . for first transverse plate 22 , anterior surface 74 of spaced - apart fingers 66 and end member 68 are textured with serrations . the peaks and valleys of the serrations have a repetitive pattern having an amplitude of approximately 15 to 25 thousandths of an inch . other repetitive patterns can be used provided they help to prevent slippage between first transverse plate 22 and second transverse plate 24 as described below in more detail . in the illustrated embodiment , first transverse plate 22 has been illustrated with an offset provided by flange 64 . alternatively , first transverse plate 24 can be straight like the third and fourth transverse plates described below in more detail . continuing to refer primarily to fig3 second transverse plate 24 for vertebrae l4 includes right end 76 that includes bore 78 and flange 80 that are substantially mirror images of left end 56 , bore 54 , and flange 64 of first transverse plate 22 . accordingly , these features will not be described in any more detail . second transverse plate 24 differs from first transverse plate 22 in that spaced - apart fingers 82 and transverse end member 84 include posterior surface 86 and anterior surface 88 , wherein posterior surface 86 is textured as described above . in order to provide the narrowed thickness of spaced - apart fingers 82 and end member 84 , a portion of posterior surface 86 is removed . when textured posterior surface 86 of spaced - apart fingers 82 and end member 84 of second transverse plate 24 and textured anterior surface 74 of spaced - apart fingers 66 and end member 68 of first transverse plate 22 are mated together , slippage therebetween is minimized because of the mating of the textured surfaces . continuing to refer primarily to fig3 third transverse plate 32 includes a left end 90 that is a substantially circular plate and includes bore 92 passing perpendicularly therethrough for receiving pedicle screw 40 along a first axis . pedicle screw 40 is identical to pedicle screw 30 described above . extending from left end 90 are substantially parallel spaced - apart fingers 94 of substantially equal length . ends of spaced - apart fingers 94 opposite left end 90 are connected by transverse end member 96 . left end 90 is canted laterally from right to left in an anterior direction so that left end 90 lies in a plane different from a plane in which spaced - apart fingers 94 and end member 96 lie . left end 90 , spaced - apart fingers 94 and end member 96 define a slot 98 passing through third transverse plate 32 . spaced - apart fingers 94 and end member 96 have a thickness in the posterior to anterior direction approximately equal to one - half the thickness of left end 90 in the same direction . spaced - apart fingers 94 and end member 96 include posterior surface 100 and an opposing anterior surface 102 . the reduced thickness of spaced - apart fingers 94 and end member 96 is provided by removing a portion of anterior surface 102 . as described above with respect to first transverse plate 22 , inferior surface 102 is textured . continuing to refer to fig3 fourth transverse plate 34 includes right end 104 , that is substantially a mirror image of left end 90 of third transverse plate 32 . right end 104 includes bore 106 that passes through right end 104 . similar to left end 90 of third transverse plate 32 , right end 104 is canted laterally from left to right in an anterior direction 12 . fourth transverse plate 34 also includes substantially parallel spaced - apart fingers 108 that extend laterally from right end 104 . spacedapart fingers 108 are substantially equal in length and are connected at an end opposite right end 104 by transverse end member 110 . right end 104 , spaced - apart fingers 108 , and end member 110 define slot 112 passing through fourth transverse plate 34 . as with third transverse plate 32 , spaced - apart fingers 108 and end member 110 have a thickness in the posterior to anterior direction that is approximately equal to one - half the thickness of right end 104 in the same direction . this reduced thickness is provided by removing a portion of posterior surface 114 of spaced - apart fingers 108 and end member 110 . fourth transverse plate 34 includes spaced - apart fingers 108 whose posterior 114 is textured with the repetitive pattern described above with respect to the other transverse plates . the repetitive pattern of fourth transverse plate 34 will mate up with the repetitive third transverse plate 32 to prevent slippage therebetween . as noted above , it should be understood that while first and second transverse plates 22 and 24 described above and illustrated in fig3 include right and left ends and spaced - apart fingers that are offset , a straight - line configuration similar to third and fourth transverse plates 32 and 34 may also be applied if appropriate . referring to fig2 and 5 , the system formed in accordance with the present invention also includes left sacral plate 116 and right sacral plate 118 . in the illustrated embodiment , sacral plates 116 and 118 are illustrated as being triangulated , however , it should be understood that it is not necessary to include triangulated sacral plates and straight sacral plates including only two screws , rather than three could be used . in fig2 and 3 , right sacral plate 116 and left sacral plate 118 are illustrated . right sacral plate 118 is a mirror image of left sacral plate 116 ; therefore , only right sacral plate 118 will be described in detail . right sacral plate 118 has a base 120 having a posterior surface 122 and an opposing anterior surface 124 . anterior surface 124 of sacral plate 118 is designed to intimately contact the posterior surface of the sacrum adjacent the lumbosacral joint . in position , base 120 lies in a plane generally tangential to the portion of the sacrum adjacent to the lumbosacral joint . for purposes of this description , that plane will be referred to as the sacral or dorsal plane . base 120 of sacrai plate 118 cames three bores that extend from the posterior surface of base 120 in a generally anterior direction . these bores are the pedicle bore 126 , the lateral bore 128 , and the oblique bore 130 . the bores 126 , 128 , and 130 , while extending in an anterior direction , are not orthogonal to the sacral plane . instead , the pedicle bore 126 has an axis extending in an anterior and medial direction that is offset in the medial direction preferably at an angle of about 15 ° to a line orthogonal to the sacrai plane , although this angle may vary depending upon the particular sacral anatomy being fixed . it is understood that a screw that extends through this bore extends through the pedicle of the sacrum and must always lie within the pedicle . lateral bore 128 extends in an anterior and lateral direction that is preferably offset in the lateral direction at an angle of about 30 ° from a line orthogonal to the sacral plane . if desired , the lateral angie may be varied and the direction of the bore canted in either an inferior or superior direction relative to the sacral plane depending on the sacral anatomy . oblique bore 130 passes through base 120 and is offset in the lateral and inferior directions . bore 130 when viewed in the sacral plane is first preferably offset about 45 ° from a lateral line , but may be varied depending on the particular sacral anatomy . the bore 130 is also offset in the lateral direction preferably about 30 ° from a line orthogonal to the sacral plane , but again , may be varied depending upon the particular sacral anatomy . extending from the left lateral side of right sacral plate 118 is flange 132 . flange 132 is substantially rectangular and has a thickness in the posterior to anterior direction substantially equal to the thickness of base 120 in the same direction . flange 132 extends laterally from base 120 , in a posterior direction from right to left at an angle of about 45 ° in the illustrated embodiment . flange 132 is relatively short with respect to the length of the spaced - apart fingers described below . this angle can be varied depending on the particular sacral anatomy . extending from the end of flange 132 opposite sacral plate 118 are substantially parallel spaced - apart fingers 134 of substantially equal length . ends of spaced - apart fingers 134 opposite flange 132 are connected by transverse end member 136 . spaced - apart fingers 134 and end member 136 have a thickness measured in the posterior to anterior direction approximately equal to one - half the thickness of flange 132 or body 120 measured in the same direction . this reduced thickness is provided by removing a portion of the posterior surface 138 of spaced - apart fingers 134 and end member 136 . posterior surface 138 of spaced - apart fingers 134 and end member 136 is also textured with a repetitive pattern in a manner similar to first , second , third , and fourth transverse plates described above . as with the transverse plates , flange 132 , end member 136 and spaced - apart fingers 138 define a slot 140 through right sacral plate 118 . continuing to refer to fig2 and 5 , left sacral plate 116 includes a base 142 and flange 144 that are substantially minor images of base 120 and flange 132 of right sacral plate 118 . extending from flange 144 are substantially parallel spaced - apart fingers 146 whose ends opposite flange 144 are connected by transverse end member 148 . spaced - apart fingers 146 , end member 148 and flange 144 define slot 150 through left sacral plate 116 . as with the spaced - apart fingers 134 and the end member 136 of right sacral plate 118 , spaced - apart fingers 146 and end member 148 of left sacral plate 116 have a thickness measured in the posterior to anterior direction that is approximately equal to one - half the thickness of flange 144 or base 142 measured in the same direction . spaced - apart fingers 146 and end member 148 of left sacral plate 116 include an anterior surface 124 that has a portion cut away to provide this thickness . anterior surface 124 is also textured as described above . referring to fig1 and 3 , the illustrated system includes longitudinal plate 42 that includes two spaced - apart elongate members 154 whose inferior end and superior end are connected by transverse members 156 and 158 . transverse end members 156 and 158 , and spaced - apart members 154 define a slot 160 through longitudinal plate 46 . longitudinal plate 46 is concave in the posterior direction which provides the curvature needed to successfully treat spondylolisthesis . the plate is bent on the table to the alignment desired as determined by a template bent to match the patient or the final alignment desired . longitudinal plate 46 is long enough to extend between first transverse plate 22 and second transverse plate 24 on vertebrae l4 and sacral plates 116 and 118 on the sacram . longitudinal plate 46 has a thickness measured in the anterior to posterior direction that is substantial enough to provide the rigidity needed for complete fixation and treatment of the spine . referring to primarily fig2 , 4 and 5 , fasteners 48 , 50 and 52 used to secure the transverse plates and the sacral plates to the longitudinal plate are identical except for the differences noted below . fasteners 48 , 50 and 52 include carriage bolt 164 , that includes head 166 , square flange 168 and threaded portion 170 . flange 168 is located between head 166 and threaded portion 170 and has a thickness that is substantially equal to the combined thickness of the spaced - apart fingers of the first and second transverse plates , or any of the other pairs of plates . flange 168 has a square cross section orthogonal to the axis of the threaded portion . the lengths of the sides of flange 168 are slightly less than the width of the slots in the transverse plates or sacral plates . accordingly , a square flange can be positioned within the respective slots and prevented from rotating . threaded portion 170 is generally long enough to extend through the combined spaced - apart fingers of the respective pairs of plates , the other elements of the fastener described below in more detail , and the posterior surface of the longitudinal plate . depending on the particular spinal anatomy , fastener 50 may include a threaded portion that is longer than the threaded portions for fasteners 48 and 52 . fasteners 48 , 50 and 52 also include a thin primary nut 172 that is threaded to mate with threaded portion 170 on carriage bolt 164 . primary nut 172 includes a posterior and anterior surface , both of which are textured to facilitate secure tightening against the posterior surface of the transverse plates and to prevent slippage between nut 172 and the anterior surface of washer 174 described below . after threaded portion 170 is passed through the slots in a pair of plates , primary nut 172 and carriage bolt 164 are used to secure spaced - apart fingers of the respective pairs of plates together . fasteners 48 , 50 and 52 also include thin washer 174 that has a bore for receiving threaded portion 162 of carriage bolt 164 after primary nut 172 has been seated . around periphery , of washer 174 are two flanges 176 extending in the posterior direction . flanges 176 are spaced - apart 180 ° around the periphery , of washer 174 . the lateral distance between flanges 176 is large enough so spaced - apart members 154 of the longitudinal plate 46 will fit between flanges 176 . flanges 176 extend from washer 174 in a posterior direction , a distance that is less than the thickness of the longitudinal plate measured in the same direction so that the ends of flanges 176 do not extend above longitudinal plate 46 when the system is secured together . alter threaded portion 162 is passed through slot 160 in longitudinal plate 56 , threaded portion 170 is secured by secondary , nut 178 that includes a threaded bore for mating with threaded portion 170 . referring to fig2 and 4 , pedicle screws 30 , 31 , 40 , and 41 used to secure first , second , third and fourth transverse plates to vertebrae l4 and l5 include at a lower end a primary threaded portion 58 and at the opposite end a secondary threaded portion 60 . intermediate these threaded portions is a flange 184 having a diameter slightly larger than the diameter of secondary threaded portion 60 . flange 184 terminates at its upper end in a shoulder that is positioned in a plane orthogonal to the axis of the screw . the pedicle screws can be secured into vertebrae l4 or l5 down to flange 184 after which the bore in the transverse plate is passed over the secondary threaded end 60 down to the shoulder of flange 184 . the bore is sized just slightly larger than the secondary threaded portion so that the pedicle screw can reciprocate relative to and transverse to the plate , but cannot angulate relative to the screw axis when engaging the bore . a nut 62 is then threaded onto secondary threaded portion 60 and used to tighten the anterior surface of the plate against the shoulder of flange 184 . a pedicle screw that can be used in the context of the present invention is available from danek group , inc ., medical division . to facilitate insertion of the pedicle screw into the pedicle , the end of the pedicle screw adjacent secondary threaded portion 60 includes an indentation for receiving a tool , such as an allen wrench . referring to fig3 and 5 , screws 186 used to affix sacral plates 116 and 118 to the sacrum include a lower threaded portion 188 , an upper flared head 190 and a cylindrical section 192 immediately below head 190 . head 190 also carries an allen socket so that the screw can be rotated into a hole drilled in the pedicle . the bone engaging threads on the lower threaded portion 188 are of conventional design . cylindrical section 192 has a diameter slightly less than the diameter of the pedicle bore passing through the sacral plates . the diameters are chosen such that when cylindrical section 192 is in the bore , the screw can rotate and reciprocate . however , the tolerances are such that the screw cannot angulate or toggle relative to the axis of the bore . upper flared head 190 is configured to mate with a countersink provided in the bore when the screw is completely threaded into the sacrum . the same screw is employed in both the lateral bore and the oblique bore . in use , the system described above can be secured to the lower lumbar region of the spine in accordance with the following steps . it should be understood that differing procedures may be applicable for particular situations and spinal anatomies . referring to fig2 and 3 , pedicle screws 30 , 31 , 40 and 41 are inserted into the pericles of vertebrae l4 and l5 using conventional techniques . sacral plates 116 and 118 are secured to a sacrum adjacent the lumbosacral junction with the screws described above . first transverse plate 22 and second transverse 24 plate am loosely mated together by passing threaded portion 170 of carriage bolt 164 through the slots in first plate 22 and second plate 24 . the carriage bolt is loosely held in place threading thin nut 174 on exposed threaded portion 170 . bore 78 of second transverse plate 24 is slipped over secondary threaded portion 60 of right pedicle screw 31 and loosely secured thereto with a conventional nut . bore 54 of first transverse plate 22 is then slipped over secondary threaded end 60 of left pedicle screw 30 and secured loosely thereto with conventional nut 62 . third and fourth transverse plates 32 and 34 are loosely secured to pedicle screws 40 and 41 that have been inserted to vertebrae l5 in a manner similar to that described above with respect to first transverse plate 22 and second transverse plate 24 . with respect to sacral plates 116 and 118 , threaded portion 170 of carriage bolt 164 is passed through slots 140 and 160 before the sacral plates are secured to the sacrum . again , a textured nut 172 is used to loosely secure carriage bolt 164 within slots 140 and 160 of left sacral plate 116 and right sacral plate 118 . sacral plates 116 and 118 are then secured to the sacrum using screws 186 . once the transverse plates and sacral plates are secured to the respective spinal anatomy , textured nuts 172 on carriage bolts 164 can be tightened so that the textured surfaces of the respective spaced - apart fingers come in contact and prevent slippage between the respective plates . next , ranged washer 174 is slipped over the exposed end of each of the carriage bolts 164 followed by placement of longitudinal plate over the exposed ends of the carriage bolts . longitudinal plate is then secured to the sacral plates and the transverse plates using the secondary nuts 178 and the exposed portions of the carriage bolts . depending on the degree of displacement and curvature resulting from spondylolisthesis , initially the anterior side of longitudinal plate 116 may not contact washer 174 of the fastener for l5 . in order to achieve reduction , this gap can be closed by tightening secondary nut 178 on carriage bolt 164 . this tightening causes the system to pull on vertebrae l5 and l4 in a posterior direction while pushing on the sacrum in the anterior direction . in applying the system described above , it should be understood that while the specific transverse plates are designed to avoid various anatomical elements of the lower region of the spine , it may be necessary to remove various anatomical elements in order to achieve placement of the system components . alternatively , different degrees of offset between the bores for the pedicle screws and the spaced - apart fingers can be used . in accordance with the present invention , pedicle screws are inserted into the pedicles of vertebrae l4 and l5 so that the pedicle screws are at angles that diverge from each other in the posterior direction . when longitudinal plate is affixed to carriage bolts as described above , before reduction , the distance between the diverging rays associated with the pedicle screws would be fixed , e . g ., distance a . after reduction , when vertebrae l4 and l5 are brought into closer proximity with longitudinal bar the distance between the diverging rays associated with the pedicle screws would be reduced to a distance b , which would be less than a . the system formed in accordance with the present invention provides a means for adjusting for this change in distance between the pedicle screws , which allows one to maintain an optimum plate placement with respect to the plates and the pedicle screws . as the reduction is implemented , the fasteners can be loosened by loosening nut 178 and nut 172 . in this manner , the spacing between the individual plates making up the pairs of plates can be adjusted by allowing the textured surfaces to slide over each other . after the desired spacing is achieved , the nuts 172 and 178 can be tightened again to secure the plates together . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention .

US-45350495-A

a method and apparatus for delivering a plurality of medicaments in a single delivery vehicle for the management of co - morbid diseases , illnesses and conditions . the present invention provides a novel delivery process for many medicaments . medicaments may be encapsulated and stored separately within a larger capsule until the time of ingestion , consumption , or the like . benefits of the present invention include maintaining separation of distinct ingredients within a single capsule and the capability to control the time release of multiple ingredients within the capsule .

it will be readily understood that the components of the present invention as detailed below , may be arranged and designed in a wide variety of different configurations and steps . thus , the description herein is not intended to limit the scope of the invention , but is merely representative of certain presently preferred embodiments in accordance with the invention and its inherent inventive concepts . those of ordinary skill in the art will , of course , appreciate that various modifications to the details herein may easily be made without departing from the essential characteristics of the invention , as described . thus , the following information is intended only by way of example , and simply illustrates certain presently preferred embodiments consistent with the invention . appendix i contains a list of diseases , illnesses and conditions which are known to affect several organ systems and a list of medicaments which may be helpful in managing said diseases , illnesses and conditions , the contents of appendix i being incorporated herein by reference in their entirety . referring to generally to appendix i , it may be demonstrated that as medical and pharmacy knowledge has continued to expand exponentially , new medicaments , new classes of medicaments and new delivery technologies are becoming available for use in animals and humans who experience particular medical diseases , illnesses or conditions . a disease , illness , or condition may affect one or more organ systems in an animal or human . organ systems may include , for example : ( 1 ) autonomic , ( 2 ) cardiovascular , ( 3 ) neurological , ( 4 ) gastro - intestinal , ( 5 ) respiratory , ( 6 ) renal system , ( 7 ) psychiatric , ( 8 ) endocrine , ( 9 ) gynecologic , ( 10 ) urologic , ( 11 ) immunologic , ( 12 ) bone and joint systems , ( 13 ) ear , nose , and throat , ( 14 ) dermatologic , ( 15 ) hematologic , ( 16 ) infectious defense and ( 17 ) nutrition and metabolism . in an animal or human who may be suffering from one disease , illness or condition , it is common to also be suffering from a disease , illness or condition affecting one or more of the other organ system ( s ). these concomitant diseases , illnesses or conditions occurring within a single animal or human are often labeled as “ co - morbidities ”, a term often shortened and referred to as “ co - morbid .” new medicaments and delivery technologies are providing patients and their health care practitioners with unprecedented therapeutic options in managing diseases , illnesses and conditions . in spite of this sophistication , there has been no effort to develop new methods of using fixed combinations of medicaments for therapy of co - morbid diseases , illnesses or conditions . moreover , there has been no effort to develop new methods of using fixed combinations of medicaments for management of a single disease , illness or condition affecting one or more organ system ( s ). the aforementioned fixed combinations may include a plurality of medicaments , which may be newly discovered and developed , or have been known for sometime or some combination of medicaments thereof . in any regard , said fixed combinations have not previously been contemplated in the art . the following examples will illustrate the invention in further detail . it will be readily understood that the various plurality of medicaments that may be introduced into the receiving chambers of the multi - compartment vehicles of the present invention , as generally described and illustrated in the examples herein , are to be viewed as exemplary of the principles of the present invention , and not as restrictive to a particular structure or process for implementing those principles . thus , the following more detailed description of the presently preferred embodiments of the methods , formulations , and compositions of the present invention , as represented in examples i - v , is not intended to limit the scope of the invention , as claimed , but is merely representative of presently preferred embodiments of the invention . referring to fig1 , in one presently preferred embodiment of the present invention , a plurality of medicaments are delivered in a single vehicle for management of co - morbid diseases , illnesses or conditions . more particularly , a plurality of medicaments comprising an hmg coa reductase inhibitor , for example , atorvastatin ( lipitor ® manufactured by pfizer , inc . ), and a serotonin reuptake inhibitor , for example , sertraline ( zoloft ® manufactured by pfizer , inc . ), may be combined into a single delivery apparatus , for example , a multi - compartment capsule . in the presently preferred embodiment , a therapeutically effective amount of atorvastatin ( lipitor ® manufactured by pfizer , inc . ), may be introduced into a receiving chamber of a secondary capsule . the base and cap of the secondary capsule may then be sealed using any available conventional means readily known to those skilled in the art . the secondary capsule may then be introduced into a receiving chamber in a primary capsule . a therapeutically effective amount of sertraline ( zoloft ® manufactured by pfizer , inc .) may be introduced into the receiving chamber of the primary capsule . the base and cap of the primary capsule may then be sealed using any available conventional means readily known to those skilled in the art . a capsular format of the present invention may include the following composition : the incorporation of time - release coatings to vary the release rates of the medicaments ( e . g ., sertraline ( zoloft ® manufactured by pfizer , inc .) and atorvastatin ( lipitor ® manufactured by pfizer , inc .)) in the primary and secondary capsules , respectively , of the multi - compartment capsule may be used to target key time intervals or events when the body may be most able to utilize the named active ingredients . for example , hmg coa reductase inhibitors are known to as much as a 70 % increase in efficacy when administered in the evening hours . thus , by varying the composition of the secondary capsular wall , release of the contents of the secondary capsule may be targeted to an optimal delivery time . a differential release between the primary capsule and secondary capsule may therefore optimize management of co - morbid conditions in a patient . the patient is able to take a single daily administration vehicle , which provides a plurality of medicaments for managing co - morbid conditions . thus , the incorporation of time - release coatings in the encapsulation process when forming a multi - compartment capsule may be specifically designed to fit the needs and desires of numerous different users having similar conditions that are being targeted for treatment . it is intended , therefore , that the examples provided herein be viewed as exemplary of the principles of the present invention , and not as restrictive to a particular structure or method for implementing those principles . referring to fig2 , in one presently preferred embodiment of the present invention , a plurality of medicaments are delivered in a single vehicle for management of co - morbid diseases , illnesses or conditions . more particularly , a plurality of medicaments comprising a thiazolidinedione derivative , for example , rosiglitazone ( avandia ® manufactured by glaxo smithkline ), and a serotonin reuptake inhibitor , for example , paroxetine ( paxil ® manufactured by glaxo smithkline ) may be combined into a single delivery apparatus , for example , a multi - compartment capsule . in the presently preferred embodiment , a therapeutically effective amount of paroxetine ( paxil ® manufactured by glaxo smithkline ) may be introduced into a receiving chamber in a secondary capsule . the base and cap of the secondary capsule may then be sealed using any available means readily known to those skilled in the art . a therapeutically effective amount of rosiglitazone ( avandia ® manufactured by glaxo smithkline ) may be introduced into a receiving chamber in a primary capsule . the secondary capsule may then be introduced into a receiving chamber in a primary capsule . the primary capsule may then be sealed using any available means readily known to those skilled in the art . a capsular format of the present invention may include the following composition : the incorporation of time - release coatings to varying the release rates of the medicaments ( e . g ., rosiglitazone ( avandia ® manufactured by glaxo smithkline ) and paroxetine ( paxil ® manufactured by glaxo smithkline )) in the primary and secondary capsules , respectively , of the multi - compartment capsule may be used to target key time intervals or events when the body may be most able to utilize the named active ingredients . for example , paroxetine ( paxil ® manufactured by glaxo smithkline ) is known to have sedating effects similar to antihistamines . therefore , to minimize these effects on activities of daily living , paroxetine ( paxil ® manufactured by glaxo smithkline ) is recommended for administration in the evening hours . thus , by varying the composition of the secondary capsule wall , release of the contents of the secondary capsule may be targeted to an optimal time . a differential release between the primary capsule and secondary capsule may therefore optimize management of co - morbid conditions in a patient . the patient is able to take a single daily administration vehicle , which provides a plurality of medicaments for managing co - morbid conditions . thus , the incorporation of time - release coatings in the encapsulation process when forming a multi - compartment capsule may be specifically designed to fit the needs and desires of numerous different users having similar conditions that are being targeted for treatment . it is intended , therefore , that the examples provided herein be viewed as exemplary of the principles of the present invention , and not as restrictive to a particular structure or method for implementing those principles . referring to fig3 , in one presently preferred embodiment of the present invention , a plurality of medicaments are delivered in a single vehicle for management of co - morbid diseases , illnesses or conditions . more particularly , a plurality of medicaments comprising a bisphosphonate , for example , alendronate ( fosamax ® manufactured by merck & amp ; co .) and an hmg coa reductase inhibitor , for example , simvastatin ( zocor ® manufactured by merck & amp ; co .) may be combined into a single delivery apparatus , for example , a multi - compartment capsule . in the presently preferred embodiment , a therapeutically effective amount of simvastatin ( zocor ® manufactured by merck & amp ; co .) may be introduced into a receiving chamber in a secondary capsule . the base and cap of the secondary capsule may then be sealed using any available conventional means readily known to those skilled in the art . the secondary capsule may then be introduced into a receiving chamber in a primary capsule . a therapeutically effective amount of alendronate ( fosamax ® manufactured by merck & amp ; co .) may be introduced into a receiving chamber in a primary capsule . the base and cap of the primary capsule may then be sealed using any available conventional means readily known to those skilled in the art . a capsular format of the present invention may include the following composition : the incorporation of time - release coatings to varying the release rates of the medicaments ( e . g ., alendronate ( fosamax ® manufactured by merck & amp ; co .) and simvastatin ( zocor ® manufactured by merck & amp ; co .)) in the primary and secondary capsules , respectively , of the multi - compartment capsule may be used to target key time intervals or events when the body may be most able to utilize the named active ingredients . for example , hmg coa reductase inhibitors are known to as much as a 70 % increase in efficacy when administered in the evening hours . therefore , to maximize its effects , simvastatin ( zocor ® manufactured by merck & amp ; co .) is recommended for administration in the evening hours . moreover , alendronate ( fosamax ® manufactured by merck & amp ; co .) is known to have an extremely low bioavailability following oral administration . alendronate ( fosamax ® manufactured by merck & amp ; co .) is recommended to be taken on an empty stomach upon waking in the morning . it is also recommended that the patient stay in an upright position for at least 30 minutes following administration . therefore the presently preferred embodiment of the present invention is ideally suited for increasing patient compliance . thus , by varying the composition of the secondary capsule wall , release of the contents of the secondary capsule may be targeted to an optimal delivery time . a differential release between the primary capsule and secondary capsule may therefore optimize management of co - morbid conditions in a patient . the patient is able to take a single daily administration vehicle , which provides a plurality of medicaments for managing co - morbid conditions . thus , the incorporation of time - release coatings in the encapsulation process when forming a multi - compartment capsule may be specifically designed to fit the needs and desires of numerous different users having similar conditions that are being targeted for treatment . it is intended , therefore , that the examples provided herein be viewed as exemplary of the principles of the present invention , and not as restrictive to a particular structure or method for implementing those principles . referring to fig4 , in one presently preferred embodiment of the present invention , a plurality of medicaments are delivered in a single vehicle for management of co - morbid diseases , illnesses or conditions . more particularly , a plurality of medicaments comprising a beta - adrenergic receptor antagonist , for example , metoprolol ( toprol xl ® manufactured by astrazeneca ) and a proton pump inhibitor , for example , omeprazole ( prilosec ® manufactured by astrazeneca ) may be combined into a single delivery apparatus , for example , a multi - compartment capsule . in the presently preferred embodiment , a therapeutically effective amount of omeprazole ( prilosec ® manufactured by astrazeneca ) may be introduced into a receiving chamber in a secondary capsule . the base and cap of the secondary capsule may then be sealed using any available conventional means readily known to those skilled in the art . the secondary capsule may then be introduced into a receiving chamber in a primary capsule . a therapeutically effective amount of metoprolol ( toprol xl ® manufactured by astrazeneca ) may be introduced into a receiving chamber in a primary capsule . the base and cap of the primary capsule may then be sealed using any available conventional means readily known to those skilled in the art . a capsular format of the present invention may include the following composition : the incorporation of time - release coatings to varying the release rates of the medicaments ( e . g ., metoprolol ( toprol xl ® manufactured by astrazeneca ) and omeprazole ( prilosec ® manufactured by astrazeneca )) in the primary and secondary capsules , respectively , of the multi - compartment capsule may be used to target key time intervals or events when the body may be most able to utilize the named active ingredients . for example , the peak acid secretion in the gastrointestinal system is believed to occur during sleep . proton pump inhibitors may therefore be more efficacious when administered in the evening hours and thus allowing a peak systemic concentration to coincide with higher levels of acid production . therefore , to maximize its effects , omeprazole ( prilosec ® manufactured by astrazeneca ) is recommended for administration in the evening hours . therefore the presently preferred embodiment of the present invention is ideally suited for increasing patient compliance . thus , by varying the composition of the secondary capsule wall , release of the contents of the secondary capsule may be targeted to an optimal delivery time . a differential release between the primary capsule and secondary capsule may therefore optimize management of co - morbid conditions in a patient . the patient is able to take a single daily administration vehicle , which provides a plurality of medicaments for managing co - morbid conditions . thus , the incorporation of time - release coatings in the encapsulation process when forming a multi - compartment capsule may be specifically designed to fit the needs and desires of numerous different users having similar conditions that are being targeted for treatment . it is intended , therefore , that the examples provided herein be viewed as exemplary of the principles of the present invention , and not as restrictive to a particular structure or method for implementing those principles . referring to fig5 , in one presently preferred embodiment of the present invention , a plurality of medicaments are delivered in a single vehicle for management of co - morbid diseases , illnesses or conditions . more particularly , a plurality of medicaments comprising an acetylcholinesterase inhibitor , for example , rivastigmine ( exelon ® manufactured by novartis , a . g ) and an angiotensin ii receptor antagonist , for example , valasartan ( diovan ® manufactured by novartis , a . g ) may be combined into a single delivery apparatus , for example , a multi - compartment capsule . in the presently preferred embodiment , a therapeutically effective amount of valasartan ( diovan ® manufactured by novartis , a . g ) may be introduced into a receiving chamber in a secondary capsule . the base and cap of the secondary capsule may then be sealed using any available conventional means readily known to those skilled in the art . the secondary capsule may then be introduced into a receiving chamber in a primary capsule . a therapeutically effective amount of rivastigmine ( exelon ® manufactured by novartis , a . g ) may be introduced into a receiving chamber in a primary capsule . the base and cap primary capsule may then be sealed using any available conventional means readily known to those skilled in the art . a capsular format of the present invention may include the following composition : the incorporation of time - release coatings to varying the release rates of the medicaments ( e . g ., rivastigmine ( exelon ® manufactured by novartis , a . g ) and valasartan ( diovan ® manufactured by novartis , a . g )) in the primary and secondary capsules , respectively , of the multi - compartment capsule may be used to target key time intervals and optimize patient compliance . for example , rivastigmine ( exelon ® manufactured by novartis , a . g ) is labeled for use in patients suffering from alzheimer &# 39 ; s disease , a type of dementia . these patients often have difficulty remembering tasks associated with activities of daily living . it is known that these patients may forget to take their medicines . by reducing the daily administration of medicine in this patient , there may be improved patient compliance . therefore the presently preferred embodiment of the present invention is ideally suited for increasing patient compliance . thus , by varying the composition of the secondary capsule wall , release of the contents of the secondary capsule may be targeted to an optimal time . a differential release between the primary capsule and secondary capsule may therefore optimize management of co - morbid conditions in a patient . the patient is able to take a single daily administration vehicle , which provides a plurality of medicaments for managing co - morbid conditions . thus , the incorporation of time - release coatings in the encapsulation process when forming a multi - compartment capsule may be specifically designed to fit the needs and desires of numerous different users having similar conditions that are being targeted for treatment . it is intended , therefore , that the examples provided herein be viewed as exemplary of the principles of the present invention , and not as restrictive to a particular structure or method for implementing those principles . as can be seen above , various embodiments of the present invention can be utilized in specific medical applications . by way of example only and not by way of limitation , the present invention can be practiced to prepare delivery devices for use in chemotherapy to address / treat , by way of example and not by limitation , the following aspects of chemotherapy : psychological , timing ( to coincide with tumor growth for example ) route of administration , nausea , vomiting ( cinv ), compliance , and cost ( e . g . reduce hospital management of patients , reduce the number of “ repeat ” drug doses due to patient vomiting , etc .). still further , the just mentioned aspects are not limited to chemotherapy , as the present invention can be practiced to address common aspects between chemotherapy and other treatments . further by way of examples , capsules containing zofran ( ondansertron ), temodar ( temozolomide ) can be made . still further , the present invention can be used in cardiovascular treatments , for example hypertension , heart failure , and heart rhythm disorders . also , the present invention can be used in immunology ( e . g . transplant rejections , auto - immune disorders , etc .). the present invention can be used to treat neurological disorders ( such as parkinson &# 39 ; s disease , dementia , stroke , epilepsy , and migraine headache , etc . ), psychiatric disorders ( schizophrenia , bipolar disease , depression , anxiety , adhd / add , addictions , etc . ), infectious diseases ( fungal , bacterial , viral ( hiv ), etc . ), and in anesthesiology ( induction anesthesia , local anesthesia ). furthermore , the present invention has application in endocrinology ( cholesterol , diabetes , hormone replacement therapy , thyroid dysfunction , oral contraception , obesity , etc . ), dermatology ( onychomycosis , acne , rosaceae , psoriasis , etc . ), rheumatology ( arthritis , gout , osteoporosis / osteomalacia ), respiratory fields ( asthma , emphysema , cystic fibrosis , etc . ), gastro - intestinal fields ( gastro - esophageal reflux disease , ulcer prophylaxis , crohn &# 39 ; s disease , inflammatory bowel disease , etc . ), chronic renal failure ( vitamin and mineral replacement , blood pressure regulation , diabetes , depression , etc . ), genito - urinary ( enlarged prostate / bph , overactive bladder , erectile dysfunction , feminine yeast infections , etc .) and hematology - oncology ( thromboembolous , hermatopoeisis , neoplastic disease , nausea / vomiting ). the present invention may be utilized for dual / multiple disease state therapy with one capsule , dual / multiple organ system therapy with one capsule , enhanced pharmacoeconomic delivery , temporal / circadian optimized delivery , sports nutrition , sports therapy , athletic performance enhancement and law enforcement and military applications . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative , and not restrictive . one skilled in the art will recognize that this technology may be applicable for providing a wide variety a plurality of medicaments in a single delivery vehicle for management of co - morbid diseases , illnesses or conditions . other drugs that may be combined , into a single delivery apparatus , for example , a multi - compartment capsule , according to the present invention include , by way of example , lipitor ( by pfizer ), prilosec ( by astra zenica ), prevacid ( by tap ), zocor ( by merck ), celebrex ( by searle ), zoloft ( by pfizer ), paxil ( by gsk ), vioxx ( by merck ), prozac ( by lilly ), augmentin ( by gsk ), norvasc ( by pfizer ), zyprexa ( by lilly ) epo ( by amgen ), cipro ( by bayer ), lotrel ( by novartis ), topamx ( by johnson and johnson ), glucotrol xl ( by pfizer ), claritin ( by schwiring ), wellbutrin sr ( by gsk ), difucan ( by pfizer ), prilosec / nexium ( by astra zenica ), accupril ( by pfizer ), zofran ( by gsk ), zithromax ( by pfizer ), imitrex ( by gsk ), fosamax ( by merck ) zytrec ( by pfizer ), neurontin ( by pfizer ), pravachol ( by bms ), depakote ( by abbott ). some embodiments of the invention include two or more of the just mentioned drugs combined in a single delivery apparatus , while other embodiments of the invention include only one of the just mentioned drugs combined with another pharmaceutical and / or nutriceutical and / or other substances , such as , by way of example and not by way of limitation , one or more of the pharmaceuticals and / or nutraceuticals and / or other substances listed in appendix i . still further , some embodiments of the invention include two or more of the pharmaceuticals and / or nutraceuticals and / or other substances listed in appendix i in a single delivery apparatus . in this regard , the present invention includes an apparatus and a method for delivering a plurality of the medicaments listed in appendix i for management of co - morbid diseases , illnesses , and / or conditions , as would be understood by one of ordinary skill in the art furnished with the teachings of the present invention . it is further noted that a singe delivery apparatus , to deliver a plurality of medicaments for management of co - morbid diseases , illnesses or conditions according to the present invention may include a deliver apparatus as is disclosed in u . s . application ser . no . 10 / 369 , 427 , filed feb . 18 , 2003 , entitled “ multi - phase , multi - compartment capsular delivery apparatus and methods for using same ,” the contents of which are hereby incorporated by reference in their entirety ; u . s . application ser . no . 10 / 368 , 951 , filed feb . 18 , 2003 , entitled “ process for encapsulating multi - phase , multi - compartment capsules ,” the contents of which are hereby incorporated by reference in their entirety ; u . s . application ser . no . 10 / 369 , 244 , filed on feb . 18 , 2003 , and entitled “ multi - phase , multi - compartment capsular delivery apparatus for therapeutic compositions and methods for using same ” the contents of which are hereby incorporated by reference in their entirety ; u . s . application ser . no . 10 / 369 , 247 , filed feb . 18 , 2003 , and entitled “ process for encapsulating multi - phase , multi - compartment capsules for therapeutic compositions ,” the contents of which are hereby incorporated by reference in their entirety ; and pct / us / 03 / 10816 filed apr . 9 , 2003 , and entitled “ multi - phase , multi - compartment capsular system ”, the contents of which are hereby incorporated by reference in their entirety , the apparatus delivering these pharmaceuticals and / or nutraceuticals and / or other substances containing them in a common phase ( e . g ., all solid , all liquid , etc . ), or in a multi - phase ( e . g ., one substance solid and one substance liquid ; two substances solid and one substance liquid , etc .) state as disclosed in the just mentioned references . 2 - pam : acetylcholinesterase reactivator pralidoxime ( protopam ) { 2 - pam }: peripheral acetylcholinesterase reactivator for certain phosphoryl - enzyme complexes albuterol ( ventolin , proventil ) clonidine ( catapres ) methoxamine ( vasoxyl ) oxymetazoline ( afrin ) phenylephrine ( neo - synephrine ) ritodrine ( yutopar ) salmeterol ( serevent ) terbutaline ( brethine ) doxazosin ( cardura ) labetalol ( trandate , normodyne ) phenoxybenzamine ( dibenzyline ) phentolamine ( regitine ) prazosin ( minipress ) terazosin ( hytrin ) tolazoline ( priscoline ) trimazosin yohimbine ( yocon ) atenolol ( tenormin ) butoxamine esmolol ( brevibloc ) labetalol ( trandate , normodyne ) metoprolol ( lopressor ) nadolol ( corgard ) pindolol ( visken ) propranolol ( inderal ) timolol ( blocadren ) disopyramide ( norpace ) flecainide ( tambocor ) ibutilide lidocaine ( xylocalne ) mexiletine ( mexitil ) moricizine ( ethmozine ) procainamide ( pronestyl , procan ) propafenone ( rythmol ) quinidine tocainide ( tonocard ) adenosine ( adenocard ) amiodarone ( cordarone ) bretylium ( bretylol ) disopyramide ( norpace ) esmolol ( brevibloc ) sotalol ( betapace ) atorvastatin ( lipitor ) cerivistatin ( baycol ) lovastatin ( mevacor ) pravastatin ( pravochol ) simvastatin ( zocor ) acebutalol ( sectral ) atenolol ( tenormin ) betaxolol ( betoptic ) bisoprolol ( zebeta ) carteolol ( cartrol ) clonidine ( catapres ) labetalol ( normodyne ) metoprolol ( toprol ) penbutalol ( levatol ) pindolol ( visken ) prazosin ( minipres ) propranolol ( inderal ) terazosin ( hytrin ) timolol ( timoptic ) amlodipine ( norvasc ) diltiazem ( cardizem ) felodipine ( plendil ) isradipine ( dynacirc ) nicardipine ( cardene ) nifedipine ( procardia ) nimodipine ( nimotop ) nisoldipine ( sular ) verapamil ( isoptin , calan ) benazepril ( lotensin ) bepridil ( vascor ) captopril ( capoten ) enalapril ( vasotec ) fosinopril ( monopril ) lisinopril ( prinivil , zestril ) moexipril ( univasc ) quinapril ( accupril ) ramipril ( altace ) amiloride ( midamor ) bumetanide ( bumex ) chlorothalidone ( hygroton ) ethacrynic acid ( edecrin ) furosemide ( lasix ) hydrochlorothiazide ( diuril ) indapamide ( lozol ) metolazone ( zaroxolyn ) torsemide ( demadex ) triamterene hydralazine ( apresoline ) minoxidil ( rogaine ) nitroprusside ( nipride ) prazosin ( minipres ) reserpine sotalol ( brevibloc ) spironolactone ( aldactone ) terazosin ( hytrin ) beclomethasone betamethasone cortisone dexamethasone fluticasone ( flovent / flonase ) hydrocortisone methylprednisolone prednisolone prednisone triamcinolone famotidine ( pepcid ) nizatidine ( axid ) pantoprazole ( protonix ) rabeprazole ( aciphex ) ranitidine ( zantac ) carbamazepine ( tegretol ) divalproex sodium ( depakote ) felbamate ( felbatol ) gabapentin ( neurontin ) lamotrigine ( lamictal ) oxcarbazepine ( trileptal ) phenytoin ( dilantin ) topiramate ( topamax ) zonisamide ( zonegran ) almotriptan ( axert ) frovatriptan ( frova ) naratriptan ( amerge ) rizatriptan ( rizalt ) sumatriptan ( imitrex ) zolmitriptan ( zomig ) alprazolam ( xanax ) clonazepam ( klonopin ) clorazepate ( tranxene ) diazepam ( valium ) flumazenil ( romazicon )— antagonist lorazepam ( ativan ) midazolam ( versed ) triazolam ( halcion ) codeine etorphine fentanyl ( sublimaze ) hydrocodeine hydromorphone meperidine ( demerol ) methadone ( dolophine ) morphine oxycodone propoxyphene levodopa carbidopa bromocriptine ( parlodel ) pergolide ( permax ) amantadine ( symmetrel ) selegiline ( deprenyl ) anticholinergic agents dopamine agonists baclofen ( lioresal ) botulinum toxin type a ( botox ) carisoprodol ( soma , rela ) chlorphenesin ( maolate ) chlorzoxazone ( paraflex ) cyclobenzaprine ( flexeril ) dantrolene ( dantrium ) diazepam ( valium ) metaxalone ( skelaxin ) methocarbamol ( robaxin ) orphenadrine ( norflex ) tizanidine ( zanaflex ) amitriptyline ( elavil , endep ) clomipramine ( anafranil ), also a ssri desipramine ( norpramin ) doxepin ( sinequan ) imipramine ( tofranil ) maprotiline ( ludiomil ) nortriptyline ( aventyl , pamelor ) protriptyline ( vivactil ) clorgyline ( specific for mao type a ) isocarboxazid ( marplan ) phenelzine ( nardil ) tranylcypromine ( parnate ) citalopram ( celexa ) clomipramine ( anafranil ) escitalopram ( lexapro ) fluoxetine ( prozac ) fluvoxamine ( luvox ) paroxetine ( paxil ) sertraline ( zoloft ) barbiturates benzodiazepines buspirone ( buspar ) chloral hydrate doxepin hydroxyzine sedative - hypnotics serotonin reuptake inhibitors acetohexamide ( dymelor ) chlorpropamide ( diabinese ) glimepiride ( amaryl ) glipizide ( glucotrol ) glyburide ( micronase , diabeta ) tolazamide ( tolinase ) tolbutamide ( orinase ) bromocriptine ( parlodel ) chorionic gonadotropin ( hcg ) corticotropin generic ( acth ) cosyntropin ( cortrosyn ) desmopressin ( ddavp ) gonadorelin acetate ( gnrh ) ( lutrepulse ) gonadorelin hydrochloride ( gnrh ) ( factrel ) goserelin acetate ( zoladex ) growth hormone histrelin ( supprelin ) leuprolide ( lupron ) menotropins ( hmg ) ( pergonal , humegon ) nafarelin ( synarel ) octreotide ( sandostatin ) oxytocin ( pitocinit , syntocinon ) pergolide ( permax ) protirelin ( thypinone , relefact trh ) sermorelin ( ghrh ) ( geref ) somatrem ( protropin ) somatropin ( humatrope , nutropin ) thyrotropin ( tsh ) ( thytropar ) urofollitropin ( metrodin ) vasopressin ( pitressin synthetic ) aspirin diclofenac ( cataflam , voltaren ) diflusnisal ( dolobid ) etodolac ( lodine ) fenoprofen ( nalfon ) flubiprofen ( ansaid ) ibuprofen ( motrin , advil , nuprin ) indomethacin ( indocin ) ketoprofen ( orudis ) ketorolac ( toradol ) meclofenamate nabumetone ( relafen ) naproxen ( naprosyn ) oxaprozin ( daypro ) phenylbutazone piroxicam ( feldene ) salicylate sulindac ( clinoril ) tolmetin ( tolectin ) brompheniramine ( dimetane ) cetirizine ( zyrtec ) chlorpheniramine ( chlor - trimeton ) clemastine ( tavist ) cyproheptadine ( periactin ) dimenhydrinate ( dramamine ) diphenhydramine ( bendaryl ) doxylamine ( sominex , unisom ) fexofenadine ( allegra ) loratidine ( claritin ) aspirin clopidogrel ( plavix ) fibrinolytic inhibitors fibrinolytics glycoprotein ( gp ) iib / iiia antagonists / monoclonal antibodies heparin low - molecular weight heparins plasma fractions — blood factors ticlopidine ( ticlid ) vitamin k warfarin ( coumadin ) amoxicillin ( amoxil polymox ) ampicillin ( principen , omnipen ) benzathine penicillin g benzyl penicillin ( penicillin g ) carbenicillin ( geocillin ) cloxacillin ( cloxapen ) dicloxacillin ( dynapen ) methicillin ( staphcillin ) mezlocillin nafcillin ( nafcil , unipen ) oxacillin phenoxymethyl penicillin ( penicillin v ) piperacillin ( pipracil ) ticarcillin ( ticar ) cefaclor ( ceclor ) cefoxitin ( mefoxin ) cefpodoxime ( vantin ) cefuroxime ( zinacef , ceftin ) loracarbef ( lorabid ) cefoperazone cefotaxime ( claforan ) cefotetan ceftazidime ( fortax , taxidime , tazicef ) ceftriaxone ( rocephin ) veftizoxime ( cefizox ) amikacin ( amikin ) gentamicin ( garamycin ) kanamycin ( kantrex ) neomycin netilmicin ( netromycin ) streptomycin tobramycin co - trimoxazole silver sulfadiazine sodium sulfacetamide sulfamethoxazole ( gantanol ) sulfasalazine ( azulfidine ) ( salicylazosulfapyridine ) sulfisoxazole ( gantrisin ) sulfonamides ciprofloxacin ( cipro ) gatifloxacin ( tequin ) levofloxacin ( levaquin ) lomefloxacin ( maxaquin ) nalidixic acid ofloxacin ( floxin ) amphotericin b ( fungizone , amphotec ) clotrimazole ( mycelex ) fluconazole ( diflucan ) flucytosine griseofulvin itraconazole ( sporanox ) ketoconazole ( nizoral ) miconazole ( monistat ) nystatin ( mycostatin ) acyclovir ( zovirax ) didanosine ( ddi ) foscarnet ( foscavir ) ganciclovir ( dhpg , cytovene ) ribavirin rimantadine stavudine ( d4t )) valacyclovir ( valtrex ) vidarabine ( vira - a ) zalcitabine ( ddc ) zidovudine ( azidothymidine , azt ) busulfan ( myleran ) carboplatin ( paraplatin ) carmustine ( bncu , bicnu ) cisplatin ( platinol ) cyclophosphamide ( cytoxan ) ifofamide ( ifex ) lomustine ( ccnu , ceenu ) mechlorethamine ( mustargen ) melphalan ( alkeran ) procarbazine ( matulane ) thiotepa bleomycin ( blenoxane ) dactinomycin ( cosmegen ) daunorubicin ( daunoxome ) doxorubicin ( adriamycin ) mitomycin ( mutamycin ) amsacrine ( amsa ) azathioprine ( imuran ) capecitabine ( xeloda ) chlorambucil ( leukeran ) cyclosporine ( sandimmune , neoral ) gemcitabine ( gemzar ) hydroxyurea ( hydrea ) mitotane ( sodren ) mitoxantrone ( novantrone ) pamidronate ( aredia ) 15 - desoxyspergualin corticosteroids cyclosporine interferons interleukins mycophenolate mofetil sirolimus ( rapamycin ) tacrolimus thalidomide calcium ion iodine iron magnesium ion phosphorous potassium ion selenium sodium ion zinc vitamin c thiamine ( vitamin b1 ) riboflavin ( vitamin b2 ) niacin ( vitamin b3 ) pyridoxine ( vitamin b6 ) folate cyanocobalamin ( vitamin b12 ) medicaments used to alleviate symptoms of allergic rhinitis , upper respiratory symptoms , cough , mild aches and pains

US-71999310-A

the present invention is a physiologically active , substantially non - immunogenic water soluble polyethylene glycol protein conjugate having the same utility as the protein which forms the conjugate , without having the same properties of producing an immunogenic response possessed by the protein which forms this conjugate .

in accordance with this invention , the protein conjugate of formula i is produced by condensing activated peg where hydroxy has been replaced by an activated linker , with one or more of the free amino groups in the proteins . the activated peg compounds used to produce the conjugate have the following formulae : ## str2 ## wherein r is as above , r 4 is lower alkyl or cycloalkyl , and r 5 and r 6 are lower alkyl or h . in accordance with this invention , by using the activated peg compound of formula ii - a , ii - b , ii - c , ii - d , ii - e , or ii - f to produce the conjugates , a linking bond between the free amino groups in the protein and the peg is formed so that the resulting conjugate retains at least a portion of the biological activity of the protein while reducing its immunogenicity . in addition , the linkage groups formed in the conjugate of this invention through the use of any one of the activated polyethylene glycols of formulae ii - a through ii - f produces a protein conjugate which is not readily susceptible to in vivo hydrolytic cleavage and is not subject to many of the disadvantages present in the peg protein conjugates of the prior art . in accordance with this invention , r 1 , r 5 , and r 6 can be any lower alkyl , preferably methyl . the term lower alkyl designates lower alkyl groups containing from 1 through 6 carbon atoms , such as methyl , ethyl , n - propyl , isopropyl , etc . generally the preferred alkyl group is a lower alkyl group containing from 1 to 4 carbon atoms with methyl being most preferable . in accordance with this invention , m and n can be selected from any combination of numbers such that the resulting protein conjugate contains at least a portion of the biological activity of the polymer which forms the conjugate . it is apparent that the sum of n and m is inversely proportional to the amount of biological activity of the protein which is retained by the conjugate . the numerical value of n relates the number of ethylene glycol units in the polyethylene glycol which form the conjugate . the term m relates to the number of free amino groups contained by the protein which is reacted with the activated peg . the higher the value of m and n , the higher the molecular weight of the conjugate . when the compound of any one of formula ii - a through ii - f is reacted with the protein and the protein contains more than one free amino group , the conjugate may be produced as a mixture of various protein peg conjugates . in cases where the protein contains two free amino groups , the activated peg can react both with one of the free amino groups and with both of the free amino groups . in this situation the mixture contains one conjugate formed where two free amino groups are reacted with peg and a second conjugate formed where only one free amino group is reacted with peg . since the various conjugates in this mixture have different molecular weights , these conjugates can be separated by conventional methods such as chromatography . to determine if m and n have been selected properly , the separated conjugates can be screened for biological activity by the same means used to screen the parent protein to determine if the conjugate still retains a portion of the biological activity of the protein used to form the conjugate . in this manner , the numbers m and n can be adjusted in any desired manner to provide the desired activity . in accordance with the preferred embodiment of this invention m and n are any number so that molecular weight of the conjugate , excluding the weight of the protein , is between approximately 300 to approximately 30 , 000 daltons . in accordance with the preferred embodiment , m is 1 . where m is 1 , this conjugate can be obtained even when there are two or more free amino groups . the activated peg compound will react first with one of the free amino groups contained within the protein groups . by regulating the concentration of the reagents such as the protein , and reaction conditions , in accordance with standard methods of amine condensation , one can regulate the degree of pegylation of the free amino groups contained within the protein . in proteins containing one or more free amino groups , where one of the free amino groups is more reactive than the other amino groups , conditions may be selected so that the protein is reacted with the activated peg compound to form the compound of formula i where m is 1 . other free amino groups contained within amino acids which form the protein may be subsequently reacted with the peg by allowing the condensation reaction to proceed longer or by utilizing other stronger conditions . in accordance with a preferred embodiment where m is 1 , n is any number so that the polyethylene glycol which forms the conjugate has a molecular weight of from 300 to 300 , 000 daltons . where r 4 is lower alkyl , r 4 can be any lower alkyl group containing from 1 to 6 carbon atoms such as defined above . when r 5 is cycloalkyl , r 5 is preferably a cycloalkyl group containing from 3 to 7 carbon atoms such as cyclopropyl , cyclopentyl , cyclobutyl , and cyclohexyl . the preferred cycloalkyl group is cyclohexyl . the title compounds of each of the following examples are named in accordance with iupac nomenclature . however , these compounds may also be named as follows : to produce the protein conjugate wherein r 2 is -- nh --, and r 3 is ═ n -- r 4 , ( the compound of formula i - a ) the following reaction scheme may be employed : ## str3 ## wherein r , r 4 , n and m are as above , in the reaction scheme , the hydroxyl group at the end of the peg molecule is converted to a halogen group by conventional means such as by treatment with a thionyl halide . the resulting peg halide is converted to an azide by conventional means such as by treatment with sodium azide . the peg azide can then be converted to an amine by conventional means such as hydrogenation . the peg - amine is then reacted with an alkyl or cycloalkyl isothiocyanate such as cyclo - hexylisothiocyanate to form the thiourea of formula iii which is then desulfurized by conventional means to form the compound of formula ii - a which contains the carbodiimide functional group . in converting the thiourea of formula iii into the peg carbodiimide of formula iia , the preferred desulfurizing agent is triphenylphosphine . the peg carbodiimide of formula ii - a can then be condensed with a protein under any conventional conditions for condensing carbodiimides with amines . generally this reaction is carried out in a standard aqueous buffer solution having ph of between 7 and 9 to produce the conjugate of formula i - a . the resulting condensation reaction may produce a mixture of peg protein conjugates of various molecular weights depending upon the number of free amino groups within the protein and the time of the reaction . the peg protein conjugates may then be separated into their individual components by conventional methods such as high performance liquid chromatography or gel electrophoresis . to produce the protein conjugate where r 2 is -- o -- and r 3 is ═ s , ( the compound of formula ib ) the following reaction scheme can be employed . ## str4 ## wherein r , m and n are as above , in this reaction a peg is refluxed with 1 , 1 - carbonothioylbis - 2 ( 1h )- pyridinone in a high boiling hydrocarbon solvent to produce the compound of formula ii - b . the compound of formula ii - b can be condensed with one or more of the free amino groups of the protein to produce the conjugate of formula i - b in the same manner as described in connection with the condensation of the compound of formula ii - a with a protein to prepare the conjugate mixture of formula i - a . separation of this mixture can be carried out according to molecular weights of the products formed as described hereinbefore . to produce the protein conjugate where r 2 is -- nh -- and r 3 is ═ o , ( the compound of formula i - c ) the following reaction scheme can be used : ## str5 ## wherein r , r 5 , m and n are as above , the compound of formula iv is produced by condensing phosgene with 2 - hydroxypyridine ( substituted if r 5 = lower alkyl ) using any conventional method for condensing an acid halide with an alcohol . the condensation of a peg amine with the compound of formula iv is effected by refluxing in a halogenated hydrocarbon solvent to produce the compound of formula ii - c . the compound of formula ii - c is condensed with the protein through one or more free amino groups on the protein to produce the compound of formula i - c . this reaction is carried out in the manner described for the condensation of the compound of formula ii - a to produce the conjugate of formula i - a . depending upon the number of free amino groups contained within the protein which react with the compound of formula ii - c , the conjugate of formula i - c may be formed as a mixture of conjugates having different molecular weights . this conjugate mixture can be separated in the manner described hereinbefore . to produce a protein conjugate of the present invention wherein r 2 is -- nh -- and r 3 is s , ( the compound of formula i - d ) the following reaction scheme can be used . ## str6 ## in this reaction scheme , peg amine is reacted with di - 2 - pyridylthionocarbonate to produce the compound of formula ii - d . in this procedure any conventional method of condensing an amine with a thiocarbonate to produce an isothiocyanate can be used . the compound of formula ii - d is reacted with the protein to form the conjugate of formula i - d in the manner described for the conversion of the compound of formula ii - a to the compound of formula i - a . depending upon the amount of free amino groups contained by the protein , condensation of the compound of formula ii - d with the protein produces a mixture of conjugates which can be separated into their individual components in the manner hereinbefore described for the separation of the conjugate of formula i . alternatively , the compound of formula i - d can be produced using the following reaction scheme : ## str7 ## the compound of formula v is produced by condensing thiophosgene with 2 - hydroxypyridine ( substituted where r 6 is lower alkyl ), using any conventional method for condensing an acid halide with an alcohol . v is then reacted with a peg - amine in the manner described for producing the compound of ii - c . the resulting compound is ii - e . the compound of formula ii - e is condensed with one or more free amino groups on a protein to produce the conjugate of formula i - d . this reaction is carried out in the manner described for the formation of conjugate i - a . the protein conjugate of the present invention where r 2 is -- o -- and r 3 is ═ s , ( the compound of formula i - e ) is produced by the following reaction scheme : ## str8 ## wherein r , m and n are as above . in accordance with this scheme , peg is reacted with the thiocarbonate of formula vi in an organic solvent to form the peg thiocarbonate of formula ii - f . any conventional method of condensing a thiocarbonate with a hydroxy group can be used in carrying out this reaction . the compound of formula ii - f is converted to the conjugate of formula i - e by condensing the compound of formula ii - f with at least one free amino group of the protein . this reaction is carried out in the manner described for the conversion of compound of formula ii - a to the conjugate of formula i - a . the product that is produced by this reaction can be a mixture of conjugates of different molecular weights depending upon the amount of free amino groups in the protein used . these conjugates can be separated by molecular weight in accordance with the procedure hereinbefore described . the interleukin - 1 receptor antagonist ( il - 1ra ) herein may be obtained from tissue cultures or by recombinant techniques . one method of obtaining il - 1ra is to treat u937 human myelomonocytic cells ( atcc crl 1594 ) with the differentiating agent phorbol myristate acetate ( pma ) and then stimulate them with granulocyte macrophage - colony stimulating factor ( obtainable from amgen ), and isolating and purifying the il - 1ra from the culture supernatant liquid as described by carter et al . nature 344 633 - 637 ( 1990 ). recombinant il - 1ra refers to il - 1ra having comparable biological activity to native il - 1ra but prepared by recombinant techniques as described by carter et al . supra or by eisenberg et al . nature 343 341 - 346 ( 1990 ). in accordance with this invention , it has been found that the protein - conjugates of this invention have the same utility as the protein used to form the conjugate . therefore , these conjugates are therapeutically active in the same manner as the protein from which they are formed and can be used in the same manner as this protein without producing the immune response connected with the administration of proteins to subjects in accordance with another embodiment of this invention , an interferon composition can be produced by the following reaction scheme ; ## str9 ## wherein r , m , and n are as above . in the above reaction scheme , di - 2 - pyridyl carbonate is reacted with peg - alcohol to produce the compound of formula vii . this reaction is carried out using conventional conditions for condensing an alcohol with a carbonate . the compound of formula vii is converted to the compound of formula viii by condensing the former compound with one or more free amino groups of the protein interferon . this reaction is carried out as described for the conversion of the compound of formula ii - a to the compound of formula i - a . the reaction mixture thus produced can contain a mixture of the conjugates of formula viii depending on the number of free amino groups contained by the protein . this mixture constitutes a mixture of various conjugates of different molecular weights . the various conjugates can be separated from the mixture as described hereinbefore . interferon includes all types of interferon , such as α , β , and δ interferon , and any subtypes of any types . interferon may be obtained from tissues or tissue cultures , or may be produced using recombinant techniques . methods for generating and isolating natural or recombinant interferon are well known in the art . a . preparation of alpha -( 2 - chloroethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 ( as used herein sru designates the number of self - repeating units present in the peg polymer ). from a slurry of 50 g mpeg ( methoxypolyethylene glycol , molecular weight - 5000 ) in 700 ml of toluene was distilled 200 ml of the solvent . to the refluxing solution was added dropwise 0 . 8 ml of dry pyridine and 2 . 2 ml of thionyl chloride . after refluxing for four hours the reaction was allowed to stir overnight . the solvent was then removed under reduced pressure and 500 ml of ch 2 cl 2 added to the residue . the resultant solution was then dried with anhydrous k 2 co 3 and passed through 50 g of basic alumina ( wolem super i ). most of the ch 2 cl 2 was then removed under reduced pressure and one liter of diethyl ether added to the resultant syrup . the ether was removed by distillation and additional diethyl ether added to cause precipitation . the mixture was stirred at room temperature for two hours and then filtered to give 45 g of alpha -( 2 - chloroethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 anal . calcd for c 3 h 7 clo ( ch 2 ch 2 o ) 111 . 7 c , 53 . 97 ; h , 9 . 12 ; cl , 0 . 71 . found : c , 54 . 21 h , 8 . 70 ; cl , 0 . 71 a mixture of 20 g of sodium azide and 50 g of alpha -( 2 - chloroethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 was heated at 120 °- 125 ° c . in 375 ml of dry dmf . after 7 hours the solvent was removed under high vacuum . the residue was dissolved in 500 ml of ch 2 cl 2 and filtered through diatomaceous earth . most of the ch 2 cl 2 was then boiled off and diethyl ether added to cause precipitation . the mixture was stirred overnight and then filtered . the residue was then dissolved in a minimum of glyme at 50 ° c ., the solution cooled , and the precipitated product filtered to give alpha -( 2 - azidoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 anal . calcd for c 3 h 3 n 3 o ( ch 2 ch 2 o ) 111 . 7 : c , 53 . 77 ; h , 9 . 09 ; n , 0 . 84 . found : c , 53 . 61 ; h , 9 . 08 ; n , 0 . 89 . to a mixture of 25 g of alpha -( 2 - azidoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 in 250 ml of dry glyme was added 3 . 5 g of 10 % pd / c . the mixture was then placed under an atmosphere of 50 p . s . i . of h 2 and shaken at 50 ° c . for 18 hours . the mixture was then filtered , the solids washed with ch 2 cl 2 and the combined organic solutions placed under reduced pressure to remove the solvent . the residue was then dissolved in 100 ml of warm glyme , and the product allowed to precipitate from the cooled solution . the precipitate was filtered and dried by warming under reduced pressure to give 23 g of alpha -( 2 - aminoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 anal . calcd for c 3 h 9 no ( ch 2 ch 2 o ) 111 . 7 : c , 54 . 43 ; h , 9 . 20 ; n , 0 . 28 . found : c , 54 . 43 ; h , 9 . 18 ; n , 0 . 36 . alternatively a solution of 40 g of alpha -( 2 - azidoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 and 6 . 7 g ( 25 . 6 mmol ) of triphenylphosphine dissolved in 200 ml of dry ch 2 cl 2 was stirred overnight under an atmosphere of argon . water ( 2 ml ) was added and the mixture stirred an additional 12 hours . most of the methylene chloride was removed under vacuum and 400 ml of diethyl ether added . the precipitate was filtered , washed with ether and dissolved in 300 ml of warm ( 50 ° c . ) glyme . the solution was allowed to stand at room temperature overnight and the resulting precipitate filtered , washed with 2 × 100 ml of glyme , 2 × 100 ml of diethyl ether and dried in a vacuum oven under a stream of n 2 to give 35 g of alpha -( 2 - aminoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 to a solution of 4 g of alpha -( 2 - aminoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 in 60 ml of dry glyme at 40 ° c . was added 0 . 1 ml of cyclohexyl isothiocyanate . the solution was allowed to stir at 40 ° c . for 18 hours . the mixture was then filtered and the solvent removed under high vacuum . the residue was then dissolved in 100 ml of warm glyme , the solution cooled and the resulting precipitate filtered and dried under high vacuum to give 3 . 5 g of alpha - 2 - ( cyclohexylamino ) thiocarbonyl !- amino ! ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 anal . calcd for c 10 h 20 n 2 os ( ch 2 ch 2 o ) 111 . 7 : c , 54 . 25 ; h , 9 . 13 ; n , 0 . 54 ; s , 0 . 62 ; found : c , 54 . 39 ; h , 8 . 87 ; n , 0 . 55 ;. s , 0 . 59 . a solution of 1 g of alpha - 2 - 1 ( cyclohexylamino )- thiocarbonyl ! amino ! ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 , 120 mg of triphenylphosphine , 90 μl of ccl 4 and 84 μl of triethylamine in 5 ml of dry ch 2 cl 2 was refluxed for 72 hr . the solvent was then removed under reduced pressure and the residue dissolved in a minimum of dry glyme . after cooling , the product precipitated and was filtered and dried under vacuum to give alpha - 2 - ( cyclohexylcarbonimidoyl ) amino ! ethyl !- omega - methoxypoly -( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . anal . calcd for c 10 h 18 n 2 o ( ch 2 ch 2 o ) 111 . 7 : c , 54 . 61 ; h , 9 . 15 ; n , 0 . 55 . found : c , 54 . 95 ; h , 9 . 27 ; n , 0 . 50 . by the procedure described in example 1a , mpeg molecular weight 10 , 000 was converted to alpha -( 2 - chloroethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 . anal . calcd for c 3 h 7 clo ( ch 2 ch 2 o ) 225 : c , 54 . 37 ; h , 9 . 14 ; cl , 0 . 35 . found : c , 54 . 30 ; h , 9 . 15 ; cl , 0 . 41 . by the procedure described in example 1b , alpha -( 2 - chloroethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 was converted to alpha -( 2 - azidoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 . anal . calcd for c 3 h 7 n 30 ( ch 2 ch 2 o ) 225 : c , 54 . 34 ; h , 9 . 13 ; n , 0 . 42 . found : c , 54 . 32 ; h , 9 . 28 ; n , 0 . 50 . by the procedure described in example 1c , alpha -( 2 - azidoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 was converted to alpha -( 2 - aminoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 . anal . calcd for c 3 h 9 no ( ch 2 ch 2 o ) 225 : c , 54 . 48 ; h , 9 . 17 ; n , 0 . 14 . found : c , 54 . 80 ; h , 9 . 21 ; n , 0 . 12 . to a solution of freshly distilled oxalyl chloride ( 0 . 5 ml ) in 40 ml of dry ch 2 cl 2 at 0 ° c . was added dropwise 0 . 5 ml of dry dmf in 10 ml of ch 2 cl 2 . the resulting solution was warmed to room temperature , stirred for 15 min and then again cooled to 0 ° c . mpeg molecular weight 1325 , ( 5 . 6 gr ) was then added , and the resulting solution refluxed for 5 hr . the mixture was then poured into water and the mixture extracted with ch 2 cl 2 . the ch 2 cl 2 solution was dried ( mgso 4 ) and the solvent removed under reduced pressure to give 1 . 7 g of alpha -( 2 - chloroethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 28 . 3 as a white powder . anal . calcd for c 3 h 7 clo ( ch 2 ch 2 o ) 28 . 3 : c , 53 . 38 ; h , 9 . 03 ; cl , 2 . 64 . found : c , 53 . 48 ; h , 9 . 10 ; cl , 2 . 41 . by the procedure described in example 1b , alpha -( 2 - chloroethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 28 . 3 was converted to alpha -( 2 - azidoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 28 . 3 . anal . calcd for c 3 h 7 n 3 o ( ch 2 ch 2 o ) 28 . 3 : c , 53 . 12 ; h , 8 . 99 ; n , 3 . 11 . found : c , 53 . 21 ; h , 9 . 07 ; n , 2 . 98 . by the procedure described in example 1c , alpha -( 2 - azidoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 28 . 3 was converted to alpha -( 2 - aminoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 28 . 3 . anal . calcd for c 3 h 9 no ( ch 2 ch 2 o ) 28 . 3 : c , 54 . 47 ; h , 9 . 17 ; n , 0 . 14 . found : c , 54 . 44 ; h , 9 . 19 ; n , 0 . 15 . preparation of recombinant interferon - alpha ( ifn - alpha ) conjugated to peg by means of the reagent alpha - 2 - ( cyclohexylcarbonimidoyl ) amino !- ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . alpha - 2 - ( cyclohexylcarbonimidoyl ) amino ! ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 prepared according to example 1 was added to 1 mg of homogenous ifn - alpha in 200 ul of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 10 moles of reagent per one mole ifn - alpha . the solutions were thoroughly mixed and the pegylation reaction allowed to proceed at room temperature for 60 minutes . the amount of derivatization ( or pegylation ) of ifn - alpha was estimated by sds - polyacrylamide gel electrophoresis ( sds - page ) ( table 1 ). proteins were visualized by coomassie blue staining . analysis of the products from the 60 min . reaction reveals new higher molecular weight protein species corresponding to peg - conjugated ifn - alpha ifn - alpha has an apparent molecular weight of 15 kd by sds - page . unmodified ifn - alpha whose apparent molecular weight remains unchanged is therefore not conjugated with peg . the peg - modified ifn - alpha product has an apparent molecular weight of 28 kd . table i______________________________________modification of ifn - alpha with the reagent described inexample 1apparent molecular weight of % of total proteinifn protein ( kd ) from reaction______________________________________15 ( unmodified ) 8028 20______________________________________ preparation of recombinant interleukin - 2 ( ril - 2 ) conjugated to peg by means of the reagent alpha - 2 - ( cyclohexylamino ! amino ! ethyl !- omega - methyoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . alpha - 2 - ( cyclohexylamino ! amino ! ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 prepared according to example 1 was added to 2 mg of ril - 2 in 200 ul of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 10 moles of reagent per one mole ril - 2 . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . the amount of derivatization ( or pegylation ) of the protein was estimated by sds - page ( table ii ). proteins were visualized by coomassie blue staining . analysis of the products from the 60 min . reaction reveals new higher molecular weight protein species corresponding to peg - conjugated ril - 2 . ril - 2 has an apparent molecular weight of 15 kd by sds - page . unmodified ril - 2 is the protein separated from the reaction mixture whose molecular weight remains unchanged and is therefore not conjugated with peg . the predominant peg - modified ril - 2 product has an apparent molecular weight of 28 kd . table ii______________________________________modification of ril - 2 with the reagent described in exampleapparent molecular weight of % of total proteinril - 2 protein ( kd ) from reaction______________________________________15 ( unmodified ) 2028 5033 2043 10______________________________________ pegylated ril - 2 was purified from the reaction mixture as described by katre et al . proc . nat . acad . sci ., usa , 84 : 1483 , ( 1987 )! using hydrophic exchange chromatography ( bio - rad ; biogel - phenyl 5 - pw ). a linear gradient with decreasing salt from 1 . 53 to 0 . 0m ( nh 4 ) 2 so 4 in 50 mm sodium phosphate ph 7 . 0 in 30 minutes was used to separate peg - modified and unmodified ril - 2 . aliquots of the fractions were evaluated by sds - page and pooled fractions were assayed to determine its specific activity in a ctll cell proliferation assay by the method described by gillis et al j . immunology 120 : 2027 , ( 1978 )!. protein concentrations were determined spectometrically at 280 nm using an extinction coefficient of 0 . 667 for ril - 2 . the specific activity of the ril - 2 isolated proteins is expressed as units / mg protein and the results are summarized in table iii . it is apparent that specific activity of ril - 2 is not significantly altered by conjugation with peg . table iii______________________________________bioactivity of ril - 2 conjugated to peg with the reagentdescribed in example 1apparent molecular weight of specific activityril - 2 protein ( kd ) ( units / mg ) ______________________________________15 ( unmodified il2 ) 2 . 0 × 10 . sup . 728 2 . 4 × 10 . sup . 7______________________________________ preparation of recombinant interleukin 1 - alpha ( ril - 1 alpha ) conjugated to peg by means of the reagent alpha - 2 - ( cyclohexylamino ! amino ! ethyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . the reagent described in example 1 was added to 2 . 0 mg of homogenous ril - 1 alpha in 1 . 0 ml 0 . 1m sodium borate , ph 9 . 0 in a molar ratio of 10 moles of reagent per one mole ril - 1 alpha . the solution was thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . the amount of derivatization ( or pegylation ) of the protein was estimated by sds - page ( table iv ). the proteins were visualized by coomassie blue staining . analysis of the products from the 60 minute reaction reveals new higher molecular weight protein species corresponding to peg conjugated ril - 1 alpha protein . ril - 1 alpha has an apparent molecular weight of 17 kd by sds - page . unmodified ril - 1 alpha is protein from the reaction mixture whose apparent molecular weight remains unchanged and is therefore not conjugated with peg . the peg - modified ril - 1 alpha product has an apparent molecular weight of 30 kd . table iv______________________________________modification of ril - 1 alpha with the reagent described inexample 1apparent molecular weight of % of total proteinril - 1 alpha protein ( kd ) from reaction______________________________________17 ( unmodified ) 8530 15______________________________________ from a solution of 1 g ( 0 . 2 mmol ) mpeg ( methoxypolyethylene glycol ) molecular weight of 5000 , in 15 ml of dry toluene was distilled 5 ml of solvent . the resulting solution was cooled and 46 . 5 mg ( 0 . 2 mmol ) of 1 , 1 - carbonothioylbis - 2 ( 1 h )- pyridinone was added . the mixture was then refluxed under an atmosphere of argon for 4 hours . the solvent was then removed under vacuum and the residue dissolved in 5 ml of dry glyme and let stand overnight . the resulting precipitate was then filtered and washed with 2 × 5 ml of dry glyme and 5 ml of diethyl ether . the product was then dried in a vacuum oven under a slow stream of nitrogen to give 0 . 96 g of alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl ) thiocarbonyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . anal . calcd for c 9 h 11 no 3 s ( ch 2 ch 2 o ) 111 . 7 : c , 54 . 37 ; h , 8 . 99 ; n , 0 . 27 ; s , o . 62 ; found : c , 54 . 03 ; h , 8 . 98 ; n , 0 . 18 ; s , 0 . 59 . by the procedure described in example 5 , mpeg ( methoxypoly - ethylene glycol ) molecular weight 10 , 000 was converted to alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl ) thiocarbonyl !- omega - methoxy - poly ( oxy - 1 , 2 - ethanediyl ) sru 225 . anal . calcd for c 9 h 11 no 3 s ( ch 2 ch 2 o ) 225 : c , 54 . 54 ; h , 9 . 08 ; n , 0 . 14 ; s , 0 . 32 . found : c , 54 . 38 ; h , 9 . 16 ; n , 0 . 15 ; s , 0 . 31 . preparation of interleukin 1 receptor antagonist ( il - 1ra ) conjugated to peg by means of the reagent alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl ) thiocarbonyl ! omega - methoxy - poly -( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl ) thiocarbonyl !- omega - methoxy - poly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 prepared according to example 5 was added to 10 mg of homogenous il - 1ra in 1 . 0 ml of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 5 moles of reagent per one mole of il - 1ra . the solution was thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . the amount of derivatization ( or pegylation ) of the protein was estimated by sds - page ( table v ). proteins were visualized by coomassie blue staining . analysis of the products from the 60 minute reaction reveals new higher molecular weight protein species corresponding to peg - conjugated il - 1ra protein . il - 1ra has an apparent molecular weight of 19 kd by sds - page . unmodified il - 1ra is the protein from the reaction mixture whose apparent molecular weight remains unchanged and is therefore not conjugated with peg . the predominant peg - modified il - 1ra proteins have apparent molecular weights of 26 and 33 kd . table v______________________________________modification of il - 1ra with the reagent described in exampleapparent molecular weight of % of total proteinil - 1ra protein ( kd ) from reaction______________________________________19 ( unmodified ) 3626 3333 21 & gt ; 33 10______________________________________ pegylated il - 1ra was purified from the reaction mixture using hydrophobic exchange chromatography ( bio - rad ; hrlc mp7 hic ). a linear gradient with decreasing salt concentrations from 0 . 43 to 0 . 0m ( nh 4 ) 2 so 4 in 50 mm sodium phosphate ph 7 . 0 in 20 minutes was used to separate pegylated il - 1ra and unmodified il - 1ra . aliquots of fractions were evaluated by sds - page and pooled fractions were assayed in an il - 1 radioreceptor competition binding assay . kilian et al . j . immunol ., 136 , 4509 , ( 1986 )!. briefly , il - 1ra and peg - il - 1ra were incubated at varying concentrations with el - 4 membranes for 30 min at 37 ° c . the 125 i ! il - 1 alpha was then added and the incubation continued for 30 min . the assay was terminated by vacuum filtration and the collection of cell bound 125 i ! il - 1 on filter plates . the concentration of il - 1ra or peg - il - 1ra that inhibits binding of 125 i ! il - 1 by 50 % ( ic 50 ) was determined graphically . the results are shown in table vi . the ic 50 of il - 1ra in this assay is 1 - 2 . 0 ng / ml . the pegylated il - 1ra mixture retained its ability to bind to the il - 1 receptor on el - 4 membranes within a factor 2 to 3 fold relative to the unmodified ii - 1ra . table vi______________________________________inhibition of . sup . 125 i ! il - 1 binding by of il - 1ra conjugatedwith the reagent described in example 5apparent molecular weight ofil - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________19k ( unmodified ) 2 . 026k , 33k ( mixture ) 5 . 0______________________________________ the pharmacodynamics of il - 1ra protein was evaluated in vivo by the ability of the il - 1ra to inhibit ril - 1alpha induction of interleukin - 6 . serum from mice treated with ril - 1alpha contain high levels of il - 6 , mcintosh et al ., immunol . 143 : 162 , ( 1989 )!. the administration of unmodified il - 1ra together with il - 1alpha ( 0 hr time point ) inhibits the induction of il - 6 . this test system was used to compare the pharmacodynamic properties of unmodified and peg il - 1ra . groups of three female c57bi / 6 mice were injected subcutaneously with 200 ug of unmodified il - 1ra or peg - il - 1ra 48 hr , 24 hr , or 6 hr before or simultaneously ( 0 hr ) with 0 . 2 ug ril - 1 alpha . three hours later , serum samples were collected . il - 6 levels ( units ) were determined using a modification of an il - 6 assay that has been previously described van snick et al ., proc . natl . acad . sci . usa 8 : 9679 , ( 1986 )!. in the il - 6 assay , b9 hybridoma cells were treated with two fold serial dilutions of the test sera in 96 - well microtiter plates . following a 3 day incubation at 37 ° c . in a humidified atmosphere comprised of 5 % co 2 and 95 % air , the wells were pulsed with 0 . 5 uci of tritiated thymidine and incubated for an additional 18 hr . the cells were then harvested onto glass fiber filters and the level of tritiated thymidine incorporation was determined by scintillation counting . il - 6 activity is expressed as u / mi . il - 6 units are defined as the inverse of the serum dilution which produces half - maximal tritiated thymidine incorporation compared to a reference standard . the pharmacodynamic data are summarized in table d1 . mice treated only with il - 1 exhibited 28852 u / ml il - 6 . both unmodified and modified il - 1ra inhibited il - 6 induction at 0 hr . however , the pegylated il - 1ra demonstrated a prolonged il - 6 - inhibitory effect as compared to unmodified il - 1ra at 8 and 24 hours after administration . table d1______________________________________pharmacodynamic profile of il - 1ra conjugated with thereagent described in example 5time ( hr .) prior to il - 6 ( units / ml ) il - 1 administration 19 kd 26 kd______________________________________0 772 7056 8361 158724 22525 984448 18485 2111972 13220 21470______________________________________ preparation of interleukin 1 receptor antagonist ( il - 1ra ) conjugated to peg by means of the reagent alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl ) thiocarbonyl !- omega - methoxypoly -( oxy - 1 , 2 - ethanediyl ) sru 225 . il - 1ra was conjugated and purified according to the procedure illustrated in example 6 using the reagent described in example 5a . the predominant peg - modified il - 1ra proteins have apparent molecular weights of 33 kd and 48 kd . the 33 kd and 48 kd protein accounted for 46 and 27 % of the total protein in the reaction mixture , respectively . the ability of these proteins to inhibit il - 1 binding , as described in example 6 , is summarized in table vii . the 33 kd peg modified protein remains the ability to inhibit il - 1 binding within 6 - fold relative to il1 - ra and more extensive modification of the protein with peg as observed with this 48 kd protein results in a substantial loss in its biding to the il - 1 receptor . table vii______________________________________inhibition of . sup . 125 i ! il - 1 binding by il - 1ra proteinsconjugated with the reagent described in example 5aapparent molecular weight ofil - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________ 19 ( unmodified ) 1 . 6 33 9 . 0 48 50 . 0______________________________________ to determine the pharmacokinetic profile of peg - il - 1ra species , c57bf / 6 mice were administered 100 ug of modified or pegylated il - 1ra species subcutaneously . serum samples were collected after 1 , 2 , 3 , 4 , and 6 hours from mice that received unmodified il - 1ra and after 2 , 4 , 8 , 10 , and 24 hours from mice that received peg - il - 1ra . the serum levels were determined in the el4 membrane binding assay described in example 6 . the data are summarized in table d2 . the peg - il - 1ra was detectable in serum samples at higher concentrations and for prolonged time compared to il - 1ra demonstrating a prolonged serum time course . table d2______________________________________pharmacokinetic profile of il - 1ra pegylatedas in example 6a serum concentration of il - 1ratime ( hr .) after administration 19 kd 33 kd______________________________________1 4002 130 2500 404 15 8006 168 30010 25024 15______________________________________ preparation of ril - 1 alpha conjugated to peg by means of the reagent alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl - thiocarbonyl ! omega - methoxy - poly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . recombinant il - 1 alpha was pegylated with the reagent described in example 5 by the method as described in example 4 . three predominant molecular weight species from the reaction mixture were identified by sds - page with apparent molecular weights corresponding to 17 ( unmodified ), 26 , and 33 kd . the latter two pegylated proteins accounted for 25 and 55 % of the total protein , respectively . pegylated ril - 1 alpha was purified from the reaction mixture after 60 minutes using hydrophobic exchange chromatography ( bio - rad ; hrlc mp7 hic ). a linear gradient with decreasing salt concentration from 0 . 43 to 0 . 0m ( nh 4 ) 2 so 4 in 50 mm sodium phosphate ph 7 . 0 in 20 minutes was used to separate pegylated ril - 1 alpha and unmodified ril - 1 alpha . aliquots of fractions were evaluated by sds - page and pooled fractions were assayed for specific activity in a d10 cell proliferation assays by the method described by kaye et al . j . exp . med . 158 : 836 , ( 1983 )!. protein concentrations were determined spectrophotometrically at 280 nm using an extinction coefficient of 1 . 0 for ril - 1 alpha . the specific activity of the ril - 1 alpha is approximately 1 . 0 × 10 8 units / mg . the specific activity results are summarized in table vlll . the 26 kd pegylated il - 1 alpha conjugate retains bioactivity within 2 - 3 fold of relative to il - 1 alpha . further modification resulting in a 33 kd protein results in substantial loss of bioactivity . table viii______________________________________bioactivity of ril - 1 alpha conjugatedwith the reagent described in example 5apparent molecular weight of specific activityril - 1 alpha protein ( kd ) ( units / mg ) ______________________________________17 ( unmodified ) 4 . 6 × 10 . sup . 726 1 . 9 × 10 . sup . 733 4 . 5 × 10 . sup . 6______________________________________ preparation of ifn - alpha conjugated to peg by means of alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl ) thiocarbonyl !- omega - methoxypoly ( oxo - 1 , 2 - ethanediyl ) sru 111 . 7 alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl ) thiocarbonyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 prepared according to example 5 , was added to 1 mg of purified ifn - alpha in 100 ul of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 8 moles of the peg reagent per one mole ifn - alpha . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . the predominant molecular weight species from the reaction mixture were identified by sds - page with apparent molecular weights of 15 ( unmodified ), and 28 kd . the 28 kd pegylated protein accounted for 40 % of the total protein . the pegylated ifn - alpha was purified from the 60 minute reaction mixture and characterized using hydrophobic exchange chromatography ( bio - rad ; biogel - phenyl - s - pw ). a linear gradient with decreasing salt concentrations from 0 . 42m to 0 . 0m ( nh 4 ) 2 so 4 in 50 mm sodium phosphate ph 7 . 0 in 20 minutes was used to separate pegylated ifn - alpha and unmodified ifn - alpha . aliquots of the fractions were evaluated by sds - page and pooled fractions were assayed for anti - viral activity ( specific activity ) in an mdbk assay by the method described in by familletti , et al . methods enzym . 78 , 387 ( 1987 )!. protein concentrations were determined spectrophotometrically at 280 nm using an extinction coefficient of 1 . 0 for a 1 mg / ml ifn - alpha buffered solution . the specific activity of the isolated proteins is expressed as units per mg protein and the results are summarized in table ix . the results show that the specific activity of the 28 kd pegylated ifn - alpha was not significantly altered relative to ifn - alpha . table ix______________________________________bioactivity of ifn - alpha conjugated withthe reagent of example 5apparent molecular weight of specific activityifn - alpha protein ( kd ) ( units / mg ) ______________________________________15 ( unmodified ) 1 . 1 × 10 . sup . 828 1 . 4 × 10 . sup . 8______________________________________ preparation of ifn - alpha conjugated to peg by means of the reagent alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl - thiocarbonyl ! omega - methoxypoly -( oxy - 1 , 2 - ethanediyl ) sru 225 . ifn - alpha was pegylated as in example 8 with the reagent described in example 5a . three predominant molecular weight species from the reaction mixture at 60 minutes were identified by sds - page with apparent molecular weights corresponding to 15 ( unmodified ), 35 and 43 . the latter two pegylated proteins accounted for 35 and 33 per cent of the total proteins in the reaction mixture , respectively . the specific activities determined by procedures described in example 8 of the pegylated species of ifn - alpha are summarized in table x . the results show that the 35 kd pegylated ifn - alpha product retained biological activity within 2 - 3 fold of ifn - alpha . the 43 kd conjugate lost substantial activity . table x______________________________________bioactivity of ifn - alpha conjugated with the reagent ofexample 5aapparent molecular weight of specific activityifn - alpha protein ( kd ) ( units / mg ) ______________________________________15 ( unmodified ) 3 . 3 × 10 . sup . 835 1 . 2 × 10 . sup . 843 1 . 5 × 10 . sup . 7______________________________________ preparation of ril - 2 conjugated to peg by means of the reagent alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl )- thiocarbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 ril - 2 was pegylated with the reagent described in example 5 and purified using the procedure as described in example 3 . the predominant molecular weight species from the reaction mixture after 60 minutes were identified by sds - page with an apparent molecular weights of 15 ( unmodified ) and 25 kd . the 25 kd pegylated protein accounted for 60 % of the total protein in the reaction . the specific activity of the ril - 2 isolated proteins were measured as described in example 3 and is expressed as units / mg protein and the results are summarized in table xi . as can be see in table xi , the biological activity of il - 2 was not altered after conjugation with peg . table xi______________________________________bioactivity of ril - 2 conjugated to peg with the reagentdescribed in example 5apparent molecular weight of specific activityril - 2 protein ( kd ) ( units / mg ) ______________________________________15 ( unmodified ) 2 . 0 × 10 . sup . 725 2 . 0 × 10 . sup . 7______________________________________ preparation of ril - 2 conjugated to peg by means of the reagent alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl )- thiocarbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 ril - 2 was pegylated using the procedure described in example 3 with the reagent described in example 5a . the predominant molecular weight species from the reaction mixture after 60 minutes were identified by sds - page with apparent molecular weights of 15 kd ( unmodified ), 33 kd , and 43 kd . the 33 and 43 kd pegylated proteins accounted for 60 and 20 per cent of the total protein in the reaction , respectively . preparation of ifn - alpha conjugated to peg by means of the reagent alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl )- thiocarbonyl !- omega - methoxy - poly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . an alternative method for conjugating ifn - alpha to peg was done as follows : ifn - alpha ( 5 mg in 1 ml ) was dialyzed against a buffer containing 5 mm sodium acetate , ph 5 . 0 , 120 mm nacl . to the dialyzed protein solution , solid potassium thiocyanate was added to obtain a final concentration of 0 . 5m salt , and the ph adjusted by the addition of one - tenth volume of 1m tricine - sodium hydroxide , ph 11 . 9 to give a final ph 10 . 0 solution . alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl ) thiocarbonyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) was added to the sample at a molar ratio of 3 moles of reagent to 1 mole of protein . the modification reaction was allowed to proceed at room temperature for 30 minutes , and stopped by the addition of 1m glycine , ph 6 . 3 to a final concentration of 20 mm . peg - modified protein was precipitated from solution by addition of a buffer containing 3 . 5m ammonium sulfate , 50 mm sodium phosphate , ph 7 . 0 to a final concentration of 1 . 1m ammonium sulfate and the precipitate collected by centrifugation ( 10 , 000 × g for 12 min .). after rinsing the pellet with a buffer containing 1 . 1m ammonium sulfate , 50 mm sodium phosphate , ph 7 . 0 , the pellet was redissolved in a buffer containing 25 mm ammonium acetate , ph 5 . 0 . the peg - modified protein was purified and characterized as described in example 2 . a single pegylated ifn species was obtained with an apparent molecular weight of 28 kd . antiviral activity ( specific activity ) of the modified protein was determined by the procedure described in example 8 . the specific activity of the starting ifn - alpha was 2 . 6 × 10 8 u / mg and the specific activity of the ifn - alpha conjugated to peg was 1 . 0 × 10 8 u / mg demonstrating that the peg conjugated ifn - alpha retained biological activity within 3 - fold relative to ifn - alpha . preparation of ifn - alpha conjugated to peg by means of the reagent alpha - ( 1 , 2 - dihydro - 2 - oxo - 1 - pyridinyl )- thiocarbonyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 . ifn - alpha was conjugated to peg according to the procedure described in example 9 . the proteins were purified and characterized as described in examples 2 and 9 . the starting ifn - alpha had a specific activity of 2 . 6 × 10 8 u / mg using the ifn - alpha conjugated to peg which has an apparent molecular weight of 31 kd and had a specific activity of 1 . 0 × 10 8 u / mg as described in example 8 . the bioactivity of the conjugated ifn - alpha was within 3 - fold of ifn - alpha . from a solution of 1 g ( 0 . 2 mmol ) of alpha -( 2 - aminoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 ( as prepared in example 1c ) in 40 ml of dry ch 2 cl 2 was distilled 15 ml of solvent . to the resulting solution at 0 ° c . was then added 65 mg ( 0 . 3 mmol ) of di - 2 - pyridyl carbonate and the mixture stirred for an additional 4 hours . the solvent was then removed under reduced pressure and the residue triturated with diethyl ether . the precipitate was then filtered and washed with 50 ml of ether followed by 50 ml of hexane . the product was then dried in a vacuum oven under a slow stream of nitrogen to give 1 g of alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . as a white powder . anal . calcd for c 9 h 12 n 2 o 3 ( ch 2 ch 2 o ) 111 . 7 : c , 54 . 56 ; h , 9 . 04 ; n , 0 . 55 ; found : c , 54 . 26 ; h , 9 . 00 ; n , 0 . 53 . by the procedure described in example 11 , alpha -( 2 - aminoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 , ( as prepared in example 1c ) was converted to alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 225 . anal . calcd for c 9 h 12 n 2 o 3 ( ch 2 ch 2 o ) 225 : c , 54 . 54 , h , 9 . 10 ; n , 0 . 28 . found : c , 54 . 49 ; h , 9 . 27 ; n , 0 . 31 . by the procedure described in example 11 , alpha -( 2 - amino - ethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 28 . 3 ( as prepared in example 1f ) was converted to alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl !- amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 28 . 3 . anal : calcd for c 9 h 12 n 2 o 3 ( ch 2 ch 2 o ) 28 . 3 : c , 54 . 61 ; h , 8 . 75 ; n , 1 . 94 . found : c , 54 . 67 ; h , 8 . 96 ; n , 1 . 63 . preparation of il - 1ra conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 2 - pyridinyloxy )- carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino !- ethoxy ! poly ( oxy - 1 , 2 - ethanediyl sru 111 . 7 , was added to 25 mg of purified il - 1ra in 2 . 5 ml of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 1 mole of reagent per one mole of il - 1ra . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . peg modified llra was then purified according to the procedure set out in example 6 . the predominant pegylated products from the 60 minute reaction had apparent molecular weights of 28 kd and 38 kd and accounted for approximately 42 and 29 % of the total protein from the reaction mixture , respectively . the ability of the purified il - 1ra proteins from the reaction mixture to inhibit il - 1 binding was determined as described in example 6 and summarized in table xii . the binding properties of the 28 kd product was not significantly altered and the bindability of the 38 kd protein retained activity within 5 - fold of il - 1ra . table xii______________________________________inhibition of . sup . 125 i !- il - 1 binding by il - 1ra proteinpegylated with the reagent described in example 11apparent molecular weight of ic . sub . 50il - 1ra protein ( kd ) ( ng / ml ) ______________________________________ 19 ( unmodified ) 2 . 0 28 3 . 0 38 10 . 0______________________________________ the pharmacodynamic profile of peg - il - 1ra was determined as described in example 6 . the data are summarized in table d3 . il - 1 alone induced 27283 u / ml of il - 6 . unmodified il - 1ra inhibited less than 50 % of the il - 1 response within 6 hours of administration . in contrast , peg il - 1ra although less active at early time points , was much more active at 24 and 48 hours after injection . thus , the peg - il - 1ra exhibited a prolonged pharmacodynamic profile . table d3______________________________________pharmacodynamic profile of il - 1ra conjugatedwith the reagent described in example 11time ( hr .) prior to il - 6 units / mlil - 1 administration 19 kd 26 kd______________________________________0 4789 238066 15324 1083324 24841 572748 16348 936472 12067 12054______________________________________ preparation of il - 1ra conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 2 - pyridinyloxy )- carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ). sru 225 alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino !- ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 225 , ( previously described in example 11a ) was added to 25 mg of purified il - 1ra in 2 . 5 ml of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 4 moles of reagent per one mole of il - 1ra . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . peg modified il - 1ra was then purified according to the procedure set out in example 6 . the predominant pegylated products from the 60 minute reaction had apparent molecular weights of 33 kd and 48 kd and accounted for approximately 76 and 15 % of the total protein from the reaction mixture , respectively . the ability of the purified il - 1ra proteins from the reaction mixture to inhibit il - 1 binding are summarized in table xiii . the 33 kd peg modified protein retained its ability inhibit il - 1 binding within 8 - fold relative to il - 1ra . the 4 . 8 kd product lost substantial binding capacity . table xiii______________________________________inhibition of . sup . 125 i ! il - 1 binding by il - 1ra proteinspegylated with the reagent described in example 11aapparent molecular weight ofil - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________ 19 ( unmodified ) 0 . 8 33 6 . 0 48 18 . 0______________________________________ the pharmacokinetic profile of peg - il - 1ra was determined as described in example 6a . the data are summarized in table d4 . the peg - il - 1ra was detectable in serum samples at higher concentrations and for a prolonged time compared to the unmodified il - 1ra . table d4______________________________________pharmacokinetic profile of il - 1ra conjugatedwith the reagent described in example 11a serum level of il - 1ra ( ng / ml ) time ( hr .) after administration 19 kd 33 kd______________________________________1 2202 33 7003 134 5 . 3 5006 1 . 58 15010 8324 5______________________________________ preparation of ril - 2 conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 2 - pyridinyloxy )- carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 ril - 2 was pegylated with alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 , according to the procedure set forth in examples 3 and 8b . the specific activity of the il - 2 protein was determined as described in example 8 . the specific activity of the 15 kd unmodified ril - 2 was 2 × 10 7 units / mg and of the 29 kd pegylated il - 2 was 2 . 4 × 10 7 units / mg il - 2 indicating no substantial loss of biological activity as a result of pegylation . preparation of peg - modified ril - 1 alpha conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 ril - 1 alpha was pegylated with the reagent described in example 11 , alpha - methyl - omega - 2 - ( 2 - pyridinyloxy )- carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 , according to the procedure set forth in examples 4 and 7 . two pegylated ril - 1 alpha proteins with apparent molecular weights of 28 kd and 38 kd were purified and accounted for 50 and 25 per cent of the total proteins from the reaction mixture at 60 minutes respectively . preparation of ifn - alpha conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 2 - pyridinyloxy )- carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 ifn - alpha was pegylated with the reagent described in example 11 , alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino !- ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 , according to the procedure set forth in example 8 . forty percent of the protein was derivatized after 60 minutes and the product had an apparent molecular weight of 26 kd . preparation of ifn - alpha conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 2 - pyridinyloxy )- carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 alternative method of peyglating ifn - alpha . using the procedure illustrated in example 9 , ifn - alpha was conjugated to peg by alpha - methyl - omega - 2 - ( 2 - pyridinyloxy )- carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 . the specific activity of ifn - alpha was determined as described in example 8 . the specific activity of the starting ifn - alpha was 1 . 7 × 10 8 u / mg and the specific activity of the ifn - alpha conjugated to peg by alpha - methyl - omega - 2 - ( 2 - pyridinyloxy ) carbonyl !- amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) was 0 . 8 × 10 8 u / mg which is within 2 - 3 fold of the ifn - alpha . preparation of ifn - alpha conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 2 - pyridinyloxy )- carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 225 . using the procedure illustrated in example 9 , ifn - alpha was pegylated by means of the reagent described in example 11a . the specific activity as determined by the method described in example 8 of the ifn - alpha conjugated to peg was 0 . 4 × 10 8 u / mg demonstrating no significant loss in bioactivity . from a solution of 1 g mpeg molecular weight 5000 dissolved in 30 ml of dry ch 2 cl 2 was distilled 10 ml of solvent . the solution was cooled to room temperature and 132 mg ( 0 . 6 mm ) of di - 2 - pyridyl carbonate and 4 mg of dmap were added . the resulting solution was then stirred for 14 hours and the solvent removed under vacuum . the residue was triturated with diethyl ether and the resulting precipitate filtered . the product was then dissolved in 7 ml of dry glyme , warmed to cause dissolution , and the resulting solution allowed to cool and stand at room temperature for several hours . the resulting precipitate was then filtered and washed with 2 × 5 ml of dry glyme . the solid was then dried in a vacuum oven and under a stream of nitrogen to give 0 . 7 g of alpha - ( 2 - pyridinyloxy )- carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . anal . calcd for c 9 h 11 no 4 ( ch 2 ch 2 o ) 111 . 7 : c , 54 . 57 ; h , 9 . 02 ; n , 0 . 28 . found : c , 54 . 51 ; h , 9 . 19 ; n , 0 . 28 . by the procedure described in example 18 , mpeg ( methoxypolyethylene glycol ) molecular weight 10 , 000 was converted to alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 225 . anal . calcd for c 9 h 11 no 4 ( ch 2 ch 2 o ) 225 : c , 54 . 54 ; h , 9 . 08 ; n , 0 . 14 . found : c , 54 . 54 ; h , 9 . 12 ; n , 0 . 11 . preparation of il - 1ra conjugated to peg by means of the reagent alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 il - 1ra was pegylated with alpha - ( 2 - pyridinyloxy ) carbonyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 by the procedure previously described in examples 6 and 12 . the predominant pegylated products had apparent molecular weights of 26 kd and 33 kd and accounted for approximately 31 and 57 per cent of the total protein from the 60 minute reaction mixture , respectively . the ability of the purified il - 1ra proteins from the reaction mixture to inhibit il - 1 binding was determined as described in example 6 and summarized in table xiv . the 26 kd pegylated il - 1ra conjugate retained its binding capacity within 4 - fold of il - 1ra . the 33 kd conjugate lost significant binding activity as indicated by a 15 - fold decrease in competitive binding activity . table xiv______________________________________inhibition of . sup . 125 i ! il - 1 binding by il - 1ra proteinspegylated with the reagent described in example 18apparent molecular weight ofil - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________ 19 ( unmodified ) 2 . 0 26 8 . 0 33 30 . 0______________________________________ preparation of il - 1ra conjugated to peg by means of the reagent alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ethanediyl ). sru 225 il - ra was pegylated with alpha - ( 2 - pyridinyloxy )- carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 225 , according to the procedure set forth in example 19 . the predominant pegylated products from the 60 minute reaction method mixture had apparent molecular weights of 33 kd and 48 kd and accounted for approximately 47 and 25 per cent of the total protein from the reaction mixture , respectively . the ability of the purified il - 1ra proteins from the reaction mixture to inhibit il - 1 binding was determined as described in examples 6 and 12 and summarized in table xv . the 33 kd protein retained activity within 6 - fold of il - 1ra . the higher molecular weight conjugate lost significant activity . table xv______________________________________inhibition of . sup . 125 i ! il - 1 binding by il - 1ra proteinspegylated with the reagent described in example 18aapparent molecular weight ofil - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________ 19 ( unmodified ) 1 . 5 33 9 . 0 48 40 . 0______________________________________ the pharmacokinetic profile of peg - il - 1ra was determined as described in example 6a . the data are summarized in table d5 . the peg - il - 1ra was detectable in the serum samples for a prolonged time compared to the unmodified il - 1ra demonstrating a prolonged serum half - life . the pharmacodynamic profile of peg - il - 1ra was determined as described in example 6 , except that 0 . 05 ug of ril - 1 alpha was administered . the data are summarized in table d6 . the response to il - 1 alone was 9203 units / ml il - 6 . a prolonged inhibitory effect , compared to unmodified il - 1ra , can be seen at up to 72 hours following administration of the peg - il - 1ra demonstrating improved pharmacodynamic properties . collectively , these data illustrate that even if a pegylated protein has diminished activity in vitro , it could have improved pharmaco - dynamic properties in vivo . table d5______________________________________pharmacokinetic profile of il - 1ra conjugatedwith the reagent described in example 18a serum il - 1ra ( ng / ml ) time ( hr .) after administration 19 kd 33 kd______________________________________1 5802 75 1003 304 30 606 88 1210 1724 10______________________________________ table d6______________________________________pharmacodynamic profile of il - 1ra conjugatedwith the reagent described in example 18time ( hr .) prior to il - 6 ( units / ml ) il - 1 administration 19 kd 26 kd______________________________________0 521 4546 2334 41624 13486 255248 16577 466772 12800 5148______________________________________ preparation of ifn - alpha conjugated to peg by means of the reagent alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 the reagent alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 , was added to 1 mg of purified ifn - alpha in 200 ul of buffer ( 0 . 1 sodium borate , ph 9 . 0 ) in a molar ratio of 10 moles of reagent per mole ifn - alpha . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . purified peg - modified ifn - alpha was then obtained according to the procedure set forth in example 8 . thirty - six percent of the protein was derivatized and the product had an apparent molecular weight of 28 kd . the specific activity of the purified ifn proteins from the reaction mixture were determined as described in example 8 and the values are summarized in table xvi . the modified ifn had a 5 - 6 fold decrease in biological activity in vitro . table xvi______________________________________bioactivity of ifn - alpha conjugated with the reagentdescribed in example 18apparent molecular weight of specific activityifn - alpha protein ( kd ) units / mg______________________________________15 ( unmodified ) 1 . 88 × 10 . sup . 828 8 . 0 × 10 . sup . 7______________________________________ preparation of ril - 2 conjugated to peg by means of the reagent alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 the reagent alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 , previously described in example 18 , was added to 1 mg of ril - 2 in 200 ul of buffer ( 0 . 1 sodium borate , ph 9 . 0 ) in a molar ratio of 5 moles of the reagent per one mole of ril - 2 . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . the predominant molecular weight species from the 60 minute reaction mixture were identified by sds - page with apparent molecular weights of 15 kd ( unmodified ) and 25 kd . the 25 kd pegylated protein accounted for 60 % of the total protein . preparation of ifn alpha conjugated to peg by means of the reagent alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . ifn - alpha was pegylated with the reagent described in example 18 according to the procedure described in example 9 . the specific activity as determined by methods described in example 8 , of the starting unmodified ifn - alpha was 1 . 0 × 10 8 u / mg and the specific activity of the ifn - alpha conjugated to peg was 0 . 4 × 10 8 u / mg demonstrating no significant loss in bioactivity . preparation of ifn alpha conjugated to peg by means of the reagent alpha - ( 2 - pyridinyloxy ) carbonyl ! omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 . peg was conjugated to ifn - alpha using the reagent described in example 18a with the procedures of example 9 . the specific activity as determined by methods described in example 8 of the ifn - alpha conjugated to peg was 0 . 3 × 10 8 u / mg . to 2 g of alpha -( 2 - aminoethyl )- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 in 100 ml ch 2 cl 2 was added 94 . 2 mg of di - 2 - pyridylthionocarbonate . the solution was allowed to stir 18 hours and then extracted with a small amount of cold water . most of the ch 2 cl 2 was removed under reduced pressure and ether added to cause precipitation . the product was filtered and dried under high vacuum to give alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 . anal . calcd for c 4 h 7 nos ( ch 2 ch 2 o ) 111 . 7 : c , 53 . 88 ; h , 9 . 07 ; n , 0 . 28 ; s , 0 . 64 . found : c , 54 . 45 ; h , 8 . 93 ; n , 0 . 28 ; s , 0 . 53 . preparation ifn - alpha conjugated to peg by means of the reagent alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 the reagent alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 , previously described in example 23 was added to 1 mg of purified ifn - alpha in 200 ul of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 10 moles of reagent per one mole ifn - alpha . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . thirty percent of the product was derivatized and had an apparent molecular weight of 26 kd . preparation of ril - 2 conjugated to peg by means of the reagent alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 the reagent alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 111 . 7 , previously described in example 23 , was added to 1 . 0 mg of recombinant il - 2 ( ril - 2 ) in 100 ul of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 10 moles of reagent peg per mole ril - 2 . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperatures for 60 minutes . purified peg - modified ril - 2 was then obtained according to the procedure as set forth in example 3 . the derivatization results are summarized in table xvii . table xvii______________________________________modification of ril - 2 with the reagent described inexample 23apparent molecular weight of % of total proteinril - 2 protein ( kd ) from reaction______________________________________15 ( unmodified ) 7026 2030 10______________________________________ preparation il - 1ra conjugated to peg by means of the reagent alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 il - 1ra was pegylated with alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 , according to the procedure described in example 6 . the predominant pegylated products had molecular weights of 26 , 31 , 38 and 48 kd and accounted for approximately 17 , 44 , 15 and 10 per cent of the total protein , respectively . the ability of the purified 26 kd il - 1ra protein from the 60 minute reaction mixture to inhibit il - 1 binding was determined by methods described in example 6 and summarized in table xviii . the pegylated protein retained its binding capacity within 2 - 3 fold of il - 1ra . table xviii______________________________________inhibition of . sup . 125 i ! il - 1 binding by il - 1ra proteinpegylated with the reagent described in example 23apparent molecular weight ofil - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________19 2 . 026 5 . 0______________________________________ preparation of ril - 1 alpha conjugated to peg by means of the reagent alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ). sru 111 . 7 recombinant il - 1 alpha was pegylated with alpha - 2 -( isothiocyanato ) ethyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 111 . 7 , as described in example 4 . two predominant molecular weight pegylated species from the 60 minute reaction mixture were identified by sds - page with apparent molecular weights of 26 and 38 kd . the latter two pegylated proteins accounted for 46 and 48 per cent of the total protein , respectively . the pegylated ril - 1 alpha was purified from the reaction mixture and characterized as described in example 4 . the bioactivity of the pooled purified fractions were evaluated in the d10 cell proliferation assay as described in example 7 and results summarized in table xix . the samples noted as mixtures in the table contained more than one protein species that was not further purified . the 26 kd pegylated protein had a specific activity essentially indistinguishable from il - 1 . table xix______________________________________bioactivity of ril - 1 alpha conjugated to peg with thereagent described in example 23apparent molecular weight of specific activityril - 1 alpha protein ( kd ) units / mg______________________________________17 1 . 1 × 10 . sup . 826 1 . 7 × 10 . sup . 826 , 38 ( mixture ) 2 . 0 × 10 . sup . 8 & gt ; 38 ( mixture ) 6 . 0 × 10 . sup . 6______________________________________ from a solution of 1 g ( 0 . 1 mmol ) mpeg ( methoxypolyethylene glycol molecular weight 10 , 000 ) in 30 ml of ch 2 cl 2 was distilled 10 ml of solvent . the resulting solution was cooled and 69 . 7 mg ( 0 . 3 mmol ) of di - 2 - pyridyl thionocarbonate and 2 mg of dmap added . the mixture was then stirred under an atmosphere of argon for 18 hours . the solvent was removed under vacuum and the residue redissolved in a minimum of ch 2 cl 2 . ether was then added and the resulting precipitate filtered and washed with ether . the product was then dissolved in 5 ml of warm glyme and the resulting solution allowed to stand overnight . the resulting precipitate was then filtered and washed with 2 × 5 ml of glyme and 5 ml of diethyl ether . the product was then dried in a vacuum oven under a slow stream of nitrogen to give 0 . 9 g of alpha - ( 2 - pyridinyloxy ) thio - carbonyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ) sru 225 . anal . calcd for c 9 h 11 no 3 s ( ch 3 ch 2 o ) 225 . 3 : c , 54 . 46 ; h , 9 . 04 . found : c , 54 . 67 ; h , 9 . 30 . preparation of il - 1ra conjugated to peg by means of the reagent alpha - ( 2 - pyridinyloxy ) thiocarbonyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ). sru 225 alpha - ( 2 - pyridinyloxy ) thiocarbonyl !- omega - methoxypoly ( oxy - 1 , 2 - ethanediyl ), sru 225 , prepared as described in example 28 , was added to 2 . 0 mg of il - 1ra in 1 . 0 ml of buffer ( 0 . 1m sodium borate , ph 9 . 0 ) in a molar ratio of 2 moles of the reagent per one mole of il - 1ra . the solutions were thoroughly mixed and the pegylation reaction was allowed to proceed at room temperature for 60 minutes . peg modified il - 1ra was then purified according to the procedure set out in example 6 . the predominant pegylated product had an apparent molecular weight of 33 kd and accounted for approximately 17 % of the total protein from the 60 minute reaction mixture . the ability of the purified il - 1ra proteins from the reaction mixture to inhibit il - 1 binding was determined as described in example 6 and summarized in table xx . the binding capacity of the 33 kd protein was within 3 - 4 fold of the il - 1ra . table xx______________________________________inhibition of . sup . 125 i ! il - 1 binding by il - 1ra proteins pegylatedwith the reagent described in example 28moleculare weight ofil - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________19 ( unmodified ) 1 . 433 5 . 0______________________________________ to a solution of 10 9 ( 0 . 09 mol ) of 6 - methyl - 2 - hydroxypyridine in 250 ml of dry ch 2 cl 2 was added 12 . 7 ml of triethylamine . the solution was cooled to 0 ° c . and under an atmosphere of argon was added dropwise 4 . 1 ml ( 0 . 046 mol ) of a solution of thiophosgene in ccl 4 ( 85 %). the mixture was then allowed to stir at room temperature for 5 hr ., filtered and the ch 2 cl 2 solution washed twice with 100 ml of a saturated nahco3 solution . the organic layer was dried and the solvent removed under reduced pressure . hexane ( 100 ml ) was then added to the residue and the resulting mixture was allowed to digest overnight . the resulting precipitate was filtered , washed with hexane and dried in a vacuum oven under a slow stream of nitrogen to give 5 . 7 g of carbonothioic acid o , o - di -( 6 - methyl - 2 - pyridinyl ) ester m . p . 155 °- 156 ° c . anal . calcd for c 13 h 12 n 2 o 2 s : c , 59 . 98 ; h , 4 . 65 ; n , 10 . 76 ; s , 12 . 32 . found : c , 59 . 65 ; h , 4 . 59 ; n , 10 . 75 ; s , 12 . 06 . a solution of 1 g of alpha - methoxy - omega -( 2 - aminoethyl ) poly ( oxy - 1 , 2 - ethanediyl ) sru 225 ( as prepared in example 1c ) and 52 . 7 mg of carbonothioic acid o , o - di ( 6 - methyl - 2 - pyridinyl ) ester ( example 30 ) dissolved in 15 ml of dry ch 2 cl 2 was stirred overnight at room temperature . the solvent was removed under reduced pressure and the residue triturated with diethyl ether . the precipitate was filtered and washed with ether . the product was then dissolved in 5 ml of warm glyme and filtered through a 0 . 75 micron millipore filter . the solution was then allowed to stand at room temperature for 48 hr . and the resulting precipitate filtered . the product was then dried in a vacuum oven under an atmosphere of n 2 for 18 hr . to give 0 . 9 g of alpha - methyl - omega - 2 - ( 6 - methyl - 2 - pyridinyloxy ) thiocarbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 225 . anal . calcd for c 10 h 14 n 2 o 2 s ( ch 2 ch 2 o ) 225 : c , 54 . 50 ; h , 9 . 09 ; n , 0 . 27 ; s , 0 . 32 . found : c , 54 . 38 ; h , 9 . 20 ; n , 0 . 21 ; s , 0 . 37 . preparation ril - 1ra conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 6 - methyl - 2 - pyridinyloxy ) thiocarbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 225 the reagent prepared as previously described in example 31 was added to 5 . 0 mg of purified ril - 1ra in 1 . 0 ml 0 . 1m sodium borate , ph 9 . 0 in a molar ratio of 2 . 0 moles reagent per mole ril - 1ra . the solution was thoroughly mixed and the reaction mixture was allowed to proceed at room temperature for 60 minutes . the ril1ra products were evaluated using the procedure described in example 6 . table xxi shows the percent of modification of primary molecular weight species from the reaction mixture . table xxi______________________________________modification of ril - 1ra with the reagent described inexample 31apparent molecular weight of % of total proteinril - 1ra protein ( kd ) from reaction______________________________________19 ( unmodified ) 30 . 035 65 . 048 5 . 0______________________________________ ril - 1ra products from the reaction mixture were purified using the method described in example 6 . purified fractions from the reaction mixture were assayed in an ril - 1radioreceptor competition binding assay as described previously in example 6 . the results are shown in table xxii . these results show that the 35 kd protein was 6 - fold less active than unmodified il - 1ra for inhibiting ii - 1 binding while the 48 kd protein was 20 - fold less active . table xxii______________________________________inhibition of . sup . 125 i ! il - 1 binding by ril - 1ra conjugated withthe reagent described in example 31apparent molecular weight ofril - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________19 ( unmodified ) 1 . 535 9 . 048 30 . 0______________________________________ from a slurry of 80 g mpeg ( polyethylene glycol - molecular weight 8000 ) in 750 ml of toluene was distilled 200 ml of the solvent . to the refluxing solution was added dropwise 1 . 7 ml of dry pyridine and 4 . 7 ml of thionyl chloride . after refluxing for twelve hours the reaction was allowed to stir overnight . methylene chloride ( 50 ml ) was then added and the resulting solution filtered through 60 g of basic alumina ( wolem super 1 ). the column was then eluted with 500 ml of ch 2 cl 2 , the organic layers combined , and the solvent removed under reduced pressure . the residue was then dissolved in 300 ml of ch 2 cl 2 and ether slowly added while the solvents are removed on a steam bath . this procedure is continued until a cloudy suspension develops . the resulting mixture is then stirred at room temperature for several hours and the product then filtered to give 73 g of alpha -( 2 - chloroethyl )- omega -( 2 - chloro - ethoxy )- poly ( oxy - 1 , 2 - ethanediyl ) sru 180 . anal . calcd for c 2 h 4 c 12 ( ch 2 ch 20 ) 180 : c , 54 . 16 ; h , 9 . 09 ; cl , 0 . 88 . found : c , 53 . 40 ; h , 8 . 81 ; cl , 0 . 93 . a mixture of 72 g of alpha -( 2 - chloroethyl )- omega -( 2 - chloroethoxy ) poly ( oxy - 1 , 2 - ethanediyl ) sru 180 , 25 g sodium azide and 700 ml of dry dmf was stirred and heated at 125 ° c . for 12 hours . the solvent was then removed under high vacuum and the residue dissolved in one liter of ch 2 cl 2 and filtered through celite . the ch 2 cl 2 was then removed on a steam bath while diethyl ether was added to cause precipitation . the mixture was stirred overnight and then filtered . the precipitate was then dissolved in a minimum of glyme at 50 ° c . , slowly cooled and filtered . the product then dried in a vacuum oven under a stream of n 2 to give 69 g of alpha -( 2 - azidoethyl )- omega -( 2 - azidoethoxy )- poly ( oxy - 1 , 2 - ethanediyl ) sru 180 . anal . calcd for c 2 h 4 n 6 ( ch 2 ch 2 o ) 180 : c , 54 . 07 ; h , 9 . 08 ; n , 1 . 044 . found : c , 53 . 76 ; h , 9 . 28 ; n , 0 . 96 . a solution of 69 g of alpha -( 2 - azidoethyl )- omega -( 2 - azidoethoxy ) poly ( oxy - 1 , 2 - ethanediyl ) sru 180 and 6 . 7 9 ( 25 . 6 mmol ) of triphenylphosphine dissolved in 200 ml of dry ch 2 cl 2 was stirred overnight under an atmosphere of argon . water ( 2 ml ) was added and the mixture stirred an additional 12 hours . most of methylene chloride was removed under vacuum and 400 ml of diethyl ether added . the precipitate was filtered , washed with ether and dissolved in 300 ml of warm ( 50 ° c .) glyme . the solution was allowed to stand at room temperature overnight and the resulting precipitate filtered , washed with 2 × 100 ml of glyme , 2 × 100 ml of diethyl ether and dried in a vacuum oven under a stream of n 2 to give 66 g of alpha -( 2 - aminoethyl )- omega -( 2 - aminoethoxy ) poly ( oxy - 1 , 2 - ethanediyl ) sru 180 anal . calcd for c 2 h 8 n 2 ( ch 2 ch 2 o ) 180 : c , 54 . 42 ; h , 9 . 18 ; n , 0 . 35 . found : c , 53 . 85 ; h , 9 . 20 ; n , 0 . 43 . from a solution of 1 g of alpha -( 2 - aminoethyl )- omega -( 2 - aminoethoxy ) poly ( oxy - 1 , 2 - ethanediyl ) sru 180 dissolved in 40 ml of dry ch 2 cl 2 was distilled 15 ml of solvent . the solution was cooled to 0 ° c . and 85 mg ( 6 . 39 mmol ) of di - 2 - pyridyl carbonate added . the mixture was then stirred at 0 ° c . for 4 hr and the solvent removed under vacuum . the residue was triturated with diethyl ether and the product filtered and washed with ether ( 2 × 75 ml ). the product was then dried under vacuum and dissolved in 8 ml of dry glyme ( 50 ° c .). the solution was then allowed to cool and stand at room temperature for 12 hr . the precipitated product was filtered , washed with 2 × 5 ml of glyme and dried in a vacuum oven under a stream of n 2 to give 1 g of alpha - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino ! ethyl !- omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino ! ethoxy ! poly -( oxy - 1 , 2 - ethanediyl ) sru 180 . anal . calcd for c 14 h 14 n 4 o 4 ( ch 2 ch 2 o ) 180 : c , 54 . 57 ; h , 8 . 99 ; n , 0 . 68 . found : c , 54 . 32 ; h , 8 . 79 ; n , 0 . 77 . by the procedure described in example 33a , polyethylene glycol molecular weight 20 , 000 was converted to alpha -( 2 - chloroethyl )- omega -( 2 - chloroethoxy )- poly ( oxy - 1 , 2 - ethanediyl ) sru 452 . anal . calcd for c 2 h 4 cl 2 ( ch 2 ch 2 o ) 452 : c , 54 . 38 ; h , 9 . 13 ; cl , 0 . 35 . found : c , 54 . 36 ; h , 9 . 23 ; cl , 0 . 40 . by the procedure described in example 33b , alpha -( 2 - chloroethyl )- omega -( 2 - chloroethoxy )- poly ( oxy - 1 , 2 - ethanediyl ) sru 452 was converted to alpha -( 2 - azidoethyl )- omega -( 2 - azidoethoxy )- poly -( oxy - 1 , 2 - ethanediyl ) sru 452 . anal . calcd for c 2 h 4 n 6 ( ch 2 ch 2 o ) 452 : c , 54 . 35 ; h , 9 . 12 ; n , 0 . 42 . found : c , 54 . 38 ; h , 9 . 30 ; n , 0 . 47 . by the procedure described in example 33c , alpha -( 2 - azidoethyl )- omega -( 2 - azidoethoxy )- poly ( oxy - 1 , 2 - ethanediyl ) sru 452 was converted to alpha -( 2 - aminoethyl )- omega -( 2 - aminoethoxy ) poly ( oxy - 1 , 2 - ethanediyl ) sru 452 . anal . calcd for c 2 h 8 n 2 ( ch 2 ch 2 o ) 452 : c , 54 . 49 ; h , 9 . 17 ; n , 0 . 14 . found : c , 54 . 44 ; h , 9 . 19 ; n , 0 . 15 . by the procedure described in example 33d , alpha -( 2 - aminoethyl )- omega -( 2 - aminoethoxy ) poly ( oxy - 1 , 2 - ethanediyl ) sru 452 was converted to alpha - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino !- ethyl !- omega - 2 - ( 2 - pyridinyloxy ) car - bonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 452 . anal . calcd for c 14 h 14 n 4 o 4 ( ch 2 ch 2 o ) 452 : c , 54 . 56 ; h , 9 . 08 ; n , 0 . 28 . found : c , 54 . 33 ; h , 9 . 13 ; n , 0 . 33 . preparation ril - 1ra conjugated to peg by means of the reagent alpha - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino ! ethyl !- omega - 2 - ( 2 - pyridinyloxy ) carbonyl ! amino ! ethoxy ! ply -( oxy - 1 , 2 - ethanediyl ) sru 452 the reagent prepared as previously described in example 34 was added to 5 . 0 mg of purified ril - 1ra in 1 . 0 ml 0 . 1m sodium borate , ph 9 . 0 in a molar ratio of 1 . 0 moles of reagent per 4 . 0 moles ril - 1ra . the solution was thoroughly mixed at room temperature for 60 minutes . the ril - 1ra products were evaluated using the method previously described in example 6 . table xxiii shows the percent of modification of primary molecular weight species from the reaction mixture . table xxiii______________________________________modification of ril - 1ra with the reagent described inexample 33apparent molecular weight of % of total proteinril - 1ra protein ( kd ) from reaction______________________________________19 ( unmodified ) 50 . 055 35 . 075 15 . 0______________________________________ a solution of 4 . 6 g ( 42 mmol ) of 3 - methyl - 2 - hydroxypyridine and 6 ml of triethylamine dissolved in 20 ml of ch 2 cl 2 was added dropwise at 0 ° c . to a solution of 50 ml of ch 2 cl 2 and 11 ml of phosgene in toluene ( 1 . 93 molar ). the mixture was stirred at 0 ° c . for 2 hr . and then at room temperature of 2 hr . the reaction mixture was then washed with a saturated nahco 3 solution followed by a saturated nacl solution and then dried ( na 2 so 4 ). the solvent was removed under reduced pressure and the residue crystallized from etoac / hexane to give 3 g of bis -( 3 - methyl - 2 - pyridyl ) carbonate m . p . 110 °- 112 ° c . anal . calcd for c 13 h 12 n 2 o 3 : c , 63 . 93 ; h , 4 . 95 ; n , 11 . 47 . found : c , 63 . 78 ; h , 4 . 86 ; n , 11 . 23 . from a solution of 1 g of alpha - methoxy - omega -( 2 - aminoethyl ) poly ( oxy - 1 , 2 - ethanediyl ) sru 225 dissolved in 25 ml of ch 2 cl 2 was distilled 10 ml of solvent . to the solution was then added 49 . 2 mg ( 0 . 2 mmol ) of bis -( 3 - methyl - 2 - pyridyl ) carbonate and the resulting mixture stirred overnight under an atmosphere of argon . the solvent was then removed under reduced pressure and 80 ml of diethyl ether added to the residue . the solid was filtered , washed with ether and then dissolved in 10 ml ch 2 cl 2 . ether was then slowly added while boiling off the solvent until the solution becomes turbid . the mixture was then allowed to stand for 18 hr . at room temperature and the resulting precipitate filtered . the solid was then dissolved in 8 ml of warm glyme and allowed to sit at room temperature for an additional 18 hr . the product was then filtered and dried in a vacuum oven under an atmosphere of nitrogen to give 0 . 6 g of alpha - methyl - omega - 2 - ( 3 - methyl - 2 - pyridinyloxy ) carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 225 . anal . calcd for c 10 h 14 n 2 o 3 ( ch 2 ch 2 o ) 225 : c , 54 . 59 ; h , 9 . 09 ; n , 0 . 28 . found : c , 55 . 64 ; h , 9 . 14 ; n , 0 . 22 . preparation ril - 1ra conjugated to peg by means of the reagent alpha - methyl - omega - 2 - ( 3 - methyl - 2 - pyridinyloxy ) carbonyl ! amino ! ethoxy ! poly ( oxy - 1 , 2 - ethanediyl ) sru 225 the reagent prepared as previously described in example 37 was added to 5 . 0 mg of purified ril - 1ra in 1 . 0 ml 0 . 1m sodium borate , ph 9 . 0 in a molar ratio of 2 . 0 moles reagent per mole ril - 1ra . the solution was thoroughly mixed and the reaction was allowed to proceed at room temperature for 60 minutes . the ril - 1ra products were evaluated using the procedure described in example 6 . table xxiv shows the percent of modification of primary molecular weight species from the reaction mixture . table xxiv______________________________________modification of ril - 1ra with the reagent described inexample 37apparent molecular weight of % of total proteinril - 1ra protein ( kd ) from reaction______________________________________19 ( unmodified ) 45 . 035 43 . 045 12 . 0______________________________________ ril - 1ra products from the reaction mixture were purified as described in example 6 . purified fractions from the reaction mixture were assayed in an ril - 1radioreceptor competition binding assay as described in example 6 . the results are shown in table xxv . the 35 kd protein was 4 - fold less active than unmodified il - 1ra for inhibiting il - 1 binding . the 45 kd protein was 30 - fold less active . table xxv______________________________________inhibition of . sup . 125 i ! il - 1 binding by ril - 1ra conjugated withthe reagent described in example 35apparent molecular weight ofril - 1ra protein ( kd ) ic . sub . 50 ( ng / ml ) ______________________________________19 ( unmodified ) 1 . 035 4 . 045 30 . 0______________________________________

US-45706895-A

the subject invention pertains to methods to enhance the therapeutic effects of cellular or drug treatment in various diseases and disorders . more particularly , the present invention provides methods of treating disorders by administering ctx0e03 cells to the patient , intravenously or intraarterially . the treatment is useful for neurodegenerative diseases , such as stroke . the ctx0e03 cells may be cryopreserved and / or passaged before administration into the patient . administration of the ctx0e03 cells into stroke rat models was at or within 48 hours after stroke . testing of the rat models through elevated body swing test to measure of neurobehavioral status at the time of transplant and repeated triphenyltetrazolium chloride staining as a measure of infarct volume showed short term survival that provided significant protection from the stroke .

the present invention may be understood more readily by reference to the following detailed description of the preferred embodiments of the invention and the examples included herein . however , before the present compounds , compositions , and methods are disclosed and described , it is to be understood that this invention is not limited to specific nucleic acids , specific polypeptides , specific cell types , specific host cells , specific conditions , or specific methods , etc ., as such may , of course , vary , and the numerous modifications and variations therein will be apparent to those skilled in the art . it is also to be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting . standard techniques for cloning , dna isolation , amplification and purification , for enzymatic reactions involving dna ligase , dna polymerase , restriction endonucleases and the like , and various separation techniques are those known and commonly employed by those skilled in the art . a number of standard techniques are described in sambrook et al ., 1989 molecular cloning , second edition , cold spring harbor laboratory , plainview , n . y . ; maniatis et al ., 1982 molecular cloning , cold spring harbor laboratory , plainview , n . y . ; wu ( ed .) 1993 meth . enzymol . 218 , part i ; wu ( ed .) 1979 meth enzymol . 68 ; wu et al ., ( eds .) 1983 meth . enzymol . 100 and 101 ; grossman and moldave ( eds .) 1980 meth . enzymol . 65 ; miller ( ed .) 1972 experiments in molecular genetics , cold spring harbor laboratory , cold spring harbor , n . y . ; old and primrose , 1981 principles of gene manipulation , university of california press , berkeley ; schleif and wensink , 1982 practical methods in molecular biology ; glover ( ed .) 1985 dna cloning vol . i and ii , irl press , oxford , uk ; hames and higgins ( eds .) 1985 nucleic acid hybridization , irl press , oxford , uk ; and setlow and hollaender 1979 genetic engineering : principles and methods , vols . 1 - 4 , plenum press , new york . abbreviations and nomenclature , where employed , are deemed standard in the field and commonly used in professional journals such as those cited herein . the term “ neurodegenerative disease ” is used herein to describe a disease which is caused by damage to the central nervous system and which damage can be reduced and / or alleviated through transplantation of neural cells according to the present invention to damaged areas of the brain and / or spinal cord of the patient . exemplary neurodegenerative diseases which may be treated using the neural cells and methods according to the present invention include for example , huntington &# 39 ; s disease , amyotrophic lateral sclerosis ( lou gehrig &# 39 ; s disease ), lysosomal storage disease (“ white matter disease ” or glial / demyelination disease , as described , for example by folkerth r d . ( 1999 ). abnormalities of developing white matter in lysosomal storage diseases . j neuropathol exp neurol . 58 ( 9 ): 887 - 902 . review ), multiple sclerosis , brain injury or trauma caused by ischemia , accidents , environmental insult , etc . in addition , the present invention may be used to reduce and / or eliminate the effects on the central nervous system of a stroke or a heart attack in a patient , which is otherwise caused by lack of blood flow or ischemia to a site in the brain of said patient or which has occurred from physical injury to the brain and / or spinal cord . neurodegenerative diseases also include neurodevelopmental disorders including for example , autism and related neurological diseases such as schizophrenia , among numerous others . the isolation , manufacture and protocols for the ctx0e03 cell line in generating cells in the present invention is described in detail by sinden , et al . ( u . s . pat . no . 7 , 416 , 888 ). in one application of the cells , a clinical trial for the stereotactic intracerebral administration of ctx0e03 drug product for the treatment of stable motor disability , 6 months to 5 years after a stroke is underway in glasgow , scotland ( clinicaltrials . gov , national institutes of health , identifier # nct01151124 ). the neural stem cells of the subject invention can be administered to patients , including veterinary ( non - human animal ) patients , to alleviate the symptoms of a variety of pathological conditions for which cell therapy is applicable . for example , the cells of the present invention can be administered to a patient to alleviate the symptoms of neurological disorders such as stroke ( e . g ., cerebral ischemia , hypoxia - ischemia ); neurodegenerative diseases , such as huntington &# 39 ; s disease ; traumatic brain injury ; amyotrophic lateral sclerosis ; multiple sclerosis ( ms ) and other demyelinating diseases . in a preferred embodiment of the present invention , the cells are administered to alleviate the symptoms of stroke . the term “ patient ” is used herein to describe an animal , preferably a human , to whom treatment , including prophylactic treatment , with the cells according to the present invention , is provided . for treatment of those infections , conditions or disease states which are specific for a specific animal such as a human patient , the term patient refers to that specific animal . the term “ donor ” is used to describe an individual ( animal , including a human ) who or which donates umbilical cord blood or fetal neural stem cells for use in a patient . the term “ effective amount ” is used herein to describe concentrations or amounts of components such as differentiation agents , fetal neural stem cells , precursor or progenitor cells , specialized cells , such as neural and / or neuronal or glial cells , blood brain barrier permeabilizers and / or other agents which are effective for producing an intended result including differentiating stem and / or progenitor cells into specialized cells , such as neural , neuronal and / or glial cells , or treating a neurological disorder or other pathologic condition including damage to the central nervous system of a patient , such as a stroke , heart attack , or accident victim or for effecting a transplantation of those cells within the patient to be treated . compositions according to the present invention may be used to effect a transplantation of the fetal neural stem cells within the composition to produce a favorable change in the brain or spinal cord , or in the disease or condition treated , whether that change is an improvement ( such as stopping or reversing the degeneration of a disease or condition , reducing a neurological deficit or improving a neurological response ) or a complete cure of the disease or condition treated . the terms “ stem cell ” or “ progenitor cell ” are used interchangeably herein to refer to umbilical cord blood - derived stem and progenitor cells . the terms stem cell and progenitor cell are known in the art ( e . g ., stem cells : scientific progress and future research directions , report prepared by the national institutes of health , june , 2001 ). the term “ neural cells ” are cells having at least an indication of neuronal or glial phenotype , such as staining for one or more neuronal or glial markers or which will differentiate into cells exhibiting neuronal or glial markers . examples of neuronal markers which may be used to identify neuronal cells according to the present invention include , for example , neuron - specific nuclear protein , tyrosine hydroxylase , microtubule associated protein , and calbindin , among others . the term neural cells also includes cells which are neural precursor cells , i . e ., stem and / or progenitor cells which will differentiate into or become neural cells or cells which will ultimately exhibit neuronal or glial markers , such term including pluripotent stem and / or progenitor cells which ultimately differentiate into neuronal and / or glial cells . all of the above cells and their progeny are construed as neural cells for the purpose of the present invention . neural stem cells are cells with the ability to proliferate , exhibit self - maintenance or renewal over the lifetime of the organism and to generate clonally related neural progeny . neural stem cells give rise to neurons , astrocytes and oligodendrocytes during development and can replace a number of neural cells in the adult brain . neural stem cells are neural cells for purposes of the present invention . the terms “ neural cells ” and “ neuronal cells ” are generally used interchangeably in many aspects of the present invention . preferred neural cells for use in certain aspects according to the present invention include those cells which exhibit one or more of the neural / neuronal phenotypic markers such as musashi - 1 , nestin , neun , class iii β - tubulin , gfap , nf - l , nf - m , microtubule associated protein ( map2 ), s100 , cnpase , glypican ( especially glypican 4 ), neuronal pentraxin ii , neuronal pas 1 , neuronal growth associated protein 43 , neurite outgrowth extension protein , vimentin , hu , internexin , o4 , myelin basic protein and pleiotrophin , among others . the term “ administration ” or “ administering ” is used throughout the specification to describe the process by which cells of the subject invention , such as fetal neural stem cells obtained from umbilical cord blood , or more differentiated cells obtained therefrom , are delivered to a patient for therapeutic purposes . cells of the subject invention be administered a number of ways including , but not limited to , parenteral ( such term referring to intravenous and intra - arterial as well as other appropriate parenteral routes ) and intrathecal administration , among others which term allows cells of the subject invention to migrate to the ultimate target site where needed . cells of the subject invention can be administered in the form of intact ctx0e03 immortalized fetal neural stem cells . the compositions according to the present invention may be used without cell expansion , i . e . passaging , with a mobilization agent or differentiation agent . administration will often depend upon the disease or condition treated and may preferably be via a parenteral route , for example , intravenously . in the case of stroke , the preferred route of administration will depend upon where the stroke is , but may be directly into the carotid artery , or may be administered systemically . in a preferred embodiment of the present invention , the route of administration for treating an individual post - stroke is systemic , via intravenous or intra - arterial administration . optionally , the fetal neural stem cells are administered in conjunction with an immunosuppressive agent , such as cyclosporine a or tacrolimus . the fetal neural stem cells of the present invention can be administered and dosed in accordance with good medical practice , taking into account the clinical condition of the individual patient , the site and method of administration , scheduling of administration , patient age , sex , body weight and other factors known to medical practitioners . the pharmaceutically “ effective amount ” for purposes herein is thus determined by such considerations as are known in the art . the amount must be effective to achieve improvement , including but not limited to improved survival rate or more rapid recovery , or improvement or elimination of symptoms and other indicators as are selected as appropriate measures by those skilled in the art . the pharmaceutical compositions may further comprise a pharmaceutically acceptable carrier . pharmaceutical compositions comprise an effective number of cells , optionally , in combination with a pharmaceutically - acceptable carrier , additive or excipient . in certain aspects of the present invention , cells are administered to the patient in need of a transplant in sterile saline . in other aspects of the present invention , the cells are administered in hanks balanced salt solution ( hbss ) or isolyte s , ph 7 . 4 . other approaches may also be used , including the use of serum free cellular media . systemic administration of the cells to the patient may be preferred in certain indications , whereas direct administration at the site of or in proximity to the diseased and / or damaged tissue may be preferred in other indications . in some embodiments , the ctx0e03 cells can be cryopreserved in a medium described by hope , et al . ( wo / 2010 / 064054 ), in order to generate a frozen cell product that can be stably manufactured , stored and shipped to the treatment site , thawed and used without washing or further significant manipulation . pharmaceutical compositions according to the present invention preferably comprise an effective number within the range of about 1 . 0 × 10 4 cells to about 1 . 0 × 10 9 cells , more preferably about 1 × 10 5 to about 1 × 10 7 cells , even more preferably about 2 × 10 5 to about 8 × 10 6 cells generally in solution , optionally in combination with a pharmaceutically acceptable carrier , additive or excipient . the term “ non - tumorigenic ” refers to the fact that the cells do not give rise to a neoplasm or tumor . stem and / or progenitor cells for use in the present invention are preferably free from neoplasia and cancer . thus , fetal neural stem cells , or progenitor cells are the targets of gene transfer either prior to differentiation or after differentiation to a neural cell phenotype . the umbilical cord blood stem or progenitor cells of the present invention can be genetically modified with a heterologous nucleotide sequence and an operably linked promoter that drives expression of the heterologous nucleotide sequence . the nucleotide sequence can encode various proteins or peptides of interest . the gene products produced by the genetically modified cells can be harvested in vitro or the cells can be used as vehicles for in vivo delivery of the gene products ( i . e ., gene therapy ). the following written description provides exemplary methodology and guidance for carrying out many of the varying aspects of the present invention . standard molecular biology techniques known in the art and not specifically described are generally followed as in sambrook et al ., molecular cloning : a laboratory manual , cold springs harbor laboratory , new york ( 1989 , 1992 ), and in ausubel et al ., current protocols in molecular biology , john wiley and sons , baltimore , md . ( 1989 ). polymerase chain reaction ( pcr ) is carried out generally as in pcr protocols : a guide to methods and applications , academic press , san diego , calif . ( 1990 ). reactions and manipulations involving other nucleic acid techniques , unless stated otherwise , are performed as generally described in sambrook et al ., molecular cloning : a laboratory manual , cold springs harbor laboratory press , and methodology as set forth in u . s . pat . nos . 4 , 666 , 828 ; 4 , 683 , 202 ; 4 , 801 , 531 ; 5 , 192 , 659 ; and 5 , 272 , 057 and incorporated herein by reference . in situ pcr in combination with flow cytometry can be used for detection of cells containing specific dna and mrna sequences ( see , for example , testoni et al ., blood , 1996 , 87 : 3822 ). standard methods in immunology known in the art and not specifically described are generally followed as in stites et al . ( eds . ), basic and clinical immunology , 8 th ed ., appleton & amp ; lange , norwalk , conn . ( 1994 ); and mishell and shigi ( eds . ), selected methods in cellular immunology , w . h . freeman and co ., new york ( 1980 ). the ctx0e03 cells ( reneuron l . td ., guildford , uk ) were grown as previously described ( pollock k , et al . ( 2006 ). a conditionally immortal clonal stem cell line from human cortical neuroepithelium for the treatment of ischemic stroke . exp neurol . 199 : 143 - 155 ; hodges h , et al . ( 2007 ). making stem cell lines suitable for transplantation . cell transplant . 16 : 101 - 115 ). in brief , the cells were revived at passage 33 and plated onto laminin ( invitrogen , carlsbad , calif .) at a density of 2 × 10 7 cells in 35 ml of media per t175 flask ( pollock k , et al . ( 2006 ). a conditionally immortal clonal stem cell line from human cortical neuroepithelium for the treatment of ischemic stroke . exp neurol . 199 : 143 - 155 ; hodges h , et al . ( 2007 ). making stem cell lines suitable for transplantation . cell transplant . 16 : 101 - 115 ). the cells were grown for 4 days or until ˜ 80 % confluence before harvesting and resuspending in hank &# 39 ; s balanced salt soluton ( invitrogen ) and n - acetylcycsteine ( sigma , st . louis ., mo . vehicle ) at a concentration of 5 × 10 4 cells / μl . all experiments were conducted in accordance with the national institutes of health guidelines , and were approved by the institutional animal care and use committee of the university of south florida , college of medicine . adult male sprague dawley ( sd ) rats ( harlan ) weighing 225 - 250 g , were housed in a temperature controlled room with a 12 h light / dark cycle and given free access to food and water . a transient intraluminal occlusion stroke model as previously described by ( yasuhara t . et al . ( 2008 ). intravenous grafts recapitulate the neurorestoration afforded by intracerebrally delivered multipotent adult progenitor cells in neonatal hypoxic - ischemic rats . j cereb blood flow metab . 28 ( 11 ): 1804 - 10 . epub 2008 jul . 2 ) was used in this study . rats were anesthetized with 5 % isoflurane ( 3 % maintenance ) and a filament embolus was introduced into the right mcao and secured in place for 1 hr . for the first 8 minutes , the left mcao was ligated to reduce collateral reperfusion that could prevent the infarct . laser doppler measurement of the cerebral blood flow was used to confirm lesioning with a drop of less than 70 % being exclusion criteria . animals were also excluded from the study retrospectively , if on post - mortem examination of the brain , considerable damage or scar tissue was observed , particularly cyst formation , or if the animal died before conclusion of the study , or showed unusual behavior , e . g . head tilt . one hour later , under anesthesia , the filament embolus was removed from the right mcao and the incision sutured and the rat allowed to recover with appropriate post - operative survival procedures two days after mcao , the animals were divided into two groups treated i . v . with either cells or vehicle . the animals were anesthetized with 5 % isoflurane ( 3 % maintenance ) and the right jugular vein was exposed . animals were randomly assigned to be injected with either 0 . 5 mls of vehicle ( hank &# 39 ; s balanced salt solution ; hbss + 0 . 5 mm n - acetyl cysteine ; nac ) or 1 × 10 7 ctx0e03 cells in the same vehicle , over a 1 minute period . the incision was sutured and the rat allowed to recover with appropriate monitoring . cryopreserved ctx0e03 cells were thawed and plated on laminin - coated flasks in medium as described previously ( pollock , et al . ( 2006 ). a conditionally immortal clonal stem cell line from human cortical neuroepithelium for the treatment of ischemic stroke . exp neurol . 199 ( 1 )) and grown at 37 ° c ., 5 % co 2 to 80 % confluence before dissociation with trypzean / edta [ cambrex ] and trituration solution ( 0 . 55 mg / ml trypsin inhibitor [ sigma ], 1 % hsa , 25 u / ml benzonase [ merck ] in dmem : f12 ) to neutralize the trypzean and digest naked dna . following centrifugation and a wash in dmem : f12 ( invitrogen ), the cells were re - suspended in vehicle at a concentration of 2 × 10 4 cells / ml . four animals were injected with cells , whereas eight received vehicle . three days after transplantation , half of the vehicle - treated animals had died compared with none of the cell - treated which was statistically significant as revealed by chi - squared analysis , as seen in fig1 . the motor asymmetry before and 3 days after transplant was found to be significantly reduced in the cell treated rats , seen in fig2 . three days after treatment , the rats were terminally anesthetized and perfused with cold saline . the brain was then removed and sliced into 2 mm coronal blocks . the blocks were then stained in 2 % triphenyltetrazolium chloride ( ttc ) in pbs for 10 minutes in the dark . the brain slices were then fixed in 4 % paraformaldehyde . the following day , six sections of the brain , covering the striatum , were photographed and the area of the infarct measured ( lack of ttc staining ) using imagej ( nih ) by 2 observers blinded to the treatments . the infarct size was normalized to the contralateral hemisphere and calculated for the whole brain . animal survival from treatment to perfusion between vehicle and cells was compared by chi - squared test . infarct size was found not significantly different between cell and vehicle - treated rats , seen in fig3 . this may have been due to the sample size . however , motor control testing did show a significant correlation between the % of motor asymmetry and the mean % infarct size in cell . two days after mcao , the surviving rats were behaviorally tested using the elevated body swing test ( ebst ) to determine motor asymmetry . the rat was held above bedding in a high - sided box by its tail and the direction the animal turns to is monitored 20 times . an unlesioned animal would be expected to turn left and right equally and therefore its motor asymmetry would be 50 %. this was repeated three days after treatment by an individual blinded to the treatment and the values compared by t - test . as infarct size increased , the percent of asymmetry was found to increase in a linear relationship , as seen in fig4 . this result was not seen in vehicle - treated animals ( data not shown ). there was therefore a significant improvement in motor behavior ( as measured by ebst ) and animal survival following cell transplant 2 days after mcao . however , a similar significant change in infarct size was not observed , though there was a correlation with ebst ( but not in the vehicle - treated animals ), suggesting a significant difference may be present . the decreased mortality of animals treated with the ctx0e03 cells also suggests that not only is the transplantation of these cells safe , but that the cells also provide an improved outcome . the i . v . implantation of ctx0e03 cells two days after experimental ischemic stroke exerts beneficial neurological effects . the grafted cells migrated to the injured site and either integrated with host cells or stimulated growth factor secretion to induce regenerative processes mediating the observed functional recovery . twelve male 22 - month old fisher ( f344 ) rats ( nia ) were anesthetized with isoflurane and placed in a stereotaxic rig . using a hamilton syringe , either vehicle ( n = 6 ) or ctx0e03 cells ( n = 6 ; 4 . 5 × 10 5 cells in 4 . 5 μl ) were slowly implanted intracerebroventricularly at coordinates relative to bregma − 1 mm anteriorly , + 1 . 6 mm medially , and − 4 . 5 mm dorsally to each rat . the following day , the rats were injected twice intraperitoneally with 50 mg / kg bromodeoxyuridine ( 5 - bromo - 2 - deoxyoridine , brdu ; sigma ), 8 h apart , and were transcardially perfused with paraformaldehyde 1 day later . the brains were then removed and cryopreserved before being cut into 40 μm sagittal sections using a microm cryostat ( richard - allan scientific , kalamazoo , mich .). six animals from each group were implanted with either vehicle or cells . immunohistochemical staining for brdu ( marker of proliferation ), doublecortin ( dcx ; immature neurons ), ionized calcium - binding adaptor molecule i ( iba - 1 ; microglia ), glial fibrillary acidic protein ( gfap , astrocytes ), and human nuclei antigen ( hunu ; transplanted human fetal cortical cells ) was performed on free floating sections as described previously ( bachstetter a d , et al . ( 2008 ). peripheral injection of human umbilical cord blood stimulates neurogenesis in the aged rat brain . bmc neurosci . 9 : 22 ). in brief , for brdu staining , every sixth section of a series that surrounds the hippocampus were pretreated with 50 % formaldehyde / 2 % ssc for 2 h at 65 ° c ., followed by 30 min 2 n hcl at 37 ° c . and a borate buffer ( ph 8 . 5 ) wash for antigen retrival . endogenous peroxidase quenching in 0 . 3 % hydrogen peroxide in methanol , followed by 1 h in blocking solution ( 3 % normal horse serum and 0 . 25 % triton x - 100 in 0 . 1 m pbs ) were performed , followed by overnight incubation with mouse anti - rat brdu ( 1 : 50 ; roche , indianapolis , ind .). this was followed by a biotinylated secondary antibody ( 1 : 200 ; vector laboratories , burlingame , calif .) and avidin - biotin substrate ( abu kit ; vector laboratories ) prior to diaminobenzidine substrate visualization . the sections were then mounted and coverslipped using permount ™ mounting medium ( fisher chemicals , nj ). dcx can be used as a marker of migrating neurons , since it is expressed for ˜ 3 weeks from the creation of a new cell and has previously been shown to be a reliable indicator of neurogenesis ( rao m s & amp ; shetty a k . ( 2004 ). efficacy of doublecortin as a marker to analyse the absolute number and dendritic growth of newly generated neurons in the adult dentate gyms . eur j neurosci . 19 : 234 - 246 ; couillard - despres s , et al . ( 2005 ). doublecortin expression levels in adult brain reflect neurogenesis . eur j neurosci . 21 : 1 - 14 ). dcx immunohistochemistry was performed without antigen retrival , using horse serum and a polyclonal goat antibody ( 1 : 150 ; santa - cruz biotuch , ca ) and the appropriate secondary antibody . immunofluorescence was used to compare colocalization of brdu and iba - 1 or brdu and gfap and to demonstrate colocalization of brdu and dcx . the 2 n hcl at room temperature was used for antigen retrival and primary incubation consisted of rat anti - brdu ( 1 : 400 ; accurate chemical , westbury , n . y .) and the phenotype - defining primary antibodies [ rabbit anti - gfap ( 1 : 500 ; dako , carpinteria , calif . ), or rabbit anti - iba1 ( 1 : 1 , 000 ; wako , richmond , va .) or dcx ( 1 : 150 ; santacruz biotech , ca )], overnight at 4 ° c . visualization was achieved using the appropriate alexafluor - conjugated secondary antibodies ( molecular probes , ca ) for 2 h and the sections were then mounted and coverslipped using vectashield ( vector labs ). the presence of the transplanted cells was detected using the mouse monoclonal hunu antibody ( 1 : 50 ; chemicon , ca ) that is specific for human nuclei . visualization was achieved using an alexafluor - conjugated secondary antibody ( molecular probes ). quantification and imaging of labeled cells within the sgz region was performed using the optical fractionator method of unbiased stereological cell counting ( west m j , et al . ( 1991 ). unbiased stereological estimation of the total number of neurons in the subdivisions of the rat hippocampus using the optical fractionator . anat rec . 231 : 482 - 497 ) using a nikon eclipse 600 ( for brdu + cell ) or olympus bx 60 ( for dcx + cell ) microscope and stereo investigator software ( microbrightfield , vt ). for the proliferation study , an identical virtual grid and counting frame of dimensions 125 μm × 125 μm was used to enable us to count all the cells that were present in a section , due to the low number of brdu + cells observed in the aged animals . the anatomical structures were outlined using a 10 ×/ 0 . 45 objective , whereas a 60 ×/ 1 . 40 objective was used for cell quantification . for dcx cells , the virtual grid and counting frame were both 150 μm × 150 μm . outlines of the anatomical structures were done using a 10 ×/ 0 . 30 objective , whereas a 40 ×/ 0 . 75 objective was used for cell quantification . defining the sgz of the dentate gyms as a two - cell diameter band on both sides of the granular cell layer ( gcl ), the number of brdu + cells within the sgz was counted . dcx + cell counts were made in the sgz / gcl , due to possible cell migration . to identify cell type - specific markers co - expressed in brdu cells , immunofluorescent colocalization was assessed using an olympus ix 70 microscope with a 10 ×/ 0 . 30 , 20 ×/ 0 . 40 or 40 ×/ 0 . 60 objective and an olympus dp 71 camera connected to a dp manager ( olympus , japan ). these cell counts were performed in the sgz / gcl . data represent mean ± sem and statistical testing was by unpaired two - tailed t - test using p & lt ; 0 . 05 as significant . twelve aged rats were implanted with either ctx0e03 cells or vehicle and treated with brdu 24 h later . forty - eight hours from the initial implant , the animals were perfused with paraformaldehyde , their brains removed and cryopreserved prior to sectioning sagitally at 40 μm . the sections were labeled with a number of different antibodies to determine cell proliferation , phenotype , and survival in the sgz of the dentate gyms . the presence of proliferating cells was determined using nuclear brdu labeling . this was evident in the sgz of the dentate gyms in both vehicle ( 218 . 0 ± 31 . 00 ) and cell - treated ( 694 . 0 ± 130 . 0 ) animals . a 3 - fold significant increase in cell number was apparent in the cell - treated rats ( t = 3 . 894 ; df = 9 ; p = 0 . 0037 ; n = 6 ), seen in fig5 . the presence of neuronal precursor cells was determined using dcx labeling of the sgz . labeled cells were seen in both vehicle ( 970 ± 32 . 7 ) and cell - treated ( 1 , 202 . 4 ± 61 . 9 ) animals , but again the number of cells was significantly increased in the cell - treated animals compared with the vehicle ( t = 4 . 29 ; df = 8 ; p = 0 . 002 ; n = 5 ), as seen in fig6 . confirmation that the dcx cells were also brdu - positive was demonstrated by colocalization staining and confocal imaging , as seen in fig7 . further identification of the potential phenotype of the proliferation cells was determined by using iba - 1 and gfap staining for microglial and astrocytes , respectively , with the localization of brdu . immunofluorescent iba - 1 - and gfap - positive staining cells were abundant , whereas nuclear brdu - positive cells were rare . thus , colocalization of brdu and iba - 1 was very limited , and brdu and gfap co - expression was not found within the sgz . no significant differences could be observed between staining in the vehicle - and cell - treated animals ( data not shown ). the presence of the transplanted cells at the injection site and in the sgz was determined using hunu staining . human nuclei staining revealed no hunu - positive cells within the sgz , demonstrating that none of the brdu - labeled cells were transplanted cells and instead were endogenous in origin . some hunu staining was apparent along the needle tract and in the ventricle , as seen in fig8 ( a ) though ( c ). however , no hunu - positive cells were found within the sgz of either vehicle or cell - implanted rats , evidencing that none of the brdu - labeled cells within the sgz were transplanted cells , but instrade were endogenous in origin . the absence of hunu staining within the sgz demonstrates that at 2 days from injection , the transplanted cells have not migrated to the region to either cause the effect or differentiate into immature neuronal cells , but instead are exerting their influence such as directly inducing cell proliferation or indirectly reducing inflammation to stimulate cell proliferation from the injection site . it is likely the cells are acting through the rapid secretion of anti - inflammatory cytokines , such as il - 10 , or neurotrophic factors , such as brain - derived neurotrophic factor , nerve growth factor , or neurotrophin - 3 , which have been known to encourage the growth and differentiation of new neurons . ctx0e03 cells were previously shown to secrete vegf and other factors in vitro ( eve d j , et al . ( 2008 ). release of vegf by ren001 cortical stem cells . cell transplant . 17 : 464 - 465 ). palmer et al . ( palmer t d , et al . ( 2000 ). vascular niche for adult hippocampal neurogenesis . j comp neurol . 425 : 479 - 494 ) reported that in the adult rat sgz , neurogenesis occurs in close proximity to blood vessels , where vegf expression is high and angiogenesis is ongoing . based on this and other evidence , palmer et al . ( palmer t d , et al . ( 2000 ). vascular niche for adult hippocampal neurogenesis . j comp neurol . 425 : 479 - 494 ) argued that neurogenesis and angiogenesis might be mechanistically linked , citing vegf as a factor that might provide such a linkage . in addition , it has been shown that intracerebroventricular infusion of vegf stimulated the proliferation of neuronal precursors in the sgz and svz both in vitro and in vivo ( jin k , et al . ( 2002 ). vascular endothelial growth factor ( vegf ) stimulates neurogenesis in vitro and in vivo . proc natl acad sci usa . 99 : 11946 - 11950 ; sun y , et al . ( 2006 ). vascular endothelial growth factor - b ( vegfb ) stimulates neurogenesis : evidence from knockout mice and growth factor administration . dev biol . 289 : 329 - 335 ). without being bound to any specific theory , given the above observations , the effects of ctx0e03 cells on endogenous neural proliferation may be modulated by vegf . this could include the use of conditioned media in which the cells have secreted factors such as vegf and attenuated cells for transplant , for example cells attenuated by freeze - thaw activity or heat inactivation . this would show that the effect is due to the factors secreted by the cells rather than the cells themselves . intracerebroventricular transplantation of ctx0e03 cells into rat brain results in increased proliferation within at least one of the endogenous stem cell reservoirs of the brain , the sgz . this proliferation is of immature neuronal cells as shown by the increased dcx staining but the absence of significant iba - 1 and gfap colocalization with brdu . confirmation that the neuronal precursors revealed by dcx staining were also proliferative ( as shown by the brdu colocalization ) was also obtained . while ctx0e03 cells do seem to have an effect on endogenous neuronal proliferation , it is not clear exactly how this occurs . previously work has shown that reducing neuroinflammation in rats be blocking the conversion of pro - interleukin ( il )- 1β to il - 1β through inhibition of the converting enzyme caspase - 1 rescued some rats from age - related decreases in neurogenesis ( gemma c , et al . ( 2007 ) blockade of caspase - 1 increases neurogenesis in the aged hippocampus . eur j neurosci . 26 : 2795 - 2803 ) and resulted in an improvement in cognitive function , which is often affected by stroke related brain damage ( gemma c , et al . ( 2005 ). improvement of memory for context by inhibition of caspase - 1 in aged rats . eur j neurosci . 22 : 1751 - 1756 ). furthermore , with hucbcs , exogenous stem cells stimulate the endogenous neural progenitor cells to increase proliferation , and reduce neuroinflammation as evidenced by a decrease in the number of activated microglia ( bachstetter a d , et al . ( 2008 ). peripheral injection of human umbilical cord blood stimulates neurogenesis in the aged rat brain . bmc neurosci . 9 : 22 ). no significant increase in the negligible number of colocalized brdu - and iba - positive cells was observed between vehicle and cells at the site of proliferation , suggesting that neither the cells nor the injection had induced an immune response of new microglial cells . further , previous work has shown that administration of human peripheral blood mononuclear cells as a control for the effect of human umbilical cord blood delivering cells did not alter neuronal proliferation or hippocampal neurogenesis ( bachstetter a d , et al . ( 2008 ). peripheral injection of human umbilical cord blood stimulates neurogenesis in the aged rat brain . bmc neurosci . 9 : 22 ). as well as the observed increased neuronal proliferation within the dentate gyms following hucbc transplantation ( bachstetter a d , et al . ( 2008 ). peripheral injection of human umbilical cord blood stimulates neurogenesis in the aged rat brain . bmc neurosci . 9 : 22 ), glial restricted progenitors or nscs from rats and mice have also been shown to promote endogenous nscs number and survival in a more long - term study in younger rats ( 12 months compared with 22 months ) and a 3 - fold increase in cell number in the cell - transplanted animal . ( hattiangady b , et al . ( 2007 ). increased dentate neurogenesis after grafting of glial restricted progenitors or neural stem cells in the aging hippocampus . stem cells . 25 : 2104 - 2117 ). a clonal human nsc line , ctx0e03 , has conditionally immortalized using the fusion transgene c - mycer tam to allow controlled expansion when cultured in the presence of 4 - hydroxy - tamoxifen . no safety or toxicology issues identified in in vivo studies with this cell line . the data presented herein evidences an additional use of ctx0e03 cells to promote the endogenous restorative properties of the brain . in the preceding specification , all documents , acts , or information disclosed does not constitute an admission that the document , act , or information of any combination thereof was publicly available , known to the public , part of the general knowledge in the art , or was known to be relevant to solve any problem at the time of priority . the disclosures of all publications cited above are expressly incorporated herein by reference , each in its entirety , to the same extent as if each were incorporated by reference individually . while there has been described and illustrated specific embodiments of an intravenous or intraarterial treatment for a neurodegenerative disease , it will be apparent to those skilled in the art that variations and modifications are possible without deviating from the broad spirit and principle of the present invention . it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described , and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween .

US-201213660647-A

an apparatus for disposition on appendage , such as an arm or leg , is capable of encircling and applying opposing forces selectively thereto . a c - shaped component receives one side of the appendage , a second c - shaped component receives the other side of the appendage , and a tensioning system draws the two components together for selective application of pressure to the appendage . outriggers and pressure applicators may be used to apply pressure to extended areas of the appendage that otherwise would not be engaged by the c - shaped components . side - to - side tissue compression thereby is provided for deflection of muscle forces , functional shortening of muscle length , and the maintenance of neurovascular channels . circumferential forces may be minimized based on semirigid characteristics of the components . elbow and shoulder braces apply side - to - side tissue compression to arms .

as a preliminary matter , it will readily be understood by one having ordinary skill in the relevant art (“ ordinary artisan ”) that the present invention has broad utility and application . furthermore , any embodiment discussed and identified as being “ preferred ” is considered to be part of a best mode contemplated for carrying out the present invention . other embodiments also may be discussed for additional illustrative purposes in providing a full and enabling disclosure of the present invention . moreover , many embodiments , such as adaptations , variations , modifications , and equivalent arrangements , will be implicitly disclosed by the embodiments described herein and fall within the scope of the present invention . accordingly , while the present invention is described herein in detail in relation to one or more embodiments , it is to be understood that this disclosure is illustrative and exemplary of the present invention , and is made merely for the purposes of providing a full and enabling disclosure of the present invention . the detailed disclosure herein of one or more embodiments is not intended , nor is to be construed , to limit the scope of patent protection afforded the present invention , which scope is to be defined by the claims and the equivalents thereof . it is not intended that the scope of patent protection afforded the present invention be defined by reading into any claim a limitation found herein that does not explicitly appear in the claim itself . thus , for example , any sequence ( s ) and / or temporal order of steps of various processes or methods that are described herein are illustrative and not restrictive . accordingly , it should be understood that , although steps of various processes or methods may be shown and described as being in a sequence or temporal order , the steps of any such processes or methods are not limited to being carried out in any particular sequence or order , absent an indication otherwise . indeed , the steps in such processes or methods generally may be carried out in various different sequences and orders while still falling within the scope of the present invention . accordingly , it is intended that the scope of patent protection afforded the present invention is to be defined by the appended claims rather than the description set forth herein . additionally , it is important to note that each term used herein refers to that which the ordinary artisan would understand such term to mean based on the contextual use of such term herein . to the extent that the meaning of a term used herein - as understood by the ordinary artisan based on the contextual use of such term - differs in any way from any particular dictionary definition of such term , it is intended that the meaning of the term as understood by the ordinary artisan should prevail . furthermore , it is important to note that , as used herein , “ a ” and “ an ” each generally denotes “ at least one ,” but does not exclude a plurality unless the contextual use dictates otherwise . thus , reference to “ a picnic basket having an apple ” describes “ a picnic basket having at least one apple ” as well as “ a picnic basket having apples .” in contrast , reference to “ a picnic basket having a single apple ” describes “ a picnic basket having only one apple .” when used herein to join a list of items , “ or ” denotes “ at least one of the items ,” but does not exclude a plurality of items of the list . thus , reference to “ a picnic basket having cheese or crackers ” describes “ a picnic basket having cheese without crackers ”, “ a picnic basket having crackers without cheese ”, and “ a picnic basket having both cheese and crackers .” finally , when used herein to join a list of items , “ and ” denotes “ all of the items of the list .” thus , reference to “ a picnic basket having cheese and crackers ” describes “ a picnic basket having cheese , wherein the picnic basket further has crackers ,” as well as describes “ a picnic basket having crackers , wherein the picnic basket further has cheese .” turning now to the figures , a first embodiment of the invention is shown in fig1 - 5 . an apparatus 10 for circumferential disposition on an appendage such as an arm or leg comprises a first partial collar 12 , a second partial collar 14 , and a tensioning system 16 ( fig5 ). the first partial collar 12 and second partial collar 14 are each adapted for partially encircling an appendage such that together they completely encircle an appendage when the apparatus 10 is disposed on the appendage . though other embodiments of the invention are adapted for disposition on other areas of other appendages , the first embodiment of the invention , namely the apparatus 10 , is particularly adapted for disposition on an arm . for example , in fig1 the apparatus 10 is disposed on an arm beyond the elbow . in this disposition , the apparatus 10 is nominally referred to as an elbow brace . the tensioning system 16 ( fig5 ) draws together the first partial collar 12 and second partial collar 14 . when the apparatus 10 is disposed on an appendage as shown in fig1 , the first partial collar 12 and second partial collar 14 are drawn together by the tensioning system ( fig5 ) and respective forces are thereby applied to the appendage by the partial collars . in particular , the first partial collar 12 is capable of applying a first force 18 ( fig3 ) to a first side of and appendage and the second partial collar 14 is capable of applying a second force 20 to a second side of the appendage , wherein the first force 18 and second force 20 , when applied , generally oppose one another . the partial collars 12 and 14 are each generally rigid , or at least semirigid . exemplary materials for their construction include , but are not limited to : plastics , particularly moldable and injection - moldable plastics ; nylon 66 ; fiberglass ; carbon and carbon composites ; polycarbonate ; polyoxymethylene ; polymethylmethacrylate ( pmma ); polyacetal ; urea - formaldehyde ; polystyrene ; and vinyl polymers . together , particularly when drawn together by the tensioning system 16 , the partial collars 12 , 14 define a collar clamp that closes upon an appendage and applies the directionally opposing forces 18 , 20 . thus , opposing forces are applied to opposing sides of an appendage and can be so applied , if desired , without any substantial circumferential forces being applied about the appendage as a function of the rigidity of the partial collars and / or use of pressure applicators . whereas circumferential forces such as those of a tourniquet tend to interfere with blood circulation , the opposing forces 18 , 20 applied by the apparatus 10 allow blood flow through an appendage encircled by the apparatus while still effecting side - to - side tissue compression of the appendage . thus , the inventive coapting apparatus 10 provides , among other things , benefits that include : deflection of muscle forces ; functional shortening of muscle length ; and the maintenance of neurovascular channels . the tensioning system 16 ( fig5 ) comprises a device 22 for controllably varying the forces applied to an appendage encircled by the apparatus 10 . in particular , a rotatable control knob 24 depends from the device 22 for grasping and rotation thereof by a wearer or user of the apparatus 10 . upon rotation of the rotatable control knob 24 in a first rotational direction 26 ( fig1 - 2 ), the directionally opposing forces 18 , 20 ( fig3 ) applied to an appendage encircled by the apparatus 10 are increased . in particular , the forces are increased by the drawing together of the first and second partial collars 12 , 14 upon rotation of the rotatable control knob 24 in the first rotational direction 26 . it should be understood that , while the first rotational direction 26 is illustrated as clockwise in fig1 - 2 , the descriptions herein similarly may relate to counterclockwise rotations as well . furthermore , by pressing of the rotatable control knob 24 , the directionally opposing forces 18 , 20 applied to an appendage are decreased or are entirely terminated . thus , in the first embodiment of the invention , the apparatus 10 closes upon rotation of the rotatable control knob and tends to spring back open upon pressing of the control knob . the apparatus 10 closes in that the second partial collar 14 moves relative to the first partial collar 12 in a first direction 30 , thereby , increasing the forces 18 , 20 ( fig3 ) when the apparatus is clamped in engagement with an appendage . the apparatus opens in that the second partial collar 14 moves relative to the first partial collar 12 in a second direction 32 , thereby decreasing the forces 18 , 20 when the apparatus is tightly clamped in engagement with an appendage . in another embodiment of the invention , not illustrated , a coapting shell encircling an appendage closes upon rotation of a rotatable control knob in one rotational direction and opens upon rotation of the rotatable control knob in an opposite rotational direction . in yet another embodiment of the invention , not illustrated , a coapting brace for encircling an appendage and applying forces thereto applies increasing forces upon rotation of a control knob and releases the forces upon pulling of the knob outwardly from the brace . it should be apparent that the present invention has many embodiments and the descriptions herein of particular tensioning systems and control devices are provided as examples and are not to be construed as limitations of the invention . nonetheless , in order to provide detailed descriptions of one or more particular embodiments , the tensioning system 16 , as shown in the exploded view of fig5 , comprises the rotary device 22 , a first line portion 28 depending from the rotary device , and a second line portion 30 depending from the rotary device . upon rotation of the rotatable control knob 24 in the first rotational direction 26 ( fig1 ), the tensioning lines are retracted and the line portions 28 , 30 are retracted and shorten . the first and second partial collars are thereby drawn together , thereby closing the apparatus 10 ( fig3 ) and increasing forces applied to an appendage . upon pressing of the rotatable control knob 24 , the tensioning lines are mechanically released and the line portions 28 , 30 tend to lengthen . the apparatus 10 ( fig3 ) is thereby opened and forces applied to an appendage are thereby decreased . an exemplary releasable and adjustable rotary device comprises a housing within which are incrementally drawn multiple lines upon selective rotation of a control knob . such an exemplary rotary device is disclosed , for example , in u . s . pat . no . 5 , 042 , 177 to schoch , titled “ rotary closure for a sports shoe , especially a ski shoe ,” which patent is hereby incorporated herein by reference . as shown in fig1 , and 5 , the first line portion and second line portion depend from the rotary device 22 and extend , in opposite directions , partially circumferentially about the first partial collar 12 . guide channels 32 ( fig5 ) and 34 ( fig1 ) are defined by the first partial collar 12 for receiving and guiding respective line portions 28 , 30 and maintaining the courses of the lines within margins of the apparatus . each line portion 28 , 30 is furthermore attached at a terminus thereof to the second partial collar . as the line portions 28 , 30 are drawn partially into the housing of the rotary device 22 upon rotation of the rotatable control knob 24 , the first and second partial collars are thereby drawn together . in another embodiment of the invention ( not illustrated ), first and second line portions that depend from a rotary device are opposing ends of a single line . the rotary device and single line completely encircle an apparatus that comprises two coapting partial collars . when the apparatus is circumferentially disposed on an appendage , the rotary device and continuous line completely encircle the appendage . in the first embodiment of the invention each line portion 28 , 30 comprises a flexible and inextensible line . the line portions 28 , 30 are illustrated in fig1 - 5 as monofilament lines though these descriptions relate as well to multifilament lines and many types of elongate flexible lines having various constructions and formed of various materials having respective tensile and flexible properties . exemplary constructions include , but are not limited to : monofilament lines , multifilament lines , wound lines , woven lines , braided lines , layered lines , strings , ropes , cords , threads , twines , intertwined strands , chains , tethers , belts , bands , straps , and combinations thereof . exemplary materials include , but are not limited to : natural fibers including hemp , cotton , linen , hide , gut , and sinew ; synthetic and plastic fibers such as nylon , polyethylene , and fluorocarbon ; lines formed of metals such as wires and cables , in particular wound steel cables ; and , combinations thereof . as shown in fig5 , each partial collar 12 , 14 comprises an open , arcuate c - shape . the first partial collar 12 comprises opposing end portions 12 a , 12 b . similarly , the second partial collar 14 comprises opposing end portions 14 a , 14 b . when the apparatus is assembled as shown in fig3 , opposing end portions 14 a , 14 b of the second partial collar are disposed in the interior of the open c - shape of the first partial collar 12 . consequentially , when the apparatus 10 is circumferentially disposed on an appendage , the opposing end portions 14 a , 14 b of the second partial collar 14 are disposed between the appendage and respective opposing end portions 12 a , 12 b of the first partial collar 12 . for example , as shown in fig1 , when the apparatus 10 is circumferentially disposed on an appendage , the end portion 14 b of the second partial collar 14 is disposed between the appendage and the end portion 12 b of the first partial collar 12 . as shown in fig3 , the second partial collar 14 comprises a pair of channels or conduits 40 , 42 for receiving respective end portions 12 a , 12 b of the first partial collar 12 . the conduits 40 , 42 assist in maintaining a coapting engagement of the first partial collar 12 and second partial collar 14 . the conduits 40 , 42 furthermore maintain the relative orientations of the partial collars . the opposing end portions 12 a , 12 b pass freely within the respective conduits 40 , 42 allowing relative movement of the partial collars in closing and opening of the apparatus 10 . for example , the end portion 12 a of the first partial collar passes freely into the conduit 40 as the apparatus 10 closes by movement of the second partial collar 14 relative to the first partial collar 12 in the first direction 30 . as further shown in fig3 , the apparatus 10 comprises a pressure applicator 46 attached to the first partial collar 12 . when the apparatus is circumferentially disposed about an appendage , the pressure applicator 46 applies pressure to a discrete area of the appendage according to the disposition of the apparatus . the pressure applicator , optionally somewhat flexible to allow mild deflection of the applicator while applying pressure to an appendage , is constructed of a material capable of bearing a load and optionally allowing mild deflection . exemplary materials include , but are not limited to : plastic ; fiberglass ; carbon and carbon composites ; and spring steel . in the first embodiment of the invention , the pressure applicator 46 comprises a leaf spring 48 attached to the first partial collar . the pressure applicator 46 is optionally padded to provide for comfort as it applies pressure to a discrete area of an appendage . the pressure applicator 46 is optionally removable from the apparatus 10 . the first and second partial collars are each optionally padded for comfort of the wearer of the apparatus 10 . for example , a collar pad 50 ( fig5 ) is adapted to nestle within the second partial collar 14 as shown in fig1 for disposition between the second partial collar 14 and an appendage when the apparatus 10 is disposed on the appendage as shown in fig1 . the collar pad 50 preferably comprises soft , breathable , and washable materials . exemplary materials include , but are not limited to , natural and synthetic fabrics , pliable foams , elastic fabrics , neoprene , spandex , felt , natural and synthetic chamois , and various stretchable and pliable materials . in the first embodiment of the invention , each partial collar defines a respective arcuate receiving area . for example , the second partial collar 14 of the apparatus 10 defines an arcuate , cylindrically - concave receiving area 14 c ( fig5 ) for receiving a side of an appendage . the apparatus 10 is particularly illustrated for use as an elbow brace in fig1 . the arcuate receiving area of the second partial collar comfortably receives , for example , the volar side of a forearm proximal an elbow as shown in fig1 . turning now to a second embodiment shown in various views in fig6 - 10 , an apparatus 110 for circumferential disposition on an appendage such as an arm or leg comprises a first partial collar 112 , a second partial collar 114 , and a tensioning system 116 ( fig1 ). the first partial collar 112 and second partial collar 114 are each adapted for partially encircling an appendage such that together they completely encircle an appendage when the apparatus 110 is disposed on the appendage . for example , in fig1 the apparatus 110 is disposed on an arm proximal a shoulder . in this disposition , the apparatus 110 is nominally referred to as a shoulder brace . the tensioning system 116 ( fig1 ) draws together the first partial collar 112 and second partial collar 114 . when the apparatus 110 is disposed on an appendage as shown in fig1 , the first partial collar 112 and second partial collar 114 are drawn together by the tensioning system 116 ( fig1 ). respective forces are thereby applied to the appendage by the partial collars . in particular , the first partial collar 112 is capable of applying a first force 118 ( fig8 ) to a first side of an appendage and the second partial collar 114 is capable of applying a second force 120 to a second side of the appendage . as the second side of the appendage is opposite the first side of the appendage , the first force 118 and second force 120 , when applied , generally oppose each other . the partial collars 112 and 114 are each generally rigid , or at least semirigid . together , particularly when drawn together by the tensioning system 116 ( fig1 ), the partial collars 112 and 114 define a collar clamp that closes upon an appendage and applies the directionally opposing forces 118 , 120 ( fig8 ). thus , opposing forces are applied to opposing sides of an appendage and can be so applied , if desired , without any considerable circumferential forces being applied about the appendage as a function of the rigidity of the partial collars and / or use of pressure applicators . generally applying only opposing forces 118 , 120 by the apparatus 110 allows blood flow through the appendage even though it is surrounded by the apparatus and even though side - to - side tissue compression is applied to the appendage . thus the inventive apparatus 110 provides , among other things , benefits that include : deflection of muscle forces ; functional shortening of muscle length ; and the maintenance of neurovascular channels . the apparatus 110 of fig6 - 10 bears many similarities to the apparatus 10 of fig1 - 5 . therefore , many of the descriptions herein relate to both apparatus 10 and apparatus 110 . however , in the interest of providing descriptions of the present invention that has many embodiments , and in the interest of minimizing duplicative descriptions , the descriptions below relate particularly to features and benefits of the apparatus 110 that are generally not merely duplicative to those of the apparatus 10 . for example , as shown in fig8 , the second partial collar 114 defines a polygonal concave receiving area 114 c for receiving a side of an appendage . the apparatus 110 is particularly illustrated for use as a shoulder brace in fig1 . the polygonal concave receiving area 114 c ( fig8 ) of the second partial collar 114 comfortably receives , for example , the volar side of an upper arm just below the shoulder . an arterial pressure point resides proximal this area of the arm . the rigid partial collar 114 , having planar facets defining the polygonal concave receiving area 114 c , is capable of applying the force 120 ( fig8 ) while minimizing the restriction of blood flow in the arm , and is furthermore capable of allowing comfortable swinging movement of the arm relative to the nearby rib - cage of the torso . for further example , while the pressure applicator 46 of fig1 - 5 does not generally extend significantly beyond margins of the partial collar 12 , other embodiments of pressure applicators contact areas of appendages beyond margins of the partial collars . for example , an outrigger 146 for contacting multiple areas of an appendage is shown in fig6 - 10 . when attached to the first partial collar 112 as illustrated in fig6 - 9 , the outrigger 146 contacts and applies pressure to multiple areas of an appendage ( fig1 ) on which the apparatus 110 is circumferentially disposed . as shown in fig1 , the outrigger 146 comprises a base 54 , multiple members 56 attached to the base , and pressure applicators 58 respectively attached to the members 56 . the outrigger 146 optionally comprises a rigid unitary construction formed , for example , of hard plastic . alternatively , the members 56 of the outrigger 146 are optionally spring loaded or are articulated by cables . the members 56 may be rigid and fixed , or may be formable . the members may be positionable like jointed fingers . furthermore , the members may be removable from the base 54 such that they may be replaced or such that a variable number of members depends from the base . with regard to each of the pressure applicators described herein , for example pressure applicator 46 of fig1 - 5 and pressure applicators 146 of fig6 - 10 , a pressure applicator according to the present invention optionally comprises an active cell ( not illustrated ). an “ active cell ” as used herein relates to an electrical , mechanical , or electromechanical device that , in conjunction with pressure applied by a pressure applicator , applies stimulus or treatment . for example , one embodiment of an active cell applies vibratory waves for massaging or otherwise stimulating tissue and vessels . in another example , an active cell applies acoustic waves . in another example , an active cell applies electrical stimulation or conveys electrical current . in yet another example , an active cell applies heating , cooling , or thermal - cycling therapy .

US-87658907-A

a soil deflecting and leveling reel is formed by end plates having a plurality of blades extending helically therebetween . intermediate plates are positioned in spaced relation to the end plates and reinforce the reel blades . the reel is rotatably mounted on a reel support frame which is pivotally connected to a tillage tool frame in close proximity behind a disc gang . the reel support frame is resiliently urged to engage the reel with the ground whereby ground contact rotates the reel as the tool frame is drawn across a field . the blades of the rotating reel engage soil ejected upwardly by the discs and deflect the soil back to the ground to minimize lateral shifting of the soil and consequent formation of ridges and furrows by the discs . additionally , the blades of the rotating reel break up clods of the soil and churn the soil to improve mixing and incorporation of chemicals applied to the soil .

as required , detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed structure . the reference numeral 1 generally designates a soil deflecting and leveling reel which embodies the present invention . in general , the reel 1 is mounted on a tillage tool frame 2 behind a disc gang 3 to deflect back to ground 4 soil 5 ejected upwardly as a result of the discs 6 being drawn through the ground 4 . the overall effect of the reel 1 is to level the ground 4 behind the discs 6 which would otherwise tend to create furrows and ridges ( not shown ) in the ground 4 after being worked by the discs 6 . the tool frame 2 is preferably a conventional tillage tool frame of the type which is generally supported on ground engaging wheels ( not shown ) mounted on the frame 2 , rather than the type of tool bar connected directly to and supported by a tractor vehicle ( not shown ), although mounting the reel 1 on such a directly connected tool bar is not precluded by the present invention . the frame 2 includes longitudinal frame members 9 interconnected with transverse frame members 10 . the disc gangs 3 are also conventional and include a plurality of discs 6 rotatably mounted in spaced relation along a generally transversely extending disc shaft ( not shown ). the disc gang 3 includes a main disc frame member 14 pivotally connected by cranks 15 to a cross member 10 of the tool frame 2 . outer ends of the cranks 17 are connected by compression springs 16 to upstanding spring brackets 17 which are mounted on the cross member 10 . the springs 16 resiliently urge the cranks 15 and , thus , the discs 6 toward engagement with the ground 4 when the tool frame 2 is lowered for soil working . the illustrated disc gangs 3 include disc scrapers 19 mounted on a scraper support bar 20 connected to the rear ends of the cranks 17 and extending parallel to the disc frame member 14 . the scrapers 19 engage soil and residue on inner sides of the discs 6 to prevent them from becoming clogged in wet soil conditions . the reel 1 includes spaced apart end plates 22 and intermediate plates 23 positioned between the end plates 22 . the illustrated end plates 22 and intermediate plates 23 are hexagonal in shape , although other shapes may be used . a plurality of blades 25 extend between the end plates 22 and are reinforced by the intermediate plates 23 . the blades 25 engage the plates 22 and 23 at vertexes of their hexagonal shapes . the blades 25 preferably extend helically between the end plates , giving the reel 1 an overall cylindrical form which allows the reel 1 to roll along the surface of the ground 4 with minimal vibration . the reel 1 is rotatably supported on a reel support frame 28 which is pivotally mounted on the tool frame 2 . the reel frame 28 includes a cross member 30 and one or more diagonal arms 31 . the arms 31 have lower mounting plates 32 which receive u - bolts 33 to secure the reel cross member 30 thereto . upper ends of the arms 31 have spaced apart ears 35 which are received on opposite sides of mounting stubs 36 which extend rearward from the tool frame transverse member 10 . the ears 35 and the rear end of the stub 36 receive a pivot bolt 37 to pivotally connect the arm 31 to the stub 36 . the stub 36 may be connected to the tillage frame member 10 , as by u - bolts 38 . although the tool support frame 28 is described and illustrated as being connected directly to the tillage frame member 10 , the frame 28 could alternatively be connected to other components of the tool frame 2 or indirectly connected to the tool frame 2 through other frame members connected to the tool frame 2 , such as the main disc frame member 14 . preferably , the reel 1 is resiliently urged toward ground engagement . the illustrated stub 36 has an internally mounted spring abutment 39 affixed therein . a spring rod 40 extends through the abutment 39 and through a bar 41 extending between and pivotally connected to the ears 35 at the upper end of the reel support arm 31 . a retainer nut 42 is secured to the rear end of the rod 40 , and a spring retainer plate 43 is secured to a front end of the rod 40 . a compression spring 45 is positioned on the rod 40 and has opposite ends engaged with the abutment 39 and the spring retainer plate 43 respectively . the spring 45 resiliently urges the spring retainer plate 43 away from the abutment 39 , transferring the force of the spring 45 through the rod 40 and bar 41 to the arm 31 . the arm 31 is , thus , urged about the pivot bolt 37 toward engaging the reel 1 with the ground 4 , whereby movement of the tool frame 2 over the ground 4 causes rotation of the reel 1 . the cross member 30 of the reel support frame 28 has reel support brackets 48 ( fig2 ) depending from opposite ends thereof . the illustrated brackets 48 are connected to the ends of the cross member 30 , as by u - bolts 49 . the end plates 22 of the reel 1 have bearing assemblies 50 mounted thereon . axle bolts 51 extend through lower ends of the brackets 48 and engage the bearing assemblies 50 , whereby the reel 1 is journaled on the reel support frame 28 and is freely rotatable thereon . preferably , there is no axle extending between the end plates 22 of the reel 1 to provide maximum space within the blades 25 between adjacent sets of the intermediate plates 23 or an intermediate plate 23 and an end plate 22 , thereby promoting better mixing of any soil 5 entering the reel 1 and avoiding clogging in wet field conditions . the illustrated discs 6 are conventional in configuration and are spherically dished . upon being drawn through the ground surface , the discs 6 cut through soil 5 , breaking it up , and through roots and surface residue from previous crops . the discs 6 rotate , thereby churning and mixing the soil 5 and crop residue and improving the incorporation of chemicals , such as fertilizers , herbicides , and insecticides , which are applied forward of the disc gang 3 . the rotation of the discs 6 tends to eject soil upward and laterally as the ground 4 is worked , which tends to create furrows and ridges behind the disc gang 3 . the reel 1 is positioned behind the disc gang 3 at such a location as to engage and deflect soil 5 ejected upwardly by the discs 6 back to the ground 6 . a preferred separation distance between the discs 6 and the reel 1 is in a range of two to six inches . although a separation distance of less than two inches is effective in preventing the formation of ridges and furrows , it also limits the desired mixing action of the reel 1 . a maximum desired separation distance is in a range of 1 . 0 to 1 . 5 times the diameter of the reel 1 . the diameter of the reel 1 is desirably in a range of thirty to eighty percent of the diameter of the discs 6 . the illustrated discs 6 have a typical diameter of twenty inches , and the illustrated reel 1 has a diameter of about 10 . 75 inches . reels smaller than thirty percent of the disc diameter have a relatively high rotation speed from ground contact , but because of their size do not catch much of the soil ejected by the discs 6 , such that leveling and mixing capability of such small reels is inadequate . such small reels also tend to become clogged in wet field conditions . reels larger than eighty percent of the disc diameter rotate slowly , whereby they are less effective in engaging and deflecting soil for a given number of reel blades 25 . a preferred size for the reel 1 is about half the diameter of the discs 6 , which combines the higher rotation speed of smaller diameter reels with the increased openness of the larger diameter reels . the reel blades 25 are preferably flat rather than round , and the illustrated blades 25 have a cross section of 0 . 25 inch by 1 . 5 inches . the blades 25 are oriented on the reel 1 with the widest dimension or sides directed circumferentially . such orientation provides a wide area to engage and deflect soil 5 thrown up by the discs 6 and a narrow profile to allow soil to easily enter and exit the reel 1 . round blades of a comparable cross sectional area reduce the soil impact area and decrease the openings between the blades for soil to enter the reel 1 . additionally , rounded blades have a tendency to pack the soil over which the reel 1 rolls and a greater tendency to clog in wet conditions . preferably , the thickness of the blades 25 is less than half the width of the blades , and the width is within a range of five to twenty percent of the diameter of the reel 1 . at the lower end of the range , the ability of the blades 25 to deflect soil is limited , while at the higher end of the range , clogging of the reel 1 becomes a problem . although the preferred embodiment of the present invention has been described and illustrated to include the reel 1 having the helically extending blades 25 , other configurations of rotating devices to deflect soil 5 thrown up by the discs 6 are envisioned . such devices ( not shown ) include tools referred to as rolling harrows , rolling baskets , rotary crumblers , and the like . such devices typically include axially or helically oriented elements spaced radially from a rotary axis of the device . another type of device includes flattened elements extending generally radially from an arbor . while the configuration of the reel 1 , as described , is preferred for its particularly useful combination of features , such other rotary soil working tools could alternatively be employed in place of the reel 1 , although to a somewhat lesser degree of efficiency . thus , such other rotary devices are considered to be functional equivalents of the reel 1 in the present invention . it is to be understood that while certain forms of the present invention have been illustrated and described herein , it is not to be limited to the specific forms or arrangement of parts described and shown .

US-56179995-A

an orthopedic pillow providing support for the head and neck of the user is disclosed . the neck is supported by either of two cylindrical neck bolsters . either of two convoluted surfaces comprising matrices of pyramid shaped nodes are utilized to give support to and cushion the head .

referring to fig1 and 3 , the orthopedic pillow 1 of the present invention is comprised of support member 4 , central head rest sections 2 and 3 , cover 5 and fastener 6 . the support member 4 is comprised of two longitudinally extending cylindrical neck bolsters 4a and 4b , and rectangular support section 4c . the neck bolsters 4a and 4b are joined to the long ends of the rectangular support section 4c such that the long ends of the rectangular support section 4c are perpendicular to each of the neck bolsters 4a and 4b . each of the central head rest sections 2 and 3 are comprised of a multitude of pyramid shaped nodes 7 which are configured with a rounded top 8 . the pyramid shaped nodes 7 are arranged in an orderly matrix fashion so as to form a convoluted surface . as best seen in fig2 adjacent rows of nodes 7 are offset to provide nodes 7 of one row in alignment with the depression 9 between the nodes 7 of the adjacent row of nodes 7 . this convoluted surface is advantageous insofar as it provides a larger area upon which the head will rest , which aids in relieving pressure points and providing maximum comfort . in addition , the convoluted surface allows more air circulation than would a flat section of foam , which aids in reducing snoring by the user . the central head rest sections 2 and 3 are joined to the rectangular support section 4c along their planar surface . by providing such head rest sections on both sides of the orthopedic pillow 1 , a user can utilize both sides to rest his head upon with equal effectiveness . referring to fig1 the orthopedic pillow 1 is encased by the cover 5 , which can be made of any material suitable for removing and cleaning . the fastener 6 is attached to the open end of the cover 5 and serves to close the cover 5 around the orthopedic pillow 1 in a conventional fashion . the fastener 6 can be implemented with a standard zipper , drawstring , or the like . practice has taught that the pillow of the subject invention that is particularly suitable for orthopedic use is made of polyurethane foam of 1 . 5 lb . density . the support member 4 should have a firmness measurement of 18 - 20 ild , while the central head rest sections 2 and 3 should have a firmness measurement of 12 - 15 ild . practice has also taught that by constructing the cylindrical neck bolsters 4a and 4b such that they are five inches in diameter and 22 inches long , the rectangular support section 4c such that it is 11 / 2 inches thick x 61 / 2 inches wide x 22 inches long , and the central head rest sections 2 and 3 such that they are 11 / 2 inches thick x 61 / 2 inches wide x 22 inches long , the orthopedic pillow 1 will easily fit into a conventional pillow case . the plane defined by the tops 8 of the nodes 7 is therefore 1 / 4 inch lower than the plane defined by the peaks of the cylindrical neck bolsters 4a and 4b , which allows the user &# 39 ; s head to lay in a natural position with respect to his neck and body . this eliminates the need for specially made pillow cases which are necessitated by the odd shaped pillows described in the prior art . the orthopedic pillow described herein is superior to the pillows of the prior art due to its versatility in usage . a user can rest his head and neck in both the supine position or while lying on his side . orthopedic pillows of the prior art contain head shaped concave depressions which limit the user to the supine position , failing to take into account the subconscious movements of a person while he sleeps . in addition , the orthopedic pillow in the present invention is constructed so as to appear to be a conventional pillow and is thereby visually pleasing . conventional pillow covers can be used , and due to the symmetry of construction , the pillow can be used upside down as can a conventional pillow . although there has been shown and described what is considered to be the preferred embodiment of the present invention , it will be appreciated by those skilled in the art that modifications of such embodiments may be made . it is therefore desired that the invention not be limited to this embodiment , and it is intended to cover in the appended claims all such modifications as fall within the true spirit of the invention .

US-33251589-A

a pacemaker system which includes a fast responding temperature sensor located near the distal end of a transvenous pacing lead generates a cycle - by - cycle variation of temperature indicative of the mechanical pumping action of the heart . a timer is used to define a detection window after the generation of a pacing pulse . the occurrence of a detected depolarization within the detection window indicates that the pacing pulses capture the heart .

in the following description , reference is made to an illustrative embodiment for carrying out the invention . it is understood that other embodiments may be utilized without departing from the scope of the invention . for example , the invention is disclosed in the context of a vvi modality pacer for treating bradycardia . it should be appreciated that the technique for evoked response detection could also be applied to a dual chamber device where capture detection is used to control the energy of the pacing stimuli delivered to the atria . in a similar fashion the ability to detect the evoked response will find utility in tachyarrhythmia pacers where direct evidence that capture has occurred can be used as feedback to control the delivery of tachyarrhythmia therapies . the present invention will now be more fully described with reference to various figures of the drawings , fig1 showing generally how a pacemaker 10 in accordance with the present invention may be implanted in patient 12 . a pacemaker lead 14 is electrically coupled to pacemaker 10 and extends into the patient &# 39 ; s heart 16 via a vein 18 . the distal end of the lead 14 includes one or more exposed conductive electrodes for receiving electrical cardiac signals and for delivering electrical pacing stimuli to the patient &# 39 ; s heart 16 . in accordance with the invention to be hereinafter described , the distal end of the pacing lead 14 also incorporates a temperature transducer ( not shown in fig1 due to the small scale of that figure ) for producing electrical signals representative of the temperature of the blood contained within the right ventricle of the heart 16 . turning to fig2 a block diagram of pacemaker 10 from fig1 is shown . although the present invention is described in conjunction with the pacemaker 10 having a microprocessor - based architecture , it will be understood that it could be implemented in any logic - based , custom integrated circuit architecture , if desired . it will also be understood that the present invention may be utilized in conjunction with other implantable medical devices , such as cardioverters , defibrillators , diagnostic monitoring devices , cardiac assist systems , and the like . in the embodiment shown in fig1 pacemaker 10 includes an activity sensor 20 , which may be , for example , a piezoelectric element bonded to the inside of the pacemaker &# 39 ; s housing . sensor 20 provides a sensor output which varies as a function of a measured parameter that relates to the metabolic requirements of patient 12 . in addition , pacemaker 10 includes a temperature sensor 22 disposed at the distal end of lead 14 , as previously noted , which may be similarly used to ascertain the metabolic requirements and / or cardiac output of patient 12 . the construction of the lead is not critical to the invention , various suitable lead arrangements being known to those skilled in the art . see for example , u . s . pat . no . 4 , 543 , 954 to cook , et al . and incorporated herein by reference . pacemaker 10 is schematically shown in fig2 to be electrically coupled by a pacing lead 14 to a patient &# 39 ; s heart 16 . lead 14 includes an intracardiac electrode 24 and temperature sensor 22 located near its distal end and positioned within the right ventricular chamber heart 16 . lead 14 can carry either unipolar or bipolar electrodes as is well known in the art . in the presently disclosed embodiment , lead 14 which couples pacemaker 10 to the ventricular endocardium can comprise a steroid - tipped , unipolar lead with an integral temperature transducer of the type describe in the aforementioned reference . electrode 24 is coupled by a suitable lead conductor 14a through input capacitor 26 to node 28 and to input / output terminals of an input / output circuit 30 . output from the first sensor 20 is coupled to input / output circuit 30 . output from temperature sensor 22 is also coupled to input / output circuit 30 by a suitable lead conductor 14b . input / output circuit 30 contains the analog circuits for interface to the heart 16 , first sensor 20 , temperature sensor 22 , and antenna 52 , as well as for the application of stimulating pulses to heart 16 to control its rate as a function thereof under control of the software - implemented algorithms in a microcomputer circuit 32 . microcomputer circuit 32 comprises an on - board circuit 34 and an off - board circuit 36 . on - board circuit 34 includes a microprocessor 38 , a system clock circuit 40 , and on - board ram 42 and rom 44 . off - board circuit 36 includes an off - board ram / rom unit 46 . microcomputer circuit 32 is coupled by data communication bus 48 to a digital controller / timer circuit 50 . microcomputer circuit 32 may be fabricated of custom integrated circuit devices augmented by standard ram / rom components . it will be understood that the electrical components represented in fig2 are powered by an appropriate implantable battery power source , not shown , in accordance with common practice in the art . an antenna 52 is connected to input / output circuit 30 for purposes of uplink / downlink telemetry through rf transmitter / receiver ( rf tx / rx ) unit 54 . telemetering both analog and digital data between antenna 52 and an external device , such as an external programmer ( not shown ), is accomplished in the presently disclosed embodiment by means of data first being digitally encoded and then pulse position modulate on a damped rf carrier , as substantially described in co - pending u . s . patent application ser . no . 07 / 468 , 407 , filed on jan . 22 , 1990 , entitled &# 34 ; improved telemetry format ,&# 34 ; which is assigned to the assignee of the present invention and which is incorporated herein by reference . a crystal oscillator circuit 56 , typically a 32 , 768 hz crystal - controlled oscillator , provides main timing clock signals to digital controller / timer circuit 50 . a vref / bias circuit 58 generates a stable voltage reference and bias currents for the analog circuits of input / output circuit 30 . an analog to digital converter / multiplexor ( adc / mux ) unit 60 digitizes analog signals and voltages to provide &# 34 ; real time &# 34 ; telemetry of temperature and intracardiac signals and battery end - of - life ( eol ) replacement function . a power - on reset ( por ) circuit 62 functions as a means to reset circuitry and related functions to a default condition upon detection of a low battery condition , which will occur upon initial device power - up or will transiently occur in the presence of electromagnetic interference , for example . the operating commands for controlling the timing of pacemaker 10 are coupled by bus 48 to digital controller / timer circuit 50 wherein digital timers and counters are employed to establish the overall escape interval of the pacemaker , as well as various refractory , blanking , and other timing windows for controlling the operation of the peripheral components within input / output circuit 30 . digital controller / timer circuit 50 is coupled to a sense amplifier 64 and an electrogram amplifier 66 for receiving amplified and processed signals picked up from electrode 24 through lead conductor 14a and capacitor 26 representative of the electrical activity of the patient &# 39 ; s heart 16 . sense amplifier 64 amplifies sensed electrical cardiac signals and provides this amplified signal to peak sense and threshold measurement circuitry 65 , which provides an indication of peak sense voltages and the measured sense amplifier threshold voltage on multiple conductor signal path 67 to digital controller / timer circuit 50 . the amplified sense amplifier signal is also provided to a comparator 69 . the electrogram signal developed by egm amplifier 66 is used on those occasions when the implanted device is being interrogated by an external programmer ( not shown ) in order to transmit by uplink telemetry a representation of the analog electrogram of the patient &# 39 ; s electrical heart activity as described in u . s . pat . no . 4 , 556 , 063 , issued to thompson et al ., assigned to the assignee of the present invention and incorporated herein by reference . input / output circuit 30 further includes sensitivity control circuitry 75 coupled between digital controller / timer circuit 50 and sense amplifier circuit 64 . sensitivity control circuit 75 controls the sense amplifier gain and thus the sensing threshold of sense amplifier 64 as instructed by digital controller / timer 50 . an output pulse generator 68 provides the pacing stimulus to the patient &# 39 ; s heart 16 through coupling capacitor 74 in response to a pacing trigger signal developed by digital controller / timer circuit 50 each time the escape interval times out , or an externally transmitted pacing command has been received , or in response to other stored commands as is well known in the pacing art . digital controller / timer circuit 50 is coupled to an activity circuit 70 for receiving , processing , and amplifying signals received from activity sensor 20 . activity circuit 70 produces an activity signal which is representative of the patient &# 39 ; s metabolic requirements . similarly , the digital controller / timer circuit 50 is coupled to a temperature circuit 72 for receiving , amplifying and processing sensor output from temperature sensor 22 . in the presently disclosed embodiment of the invention , temperature circuit 72 produces an amplified , filtered analog temperature signal which is received by digital controller / timer circuit 50 . the design of the temperature sensing circuitry is not critical to the invention herein described , various suitable designs being known to those skilled in the art . see for example , u . s . pat . no . 4 , 803 , 987 to calfee , et al . and incorporated herein by reference . in conjunction with adc / mux 60 , digital controller / timer circuit 50 samples and digitizes the temperature signal from the temperature circuit 72 to obtain the digital representation of the peak - to - peak value of the intracardiac blood temperature during each cardiac cycle . this value is provided to microprocessor 34 , which maintains a running average over a previous number of cardiac cycles of the intracardiac pulse temperature . dynamic temperature sensor 22 is disposed in the right ventricle ( rv ) of the patient &# 39 ; s heart to sense fluid temperature therein ( rv temp ), and to provide a sensor output ( output temp ) related to changes in the fluid temperature associated with the heart &# 39 ; s mechanical activity , contractility and blood flow . processing by pacemaker 10 of output temp yields a signal which is proportional to the magnitude of such rv temperature changes . each sensed or paced rv event will yield a dynamically varying signal . in the preferred embodiment , the last sixteen valid pulse values ( both paced and sensed events ) are used to determine an average temperature pulse peak value , referred to as the temperature pulse peak average or &# 34 ; temp . avg &# 34 ; pacemaker 10 tests for validity of each peak temperature value on a sample - by - sample basis , based upon the requirement that a sampled temperature pulse peak value must be within a predetermined range defined by the temp . avg value . in the preferred embodiment , this validity range is defined as temperature pulse peak values between 25 % to 400 % of temp . avg . values outside this validity range are considered artifacts and are ignored . once determined , temp . avg is used to verify capture on a beat - by - beat basis . a programmable ( 25 % to 75 %, in 12 . 5 % steps ) threshold of temp . avg value ( a continuous running average of 16 pulse temperature values ) during a window of time ( t2 ) subsequent to a stimulating pulse will be used to generate a capture detect signal in response to a successful capture due to the stimulating pulse . the capture detect signal is generated when the temperature circuitry 72 in conjunction with the microcomputer circuit 32 generates a detect signal during the capture detect window t2 . this capture detect signal may be used in a variety of ways , and is illustrated herein in the context of an auto - threshold - type pacer . in this instance , the capture detect signal is communicated to auto - threshold logic 61 . auto threshold logic 61 controls the energy content of the pacing pulses delivered by the output circuit 68 to the lead system via capacitor 74 . in the event that a pacing pulse is delivered and no capture detect signal follows , auto threshold logic 61 will generate a control signal allowing input / output circuit 30 to increment the amplitude of the pacing pulses provided by output circuit 68 . auto threshold logic 61 may also decrement the amplitude of the pacing pulses in response to an extended period in which all pacing pulses successfully capture the heart to enable a determination of the minimum energy required to reliably pace the heart . auto threshold logic 61 may also respond to the failure of a pacing pulse to capture the heart by quickly triggering an additional pacing pulse at an increased amplitude . appropriate mechanisms for adjusting the energy content of the pacing pulses generated by output circuit 68 are disclosed in u . s . pat . no . 4 , 858 , 610 issued to callaghan et al ., u . s . pat . no . 4 , 878 , 497 issued to callaghan et al ., and u . s . pat . no . 4 , 729 , 376 issued to decote , all of which are incorporated herein by reference in their entireties . alternative pacing functions which may be modified in response to the detection or nondetection of cardiac depolarizations during the capture detect window are described in u . s . pat . no . 4 , 759 , 366 issued to callaghan et al ., and in the above cited u . s . pat . no . 4 , 305 , 396 issued to whittkampf , both of which are incorporated herein by reference in their entireties . the operation of the invention is illustrated in fig3 . this figure shows tracings of cardiac waveforms having a unipolar pacing lead implanted in the heart . pacing pulses were delivered between the tip electrode and electrode corresponding to pacemaker 10 housing ( fig1 ). tracing 1 was taken with the sense amplifier 64 coupled to tip and can electrodes , and corresponds to the signals seen on the pacing lead 14 . tracing 2 corresponds to the signal seen by the temperature circuit 72 from the sensor 22 . tracing 3 reflects the logic level output of the peak temperature detect circuitry . tracing 4 corresponds to the capture detect window signal . high logic level signals in tracing 4 correspond to the duration of the capture detect window t2 . tracing 5 corresponds to the logic level output of the evoked response detection circuitry and indicates the occurrence of a sensed ventricular depolarization during the t2 time window . tracing 6 corresponds to the output of the output circuit 68 ( fig2 ). the amplitude of the pacing pulses are reflected by the height of the pulse markers . the occurrence of pacing pulses is also reflected by the artifacts 112 , 114 , 116 , 118 and 120 ( tracing 1 ). the first cardiac waveform 110 results from a normal sinus depolarization of the heart . the sensed detect signal 122 on tracing 3 reflects the normal detection of this event . in the context of the pacer of fig2 this detected depolarization resets the escape interval timer contained within digital controller timer circuit 50 . at the conclusion of the escape interval , timer 50 generates a v pace signal which triggers a ventricular pacing pulse from output circuit 68 . artifact 112 and pacing pulse marker 142 on tracing 6 indicate the delivery of a pacing pulse . a capture detect window is defined thereafter as indicated at 128 , on tracing 4 . no depolarization results , as the pacing pulse is of insufficient amplitude to capture the heart . this lack of capture is evidenced by the fact that no v sense detect signal follows the delivery of the pacing pulse at 112 . in this instance , the auto threshold logic 61 ( fig2 ) generates another ventricular pacing pulse at a programmed upper rate limit interval as indicated by artifact 114 . the amplitude of this pacing pulse is increased , as indicated by pacing pulse marker 144 in tracing 6 . in this instance the second pacing pulse captures the heart as evidenced by the depolarization waveform 115 on tracing 1 . this ventricular depolarization was detected within the capture detect window 130 following the delivery of pacing pulse at 114 , as evidenced by v sense detect signal 124 in tracing 3 and capture detect signal 138 in tracing 5 . the tracings associated with depolarization waveform 121 illustrates a sequence of three pacing pulses delivered at 116 , 118 and 120 . the first two pacing pulses ( 116 and 118 ) fail to capture the heart , as indicated by the absence of v sense detect signals and capture detect signals during capture detect window 132 and 134 . pacing pulse amplitude is increased with each pulse , as indicated by pacing pulse markers 146 , 148 and 150 ( all at the programmable upper rate limit interval ). the third pulse delivered at 120 is successful in capturing the heart as indicated by v sense detect signal 126 and capture detect signal 140 during capture detect window 136 . in fig3 the t1 period extends from the conclusion of ventricular pace signal depicted in the figure by pacing artifacts 112 , 114 , 116 , 118 and 120 . the duration of the t1 period should be short with an expected duration of 10 - 50 milliseconds . the duration of period t2 should be long enough to allow a detection of any pacemaker triggered cardiac response . the inventor believes that 100 to 300 milliseconds is an appropriate duration for t2 . fig4 shows a hardware flow diagram setting forth a state machine description of the detection procedure performed by the circuitry of fig2 . in state a ( 200 ) shown in the flow diagram , both the t1 and t2 timing functions of the capture detection timer in digital controller timer circuit 50 are disabled . this state corresponds to the pacer &# 39 ; s operation during sinus rhythm which inhibits the pacemaker . the state is reentered upon the occurrence of a v sense detect signal as at 122 in tracing 3 . the occurrence of a v paced signal at decision block 202 forces a state transition to state b ( 204 ) where the t1 timing function is enabled . as the period t1 times out the machine moves from state b ( 204 ) to state c ( 208 ) where the t2 window is being timed . the v sense detect signal occurs during t2 and is taken as the indication of an evoked response and a capture detect is declared in block 208 . the expiration of the t2 time period , tested at decision block 210 , triggers adjustment of the pacing pulse amplitude at 212 and the return to state a ( 200 ).

US-95797592-A

a pacemaker sense amplifier which includes active circuitry which establishes and attempts to maintain a constant field density between two electrodes , effectively clamping them together at substantially fixed relative electrical potentials . the amount of current or power provided to the electrodes monitored and forms the basis of detection of the passing cardiac depolarization wavefront . a timer is sued to define a detection window after the generation of a pacing pulse . the occurrence of a detected depolarization within the detection window is indicates that the pacing pulse has captured the heart .

in the following description , reference is made to an illustrative embodiment for carrying out the invention . it is understood that other embodiments may be utilized without departing from the scope of the invention . for example , the invention is disclosed in the context of a vvi modality pacer for treating bradycardia . it should be appreciated that the technique for myocardial depolarization detection could also be applied to a dual chamber device where capture detection is used to control the energy of the pacing stimuli delivered to the atria . in a similar fashion the ability to detect the driven r - wave will find utility in tachyrhythmia pacers where direct evidence of capture can be used as feedback to control the delivery of tachyarrhythmia therapies . fig1 is a schematic representation of an implanted pacer . in the figure , the pacer 14 is implanted subcutaneously , between the skin and the ribs . a lead 12 is passed through a vein into the right ventricle of the heart 10 . the distal end of the lead or catheter has a tip electrode 22 contacting the interior of the heart . a second , ring electrode 25 , is spaced from the tip electrode 22 . each of these electrodes is connected to the circuitry contained in the pacer 14 . a portion of the metallic enclosure or &# 34 ; can &# 34 ; of the pacer forms an electrode surface 24 . this electrode configuration places tip electrode 22 and ring electrode 25 within the heart . the remaining , can electrode 24 , is outside the heart . the distance between the tip electrode 22 and the ring electrode is typically between 10 and 30 mm and the distance between the ring electrode 25 and the pacer can electrode 24 is typically between 10 and 30 cm . although a variety of lead configurations can be used to pace the heart and to sense the intrinsic depolarizations of the heart , the present invention is disclosed in the context a unipolar pacing configuration where the pacing energy is delivered between the tip electrode 22 and the can electrode 24 . sensing is accomplished between the ring electrode 25 and the can electrode 24 . alternative electrode configurations include those in which only one pair of electrodes are used , coupled to both the sense amplifier and the pulse generator and those in which two pairs of electrodes are used , one pair coupled to the sense amplifier and the other pair coupled to the pulse generator . electrode pairs may include two electrodes located on or in the heart , or one electrode located in or on the heart and one electrode located displaced from the heart . the sense amplifier may also be employed using two electrodes , both located remote from the heart , for example both located on the pacemaker can . fig2 depicts the major circuit elements contained within the pacer . for detection of ventricular depolarizations , it is preferred to couple the sense amplifier 26 to sense electrical heart signals between the ring electrode 25 and the can electrode 24 . the pacing pulse generator 34 is preferably connected to pace between the tip electrode 22 and the can electrode 24 . in operation , the sense amplifier 26 detects the occurrence of a cardiac depolarization by means of the ring and can electrodes 25 and 24 , and in response generates a ventricular sense detect signal ( vs detect ) on line 32 . the occurrence of a vs detect signal resets the escape interval timer 30 and thus resynchronizes the pacer to the underlying rhythm of the patients heart . if no ventricular depolarizations are sensed within the escape interval , timer 30 generates a ventricular pace signal on line 29 at the expiration of the escape interval . the ventricular pace signal ( v - pace ) is provided to the pulse generator circuit 34 via line 36 . typically , the escape interval timer 30 is remotely programmed by telemetry to adjust the duration of the ventricular escape interval , which corresponds to the desired maximum time interval between heartbeats . the v - pace signal on line 36 generated by the escape interval timer 30 is also communicated to electronic capture detect timer 33 via line 39 . the v - pace signal resets the timer 33 , which thereafter defines the capture detect time window . during the capture detect window ( t2 ), timer 33 provides a signal on line 43 which enables gate 41 . the occurrence of a vs detect signal during the capture detect window results in a capture detect signal ( ecd ) from gate 41 on line 37 . in the case of a typical modern pacemaker , the duration of the pacing pulse may be about 1 ms , with a fast recharge pulse thereafter extending for about 8 ms . in such case , the capture detect window can begin approximately 10 ms after the ventricular pacing pulse and may end 40 to 50 ms thereafter . in cases where shorter pacing and recharge pulse widths are used , the capture detect window may begin sooner . the given values have been found to work well with the conduction velocity ( 1 mm / msec ) found in canine models . the conduction velocities found in humans range from 0 . 5 mm / msec to 2 mm / msec . it is anticipated that each of these values will be programmable with nominal window lengths of up to 80 - 100 ms to provide performance with a wide range of conduction velocities occurring in the human population . the time interval from ventricular pacing pulse to the start of the electronic capture detect window is referred to as t1 . at the expiration of t1 , the capture detect window t2 begins . as previously described , a capture detect signal is generated when the sense amplifier 26 generates a vs - detect signal during the capture detect window t2 . this capture detect signal may be used in a variety of ways , and is illustrated in the context of an auto - threshold type pacer . in this instance , the capture detect signal ecd is communicated to auto - threshold logic 35 via line 37 . auto - threshold logic 35 controls the energy content of the pacing pulses delivered by the pulse generator 34 to the lead system . in the event that a pacing pulse is delivered and no capture detect signal follows , auto - threshold logic 35 will generate a control signal on line 45 to increment the amplitude of the pacing pulses provided by pulse generator 34 . auto - threshold logic 35 may also decrement the amplitude of the pacing pulses in response to an extended period in which all pacing pulses successfully capture the heart to enable a determination of the minimum energy required to reliably pace the heart . auto - threshold logic 35 may also respond to the failure of a pacing pulse to capture the heart by quickly triggering an additional pacing pulse at an increased amplitude . appropriate mechanisms for adjusting the energy content of the pacing pulses generated by pulse generator 34 are disclosed in u . s . pat . no . 4 , 858 , 610 issued to callaghan et al , u . s . pat . no . 4 , 878 , 497 issued to callaghan et al . and u . s . pat . no . 4 , 729 , 376 issued to decote , all of which are incorporated herein by reference in their entireties . alternative pacing functions which may be modified in response to the detection or non - detection of cardiac depolarizations during the capture detect window are described in u . s . pat . no . 4 , 795 , 366 issued to callaghan et al ., and in the above cited u . s . pat . no . 4 , 305 , 396 issued to wittkampf , both of which are incorporated herein by reference in their entireties . fig3 discloses a preferred sense amplifier for use in conjunction with the electronic capture detection system . this form of sense amplifier is more fully described in co - pending u . s . patent application ser . no . 566 , 636 for a &# 34 ; field density clamp for sensing cardiac depolarizations &# 34 ;, filed oct . 8 , 1990 , by hudrlik , which is incorporated by reference herein in its entirety . the active circuitry of the sense amplifier 26 attempts to maintain an equilibrium condition between the sensing electrodes . the field perturbation caused by the passing wavefront is nulled out by the active circuitry which attempts to maintain a fixed relationship between the potentials at the electrodes . current supplied to the electrodes in the attempt to maintain an electrode / electrolyte equilibrium condition is passed through a virtual load . the current delivered through the virtual load is monitored and forms the basis for the detection of the passing depolarization wavefront . it is preferred to also monitor the voltage across the virtual load and multiply it with the current measurement to characterize the power delivered to the electrode system in response to the passing depolarization wavefront . thus , in a preferred embodiment , the cardiac depolarization is distinguished from noise based upon the power level of the depolarization signal . although this form of sense amplifier is disturbed both by the delivery of pacing energy to the lead system and by the recharge of the output capacitor , the system recovers very quickly . as shown in the schematic diagram of fig3 the sense amplifier may be practiced with a first operational amplifier 38 which has its non - inverting input 40 connected to the can electrode 24 . the inverting input 42 is coupled to ring electrode 25 through a variable resistor 44 which is used to set a virtual load resistance for the system . this resistance is preferably between 10 and 1000 ohms . a feedback path is provided for the amplifier 38 by a resistance 48 which converts input current to a proportional voltage signal b . in operation the op amp 38 provides a signal b which reflects the amount of current provided to electrodes 25 and 24 in the attempt to counteract the perturbation of the electric field surrounding the electrodes due to cardiac depolarization . a differential amplifier 54 may be provided to measure the magnitude of the potential difference between electrodes 22 and 25 , and thus the voltage across the virtual load resistance 44 . the non - inverting input 50 of this differential amplifier 54 is coupled to ring electrode 25 while the can electrode 24 is coupled to inverting input 52 . the voltage output a of differential amplifier 54 is proportional to the voltage difference between the electrodes 25 and 24 . the voltage measurement a and the current measurement current b may be used to compute the power delivered through the virtual load resistance to maintain the constrained equilibrium , as this equilibrium is perturbed by the passage of a cardiac depolarization wavefront . however it is possible to use the current signal b , alone to detect the depolarization . the power computation is carried out by an analog multiplier 56 which computes the power level an provides a voltage output c proportional to the computed power . current signal b or power signal c are communicated to comparator 58 via switch 57 . comparator 58 compares the selected input to a threshold voltage vref defined by voltage source 46 . if the selected one of the current signal b or the power signal c exceeds vref , comparator 58 generates a v - sense detect signal vsd on line 32 . the operation of the invention is illustrated in fig4 . this figure shows tracings of cardiac waveforms collected from a canine subject having a chronic bipolar pacing lead implanted in the heart . pacing pulses were delivered between the tip electrode and an electrode corresponding to can electrode 24 ( fig2 ). tracings 1 and 2 were taken with a circuits corresponding to fig3 in which the current signal b was provided to the comparator 58 . when the measured current exceeded the sensing threshold ( vref ), comparator 58 provided a short , high logic level pulse . tracing 1 was taken with a sense amplifier coupled to tip and can electrodes , and corresponds to the current signal b from operational amplifier 38 ( fig3 ). tracing 2 was taken with a sense amplifier coupled to the ring and can electrodes and similarly corresponds to the current signal b from operational amplifier 38 . tracing 3 reflects the logic level output of the sense amplifier and corresponds to the signal taken from the output comparator 58 . tracing 4 is corresponds to the logic level output of gate 41 ( fig3 ) and indicates the occurrence of a sensed ventricular depolarizations during the t2 time window established by the capture detect timer 33 . high logic signals in tracing 4 correspond to capture detect signals from gate 41 . tracing 5 corresponds to the signal on line 43 from capture detect timer 33 ( fig3 ). high logic level signals in tracing 5 correspond to the duration of the capture detect window t2 . tracing 6 corresponds to the output of the ventricular pulse generator 34 ( fig2 ). the amplitude of the pacing pulses is reflected by the height of the pulse markers . the occurrence of pacing pulses is also reflected by the sensed artifacts 62 , 63 , 72 , 73 and 74 , which extend across tracings 1 - 5 . the first cardiac waveform 60a , 60b results from a normal sinus depolarization of the heart . v - sense detect signal 61 on tracing 3 reflects the normal detection of this event . in the context of the pacer of fig2 this detected depolarization resets the escape interval timer 30 . at the conclusion of the escape interval , timer 30 generates a v - pace signal which triggers a ventricular pacing pulse . artifact 62 and pacing pulse marker 69 on tracing 6 indicate the delivery of a pacing pulse . a capture detect window is defined thereafter as indicated at 67 , on tracing 5 . no depolarization results , as the pacing pulse is of insufficient amplitude to capture the heart . this lack of capture is evidenced by the fact that no v - sense detect signal follows the delivery of the pacing pulse at 62 . in this instance the auto - threshold logic 35 ( fig2 ) generates another ventricular pacing pulse as indicated by artifact 63 . the amplitude of this pacing pulse is increased , as indicated by pacing pulse marker 70 in tracing 6 . in this instance the second pacing pulse captures the heart as evidenced by the depolarization waveform 64a , 64b on tracings 1 and 2 , respectively . this ventricular depolarization was detected within the capture detect window 68 following the delivery of pacing pulse at 63 , as evidenced by v - sense detect signal 65 in tracing 3 and capture detect signal 66 in tracing 4 . the tracings associated with depolarization waveform 71a , 71b illustrate a sequence of three pacing pulses delivered at 72 , 73 , 74 . the first two pacing pulses fail to capture the heart , as indicated by the absence of v - sense detect signals and capture detect signals during capture detect windows 77 and 78 . pacing pulse amplitude is increased with each pulse , as indicated by pacing pulse markers 80 , 81 , 82 . the third pulse delivered at 74 is successful in capturing the heart as indicated by v - sense detect signal 75 and capture detect signal 76 during capture detect window 79 . the test data shown in fig4 was taken with an experimental version of the invention which permitted adjustment of the t1 and t2 periods . the t1 period extends from the conclusion of the ventricular pace signal depicted in the figure by pacing artifacts 62 , 63 , 72 , 73 and 74 . the duration of the t1 period should be short and experimentation suggests that in systems employing field density clamp sense amplifiers , 5 - 10 ms is an appropriate value . the duration of period t2 should be long enough to allow detection of any pacemaker triggered depolarization . experimentation suggests that 30 - 100 ms is an appropriate duration for t2 . fig5 shows a hardware flow chart setting forth a state machine description of the detection procedure performed by the circuitry of fig2 . in state a shown in the flow chart at 83 , both the t1 and t2 timing functions of the ecd timer 33 are disabled . this state corresponds to the pacer &# 39 ; s operation during sinus rhythm which inhibits the pacemaker . the state is reentered upon the occurrence of a v - sense detect signal as at 61 in tracing 3 . the occurrence of a v - pace signal at decision block 74 forces a state transition to state b where the t1 timing function is enabled . as the period t1 times out the machine moves from state b ( 85 ) to state c ( 87 ) where the t2 time window is being timed . if a v - sense detect signal occurs during t2 it is taken as the indication of a driven r - wave , and a capture detect is declared in block 87 . the expiration of the t2 time period , tested at decision block 88 , triggers adjustment of the pacing pulse amplitude at 89 and the return to state a .

US-62606190-A

a hair accessory device ; in particular , a device and method of use that is uniquely configured to clamp and securely grasp hair in place and allow the hair to appear fuller . the device is a double hair clip having a corresponding pair of pivotable jaws , an inner set and an outer set . this advantageously allows for the secure holding of hair while creating the look of hair fullness .

with reference to the drawings , wherein the same reference number indicates the same element throughout , there is shown in fig1 , a side view of the double hair clip 100 of the present invention . as shown in fig1 the double hair clip 100 comprises a corresponding pair of jaws , an inner set of jaws 10 and an outer set of jaws 20 . each of the inner set of jaws 10 has a retaining end 11 and a pivotable end 12 . each of the outer set of jaws 20 has a retaining end 21 and a pivotable end 22 . the pivotable ends 12 of the inner set of jaws 10 are pivotally connected to each other by a pin 14 with enlarged heads . the inner set of jaws 10 are movable from an open position to a closed position . the retaining ends 11 of the inner set of jaws 10 are capable of abutting each other and retaining a portion of hair therein . the retaining ends 11 of the inner set of jaws 10 may further comprise a clasping means so that the respective retaining ends are capable of clasping together by clasp 15 when in a closed position . each of the inner set of jaws 10 have an inside surface 10 a and an outside surface 10 b . the inside surfaces 10 a of the inner set of jaws 10 have equally spaced apart teeth 5 extending therefrom . the outside surfaces 10 b of the inner set of jaws 10 have equally spaced apart teeth 5 extending therefrom . as shown in fig2 , the teeth 5 are spaced apart so they are capable of interlocking and interacting with each other when the inner set of jaws 10 are in the closed position , but other teeth spacing can be used . in the preferred embodiment of the present invention the inner set of jaws 10 are each substantially semi - circular , but other shapes can also be used . as shown in fig1 , the double hair clip 100 comprises a connection member 16 having a first end and a second end . the first end of the connection member 16 attaches to the pivotable ends 12 of the inner set of jaws 10 . the second end of the connection member 16 attaches to the outer set of jaws 20 at its pivotable ends 22 . the connection member 16 may be of varying length and shape ( e . g . straight , curved , wavy , zig - zag , etc .). the pivotable ends 22 of the outer set of jaws 20 are pivotally connected to each other by pin 24 with enlarged heads . the outer set of jaws 20 are movable from an open position to a closed position . the retaining ends 21 of the outer set of jaws 20 are capable of abutting each other and retaining a second portion of hair therein . the retaining ends 21 of the outer set of jaws 20 may further comprise a clasping means so that the respective retaining ends are capable of clasping together by clasp 25 when in a closed position . each of the outer set of jaws 20 have an inside surface 20 a and an outside surface 20 b . the inside surfaces 20 a of the outer set of jaws 20 have equally spaced apart teeth 5 extending therefrom , however other teeth spacing can be used . in the preferred embodiment of the present invention the outer set of jaws 20 are each substantially semi - circular , but other shapes can also be used . it is contemplated that the inner set of jaws 10 and the outer set of jaws 20 may have different shapes such as square , rectangular or oval , etc . it is also contemplated that the inner set of jaws 10 may have one shape , such as a circle , and the outer set of jaws 20 may have another shape such as a square . the clasping means and clasps ( 15 , 25 or 35 ) of the inner set of jaws 10 and the outer set of jaws 20 may be any removably fastening means known to one skilled in the art , such as corresponding hooks , latch and hook , corresponding velcro ® hooks and eyes , magnetic clasps , etc . fig2 shows the inner set of jaws 10 being held in a closed position by clasp 15 while the outer set of jaws 20 is in an open position . fig3 shows the inner set of jaws 10 in a closed position and the outer set of jaws 20 in the closed position . the method of the present invention for enhancing the fullness of a hairstyle using hair clip 100 or 102 comprises the steps of positioning a pivotable pair of inner jaws 10 movable between an open position and a closed position , each jaw having a pivotable end 12 and a retaining end 11 , a clasping means such as clasp 15 at the retaining end 11 , each jaw having an inside surface 10 a and an outside surface 10 b . the inside surfaces 10 a having teeth 5 extending therefrom . placing a first portion of hair inside the inner set of jaws 10 and closing the retaining ends 11 , which can be accomplished with clasps 15 of the retaining ends 11 of the inner jaws 10 around the first portion of hair , gathering a second portion of hair around the closed inner jaws 10 , positioning the pivotable pair of outer jaws 20 , movable from an open position and a closed position , each jaw having a pivotable end 22 and a retaining end 21 , a clasping means at the retaining ends 21 , each jaw having an inside surface 20 a and an outside surface 20 b , the inside surfaces 20 a having teeth 5 extending therefrom , fastening the clasping means such as clasp 25 of the retaining ends 21 of the outer jaws 20 around the second portion of hair . as shown in fig4 - 6 , the double hair clip 102 may have teeth 5 of different shapes , such as diamonds or pins , with varying sizes , lengths and widths . the length and width of the teeth 5 are sized to accommodate different users having different hair thickness , texture and length . it is contemplated that the teeth 5 may not be equally spaced apart but are set at random locations . it is further contemplated that the teeth 5 do not interlock when the inner set of jaws 10 and the outer set of jaws 20 are in the closed position , but instead are adjacent to or abut each other . the teeth 5 may be resilient to be able to engage the hair placed therebetween . the surface of each tooth 5 may be rough to prevent hair held therein from slipping out of the hair clip 100 or 102 . instead of teeth 5 , other hair holding means known to one skilled in the art may be used , such as hooks , pins , velcro ® hooks and eyes , magnetic clasps etc . as shown in fig9 , in an alternative embodiment of the present invention is the double hair clip 104 . the outer set of jaws 20 are movable from an open position to a closed position . the retaining ends 21 of the outer set of jaws 20 may have clasping means such as clasps 25 . the clasping means of the retaining ends 21 further comprise an arm element 27 . the outer set of jaws 20 are capable of clasping together by securing the arm element 27 within the opposite clasp 25 when in a closed position . when each arm element 27 is secured to the opposite clasp 25 , the arm elements 27 define a ring area 28 . the method of the alternative embodiment of the present invention using the hair clip 104 for enhancing the fullness of a ponytail comprises the steps of positioning a pivotable pair of inner jaws 10 movable between an open position and a closed position , each jaw having a pivotable end 12 and a retaining end 11 , a clasping means such as clasp 15 at the retaining end 11 , each jaw having an inside surface 10 a and an outside surface 10 b . the inside surface 10 a having teeth 5 extending therefrom . placing a first portion of hair inside the inner set of jaws 10 and closing the clasps 15 of the retaining ends 11 of the inner jaws 10 around the first portion of hair , gathering a second portion of hair around the closed inner jaws 10 , positioning the pivotable pair of outer jaws 20 , movable from an open position and a closed position , each jaw having a pivotable end 22 and a retaining end 21 , a clasping means such as clasp 25 at the retaining end 21 , each jaw having an inside surface 20 a and an outside surface 20 b , the inside surfaces 20 a having teeth 5 extending therefrom , attaching the arm element 27 to the opposite clasp 25 of the retaining ends 21 of the outer jaws 20 around both the first and second portions of hair such that all the hair is positioned within the ring area 28 . as shown in fig1 - 13 , in an alternative embodiment of the present invention is the double hair clip 105 . the outer set of jaws 20 is movable from an open position to a closed position . each retaining end 31 of the outer set of jaws 20 has an arm element 37 with a clasp 35 at its distal end . the outer set of jaws 20 are capable of clasping together by securing the clasp 35 with the opposite clasp 35 when in a closed position . arm element 37 may be pivotably or fixedly connected to the retaining end 31 of the outer set of jaws 20 . the method of the alternative embodiment of the present invention using the hair clip 105 for enhancing the fullness of a ponytail comprises the steps of positioning a pivotable pair of inner jaws 10 movable between an open position and a closed position , each jaw having a pivotable end 12 and a retaining end 11 , a clasping means such as clasp 15 at the retaining end 11 , each jaw having an inside surface 10 a and an outside surface 10 b . the inside surfaces 10 a having teeth 5 extending therefrom . placing a first portion of hair inside the inner set of jaws 10 and closing the clasps 15 of the retaining ends 11 of the inner jaws 10 around the first portion of hair , gathering the second portion of hair around the closed inner jaws 10 , positioning the pivotable pair of outer jaws 20 , movable from an open position and a closed position , each outer jaw having a pivotable end 22 and a retaining end 31 with an arm element 37 having a clasping means 35 at its distal end , each jaw having an inside surface 20 a and an outside surface 20 b , the inside surfaces 20 a having teeth 5 extending therefrom , attaching the clasp 35 at the distal end of the arm element 37 to the opposite clasp 35 of the retaining ends 31 of the outer jaws 20 around the first and second portions of the hair . the pivotable ends ( 12 , 22 or 32 ) of the inner set of jaws 10 and the outer set of jaws 20 may also be any movable means known to one skilled in the art , such as hinges , corresponding boss and opening , corresponding gears , a hole , pin and spring or jaws made of a resilient material such that the jaws are biased towards each other but movable away from each other with force . the double hair clip 100 , 102 , 104 or 105 of the present invention may be made of plastic . in another embodiment of the present invention the double hair clip 100 , 102 , 104 or 105 is made of metal . it is further contemplated that the entire double hair clip 100 , 102 , 104 or 105 be made from rubber . the double hair clip 100 , 102 , 104 or 105 may be planar or curved with varying heights / thickness . a curved double hair clip 100 , 102 , 104 or 105 , as shown in fig7 , allows the double hair clip 100 , 102 , 104 or 105 to be positioned closely adjacent a user &# 39 ; s scalp . the inner set of jaws 10 and the outer set of jaws 20 may be on the same planar or curved surface or be offset from each other ( as shown in fig8 ) to achieve different hairstyling effects . the features of the invention illustrated and described herein are the preferred embodiments . therefore , it is understood that the specification is intended to cover unforeseeable embodiments with insubstantial differences that are within the spirit of the specification .

US-201213726283-A

a coordinative dental - die - interlocking system includes a dental - die pin anchored in a tooth - die base and inserted removably in a die - pin sleeve that is anchored in a dental - model base . the dental - die pin includes a pin that lock - fits in the die - pin sleeve . the dental - die pin and the die - pin sleeve include predeterminedly color - coded identification marking . a plurality of sizes of die pairs which are color - coded mate rigidly in a system of coordinative interlocking to prevent mismatching errors and to save time matching dental - die pins and die - pin sleeves by dental artisans .

listed numerically below with reference to the drawings are terms used to describe features of this invention . these terms and numbers assigned to them designate the same features throughout this description . reference is made first to fig1 - 7 . a coordinative dental - die - interlocking system includes a dental - die pin 1 that fits conveniently , accurately and rigidly in a die - pin sleeve 2 from which it is removable easily . fitting insertion of the dental - die pin 1 is coordinated to avoid error of insertion in incorrect die - pin sleeves 2 . the dental - die pin 1 has a tooth - anchor portion 3 for anchoring the dental - die pin 1 rigidly and permanently in a tooth - die base 4 and a sleeve - insertion portion 5 for being inserted removably in the die - pin sleeve 2 . the die - pin sleeve 2 is anchored rigidly and permanently with sleeve anchors 14 embedded in a dental - model base 6 . the sleeve - insertion portion 5 of the dental - die pin 1 includes one or more guide projections that fit predeterminedly intermediate guide walls on the die - pin sleeve 2 . the one or more guide projections can include an arcuate ridge 7 shown in fig3 and 5 and the one or more guide walls can include walls of an arcuate groove 8 shown in fig3 and 6 . a pin taper on a predetermined outside peripheral portion of the dental - die - pin 1 provides rigidity of snug fitting by its bottoming snug insertion in a mating sleeve taper of the die - pin sleeve 2 that is tapered reciprocally . the pin taper can include tapering of the arcuate ridge 7 and reciprocal tapering of the arcuate groove 8 . tapering of the arcuate ridge can be end - tapering with a tapered ridge end 9 and a tapered groove end 10 as shown or optionally a full - length tapering of the arcuate ridge 7 and the arcuate groove 8 that are not shown . taper angle can be under fifteen degrees for some embodiments and over fifteen degrees for other embodiments of this invention . some taper angles are preferably two - to - four degrees as indicated . to aid in coordinating insertion of the dental - die pins 1 in correct die - pin sleeves 2 , a plurality of sizes of the die - pin sleeves 2 , which include a separate die - pin sleeve 2 for each of a plurality of teeth sections of the dental - model base 6 , is matched by a plurality of sizes of the dental - die pins 1 . preferably , the plurality of sizes of the die - pin sleeves 2 include a first sleeve size for anterior portions of dental - model bases , a second sleeve size for posterior portions of dental - model bases , and a third sleeve size for intermediate portions of dental - model bases . the plurality of sizes of the dental - die pins include a first pin size for anterior teeth , a second pin size for posterior teeth and a third pin size for intermediate teeth . the first pin size and the first sleeve size are a first die pair 11 , the second pin size and the second sleeve size are a second die pair 12 and the third pin size and the third sleeve size are a third die pair 13 . the plurality of die - pin sleeves 2 include sleeve - identification markings and the dental - die pins 1 include pin - identifications which are preferably color - coded with predetermined colors on predetermined portions thereof that are visible when the die - pin sleeve 2 is separated from the dental - die pin 1 . a pin lock is in predetermined locking communication intermediate the dental - die pin 1 and the die - pin sleeve 2 . in its simplest and most basic form , the pin lock is the snug fitting of the dental - die pin 1 in the die - pin sleeve 2 . this can be in combination with a suitable grease - like substance to prevent the dental - die pin 1 and a dental die 15 on the tooth - die base 4 from loosening when worked on or falling out when inverted . snugness of the fitting can be modified for particular use requirements . referring to fig8 - 12 , the pin lock can include a lock recess that is a pin groove 16 extended circumferentially about an outside periphery of the dental - die pin 1 proximate a major diameter of a pin - lock taper 17 . the sleeve lock recess can include a sleeve groove 18 that is extended circumferentially about an inside periphery of the die - pin sleeve 2 proximate a major diameter of a sleeve - lock taper 19 . also included for the pin lock can be a resilient toroid 20 that is an expansion - tensioned member situated predeterminedly in the pin groove 16 and in the sleeve groove 18 . the sleeve groove 18 can include an entry - side wall 21 that is predeterminedly proximate an insertion - side wall 22 of the pin groove 16 while the pin - lock taper 17 is bottomed in the sleeve - lock taper 19 and while the resilient toroid 20 is in the sleeve groove 18 and in the pin groove 16 simultaneously . the one or more guide projections can include a straight - wall ridge 23 having opposite straight walls and the one or more guide walls can include a straight - wall groove 24 having opposite straight walls . four straight walls are shown for each but can be polygonal with as few as three but preferably less than eight straight walls . a pin extension 25 of the dental - die pin 1 shown in fig1 can be extended also from the embodiments shown in fig8 and 13 for additional pin stability and rigidity . referring to fig1 - 19 , the pin taper can be on an outside periphery of a polygonal extension 26 of the dental - die pin 1 from proximate a sleeve side of the dental - die pin 1 . the sleeve taper can be on an inside periphery of a polygonal portion 27 of the die - pin sleeve 2 that is proximate an entrance to the die - pin sleeve 2 . the sleeve taper matches the pin taper . for this embodiment , the pin taper preferably has predeterminedly less than seven degrees of taper angle inwardly from being parallel to an axis of the dental - die pin 1 in a direction opposite from the tooth - anchor portion 3 of the dental - die pin 1 . the sleeve taper has reciprocally less than the seven degrees of taper angle outwardly from an axis of the die - pin sleeve 2 . preferably , the taper angles are two - to - four degrees . this embodiment is particularly rigid , light weight and reliable , but sticks together so tightly , accurately and reliably that it needs to be pried apart . this can be done easily , quickly and conveniently with a pry wrench that is preferably a hexagonal - rod wrench 28 shown in fig1 and 19 . a pry - wrench slot 29 is provided with slot walls that are orthogonal intermediate a pin wall 30 and a sleeve wall 31 and slot bottoms in either or both the pin wall 30 and the slot wall 31 . the pry - wrench slot 29 is articulated to receive the hexagonal - rod wrench 28 snugly for its rotation to wedge against the slot bottoms for prying apart the polygonal extension 26 and the polygonal portion 27 just enough to loosen them for ease of the separation . optionally for this embodiment and for other embodiments , additional or supplemental grasping for effective locking of the dental - die pin 1 in the die - pin sleeve 2 , can be provided with a ring - grasp extension 32 of the polygonal extension 26 or other portion of the dental - die pin 1 . the ring - grasp extension 32 is circumferential with a predeterminedly slight taper . a lock ring 33 that is preferably toroidal in a lock - ring groove 34 surrounds the ring - grasp extension 32 with a predetermined snugging tightness that can be released with the hexagonal - rod wrench 28 . although shown with this polygonal - extension 26 embodiment , this ring - grasp extension 32 is recommended more for other embodiments . this embodiment can be lighter yet with a hollowed and appropriately designed polygonal extension 26 that can be made particularly effective and convenient with the pry - wrench features , the color - coding and the plurality of sizes for this coordinative dental - die - interlocking system . a new and useful coordinative dental - die - interlocking system having been described , all such foreseeable modifications , adaptations , substitutions of equivalents , mathematical possibilities of combinations of parts , pluralities of parts , applications and forms thereof as described by the following claims and not precluded by prior art are included in this invention .

US-87109201-A

the present invention provides compositions for blending in hair treating agents which can prepare hair conditioners , waving agents , finishing agents or thickening agents used on preparing hair treating agents easily by lower cost , further , the present invention provides hair treating agents which are excellent in the features of feeling at actual use such as moist feel , slippery feel , slightly oily feel , good feeling to hair , brilliance , suppleness , soft feel and smooth combing and excellent in the features of hair treating agents such as less damage for hair , absorbency • penetration • fixing ability • spreading ability , wetting ability and smooth forming of wave without unevenness and tight and protection for generation of static electricity , by containing cationic surfactants or nonionic surfactants .

in this embodiment , at least one compound , for example , one or two compounds selected from the group consisting of nonionic surfactants , silicones and polymers are contained in the compositions for blending in hair treating agents of the present invention . examples of nonionic surfactants include , for example , polyoxyethylene alkyl ethers , polyoxyethylene alkenyl ethers , polyoxyethylene alkyl aryl ethers , polyoxyethylene derivatives prepared from natural fatty acids , ( mono - or sesqui -) esters prepared with polyhydric alcohols ( e . g . sorbitanes etc .) and higher fatty acids , fatty acid alkylolamides and ethylene oxide • propylene oxide block copolymers . ethylene oxide ( eo ) addition polymerization degrees in “ polyoxyethylene ” may be , for example , 10 ˜ 70 . propylene oxide ( po ) addition polymerization degrees in “ polyoxypropylene ” may be , for example , 3 ˜ 90 . concrete examples of nonionic surfactants include one to four compounds selected from the group consisting of polyoxyethylene lauryl ether , polyoxyethylene cetyl ether , polyoxyethylene oleyl ether , polyoxyethylene nonylphenyl ether , polyoxyethylene lanolin , polyoxyethylene hydrogenated castor oil , sorbitan monostearate , sorbitan monooleate , sorbitan sesquioleate , polyoxyethylene sorbitan monooleate , oleic acid diethanolamide and polyoxyethylene polyoxypropylene glycol . for example , in compositions for blending in hair colorings , in compositions for blending in waving agents , in compositions for blending in finishing agents and in compositions for blending in emulsion stabilizers , polyoxyethylene oleyl ether may be contained . in compositions for blending in hair colorings , in compositions for blending in waving agents , in compositions for blending in finishing agents and in compositions for blending in emulsion stabilizers , sorbitan monooleate may be contained . example of silicones ( si compounds ) include silicone oils . examples of silicone oils include siloxanes , their homopolymers and copolymers . the polymerization degrees of polysilicones are not limited . polysilicones between low polymerized polysilicones and highly polymerized polysilicones may be used . concrete examples of silicones include one to three compounds selected from the group consisting of decamethyl cyclopentasiloxane , methyl polysiloxane , methylphenyl polysiloxane , dimethylsiloxane • methylstearoxysiloxane copolymer and aminoethylaminopropylsiloxane • dimethylsiloxane copolymer . for example , in compositions for blending in waving agents and in compositions for blending in permanent waving iron sliding improvers , decamethyl cyclopentasiloxane may be contained . in compositions for blending in hair colorings and in compositions for blending in waving agents , for example , methyl polysiloxane may be contained . concrete examples of polymers include one or three compounds selected from the group consisting of carboxyvinylpolymer ( average molecular weight , e . g . 1 million ˜ 5 million ), polyethylene glycol ( average molecular weight , e . g . 1 million ˜ 5 million ), styrene polymer , polyvinylpyrrolidone ( average molecular weight , e . g . 100000 ˜ 1 million ), and hydroxyethyl cellulose ( the degree of viscosity of 2 % aqueous solution , e . g . 1000 ˜ 20000 cps .). for example , in compositions for blending in hair colorings , in compositions for blending in waving agents and in compositions for blending in finishing agents , polymers may be contained . further , in the compositions for blending in hair treating agents of the present invention , any kind of additives may be contained in accordance with the kind and the purposes of hair treating agents . for example , in the composition for blending in hair treating agent of the present invention , two to seven ingredients selected from the group consisting of fats and oils , paraffins • waxes , anionic surfactants , organic acids , amphoteric surfactants , phosphoric acids , bases , sequestering agents , antioxidants , parabens and water may be contained . examples of fats and oils include , for example , animal fats and oils and vegetable fats and oils . concrete examples of fats and oils include one to three compounds selected from the group consisting of olive oil , safflower oil , castor oil , lanolin , hydrogenated oil ( hydrogenated palm oil fatty acid triglyceride , hydrogenated tallow acid triglyceride , hydrogenated castor oil etc .) and mink oil . for example , in compositions for blending in hair colorings , in compositions for blending in waving agents , in compositions for blending in finishing agents , in compositions for blending in emulsion stabilizers and in compositions for blending in permanent waving iron sliding improvers , fats and oils may be contained . examples of paraffins • waxes include paraffin itself , wax itself and their derivatives ( e . g . their halides ). concrete examples of paraffins • waxes include one or two compounds selected from the group consisting of liquid petrolatum , light liquid isoparaffin , chlorinated paraffin and microcrystalline wax . for example , in compositions for blending in hair colorings , in compositions for blending in waving agents , in compositions for blending in finishing agents and in compositions for blending in emulsion stabilizers , paraffins • waxes may be contained . examples of anionic surfactants include , for example , salts of polyoxyethylene alkyl ether sulfates . concrete examples of anionic surfactants include ammonium polyoxyethylene lauryl ether sulfate or triethanolamine polyoxyethylene lauryl ether sulfate . for example , in compositions for blending in waving agents , anionic surfactants may be contained . eo addition polymerization degrees of above - mentioned “ polyoxyethylene ” may be , for example , 1 to 5 . examples of organic acids include fatty acids . concrete examples of organic acids include one or two compounds selected from the group consisting of lauric acid , stearic acid , oleic acids and sorbic acid . for example , in compositions for blending in hair colorings , in compositions for blending in waving agents , in compositions for blending in finishing agents and in compositions for blending in emulsion stabilizers , organic acids may be contained . examples of amphoteric surfactants include carboxylic acid type betaines . concrete examples of amphoteric surfactants include 2 - alkyl - n - carboxymethyl - n - hydroxyethyl imidazolinium betaine and / or cocoyl amide propyldimethyl glycine . for example , in compositions for blending in waving agents , amphoteric surfactants may be contained . examples of phosphoric acids include phosphoric acid itself and its partially neutralized salts . concrete examples of phosphoric acids include one or two compounds selected from the group consisting of phosphoric acid , dibasic sodium phosphate and monobasic sodium phosphate . for example , in compositions for blending in hair colorings , in compositions for blending in waving agents , in compositions for blending in finishing agents and in compositions for blending in emulsion stabilizers , phosphoric acids may be contained . for example , in compositions for blending in pemanent waving iron sliding improvers , antioxidants may be contained . examples of bases include amines and alkaline metal hydroxides . concrete examples of bases include triethanolamine or sodium hydroxide . for example , in compositions for blending in hair colorings , in compositions for blending in waving agents , in compositions for blending in finishing agents and in compositions for blending in emulsion stabilizers , bases may be contained . concrete examples of sequestering agents include 1 - hydroxyethane - 1 , 1 - diphosphonic acid or disodium edetate . for example , in compositions for blending in hair colorings , in compositions for blending in waving agents and in compositions for blending in finishing agents , sequestering agents may be contained . for example , in compositions for blending in permanent waving iron sliding improvers , antioxidants may be contained . examples of parabens include parahydroxybenzoates . concrete examples of parabens include propyl parahydroxybenzoate and / or methyl parahydroxybenzoate . for example , in compositions for blending in waving agents , parabens may be contained . in the formulations of the compositions for blending in hair treating agents of the present invention , when the content of one or two kinds selected from the group consisting of nonionic surfactants , silicones and polymers is a ( wt %), it is desirable for a to satisfy following expression ; 0 . 1 ≦ a ≦ 100 . for example , in a case of the compositions for blending in hair conditioners , a may be 80 ≦ a ≦ 100 . for example , in a case of compositions for blending in hair colorings , a may be 0 . 5 ≦ a ≦ 20 . for example , in a case of compositions for blending in waving agents and in compositions for blending in emulsion stabilizers , a may be 0 . 1 ≦ a ≦ 100 . for example , in a case of compositions for blending in finishing agents , a may be 0 . 5 ≦ a ≦ 50 . for example , in a case of compositions for blending in permanent waving iron sliding improvers , a may be 5 ≦ a ≦ 30 . as the substantial method to prepare the compositions for blending in hair treating agents of this embodiment , following method may be exemplified . that is , one or two kinds selected from the group consisting of nonionic surfactants , silicones and polymers and , if necessary , ingredients such as additives are mixed homogeneously with stirring under heating ( if necessary ). the adding order of each ingredient is not limited . for example , all ingredients may be added at a time . or , each ingredient may be added in such order as following ingredient is added after the previously added ingredients have been dissolved completely . in another preparation method of the compositions for blending in hair treating agents of this embodiment , for example , oiliness ingredients containing one or two kinds selected from the group consisting of nonionic surfactants , silicones and polymers are stirred and mixed homogeneously under heating if necessary . next , water , which has been heated if necessary , is added to this homogeneous mixture ( or this homogeneous mixture is added to water ), and then mixed homogeneously as stirring to be emulsified . and then , remaining aqueous ingredients are added to prepare the compositions for blending in hair treating agents of this embodiment . the hair treating agents of the present invention contain the above - mentioned compositions for blending in hair treating agents of the present invention . hair conditioners , hair colorings , waving agents , finishing agents , emulsion stabilizers and permanent waving iron sliding improvers are illustrated below as the hair treating agents . the hair conditioners of the present invention contain above - mentioned compositions for blending in hair conditioners . one or more kinds of the compositions for blending in hair conditioners may be used . further , in the hair conditioners of the present invention , additive compositions and water may be contained . examples of additive compositions include mixtures with alcohols and cationic surfactants . in the formulations of the hair conditioners of the present invention , the contents of the compositions for blending in hair conditioners are , for example , from 1 to 20 wt . %. the preparing methods of the hair conditioners of the present invention are not limited . for example , the compositions for blending in hair conditioners and additive compositions are dissolved homogeneously under heating . to this homogeneously dissolved material , water are added and mixed homogeneously to prepare the hair conditioner of the present invention . hair colorings of the present invention include oxidizing hair coloring agents . the oxidizing hair coloring agents may be composed of no . 1 agents and no . 2 agents ( in the present invention , no . 1 agents alone and no . 2 agents alone are also included in the hair colorings of the present invention .). no . 1 agents of the oxidizing hair coloring agents of the present invention may contain alkaline agents , dye intermediates and water may be contained besides the compositions for blending in hair colorings of the present invention examples of alkaline agents include ammonia aqueous solution and monoethanolamine ( mea ). examples of dye intermediates include , for example , phenylene diamines ( e . g . ortho -, meta -, para - phenylene diamine ), phenols ( e . g . ortho -, meta -, para - aminophenol and nitrophenols ), resorcinol and aminocresols . in the formulations of no . 1 agents of oxidizing hair coloring agents , the contents of the compositions for blending in hair colorings are , for example , from 20 to 60 wt . %. as the substantial methods to prepare no . 1 agents of oxidizing hair coloring agents , following methods may be exemplified . that is , for example , dye intermediates is added to heated water to be dissolved homogeneously , and then the composition for blending in hair colorings is added and mixed homogeneously . after cooled , alkaline agent is added with stirring to prepare no . 1 agents of oxidizing hair coloring agent . the heating temperatures of water and the composition for blending in hair coloring are desirably lower than decomposition temperatures of the ingredients , for example , lower than 95 ° c . no . 2 agents of oxidizing hair coloring agents of the present invention may contain sequestering agents , ph adjustors , oxidizing agents and water may be contained besides the compositions for blending in hair colorings of the present invention . examples of sequestering agents include 1 - hydroxyethane - 1 , 1 - diphosphonic acid . examples of ph adjustors include phosphoric acids ( for example , dibasic sodium phosphate ). examples of oxidizing agents include hydrogen peroxide . in formulations of no . 2 agents of oxidizing hair coloring agents , for example , 0 . 5 - 15 wt . % of the compositions for blending in hair colorings may be contained . as the substantial methods to prepare no . 2 agents of oxidizing hair coloring agents , following method may be exemplified . that is , for example , the composition for blending in hair coloring , sequestering agent , ph adjustor , oxidizing agent and water are mixed homogeneously with stirring under heating , if necessary , to prepare no . 2 agent of oxidizing hair coloring agent . the oxidizing hair coloring agents of the present invention contain at least one selected from the group consisting of no . 1 agents of oxidizing hair coloring agents of the present invention and no . 2 agents of oxidizing hair coloring agents of the present invention . for example , in the oxidizing hair coloring agents of the present invention , the hair colorings consisting of no . 1 agents of oxidizing hair coloring agents of the present invention and no . 2 agents of oxidizing hair coloring agents of the present invention , the hair colorings consisting of no . 1 agents of oxidizing hair coloring agents of the present invention and no . 2 agents of oxidizing hair coloring agents except the above - mentioned ones , and the hair colorings consisting of no . 1 agents of oxidizing hair coloring agents except the above - mentioned ones and no . 2 agents of oxidizing hair coloring agents of the present invention are included . “ no . 1 agents of oxidizing hair coloring agents except the above - mentioned ones ” and “ no . 2 agents of oxidizing hair coloring agents except the above - mentioned ones ” include such no . 1 agents and no . 2 agents as are generally used for the usual hair colorings . another hair treating agents of the present invention include decolorizing agents . the decolorizing agents may be composed of no . 1 agents and no . 2 agents ( the decolorizing agents , no . 1 agents alone and no . 2 agents alone are included in the hair colorings of the present invention ). no . 1 agents of the decolorizing agents of the present invention may contain alkaline agents and water besides the compositions for blending in hair colorings of the present invention . examples of alkaline agents include ammonia and mea . in formulations of no . 1 agents of decolorizing agents , the contents of the compositions for blending in hair colorings may be , for example , from 20 to 60 wt . %. as the substantial method to prepare no . 1 agents of decolorizing agents , following method may be exemplified . that is , for example , the composition for blending in hair coloring of the present invention , that has been heated and dissolved homogeneously , is added with stirring to heated water to be emulsified . after cooling , additives such as alkaline agent are added to prepare no . 1 agent of decolorizing agent . the heating temperatures of water and the composition for blending in hair coloring are desirably lower than the decomposition temperatures of the ingredients , for example , lower than 95 ° c . ingredients , formulations and preparation methods of no . 2 agents of decolorizing agents of the present invention may be the same as no . 2 agents of oxidizing hair coloring agents of the present invention . the decolorizing agents of the present invention contain at least one selected from the group consisting of no . 1 agents of decolorizing agents of the present invention and no . 2 agents of decolorizing agents of the present invention . for example , in the decolorizing agents of the present invention , the decolorizing agents consisting of no . 1 agents of decolorizing agents of the present invention and no . 2 agents of decolorizing agents of the present invention , the decolorizing agents consisting of no . 1 agents of decolorizing agents of the present invention and no . 2 agents of decolorizing agents except the above - mentioned ones , and the decolorizing agents consisting of no . 1 agents of decolorizing agents except the above - mentioned ones and no . 2 agents of decolorizing agents of the present invention are included . “ no . 1 agents of decolorizing agents except the above - mentioned ones ” and “ no . 2 agents of decolorizing agents except the above - mentioned ones ” include such no . 1 agents and no . 2 agents as are generally used for the usual decolorizing . waving agents of the present invention may be composed of no . 1 agents and no . 2 agents ( in the present invention , both no . 1 agents alone and no . 2 agents alone are also included in the hair treating agents of the present invention ). no . 1 agents of the waving agents of the present invention may contain additive compositions , reducing agents , alkaline agents and water besides the compositions for blending in waving agents of the present invention . one or more kinds of the compositions for blending in waving agents may be used . examples of the additive compositions include , for example , mixtures comprised of various kinds of surfactants ( nonionic surfactants , amphoteric surfactants and anionic surfactants ), sequestering agents , amines , alcohols and water . examples of the reducing agents include thioglycolic acid and cysteine or their salts [ ammonium salt , monoethanolamine ( mea ) salt , hydrochloric acd salts etc .]. examples of the alkaline agents include ammonia , amines ( mea , triethanolamine , isopropanolamine , etc . ), ammonium salts ( ammonium bicarbonate etc .) and basic amino acid . in formulations of no . 1 agents of the waving agents of the present invention , the contents of the compositions for blending in waving agents may be , for example , 0 . 5 - 70 wt . %. as the substantial method to prepare no . 1 agents of the present waving agents , following method may be exemplified . that is , for example , each ingredient is mixed with stirring under heating , if necessary , to prepare no . 1 agents . adding order of each ingredient is not limited . for example , each ingredient may be added at a time . or , for example , the compositions for blending in waving agents , water , alkaline agents and reducing agents may be added in this order . in no . 2 agents of the waving agents of the present invention , additive compositions , oxidizing agents , alkaline agents and water etc . may be contained besides the compositions for blending in waving agents of the present invention . examples of the additive compositions include the ones exemplified in no . 1 agents of the waving agents . examples of the oxidizing agents include salts of bromic acid ( e . g . sodium bromate ) and hydrogen peroxide . examples of alkaline agents include alkaline metal hydroxides ( e . g . sodium hydroxide ). in formulations of no . 2 agents of the waving agents , the contents of the compositions for blending in waving agents may be , for example , 0 . 5 - 70 wt . %. as the substantial method to prepare no . 2 agents of the present waving agents , following method may be exemplified . that is , for example , each ingredient is mixed with stirring under heating , if necessary , to prepare no . 2 agents . adding order of each ingredient is not limited . for example , each ingredient may be added at a time . or , for example , the compositions for blending in waving agents , water , oxidizing agent and alkaline agents may be added in this order . the waving agents of the present invention contain at least one selected from the group consisting of no . 1 agents of waving agents of the present invention and no . 2 agents of waving agents of the present invention . for example , the waving agents of the present invention is one consisting of no . 1 agents of waving agents of the present invention and no . 2 agents of waving agents of the present invention , one consisting of no . 1 agents of waving agents of the present invention and no . 2 agents of waving agents except the above - mentioned ones , and another one consisting of no . 1 agents of waving agents except the above - mentioned ones and no . 2 agents of waving agents of the present invention . “ no . 1 agents of waving agents except the above - mentioned ones ” and “ no . 2 agents of waving agents except the above - mentioned ones ” include such no . 1 and no . 2 agents as are ordinary used in the conventional waving agents . the finishing agents of the present invention contain the compositions for blending in finishing agents , and may further contain alcohols , alkaline agents , silicones , amines , organic acids , esters , cationic surfactants , hydrolyzed animal protein , colorants , parabens and perfumes . examples of alcohols include lower and higher alcohols ( e . g . ethanol , cetanol , behenyl alcohol ), aromatic alcohols ( e . g . phenoxyethanol ), glycols ( e . g . propylene glycol , 1 , 3 - butylene glycol , neopentyl glycol dicaprate ). examples of alkaline agents include alkaline metal hydroxides ( e . g . sodium hydroxide ). examples of silicones , organic acids and parabens include respectively the ones exemplified in the aforementioned compositions for blending in hair treating agents . examples of amines include mea . examples of esters include fatty esters ( e . g . isononyl isononanoate , polyoxyethylene distearate ). examples of cationic surfactants include aliphatic alkyl trimethyl ammonium salts ( e . g . stearyl trimethyl ammonium chloride ). examples of colorants include tar colorants ( e . g . blue no . 1 ). examples of perfumes include such ones as are ordinary used in the usual finishing agents . in formulations of the finishing agents of the present invention , the contents of the compositions for blending in finishing agents may be , for example , 1 ˜ 70 wt . %. as the substantial methods to prepare the finishing agents of the present invention , following method may be exemplified . that is , for example , each ingredient is mixed homogeneously as stirring to prepare the finishing agents . all ingredients may be added at a time . or , all ingredients may be added in such order as each ingredient can be dissolved homogeneously . concretely , the compositions for blending in finishing agents , water , alcohols and colorants are mixed homogeneously with stirring , and then further parabens , alkaline agents and silicones are added in order and mixed homogeneously as stirring to prepare the finishing agents . in another preparation method of finishing agents of the present invention , for example , alkaline agents , water and esters are mixed with stirring under heating to prepare aqueous solutions . on the other hand , the composition for blending in finishing agent , parabens and remaining oiliness ingredients are mixed with stirring under heating to prepare homogeneous mixture . next , the homogeneous mixture is added to the above - mentioned aqueous solutions , and then emulsified with stirring to prepare the finishing agents . in another preparation method of finishing agents of the present invention , for example , the heated composition for blending in finishing agent are added to heated water to prepare emulsion . after cooling , the above - mentioned emulsion and amines are added in order to another composition for blending in finishing agent , and then mixed homogeneously with stirring to prepare the finishing agents . emulsion stabilizers of the present invention are such ones as are blended to emulsion in order to improve the emulsion stability when emulsion such as waving agents is added to concentrated salts materials . emulsion stabilizers of the present invention may be the compositions for blending in emulsion stabilizers themselves . the contents of the emulsion stabilizers of the present invention may be , for example , 5 ˜ 20 parts by weight per 100 parts by weight of the waving agents . permanent waving iron sliding improvers of the present invention contain the compositions for blending in permanent waving iron sliding improvers , and may further contain additives such as perfumes and colorants . examples of perfumes include such ones as are ordinarily used in usual permanent waving iron sliding improvers . examples of colorants include tar colorants . in formulations of the permanent waving iron sliding improvers of the present invention , the contents of the compositions for blending in permanent waving iron sliding improvers may be , for example , more than 80 wt . %. as the substantial methods to prepare the permanent waving iron sliding improvers of the present invention , following method may be exemplified . that is , for example , the compositions for blending in permanent waving iron sliding improvers and additives are mixed homogeneously as stirring under heating , if necessary , to prepare the permanent waving iron sliding improvers . in this embodiment , cationic surfactants bedsides at least one compound ( for example , nonionic surfactants ) selected from the group consisting of nonionic surfactants , silicones and polymers are contained in the compositions for blending in hair treating agents of the present invention . examples of cationic surfactants include , for example , dipolyoxyethylene alkyl methyl ammonium salts , dipolyoxyethylene alkenyl methyl ammonium salts , alkyl trimethyl ammonium salts , alkenyl trimethyl ammonium salts , fatty acid amidoalkyl ethyl dimethyl ammonium salts . concrete examples of cationic surfactants include one to three compounds selected from the group consisting of dipolyoxyethylene [ e . g . 2 ˜ 10 eo ] oleyl methyl ammonium chloride , lauryl trimethyl ammonium chloride , lauryl trimethyl ammonium bromide , cetyl trimethyl ammonium chloride , stearyl trimethyl ammonium chloride , cethyl trimethyl ammonium saccarinate and lanolin amidopropyl ethyl dimethyl ammonium ethylsulfate . for example , in compositions for blending in hair conditioners , in compositions for blending in waving agents and in compositions for blending in finishing agents , dipolyoxyethylene oleyl methyl ammonium chloride may be contained . in compositions for blending in waving agents , for example , lauryl trimethyl ammonium chloride may be contained . in compositions for blending in hair conditioners and in compositions for blending in waving agents , for example , cetyl trimethyl ammonium chloride may be contained . in this embodiment , nonionic surfactants are contained in the compositions for blending in hair treating agents of the present invention . examples of nonionic surfactants include , for example , polyoxyethylene alkyl ethers , polyoxyethylene alkenyl ethers , polyoxyethylene aryl ethers , polyoxyethylene derivatives prepared from natural fatty acids , ethylene oxide • propylene oxide block copolymers , fatty acid alkylolamides and esters ( e . g . mono -, di - or tri - esters ) prepared with polyhydric alcohols ( e . g . glycols and sorbitanes etc .) and higher fatty acids . ethylene oxide ( eo ) addition polymerization degrees in “ polyoxyethylene ” may be , for example , 2 ˜ 70 . propylene oxide ( po ) addition polymerization degrees in “ polyoxypropylene ” may be , for example , 10 ˜ 20 . concrete examples of nonionic surfactants include one to four compounds selected from the group consisting of polyoxyethylene lauryl ether , polyoxyethylene cetyl ether , polyoxyethylene oleyl ether , polyoxyethylene nonylphenyl ether , polyoxyethylene castor oil , polyoxyethylene lanolin , polyoxyethylene • polyoxpropylene lanolin , lauric acid diethanolamide , polyethylene glycol monolaurate , polyoxyethylene glyceryl oleate , sorbitan monolaurate and sorbitan trioleate . for example , in compositions for blending in waving agents , polyoxyethylene lauryl ether may be contained . in compositions for blending in waving agents and in compositions for blending in thickening agents used on preparing hair treating agents , for example , polyoxyethylene nonylphenyl ether may be contained . in compositions for blending in hair conditioners and in compositions for blending in waving agents , for example , polyoxyethylene lanolin and / or lauric acid diethanolamide may be contained . further , in the compositions for blending in hair treating agents of the present invention , any kind of additives may be contained in accordance with the kind and the purposes of hair treating agents . for example , in the composition for blending in hair treating agent of the present invention , one to five kinds of ingredients selected from the group consisting of fats and oils , hydrocarbons , silicones ( si compounds ), alkalis , acids , amphoteric surfactants , sequestering agents , polymers , esters , antibacterial agents and water may be contained . for example , in compositions for blending in waving agents , one to three kinds of ingredients selected from the group consisting of fats and oils , hydrocarbons , alkalis , amphoteric surfactants and polymers may be contained . in compositions for blending in finishing agents and in compositions for blending in thickening agents used on preparing hair treating agents , for example , silicones may be contained . in compositions for blending in hair conditioners and in compositions for blending in waving agents , for example , acids and / or sequestering agents may be contained . in compositions for blending in thickening agents used on preparing hair treating agents , for example , esters may be contained . in compositions for blending in finishing agents , for example , antibacterial agents may be contained . in compositions for blending in compositions for blending in hair conditioners , in compositions for blending in waving agents and in compositions for blending in finishing agents , for example , water may be contained . examples of fats and oils include lanolin . examples of hydrocarbons include liquid petrolatum . examples of silicones include polyoxyethylene • methyl polysiloxane copolymer or methylphenyl polyethylene siloxane ( degree of viscosity , e . g . 10 ˜ 100 cs ). examples of alkalis include sodium hydroxide . examples of acids include one or two compounds selected from the group consisting of phosphoric acid , dibasic sodium phosphate and sorbic acid . examples of amphoteric surfactant include lauryl dimethlaminoacetic acid betaine . examples of sequestering agents include disodium edetate or hydroxyethane diphosphoric acid . examples of polymers include polyethylene glycol ( average molecular weight , e . g . 300 ˜ 500 ). examples of esters include polyethylene ( 100 ˜ 200 eo ) glycol distearate . examples of antibacterial agents include phenoxyethanol . in the formulations of the compositions for blending in hair treating agents of the present invention , when the respective contents of cationic surfactants and nonionic surfactants are b and c ( wt %), b and c desirably satisfy the expressions of 0 . 5 ≦ b ≦ 30 , 0 . 1 ≦ c ≦ 95 and b + c ≦ 100 . for example , in a case of the compositions for blending in hair conditioners and the compositions for blending in waving agents , b and c may be 0 . 5 ≦ b ≦ 30 , 1 ≦ c ≦ 95 and b + c ≦ 100 . in a case of compositions for blending in finishing agents , b and c may be 5 ≦ b ≦ 30 , 0 . 1 ≦ c ≦ 10 . in a case of compositions for blending in thickening agents used on preparing hair treating agents , b and c may be 0 . 5 ≦ b ≦ 10 , 65 ≦ c ≦ 95 and b + c ≦ 100 . as the substantial method to prepare the compositions for blending in hair treating agents of this embodiment , following method may be exemplified . that is , cationic surfactants , nonionic surfactants and ingredients such as additives ( if necessary ) are mixed and stirred under heating ( if necessary ) until completely dissolved . the heating temperature is desirably lower than the decomposition temperature of the mixture , for example , lower than 95 ° c . the adding order of each ingredient is not limited . in another preparation method of the compositions for blending in hair treating agents of this embodiment , for example , nonionic surfactants and other oiliness ingredients ( e . g . fats and oils , hydrocarbons ) are mixed and dissolved homogeneously under heating . this homogeneously dissolved material is added with stirring to heated water to prepare emulsion , and then this emulsion is cooled . on the other hand , cationic surfactants and water are mixed with stirring under heating and dissolved homogeneously , and then cooled . next , this homogeneously dissolved material is added with stirring to the above - mentioned emulsion , and then mixed homogeneously to prepare the compositions for blending in hair treating agents of this embodiment . the heating temperature is desirably lower than the decomposition temperature of the mixture , for example , lower than 95 ° c . the hair treating agents of the present invention contain the above - mentioned compositions for blending in hair treating agents of the present invention . hair conditioners , waving agents , finishing agents and thickening agents used on preparing hair treating agents are illustrated below as the hair treating agents . the hair conditioners of the present invention contain above - mentioned compositions for blending in hair conditioners . one or more kinds of the compositions for blending in hair conditioners may be used . further , in the hair conditioners of the present invention , polymers and water may be contained as additives . examples of polymers include hydroxyethyl cellulose ( degree of viscosity of 1 % aqueous solution , e . g . 500 ˜ 5000 cps ). in the formulations of the hair conditioners of the present invention , the contents of the compositions for blending in hair conditioners are , for example , from 5 to 30 wt . %. the preparing methods of the hair conditioners of the present invention are not limited . for example , the composition for blending in hair conditioner is heated to obtain homogeneously dissolved material . on the other hand , water and polymers are mixed and heated to prepare homogeneously dissolved material . to this homogeneously dissolved material , the aforementioned homogeneously dissolved material is added with stirring to be emulsified . after cooling , the hair conditioner of the present invention is prepared . waving agents of the present invention may be composed of no . 1 agents and no . 2 agents ( in the present invention , both no . 1 agents alone and no . 2 agents alone are also included in the hair treating agents of the present invention ). no . 1 agents of the waving agents of the present invention may contain reducing agents , alkaline agents and water besides the compositions for blending in waving agents of the present invention . examples of the reducing agents include thioglycolic acid and cysteine or their salts [ ammonium salt , mea salt , hydrochloric acd salts etc .]. examples of the alkaline agents include ammonia , amines ( mea , isopropanolamine , etc . ), ammonium salts ( ammonium bicarbonate etc .) and basic amino acid . in formulations of no . 1 agents of the waving agents of the present invention , the contents of the compositions for blending in waving agents may be , for example , 0 . 1 ˜ 25 wt . %. in no . 2 agents of the waving agents of the present invention , oxidizing agents , surfactants , sequestering agents and water etc . may be contained besides the compositions for blending in waving agents of the present invention . examples of the oxidizing agents include salts of bromic acid ( e . g . sodium bromate ) and hydrogen peroxide . examples of the surfactants include lauryl trimethyl ammonium halide ( lauryl trimethyl ammonum chloride , lauryl trimethyl ammonium bromide etc .). examples of the sequestering agents include disodium edetate and 1 - hydroxyethane - 1 , 1 - diphosphonic acid . in formulations of no . 2 agents of the waving agents , the contents of the compositions for blending in waving agents may be , for example , 1 ˜ 15 wt . %. conventional no . 2 agents of the waving agents may be used instead of no . 2 agents of the waving agents of the present invention . examples of such conventional no . 2 agents of the waving agents include the mixture prepared by dissolving oxidizing agents ( e . g . sodium bromate ) and surfactants ( lauryl trimethyl ammonum chloride , lauryl trimethyl ammonium bromide etc .) homogeneously in water . as the substantial method to prepare no . 1 agents of the present waving agents , following method may be exemplified . that is , for example , the composition for blending in waving agent , that has been heated and dissolved homogeneously , is added to heated water , stirred and emulsified . then , viscous liquid is prepared by cooling . next , reducing agents and alkaline agents may be added to the viscous liquid at room temperature , and mixed homogeneously as stirring . the contents of the compositions for blending in waving agents in viscous liquids may be , for example , from 1 to 20 wt . %. as another method to prepare no . 1 agent of the present waving agent , following method may be exemplified . that is , for example , the composition for blending in waving agent , reducing agent , alkaline agent and water are added , and then mixed as stirring under heating , if necessary , to prepare no . 1 agent of the present waving agent . in no . 2 agents of the waving agents of the present invention , for example , the composition for blending in waving agent , oxidizing agents and water are added , and then mixed as stirring under heating , if necessary , to prepare no . 2 agent of the present waving agent . the waving agents of the present invention contain at least one selected from the group consisting of no . 1 agents of waving agents of the present invention and no . 2 agents of waving agents of the present invention . for example , the waving agents of the present invention is one consisting of no . 1 agents of waving agents of the present invention and no . 2 agents of waving agents of the present invention , one consisting of no . 1 agents of waving agents of the present invention and no . 2 agents of waving agents except the above - mentioned ones , and another one consisting of no . 1 agents of waving agents except the above - mentioned ones and no . 2 agents of waving agents of the present invention . as “ no . 1 agents of waving agents except the above - mentioned ones ” and “ no . 2 agents of waving agents except the above - mentioned ones ”, the no . 1 and no . 2 agents , which are ordinary used in the conventional waving agents , may be exemplified respectively . concrete examples of the “ no . 2 agents of waving agents except the above - mentioned ones ” include the mixture prepared by dissolving oxidizing agents and surfactants homogeneously in water . the finishing agents of the present invention contain the compositions for blending in finishing agents , and may further contain , if necessary , alcohols , preservatives and perfumes as additives . in formulations of the finishing agents of the present invention , the contents of the compositions for blending in finishing agents may be , for example , 1 ˜ 35 wt . %. as the substantial methods to prepare the finishing agents of the present invention , following method may be exemplified . that is , for example , the compositions for blending in finishing agents , alcohols , preservatives , perfumes and water are added as stirring in order , and then mixed homogeneously under heating , if necessary , to prepare the finishing agents . thickening agents used on preparing hair treating agents of the present invention are such ones as may be blended to hair treating agents such as waving agents when hair treating agents are prepared and as can increase the viscosity of hair treating agents such as waving agents . thickening agents used on preparing hair treating agents of the present invention contain the compositions for blending in thickening agents used on preparing hair treating agents of the present invention , and may further contain esters , glycols , preservatives and water . examples of esters include fatty esters such as cetyl octanoate . examples of glycols include 1 , 3 - butylene glycol . examples of preservatives include parabens such as methyl parahydroxybenzoate . in formulations of thickening agents used on preparing hair treating agents of the present invention , the compositions for blending in thickening agents used on preparing hair treating agents may be 40 ˜ 80 wt . %. as the substantial methods to prepare the thickening agents used on preparing hair treating agents of the present invention , following method may be exemplified . that is , for example , the compositions for blending in thickening agents used on preparing hair treating agents , esters , glycols and preservatives are dissolved homogeneously under heating , if necessary . next , this homogeneously dissolved materials is added with stirring to water , and then mixed homogeneously to prepare the thickening agents used on preparing hair treating agents of the present invention the first embodiment of the present invention is illustrated more concretely according to the following examples . the amount ( kg ) shown in table 1 - 6 of each ingredient was heated to the temperature shown in table 1 , 3 or 5 , and then mixed homogeneously with stirring . thus , the composition for blending in hair treating agent ( examples 1 , 18 ˜ 23 , 25 and 26 ) of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 1 - 6 . each ingredient except ingredient 38 , 41 , 45 and 51 was heated to the temperature shown in table 1 or 3 , and then dissolved homogeneously . this homogeneously dissolved material was added with stirring to ingredient 51 , which had been heated to the temperature shown in table 1 or 3 , and then emulsified . after the emulsion was cooled below 45 ° c ., ingredient 38 , 45 and 41 were added to the emulsion , and further ingredient 51 ( add water ) was added so as to adjust the total weight to be 100 kg . thus , the composition for blending in hair treating agent of the present invention ( examples 2 ˜ 7 , 9 ˜ 11 and 13 ) was prepared . each numbers indicating ingredient , the ingredients and contents ( kg ) are shown in table 1 - 4 . ingredient 3 ( 0 . 76 kg ) was heated to 45 ˜ 50 ° c . 0 . 38 kg of perfumes [ trade name , “ bois de rose ” ( meiji koryo co .)] was added to this and dispersed homogeneously . then , ingredient 51 ( 3 . 98 kg ) was added with stirring , and then mixed homogeneously to prepare an agent for solbilizing perfumes . on the other hand , ingredient 5 ( 2 . 99 kg ) and ingredient 51 ( 5 . 3 kg ) were heated to 70 ˜ 90 ° c ., and then mixed homogeneously . after this homogeneous mixture was cooled below 40 ° c ., the cooled mixture was added to 86 . 34 kg of the composition for blending in a hair treating agent ( example 11 ), and stirred to prepare homogeneous composition . the aforementioned agent for solbilizing perfume and above - mentioned homogeneous composition are mixed with stirring . thus , the composition for blending in hair treating agent of the present invention was prepared . each number indicating ingredient , the ingredients and contents ( kg ) are shown in table 1 and 2 . each ingredient 1 , 39 , 40 and 51 ( 36 . 42 kg ) were heated to the temperature shown in table 3 , and then mixed homogeneously . after cooled below 40 ° c ., mixture with ingredient 41 and 51 and ingredient 20 were added in order to the cooled mixture , and then mixed homogeneously with stirring . thus , the composition for blending in hair treating agent of the present invention was prepared . each number indicating ingredient , the ingredients and contents ( kg ) are shown in table 3 and 4 . ingredient 1 was added to ingredient 51 ( 41 . 46 kg ), which had been heated to the temperature shown in table 3 , and dissolved . to this , ingredient 39 and 40 were added , and cooled with stirring homogeneously below 45 ° c . next , ingredient 41 was added , and further ingredient 51 ( add water ) was added so as to adjust the total weight to be 100 kg , and then mixed homogeneously with stirring . thus , the composition for blending in hair treating agent of the present invention was prepared . each number indicating ingredient , the ingredients and contents ( kg ) are shown in table 3 and 4 . each ingredient except ingredient 51 was heated to the temperature shown in table 3 , and then dissolved homogeneously . ingredient 51 , which had been heated to the temperature shown in table 3 , was added with stirring to this homogeneously dissolved material . after cooled below 45 ° c ., ingredient 51 ( add water ) was added so as to adjust the total weight to be 100 kg , and then mixed homogeneously with stirring . thus , the composition for blending in hair treating agent of the present invention was prepared . each number indicating ingredient , the ingredients and contents ( kg ) are shown in table 3 and 4 . each ingredient 12 , 19 , 33 and 50 was mixed and heated to the temperature shown in table 3 to be dissolved homogeneously . after cooled below 50 ° c ., ingredient 51 ( 49 . 21 kg ), 47 and 42 were added in order , and finally ingredient 51 ( add water ) was added so as to adjust the total weight to be 100 kg , and then mixed homogeneously with stirring . thus , the composition for blending in hair treating agent of the present invention was prepared . each number indicating ingredient , the ingredients and contents ( kg ) are shown in table 3 and 4 . ingredient 21 was dissolved in ingredient 51 ( 20 kg ), which had been heated to 80 ˜ 90 ° c ., to prepare mixture i . ingredient 22 was dissolved in ingredient 51 ( 30 kg ), which had been heated to 80 ˜ 90 ° c ., to prepare mixture ii . ingredient 19 , 49 and 50 were heated to 80 ˜ 90 ° c ., and then ingredient 51 was added to prepare mixture iii . next , each ingredient i , ii and iii were added in order , and then mixed homogeneously with stirring . thus , the composition for blending in hair treating agent of the present invention was prepared . each number indicating ingredient , the ingredients and contents ( kg ) are shown in table 5 and 6 . each ingredient 6 , 13 , 24 ( 4 kg ) and 25 was mixed and heated to the temperature shown in table 5 to prepare homogeneously dissolved material i . on the other hand , ingredient 24 and 48 were mixed and heated to the temperature shown in table 5 to prepare homogeneously dissolved material ii . to homogeneously dissolved material i , homogeneously dissolved material ii was added , and then mixed homogeneously with stirring . thus , the composition for blending in hair treating agent of the present invention was prepared . each number indicating ingredient , the ingredients and contents ( kg ) are shown in table 5 and 6 . each ingredient except ingredient 18 was mixed homogeneously with stirring . and then , to this homogeneous mixture , ingredient 18 was added with stirring , and then dispersed homogeneously . thus , the composition for blending in hair treating agent ( examples 28 and 29 ) of the present invention was prepared . each number indicating ingredient , the ingredients and contents ( kg ) are shown in table 5 and 6 . after the composition for blending in hair conditioner ( example 20 or 22 ) and additive composition were mixed , heated to 80 ˜ 85 ° c ., and dispersed homogeneously , water , which had been heated to 80 ˜ 85 ° c ., was added , and then mixed homogeneously with stirring . thus , the hair conditioner ( examples 30 and 31 ) of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 7 . dye intermediates ( mixture with resorcinol , p - phenylene diamine , m - aminophenol and p - aminophenol ) and water were mixed and heated to 80 ° c . to prepare aqueous solution . to this aqueous solution , the composition for blending in hair coloring was added and then mixed homogeneously with stirring . after cooled to room temperature , mixture with monoethanolamine ( mea ) and strong ammonia solution was added , and then mixed homogeneously with stirring . thus , no . 1 agent of oxidizing hair coloring agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 8 . each ingredient shown in table 8 was mixed homogeneously with stirring . thus , no . 2 agent of oxidizing hair coloring agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 8 . no . 1 agent of decolorizing agent of the present invention was prepared in the same manner as example 32 excepted that dye intermediates was not used . the ingredients and contents ( kg ) are shown in table 8 . no . 2 agent of decolorizing agent of the present invention was prepared in the same manner as example 32 . the ingredients and contents ( kg ) are shown in table 8 . to one composition for blending in waving agent ( example 28 ), water , triethanolamine , mixture with atg and strong ammonia aqueous solution and the other composition for blending in waving agent ( example 4 ) were added in order with stirring , and then mixed homogeneously . thus , no . 1 agent of waving agents of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 9 . no . 2 agent of waving agent of the present invention was prepared in the same manner as following examples 40 ˜ 42 . the ingredients and contents ( kg ) are shown in table 9 . to one composition for blending in waving agent ( example 29 ), water , monoethanolamine , the other composition for blending in waving agent ( example 4 , 14 , 16 ) or additive composition , atg and strong ammonia aqueous solution were added in order with stirring , and then mixed homogeneously . thus , no . 1 agent of waving agents of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 9 . to one composition for blending in waving agent ( example 29 ), water , sodium hydroxide , the other composition for blending in waving agent ( example 4 , 14 , 16 ) or additive composition , sodium bromate and “ kathon cg ” were added in order with stirring , and then mixed homogeneously . thus , no . 2 agent of waving agents of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 9 . to one composition for blending in waving agent ( example 29 ), water , the other composition for blending in waving agent ( example 18 ), monoethanolamine , atg and strong ammonia aqueous solution were added in order with stirring , and then mixed homogeneously . thus , no . 1 agent of waving agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 9 . to one composition for blending in waving agent ( example 29 ), water , the other composition for blending in waving agent ( example 18 ), sodium hydroxide , sodium bromate and “ kathon cg ” were added in order with stirring , and then mixed homogeneously . thus , no . 2 agent of waving agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 9 . each ingredient shown in table 9 was mixed homogeneously with stirring . thus , no . 1 agent of waving agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 9 . each ingredient shown in table 9 was mixed homogeneously with stirring . thus , no . 2 agent of waving agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 9 . potassium hydroxide , 70 kg of water and polyoxyethylene distearate was heated to 80 ˜ 85 ° c ., and then stirred to prepare aqueous solution . on the other hand , the composition for blending in a finishing agent ( example 1 ), parabens and remaining oiliness ingredients were heated to 80 ˜ 85 ° c ., and then stirred to prepare homogeneous mixture . this homogeneous mixture was added to the aforementioned aqueous solution , and emulsified with stirring . after this emulsion was cooled to 50 ° c ., water ( add water ) was added so as to adjust the total weight to be 100 kg , and then mixed homogeneously . thus , finishing agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 10 . after each ingredient except water was mixed homogeneously with stirring , water was added and emulsified . thus , finishing agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 10 . each ingredient shown in table 10 was mixed with stirring to be dissolved homogeneously . thus , finishing agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 10 . the composition for blending in a finishing agent ( example 29 ), water , propylene glycol and blue no . 1 aqueous solution were mixed and stirred to prepare homogeneous mixture . to this homogeneous mixture , mixture with parabens and ethanol , potassium hydroxide and decamethyl cyclopentasiloxane were added in order , and then mixed homogeneously with stirring . thus , the finishing agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 10 . to water that had been heated to 80 ° c ., one composition for blending in a finishing agent ( example 1 ), that had been heated to 80 ° c . to be dissolved homogeneously , was added with stirring to prepare emulsion . after this emulsion was cooled to 45 ° c . with stirring , the above - mentioned emulsion and monoethanolamine were added in order to the other composition for blending in a finishing agent ( example 28 or 29 ), and then mixed homogeneously with stirring . thus , the finishing agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 10 . the composition for blending in emulsion stabilizer ( example 13 ) itself was used as emulsion stabilizer ( example 54 ). namely , 0 . 9 kg of the emulsion stabilizer ( example 54 ), 3 kg of the composition for blending in waving agent ( example 4 ), 15 kg of sodium bromate and such amount of water as the total volume of the waving agent would be 100 l were added , and then mixed homogeneously with stirring . thus , no . 2 agent of waving agent of the present invention was prepared . then , this no . 2 agent of waving agent was left at 40 ° c . for more than one year . as a result , it was found by visual examination that there was no change in appearance and the emulsion was stable . about 99 kg of the composition for blending in permanent waving iron sliding improver ( example 27 ), proper amount of perfume and proper amount of aqueous colorants solution were added , and then mixed homogeneously at room temperature to prepare 100 kg of mixture . thus , the permanent waving iron sliding improver of the present invention was prepared . hair treating were carried out to 50 monitors by the following methods . and the results of the organoleptic tests about hair treating effects ( i . e . feel when used and characteristic properties ) of the hair treating agents were obtained . the results of organoleptic tests were summarized in table 11 and 12 . after ordinary shampoo , a specimen of hair conditioners ( examples 30 and 31 ) was applied to hair and spread by combing , and then rinsed and dried using a dryer . no . 1 agent and no . 2 agent of the hair coloring ( example 32 and 33 ) were mixed ( the wt . % ratio of no . 1 agents to no . 2 agents was 1 : 1 ). this mixture was applied to hair and left for 30 minutes at room temperature . then , the hair was rinsed and dried using a dryer . no . 1 agent of the waving agent ( example 34 , 40 ˜ 45 ) was applied to hair and spread by combing , and the hair was wound to a rod and left for 7 minutes at 45 ° c . then no . 2 agent was applied by an applicator and left for 7 minutes . repeatedly , no . 2 agent was applied by an applicator and left for 7 minutes . next , the rod was removed , and the hair was rinsed and dried using a dryer . no . 1 agent of the waving agent ( example 35 ˜ 39 ) was applied to hair and spread by combing and the hair was formed to the straight shape . then , the hair was left for 10 minutes . after that , no . 2 agents ( example 35 ˜ 45 and one prepared in example 54 ) was applied to hair and spread by combing , further left for 10 minutes , and finally , rinsed and dried using a dryer . the finishing agent ( example 46 ˜ 53 ) was applied to hair and spread . the method for hair treating with permanent waving iron sliding improvers the permanent waving iron sliding improver ( example 55 ) was applied to hair . and the hair was formed to predetermined hair style with iron . as clearly understood from the results of the above - mentioned examples , the compositions for blending in hair treating agents of the present embodiment are prepared by selecting and combining adequately the ingredients which are cheap and easy to purchase so as to display an excellent hair treating effect . therefore , the compositions for blending in hair treating agents of the present invention may be produced by lower cost and easily . since the hair treating agents of the present embodiment are prepared using above - mentioned compositions for blending in hair treating agents of the present invention , the costs for production are low , further , have excellent feels when used such as luster , smooth feel , neat feel , soft feel , moisture feel , rustle feeling and less stickiness , and have excellent functionalities such as spreadability of hair treating agents and protective ability for hair etc . further , in the preparation process of hair treating agent since , it is possible by using the compositions for blending in a hair treating agents of the present invention to blend various ingredients containing at least one compound selected from the group consisting of nonionic surfactants , silicones and polymers etc . at a time , the production process may be remarkably simplified . the second embodiment of the present invention is illustrated more concretely according to the following examples . the amount ( kg ) shown in table 13 and 14 of each ingredient was poured into a vessel and mixed , and the mixture was stirred and dissolved completely at the heating temperature shown in table 13 and 14 ( examples 56 , 59 ˜ 67 and 69 ) or at room temperature ( example 68 ). thus , the composition for blending in hair treating agent ( examples 56 , 59 ˜ 69 ) of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 13 and 14 . polyoxyethylene oleyl ether [ 4 . 43 kg ( 7 eo )+ 1 . 1 kg ( 20 eo )], lanolin and liquid petrolatum were mixed , and then heated to 93 ˜ 95 ° c . to prepare homogeneously dissolved material . the heated homogeneously dissolved material was added with constant stirring to 25 . 59 l of water , that had been heated to 93 ˜ 95 ° c ., and the mixture was cooled below 28 ° c . to prepare homogeneous mixture . on the other hand , lauryl trimethyl ammonium chloride , cetyl trimethyl ammonum chloride and 19 . 69 kg of water were mixed . after this mixture was heated to 80 ° c . and then mixed as stirring , this mixture was cooled below 30 ° c . to prepare homogeneously dissolved material ( i ). further , polyoxyethylene lanolin and 9 . 84 kg of water were mixed . after this mixture was heated above 80 ° c ., and then mixed with stirring , this mixture was cooled below 30 ° c . to prepare homogeneously dissolved material ( ii ). the afore - mentioned homogeneously dissolved material ( i ) and ( ii ) were added in order . next , sorbic acid , phosphoric acid and sodium hydroxide were added . finally , water ( add water ) was further added so as to adjust the total weight to be 100 kg , and mixed homogeneously . thus , the composition for blending in hair treating agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 13 and 14 . polyoxyethylene oleyl ether [ 2 . 67 kg ( 30 eo )+ 1 . 33 kg ( 50 eo )] and 13 . 33 kg of water were mixed as stirring at 80 ° c . to prepare homogeneously dissolved material . next , 13 . 33 kg of ice was added to the above - mentioned homogeneously dissolved material , and then the mixture was cooled below 30 ° c . to this , 66 . 67 kg of the aqueous composition 1 ) was added . finally , water ( add water ) was further added so as to adjust the total weight to be 100 kg , and mixed homogeneously . thus , the composition for blending in hair treating agent of the present invention was prepared . the ingredients and contents ( kg ) are shown in table 13 and 14 . 1 ) ingredient ( kg ); lauryl trimethyl ammonum chloride ( 1 . 48 ), cetyl trimethyl ammonium chloride ( 9 . 88 ), polyoxyethylene oleyl ether ( 7 . 11 ), lanolin ( 4 ), liquid petrolatum ( 9 ), sodium hydroxide ( 0 . 06 ), phosphoric acid ( 0 . 01 ), sorbic acid ( 0 . 15 ), water ( 68 . 31 ). 80 kg of initial water and 2 kg of hydroxyethyl cellulose were mixed and heated to 90 ° c . to prepare aqueous solution . after this aqueous solution was cooled to 45 ° c ., 10 kg of the compositions for blending in hair conditioners ( example 65 ) was added with stirring to the above - mentioned cooled aqueous solution , and mixed homogeneously . thus , the hair conditioner of the present invention was prepared . 10 kg of the composition for blending in waving agent ( example 56 ) was heated to 80 ˜ 85 ° c ., and then homogeneously dissolved . on the other hand , 80 kg of initial water was heated to 80 ˜ 85 ° c . the afore - mentioned heated homogeneously dissolved material was added as stirring to the heated initial water , and then homogeneously mixed . after this homogeneous mixture was cooled as stirring to 47 ˜ 49 ° c ., water was added so as to adjust the total weight to be 100 kg , and then mixed homogeneously . thus , the viscous liquid , in which 10 wt . % of the composition for blending in waving agent was contained , was prepared . to 25 kg of the 10 % viscous liquid obtained above , 13 kg of 50 % ammonium thioglycolate ( atg ) and proper amount of strong ammonia solution were added at room temperature . further , water ( add water ) was added so as to adjust the total weight to be 100 kg , and then mixed homogeneously . thus no . 1 agent of waving agent was prepared . 1 kg of lauryl trimethyl ammonum chloride , 8 kg of sodium bromate and water was added to prepare 100 kg of aqueous solution . this aqueous solution was used as no . 2 agent of waving agent . the composition for blending in waving agent ( example 57 ˜ 67 ), 50 % atg , strong ammonia solution and water were mixed homogeneously with stirring at room temperature . thus , no . 1 agent ( example72 ˜ 82 ) of waving agent was prepared . ingredients and contents ( kg ) are shown in table 15 and 16 . the composition for blending in waving agent ( example 57 ˜ 59 and 67 ), sodium bromate and water were mixed homogeneously with stirring at room temperature . thus , no . 2 agent ( example72 ˜ 82 ) of waving agent was prepared . ingredients and contents ( kg ) are shown in table 15 and 16 . 10 kg of the composition for blending in a finishing agent ( example 68 ), 10 l of ethanol , 0 . 1 kg of methyl parahydroxybenzoate , proper amount of perfume , proper amount of aromatic material dispersant and such amount of water as the total volume of the finishing agent would be 100 l were added in order with stirring , and then mixed homogeneously . thus , finishing agent ( example 83 ) of the present invention was prepared . 62 kg of the composition for blending in thickening agent used on preparing hair treating agent ( example 69 ), 4 kg of cetyl octanoate , 12 kg of 1 , 3 - butylene glycol and 0 . 1 kg of methyl parahydroxybenzoate were mixed and heated to 80 ° c ., and then dissolved homogeneously . this homogeneously dissolved material was added with stirring to water , which had been heated to 80 ° c ., and then dissolved homogeneously . such amount of water as the total weight of the thickening agent used on preparing hair treating agent would be 100 kg was added . thus , thickening agent used on preparing hair treating agent of the present invention was prepared . 30 kg of the obtained thickening agent used on preparing hair treating agent ( example 84 ) was added to 70 kg of the afore - mentioned waving agent ( example 59 ) to prepare new another type of waving agent . it was confirmed by visual inspection that the waving agents had changed from fluid state to gel stage . further , the organoleptic tests of this new type of waving agent were carried out as follows . the results of organoleptic tests were summarized in table 17 . hair treating were carried out to 50 monitors by the following methods . and the results of the organoleptic tests about hair treating effects ( i . e . feel when used and characteristic properties ) of the hair treating agents were obtained . the results of organoleptic tests were summarized in table 17 . after ordinary shampoo , a specimen of hair conditioners ( examples 70 ) was applied to hair and spread by combing , and then rinsed and dried using a dryer . no . 1 agent of the waving agent ( example 71 ˜ 82 ) was applied to hair and spread by combing , and the hair was wound to a rod and left for 7 minutes at room temperature . then no . 2 agent was applied by an applicator and left for 7 minutes . repeatedly , no . 2 agent was applied by an applicator and left for 7 minutes . next , the rod was removed , and the hair was rinsed and dried using a dryer . no . 1 agent of the waving agent ( new type of waving agent prepared in example 84 ) was applied to hair and spread by combing and the hair was formed to the straight shape . then , the hair was left for 10 minutes . after that , no . 2 agent was applied to hair and spread by combing , further left for 10 minutes , and finally , rinsed and dried using a dryer . the finishing agent ( example 83 ) was applied to hair and spread . as clearly understood from the results of the above - mentioned examples , the compositions for blending in hair treating agents of the present embodiment are prepared by selecting and combining adequately the ingredients which are cheap and easy to purchase so as to display an excellent hair treating effect . therefore , the compositions for blending in hair treating agents of the present invention may be produced by lower cost and easily . since the hair treating agents of the present embodiment are prepared using above - mentioned compositions for blending in hair treating agents of the present invention , the costs for production are low , further , have excellent feels when used such as moisture feel , smooth feel , slightly oily feel , pleasant sense of touch to the hair , luster , suppleness , soft feel and smooth combing , and have excellent functionalities such as less hair damage ( protective ability for hair ), absorptivity to hair • penetrating ability into hair • adhesiveness to hair • spreadability of hair treating agent ( especially waving agent ), moisturizing ability , smooth formation of less uneven , firmly rooted and knitted wave and prevention against generation of static electricity etc . further , in the preparation process of hair treating agent since it is possible by using the compositions for blending in a hair treating agents of the present invention to blend cationic surfactants and nonionic surfactants etc . at a time , the production process may be remarkably simplified .

US-10636102-A

in one aspect , the present invention is directed to a nose filter adapted to be inserted into a nostril , the nose filter comprising : a housing having an external shape corresponding to the nostril , for enforcing breathed air to pass through the housing ; filtering membrane , for filtering inhaled air ; a first air passageway , through the filtering membrane ; a second air passageway , bypassing the filtering membrane ; and valve , for enforcing inhaled air to pass through the filtering membrane , and bypass the filtering membrane upon exhalation ; wherein the valve are operative to block the second air passageway upon inhalation , and operative to open the second passageway upon exhalation .

while this invention is adaptable to many different forms , there is shown in the drawings and will herein be described in detail a preferred embodiment , with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the broad aspect of the invention to the embodiments illustrated . each of fig1 a , 1 b and fig2 is a cross - section of a nose filter , according to one embodiment of the invention . fig1 a illustrates the nose filter during exhalation time , and fig1 b illustrates the nose filter during inhalation time . fig2 illustrates the parts of the nose filter , according to one embodiment of the invention . the nose filter comprises : a housing 10 , a valve ( comprising elements 21 , 24 , and 25 in the figures ) and a filtering membrane 30 . the housing 10 comprises an upper cavity 11 , and a lower cavity 12 . the air passes through the cavities while the wearer thereof breathes . in the embodiments illustrated in fig1 a , fig1 b and fig2 , the valve comprises an axle 21 , and a seal ( obturator ) 22 to which the filtering membrane 30 ( a filtering substance ) is attached . the axle 21 is movable through cavity 27 of an adherent 25 , which is attached to the housing 10 . the adherent 25 comprises one or more cavities 26 for enabling inhaled and exhaled air to pass through adherent 25 . upon inhaling , as illustrated in fig1 b , the inhaled air pushes the seal 22 upward to the narrow portion of housing 10 until stopped by housing 10 , thereby closing the air passage 28 and forcing inhaled air to pass through the filtering membrane 30 . upon exhaling , as illustrated in fig1 a , the exhaled air pushes the seal 22 downward until stopped by the adherent 25 , thereby opening an air passage 28 between the seal 22 and the housing 10 , through which the air passes out . the seal 22 must have one or more cavities 24 , through which air can pass through the seal 22 . fig3 a is a cross - section of a nose filter while exhaling , according to a preferred embodiment of the invention . fig3 b is a cross - section of a nose filter while inhaling , according to a preferred embodiment of the invention . referring to fig3 a and 3b , housing 10 comprises upper cavity 11 , and lower cavities 12 and 12 a . housing 10 includes a first lower cell 54 containing a stationary filtering membrane 30 ; a second lower cell 50 ; and an upper cell 52 . a substantial portion 60 of the upper cell 52 is vertically aligned with the lower cells 50 and 54 . a center wall 62 separates the lower cells 50 and 54 . the first lower cell 54 includes a lower cavity 12 and a top passageway 56 . the second lower cell 50 includes a lower cavity 12 a and a top passageway 38 . the bottom of upper cell 52 includes passageways 56 and 38 ; and the top of upper cell 52 includes upper cavity 11 . the valve comprises an air passageway 38 and an elastic cover thereof 39 , which covers the bottom of the passageway 38 . in its “ normal ” state , the elastic cover 39 covers the air passageway 38 . on exhalation , when the air 32 passes downwards , the elastic cover 39 bends thereby allowing the air 32 to pass through the passageway 38 , through lower cell 50 , down to lower cavity 12 a , as illustrated in fig3 a . on inhalation , when the inhaled air 31 passes upwards , the elastic cover 39 blocks the passageway 38 , thereby forcing the inhaled air 31 to pass through the stationary filtering membrane 30 , as illustrated in fig3 b . the elastic cover 39 blocks the exhaled air , left within housing 10 below passageway 38 , from returning by the inhaling , into cavity 11 and into the nostril . the normal state of the elastic cover 39 is illustrated in fig3 b . in this state the cover 39 covers the entire passageway 38 . as a result , the nose filter of the present invention is less constraining and more readily simulates normal breathing by the wearer . fig4 schematically illustrates a nose filter , according to a preferred embodiment of the invention . it includes two nose filters , one for the left nostril and one for the right nostril . the left and the right nose filters are connected by a flange 19 , being disposed below and outside housings 10 of the nose filters . the disposition of elastic cover 39 within housing 10 and not outside housing 10 enables disposing flange 19 outside housing 10 . the housing 10 may be formed of flexible or rigid material . in a preferred embodiment of the present invention , any plastic or rubber - like material which is non - toxic and which will not irritate the inner wall of the nostril may be used to form the housing . the housing 10 may be formed also from synthetic rubber latex . however , the present invention also contemplates embodiments wherein the housing comprises natural porous filtering material , such as activated carbon , cotton , linen , gauze or the like . it has been found that when the housing is formed from a plastic or rubber - like material arid and the nose filter is inserted into the nostril , the housing 10 also aids in forcing the nasal passageway open , thus allowing more air to pass through the nose filter and into the sinus cavity . when the nose filters of the present invention are not in use , they may be kept in a convenient container filled with a saline or other aqueous solution to retain moisture of the filter component . it will also be understood that the size and shape of the nose filters of the present invention may be varied to accommodate noses of different sizes and shapes . while the specific embodiment has been illustrated and described , numerous modifications come to mind without markedly departing from the spirit of the invention . the scope of protection is only intended to be limited by the scope of the accompanying claims . the filtering membrane 30 may comprise a plurality of layers , each of a different filtering material , thereby allowing a plurality of filtering characteristics . in all of the embodiments of the present invention , any suitable material such as cotton , activated carbon or a cellulose material may be used to form the filtering membrane . however , in a preferred embodiment , the filtering membrane consists of an absorbent material , such as activated carbon . the filtering membrane may further be soaked in a saline solution , herbal or vitamin oil , medicant or any aqueous solution . for example , the nose filters of the present invention may be moistened with a nose drop spray , medicant or aqueous solution , even when the filter is inserted in the nostril . the nose filter may be operative for filtering dust , germs , allergic matter , or other foreign particulate from the air passing through the nostrils into the sinus cavity . it has been found that as the air passes through the filter , the air is also warmed before it reaches the sinus cavity and eventually the lungs . the nose filter can be designed to easily inserted and removed from the nostril , and which will conform to the shape of the nasal passageway without irritating the sensitive inner wall of the nostril . those skilled in the art will appreciate that the invention can be embodied in other forms and ways , without losing the scope of the invention . the embodiments described herein should be considered as illustrative and not restrictive .

US-57497906-A

a pair of gloves and the handle of a golf club include self - gripping tape which forms a tenacious bond when engaged . patches of such tape are located on inner surfaces of an end of each thumb of each glove , only at knuckles of at least three fingers of one glove , and only at knuckles of the second glove . additional coacting patches of such tape are located on the palm of the second glove at the base of the thumb , and on the back of the thumb of the first glove .

referring now to the drawings , and in particular fig1 and 2 , there is shown golf club gripping means 10 and 12 which includes golf gloves 16 and 18 . fig1 illustrates a glove 16 for a left hand which includes a portion covering a palm 20 a sheath 22 covering a thumb and individual sheath covering individual fingers 24 , 26 , 28 and 30 . fig2 illustrates a golf glove 18 for the right hand . it too includes a palm portion 32 , a sheath 34 covering a thumb and individual sheaths covering fingers 36 , 38 , 40 and 42 . the gloves are typically made of a soft leather which does not readily stiffen upon drying after being wet . gloves marketed by the wilson company would be suitable , for example . in accordance with an embodiment of the invention there is provided a bonding means on each of the gloves which cooperate with each other to provide a tenacious bond which tends to hold the gloves together . as shown in fig1 bonding means 44 includes a self - gripping tape 46 that is attached to an outer surface 48 of sheath 22 with the tape extending along the length of the sheath ; that is the length of the thumb . bonding means 48 includes individual tapes 50 , 52 , 54 , 56 and 58 attached to the inner surfaces of the sheaths for the thumb and individual fingers . the tapes are , as shown , circular spots which are located on the inner surface of the sheaths at the knuckles of the fingers and at the end of the thumb on the inner surface of its sheath . the tapes are also of the self - gripping type . referring to fig2 there is shown bonding means 60 and 62 that are carried by the right handed glove 18 . bonding means 60 includes a self - gripping tape 64 that is carried lengthwise in the palm portion 32 of the glove along the base of the thumb 34 . bonding means 62 includes circular self - gripping tapes 66 , 68 , 70 , and 71 located on the inner sheaths at the knuckles of the fingers and at the end of the thumb on the inner surface of its sheath . for reasons that will be apparent hereafter , there is no tape on the sheath for the little finger 36 . referring now to fig3 there is shown a portion of a golf club 72 which serves as the handle or grip 74 for the club . a bonding means 76 includes a self - gripping tape 78 which is wrapped around the grip 74 of the club . in the alternative the self - gripping tape could serve as the grip portion itself . the self - gripping tapes of the present invention are of the type marketed by velcro usa inc . of manchester , n . h . the self - gripping tapes are used on most if not all of the golf gloves used today as a means for aiding in securing the glove on the hand at the wrists as partially indicated at 65 , fig4 . such use does not form any part of the present invention . as will be described hereinafter the tapes work in pairs to effectuate a tenacious bond between the two . more specifically , one of the tapes has a surface which is composed of &# 34 ; hooks &# 34 ; while the other tape which is composed of &# 34 ; loops &# 34 ;. when the two surfaces are meshed together the loops intermesh with the hooks to provide a tenacious bonding . the tapes may be attached to the gloves and the club shaft by some suitable means such as by sewing , basting , or gluing for example . fig3 and 4 illustrates the use of the tapes to achieve and maintain a proper grip by a golfer on a golf club as the club is swung by the golfer . referring to fig3 the glove of fig1 for the left hand is shown being placed in proper location on the grip of the club shaft . in this illustration , the tape 78 on the golf club has the loop surface while the tapes 52 , 54 , 56 , and 58 have the hook surface . when the club is gripped as shown in fig4 a bond is made between the tapes to aid in maintaining a proper grip with respect to the fingers of the left hand . at the same time , when the thumb 22 is placed in position tape 50 becomes bonded with the grip 78 . also , tape 46 is placed in position to receive and form a bond with tape 64 when the right hand is laid over to complete the grip . since tape 78 has the hook surface the surfaces of tapes 52 , 54 , 56 and 58 will have loop surfaces . likewise on of the tapes of 46 or 64 will have a hook surface while the other will have a loop surface . further when the right hand is laid over to complete the grip and the finger of the right closed around the club shaft , a tenacious bond will be made between grip 78 and tapes 66 , 68 and 70 . there is no tape on the little finger 36 because of the overlapping of the finger with the left hand which is a grip common among golfers . it is apparent that when the hands are placed on the golf club with the tapes held in a proper position and mating each other , a proper golf grip is achieved and , due to the tenacious bond achieved by the cooperating tapes , the grip can be maintained during a golf swing . fig5 illustrates a tennis racquet or a racquet ball racquet 100 using a bonding means of the invention . the racquet includes a handle 102 having a grip 104 to which a self - gripping tape 106 of the invention is applied . then either the gloves of the left hand of fig1 having the tapes of 52 , 54 , 56 , and 58 or the glove of the right hand of fig2 having the tapes of 66 , 68 , 70 and 71 as well as a tape for the little finger 36 can be fitted over the handle to form a tenacious bond between the tapes and tape 106 . if desired both hands can be used together . referring to fig6 both the left or right handed gloves with their tapes can be used to grip baseball bat 108 to form a tenacious bond with a self - gripping tape 110 carried by the handle 112 of the bat . as illustrated in the present embodiments of the invention , the gripping means is described for a right handed player . the invention is also applicable for a left handed player with the locations of the tapes being reversed .

US-98890392-A

catheter device with an imaging device , in particular for optical coherence tomography , for insertion into a bifurcation region of a vessel of the human or animal body , comprising a main catheter with a balloon arranged thereupon and inflatable via a supply line , for the purpose of occluding the vessel proximal to the bifurcation , with a total of two further occlusion balloons for positioning in one of the two vascular branches in each case distal to the bifurcation being arranged on the main catheter and / or at least one auxiliary catheter , at a distance from the first balloon , such that they can be inflated for the distal occlusion of the respective vascular branch .

fig1 a shows a catheter device 1 according to the invention having a main catheter 2 and two auxiliary catheters 3 . the main catheter 2 comprises a balloon 4 , with which a vessel proximal to a bifurcation can be closed . the balloon 4 is shown inflated in the illustration . the two auxiliary catheters 3 issue through an opening 5 in the main catheter 2 , said auxiliary catheters 3 having for their part distal occlusion balloons 6 , with which the bifurcation branches can be closed . to this end , the auxiliary catheters 3 are inserted into the auxiliary branches of the bifurcation , at a specific angle to the main catheter 2 , said angle being predetermined by the vascular geometry . in addition , the opening 5 comprises a region , through which a rinsing agent can be introduced into the vessel . a low pressure occlusion of the vessel comprising a bifurcation is possible by means of balloons 4 and / or 6 . this enables an imaging for instance within the scope of optical coherence tomography without interference due to a retrograde blood flow from one or both of the vascular branches on the other side of the bifurcation . fig1 b shows a cross - section through an auxiliary catheter 3 in fig1 a . the auxiliary catheter additionally comprises a lumen 7 for filling the distal balloon 6 assigned to the auxiliary catheter 3 via a further lumen 8 , which is designed to accommodate an imaging catheter . a third lumen 9 is designed to accommodate a guide wire . the auxiliary catheter 3 is guided using monorail technology , in other words in an over - the - wire technology , in which only the distal catheter part is guided by the wire . a cross - section through the main catheter 2 can be seen in fig1 c . the main catheter 2 comprises a large lumen 10 for accommodating the two auxiliary catheters 3 . a second lumen 11 a is provided separately from the above , said lumen serving to introduce a rinsing agent into the intermediate region between the proximal and the distal balloons 4 and / or 6 . furthermore , the cross - section of the main catheter 2 shown here illustrates a third lumen 11 b , which is provided proximal to the proximal occlusion balloon and is used to supply a gaseous medium for inflating said proximal balloon . by using two auxiliary catheters 3 , each with their own distal occlusion balloon 6 , it is possible to optimally select the balloon diameter for each of the vascular branches , in order to achieve the desired occlusion . fig2 a shows a catheter device 12 according to the invention with a main catheter 13 and an auxiliary catheter 14 , with the main catheter 13 having a proximal balloon 15 and a distal balloon 16 , the occlusion balloons of which are both shown here in an inflated state . an opening 17 is provided between the proximal balloon 15 and the distal balloon 16 of the main catheter 13 , through which opening an auxiliary catheter 14 with its own distal balloon 18 can issue . the distal balloon 18 of the auxiliary catheter 14 for occluding a vascular branch is likewise shown in an inflated state . with the catheter device 12 shown here , the proximal balloon 15 and the distal balloon 16 of the main catheter 13 are approximately of the same size , whereas the distal balloon 18 of the auxiliary catheter 14 is inflated significantly less . accordingly , the illustrated catheter device 12 lends itself to use with bifurcations in which the main branch crosses over into a bifurcation branch of approximately the same size , whereas the second bifurcation branch is less developed , so that an occlusion can be achieved by means of the distal balloon 18 of the auxiliary catheter 14 . the backflow of blood and the retrograde reflux from the two vascular branches is prevented by blocking proximal to the bifurcation and distal in both bifurcation branches . fig2 b shows a cross - section through the auxiliary catheter 14 in fig2 a . in a central region , this comprises a lumen 19 for accommodating an imaging catheter , so that this can be advanced in a transparent region between the balloon 15 and / or 16 and 18 . furthermore , a lumen 20 is provided for guiding the auxiliary catheter 14 , which is designed as a monorail guide . a third lumen 21 of the auxiliary catheter 14 allows the supply of a gaseous medium for inflating the distal balloon 18 of the auxiliary catheter 14 . the main catheter 13 comprises the cross - section shown in fig2 c proximal to the first , proximal occlusion balloon 15 . the auxiliary catheter 14 is guided via a larger lumen 22 , whilst an essentially central lumen 23 for guiding an imaging catheter is again provided for optical coherence tomography for instance . the guiding is carried out via a lumen 24 by means of a guide wire using over - the - wire technology and / or as a monorail guide . in monorail technology , which represents one variant of over - the - wire technology , only the distal part of the balloon catheter is guided by the centrally arranged wire . with over - the - wire technology , the balloon is introduced using the guide wire as a guide rail . furthermore , the main catheter 13 has a lumen 25 for introducing a rinsing agent such as a gas and / or a fluid into the region between the proximal balloon 15 and the distal balloon 16 and 18 . the filling of the proximal balloon 15 as well as the distal balloon 16 is enabled with the aid of the lumen 26 , via which a gaseous medium to inflate the balloon 15 , 16 is filled . the balloons 15 , 16 can thus be filled at the same time , whereas rinsing of the vascular region lying therebetween is subsequently carried out via the lumen 25 , whereupon the distal balloon 18 of the auxiliary catheter 14 is inflated for occluding the remaining vascular branch . fig3 shows a pressure divider system 27 for a catheter device according to fig1 a . in this system , a pressure inlet opening 28 faced by three pressure outlet openings 29 is provided in the center , said three pressure outlet openings 29 each being assigned to the two auxiliary catheters and to the main catheter . the pressure outlet openings 29 of the main catheter and of an auxiliary catheter can be closed in each instance via valves 30 . a sequential occlusion of the individual balloons using just one pump is thus enabled . a pressure divider system 31 , which is shown in fig4 , is provided for a catheter device , according to fig2 a , which comprises a main catheter and an auxiliary catheter . here two pressure outlet openings 33 for the main catheter and / or the auxiliary catheter face the pressure inlet opening 32 . the second exit with the pressure outlet opening 33 for the auxiliary catheter can be switched on via a valve 34 , so that it is first possible to inflate the proximal and distal balloon of the main catheter and only then , after rinsing , to fill the distal balloon in the remaining side branch with gas in order to occlude said side branch . fig5 shows a flow diagram for a method according to the invention using a catheter device 1 according to fig1 a . in this way , in a step a 1 , the main catheter with an occlusion balloon is first positioned proximal to the bifurcation , whereupon in step a 2 , a first and second guide wire are arranged distal to the bifurcation in one of the two vascular branches of the bifurcation in each case . it is then possible in step a 3 , to position the two auxiliary catheters with their occlusion balloons distal to the bifurcation in one of the two vascular branches in each case . then the proximal occlusion balloon of the main catheter is inflated in step a 4 , and the imaging catheter is positioned distal to the proximal occlusion balloon . subsequently in a step a 5 , a rinsing agent such as carbon dioxide can be filled , and the distal occlusion balloon of the two auxiliary catheters can then be inflated . during the inflation , further rinsing is subsequently carried out , if necessary with a reduced volume . the production of image recordings using the imaging catheter is subsequently provided in step a 6 , for which purpose the main catheter and the auxiliary catheters in the regions in which the imaging is carried out , consist of a material which is transparent and suitable for this purpose . a flow diagram for a method according to the invention using a catheter device 12 according to fig2 a is shown in fig6 . in this way , a main catheter with two occlusion balloons is first positioned in step b 1 , one of said two occlusion balloons being arranged proximal and the other distal to the bifurcation . in step b 2 , an auxiliary catheter with an occlusion balloon is then positioned distal to the bifurcation in the other vascular branch , for which purpose the main catheter comprises a corresponding opening out of which the main catheter can issue . in step b 3 , the imaging catheter for the imaging method is positioned distal to the proximal occlusion balloon of the main catheter . in step b 4 , the proximal distal occlusion balloon of the main catheter is inflated , with this being able to be carried out if necessary prior to positioning the imaging catheter . a rinsing agent is injected and / or filled in step b 5 only after the occlusion balloons of the main catheter are inflated , in order to allow the blood and / or a mixture of blood and fluid to flow out of the vascular branch which is still open . in step b 6 , the desired image recordings are finally produced using the imaging catheter , said image recordings being able to be produced with a good image quality , despite a reduced quantity of the introduced rinsing agent , by preventing the retrograde blood flow from flowing out of the side branch .

US-51614206-A

an improved container comprising a frame and a flexible receptacle secured thereto includes bracket or hook means for being secured substantially entirely within the space between opposite leg members in a walker .

in fig1 there is illustrated a first embodiment of the invention in which a carrier 10 is removably secured on a walker . the walker shown is of the folding - type so that it can be collapsed and more easily handled and stored when not in use , well known to those skilled in the art . the walker includes two opposite leg members 12 and 14 separated to form a space in which the user may position his or her body , especially when standing . it will be understood that the front of the walker viewed in fig1 is closed with brace members 15 and 30 extending between the respective leg members to which they are secured for structurally stabilizing the walker . however , such braces are not present on the opposite back side of the walker so that it is open , so that the user can step into the space between the leg members . each leg - member is composed of two legs , leg member 12 having a pair of legs 11 and 18 and leg member 14 comprising legs 13 and 16 , respectively . the leg members themselves are also structurally supported by brace members , such members 24 and 35 secured to and extending between legs 13 and 16 and brace members 26 and 33 between legs 11 and 18 . brace members 15 and 30 are secured between two slidable sleeves 31 for supporting the walker in the open or folded position . slotted brackets 39 secured between upper brace members 26 ( 24 ) and brace member 30 also assist to selectively support the walker in an open position . handles 20 and 22 are located at the top ends of the pairs of legs , which handles normally have grips , as shown , so that the user may conveniently hold on to the handles for support when the walker is used . the carrier of the invention is removably secured in the space between the leg members 12 and 14 . as illustrated in fig1 the carrier comprises a receptacle 37 , preferably made of a fabric or plastic material , which is flexible and somewhat soft to avoid sharp edges or corners which could cause discomfort or otherwise injure the user . moreover , such materials are lightweight and relatively easy to work with in assembling the carrier . referring also to fig5 and 6 , a rigid frame includes a pair of hooks 34 and 36 for being secured over brace member 30 and slotted brackets 39 at the front of the walker . the frame to which the soft and flexible receptacle is secured is generally rectangular and includes a pair of shorter side frame members 66 and 68 and opposite longer frame members 62 and 64 , these frame members being attached to each other at their adjacent ends . receptacle 37 in being secured to such a frame has a front , back , sides and a bottom as illustrated , and preferably a cover 38 which is hinged along one of the longer side edges 32 so that the articles placed inside the container are well protected , as well as being hidden . such a cover may be a separate piece or an extended portion of the front of the receptacle . the number of individual pieces of material used to form the receptacle is not critical . preferably , the width of the frame is such that it will extend substantially across the space between the leg members , and the depth of the carrier , which corresponds generally to the length of the shorter side frame members 66 and 68 , will not take up all of the room in the space between the leg members . thus , for example the width of the carrier may be between about 16 &# 34 ; and about 18 &# 34 ; whereas the length may suitably be between about 5 &# 34 ; and about 8 &# 39 ;. the depth of the receptacle itself is not critical and any convenient size of receptacle may be selected , normally between about 3 - 6 &# 34 ; useful for most purposes . in the frame shown in fig5 the shape of frame member 62 simply accommodates the additional space afforded by the shape of brace member 30 . otherwise a rectangular frame shape for the carrier is quite suitable . with the carrier embodiment shown in fig1 , and 6 , even though it is supported in the walker with only two hooks 34 and 36 secured on brace member 30 , the carrier will also rest against brace member 15 so that it does not extend outside of the space between the leg members thereby affording the weight distribution advantage of the invention . in fig2 there is illustrated a second embodiment of the carrier of the invention utilized with a rigid walker , the figure being viewed from the back to show the full opening of the space between the leg members . in the walker of fig2 brace members 15 and 30 which are at the back of the walker , are not hinged . the carrier and the frame which is shown in fig3 and 4 , comprises a rectangular frame with opposite long frame members 55 and 57 to which are secured short frame members 51 and 53 , again adjacent the ends thereof . at the ends of each of the elongated frame members 55 and 57 are hooks 52 and 58 , and 54 and 56 , respectively , which are preferably of the type illustrated in fig4 . such hooks , rather than having a return , are right angle bends illustrated in fig4 . in this manner , the hooks of the frame can simply be placed over the two opposite brace members 24 and 26 . the receptacle , other than any change of shape due to the shape of the frame is identical between the two embodiments shown , within the descriptions of materials and dimensions as set forth hereinabove . again , the second embodiment illustrated in fig2 - 4 also is substantially entirely located within the space between the leg members , and does not extend outwardly therefrom to achieve the same advantage and efficiency of weight distribution . these as well as other features and embodiments within the scope of the invention disclosed herein will be evident to those skilled in the art .

US-3463087-A

the present application describes a composition for blood glucose control containing green tea extracts with gallated catechins and macromolecule to prevent the intestinal absorption of gc .

in the present application , “ a ” and “ an ” are used to refer to both single and a plurality of objects . as used herein , “ carriers ” include pharmaceutically acceptable carriers , excipients , or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed . often the pharmaceutically acceptable carrier is an aqueous ph buffered solution . examples of pharmaceutically acceptable carriers include without limitation buffers such as phosphate , citrate , and other organic acids ; antioxidants including ascorbic acid ; low molecular weight ( less than about 10 residues ) polypeptide ; proteins , such as serum albumin , gelatin , or immunoglobulins ; hydrophilic polymers such as polyvinylpyrrolidone ; amino acids such as glycine , glutamine , asparagine , arginine or lysine ; monosaccharides , disaccharides , and other carbohydrates including glucose , mannose , or dextrins ; chelating agents such as edta ; sugar alcohols such as mannitol or sorbitol ; salt - forming counterions such as sodium ; and / or nonionic surfactants such as tween ®, polyethylene glycol ( peg ), and pluronics ®. as used herein , “ effective amount ” is an amount sufficient to effect beneficial or desired clinical or biochemical results . an effective amount can be administered one or more times . for purposes of this invention , an effective amount of an inhibitor compound is an amount that is sufficient to palliate , ameliorate , stabilize , reverse , slow or delay the progression of the disease state . as used herein , “ mammal ” for purposes of treatment refers to any animal classified as a mammal , including humans , domestic and farm animals , and zoo , sports , or pet animals , such as dogs , cats , cattle , horses , sheep , pigs , and so on . preferably , the mammal is human . as used herein “ pharmaceutically acceptable carrier and / or diluent ” includes any and all solvents , dispersion media , coatings antibacterial and antifungal agents , isotonic and absorption delaying agents and the like . the use of such media and agents for pharmaceutical active substances is well known in the art . except insofar as any conventional media or agent is incompatible with the active ingredient , use thereof in the therapeutic compositions is contemplated . supplementary active ingredients can also be incorporated into the compositions . it is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage . dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated ; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier . the specification for the dosage unit forms of the invention are dictated by and directly dependent on ( a ) the unique characteristics of the active material and the particular therapeutic effect to be achieved , and ( b ) the limitations inherent in the art of compounding such an active material for the treatment of disease in living subjects having a diseased condition in which bodily health is impaired . the principal active ingredient is compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form . a unit dosage form can , for example , contain the principal active compound in amounts ranging from 0 . 5 μg to about 2000 mg . expressed in proportions , the active compound is generally present in from about 0 . 5 μg / ml of carrier . in the case of compositions containing supplementary active ingredients , the dosages are determined by reference to the usual dose and manner of administration of the said ingredients . the method to manufacture the compositions with blood glucose lowering effect as to this invention contains the step to extract gc , which possesses at least one of either egcg or ecg , from green tea ; the step of mixing the gc - containing extract solution or powder with at least one of polyglycol ( pg ), such as polyethylene glycol ( peg ), peg derivatives ( e . g ., peg - alkyl , peg - dialkyl , peg - ester , peg - diester , etc ), peg copolymer ( e . g ., peg - ppg , peg - ppg - peg ( poloxamer , pluronic )), water - soluble copolymer ( e . g ., polyvinyl pyrrolidine etc ), or macromolecules to selectively bind gc . the above compositions can also be manufactured by mixing pg with gc which is commercially concentrated and available . the above compositions contain gc at concentrations between 10 - 2000 mg and pg ( 0 . 01 - 50 g / ggc ). the molecular weight of the above pg is 100 - 2 , 000 , 000 daltons , more appropriately 500 - 100 , 000 daltons , the most appropriately , 1 , 000 to 80 , 000 , 1 , 000 - 50 , 000 daltons , or 1 , 000 to 8 , 000 daltons as it is better to be ingested without discomfort and control blood glucose . according to requested physical properties and nature , the chemical structure of used pg can be various pg derivatives with one or two substitution ; c1 - c6 alkyl , aryl , acetyl , acetyl substituted for c1 - c6alkyl or aryl , sulfone substituted for c1 - c6alkyl or aryl on the terminus of pg . 1 . step for filtering the extract solution obtained by boiled water extraction of dry leaves ; 2 . step for obtaining powder by lyophilizing the above extract solution ; and 3 . step for purification of gc or its fraction by column chromatography , after dissolving the powder with distilled water . to describe the details of the above steps , in step 1 , green tea leaves were added to hot water ( 80 - 95 ° c ., 10 - 50 times of leaves weight ), stirred gently for 5 min - 1 hour for extraction and filtered . in step 2 , the powder containing polyphenols of green tea was obtained by lyophilizing the above extract solution . in step 3 , to purify and obtain polyphenol chemicals in the powder , column chromatography was performed . this invention employed high porosity polystyrene gel column chromatography ( particle size , 75 - 150 μm , diaion hp - 20 , mitsubishi kagaku co ., japan ; column , 25 φ × 1 , 000 mm ). at this time , the extraction solvent was 100 ml methanol : h 2 o ( 1 : 5 ), and the extract was extracted once more with 100 ml methanol : h 2 o ( 2 : 5 ). the flow rate was 5 ml / min when the components of green tea polyphenol compounds obtained by the above method were analyzed , gallocatechin and epigallocatechin were harvested in fraction 1 . in fraction 2 , catechin , epicatechin , gallocatechin gallate and egcg were detected . in fraction 3 , ecg was collected . according to this invention , gc contained in manufactured compositions inhibits the activity of sglt ( sodium - dependent glucose transporter ) in the intestinal lumen and thus suppresses intestinal glucose absorption . it has fewer side effects than now available hypoglycemic drug to inhibit amylase activity . in addition , the intestinal absorption of gc itself , which increases blood glucose in the circulation , can be suppressed by co - administered polyglycol ( pg ). therefore , this invention , by decreasing postprandial blood glucose levels , may offer diabetic prevention of normal individuals , inhibition of diabetic progression of individuals predisposed to diabetes , and relief of diabetic complications of diabetic patients . the gc - contained compositions of this invention are applied orally with commercially available types . they can be applied before or during a meal , but preferably to be applied just before a meal . because the gc - contained compositions of this invention are natural bioactive materials extracted from natural green tea and not absorbed into the circulation , when orally applied in animals and humans , they are safe without side effects and acute toxicity . therefore , this invention offers food or functional healthy food , containing gc and pg , to control postprandial blood glucose . according to this invention , in the case of manufacturing as a pharmaceutical agent , gc and pg can be mixed and formed with commercially and pharmaceutically available material to make tablets , rigid or soft capsules , chewing tablets , powder , liquid or immersion on the purpose of oral ingestion . in the formation of tablets , rigid or soft capsules , chewing tablets , powder , liquid or immersion as an orally applicable material using the compositions , it can contain arabian gum , corn starch , bonding material like fine grain cellulose or gellatin , vehicle like calcium phosphate or lactose , disintegrator like alginic acid , corn starch or potato starch , lubricant like stearic acid magnesium , sweetener like sucrose or saccharine , and flavor like methyl salicylate or fruits flavor . in the case of capsule , it can contain liquid materials like fat oil in addition to the above materials . potentially all supplementary materials can be mixed and used for the formation of orally applicable materials with gc and pg , if they are pharmaceutically pure , substantially non - toxic , and do not affect the action of bioactive materials . in this invention , the dose for achieving the effect as a blood glucose controller can be determined by doctors with the consideration in the type of diseases , disease severity , gender , age , body weight , health status , application type , application frequency and time , the presence of combinatorial drugs , and other related environment . this pharmacological drug in this invention , which contains gc and pg ( 0 . 01 - 50 gram gc ), in the case of oral ingestion , 0 . 5 - 100 mg egcg , ecg or its mixed compounds per kg body weight , more appropriately 1 - 50 mg , can be applied once or several times a day , more appropriately 1 - 3 times a day , just before , during , or just after a meal . gc and pg in this invention can be manufactured for a supplementary material of commercial beverages , mineral water , alcoholic beverages , chewing gum , caramel , candy , ice cream , and cookies . in addition , it can be applied in healthy food or food supplements with vitamins and minerals in order to lower postprandial blood glucose . the present study has revealed that gc of green tea , such as egcg and ecg , acutely reduces blood glucose levels mainly through its activities in the alimentary tract while increases the glucose level when gc is in the circulation ( fig8 for summary ). although green tea polyphenols have been reported to inhibit intestinal sucrase and α - amylase activity as well , gc may not be the major inhibitor because the inhibitory effect of green tea was weaker than that of black tea which has smaller amount of gc ( 19 ). the intestinal glucose uptake is mediated by sglt1 , and gte or gc has been found to be a competitive inhibitor of sglt1 of human intestinal epithelial cells ( 9 , 20 ). in the present study , the blood glucose uptake into metabolically - important cells was also inhibited in the presence of egcg . the inhibitory effect of gc on cellular glucose transporters has been previously observed in mouse adipocytes ( 21 ), rat adipocytes ( 22 ) and human erythrocytes ( 7 ). hence , one may speculate that gc might hinder the action of various glucose transporters in the body , including the na - glucose co - transporters as well as the na - independent glucose transporters . therefore , gc in the alimentary tract may be helpful in controlling diabetes and obesity by decreasing glucose entry into the circulation ( 23 ), but it may be harmful in the circulation . these ambivalent effects of gc in the two compartments may confound attempts to evaluate their precise role in the blood glucose control . we further observed an acute insulin resistance either by circulating egcg alone or more prominently by circulating gte . the latter amplification may be due to the other constituents , such as ecg and gallic acid , which may exert additional effects , or may be due to the delayed catabolism of egcg in the presence of other green tea components ( 16 ). therefore , it is expected that the accumulation of glucose in the circulation caused by green tea catechins may induce insulin hypersecretion . it is not surprising that long - term beta - cell overload represents a detrimental consequence that leads to eventual beta - cell impairment . in the present study , gte was effective at blood egcg concentrations of 1 - 2 μm , which is readily achievable by daily oral administration of green tea ( 24 ). experiments that use rats are more likely to overlook this circulating effect , because rats have a much lower oral bioavailability of egcg ( 15 , 16 ). to clarify the effect of circulating gte , we employed long - time ogtt in humans , who have the relatively higher oral bioavailability of egcg than rats , and found that gte hindered return of the glucose level to the control value . an in vivo report which examined the circulating egcg effect within a concentration range applicable to human showed that relatively long - term intraperitoneal egcg application led to weight loss in rats ( 17 ). however , they found significant deterioration in the sexual organs . it may be probably due to egcg inhibition of glucose uptake in the androgen - producing leidig cells ( 7 ). a recent investigation ( 7 ) revealed that 100 nm ecg competed with glucose for binding to glucose transporter type 1 in red blood cells , such that the reaction rate was half its maximal value . the same effect was attained with 1 μm egcg . in this regard , it may be supposed that the decreasing effects on hepatic gluconeogenesis induced by egcg might be partly due to the egcg - mediated inhibition of hepatic glucose uptake ( 7 , 25 ). in addition , the beneficial effects of egcg in treatment of some cancers may be , at least partly , due to the glucose deprivation effect that egcg may inflict on cancer cells which are more metabolically active and glycolytic - dependent than normal cells ( 26 ). other polyphenols , such as quercetin and myricetin , seem to have relatively broader safety margins because they inhibit cellular glucose uptake around 10 μm ( 27 ). the efforts to manage type 2 diabetes and obesity by natural green tea treatment appear to be cautious because systemically - absorbed gc actually blocks cellular glucose uptake and thereby increases blood glucose and insulin levels . moderate green tea intake ( 1 - 2 cups per day ) during a meal may be beneficial since the gc entering the circulation will be minimal , but its long - term effect may likely be limited to a certain category of the population ( 28 ). many trials have measured the ability of natural products to inhibit intestinal glucose absorption . however , none of these trials have explored the use of non - absorbable , gc - derived inhibitors of glucose and lipid absorption . maximizing the positive effect of gc in the intestinal lumen , while minimizing the negative effect in the circulation , would be recommended to control those metabolic diseases . the present invention is not to be limited in scope by the specific embodiments described herein . indeed , various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures . such modifications are intended to fall within the scope of the appended claims . the following examples are offered by way of illustration of the present invention , and not by way of limitation . dulbecco &# 39 ; s modified eagle &# 39 ; s medium ( dmem ), phosphate - buffered saline ( pbs ), fetal bovine serum ( fbs ) and fetal calf serum ( fcs ) were purchased from gibco ( carlsbad , calif .). rpmi - 1640 medium was purchased from welgene ( daegu , korea ). polyethylene glycol ( peg ; novasyn tg hydroxy resin ) was delivered from novabiochem ( darmstadt , germany ) for animal study . peg for human study was kindly gifted from taejoon ( seoul , korea ). green tea leaves ( bosung seijak ) were purchased from bosung green tea co . ( jeonnam , korea ). epigallocatechin - 3 - gallate ( egcg ), epicatechin - 3 - gallate ( ecg ), epigallocatechin ( egc ) and epicatechin ( ec ) were purchased from sigma - aldrich ( st . louis , mo .). all other chemicals were obtained from sigma - aldrich . rat l6 myoblasts were cultured in low - glucose dmem with 10 % ( v / v ) fbs until they reached 80 % confluency . to induce differentiation , cells were further cultured in dmem ( 24 . 9 mm glucose ) containing 2 % fbs for 7 days . cell viability was assessed by the trypan blue viability test . myogenic differentiation to myotube status was evaluated both morphologically and biochemically . mouse 3t3 - l1 preadipocytes were grown to confluence at 37 ° c . in 35 - mm culture dishes in dmem containing 10 % fcs with no added biotin or pantothenate in incubators equilibrated with 5 % co 2 . at two days post - confluence ( day 0 ), differentiation was induced with methylisobutylxanthine ( 0 . 5 mm ), dexamethasone ( 0 . 5 μm ) and insulin ( 5 μg / ml ) in dmem containing 10 % fbs . on day 2 , methylisobutylxanthine and dexamethasone were removed and insulin treatment was continued for 2 additional days . on day 4 and thereafter , dmem ( without insulin supplementation ) plus 10 % fbs was replaced every 2 days . cells ( 2 × 10 6 cells / dish ) were used for experiments on day 8 . cell differentiation was evaluated by the oil red - 0 staining human hepatocellular carcinoma hepg2 cell line was maintained in dmem containing 10 % fbs at 37 ° c . rat insulin - secreting ins - 1 cells were grown in rpmi - 1640 media supplemented with 10 % fbs , 10 mm n -( 2 - hydroxyethyl ) piperazine - n ′-( 2 - ethanesulfonic acid ) ( hepes ), 1 mm sodium pyruvate , 50 mm 2 - mercaptoethanol , 100 iu / ml penicillin , and 100 mg / ml streptomycin . for animal studies , 20 g of green tea leaves were added to 1 , 000 ml of nanopure water . after being stirred for 5 min at 80 ° c ., the tea leaves were removed by filtration using filter paper ( advantec 2 filter paper , hyundai micro co ., seoul , korea ) under reduced pressure . the extract was dried by lyophilization . ( a total of 3 g of gte was harvested , in which egcg , ecg , egc and ec were ˜ 100 , 53 , 56 and 31 mg / g gte , respectively ). an equal amount of the gte solution was mixed with 2 g peg bead for 5 min at room temperature . after filtration , the supernatant was lyophilized ( egcg , ecg , egc and ec were ˜ 26 , 14 , 42 and 25 mg / g gte , respectively ) to obtain gc - deficient gte ( gte - gc ). the results indicated that the resin pretreatment preferentially reduced gc from the gte solution . for the human study , 30 g of green tea leaves were added to 500 ml of nanopure water . after being stirred for 3 min at 80 ° c ., tea leaves were removed by filtration , remaining a 350 ml solution , which contained ˜ 500 mg of egcg . healthy male volunteers aged 20 - 29 with no family history of diabetes and no insulin resistance judged by homa index were randomly chosen and fasted overnight before the experiments began . first , individuals who exhibited fasting blood glucose level greater than 100 mg / dl were excluded . at 9 : 00 am , each individual orally consumed 350 ml of water only ( control ), or 350 ml of gte solution containing 125 mg , 250 mg or 500 mg of egcg , immediately before or 1 - h before ingestion of 150 - ml water containing 75 g of glucose . another group of subjects ingested peg ( 110 mg / 100 mg egcg ) with the gte solution . after blood had been collected through an angiocatheter inserted into a forearm vein , blood glucose and plasma insulin levels were measured at the indicated times . blood glucose levels were measured using the glucocard test strip ii ( arkray inc ., kyoto , japan ). plasma insulin levels were measured using an immunoradiometric kit ( insulin myria , techno genetics , sesto , italy ). before the study began , its purpose and risks were carefully explained , and written informed consent was obtained from all participants . the protocol was approved by the irb keimyung university ethics committee , daegu , korea , regulating human research . sprague - dawley rats were provided by hyochang science co . ( seoul , korea ). after a 12 - h fast , rats were anesthetized using pentobarbital sodium ( 40 mg / kg , i . p . ; nembutal , 50 mg / ml , hanlim pharmaceutical co ., seoul , korea ) and then injected with one of the epicatechins : egcg , egc , ecg , and ec ( each 10 mg / kg in 300 μl pbs , i . v .). ec was dissolved in a minute amount of dmso in advance before addition of pbs . in another experiment , rats were randomly divided into 3 groups : control , gte and gte - gc . the rats in the gte group were injected with natural gte ( 100 mg / kg in 300 μl pbs , i . v . ; 10 mg / kg as egcg ) through the tail vein , while the control rats were injected with only 300 μl pbs and rats in the gte - gc group were given an equal amount of gc - deficient gte ( 100 mg / kg in 300 μl pbs , i . v . ; 2 . 6 mg / kg as egcg ). thirty minutes after the injection , glucose ( 2 . 0 g / kg in 600 μl distilled water , i . p .) was injected . for ogtt , the rats were ingested with 1 - ml distilled water only ( control ), or 1 - ml distilled water containing one of natural gte ( 900 mg / kg ), gc - deficient gte ( 900 mg / kg ), egcg ( 90 mg / kg ), natural gte plus peg ( 110 mg / 100 mg egcg ) or peg alone immediately after the ingestion , each rat was orally given 1 - ml distilled water containing glucose ( 2 g / kg ). for the assay of blood glucose levels , blood was drawn from the tail vein at the indicated times . all the experiments were approved by the keimyung university institutional ethics committee , daegu , korea for supervising animal research . kir6 . 2 knock - out ( k / o ) mice were kindly provided by prof . susumu seino at kobe university in japan . following a 4 - h fast , kir6 . 2 k / o mice or normal rats were intravenously injected with pbs ( 100 μl for mouse , 300 μl for rat ) only , or pbs containing egcg ( 10 mg / kg ), natural gte ( 100 mg / kg ) or gc - deficient gte ( 100 mg / kg ). thirty minutes after the injection , the mice and rats were injected intraperitoneally with normal saline ( 300 μl for mouse , 600 μl for rat ) containing insulin ( 1 iu / kg ; insulin lispro , eli lilly , ind .). blood samplings were done through the tail vein at the indicated times . briefly , after serum starvation for 30 min , the cells were washed with krebs - ringer phosphate - hepes buffer [ krph buffer : 10 mm phosphate buffer , ph 7 . 4 ; 1 mm mgso 4 , 1 mm cacl 2 , 136 mm nacl , 4 . 7 mm kcl , and 10 mm hepes , ph 7 . 6 ] and then incubated with or without 100 nm insulin for 20 min in krph buffer that contained egcg ( 0 , 0 . 1 , 1 . 0 or 10 μm ). glucose transport was determined by the addition of 2 - deoxy -[ 3 h ] glucose ( 0 . 1 mm , 0 . 5 μci / ml ; perkinelmer life and analytical science , waltham , mass .). after 10 min of incubation , the reaction was stopped by three quick washes with ice - cold pbs . the cells were then lysed in pbs containing 0 . 2 m naoh , and glucose uptake was assessed by scintillation counting . to determine the effect of egcg on the activity of protein kinase b ( pkb ), the phosphorylation status of pkb was examined after exposure of l6 , ins - 1 , hepg2 and 3t3l - 1 cells to media containing different concentrations of egcg and insulin . as in the 2 - deoxyglucose uptake assay , experimental cells were exposed to media without glucose for 30 min and then incubated with or without 100 nm insulin for 20 min in krph that contained egcg ( 0 , 0 . 1 , 1 . 0 or 10 μm ). after an additional 10 min of incubation with 5 mm glucose , the reaction was stopped by three quick washes with ice - cold pbs . total cellular proteins were extracted in lysis buffer ( 10 mm tris - cl ( ph 7 . 4 ), 130 mm nacl , 5 % ( v / v ) triton x - 100 , 5 mm edta , 200 nm aprotinin , 20 mm leupeptin , 50 mm phenanthroline , 280 mm benzamidine - hcl ) for 20 min at 4 ° c . lysates were separated by sds - page and electrotransferred to an immobilion - p membrane ( millipore , billerica , mass .). after probing with specific antibodies [ anti - phospho - pkb ( ser473 ) antibody ( cell signaling technology , danvers , mass . ), and anti - β - actin antibody ( sigma )], the immunoreactive bands were visualized with horseradish peroxidase - conjugated secondary antibody ( 1 : 5 , 000 ; santa cruz , calif .) using enhanced chemiluminescence ( amersham biosciences , little chalfont , uk ). hplc analysis was conducted on a waters alliance 2695 liquid chromatograph equipped with a model 2487 dual absorbance detector ( waters co ., milford , mass .). a waters symmetry c18 reversed - phase packing column ( 4 . 5 mm × 250 mm , 5 μm ) was used at 25 ° c . for separation throughout this study . catechins were determined simultaneously at 235 nm . a gradient elution was performed by varying the proportion of solvent a ( water - trifluoroacetic acid , 99 . 9 : 0 . 1 v / v ) to solvent b ( acetonitrile - trifluoroacetic acid , 99 . 9 : 0 . 1 v / v ), with a flow rate of 1 ml / min . the mobile phase composition changed linearly from 9 . 5 % to 14 % solvent b in 10 min and then kept the same composition for 10 min , followed by a linear increase of solvent b to 27 . 5 % within 15 min . the mobile phase composition was then brought back to the initial conditions over a period of 5 min for the next run . all the prepared solutions were filtered through 0 . 45 μm membranes ( sartorius , maisemore , uk ), and the mobile phase was degassed before injection into the hplc . the results are expressed as mean ± sem . the spss ( release 14 . 0 ) software package ( spss inc ., chicago , ill .) was used for the statistical analyses . area under the curve was calculated by using microcal origin software ( version 7 . 0 ; northampton , mass .). comparisons between two groups were performed with the student &# 39 ; s two - tailed t - test for paired or unpaired data . for comparisons of more than two groups , significance was tested using an analysis of variance ( anova ) with bonferroni correction to deal with relatively small amounts of samples . differences between groups were considered significant when p & lt ; 0 . 05 . effect of gte intake on blood glucose and plasma insulin levels during human ogtt the results of ogtt that had been performed with healthy male volunteers showed that the effects of gte intake on glucose tolerance were changed depending on the time lag between gte and glucose administration . orally - administered gte maintained blood glucose levels lower than the control during ogtt when glucose was taken immediately after gte administration ( fig1 a ). this effect is the same with the previously reported results ( 14 ). the lowering effect of gte on blood glucose levels during ogtt was reversed when it was administered 1 h earlier than the administration of glucose ( fig1 c ). the blood glucose level was significantly higher in the gte group than in the control 60 min after glucose loading ( p & lt ; 0 . 01 ). the 1 - h interval between gte and glucose intake was chosen because the blood concentrations of tea ingredients , especially catechins , were known to peak between 1 - 2 h after gte ingestion ( 4 , 15 ). interestingly , plasma insulin levels were also significantly ( p & lt ; 0 . 05 ) higher in the gte group at the 60 min ( fig1 d ), implying that the higher blood glucose levels may induce a higher rate of insulin secretion . egcg and ecg of tea catechins are critical for glucose intolerance to clarify which gte components were responsible for the abnormal ogtt in humans , ipgtt was performed with rat ( fig2 ). since epicatechins were studied intensively for its role in glucose tolerance , egcg , ecg , egc and ec were used for ipgtt . each catechin was injected in rats 30 min before glucose administration . the amount of egcg injected ( 10 mg / kg , i . v .) was chosen to achieve its blood concentrations around 1 μm at 30 min after injection ( 16 , 17 ). same amount of other catechins was used even though they had different pharmacokinetic profiles ( 10 ). egcg and ecg caused more elevated blood glucose levels 30 min after glucose loading compared to control ( p & lt ; 0 . 01 ) while ec and egc had no effects . this result suggested that the effect of gte on glucose intolerance was mainly due to the two gc , egcg and ecg . since the amount of egcg in water - soluble gte was about 2 - 3 times higher than ecg ( 18 ), further studies were performed with egcg as a representative of gc . the dose dependencies of basal and insulin - stimulated glucose uptake on egcg were evaluated with metabolically - important cells including beta cells ( fig3 ). both basal and insulin - stimulated glucose uptake were decreased by egcg dose - dependently for all egcg - pretreated cells . also , in the tested cell lines up to 10 μm egcg , egcg did not alter the basal and insulin - regulated expression of phospho - pkb ( fig4 ). the possibility of association between egcg - mediated glucose intolerance and atp - sensitive potassium ( k atp ) channels , which modulate peripheral insulin resistance as well as beta - cell insulin secretion , was examined normal rats and kir6 . 2 k / o mice were fasted for 4 h before egcg injection . the significant elevation of blood glucose levels in both normal rats and kir6 . 2 k / o mice were found 30 min after the egcg injection ( p & lt ; 0 . 01 ; fig5 a , b ). this result suggests that the egcg - induced change in blood glucose level was not mediated through a mechanism involving k atp channels . when treated with insulin , the rate of blood glucose disappearance was delayed mildly but significantly in egcg - pretreated rats and kir6 . 2 k / o mice ( p & lt ; 0 . 01 ; fig5 c , d ). gte injection with 4 - h fasted rats caused significant elevation of blood glucose levels ( p & lt ; 0 . 05 ; fig6 a ), which was similar finding to the injection with egcg alone in fig5 a , while gc - deficient gte injection did not ( p = 0 . 114 ). itt revealed remarkable insulin resistance in the gte group ( p & lt ; 0 . 01 at the 20 min ), whereas significant amelioration of insulin resistance was observed in the gte - gc group ( fig6 b ). rats in another experiment were fasted for 12 h , not 4 h , to minimize elevation of blood glucose level by gte itself . then they were injected intravenously with pbs alone , or with pbs containing either natural gte or gc - deficient gte 30 min before glucose loading . as shown in fig6 c , blood glucose levels in the gte - treated group during ipgtt were remarkably higher than those in the pbs control ( p & lt ; 0 . 01 at 10 and 20 min ), while the gte - gc group showed similar glucose levels to the control . the effects on glucose absorption into the circulation of gc within the gastrointestinal tract were evaluated by rat ogtt . it was performed by oral intake of gte immediately followed by glucose ingestion ( fig6 d ). expectedly , the blood glucose levels were maintained during ogtt at a lower level in the gte - administered group than in the control group that ingested only pbs . the gc - deficient gte - or egcg - administered group appeared to inhibit glucose absorption less efficiently than in the gte - treated group , indicating that gc is also critical for the effect of gte on blockade of glucose absorption in the intestinal lumen . on the assumption that the resin peg selectively inhibits the intestinal absorption of gc of gte , natural gte was ingested along with peg . during rat ogtt immediately following the ingestion , blood glucose levels were significantly lower in the gte + peg group than in the control ( p & lt ; 0 . 05 ), comparable to the group with gte alone ( fig7 a ). there was no difference between the control group and the peg - alone - treated group in blood glucose levels , indicating that peg itself did not affect glucose absorption or intestinal motility at the range of concentrations used . the time for human ogtt was extended to 3 h observing the effect of circulating gc on basal blood glucose levels ( fig7 b ). although the blood glucose levels in the gte group during the earlier period of ogtt appeared to be lower than in the control , they during the later period of ogtt were significantly higher than in the control , which was not observed in the gte + peg group . when human ogtt was conducted 1 h after gte + peg ingestion , blood glucose and plasma insulin levels were also normalized in contrast to the gte group , which showed significant elevation of the glucose and insulin levels ( fig7 c , d ). for animal studies , 20 g of green tea leaves were added to 1 , 000 ml of nanopure water . after being stirred for 5 min at 80 ° c ., the tea leaves were removed by filtration using filter paper ( advantec 2 filter paper , hyundai micro co ., seoul , korea ) under reduced pressure . the extract was dried by lyophilization . ( a total of 3 g of gte was harvested , in which egcg , ecg , egc and ec were ˜ 100 , 53 , 56 and 31 mg / g gte , respectively ) after example 3 , an equal amount of the gte solution was mixed with 2 g peg ( 3 , 000 - 4 , 000 ) bead for 5 min at room temperature . after filtration , the supernatant was lyophilized ( egcg , ecg , egc and ec were ˜ 26 , 14 , 42 and 25 mg / g gte , respectively ) to obtain gc - deficient gte ( gte - gc ). the results indicated that the resin pretreatment preferentially reduced gc from the gte solution . for the human study , 30 g of green tea leaves were added to 500 ml of nanopure water . after being stirred for 3 min at 80 ° c ., tea leaves were removed by filtration , remaining a 350 ml solution , which contained ˜ 500 mg of egcg and ˜ 260 mg of ecg . a tablet containing 50 mg of egcg , ecg or its mixed form ; 50 mg peg ( 4 , 000 ); 20 mg starch ; adequate amount of stearic acid magnesium can be made as a blood glucose controller , according to general instruction for tablet production . a capsule filled with 50 mg of egcg , ecg or its mixed form ; 50 mg peg ( 4 , 000 ); 19 mg starch ; 1 mg talc ; adequate amount of stearic acid magnesium can be made as a blood glucose controller , according to general instruction for capsule production . a granule can also be made as a blood glucose controller , according to general instruction for granule production . all of the references cited herein are incorporated by reference in their entirety . those skilled in the art will recognize , or be able to ascertain using no more than routine experimentation , many equivalents to the specific embodiments of the invention specifically described herein . such equivalents are intended to be encompassed in the scope of the claims 1 . bonora e . protection of pancreatic beta - cells : is it feasible ? nutr metab cardiovasc dis 2008 ; 18 : 74 - 83 . 2 . jiang m h , fei j , lan m s , et al . hypermethylation of hepatic gck promoter in ageing rats contributes to diabetogenic potential . diabetologia 2008 ; 51 : 1525 - 1533 . 3 . lambert j d , yang cs . mechanisms of cancer prevention by tea constituents . j nutr 2003 ; 133 ( suppl ): s3262 - s3267 . 4 . yang c s , chen l , lee m j , balentine d , kuo m c , schantz s p . blood and urine levels of tea catechins after ingestion of different amounts of green tea by human volunteers . cancer epidemiol biomarkers prey 1998 ; 7 : 351 - 354 . 5 . anderson r a , polansky m m . tea enhances insulin activity . j agric food chem 2002 ; 50 : 7182 - 7186 . 6 . fukino y , shimbo m , aoki n , okubo t , iso h . randomized controlled trial for an effect of green tea consumption on insulin resistance and inflammation markers . j nutr sci vitaminol ( tokyo ) 2005 ; 51 : 335 - 342 . 7 . naftalin r j , afzal i , cunningham p , et al . interactions of androgens , green tea catechins and the antiandrogen flutamide with the external glucose - binding site of the human erythrocyte glucose transporter glut1 . br j pharmacol 2003 ; 140 : 487 - 499 . 8 . johnston k , sharp p , clifford m , morgan l . dietary polyphenols decrease glucose uptake by human intestinal caco - 2 cells . febs lett 2005 ; 579 : 1653 - 1657 . 9 . kobayashi y , suzuki m , satsu h , et al . green tea polyphenols inhibit the sodium - dependent glucose transporter of intestinal epithelial cells by a competitive mechanism . j agric food chem 2000 ; 48 : 5618 - 5623 . 10 . zhu m , chen y , li r c . pharmacokinetics and system linearity of tea catechins in rat . xenobiotica 2001 ; 31 : 51 - 60 . 11 . raederstorff d g , schlachter m f , elste v , weber p . effect of egcg on lipid absorption and plasma lipid levels in rats . j nutr biochem 2003 ; 14 : 326 - 332 . 12 . van amelsvoort j m , van h of k h , mathot j n , mulder t p , wiersma a , tijburg l b . plasma concentrations of individual tea catechins after a single oral dose in humans . xenobiotica 2001 ; 31 : 891 - 901 . 13 . sabu m c , smitha k , kuttan r . anti - diabetic activity of green tea polyphenols and their role in reducing oxidative stress in experimental diabetes . j ethnopharmacol 2002 ; 83 : 109 - 116 . 14 . tsuneki h , ishizuka m , terasawa m , wu j b , sasaoka t , kimura i . effect of green tea on blood glucose levels and serum proteomic patterns in diabetic ( db / db ) mice and on glucose metabolism in healthy humans . bmc pharmacol 2004 ; 4 : 18 - 27 . 15 . lee m j , maliakal p , chen l et al . pharmacokinetics of tea catechins after ingestion of green tea and (−)- epigallocatechin - 3 - gallate by humans : formation of different metabolites and individual variability . cancer epidemiol biomarkers prey 2002 ; 11 : 1025 - 1032 . 16 . chen l , lee m j , li h , yang c s . absorption , distribution , elimination of tea polyphenols in rats . drug metab dispos 1997 ; 25 : 1045 - 1050 . 17 . kao y h , hiipakka r a , liao s . modulation of endocrine systems and food intake by green tea epigallocatechin gallate . endocrinology 2000 ; 141 : 980 - 987 . 18 . lin y s , tsai y j , tsay j s , lin j k . factors affecting the levels of tea polyphenols and caffeine in tea leaves . j agric food chem 2003 ; 51 : 1864 - 1873 . 19 . hara y , honda m . the inhibition of α - amylase by tea polyphenols . agric biol chem 1990 ; 54 : 1939 - 1945 . 20 . shimizu m , kobayashi y , suzuki m , satsu h , miyamoto y . regulation of intestinal glucose transport by tea catechins . biofactors 2000 ; 13 : 61 - 65 . 21 . nomura m , takahashi t , nagata n , et al . inhibitory mechanisms of flavonoids on insulin - stimulated glucose uptake in mc3t3 - g2 / pa6 adipose cells . biol pharm bull 2008 ; 31 : 1403 - 1409 . 22 . strobel p , allard c , perez - acle t , calderon r , aldunate r , leighton f . myricetin , quercetin and catechin - gallate inhibit glucose uptake in isolated rat adipocytes . biochem j 2005 ; 386 : 471 - 478 . 23 . arakawa k , ishihara t , oku a , et al . improved diabetic syndrome in c57bl / ksj - db / db mice by oral administration of the na + - glucose cotransporter inhibitor t - 1095 . brit j pharm 2001 ; 132 : 578 - 586 . 24 . chow h h , cai y , alberts d s , et al . phase i pharmacokinetic study of tea polyphenols following single - dose administration of epigallocatechin gallate and polyphenon e . cancer epidemiol biomarkers prev 2001 ; 10 : 53 - 58 . 25 . collins q f , liu h y , pi j , liu z , quon m j , cao w . epigallocatechin - 3 - gallate ( egcg ), a green tea polyphenol , suppresses hepatic gluconeogenesis through 5 ′- amp - activated protein kinase . j biol chem 2007 ; 282 : 30143 - 30149 . 26 . kim j w , dang c v . cancer &# 39 ; s molecular sweet tooth and the warburg effect . cancer res 2006 ; 66 : 8927 - 8930 . 27 . park j b . flavonoids are potential inhibitors of glucose uptake in u937 cells . biochem biophys res commun 1999 ; 260 : 568 - 574 . 28 . polychronopoulos e , zeimbekis a , kastorini c m , et al . effects of black and green tea consumption on blood glucose levels in non - obese elderly men and women from mediterranean islands ( medis epidemiological study ). eur j nutr 2008 ; 47 : 10 - 16 .

US-200913055281-A

in order to modify the immune system in humans having symptoms of a disorder of the immune system characterized by the presence of lymphocytes not apparently activated such lymphocytes are deactivated by a limited and closely controlled extracorporeal irradiation of an intensity and duration sufficient to cause the symptoms to disappear .

it has now been found by subsequent research that extracorporeal irradiation of the blood which produces a selective suppression of immunity may be used successfully to treat auto - immune diseases . furthermore , if extracorporeal irradiation of the blood is continued past the point of lymphocyte suppression then the general immunity increases , while the specific , undesired immunity remains decreased . this rise in general immunity may be used to treat disease characterized by insufficient immunity , such as malignant neoplastic disease . in these diseases treated by use of the method of this invention , none of the cells are from sources which are foreign to the patient &# 39 ; s body , such as are present in transplant patients . in transplant patients the human body , which normally has immune defenses to foreign cells , must have the immunity suppressed by methods such as that of u . s . pat . no . 4 , 321 , 918 or by drug therapy or other means . in the diseases of the immune system to which this invention is directed , there are no cells present from sources outside the body . non - limiting examples of auto - immune diseases are lupus erythematosus , multiple sclerosis , scleroderma , etc . immune insufficiency diseases include those which produce malignant neoplasms such as cancerous tumors or leukemia . in auto - immune disease , activated lymphocytes are directed against the host . in cancer and other immune insufficiency diseases the activated lymphocytes are inadequately directed against the disease . according to this invention , immune modification is effected , the immune memory no longer produces the same undesirable lymphocytes , and a different lymphocyte population emerges , shown by removal of the disease symptoms . in auto - immune disease the disease condition recedes and in malignant neoplastic disease the host controls the neoplasm causing a cessation of cell proliferation . the procedure for extracorporeal irradiation of the blood is simple and painless to the patient , and is described with reference to the drawings : fig2 is an exploded view of the spiral tubing disc and mounting , and fig3 is a perspective view of the mounted spiral tubing disc . fig4 - 9 show graphically the results of lymphocyte stimulation studies in patient examples 1 - 6 . the apparatus used , and shown in fig1 - 3 is the same as that disclosed in my previous patent , u . s . pat . no . 4 , 321 , 918 . referring to the drawings , fig1 illustrates a source of x - rays 2 emitting a beam 4 which impinges upon the spiral disc 6 of tubing 7 . the patient 8 is cannulated so that a blood pump 10 can pump from an artery or other appropriate vessel 12 through the spiral disc 6 and back to the patient &# 39 ; s vein 14 . referring to fig2 the tubing 7 of spiral disc 6 is wound onto a bobbin 16 between two low - density plastic plates ( polycarbonate , for example ) 18 and 20 which keep the tubing flat and thereby keep the field substantially uniform . a screw 22 and a wing nut 24 keep the assembly together ; a relief slot 26 for the tubing end allows the disc to remain flat . the spiral disc assembly may slide into a drawer in a shielded box beneath the source of radiation . the spiral may be wound in multiple layers in order to increase the radiation dose permitting a faster flow rate . the apparatus is shown assembled at fig3 . the tubing used for extracorporeal irradiation is primed with normal saline and heparin before connection to the patient . the patient is then systemically heparinized and connected to the tubing via conventional cannulation with arteriovenous shunt or fistula . the tubing 7 used for the extracorporeal irradiation link is any tubing suitable for an extra corporeal blood circuit and capable of allowing the passage of x - rays . for example , sterilized polyvinyl chloride tubing is suitable . the radiation dose received by the blood as it passes through the radiation field is the transit dose . the total dose per treatment is the transit dose multiplied by the number of times the blood passes through the radiation field each treatment . the general treatment regimen is to irradiate the blood daily while passing it through an extracorporeal irradiation link for approximately one hour . for example , if the transit dose used is 31 . 1r , a total dose per daily treatment of 31 . 1r to 62 . 2r may be provided in an approximately one hour treatment , by irradiating the blood in one to two transits through the extracorporeal irradiation link . higher or lower doses may be used according to the responsiveness of the patient . the radiation dose is critical as it must be enough to suppress the activated lymphocytes without killing them while allowing a different population of lymphocytes to emerge . used according to the subject process , extracorporeal irradiation of the blood has no harmful side effects to the patient &# 39 ; s body since the dosage is very low and the irradiation takes place outside the body . the patient &# 39 ; s blood may even be irradiated continuously so long as the total dose resulting from the blood transits does not exceed that necessary to suppress the undesired lymphocytes without killing them , while allowing the desirable lymphocyte cell population to emerge . the following case study examples demonstrate the immune modification of the invention , evidenced by lymphocyte stimulation studies , shown graphically in fig4 - 9 . all the patients showed a rise in immunity . the treatment is discontinued when the desired immune status is achieved , as determined by immune studies and by the relief of symptoms . table 1__________________________________________________________________________ immune number of series total number of daily modifi - patient sex age diagnosis of treatments daily treatments dose cation ? __________________________________________________________________________ap f 48 neoplastic 3 19 62 . 2 r yesmm f 65 neoplastic 1 14 38 . 9 r yes auto - immunert m 49 auto - immune 3 40 62 . 2 r yesca m 65 neoplastic 1 7 38 . 9 r yeseb m 72 neoplastic 1 12 46 . 6 r yesnh m 66 neoplastic 1 9 38 . 9 r yes__________________________________________________________________________ the six case histories presented below illustrate each of the three situations where immune modification is required and desired , i . e ., an increase in general immunity such as is required in treatment of immune insufficiency disease ; an increase in general immunity and a decrease in specific immunity , for example , in malignant neoplastic disease combined with auto - immune disease ; and where only decrease in specific immunity is needed , as in auto - immune disease . female , age 48 , with a diagnosis of disseminated , inoperable , terminal cancer of the colon . the patient was presented to extracorporeal irradiation as a last resort , since other therapy was to no avail . upon presentation , the patient was unable to stand upright without extreme uncontrollable pain . she was unable to eat , in great emotional trauma , and heavily medicated with narcotic pain killers which did not adequately control the pain . extracorporeal irradiation of the blood was conducted daily with a transit dose of 31 . 1r for a period of approximately one hour , resulting in a total daily dose of 62 . 2r . the initial series was for nine treatments followed by two series of five treatments each , at approximately one month intervals . the patient responded quickly with a lessening of pain and a return of appetite and feeling of well - being . subsequent to the first series , she was discharged from the hospital without pain and was withdrawn from pain medication . she was able to reenter the life of the community of which she was a resident . she was able to drive an automobile and returned for her subsequent series of treatments as an outpatient . thermographic analysis documented greatly decreased inflammation of the bowel during the course of ecib therapy . her lymphocyte stimulation studies are illustrated in fig4 and demonstrate immune modification . the patient subsequently died of complications resulting from previously incurred surgically - produced adhesions , and autopsy confirmed that the previously massive tumor had shrunk from its former size and condition and was comprised largely of dying and necrotic tissue . female , age 65 , with a diagnosis of terminal disseminated cancer and systemic lupus erythematosus characterized by a profound thrombocytopenia and a resumed lupus nephritis . she exhibited diffuse erythematous patches . the patient was presented to extracorporeal irradiation as a last resort , since other therapy had not been successful . the patient was moderately hypervolemic ; pre - treatment platelet levels were so low as to require transfusion . she was agitated with pain controlled by medication . platelet destruction was continuing until ecib treatment commenced . extracorporeal irradiation of the blood was conducted daily with a transit dose of 31 . 1r for approximately one hour per day resulting in a daily dose of 38 . 9r . the patient was treated 14 times . the patient responded quickly with a lessening of pain and a loss of excess fluid . the erythematous discolored patches decreased or disappeared altogether . platelet levels stabilized during treatment , and then platelet levels rose quickly , and at the end of the series the platelet count was approximately 3 times pre - treatment level . her lymphocyte stimulation studies are illustrated in fig5 and demonstrate modification of immunity . the patient was presented to extracorporeal irradiation because other therapy had been to no avail in spite of progressive disease of some ten years duration , characterized by increasing loss of bowel and bladder control and increasing motor difficulties such as inability to walk unassisted or climb short steps . prior to receiving extracorporeal irradiation , and on one occasion simultaneously , the patient was treated with biocompatible hemoperfusion ( as described in u . s . pat . no . 4 , 048 , 064 ) in order to plasmapherese humoral immune components and thereby accelerate control of cellular immunity . the patient responded very quickly to extracorporeal irradiation which was at first manifest by an improved sense of confidence and well - being . as the treatments progressed , bowel and bladder control returned , and the patient was able to climb stairs and walk with far greater ease . the patient was treated daily in three series of treatments . the first series was 7 treatments , the second was 10 treatments , and the third was 23 treatments . treatment was one hour daily at a transit dose of 31 . 1r for a total daily dose of approximately 62 . 2r . the patient &# 39 ; s lymphocyte stimulation studies are illustrated at fig6 . the patient &# 39 ; s condition has stabilized in the improved condition . the patient was introduced to ecib when all other therapy had been to no avail . upon presentation , the patient exhibited acute distress , agitation , difficulty breathing , edema , rapidly rising white cell count , very extremely elevated uric acid , rapidly advancing kidney failure , and pain controlled by medication . because the patient had great difficulty breathing and remaining sedentary , treatment was necessarily shortened . ecib was begun when the patient was near death . the patient was treated 30 min . to 1 hr . for 6 days at 31 . 1 to 46 . 6r . at the end of his sixth treatment , his white count had stabilized , and his uric acid had completely returned to normal indicating that cell destruction characteristic of the disease was ceasing . thermographic analysis documented much decreased inflammation of the lymphatic system . the curve of fig7 graphically illustrates a case wherein the inappropriateness of the activation of the patient &# 39 ; s lymphocytes was that it was a zero activation , this being a characteristic of malignant neoplasm . after commencing the treatment the count per minute of lymphocyte stimulation rose slightly , but the patient &# 39 ; s symptoms were such that the inappropriateness of activation persisted . after the commencement of the second day of treatment , the count per minute rose to slightly more than 10 , 000 counts per minute , but the persistence of the symptoms lasted until near the commencement of the fifth day , whereupon the counts per minute commenced to rise and during about the middle of the fifth day the counts per minute rose greatly and soon thereafter rose abruptly to near 50 , 000 counts per minute and the symptoms of the disorder subsided . the patient &# 39 ; s immune studies shown in fig7 demonstrate that immune modification had taken place . male , age 72 , with a diagnosis of terminal cancer of the bone . the patient was introduced to ecib when all other therapy had been to no avail . upon presentation , the patient suffered painful walking and hip movement . uric acid was moderately elevated , and his white count was very low . the patient was given 12 daily 1 hr . treatments at a dose rate of 46 . 6r . at termination of treatment , the patient could walk and turn with greater ease , pain was decreased , uric acid was reduced , and his white count had increased to normal . the patient &# 39 ; s lymphocyte stimulation studies demonstrating immune modification are shown in fig8 . male , age 66 , diagnosed as having terminal cancer of the prostate . the patient was presented to ecib when all other therapy had been to no avail . the patient was mentally disoriented with complaints of discomfort , agitation , and pain which was controlled by medication . his white cell count was very low , and his urine output was inadequate . the patient was treated 1 hr . per day for 9 days with a daily dose of 41 . 4r to 46 . 6r . at termination of treatment , his white count had doubled to become normal , urine output had increased 600 % to become normal , and pain and discomfort decreased . the patient &# 39 ; s lymphocyte stimulation studies showing immune modification are shown in fig9 . the curves in fig9 graphically describe the change in the lymphocyte activation where repetitive doses were required to affect the desired change . the lymphocyte activation of a patient having symptoms of immune disorder was measured at the start , exhibiting a count of 4 , 000 per minute . at the end of four days , the count had dropped to about 500 counts per minute , denoting deactivation of the inappropriately activated lymphocytes , and on the fifth day the count had dropped to less than 500 counts per minute . during the sixth day , the counts per minute rose to about 3 , 500 per minute , denoting the emergence of a new lymphocyte population , but since the symptoms of disorder persisted the emerged lymphocyte population also was not appropriately activated . the doses were continued and by the tenth day the count per minute had dropped to a count of 100 or 200 a minute , and after the tenth day the counts per minute rose concurrently with an abatement of the symptoms of immune disorder and the curve continued to rise until on about the 27th day , the counts per minute had risen to about 6 , 750 per minute , the absence of recurrence of the symptoms of disorder proving that the lymphocytes in the population of the patient &# 39 ; s blood were not inappropriately activated . each of the patients here summarized unexpectedly greatly benefited in their physical well - being from treamtment by extracorporeal irradiation of the blood . the lymphocyte stimulation studies for each patient clearly demonstrate immune modification with this technique , and none of the patients suffered any undesirable side effects , even though before treatment conventional therapeutic possibilities had been exhausted . using such a low suppressive dose of radiation to the blood does not cause cell death and apparently causes lymphocyte cell population shifts , because the activated lymphocytes are more radiosensitive than unactivated lymphocytes . for this reason , extracorporeal irradiation of the blood is preferably initiated when the offending lymphocyte population is active and the diseases exacerbate . where it is desired to increase general immunity , extracorporeal irradiation is continued until sufficient immune virulence is achieved as successive lymphocyte populations emerge . where it is desirable to selectively decrease specific immunity , extracorporeal irradiation is continued until that specific immunity is decreased followed by an increase in the general immunity . using the technique described , blood cell counts will not decrease , massive cell death will not occur , and the immune status of the patient will be desirably modified , leading to improved health and well - being . for each of these six patients , x - ray irradiation was used , though other types of radiation , for example , ultraviolet or other type of ionizing actinic radiation may be used . the x - ray machine used was a g . e . maxima r with a 1 / 2 mm . a1 . filter , operated at 100 kv with a 7ma . current delivering a dose rate of 155 . 5r / min . to the tubing spiral disposed at 15 cm from the target electrode . the resultant transit doses were 31 . 1r per minute . in each instance , the irradiation was considered to be adequate when modification of the immune system was shown by a standard lymphocyte stimulation test , with no cell death and blood cell counts unimpaired . if the activated lymphocytes were to be killed , the patient &# 39 ; s system would tend to be triggered into creating a replacement population of identical undesirable lymphocytes . the treatments of a patient are continued from day - to - day until the symptoms of the disease subside . because of the relatively short life span of the blood of a human being , the cumulative effects of the extracorporeal irradiation are not a factor , as are the cumulative effects when body tissues are irradiated . the blood which has been irradiated during one series of daily treatments will not likely be present during a subsequent series of treatments . total doses per treatment ranging from 24 . 4r to 93 . 3r have been sufficient to suppress the activated lymphocytes and the immune memory and to allow a different lymphocyte population to emerge . immune modification is demonstrated by the fact that the different lymphocyte population which emerges does not cause the disease symptoms . the patient &# 39 ; s disease symptoms subside when the cell population shifts . by treatment with this invention , the immune system is deactivated until another cell population emerges in which the new activated lymphocytes correct the error of the body &# 39 ; s immune system , causing the disease symptoms to recede . the reproduction of the cells has been affected . variations and modifications of this invention can be effected within the spirit and scope of the invention as described above and as defined in the appended claims .

US-65843684-A

a new class of polypeptides is disclosed , along with a method for identifying and producing such polypeptides , having the characteristic of being unique to diseased states , particularly tumors and blood - borne malignancies . these new polypeptides are active and will be useful for therapeutic purposes .

four distinct classes of interferons ( ifns ) are known to exist in humans . the ifn - α family represents the predominant class of ifns and are produced by stimulated peripheral blood leukocytes ( 10 - 15 , 17 - 27 , 29 , 50 , 51 , 57 - 59 , 61 , 63 , 64 , 68 , 70 ), and lymphoblastoid and myeloblastoid cell lines ( 28 , 30 , 60 ). cloning of the ifn - α genes from these cells has revealed that ifn - α is encoded by a multigene family consisting of about 15 functional genes and four pseudogenes ( 17 , 26 , 27 , 29 , 31 , 50 , 51 , 53 , 54 , 57 , 61 , 63 , 64 , 65 ). it has been uncertain whether or not some of the cloned human ifn - α genes and cdnas with few nucleotide differences , such as the hu - ifn - αa , hu - ifn - α2 and hu - ifn - α2 ( arg ) genes , are allelic variants or represent distinct genes . to determine if these sequences do indeed represent separate genes or are instead polymorphic variants of a single gene , sequences representing only the hu - ifn - αa , hu - ifn - α2 and hu - ifn - α2 ( arg ) genes were amplified by nested polymerase chain reaction ( pcr ) from human genomic dnas of healthy consenting individuals . these sequences were then subcloned and examined by sequencing of individual clones . in addition , the dnas were examined from kg - 1 ( 80 ) and namalwa ( 81 ) cell lines from which the hu - ifn - αa and hu - ifn - α2 ( arg ) cdnas , respectively , were cloned . three oligodeoxynucleotides were prepared by the phosphoramidite method ( 82 , 83 ) and purified ( 84 ). primer i ( 5 &# 39 ;- tgggctgtgatctgcctc - 3 &# 39 ;) ( seq id no : 1 ) complementary to nucleotides 125 to 142 at the 5 &# 39 ; end was used with primer ii ( 5 &# 39 ;- catgatttctgctctgacaacc - 3 &# 39 ;) ( seq id no : 2 ) complementary to nucleotides 552 to 573 at the 3 &# 39 ; end to amplify the desired nucleotide sequences . the dna , as amplified by the polymerase chain reaction ( pcr ) with this primer pair , was expected to represent sequences from most of the ifn - α gene family ( 79 ). this conserved pcr product was then used as template in a second amplification reaction with the same 3 &# 39 ; oligonucleotide but with a 5 &# 39 ; oligonucleotide specific for the human ifn - αa , ifn - α2 and ifn - α2 ( arg ) genes only ( 79 ). the second reaction produced a product of 430 bp when primer iii ( 5 &# 39 ;- aacccacagcctgggtag - 3 &# 39 ;) ( seq id no : 3 ) complementary to nucleotides 144 to 161 was substituted for the primer i . the 430 bp dna was purified and cloned into the smai site of pbluescript - sk + ( stratagene , lajolla , calif .) as described ( 79 , 85 , 86 ). dna of the plasmids was prepared by the alkaline lysis miniprep procedure ( 86 , 87 ) from 1 ml cultures grown overnight in lb medium containing 100 μg / ml ampicillin . the resultant dna pellet was sequenced by the dideoxy chain termination procedure ( 79 , 88 , 89 ). the reactions were run on 6 % polyacrylamide gels which were then dried and exposed to x - ray film overnight at room temperature with an intensifying screen . reverse transcriptase pcr ( rt - pcr ) was used to analyze the expression of the ifn - α subtypes αa , α2 and α2 ( arg ) in the kg - 1 and namalwa cell lines ( 90 ). rna was isolated at 6 hours after induction from sendai virus - induced kg - 1 cells ( 60 ) and at 8 hours post induction from ndv - stimulated namalwa cells ( 91 , 92 ). dna was extracted from the human myeloblastoid cell line kg - 1 and from the lymphoblastoid namalwa cell line by a modification of the method of pellicer et al . ( 93 ). after obtaining informed consent , human genomic dna was prepared from whole blood samples collected from normal , healthy individuals by ammonium acetate precipitation as described ( 79 , 94 ). the dna from 11 normal individuals was amplified by nested pcr then cloned and sequenced as described above . the number of sequences corresponding to the various human ifn - α species is shown in table 1 . it can be seen that neither the sequence for the αa gene nor the α2 ( arg ) gene was detected in any of the normal individuals examined in this study . as shown in table 2 , however , the αa sequence was detected in the dna from the kg - 1 cell line , but not in namalwa cells ; and the α2 ( arg ) sequence was detected in the dna from the namalwa cell line , but not in kg - 1 cells . table 1______________________________________frequency of hu - ifn - αa , - α2 and α2 ( arg ) clones fromnormalindividualsinterferon variant number of clones______________________________________ifn - α2 165ifn - αa 0ifn - α2 ( arg ) 0other . sup . 1 36total 201______________________________________ . sup . 1 other refers to sequences which contained one or more mutations in an area unrelated to the αa and α2 ( arg ) specific differences . it should be noted that the frequency of mutations detected is in the range or slightly lower than that predicted from the combined error rates of taq dna polymerase and sequenase dna polymerase ( 95 , 96 ). previous analysis of ifnα2 genes have been reported ( 97 , 98 ), but did not discern any differences in their representation in the dna from normal individuals . descriptions and abbreviations relevant to interferons are described in detail in several references ( 10 - 12 , 61 , 99 , 100 ). table 2______________________________________frequency of ifn - α clones from kg - 1 and namalwa cell linescells ifn - α2 ifn - αa ifn - α2 ( arg ) other total______________________________________kg - 1 cells 15 10 0 16 41namalwa cells 22 0 13 2 37______________________________________ restriction endonuclease analysis to detect the ifn - αa gene was also performed on dna from five of the individuals from whom clones had been sequenced and on dna from seven additional people that were not examined by dna sequencing . it was found that the restriction endonuclease analysis of the amplified dna from all of these individuals showed no ifn - αa gene present ( see ref . 79 , fig2 ). from the foregoing analysis , it can be concluded that in human dna from a wide variety of humans only hu - ifn - α2 is present . the species hu - ifn - αa and hu - ifn - α2 ( arg ), not present in the dna of 11 normal individuals , apparently arose during the development of the disease and / or the establishment of the cell lines in culture . it is noteworthy that the expression of these alleles of hu - ifn - α2 yields ifn - α species with high activity in a wide variety of assays ( 63 , 68 , 69 , 101 - 115 ). the specific activities of all three of these ifn - α species are comparable . furthermore , it has been reported that patients treated with hu - ifn - αa produced a higher level of anti - interferon antibodies than patients treated with hu - ifn - α2 or hu - ifn - αn ( welferon : a preparation of mixed hu - ifn - α species produced by induced namalwa cells ) ( 116 - 124 ). some of the new interferons produced by the described invention may be able to by - pass neutralization by the antibodies produced in patients treated with ifn - α preparations in current use . such new ifn - α species should be able to be used to treat patients who have relapsed because of neutralization of the administered ifn - α species . while the inventor has , for convenience , used hu - ifn - α2 and its known variants for establishing his hypothesis of the existence of a class of super or tumor interferons , it will be apparent to those skilled in the art that the results extend to an entire class of such interferons , as well as other polypeptides . illustrative of this conclusion is the extraordinary high percentage of variant forms of the ifn - α2 and αa genes in kg - 1 cells -- i . e ., 39 % ( 16 / 41 ), much more than could be explained by experimental error , as shown in the column labeled &# 34 ; other &# 34 ; of table 2 . it will also be apparent that the method of the invention , as illustrated above for hu - ifn - α2 , can be applied to any protein . in the general case , a primer pair is chosen to encompass part or all of the nucleotide coding sequence with the use of dna from tumor cells or from cultured cells as templates for the pcr . the pcr product is then cloned and sequenced . the amino acid sequence predicted by the nucleotide sequence so obtained is compared to the sequence of the protein in normal individuals . proteins with amino acid sequences different from those proteins in normal individuals are then cloned in appropriate expression vectors ( 11 , 12 , 14 , 17 , 45 , 53 , 54 , 57 , 63 , 69 , 86 , 103 ), produced , purified and characterized . those with desirable activities are then developed for therapeutic use . the origin of the tumor interferons or super interferons is unknown . yet , it is clear that they are developed during the pathological process . it is believed that the cells producing these interferons have been selected during development and progress of the disease . the presence of allelic forms of ifn - α2 in the kg - 1 and namalwa cells is most noteworthy . dna from leukocytes from normal individuals did not contain these variants . because both the kg - 1 and namalwa cells originated from patients with leukemia or lymphoma , it is believed that this alteration is an early change in progression of these diseases . indeed , it has been reported that there are significant gross changes in restriction endonuclease digestion patterns for the ifn - α genes in acute leukemias ( 125 , 126 ). the disease mechanisms involved in developing malignant cells and selection of those cells produce a wide variety of genetic changes in the resultant tumor cells . in order for cancer cells to grow unfettered , to escape the normal controls and to metastasize , the usual regulatory network of the immune system , involving growth inhibitors as the interferons and growth factors and hormones , may be modified . the control of cell growth and nonmalignant behavior is a delicate balance of many regulatory factors , a few of which gone astray can alter the normal growth patterns . although it has been reported that changes in the dna of cancer cells occurs , the changes have been focussed on oncogenes and tumor suppressor genes that lead to the malignant phenotype . the inventor has provided data that the changes are more pervasive than expected , not merely those changes focussed on oncogenes and tumor suppressors . furthermore , by genetic changes ( mutations in dna ) and selection of tumor cells for aggressiveness , many alterations will be embodied in the final tumor cell population . the new proteins produced will have lower , the same or higher activities than the normal proteins . by identifying those modified proteins associated with changes in activity , it will be possible to identify those proteins with new and / or enhanced activities . from an analysis of initial clones obtained from the kg1 cell line ( 53 , 54 , 63 ), it was shown that several abnormal interferons exist in this cell line ( also see ref . 61 for list of ifn - α species ). this is especially evident in that αb ( not previously recognized as an abnormal interferon ) has an insertion and compensating deletion making an abnormal protein that differs from hu - ifn - α8 , the normal counterpart . the presence of an insertion and a compensating deletion producing a normal sized molecule suggests some enormous selective pressures to produce these interferons . the fact that an insertion and a deletion would be incorporated into a molecule simply by random stochastic processes without external pressures is highly unlikely . thus , these modified interferons are seen to represent an entire new family of molecules that have been developed under the pressure of enormous external forces to provide for the selection of these species . with respect to the interferons produced by mechanisms to enhance or combat the disease process , some may indeed have unusual properties and may be more active than some of the interferons produced by normal cells . for example , since interferon is a growth inhibitory molecule , production of a new interferon that could down regulate the receptors for interferon in cells and help select for cells without interferon receptors or low levels of interferon receptors may enhance the disease process . such interferons could also help select cells with an altered signal transduction mechanism , but normal receptor number . thus , a cell producing spontaneously some interferon , could be expected to have initially a low level of receptors due to down regulation and its growth would likely be reduced . nevertheless , during the multiplication of such cells , cells would be selected that would have low levels of receptors so that they could escape the inhibition of the endogenous interferon . the same would hold for a wide variety of other molecules such as cytokines , lymphokines , tumor suppressors , growth factors , anti - growth factors , matrix molecules , hormones , angiogenic factors , clotting factors , etc ., all molecules that can control growth and / or metastases in one manner or another . the altered proteins described herein are found in tumor cells or cultured cells obtained from tumors . furthermore , selection of cell - lines in culture can also produce some of the alterations as selection in vivo . a new , interferon was amplified from the genomic dna of kg - 1 cells ( atcc ccl 246 ) based on the strategies outlined hereinbefore and by the procedures described herein and elsewhere ( 79 ). the primers used to amplify the genes are shown in table 3 . the 5 &# 39 ; primer contains an apal site , and the 3 &# 39 ; primer contains an xbai site for cloning . the pcr reactions were carried out in 50 μl with 100 ng kg - 1 template dna , 100 ng of each primer ( 6431 and 6432 ), 0 . 2 mm of each dntp , and 2 . 5 units of taq dna polymerase for 30 cycles of 94 ° c . 30 seconds , 50 ° c . 30 seconds , 72 ° c . 30 seconds in the perkin elmer model 9600 thermocycler . products of the pcr amplification were cloned into the apai and xbai sites of plasmid pbluescript ii ks +( stratagene ) and then transformed into competent e . coli strain dh5α cells . competent cells were prepared in 12 % peg and 36 % glycerol in luria - bertani medium ( l - broth medium , 10 g tryptone , 5 g yeast extract , 10 g nacl , ph 7 . 3 ) from digene ( silver spring , md . 20904 , cat . no . 3500 - 1002 ) as described ( 127 ). plasmid dna was isolated from 2 . 0 ml of overnight cultures grown at 37 ° c . by a modified alkaline lysis procedure as reported ( 128 ). the size of the inserts was determined by digestion with restriction endonucleases kpni and sacl that flanked the cloning sites in the vector pbluescript . a total of 10 independent colonies were identified that contained a 700 base pair insert . table 3______________________________________primers for pcr amplification primerprimer sequence length no . ______________________________________5 &# 39 ; gcgggccccaatggccytgyccttt 25 6431 ( seq id no : 4 ) 3 &# 39 ; gctctagaaytcatgaaagygtga 24 6432 ( seq id no : 5 ) ______________________________________ the sequence of the primers are given in the 5 &# 39 ; to 3 &# 39 ; direction . the &# 34 ; y &# 34 ; represents a pyrimidine ( t or c ). the dna from one of the clones ( plasmid pbs001 ) was sequenced in both directions . automated dna sequencing was performed on a genesis 2000 automated dna sequencer ( dupont , wilmington , del .) with the primers shown in table 4 by methods previously reported ( 86 , 88 , 89 ). all sequences were performed on both strands . automated sequencing was carried out and the results were compiled to create a consensus sequence . the sequence determined from the t3 primer represents the 5 &# 39 ; end of the insert ; the t7 - derived sequence represents the 3 &# 39 ; end . the sequence so determined is designated hu - ifn - α001 and is shown in fig1 . the location of the alwni restriction endonuclease recognition site ( 5 &# 39 ; cagnnnctg 3 &# 39 ;) that was used for the splicing of the hu - ifn - α001 insert into the expression vector tgatg ( 129 ) is indicated in the figure by underlining . the signal peptide is shown as the 23 amino acids labeled - 1 to - 23 . as seen in fig1 the mature protein contains 166 amino acids . table 4__________________________________________________________________________primers used for sequencing primer position indesignation sequence no . hu - ifn - α001 direction__________________________________________________________________________ifn - a1 cttgaaggacagacatg ( seq id no : 6 ) 6942 157 - 172 fifn - a2 ctgtcctccatgagatg ( seq id no : 7 ) 6941 233 - 249 fifn - a3 ggtcattcagctgctgg ( seq id no : 8 ) 6940 339 - 355 rifn - a4 tcctccttcatcagggg ( seq id no : 9 ) 6939 397 - 413 rt3 attaaccctcactaaag ( seq id no : 10 ) t3 vector ft7 taatacgactcactata ( seq id no : 11 ) t7 vector r__________________________________________________________________________ all primers are shown from 5 &# 39 ; to 3 &# 39 ; orientation . the column designated &# 34 ; direction &# 34 ; represents the direction of sequencing with respect to the sequence of the huifn - α ; &# 34 ; f &# 34 ; represents forward ; &# 34 ; r &# 34 ; - reverse . oligodeoxynucleotides were synthesized on an applied biosystem dna synthesizer model 380b by the phosphoramidite method ( 83 , 130 ). a comparison of the protein sequence with other human interferon alpha species ( hu - ifn - α ) demonstrates that hu - ifn - α001 is most closely related to hu - ifn - αj . that comparison is graphically depicted in fig2 . a summary of the known hu - ifn - α sequences has been previously reported ( 61 ). there are a total of six amino acid changes compared to hu - ifn - αj . the data clearly demonstrate that this tumor derived hu - ifn - α species is different from any other known hu - ifn - α species previously reported . furthermore , it would not have been possible to predict this specific sequence as the number of possible proteins with alterations in these six positions is 20 6 or 64 , 000 , 000 . one of the amino acid changes is in the signal peptide sequence ; the remaining five alternations are in the mature protein . it is also to be emphasized that the derived hu - ifn - α species presented here is a natural interferon derived from tumor cells . it is not a synthetic construct prepared by simply mutating six positions . expression of the hu - ifn - α001 gene was accomplished in two steps . the plasmid pbs001 was digested with restriction endonuclease kpni ( 5 &# 39 ; end of hu - ifn - α001 sequence ). the kpni ends were made blunt by incubation with t4 dna polymerase in the following reaction mixture : 1 μg of dna ; 33 mm tris acetate , ph 7 . 9 ; 66 mm potassium acetate ; 10 mm magnesium acetate ; 0 . 5 mm dithiothreitol ; 100 μg / ml bsa ( bovine serum albumin ); 2 mm of each of the four dntps ; 5 units of t4 dna polymerase ( united states biochemical corp . ); total volume of 18 μl . incubation was performed for 5 minutes at 37 ° c . to prepare the blunt ends . the plasmid dna was then digested with xbai ( 3 &# 39 ; end of hu - ifn - α001 sequence ) to release the insert containing the hu - ifn - α001 sequence . the dna fragments were then purified as described ( 86 ). the tgatg vector was prepared by digestion with restriction endonuclease saci , followed by preparing blunt ends with t4 dna polymerase as described above , and then digested with restriction endonuclease xbai . the fragment containing the hu - ifn - α001 insert was then ligated to the ptgatg expression vector ( 129 ). after ligation the dna was transformed into competent e . coli dh5α cells . colonies were analyzed by growing the cells as described above to isolate plasmid dna . the plasmids were then digested with restriction endonucleases ecori and xbai to determine the size of the insert . an expression vector for hu - ifn - αj was prepared as previously described for the expression plasmids for hu - ifn - αb2 and hu - ifn - αa / d ( 131 ). the nucleotide sequences encoding hu - ifn - αj and hu - ifn - α001 contain an alwni site in identical positions of the sequence ( fig3 ); and , as illustrated in fig3 which shows the structure of the plasmid phu - ifn - α001 containing the expression vector for hu - ifn - α001 , there is a second alwni site in the vector itself . in addition , because the alwni recognition sites ( cagnnn ctg ) have three unspecified nucleotides ( nnn ) in the 3 &# 39 ; overhang , the religations are specific and asymmetric . accordingly , ptgatg vectors ( 129 ) encoding hu - ifn - αj and hu - ifn - α001 were digested with restriction endonuclease alwni to isolate the large vector and hu - ifn - α001 ( 3 &# 39 ; end ) fragments , respectively . the hu - ifn - α001 fragment was then ligated into the vector fragment from plasmid phu - ifn - αj to yield the e . coli expression vector phu - ifn - α001 , as shown in fig3 which was transfected into competent e . coli ( dh5α ) cells ( 86 ). plasmid phu - ifn - α001 is deposited with the american type culture collection ( atcc ) at 12301 parklawn drive , rockville , md . 20852 : accession number : 69640 ; deposit date jun . 7 , 1994 ; and designated as plasmid phu - ifn - α001 ( e . coli dh5α / phu - ifn - α001 as the host vector system ). the e . coli ( dh5α ) cells containing the expression vector phu - ifn - α001 were grown in 875 ml of medium a overnight at 30 ° c . in one 2 liter flask with rotary shaking . medium a consists of kh 2 po 4 ( 4 . 5 g / l ), na 2 hpo 4 . 7h 2 o ( 18 . 9 g / l ), nh 4 cl ( 1 . 5 g / l ), nacl ( 0 . 75 g / l ), glucose ( 15 g / l ), casamino acids ( 7 . 5 g / l ), mgso 4 . 7h 2 o ( 0 . 369 g / l ), thiamine hydrochloride ( 0 . 0015 g / l ), leucine ( 0 . 04 g / l ), proline ( 0 . 04 g / l ) and ampicillin ( 0 . 05 g / l ) adjusted to ph 7 . 4 . the overnight culture was used to inoculate 22 . 5 liters of medium a in a fermentor . the e . coli containing the expression vector were grown at 30 ° c . until the a 550 reached 7 . 0 at which time the temperature was raised to 42 ° c . the cells were harvested 3 hrs after temperature induction at 42 ° c . by centrifugation and cell pellets divided into 50 g portions prior to freezing at - 80 ° c . the cells were stored at - 80 ° c . until used for preparation of interferon . for purification of hu - ifn - α001 , frozen e . coli cell paste was thawed by suspension in 10 volumes of buffer a ( 50 mm tris - hcl , ph 8 . 0 , 50 mm nacl , 10 mm edta , 0 . 1 mm pmsf , phenylmethylsufonylfluoride ). after the addition of egg white lysozyme ( 0 . 2 mg / ml ) the suspension was sonicated four times with 30 second bursts while kept in an ice bath , then incubated at 23 ° c . overnight while stirring vigorously to eliminate viscosity contributed by dna . the suspension was centrifuged for 20 minutes at 12 , 000 rpm at 4 ° c . the pellet was resuspended again in 10 volumes of buffer a with 1 % triton x - 100 , 50 mm edta and 0 . 5m nacl and incubated for at least 2 hours ( 2 - 16 hrs ) at room temperature with shaking and then centrifuged for 20 min at 12 , 000 rpm at 4 ° c . once again , the pellet was resuspended in 5 volumes of buffer a with 0 . 5m nacl and incubated for 60 min at room temperature with shaking and then centrifuged for 20 min at 12 , 000 rpm at 4 ° c ; the supernatant was discarded . the pellet was dispersed in 2 volumes of buffer a in the presence of a mixture of oxidized / reduced forms of glutathione ( 0 . 2 mm / 2 . 0 mm ) and solid guanidine . hcl ( 2 . 5 times bacterial weight ) was added and the solution was stirred at room temperature for 7 hours . after this , the mixture was diluted tenfold with buffer a and allowed to stand overnight . renaturation of the interferon was carried out by very slow addition of 7m guanidine . hcl to 0 . 7m . the refolding of hu - ifn - α001 in solution takes more than 15 hours . since hu - ifn - α001 contains two disulfide bonds , this step involves slow oxidation of the protein during dilution from guanidine - containing solution . then suspension was then centrifuged to remove debris . solid ( nh 4 ) 2 so 4 was added to the supernatant to a final concentration 1m , and the solution , after clarification by centrifugation , was loaded at 5 ml / min onto a column ( pharmacia xk 26 / 20 # 18 - 1000 - 72 ) packed with 100 ml of the sorbent phenyl - toyopearl 650 s ( 20 - 50 μm ) ( supelco , # 8 - 14477 : 100 g ), previously equilibrated with 3 - 4 column volumes of buffer b ( 50 mm tris . hcl , ph 7 . 4 , 0 . 5 m guanidine - hcl and 1m ( nh 4 ) 2 so 4 . the column effluent was monitored at 280 nm . after loading , the column was washed with buffer b until the a 280 of the effluent returned to near baseline level and then was eluted sequentially with 2 - 3 column volumes of buffer c ( 50 mm tris . hcl , 0 . 5m guanidine . hcl , 0 . 6m ( nh 4 ) 2 so 4 ) with which the hu - ifn - α001 was eluted . peak fractions showing maximum bands of hu - ifn - α001 on sds - polyacrylamide gel electrophoresis were pooled . the phenyl - toyopearl column was regenerated in situ with 100 ml 0 . 5m naoh and 1m nacl solution ; and was stored in 0 . 01 % sodium azide . fractions with hu - ifn - 001 as measured by antiviral activity and / or gel electrophoresis were pooled and concentrated 10 - fold with an amicon centriprep 10 concentrator . the solution was then diluted 3 - fold with buffer d ( 20 mm tris . hcl , ph 8 . 0 , 5 % glycerol ) and was loaded onto a fplc monoq hr 10 / 10 ion exchange column ( pharmacia # 17 - 0556 - 01 ) equilibrated with buffer d . the column was washed with about 10 ml of buffer d until the a 280 reached baseline . elution of hu - ifn - α001 was accomplished with a linear gradient of buffer d and buffer e ( buffer d plus 1m nacl ) at a flow rate of 1 . 5 ml / min from 0 to 100 % buffer e over 3 hours . the hu - ifn - α001 was eluted at 0 . 15m nacl in a single peak . the fractions were pooled , analyzed by sodium dodecylsulfate ( sds ) polyacrylamide gel electrophoresis and assayed for antiviral activity . from 6 g of bacterial pellet ( wet weight ), about 8 - 10 mg of purified hu - ifn - α001 was obtained . the purified protein was mixed with 15 μl of sds sample buffer ( 0 . 5m tris . hcl , ph 6 . 8 , 1 % ( v / v ) β - mercaptoethanol , 1 % ( w / v ) sodium dodecylsulfate ( sds ), 12 % ( v / v ) glycerol , 2 mm ethylenediaminetetraacetic acid ( edta ), bromphenol blue ) in a total volume of 35 μl . the solution was boiled for two minutes after which 25 μl was loaded onto a 12 . 5 % polyacrylamide gel with a 4 % polyacrylamide stacking gel . the separating gel was buffered in 0 . 3m tris . hcl , 0 . 08 % sds , 2 mm edta , ph 8 . 8 . the stacking gel was in 0 . 065m tris . hcl , ph 6 . 8 , and 0 . 05 % sds . the chamber buffer was 25 mm tris . hcl , 0 . 1 % sds , 0 . 2m glycine . electrophoresis was carried out for 1 hour at 150 v , 20 ma in the biorad miniproteian ii apparatus ( 132 ). the gel was stained with coomassie blue r - 250 ( 2 . 4 %, w / v , coomassie blue in 45 % methanol , 9 %, v / v , acetic acid ) for 1 hour at room temperature ; and destained in 8 % acetic acid . from sds - polyacrylamide gel electrophoresis it was apparent that the purified hu - ifn - α001 migrated with a m r of 20 , 000 as shown in fig4 . as indicated in that figure , hu - ifn - α001 was placed in lanes 1 , 2 and 3 in amounts of 3 μg , 1 . 5 μg and 0 . 75 μg , respectively . the columns labeled m represent the molecular weight markers with the values in kilodaltons given to the left of each respective molecular weight marker . as can be seen , the hu - ifn - α001 exhibited a slightly slower mobility than hu - ifn - αj on sds - polyacrylamide gel electrophoresis ( sds page , ref . 132 ). antiviral activity of hu - ifn - α001 was assayed on bovine mdbk and human fs7 cells with vesicular stomatitis virus ( vsv ) ( table 5 ) as described previously ( 133 ). the antiviral units were determined with respect to the human ifn - αa international standard gxa01 - 901 - 535 . there was approximately equal antiviral activity on human and bovine cells ( table 5 ) as is seen with many hu - ifn - α species ( 17 , 27 , 30 , 100 , 103 , 134 ). table 5______________________________________antiviral assay of interferon interferon titer ( units / ml ) ratiosample fs - 7 cells mdbk cells ( fs - 7 / mdbk ) ______________________________________α001 1 × 10 . sup . 8 1 × 10 . sup . 8 1 . 0______________________________________ the interferon titer is given in units / mg as described ( 10 - 12 , 99 , 100 , 133 , 135 ) with respect to the international standard for human interferon alpha a gxa01901 - 535 from the national institutes of health . vesicular stomatitis virus ( vsv ) was used as the challenge virus with human fs7 and bovine mdbk cells . the ratio of the antiviral activity of the interferon on fs7 to that on mdbk cells is given in the last column . the samples of huifn - α001 were prepared as described in the text . protein was determined by the method of bradford ( 136 ). herein has been described an entire new class of molecules designated as super proteins , proteins not present in normal cells , but present in the cells in various diseased states and a method for identifying , producing and expressing such molecules . although the present embodiment of the invention has been described in detail , it should be understood that various changes , alterations and substitutions can be made therein without departing from the spirit and scope of the invention as defined by the appended claims . 1 . isaacs , a ., and lindenmann , j ., production of viral interfering substances , u . s . pat . no . 3 , 699 , 222 ( application ser . no . 757 , 188 ) filed aug . 5 , 1968 , issued oct . 17 , 1972 . 2 . isaacs , a ., and lindenmann , j . ( 1957 ) &# 34 ; virus interference . i . the interferon ,&# 34 ; proc . royal society , london ser . b 147 , 258 - 267 . 3 . nagano , y ., and kojima , y . ( 1958 ) &# 34 ; inhibition de l &# 39 ; infection vaccinale par un facteur liquide dans le tissu infecte par le virus homologue ,&# 34 ; c . r . seances soc . biol . ses fil . 152 , 1627 - 1629 . 4 . wheelock , e . f . ( 1965 ) &# 34 ; interferon - like virus - inhibitor induced human leukocytes by phytohemagglutinin ,&# 34 ; science 149 , 310 - 311 . 5 . wheelock , e . f . ( 1966 ) &# 34 ; virus replication and high - titered interferon production in human leukocyte cultures inoculated with newcastle disease virus ,&# 34 ; j . bact . 92 , 1415 - 1421 . 6 . youngner , j . s ., and stinebring , w . r . ( 1965 ) &# 34 ; interferon appearance by endotoxin , bacteria , or viruses in mice pretreated with escherichia coli , endotoxin , or infected with mycobacterium tuberculosis ,&# 34 ; nature 208 , 456 - 458 . 7 . youngner , j . s ., and salvin , s . b . ( 1973 ) &# 34 ; production and properties of migration inhibitory factor and interferon in the circulation of mice with delayed hypersensitivity ,&# 34 ; j . immunol . 111 , 1914 - 1922 . 8 . cantell , k ., and tovell , d . r . ( 1971 ) &# 34 ; substitution of milk for serum in the production of human leukocyte interferon ,&# 34 ; appl . microbiol . 22 , 625 - 628 . 9 . stewart , w . e ., ii ( 1979 ) &# 34 ; the interferon system ,&# 34 ; springer - verlag , new york , pp . 421 . 10 . pestka , s . ( 1981 ) &# 34 ; interferons , part a ,&# 34 ; methods in enzymology , ( s . pestka , ed .) academic press , new york , vol . 78 , pp 632 . 11 . pestka , s . ( 1981 ) &# 34 ; interferons , part b ,&# 34 ; methods in enzymology , ( s . pestka , ed .) academic press , new york , vol . 79 , pp 677 . 12 . pestka , s . ( 1986 ) &# 34 ; interferons , part c ,&# 34 ; methods in enzymology , ( s . pestka , ed .) academic press , new york , vol . 119 , pp 845 . 13 . baron , s ., and dianzani , f . ( 1977 ) &# 34 ; the interferon system : a current review to 1978 , &# 34 ; texas reports on biology and medicine vol . 35 , university of texas medical branch , galveston , pp . 573 . 14 . baron , s ., dianzani , f ., and stanton , g . j . ( 1982 ) &# 34 ; the interferon system : a review to 1982 -- part i ,&# 34 ; texas reports on biology and medicine vol . 41 , university of texas medical branch , galveston , pp . 410 . 15 . baron , s ., dianzani , f ., and stanton , g . j . ( 1982 ) &# 34 ; the interferon system : a review to 1982 -- part ii ,&# 34 ; texas reports on biology and medicine vol . 41 , university of texas medical branch , galveston , pp . 411 - 715 . 16 . pestka , s ., mcinnes , j ., havell , e ., and vilcek , j . ( 1975 ) &# 34 ; cell - free synthesis of human interferon ,&# 34 ; proc . natl . acad . sci . u . s . a . 72 , 3898 - 3901 . 17 . pestka , s . ( 1983 ) &# 34 ; the human interferons -- from protein purification and sequence to cloning and expression in bacteria : before , between , and beyond ,&# 34 ; arch . biochem . biophys . 221 , 1 - 37 . 18 . bose , s ., gurari - rotman , d ., th . ruegg , u ., corley , k ., and c . b . anfinsen ( 1976 ) &# 34 ; apparent dispensability of the carbohydrate moiety of human interferon for antiviral activity ,&# 34 ; j . biol . chem . 251 , 1659 - 1662 . 19 . bose , s ., and hickman , j . ( 1977 ) &# 34 ; role of the carbohydrate moiety in determining the survival of interferon in the circulation ,&# 34 ; j . biol . chem . 252 , 8336 - 8337 . 20 . bridgen , p . j ., anfinsen , c . b ., corley , l ., bose , s ., zoon , k . c ., th . ruegg , u ., and buckler , c . e . ( 1977 ) &# 34 ; human lymphoblastoid interferon . large scale production and partial purification ,&# 34 ; j . biol . chem . 252 , 6585 - 6587 . 21 . rubinstein , m ., rubinstein , s ., familletti , p . c ., gross , m . s ., miller , r . s ., waldman , a . a ., and pestka , s . ( 1978 ) &# 34 ; human leukocyte interferon purified to homogeneity ,&# 34 ; science 202 , 1289 - 1290 . 22 . rubinstein , m ., rubinstein , s ., famnilletti , p . c ., miller , r . s ., waldman , a . a ., and pestka , s . ( 1979 ) &# 34 ; human leukocyte interferon : production , purification to homogeneity , and initial characterization ,&# 34 ; proc . natl . acad . sci . u . s . a . 76 , 640 - 644 . 23 . rubinstein , m ., rubinstein , s ., familletti , p . c ., brink , l . d ., hershberg , r . d ., gutterman , j ., hester , j ., and pestka , s . ( 1979 ) &# 34 ; human leukocyte interferon production and purification to homogeneity by hplc ,&# 34 ; in peptides : structure and biological function ( e . gross and j . meienhofer , eds . ), pierce chemical company , rockford , ill ., 99 - 103 . 24 . rubinstein , m ., rubinstein , s ., familletti , p ., gutterman , j ., hester , j ., and pestka , s . ( 1980 ) &# 34 ; an alternative source of human leukocyte interferon ,&# 34 ; in interferon : properties and clinical uses ( a . khan , n . o . hill , and g . l . dorn , eds . ), leland fikes foundation press , dallas , tex ., 45 - 55 . 25 . zoon , k . c ., smith , m . e ., bridgen , p . j ., zur nedden , d ., and anfinsen , c . b . ( 1979 ) &# 34 ; purification and partial characterization of human lymphoblastoid interferon ,&# 34 ; proc . natl . acad sci . u . s . a . 76 , 5601 - 5605 . 26 . allen , g ., and fantes , f . h . ( 1980 ) &# 34 ; a family of structural genes for human lymphoblastoid ( leukocyte - type ) interferon ,&# 34 ; nature ( london ) 287 , 408 - 411 . 27 . rubinstein , m ., levy , w . p ., moschera , j . a ., lai , c .- y ., hershberg , r . d ., bartlett , r . t ., and pestka , s . ( 1981 ) &# 34 ; human leukocyte interferon : isolation and characterization of several molecular forms ,&# 34 ; arch . biochem . biophys . 210 , 307 - 318 . 28 . zoon , k . c . ( 1981 ) &# 34 ; purification and characterization of human interferon from lymphoblastoid ( namalwa ) cultures ,&# 34 ; methods in enzymology 78 , 457 - 464 . 29 . berg , k ., and heron , i . ( 1981 ) &# 34 ; antibody affinity chromatography of human leukocyte interferon ,&# 34 ; methods in enzymology 78 , 487 - 499 . 30 . hobbs , d . s ., and pestka , s . ( 1982 ) &# 34 ; purification and characterization of interferons from a continuous myeloblastic cell line ,&# 34 ; j . biol . chem . 257 , 4071 - 4076 . 31 . berg , k . ( 1982 ) &# 34 ; purification and characterization of murine and human interferons . a review of the literature of the 1970s ,&# 34 ; acta path . microbiol . immunol . scand ., section c , suppl . 279 , 1 - 136 . 32 . pestka , s . ( 1989 ) &# 34 ; the interferons ,&# 34 ; p . 433 - 480 , in journal of chromatography library -- vol . 43 , &# 34 ; natural products isolation &# 34 ; ( edited by g . h . wagman and r . cooper ) elsevier , n . y ., pp 619 . 33 . knight , e ., jr . ( 1976 ) &# 34 ; interferon : purification and initial characterization from human diploid cells ,&# 34 ; proc . natl . acad . sci . u . s . a . 73 , 520 - 523 . 34 . berthold , w ., tan , c ., and tan , y . h . ( 1978 ) &# 34 ; purification and in vitro labeling of interferon from a human fibroblastoid cell line ,&# 34 ; j . biol . chem . 253 , 5206 - 5212 . 35 . iwakura , y ., yonehara , s ., and kawade , y . ( 1978 ) &# 34 ; purification of mouse l cell interferon . essentially pure preparations with associated cell growth inhibitory activity ,&# 34 ; j . biol . chem . 253 , 5074 - 5079 . 36 . kawakita , m ., cabrer , b ., taira , h ., rebello , m ., slattery , e ., weideli , h ., and lengyel , p . ( 1978 ) &# 34 ; purification of interferon from mouse ehrlich ascites tumor cells ,&# 34 ; j . biol . chem . 253 , 598 - 602 . 37 . de maeyer - guignard , j ., tovey , m . g ., gresser , i ., and de maeyer , e . ( 1978 ) &# 34 ; purification of mouse interferon by sequential affinity chromatography on poly ( u )-- and antibody -- agarose columns ,&# 34 ; nature , london 271 , 622 - 625 . 38 . cabrer , b ., taira , h ., broeze , r . j ., kempe , t . d ., williams , k ., slattery , w . h ., konigsberg , w . h ., and lengyel , p . ( 1979 ) &# 34 ; structural characteristics of interferons from mouse ehrlich ascites tumor cells ,&# 34 ; j . biol . chem . 254 , 3681 - 3684 . 39 . stein , s ., kenny , c ., friesen , h .- j ., shively , j ., del valle , u ., and pestka , s . ( 1980 ) &# 34 ; nh 2 - terminal amino acid sequence of human fibroblast interferon ,&# 34 ; proc . natl . acad . sci . u . s . a . 77 , 5716 - 5719 . 40 . friesen , h .- j ., stein , s ., evinger , m ., familletti , p . c ., moschera , j ., meienhofer , j ., shively , j ., and pestka , s . ( 1981 ) &# 34 ; purification and molecular characterization of human fibroblast interferon ,&# 34 ; arch . biochem . biophys . 206 , 432 - 450 . 41 . de maeyer - guignard , j . ( 1981 ) &# 34 ; purification of mouse c - 243 cell interferon by affinity chromatography and polyacrylamide gel electrophoresis ,&# 34 ; methods in enzymology 78 , 513 - 522 . 42 . okamura , h ., berthold , w ., hood , l ., hunakpiller , m ., inoue , m ., smith - johannsen , h ., and tan , y . h . ( 1981 ) &# 34 ; human fibroblastoid interferon : immunosorbent column chromatography and n - terminal amino acid sequence ,&# 34 ; biochemistry 19 , 3831 - 3835 . 43 . kawade , y ., fujisawa , j ., yonehara , s ., iwakura , y ., and yamamoto , y . ( 1981 ) &# 34 ; purification of l cell interferon ,&# 34 ; methods in enzymology 78 , 522 - 535 . 44 . knight , e ., jr ., and fahey , d . ( 1982 ) &# 34 ; human interferon - beta : effects of deglycosylation ,&# 34 ; j . interferon res . 2 , 421 - 429 . 45 . goeddel , d . v ., shepard , h . m ., yelverton , e ., leung , d ., crea , r ., sloma , a ., and pestka , s . ( 1980 ) &# 34 ; synthesis of human fibroblast interferon by e . coli ,&# 34 ; nucleic acids res . 8 , 4057 - 4074 . 46 . taniguchi , t ., ohno , s ., fujii - kuriyama , y ., and muramatsu , m . ( 1980 ) &# 34 ; the nucleotide sequence of human fibroblast interferon cdna ,&# 34 ; gene , 10 , 11 - 15 . 47 . derynck , r ., content , j ., de clercq , e ., volckaert , g ., tavernier , j ., devos , r ., and fiers , w . ( 1980 ) &# 34 ; isolation and structure of a human fibroblast interferon gene ,&# 34 ; nature ( london ) 285 , 542 - 547 . 48 . houghton , m ., steward , a . g ., doel , s . w ., emtage , j . s ., eaton , m . a . w ., smith , j . s ., patel , t . p ., lewis , h . m ., porter , a . g ., birch , j . r ., cartwright , t ., and carey , n . h . ( 1980 ) &# 34 ; the amino - terminal sequence of human fibroblast interferon as deduced from reverse transcripts obtained using synthetic oligonucleotide primers ,&# 34 ; nucleic acids res . 8 , 1913 - 1931 . 49 . friesen , h .- j ., and pestka , s ., preparation of homogeneous human fibroblast interferon , u . s . pat . no . 4 , 289 , 689 ( application ser . no . 160 , 889 ) filed jun . 19 , 1980 , issued sep . 15 , 1981 . 50 . pestka , s ., and rubinstein , m ., protein purification process and product , u . s . pat . no . 4 , 289 , 690 ( application ser . no . 167 , 165 ) filed jul . 9 , 1980 , issued sep . 15 , 1981 . 51 . pestka , s ., and rubinstein , m ., protein purification process and product , u . s . pat . no . 4 , 503 , 035 ( application ser . no . 465 , 979 ) filed feb . 14 , 1983 , issued mar . 5 , 1985 . 52 . kung , h .- f ., miller , d . l ., and pestka , s ., crystalline human leukocyte interferon , u . s . pat . no . 4 , 672 , 108 ( application ser . no . 751 , 753 ) filed jul . 3 , 1985 , issued jun . 9 , 1987 . 53 . goeddel , d . v ., and pestka , s ., microbial production of mature human leukocyte interferon k and l , u . s . pat . no . 4 , 801 , 685 ( application ser . no . 56 , 623 ), filed jun . 1 , 1987 , issued jan . 31 , 1989 ; european patent application 82107337 . 6 . 54 . goeddel , d . v ., and pestka , s ., microbial production of mature human leukocyte interferon k and l , u . s . pat . no . 4 , 810 , 645 ( application ser . no . 822 , 984 ) filed jan . 27 , 1986 , issued mar . 7 , 1989 . 55 . friesen , h .- j ., and pestka , s ., preparation of homogeneous human fibroblast interferon , u . s . pat . no . 5 , 015 , 730 ( application ser . no . 386 , 088 ), filed jul . 14 , 1989 , issued may 14 , 1991 . 56 . baron , s ., coppenhaver , d . h ., dianzani , f ., fleischmann , w . r ., jr ., hughes , t . k ., jr ., klimpel , g . r ., niesel , d . w ., stanton , g . j ., and tyring , s . k ., editors ( 1992 ) &# 34 ; interferon : principles and medical applications ,&# 34 ; the university of texas medical branch at galveston , galvestan , pp . 624 . 57 . pestka , s ., langer , j . a ., zoon , k . c ., and samuel , c . e . ( 1987 ) &# 34 ; interferons and their actions ,&# 34 ; annu . rev . biochem . 56 , 727 - 777 . 58 . havell , e . a ., berman , b ., ogburn , c . a ., berg , k ., paucker , k ., and vilcek , j . ( 1975 ) &# 34 ; two antigenically distinct species of human interferon ,&# 34 ; proc . natl . acad . sci . usa 72 , 2185 - 2187 . 59 . cavalieri , r . l ., havell , e . a ., vilcek , j ., and pestka , s . ( 1977 ) &# 34 ; synthesis of human interferon by xenopus laevis oocytes : two structural genes for interferons in human cells ,&# 34 ; proc . natl . acad . sci . u . s . a . 74 , 3287 - 3291 . 60 . familletti , p . c ., mccandliss , r ., and pestka , s . ( 1981 ) &# 34 ; production of high levels of human leukocyte interferon from a continuous human myeloblastoid cell culture ,&# 34 ; antimicrob . agents chemother . 20 , 5 - 9 . 61 . pestka , s . ( 1986 ) &# 34 ; interferon from 1981 to 1986 ,&# 34 ; methods in enzymology ( s . pestka , ed . ), academic press , new york 119 , 3 - 14 . 62 . maeda , s ., mccandliss , r ., gross , m ., sloma , p . c ., familletti , j . m ., tabor , m ., evinger , m ., levy , w . p ., and pestka , s . ( 1981 ) &# 34 ; construction and identification of bacterial plasmids containing nucleotide sequence for human leukocyte interferon ,&# 34 ; proc . natl . acad . sci . usa 77 , 7010 - 7013 ( 1980 ); 78 , 4648 . 63 . goeddel , d . v ., and pestka , s . ( 1982 ) polypeptides , process for their microbial production , intermediates therefor and compositions containing them microbial production of mature human leukocyte interferons ! european patent application 81105067 . 3 64 . henco , k ., brosius , j ., fujisawa , a ., fujisawa , j .- i ., haynes , j . r ., hochstadt , j ., kovacic , t ., pasek , m ., schambock , a ., schmid , j ., todokoro , k ., walchli , m ., nagata , s ., and weissmann , c . ( 1985 ) &# 34 ; structural relationship of human interferon alpha genes and pseudogenes ,&# 34 ; j . mol . biol . 185 , 227 - 260 . 65 . diaz , m . o ., pomykala , h ., bohlander , s ., maltepe , e ., olopade , o . ( 1991 ) &# 34 ; a complete physical map of the type - i interferon gene cluster ,&# 34 ; j . interferon res ., 11 , s85 . 66 . owerback , d ., rutter , w . j ., shows , t . b ., gray , p ., goeddel , d . v ., and lawn , r . m . ( 1981 ) &# 34 ; leukocyte and fibroblast interferon genes are located on chromosome 9 ,&# 34 ; proc . natl . acad . sci . usa 78 , 3123 - 3127 . 67 . trent , j . m ., olson , s ., and lawn , r . m . ( 1982 ) &# 34 ; chromosomal localization of human leukocyte , fibroblast and immune interferon genes by means of in situ hybridization ,&# 34 ; proc . natl . acad . sci . usa 79 , 7809 - 7813 . 68 . langer , j . a ., and pestka , s . ( 1984 ) &# 34 ; purification , bacterial expression and biological activities of the human interferons ,&# 34 ; j . invest . dermatol . 83 , 128 - 136s . 69 . goeddel , d . v ., yelverton , e ., ullrich , a ., heyneker , h . l ., miozzari , g ., holmes , w ., seeburg , p . h ., dull , t ., may , l ., stebbing , n ., crea , r ., maeda , s ., mccandliss , a ., sloma , j . m ., tabor , j . m ., gross , m ., familleti , p . c ., and pestka , s . ( 1981 ) &# 34 ; human leukocyte interferon produced in e . coli is biologically active ,&# 34 ; nature 287 , 411 - 416 . 70 . streuli , m ., nagata , s ., and weissmann , c . ( 1980 ) &# 34 ; at least three human type α interferons : structure of α2 ,&# 34 ; science 209 , 1343 - 1347 . 71 . lawn , r . m ., gross , m ., houk , c . m ., franke , a . e ., gray , p . v ., and goeddel , d . v . ( 1981 ) &# 34 ; dna sequence of a major human leukocyte interferon gene ,&# 34 ; proc . natl . acad . sci . usa 78 , 5435 - 5439 . 72 . dworkin - rastl , e ., dworkin , m . b ., and swetly , p . ( 1982 ) &# 34 ; molecular cloning of human alpha and beta interferon genes from namalwa cells ,&# 34 ; j . interferon research 2 , 575 - 585 . 73 . physicians &# 39 ; desk reference , pdr , 47th edition , 1993 : pages 1078 - 1079 ; 1879 - 1881 ; 2006 - 2008 ; 2194 - 2201 . 74 . dianzani , f . ( 1992 ) biological basis for therapy and for side effects in &# 34 ; interferon : principles and medical applications ,&# 34 ;( baron , s ., coppenhaver , d . h ., dianzani , f ., fleischmann , w . r ., jr ., hughes , t . k ., jr ., klimpel , g . r ., niesel , d . w ., stanton , g . j ., and tyring , s . k ., editors ) the university of texas medical branch at galveston , galvestan , 409 - 416 . 75 . hosoi , h ., miyaki , k ., and yamanaka , m . ( 1992 ) &# 34 ; the interferon α2 gene in japanese patients with chronic viral hepatitis who developed antibodies after recombinant interferon α2a treatment ,&# 34 ; international society for study of the liver , brighton , uk , 3 - 6th jun ., 1992 ; p 113 , abstract . 76 . desai , m ., hussain , m ., lee , n ., ni , d ., liao , m .- j ., and testa , d . ( 1992 ) &# 34 ; identification of ifn - α2 transcripts in sendai virus induced human leukocytes by pcr ,&# 34 ; j . interferon res . 12 , s138 . 77 . adolf , g . r ., kalsner , i ., ahorn , h ., maurer - fogy , i ., and cantell , k . ( 1991 ) &# 34 ; natural human interferon alpha - 2 is o - glycosylated ,&# 34 ; biochem . j . 276 , 511 - 518 . 78 . zoon , k . c ., miller , d ., bekisz , j ., zur nedden , d ., ny , j . c ., nguyen , n . y ., and hu , r . ( 1992 ) &# 34 ; purification and characterization of multiple components of human lymphoblastoid interferon - α ,&# 34 ; j . biol . chem . 267 , 15210 - 15216 . 79 . emanuel , s . l ., and pestka , s . ( 1993 ) &# 34 ; human interferon - αa , - α2 and - α2 ( arg ) genes in genomic dna ,&# 34 ; j . biol . chem . 268 , 12565 - 12569 . 80 . koeffler , h . p ., and golde , d . w . ( 1978 ) &# 34 ; acute myelogenous leukemia : a human cell line responsive to colony - stimulating activity ,&# 34 ; science 200 , 1153 - 1154 . 81 . nadkarni , j . s ., nadkarni , j . j ., clifford , p ., manolov , g ., fenyo , e . m ., and klein , e . ( 1969 ) &# 34 ; characteristics of new cell lines derived from burkitts lymphomas ,&# 34 ; cancer 23 , 64 - 79 . 82 . beaucage , s . l ., and carothers , m . h . ( 1981 ) &# 34 ; deoxynucleoside phosphoramidites - a new class of key intermediates for deoxypolynucleotide synthesis ,&# 34 ; tetrahedron lett . 22 , 1859 - 1862 . 83 . chow , r ., kempe , t ., and palm , g . ( 1981 ) &# 34 ; synthesis of oligodeoxyribonucleotides on silica gel support ,&# 34 ; nucleic acids res . 9 , 2807 - 2817 . 84 . johnson , b . a ., mc clain , s . g ., and doran , e . r . ( 1990 ) &# 34 ; rapid purification of synthetic oligonucleotides : a convenient alternative to high - performance liquid chromatography and polyacrylamide gel electrophoresis ,&# 34 ; biotechniques 8 , 424 - 429 . 85 . alting - mees , m . a ., and short , j . m . ( 1989 ) &# 34 ; pbluescript ii : gene mapping vectors ,&# 34 ; nucelic acids res . 17 , 9494 . 86 . sambrook , j ., frisch , e . f ., and maniatis , t . ( 1989 ). molecular cloning : a laboratory manual . three volume set , cold spring harbor laboratory , new york . 87 . birnboim , h . c ., and doly , j . ( 1979 ) &# 34 ; a rapid alkaline extraction procedure for screening recombinant plasmid dna ,&# 34 ; nucleic acis res . 7 , 1513 - 1523 . 88 . sanger , f ., nicklen , s ., and coulson , a . r . ( 1977 ) &# 34 ; dna sequencing with chain terminating inhibitors ,&# 34 ; proc . natl . acad . sci . usa 74 , 5463 - 5467 . 89 . tabor , s ., and richardson , c . c . ( 1987 ) &# 34 ; dna sequence analysis with a modified bacteriophage t7 dna polymerase ,&# 34 ; proc . natl . acad . sci . usa 84 , 4767 - 4771 . 90 . kawasaki , e . s ., and wang , a . m . ( 1989 ) &# 34 ; detection of gene expression ,&# 34 ; in : pcr technology : principles and applications of dna amplification . ( erlich , h . a . ed .) stockton press , inc ., new york , n . y ., pp 89 - 97 . 91 . mccandliss , r ., sloma , a ., and pestka , s . ( 1981 ) &# 34 ; isolation and cell - free translation of human interferon mrna from fibroblasts and leukocytes ,&# 34 ; in methods in enzymology , vol . 79 ( s . pestka , ed . ), academic press , new york , 51 - 59 . 92 . chomczynski , p ., and sacchi , n . ( 1987 ) &# 34 ; single step method of rna isolation by acid guanidinium thiocyanate - phenol - chloroform extraction ,&# 34 ; anal . bioch . 162 , 156 - 159 . 93 . pellicer , a ., wigler , m ., and axel , r . ( 1978 ) &# 34 ; the transfer and stable integration of the hsv thymidine kinase gene into mouse cells ,&# 34 ; cell 14 , 133 - 14 . 94 . gross - bellard , m ., oudet , p ., and chambon , p . ( 1973 ) &# 34 ; isolation of high - molecular - weight dna from mammalian cells ,&# 34 ; eur . j biochem . 36 , 32 - 38 . 95 . saiki , r . k ., scharf , s ., faloona , f ., mullis , k . b ., hom , g . t ., erlich , h . a ., and arnheim , n . ( 1985 ) &# 34 ; enzymatic amplification of beta - globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia ,&# 34 ; science 230 , 1350 - 1354 . 96 . keohavong , p ., and thilly , w . g . ( 1989 ) &# 34 ; fidelity of dna polymerases in dna amplification ,&# 34 ; proc . natl . acad . sci . usa 86 , 9253 - 9257 . 97 . hotta , k ., collier , k . j ., and pestka , s . ( 1986 ) &# 34 ; detection of a single base substitution between human leukocyte interferon αa and α2 genes with octadecyl deoxyoligonucleotide probes ,&# 34 ; in methods in enzymology ( s . pestka , ed . ), academic press , new york 119 , 481 - 485 . 98 . hotta , k ., monahan , j ., collier , k . j ., and pestka , s . ( 1988 ) &# 34 ; detection of human leukocyte interferon αa and α2 genes in genomic dnas by the use of deoxyoctadecyloligonucleotide probes ,&# 34 ; j . interferon res . 8 , 51 - 60 . 99 . pestka , s ., and baron , s . ( 1981 ) &# 34 ; definition and classification of the interferons ,&# 34 ; in methods in enzymology ( s . pestka , ed . ), academic press , new york , 78 , 3 - 14 . 100 . pestka , s . ( 1986 ) &# 34 ; interferon standards and general abbreviations ,&# 34 ; in methods in enzymology ( s . pestka , ed . ), academic press , new york , 119 , 14 - 23 . 101 . evinger , m ., maeda , s ., and pestka , s . ( 1981 ) &# 34 ; recombinant human leukocyte interferon produced in bacteria has antiproliferative activity ,&# 34 ; j . biol . chem . 256 , 2113 - 2114 . 102 . herberman , r . b ., ortaldo , j . r ., mantovani , a ., hobbs , d . s ., kung , h .- f ., and pestka , s . ( 1982 ) &# 34 ; effect of human recombinant interferon on cytotoxic activity of natural killer ( nk ) cells and monocytes ,&# 34 ; cell immunol . 67 , 160 - 167 . 103 . rehberg , e ., kelder , b ., hoal , e . g ., and pestka , s . ( 1982 ) &# 34 ; specific molecular activities of recombinant and hybrid leukocyte interferons ,&# 34 ; j . biol . chem . 257 , 11497 - 11502 . 104 . jones , c . m ., varesio , l ., herberman , r . b ., and pestka , s . ( 1982 ) &# 34 ; interferon activates macrophages to produce plasminogen activator ,&# 34 ; j . interferon res . 2 , 377 - 386 . 105 . grant , s ., bhalla , k ., weinstein , i . b ., pestka , s ., and fisher , p . b ( 1982 ) &# 34 ; differential effect of recombinant human leukocyte interferon on human leukemic and normal myeloid progenitor cells ,&# 34 ; biochem . biophys . res . commun . 108 , 1048 - 1055 . 106 . ortaldo , j . r ., herberman , r . b ., and pestka , s . ( 1982 ) &# 34 ; augmentation of human natural killer cells with human leukocyte and human recombinant leukocyte interferon ,&# 34 ; in nk cells and other natural effector cells ( r . b . herberman , ed . ), academic press , new york , 1279 - 1283 . 107 . ortaldo , j . r ., mason , a ., rehberg , e ., moschera , j ., kelder , b ., pestka , s ., and herberman , r . b . ( 1983 ) &# 34 ; effects of recombinant and hybrid recombinant human leukocyte interferons on cytotoxic activity of natural killer cells ,&# 34 ; j . biol . chem . 258 , 15011 - 15015 . 108 . fisher , p ., miranda , a . f ., babiss , l . e ., pestka , s ., and weinstein , i . b . ( 1983 ) &# 34 ; opposing effects of interferon produced in bacteria and of tumor promoters on myogenesis in human myoblast cultures ,&# 34 ; proc . natl . acad . sci . u . s . a . 80 , 2961 - 2965 . 109 . sen , g . c ., herz , r . e ., davatelis , v ., and pestka , s . ( 1984 ) &# 34 ; antiviral and protein - inducing activities of recombinant human leukocyte interferons and their hybrids ,&# 34 ; j . virol . 50 , 445 - 450 . 110 . giacomini , p ., aguzzi , a ., pestka , s ., fisher , p . b ., and ferrone , s . ( 1984 ) &# 34 ; modulation by recombinant dna leukocyte ( α ) and fibroblast ( β ) interferons of the expression and shedding of hla and tumor associated antigens by melanoma cells ,&# 34 ; j . immunol . 133 , 1649 - 1655 . 111 . greiner , j . w ., hand , p . h ., noguchi , p ., fisher , p . b ., pestka , s ., and schlom , j . ( 1984 ) &# 34 ; enhanced expression of surface tumor - associated antigens on human breast and colon tumor cells after recombinant human leukocyte α - interferon treatment ,&# 34 ; cancer res . 44 , 3208 - 3214 . 112 . fisher , p . b ., prignoli , d . r ., hermo , h ., jr ., weinstein , i . b ., and pestka , s . ( 1985 ) &# 34 ; effects of combined treatment with interferon and mezerein on melanogenesis and growth in human melanoma cells ,&# 34 ; j . interferon res . 5 , 11 - 22 . 113 . grant , s ., bballa , k ., weinstein , i . b ., pestka , s ., mileno , m . d ., and fisher , p . b . ( 1985 ) &# 34 ; recombinant human interferon sensitizes resistant myeloid leukemic cells to induction of terminal differentiation ,&# 34 ; biochem . biophys . res . commun . 130 , 379 - 388 . 114 . guadagni , f ., schlom , j ., johnston , w . w ., szpak , c . z ., goldstein , d ., smalley , r ., simpson , j . f ., borden , e . c ., pestka , s ., and greiner , j . w ., ( 1989 ) &# 34 ; selective interferon - induced enhancement of tumor - associated antigens on a spectrum of freshly isolated human adenocarcinoma cells ,&# 34 ; j . natl . cancer inst . 81 , 502 - 512 . 115 . sperber , s . j ., gocke , d . j ., haberzettl , c ., kuk , r ., schwartz , b ., and pestka , s . ( 1992 ) &# 34 ; anti - hiv - 1 activity of recombinant and hybrid species of interferon alpha ,&# 34 ; j . interferon res . 12 , 363 - 368 . 116 . huber , c ., flener , r ., and gastl , g . ( 1985 ) &# 34 ; interferon - alpha - 2c in the treatment of advanced hairy cell leukemia ,&# 34 ; oncology 42 , suppl 1 , 7 - 9 . 117 . foon , k . a ., maluish , a . e ., abrams , p . g ., wrightington , s ., stevenson , h . c ., alarif , a ., fer , m . f ., overton , w . r ., and poole , m . ( 1986 ) &# 34 ; recombinant leukocyte a interferon therapy for advanced hairy cell leukemia ,&# 34 ; am . j med . 80 , 351 - 356 . 118 . steis , r . g ., smith , j . w . ii , urba , w . j ., clark , j . w ., itri , l . m ., evans , l . m ., schoenberge , c ., and longo , d . l . ( 1988 ) &# 34 ; resistance to recombinant interferon alfa - 2 in hairy cell leukemia associated with neutralizing anti - interferon antibodies ,&# 34 ; new engl . j med . 318 , 1409 - 1413 . 119 . von wussow , p ., freund , m ., hartmann , f ., diedrich , h ., poliwoda , h ., and deicher , h . ( 1987 ) &# 34 ; anti interferon antibodies : pharmokinetics and clinical significance ,&# 34 ; j . interferon res . 7 , 680 . 120 . freund , m ., von wussow , p ., diedrich , h ., eisert , r ., link , h ., wilke , h ., buchholz , f ., leblanc , s ., fonatsch , c ., deicher , h ., and poliwoda , h . ( 1989 ) &# 34 ; recombinant human interferon ( ifn ) alpha - 2b in chronic myelogenous leukemia : dose dependency of response and frequency of neutralizing anti - interferon antibodies ,&# 34 ; br . j haematol . 72 , 350 - 356 . 121 . itri , l . m ., campion , m ., dennin , r . a ., palleroni , a . v ., gutterman , j . o ., groopman , j . e ., and trown , p . w . ( 1987 ) &# 34 ; incidence and clinical significance of neutralizing antibodies in patients receiving recombinant interferon alpha - 1a by intramuscular injection ,&# 34 ; cancer 59 , 668 - 674 . 122 . moormeier , j . a ., westbrook , c . a ., ratain , m . j ., and golomb , h . m . ( 1989 ) &# 34 ; interferon alfa - 2b antibodies and clinical resistance in a patient with hairy cell leukemia ,&# 34 ; leuk . lymphoma 1 , 43 - 45 . 123 . quesada , j . r ., rios , a ., swanson , d . a ., trown , p ., and gutterman , j . u . ( 1985 ) &# 34 ; antitumor activity of recombinant - derived interferon alpha in metastatic renal cell carcinoma ,&# 34 ; j . clin . oncol . 3 , 1522 - 1528 . 124 . antonelli , g ., currenti , m ., turriziani , o ., and dianzani , f . ( 1991 ) &# 34 ; neutralizing antibodies to interferon α : relative frequency in patients treated with different interferon preparations ,&# 34 ; j . infect . dis . 163 , 882 - 885 . 125 . colamonici , o ., porterfield , b ., and diaz , m . o . ( 1991 ) &# 34 ; interferon sensitivity of human leukemia cell lines with and without deletion of the interferon genes ,&# 34 ; j . interferon res . 11 , s54 . 126 . grande r , d ., heyman , m ., bro ndum - nielsen , k ., liu , y ., lundgren , e ., so derha ll , s ., and einhorn , s . ( 1992 ) &# 34 ; interferon system in primary acute lymphocytic leukemia cells with or without deletions of the α / β - interferon genes ,&# 34 ; blood 79 , 2076 - 2083 . 127 . nishimura , a ., morita , m ., nishimura , y . and sugino , y . ( 1990 ) &# 34 ; a rapid and highly efficient method for preparation of competent escherichia coli cells ,&# 34 ; nucleic acids research 18 , 6169 . 128 . lee , s . and rashid , s . ( 1990 ) &# 34 ; a simple procedure for maximum yield of high - quality plasmid dna ,&# 34 ; biotechniques 9 , 676 - 679 . 129 . mashko , s . v ., veiko , v . p ., lapidus , a . l ., lebedeva , m . i ., mochculsky , a . v ., shechter , i . i ., trukhan , m . e ., ratmanova , k . i ., rebentish , b . a ., kaluzhsky , v . e . and debabov , v . g . ( 1990 ) tgatg vector : a new expression system for cloned foreign genes in escherichia coli cells . gene 88 , 121 - 126 . 130 . caruthers , m . h ., barone , a . d ., beaucage , s . l ., dodds , d . r ., fisher , e . f ., mcbride , l . j ., matteucci , m ., stabinsky , z ., tang , j . y . ( 1987 ) &# 34 ; chemical synthesis of deoxyoligonucleotides by the phosphoramidite method ,&# 34 ; methods in enzymology 154 , 287 - 313 . 131 . wang , p ., izotova , l ., mariano , t . m ., donnelly , r . j . and pestka , s . ( 1994 ) &# 34 ; construction and activity of phosphorylatable human interferon - αb2 and interferon - αa / d .&# 34 ; j . interferon res . 14 , 41 - 46 . 132 . laemmli , u . k . ( 1990 ) cleavage of structural proteins during the assembly of the head of bacteriophage t4 . nature ( london ) 227 : 680 - 685 . 133 . familletti , p . c ., rubinstein , s ., and pestka , s . ( 1981 ) &# 34 ; a convenient and rapid cytopathic effect inhibition assay for interferon ,&# 34 ; in methods in enzymology , vol . 78 ( s . pestka , ed . ), academic press , new york , 387 - 394 . 134 . staehelin , t ., hobbs , d . s ., kung , h .- f ., lai , c .- y ., and pestka , s . ( 1981 ) &# 34 ; purification and characterization of recombinant human leukocyte interferon ( iflra ) with monoclonal antibodies ,&# 34 ; j . biol . chem . 256 , 9750 - 9754 . 135 . pestka , s . ( 1981 ) &# 34 ; standard media and general abbreviations ,&# 34 ; in methods in enzymology , vol . 78 ( s . pestka , ed . ), academic press , new york , 22 - 25 . 136 . bradford , m . m . ( 1976 ) &# 34 ; a rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein - dye binding ,&# 34 ; anal . biochem . 72 , 248 - 254 . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 12 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 18 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 1 : tgggctgtgatctgcctc18 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 22 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 2 : catgatttctgctctgacaacc22 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 18 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 3 : aacccacagcctgggtag18 ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 25 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 4 : gcgggccccaatggccytgyccttt25 ( 2 ) information for seq id no : 5 :( i ) sequence characteristics :( a ) length : 24 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 5 : gctctagaaytcatgaaagygtga24 ( 2 ) information for seq id no : 6 :( i ) sequence characteristics :( a ) length : 17 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 6 : cttgaaggacagacatg17 ( 2 ) information for seq id no : 7 :( i ) sequence characteristics :( a ) length : 17 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 7 : ctgtcctccatgagatg17 ( 2 ) information for seq id no : 8 :( i ) sequence characteristics :( a ) length : 17 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 8 : ggtcattcagctgctgg17 ( 2 ) information for seq id no : 9 :( i ) sequence characteristics :( a ) length : 17 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 9 : tcctccttcatcagggg17 ( 2 ) information for seq id no : 10 :( i ) sequence characteristics :( a ) length : 17 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 10 : attaaccctcactaaag17 ( 2 ) information for seq id no : 11 :( i ) sequence characteristics :( a ) length : 17 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 11 : taatacgactcactata17 ( 2 ) information for seq id no : 12 :( i ) sequence characteristics :( a ) length : 570 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : genomic dna ( xi ) sequence description : seq id . no : 12 : atggccttg9metalaleu23tccttttctttactgatggtcgtgctggtactcagctacaaatcc54serpheserleuleumetvalvalleuvalleusertyrlysser20 - 15 - 10atctgctctctgggctgtgatctgcctcagacccacagcctgcgt99ilecysserleuglycysaspleuproglnthrhisserleuarg51510aataggagggccttgatactcctggcacaaatgggaagaatctct144asnargargalaleuileleuleualaglnmetglyargileser152025cctttctcctgcttgaaggacagacatgaattcagattcccagag189prophesercysleulysasparghisglupheargpheproglu303540gaggagtttgatggccaccagttccagaagactcaagccatctct234gluglupheaspglyhisglnpheglnlysthrglnalaileser455055gtcctccatgagatgatccagcagaccttcaatctcttcagcaca279valleuhisglumetileglnglnthrpheasnleupheserthr606570gaggactcatctgctgcttgggaacagagcctcctagaaaaattt324gluaspserseralaalatrpgluglnserleuleuglulysphe758085tccactgaactttaccagcaactgaatgacctggaagcatgtgtg369serthrgluleutyrglnglnleuasnaspleuglualacysval9095100atacaggaggttggggtggaagagactcccctgatgaatgaggac414ileglngluvalglyvalglugluthrproleumetasngluasp105110115tccatcctggctgtgaggaaatacttccaaagaatcactctttat459serileleualavalarglystyrpheglnargilethrleutyr120125130ctaacagagaagaaatacagcccttgtgcctgggaggttgtcaga504leuthrglulyslystyrserprocysalatrpgluvalvalarg135140145gcagaaatcatgagatccctctcgttttcaacaaacttgcaaaaa549alagluilemetargserleuserpheserthrasnleuglnlys150155160agattaaggaggaaggattga570argleuargarglysaspend165__________________________________________________________________________

US-25778494-A

a hunting seat including a planar cushion provided with a transverse anchor pad is described . the anchor pad it substantially thicker than the cushion so that it secures the position of a user and provides leveling on hilly terrain . preferably , the anchor pad is detachable .

there is shown in fig1 a perspective view of a first embodiment of a hunting seat 10 constructed in accordance with the present invention . the hunting seat includes a planar cushion portion 12 as well as a transverse anchor member 14 attached with straps 16 , 18 which pass about the anchor member and through slots 20 , 22 , 24 , and 26 . the anchor member is thus detachably secured to the cushion . the straps may be provided with buckles if so desired , or more preferably be provided with velcro ® fastener portions which serve to fasten them . planar cushion 12 is made of a polymer foam and may be flat or scalloped if so desired . preferred materials are elastomeric foams so that the cushion is flexible and will readily deform upon application of the weight of a user . particularly preferred materials are closed - cell elastomeric urethane foams and closed - call elastomeric polyester foams . generally , cushion 12 is rectangular as shown and is wide enough , that is the lateral dimension is long enough to extend over the entire seat of a user . an additional strap , 28 , is provided through another slot 30 in cushion 12 in order to attach the hunting seat to the belt of a user . fig2 is a view in elevation of hunting seat 10 wherein the relative dimensions of the seat can be more readily appreciated . the planar cushion member 12 is typically from about 1 / 4 inch to 2 inches in thickness . as noted , the cushion may be scalloped but is more typically simply of uniform thickness . anchor member 14 is shown in fig2 to be cylindrical with a central cavity 32 along its longitudinal axis . the anchor may also be of other shapes and is made of a polymer foam preferably of the type generally used to make cushion 12 ; particularly preferred materials being closed - cell elastomeric polymer foams of either elastomeric polyurethane or elastomeric polyester . anchor 14 has a diameter at least 1 . 5 times the thickness of cushion 12 . more preferably the thickness of anchor member is a least twice the thickness of cushion 12 and even more preferably at least three or at least four times the thickness of the cushion . in connection with a cylindrical anchor member , the thickness referred to is the diameter of the cylinder . if another profile is used for the anchor , the thickness of the anchor referred to herein is the thickness of the anchor in the direction perpendicular to the outer surface 34 of the hunting seat . anchor 14 extends across the entire transverse direction of the rectangular cushion 12 at the lower extremity 36 of cushion 12 substantially parallel to edge 38 thereof as can be seen in fig1 and fig2 . fig3 is a plan view of the inner surface 40 of the hunting seat shown in fig1 and 2 . when in use , the seat 10 is worn such that surface 40 is adjacent the wearer , as shown in fig4 and 5 . seat 10 is suspended by way of strap 28 from a belt 42 of a user such that lower extremity 36 is above knee level and below the buttocks . anchor member 14 is thus between knee level and the level of the buttocks as can be seen . in fig4 straps 16 , 18 are shown with buckles for holding anchor member 14 in its appropriate position near edge 36 . fig6 illustrates operation of the hunting seat . cushion 12 is readily deformed by the weight of a user to conform to the contours of the ground . anchor member 14 frictionally engages the ground and provides a leveling effect . the user will thus be prevented from sliding down an inclined surface . member 14 is sufficiently stiff so that it will not completely deform and will provide the requisite elevation . typically , anchor member 14 will retain at least about 90 percent of its thickness under the weight of a user so that the anchor member remains functional to elevate extremity 36 of seat 10 . there is shown in fig7 an alternate embodiment of the inventive hunting seat . in this embodiment the user dons a vest 175 wherein cushion 112 is stitched onto the vest as indicated at 150 , along the entire upper edge 144 of the rectangular cushion 112 . when cushion 112 is suspended downwardly from the stitching indicated at 150 , anchor member 114 is above knee level and below the buttocks as shown while outer surface 134 faces away from the user . straps 118 , 116 are preferably velcro ® fastener material adapted to fasten onto retaining patches 155 , 160 . the hunting seat can thus be folded upwardly onto the back of a user by way of straps 116 , 118 fastening onto patches 155 , 160 as shown in fig8 . when so positioned , the inner surface 140 faces away from the user and the seat does not interfere with movement . there are shown in fig9 three cylinders 214 , 314 and 414 as seen from an end thereof . the cylinders range in diameter ( thickness ) from about 3 to about 6 times the thickness of cushion portion 12 , that is , the diameter of cylinder 214 is 3 times the thickness of cushion 12 , the diameter of cylinder 314 is about 4 . 5 times the thickness of cushion 12 and the diameter of cylinder 414 is about 6 times the length of cushion 12 . any one of cylinders 214 , 314 or 414 is of suitable length so it may be substituted for cylinder 14 of fig1 . in this way , the hunting seat can be adjusted to suit the preference of the wearer and to be more suitable for the particular terrain involved . the cylinders are so attached one at a time , or in other words , exclusively attached depending on the degree of leveling desired . the invention has been described above for purposes of exemplification only . numerous modifications may be made within the spirit and scope of the present invention which is limited and defined by the appended claims .

US-5601698-A

apparatus for infusion and removal of samples of blood and other body fluids comprising a blood connection which is connected via a first line to a sample taking means , a pump connected to the first line , a container connected to the first line via a second line and containing an aqueous fluid , a first shut - off means connected into the second line and a control means for activating the first shut - off means and the pump , the control means switching the shut - off means and the blood pump alternately into fluid supply mode and blood removal mode .

a first embodiment of the apparatus 1 according to the invention shown in fig1 for taking samples and infusion comprises a blood connection 2 which can be made in the form of a conventional catheter . the blood connection 2 is inserted into the patient represented in fig1 by means of the circle 3 . connected to the blood connection 2 via a connector 4 is a line system which in the example of embodiment consists of four line sections 6 , 7 , 8 and 9 . connected to the line section 6 is a first branch line 10 in which a shut - off means 11 is disposed and which communicates with an infusion solution container 12 . further connected to the first line section 6 is a second branch line 13 which communicates with a pump 14 which is preferably constructed as pneumatically driven pump . furthermore , in the line section 6 between the blood connection 2 and the branch line 10 a shut - off means 15 is disposed . a further shut - off means 16 is disposed in the line section 6 between the pump 14 and a branch point 17 in the line section 6 and the line section 7 . provided in the line section 8 is a measuring means 18 by means of which the blood parameters to be investigated can be determined . furthermore , the line section 8 has an air detector 19 and a further shut - off means 20 which is disposed between the measuring means 18 and the return point 21 of the line section 9 in the line section 6 . furthermore , a schematically simplified control means 22 is provided serving to control the shut - off means 11 , 15 , 16 and 20 . below , the principle of the mode of operation of the apparatus 1 according to the invention will be described . by the preferably pneumatically driven pump 14 by suitable switching of the shut - off means 11 , 15 , 16 and 20 as desired either blood can be taken from the patient or infused back via the measuring and / or sample taking means 18 ( hereinafter sample taking means 18 ) or infusion solution from the infusion solution container 12 infused into the patient . for this purpose for taking samples the shut - off means 11 , 16 and 20 are closed whilst the shut - off means 15 is open . in this state the pneumatic pump 14 can extract blood from the patient . once the suction operation is terminated the shut - off means 15 is closed and the shutoff means 16 and 20 are opened . the pump 14 then compresses and conveys the extracted blood via the sample taking means 18 back into the patient . once the sample taking and measurement are concluded the apparatus 1 according to the invention can be switched over to infusion . for this purpose the shut - off means 15 is first closed whilst for drawing off infusion solution the shut - off means 11 is opened . thereafter for the infusion the shut - off means 11 is closed again whereas the shut - off means 16 and 20 are opened . in this state of the shut - off means the infusion solution drawn off by the pump 14 is supplied to the patient via the line sections 7 , 8 , 9 and the portion of the line section 6 leading from the connector 4 to the return point 21 . as an alternative to this switching of the shut - off means described above it is however also possible after the drawing off of the infusion solution to close the shut - off means 16 and open and shut - off means 15 , whereafter the infusion solution can be conveyed directly to the patient via the line section 6 . the following marginal conditions are to be observed for the function of the apparatus 1 : the region of the line section 6 between the point 21 and the shut - off means 15 which is not continuously flushed through should be kept as short as possible to stop blood becoming stationary therein and coagulating . the pump volume of the pneumatic pump 14 should be made large enough the ensure that the blood or fluid is not moved simply to and fro but in fact taken from the patient and returned again . this means that the pump volume of the pump 14 must be appreciably greater than the filling volume of the catheter up to the point 21 . in this respect the previously described second possibility for infusion only via the line section 6 has the advantage that in this manner blood disposed in this region of the apparatus can be returned to the patient by means of the infusion solution . if the two previously described infusion possibilities are carried out in succession it is possible in this manner to free the entire apparatus from blood residues . fig2 shows a constructionally simplified embodiment of the apparatus 1 according to the invention . in the following description identical parts are provided with the same reference numerals as in fig1 . as apparent from the illustration the embodiment of the apparatus 1 illustrated in fig2 has only two shut - off means 15 and 11 which are disposed in the line section 6 or in the in this case only branch line 10 . as regards its function the second embodiment differs from the first in that in the sample taking mode the blood is not circulated but merely pumped forwards and backwards . for taking a sample the pump 14 is first compressed , the valve or shut - off means 11 closed and the valve or shut - off means 15 opened . blood can then be withdrawn , initially infusion solution being sucked back from the blood connection 2 and blood then following . at the upper dead centre of the pump 14 a sample can then be taken , whereafter the blood is infused back . thereupon the pump 14 is operated as infusion pump , in the withdrawal operation the shut - off means 15 being closed whilst the shut - off means 11 is open . on conveying infusion solution , however , the shut - off means 11 is closed and the shut - off means 15 open . as regards the functionability of this embodiment it must be assumed that the pump volume of the pump 14 is substantially greater than the volume of the line from the pump 14 up to the end of the blood connection 2 . as apparent from fig1 and 2 the pump serves to convey the infusion solution or the blood or body fluids . advantageously , said pump 14 is constructed as pneumatic pump and as shown in fig1 and 2 comprises a pump chamber ( 24 ) which is divided by a flexible membrane or diaphragm ( 25 ) into a first pump chamber section ( 26 ) and a second pump chamber section ( 27 ). the two first and second pump chamber regions form together the internal volume v 1 of the pump chamber ( 24 ). the flexible membrane ( 25 ) can move in opposite directions , depending on the operating phase of the pump , the compression or expansion phase , until it bears completely on the inner wall of the pump chamber . this is for example shown in the embodiment of fig2 in the expansion state of the pump 14 . as apparent from the drawings the pump chamber ( 24 ), in particular the second pump chamber portion ( 27 ) is connected via a connecting line ( 32 ) to the drive member ( 28 ) consisting of a pneumatically operated bellows ( 29 ), a drive motor ( 30 ) and a valve unit ( 31 ). the first pump chamber portion ( 26 ) is however connected to the line section ( 6 ) via a further connecting line ( 33 ). it should be mentioned that this intermediate line ( 33 ) can also be omitted , i . e . the first pump chamber portion ( 26 ) can be connected directly into the line ( 6 ). the bellows ( 29 ) can either be compressed or expanded by the drive motor ( 30 ), the switching of the pump ( 14 ) from the one to the other phase taking place at the lower and upper dead centres of the pump . synchronously with this switchover the switching over of the shut - off members ( 11 , 15 , 16 and 20 ) to the other operating phase by the control unit ( 22 ) takes place . finally , it is pointed out that the valve unit ( 31 ) can be used for venting the connecting line ( 32 ) and thus the bellows ( 29 ) in accordance with a predetermined program as for example described in de - os no . 3 , 205 , 449 corresponding to u . s . pat . no . 4 , 552 , 552 , incorporated herein be reference , which also describes such a bellows pump . as already mentioned the internal volume v 1 of the pump chamber ( 24 ) is substantially greater than the internal volumes of the lines including the catheter so as to prevent a pumping to and fro of the infusion solution or the blood in the line system . preferably , the volume of the pump chamber is at least twice as great as the total internal volume of the line system . as already mentioned as sample taking unit ( 18 ) an electrochemical sensor system may be used with which advantageously selectively specific blood parameters , for example sodium , potassium or calcium ions , may be detected . such an arrangement is described for example in de - os corresponding to u . s . patent application ser . no . 06 / 732 , 022 to the disclosure of which express reference is made . of advantage when using electrochemical sensors is the fact that the solution to be infused because of its constant composition can be used as flushing solution and calibration standard for the electrochemical sensor between respective determinations of the blood parameters so that every time the exactly calibrated measuring arrangement is available for the measurement to be carried out . it is additionally pointed out that the apparatus described need not necessarily be simultaneously used as infusion pump . however , to avoid coagulation of the blood it is advantageous after the measurement to at least flush free the sample taking and measuring means with an infusion solution . if part of this solution is also infused into the patient this part must be included in the calculation of the fluid and substance balance .

US-88412886-A

a spice grinder includes a hollow container having a first opening and a second opening respectively communicating with exterior of the container , a skirt rotatably mounted around the hollow container , a hollow cap detachably supported by the skirt so as to alternately close the communication between an interior and the exterior of the hollow container , the hollow cap having multiple slits defined in a top face thereof and being provided for receiving therein condiment and a grinding device for grinding spice received in the hollow container .

with reference to fig1 and 2 , the spice grinder in accordance with the present invention includes a hollow container ( 10 ) having a first opening ( 11 ) and a second opening ( 12 ), a cap ( 30 ) detachably mounted on one of the first opening ( 11 ) and the second opening ( 12 ) of the container ( 10 ) ( the cap ( 30 ) is detachably mounted on the first opening ( 11 ) of the container ( 10 ) in this embodiment ) and a grinding mechanism ( 40 ) inside the container ( 10 ). the container ( 10 ) has a neck ( 13 ) formed on a top portion of the container ( 10 ) and a skirt ( 20 ) securely connected to the neck ( 13 ). the skirt ( 20 ) has a tapered inner side wall ( 21 ), ribs ( 22 ) extending from the tapered inner side wall ( 21 ) toward a center of the skirt ( 20 ), an assembly hole ( 23 ) defined in the joint of the ribs ( 22 ) and gaps ( 24 ) defined between two adjacent ribs ( 22 ). furthermore , a cutout ( 25 ) is defined in a lower portion of the tapered inner side wall ( 21 ) to correspond to and receive therein the neck ( 13 ) of the container ( 10 ). a pad ( 26 ) is sandwiched between a top face of the neck ( 13 ) and a side face defining the cutout ( 25 ) to reduce friction between the container ( 10 ) and the skirt ( 20 ) after the neck ( 13 ) is received in the cutout ( 25 ). the cap ( 30 ) is hollow and supported by the skirt ( 20 ). that is , the cap ( 30 ) stops communication between an interior of the container ( 10 ) and an exterior of the container ( 10 ) when the cap ( 30 ) is situated in and supported by the skirt ( 20 ). the cap ( 30 ) has a top face ( 31 ) provided with multiple slits ( 311 ) to allow a communication between an interior of the cap ( 30 ) and an exterior of the cap ( 30 ), and a bottom face formed by a resilient plate ( 32 ). the cap ( 30 ) has a flange ( 312 ) extending outward from a bottom edge of the cap ( 30 ) and the bottom face ( 32 ) of the cap ( 30 ) has a bend ( 321 ) integrally formed with the bottom face ( 32 ) to enclose the flange ( 312 ) so that when the cap ( 30 ) is situated in and supported by the skirt ( 20 ), engagement between the bend ( 321 ) and the tapered inner side wall ( 21 ) seals the communication of the gaps ( 24 ) with exterior of the container ( 10 ). the grinding mechanism ( 40 ) includes a driving shaft ( 41 ) having a first end securely extending into the assembly hole ( 23 ) of the skirt ( 20 ) and a second end , a positioning seat ( 42 ) fixedly mounted inside the container ( 10 ) and having arms ( 422 ) inclinedly and convergently extending upward to form a supporting ring ( 423 ) by free ends of the arms ( 422 ), a first tapered block ( 43 ) securely received inside the positioning seat ( 42 ) and provided with multiple first grooves ( 431 ) defined in an inner face of the first tapered block ( 43 ) and a second tapered block ( 45 ) securely connected to the second end of the driving shaft ( 42 ) and received in the first tapered block ( 43 ). the second tapered block ( 45 ) has multiple second grooves ( 451 ) defined in an outer face of the second tapered block ( 45 ) to correspond to the first grooves ( 431 ). a spring ( 44 ) is sandwiched between the supporting ring ( 423 ) and a top face of the second tapered block ( 45 ) to constantly apply a force to the second tapered block ( 45 ) to maintain the second tapered block ( 45 ) apart from the first tapered block ( 43 ) for a distance . a cover ( 46 ) is also threadingly connected to the second end of the driving shaft ( 41 ) to sandwich the second tapered block ( 45 ) with the spring ( 44 ). because the cover ( 46 ) is threadingly connected to the second end of the driving shaft ( 41 ), rotation of the cover ( 46 ) relative to the driving shaft ( 41 ) is able to adjust the distance between the first tapered block ( 43 ) and the second tapered block ( 45 ). furthermore , the first grooves ( 431 ) have a direction opposite to that of the second grooves ( 451 ). with reference to fig3 , when the spice grinder is in use , the cap ( 30 ) is removed to allow the interior of the container ( 10 ) to communicate with the exterior of the container ( 10 ) via the gaps ( 24 ) such that condiment particles are able to be fed into the container ( 10 ) via the gaps ( 24 ) and the first opening ( 11 ) of the container ( 10 ). after the condiment particles are fed into the container ( 10 ), rotation of the skirt ( 20 ) will facilitate the rotation of the driving shaft ( 41 ) as well as the second tapered block ( 45 ) and thus the condiment particles between the first tapered block ( 43 ) and the second tapered block ( 45 ) will be ground . the ground condiment powder will then be dispersed out of the container ( 10 ). when another condiment is required , the user is able to remove and then reverse the cap ( 30 ) to allow the condiment received inside the hollow cap ( 30 ) to escape from the cap ( 30 ) via the slits ( 311 ). while the cap ( 30 ) is removed for dispersing condiment , the spice grinder is still kept standing upright . that is , inside the spice grinder , the ground spice powder is kept at the bottom of the container ( 10 ) and the unground spice is kept away from direct engagement with air so that the unground spice is able to keep its freshness . it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .

US-94597904-A

the present invention provides an improved hoop - type amusement device adapted with a counter for counting the number of revolutions achieved by the user . the counter is preferably adapted for attachment to any of a variety of hoop type devices , including the hula hoop , as well as specially configured hoop type devices , such as the type that may be formed from a plurality of variously sized and shaped connectable components that are selectively interconnected by the user to form a simple or complex hoop configuration of a particular desired size and shape . the counter functions to count the number of revolutions achieved by the user thereby allowing the user to monitor and gage performance .

with reference now to the drawings , fig1 - 14 show hoop - type amusement device , generally referenced as 10 , adapted with a counter 20 in an operational position in accordance with the present invention . fig1 shows counter 20 in relation with a complex hoop - type amusement device , including an inner annular hoop member 12 and an outer octagonal hoop member 14 secured in concentric relation by connectors 16 . device 10 provides a hoop - type amusement device that rotates about the user in response to movement and gyrations produced by the user thus providing the source of amusement . in the operation of the hoop - type amusement device 10 , one point of the inner surface of the inner annular hoop member 12 remains in contact with the hips of the user , such that during one complete rotation of the device 10 , virtually every point in the entire surface of the inner annular member 12 makes contact with the hip of the user just once . as best illustrated in fig4 - 6 , counter 20 is preferably adapted to function as either a mechanical or electrical tally counter device , and is specifically configured for attachment to a portion of hoop - type amusement device 10 . counter 20 includes a housing 22 having a c - shaped connector , generally referenced as 24 . c - shaped connector 24 is preferably sized and shaped so as to allow for removable attachment of counter housing 22 to inner annular member 12 thereby allowing for removable attachment of counter 20 . as should be apparent , c - shaped connector 24 fits tightly enough around the inner annular member 12 to ensure that the counter remains rigidly secured during the operation of the hoop - type amusement device 10 . counter 20 further includes a counter actuator arm 26 pivotally connected thereto and projecting from housing 22 . when counter 20 is in operative engagement with hoop inner annular member 12 actuator arm 26 projects into the void formed radially within the inner angular member 12 . actuator arm 26 terminates in an end portion that is bent upwards so that the bottom of the actuator creates a flat surface that makes contact with the user when the actuator is triggered . as the hoop - type amusement device 10 rotates around the hips of the user , the counter actuator arm 26 is caused to move by contact with the user &# 39 ; s body once during every rotation . in turn , every actuation of counter actuator arm 26 represents one full rotation of the hoop - type amusement device 10 about the user . the number of times the counter actuator arm 26 is activated represents the total number of times the hoop - type amusement device 10 has rotated completely around the user . counter housing 22 further includes a transparent window 28 for displaying the tally to the user . as should be apparent , the tally is continuously updated in real time during the operation of the hoop - type amusement device 10 and actuation of arm 26 . counter 20 further includes a reset knob 29 to allow the user to reset the counter back to zero , or any other desired count . a counter resetting actuator 29 protrudes from the sidewall 10 of the counter housing 22 . resetting actuator 29 is used to re - set the number that is presented on the counter display to a specific number , such as zero . the number on the display can also be reset to any number depending on the preference of the user . the counter resetting actuator 29 is preferably a rotatable knob that is turned in either a clockwise or counter clockwise direction , however any suitable reset actuator structure is considered within the scope of the present invention . counter 20 can be attached to the hoop - type amusement device 10 through any suitable means . in the preferred embodiment , counter 20 is attached through a simple c - shaped connector 24 . c - shaped connector 24 consists of two c - shaped extension pieces , referenced as 24 a and 24 b , which extend from opposing lateral ends of the bottom front side of the counter housing 22 . c - shaped extension pieces 24 a and 24 b fit around the innermost member of the hoop - type amusement device 10 forming a secure connection as to limit the lateral and vertical displacement of the counter 20 during the operation of the device 10 . in a preferred attachment embodiment , counter 20 is mounted in a position so that the front of the housing 22 faces the center of the hoop - type device 10 and the display window 28 faces vertically upward . fig7 - 13 present an alternative embodiment of the present invention , wherein the counter is adapted for attachment to a component connector coupling multiple members that axe used to form a complex hoop - type device 10 . the complex device configuration can consist of multiple members of varying shapes that are each coupled together . specifically , fig8 shows a connector member 30 for use in forming an octagonal outer hoop 14 concentrically disposed around an inner circular hoop member 12 . a plurality of connectors referenced as 30 are disposed in engagement with inner member 12 , and the intersection point of two sides of the octagonal outer member 14 as best seen in fig1 . each connector 30 functions as a coupler for connecting individual side members 40 to form a complete octagonal outer member 14 , and further functions to couple octagonal outer member 14 with inner member 12 . accordingly , each connector 30 includes a first pair of tubular openings 32 that receive members forming the outer hoop member , and a second pair of tubular openings 34 that receive members forming the inner hoop member . in addition , inserts 42 may be provided to allow for the connection of members 40 to form an enlarged hoop configuration . connector 30 further includes a raised , generally cylindrical , mount 36 that functions to receive a counter 20 in press fit engagement therewith . in this embodiment , counter housing 22 is attached to a mount 36 on one of the connectors 30 . in turn , the connectors 30 receive hoop side members 40 which form each side of the octagonal shaped outer member 14 . as should be apparent , counter 20 is positioned so that the c - shaped connector 24 , which protrudes from counter housing 22 extends inwards towards the center of the hoop - type device 10 . more particularly , the c - shaped connector 24 fits around the inner circular member 12 , thereby connecting the inner member 12 to the outer member 24 . counter actuator arm 26 extends from the bottom of the counter housing 22 , and projects radially inward so as to be in position to engage a portion of the user &# 39 ; s body as the hoop rotates . as with the previous disclosed embodiment of the present invention , activation of the counter actuator arm 26 causes the number stored by counter mechanism to increase by a value of one for each actuation / revolution . since the counter actuator piece 30 can only be activated once during a full rotation of the hoop - type amusement device 10 , the value stored by the counter mechanism represents the total number of rotations performed in the operation of the device 10 . as noted above , a reset actuator 29 extends from the side of counter housing 22 into the space between the inner and outer members 12 and 14 . the reset actuator 29 can be but is not limited to a winding knob . by turning the winding knob in a specific direction , the reset actuator 29 is activated , and the number stored by the counter mechanism is set to a desired value . the instant invention has been shown and described herein in what is considered to be the most practical and preferred embodiment . it is recognized , however , that departures may be made therefrom within the scope of the invention and that obvious structural and / or functional modifications will occur to a person skilled in the art .

US-201113267079-A

a sunscreen composition containing a uv - a dibenzoylmethane derivative , such as 4 -- 4 &# 39 ;- methoxydibenzoylmethane , and a stabilizer / solubilizer for the dibenzoylmethane derivative having formula : ## str1 ## these long branched chain alkyl salicylates having a c 4 branch at the 2 position are quite effective in stabilizing the dibenzoylmethane derivative uv - b filter compounds making them more effective ; effective for longer periods of time .

the sunscreen compositions of the present invention include about 0 . 5 % to about 5 %, preferably about 0 . 5 % to about 3 % of a dibenzoylmethane derivative uv - a filter compound , such as 4 -( 1 , 1 - dimethylethyl )- 4 &# 39 ;- methoxy - dibenzoylmethane ( parsol ® 1789 ) and about 1 % to about 10 % by weight of a branched chain salicylate stabilizer / solubilizer for the dibenzoylmethane derivative , having formula ( i ): ## str7 ## the compounds of formula ( i ) are formed by typical esterification and transesterification reactions as follows : ## str8 ## ______________________________________loading formula for butyloctyl salicylate ( preferred formula ( i )) synthesisreactants weight % ______________________________________hydroxybenzoic acid 40 . 32 - butyloctanol ( isofol 12 ) 59 . 7m . s . a . * ( 99 . 9 %) 0 . 2sodium hypophosphite 0 . 015 ** ______________________________________ * methane sulfonic acid catalyst ** based on the weight of hydroxybenzoic acid preferably , the compositions of the present invention include one or more branched chain alkyl benzoates of formula ( ii ) that act as solvents and emollients in the composition : ## str9 ## the benzoates of formula ( ii ) can be synthesized as follows : ## str10 ## ______________________________________loading formula for 40 % 2 - butyloctylbenzoate / 60 % 2 - hexyldecyl benzoatereactants weight % ______________________________________methylbenzoate 40 . 82 - butyloctyl alcohol 22 . 4 lbs . ( isofol 12 ) 2 - hexyldecyl alcohol 36 . 8 lbs . ( isofol 16 ) catalyst fascat 9102 * 0 . 03 %** sodium hypophosphite 0 . 015 %** sorbamol 1 . 5 %** dicalite 0 . 75 %** ______________________________________ * butyltin tris 2ethylhexanoate catalyst ** based on the weight of methyl benzoate + alcohols after loading the raw materials , agitation , nitrogen sparge and heat were turned on in a glass reaction kettle . sodium hypophosphite was added on loading . at 290 ° f . the catalyst was added and heating was continued . reaction started in the 380 °- 385 ° f . range as manifested by the evolution of meoh . the overhead temperature was maintained at 140 °- 145 ° f . during the generation of meoh . this was accomplished by controlling the reflux at 1 : 2 ratio . the reflux ratio indicates one fraction of the overhead product is taken out as a distillate product and two fractions goes back to the reaction kettle as reflux . this is the ratio found to be ideal to control the overhead temperature . heat was continued to a maximum reaction temperature of 420 ° f . when the overhead temperature dropped to 130 °- 135 ° f ., the column was switched off and the reaction was continued on by - pass . kettle samples were checked for acid value , color and percent alcohol . vacuum was applied when the methyl alcohol content dropped to 2 % by weight . partial vacuum was applied initially to prevent foam over , then gradually increased to full as conditions permitted . stripped for methylbenzoate until 0 . 10 % by weight . at this time methylbenzoate odor was very faintly detectable . cooled down the glass - lined reaction kettle to 180 ° f . it is preferred to treat the product with a color body - absorbing compound , such as an activated charcoal or acid - activated calcium montmorillonite clay , to improve the color . the product required three separate activated charcoal treatments using 1 % charcoal ( based on batch initial weight ) for each treatment to bring color down to 30 - 40 apha . on the other hand , only one treatment with an acid - activated calcium montmorillonite clay ( sorbamol ) was required , in an amount of 1 . 2 % based on the initial weight of the batch , to improve color to 20 apha . all post treatment decolorizing steps were done at 180 ° f . and mixed for one hour , and then the batch was filtered with dicalite . the finished product was then analyzed and the results are as follows : ______________________________________appearance clear______________________________________acid value 0 . 01color , apha 30 - 40water , % 0 . 03saponification value 175 . 7specific gravity 0 . 92refractive index 1 . 48______________________________________ one or more of the compounds of formula ( i ) are combined with moisturizers , emollients , solvents , lubricants , emulsifiers and / or other common cosmetic formulation ingredients for solubility of the formula ( i ) compound ( s ), one or more emulsifiers , thickening agents , and to provide other skin enhancement , e . g ., moisturizing and humectant properties . the compositions can be produced as oily lotions , gels , solid sticks , emulsions , aerosols , and all other forms of cosmetic compositions . the compositions of the following examples provide exceptional skin feel , moisturizing and humectant properties in comparison to typical prior art sunscreen compositions . __________________________________________________________________________example 1 preferredphase chemical name trade name range range % ww function__________________________________________________________________________a . octyl methoxycinnamate escalol 557 . sup . 7 0 - 10 1 - 9 7 . 50 sunscreen ( uv - b ) a . octyl salicylate dermoblock os . sup . 4 0 - 10 1 - 8 5 . 00 sunscreen ( uv - b ) a . butyloctyl salicylate hallbrite ™ bhb . sup . 1 * 1 - 15 1 - 10 5 . 00 cosolvent , emollienta . hexyldecyl benzoate & amp ; hallstar ™ ab . sup . 1 * 0 - 10 1 - 7 2 . 00 cosolvent , butyloctyl benzoate emollienta . isopropyl myristate hallstar ™ ipm . sup . 1 * 0 - 5 1 - 4 3 . 00 cosolvent , emollienta . avobenzone parsol ® 1789 . sup . 3 0 . 5 - 5 0 . 5 - 3 3 . 00 sunscreen ( uv - a ) a . oxybenzone escalol 567 . sup . 7 0 - 10 0 . 1 - 7 4 . 00 sunscreen ( uv - a / uv - b ) b . sorbitan oleate span 80 . sup . 5 0 - 2 0 . 1 - 1 0 . 40 particle size reducerb . dimethicone copolyol silwet l - 7087 . sup . 8 * 0 - 2 0 . 01 - 1 0 . 20 lubricantb . pvp / eicosene copolymer ganex v - 220 . sup . 7 0 - 2 0 . 01 - 2 0 . 75 moisture barrierc . silica aerosil r972 . sup . 11 0 - 2 0 . 1 - 1 0 . 50 thixotroped . acrylates / c . sub . 10 - 30 alkyl acrylates pemulen tr - 1 , 0 - 5 0 . 1 - 2 0 . 30 emulsifier crosspolymer pemulen tr - 2 . sup . 9d . carbomer carbopol ultrez . sup . 9 0 - 5 0 . 1 - 2 0 . 20 thickener , stabilizere . deionized water water 50 - 90 60 - 80 q . s . solvent , carriere . disodium edta disodium edta 0 - 1 0 . 01 - 1 0 . 10 chelatore . hydroxypropyl methylcellulose primaflow 0 - 2 0 . 01 - 1 0 . 20 film former mp3295a . sup . 10f . glycerin glycerin * 0 - 10 1 - 8 4 . 00 humectantf . butylene glycol 1 , 3 butane diol * 0 - 5 1 . 4 2 . 00 humectant , solventf . phenoxyethanol ( ) methyl - phenonip . sup . 2 0 - 5 0 . 1 - 5 0 . 50 preservative paraben ( ) ethylparaben ( ) propyl - paraben ( ) butylparabenf . panthenol & amp ; propylene glycol d - panthenol 50 - p . sup . 8 0 - 5 0 . 1 - 5 0 . 50 moisturizerf . triethanolamine ( 99 %) triethanolamine * 0 - 1 0 . 01 - 2 0 . 25 neutralizer__________________________________________________________________________ . sup . 1 . c . p . hall . sup . 2 . nipa . sup . 3 . roche . sup . 4 . alzo . sup . 5 . ici . sup . 6 . osi . sup . 7 . isp . sup . 8 . basf . sup . 9 . b . f . goodrich . sup . 10 . aqualon . sup . 11 . degussa * available from c . p . hall ** spf determined on human subjects by harrison research laboratories , union , nj . report available upon request . ref : cag257 , 78 spf30a . frm 1 . blend &# 34 ; a &# 34 ; oils . in turn , dissolve avobenzone and oxybenzone . add &# 34 ; b &# 34 ; ingredients , heating oil phase to 35 ° c . to 40 ° c . to dissolve pvp / eicosene copolymer . thoroughly wet and disperse silica in oil . this is best done with high shear such as produced by a rotor / stator head . fifteen ( 15 ) minutes before emulsification , disperse pemulen tr - 1 ( 0 . 20 %), pemulen tr - 2 ( 0 . 10 %), and carbomer in oil phase . 2 . dissolve half of the disodium edta ( 0 . 05 %) in the water . add hydroxypropyl methylcellulose to water with sitrring . pre - blend &# 34 ; f &# 34 ; ingredients , then add to water to complete water phase . 3 . with vortex stirring , add oil phase (&# 34 ; a &# 34 ;, &# 34 ; b &# 34 ;, &# 34 ; c &# 34 ;, &# 34 ; d &# 34 ;) all at once to water phase (&# 34 ; e &# 34 ;, &# 34 ; f &# 34 ;). this may be done at room temperature or up to 40 ° c . stir / blend for fifteen ( 15 ) minutes . adjust viscosity as necessary by adding some or all of remaining disodium edta in a step - wise fashion . continue stirring / blending until creamy smooth . in order to demonstrate that the branched chain salicylates of formula ( i ) photostabilize the dibenzoylmethane derivative uv - a filter compounds , such as parsol ® 1789 , two sunscreen formulations were prepared containing 2 % avobenzone ( dibenzoylmethane derivative -- uv - a filter ) incorporated in an oil phase consisting of 8 % c 12 - 15 alkyl benzoate and an equal amount of another ester : octyl palmitate ( formulation a ) or butyloctyl salicylate ( formulation b ). slides 7 mm square were prepared for each formulation by placing approximately 100 μl on a skin - like substrate ( vitro - skin , ims ) and spreading the material with a finger cot according to the established protocol . measurements were made of each formulation using a labsphere uv transmittance analyzer and the results were recorded . the slides were then placed in sunlight for two hours , following which measurements were again taken and the results were recorded . ______________________________________before sunexposure formulation a formulation b______________________________________sun protection 2 . 9 8 . 0factoruva absorbance 88 . 26 % 88 . 63 % uvb absorbance 62 . 87 % 86 . 78 % after sunexposure formulation a formulation bsun protection 0 . 9 4 . 8factoruva absorbance 0 . 0 % 32 . 66 % uvb absorbance 23 . 25 % 83 . 75 % ______________________________________ as demonstrated by the data , formulation b , containing butyloctyl salicylate , retains 60 % of its sun protection factor ( spf ), 38 % of is uv - a absorbance , and 97 % of its uv - b absorbance following two hours of exposure to sunlight . in contrast , the formulation containing octyl palmitate retains only 31 % of its spf , none of its uv - a absorbance , and only 37 % of its uv - b absorbance . the addition of butyloctyl salicylate to a formulation containing avobenzone clearly contributes to the photostability of the avobenzone and the maintenance of the efficacy of the formulation .

US-98476597-A

in the pasteurizing of beverages and comestibles in closed containers , the containers are progressively raised in temperature to the pasteurizing temperature and after an appropriate time progressively cooled down in apparatus which practices a method for storing heat in water and applying the heated water from storage so that skips in the supply of the containers will be accommodated to the end that a saving in steam can be realized . the method realizes saving of substantial amounts of energy , as well as avoiding dumping overly warm water into local sewers to disturb the ecological balance , and also avoids the use of refrigeration to reduce temperature of the discharge water .

a desirable form of the present invention is shown in fig1 of the drawings and comprises apparatus which is associated with an elongated housing 10 having conveyor 11 of the general type shown in u . s . pat . no . 2 , 658 , 608 granted nov . 10 , 1953 for conveying apparatus of f . w . wehmiller . other suitable means may be used to move the product to be pasteurized through zones which progressively raises the temperature to the pasteurizing temperature and then progressively lowers the temperature before returning the product to ambient temperature conditions . the product , whether metallic containers or glass bottles , is fed into the housing 10 by a delivery conveyor 12 and is discharged by the conveyor 11 onto a discharge conveyor 13 . more specifically , the apparatus of fig1 includes a series of preheating showering devices 14 , 15 , 16 and 17 leading up to pasteurizing showering means 18 , and a pasteurizering temperature holding device 19 followed by a series of precooling showering devices 20 , 21 , 22 and 23 . the preheating showering devices are located such that the liquid will fall through the conveyor 11 and into collecting compartments 24 , 25 , 26 and 27 . the pasteurizing showering means is located above a compartment 28 , the pasteurizing holding device above compartment 29 , and the precooling showering devices are positioned above compartments 30 , 31 , 32 and 33 such that the liquid will fall through the conveyor 11 and be collected in these compartments . process water from a suitable source 34 is supplied through pipes 35 , 36 , 37 and 38 to the respective compartments 24 , 25 , 26 and 27 . control valves 35a , 36a , 37a and 38a are inserted in those pipes respectively , and the valves are under control of temperature responsive sensors shown respectively at 39 , 40 , 41 and 42 so as to measure the temperature of the liquid spray from the showering devices 14 , 15 , 16 and 17 respectively . the pasteurizing showering device 18 is connected by pipe 43 to pump 44 disposed in the liquid compartment 28 . the liquid in that compartment is heated by a steam heating means 45 supplied by pipe 46 from a source of steam 47 under control of valve 48 which is responsive to a sensor 49 at the showering device 18 . the sensor 49 is modulated by the temperature at the inlet suction screen adjacent the pump 44 . following the pasteurizing zone , the showering device 19 is supplied by pipe 50 from pump 50a receiving liquid through screen in compartment 29 . the liquid is temperature controlled by a steam heating means 51 supplied through pipe 52 from valve 53 in steam source 47 . temperature sensor means 54 responsive to the showering liquid modulates the steam valve 53 in relation to the temperature at the screen inlet to pump 50a . the supply of liquid to showering device 20 is by pipe 55 connected to the outlet of pump 56 which draws liquid at a screened inlet in compartment 27 . the showered liquid collected in compartment 30 is transferred through screened inlet for pump 57 to pipe 58 which supplied showering device 17 . the temperature of the showering device 20 is sensed by sensor 59 , and that device controls the admission of steam from source 47 at valve 60 to heating means 61 by pipe 62 . the valve 60 is subject to modulation by the temperature at the inlet to pump 57 . the next following showering device 21 is supplied with liquid by pipe 63 which is the outlet of pump 64 drawing liquid from compartment 26 at its screen inlet . the liquid from showering device 21 is collected in compartment 31 and transferred through the screened inlet of pump 65 by delivery pipe 66 to the showering device 16 where the liquid is collected in compartment 26 . the temperature of the liquid in compartment 31 is heated by heating means 67 , but it is also heated by hot liquid brought thereto by pipe 68 from a source of heated liquid 69 moved by pump 70 . the steam for heating means 67 is supplied by pipe 67a and controlled by a valve 71 , and the heated liquid from pipe 68 is suppled by pipe 72a controlled by valve 72 . the valves 71 and 72 are subject to control by sensor 73 in the showering from device 21 , modulated by the temperature at the screened inlet to pump 65 . showering device 22 is supplied with liquid by pipe 75 from pump 76 which draws liquid at screened inlet in compartment 25 . the liquid collected in compartment 32 from showering device 22 is transferred by pump 77 drawing from compartment 32 and delivering by pipe 78 to showering device 15 . the temperature of the liquid in compartment 32 is maintained by heating means 79 supplied by pipe 80 through valve 81 from source 47 , as well as by heated liquid received from pipe 68 at pipe 82 under control of valve 83 . the valves 81 and 83 are subject to control by the sensor 84 which is modulated by the temperature at the screened inlet to transfer pump 77 . in like manner , showering device 23 has its liquid collected in compartment 33 and transferred through screened inlet to pump 85 and by delivery pipe 86 to showering device 14 . the liquid collected in compartment 24 is transferred through screened inlet to pump 87 and deliverd by pipe 88 to the showering device 23 . the liquid in compartment 33 is subject to heat from the heating means 89 connected by pipe 90 through valve 91 to steam source 47 , as well as by heated liquid from pipe 68 through pipe 92 and valve 93 . the valve 91 and 93 are controlled by temperature sensor 94 in the showering liquid , modulated by the temperature at the screened inlet to pump 85 . it is seen that each of the compartments 31 , 32 annd 33 are provided with a liquid drain pipe 95 . all of these drain pipes may be connected to a sewer , or the liquid so discharged may be collected and cooled in a tower or by refrigeration ( not shown ) and reused as part of the process liquid brought in at pipe 34 . it has been pointed out that there is a hot liquid source 69 positioned at the top of the pasteurizing zone ( fig1 ) where it is able by radiation from the pasteurizing zone to add heat to the liquid moved by pump 97 through pipe 98 from the compartment 27 to pipe 99 connected to the source 69 . certain modifications of this arrangement may be selected . as for example , the fragmentary view of fig3 illustrates the location of the source of heated liquid 69a disposed directly in an enlarged compartment 100 which is made up of the previously designated compartment 27 and 28 in fig1 . the heated liquid is transferred by pipe 101 to pump 70 and delivery pipe 68 as before described . a further modification is seen in the fragmentary view of fig4 where , instead of locating the compartment above the pasteurizing zone as in fig1 a remotely located holding tank 102 may be supplied by pump 103 from compartment 27 . the liquid from tank 102 is delivered by pump 70 to pipe 68 as before described . referring again to fig1 it shall be assumed for this discussion that the apparatus 10 has a full complement of product containers c being delivered by conveyor 12 and being carried away at conveyor 13 . the several showering zones identified by the showering devices 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 and 23 are also filled with the product containers . it is assumed also that the containers c arrive at a temperature of about 34 ° f . they are moved by the conveyor 11 through the several preheating zones of showering devices 14 , 15 , 16 and 17 where the temperature is brought up in stages to the pasteurizing temperature in zone of showering device 18 which is about 140 ° f . the travel of the containers c then goes through progressively cooler zones of showering devices 19 , 20 , 21 and 22 until at the last showering device 23 the temperature is lowered to about 70 ° to 80 ° f . shortly after the apparatus 10 has been in full operation it attains a substantial thermal balance with the containers c where heat extracted in the cooling zones is made available to bring the container temperature up from the low entering temperature level to one more compatible with the pasteurizing zone temperature . the foregoing is considered to be generally normal operation known in this art . in many cases a circumstance arises where product is not present such as the failure of a batch of containers to arrive and that creates a gap or &# 34 ; skip &# 34 ; in the preheat zones . the &# 34 ; skip &# 34 ; calls for the addition of process water to supply the precooling zones in an effort to maintain the thermal balance between the incoming and outgoing ends of the pasteurizer . the process water added is used and becomes excess liquid so must be dumped at a higher temperature , such as at a level of about 120 ° f . the excess water can be sewered but is harmful to the ecological state , or it can be pumped to a cooling tower or chiller at the expense of energy consumption . furthermore , when the &# 34 ; skip &# 34 ; reaches the precooling zones it is necessary to inject steam as a substitute for the missing hot product in order to maintain a thermal balance . the production of steam is an energy consumer , and this adds to the cost of pasteurizer operation . the present invention is , therefore , directed toward overcoming the foregoing problems by storing the high temperature excess water and reusing it instead of steam when a &# 34 ; skip &# 34 ; occurs . this reuse extracts the thermal value and lowers the water temperature to a safe level before it is discharged . thus , the ecological status is not disturbed and the cost of chilling or operating a cooling tower is reduced . according to the &# 34 ; skip &# 34 ; conditions shown in fig1 no containers c are passing through zones at showering devices 15 and 16 . this upsets the thermal balance with the associated zones at precooling showering devices 21 and 22 because these zones are interrelated by operation of pumps 64 and 65 between showering devices 16 and 21 , and by operation of pumps 76 and 77 between showering devices 15 and 22 . the temperature sensors 40 and 41 sense an increase in temperature because there are no containers present to be preheated and thereby absorb heat . thus , the sensors 40 and 41 act to reduce the heat picked up from the liquid supplied by pumps 77 and 65 by calling for process water through opening valves 36a and 37a . this action makes up for the lack of cool liquid in the pre - cooling zones . as added processing water enters the compartments 25 and 26 it overflows and ends up in compartmet 27 where there exists a higher temperature of the order of 120 ° f . this excess water is moved by pump 97 into the storage source 69 where its heat level is kept up by radiant heat from the pasteurizing zone . it can be readily seen that the apparatus of fig2 . is substantially the same as that described for fig1 and the reference characters are essentially the same to designate parts , piping , pumps and other components which are repeated . when the &# 34 ; skip &# 34 ; reaches the pre - cooling showering device 21 and 22 ( fig2 ) the liquid is not intercepted by hot containers and so falls directly into compartments 31 and 32 respectively without temperature change which is cooler than required at the preheating zones at showering devices 15 and 16 . the zone related with showering device 23 is also affected , so the sensors 73 , 84 and 94 open the valves 72 , 83 and 93 respectively and release the hot storage liquid from source 69 to supply the preheating zones at showering devices 14 , 15 and 16 and effect proper preheating of the containers . this action operates to maintain a thermal balance between the entering preheating zones and leaving precooling zones of the apparatus . if the heat contained in the liquid supplied by pump 70 to zones 21 , 22 and 23 is sufficient to meet the needs in preheating zones 14 , 15 and 16 , the thermal sensors will not actuate the normally closed valves 71 , 81 and 91 in the steam supply pipe 47 . thus , no steam utilization occurs . as the liquid supplied by pump 70 enters the compartments 31 , 32 and 33 it raises the level of the liquid to the stage where it can flow into the drain boxes 95a and be conducted away by pipes 95 . the pipes 95 may be connected to an adjacent sewer to discharge liquid off the top layer in compartments 31 , 32 and 33 which is the cooler liquid from the showering devices 21 , 22 and 23 supplied by heat spent liquid pumped from compartments 24 , 25 and 26 associated with the transfer of heat to the containers for preheating purposes . the above described apparatus operates to establish a substantial thermal balance between the container preheating zones in advance of the pasteurizing zone and the container precooling zones following the pasteurizing , especially when a skipper in the supply of containers occurs and is moved through the apparatus 10 . it appears from fig1 and 2 that there is a definite piping interconnection from the respective preheating zone defined by showering device 14 and thr precooling zone defined by showering device 23 . the same relationship obtains for preheating zones defined by showering devices 15 , 16 and 17 and precooling showering devices 22 , 21 and 20 respectively . in this relationship , when ( fig1 ) a skipper apppears at the preheating zones there is no container complement to absorb the heat extracted from the containers in the related precooling zones , so ineffective precooling takes place in the precooling zones . by introducing process water from supply 34 a cooling liquid is supplied to the preheating compartments 24 , 25 and 26 which liquid is moved by pumps 87 , 76 and 64 to the precooling showering devices 23 , 22 and 21 to absorb the heat in the full complement of containers moved in those zones . when the skipper above noted reaches the precooling zones ( fig2 ) the reverse thermal interchange needs to be established . this is accomplished by delivering the stored heated liquid from source 69 ( or 100 or 102 ) to the compartments in the precooling zones so it may be pumped to the associated preheating showering devices for raising the temperature of the containers moved into those zones for preheating . the foregoing description has set forth a preferred embodiment of apparatus for operating a pasteurizer under conditions that result in a more economical operation . one of the important and unique features is in reducing the call for steam outside of the usual steam necessary to bring the spray temperatures up to proper pasteurizing levels . it is also unique in the operation of the present apparatus to avoid dumping hot water into a local sewer at temperatures that upset the local ecology . furthermore , the apparatus is operated in a manner that is uniquely designed to obtain a substantially balanced thermal load between the preheating sections and the precooling sections located on opposite sides of the usual pasteurizing section . this unique feature is accomplished by utilizing local ambient water under controlled conditions when a gap or skip occurs in the flow of containers , and to collect and store hot liquid so that it may be utilized at such times as the skip reaches the precooling zones . the storage and reuse of the hot liquid replaces to a large extent the use of steam to provide the heat source , and this is of great advantage in some plant installations where expensive fuel is necessary in order to produce the steam .

US-6269379-A

in the case of a chair , in particular a swivel chair for the office , the armrest is made up of an armrest carrier , which comprises a carrier and a sleeve sliding thereon and is attached to the seat at the bottom by a seat flange which can be displaced transversely to the seat direction , and of an arm support , which can be displaced longitudinally via a guide and can be rotated via a rotary part mounted in a rotary bearing . the guide is arranged parallel , but eccentrically in relation , to the axis of symmetry of the arm support . since the rotatability of the arm support is at least 180 °, it is possible to set different clear distances between the two arm supports of the chair .

the invention relates to the field of seating furniture , in particular to a three - dimensionally adjustable armrest for an office chair . different technical solutions for chairs which allow the user to change the position of the arm support are known . for example , ep 0 809 957 a3 discloses a chair in the case of which the arm support can be adjusted three - dimensionally , that is to say in respect of height , in a horizontal plane and in respect of rotation . the arm support here is fastened on an attachment plate , fitted at the top end of the carrier , and can be rotated about a pin and displaced longitudinally via a sliding body . the axis of rotation of the arm support is located centrally in the arm support and eccentrically in relation to the centre axis of the carrier . this design only allows the clear distance between the arm supports of the chair to be changed to a limited extent . in design terms , the known solution involves high outlay to produce and install and is not particularly stable . u . s . pat . no . 6 , 076 , 891 discloses the armrest of a chair in the case of which the arm support is mounted in a pivotable manner on a horizontal arm which , for its part , is mounted in a pivotable manner on a vertical , height - adjustable carrier . although this design provides considerable scope for movement for the arm support in a horizontal plane , it is of complex design , is not very stable and also is not aesthetically acceptable to the user . u . s . pat . no . 5 , 752 , 683 discloses an armrest which specifically avoids the occurrence of carpal tunnel syndrome in individuals who spend long periods of time working with equipment such as typewriters , personal computers and the like . provided for this purpose is a longitudinally extending , high - outlay arm support which can be displaced over a considerable distance in the forward and rearward directions and , at the front , has a special , swing - up supporting means for the ball of the thumb , and which is mounted in a pivotable manner on the vertical carrier . the known armrest is of extremely complex design and is not suitable for mass production . u . s . pat . no . 6 , 076 , 892 discloses an armrest which provides for a large number of movement possibilities for the arm support : heightwise , forwards and rearwards , laterally and in rotation . this known armrest also involves extremely high outlay and is far too expensive for mass production . there is thus a real need for an armrest which , while being as adaptable as possible to the user &# 39 ; s requirements , is nevertheless straightforward to produce and install and is thus suitable for use in reasonably priced mass - produced furniture . in particular , it should be possible for the clear distance between the arm supports to be easily varied , because the clear distance between the arm supports of an office chair is a critical , and in some cases country - specific , magnitude . thus , for example , in accordance with eu standards , the maximum clear distance is 460 - 510 mm , while , in the netherlands , the clear distance should be a minimum of 390 - 510 mm . however , both in respect of production outlay and from the sales standpoint , the way in which these conflicting requirements should be tackled is problematic . the object of the invention is thus to develop an armrest which makes it possible for the clear distance between the two arm supports to be adjusted in a straightforward manner without particular production or installation outlay being necessary for this purpose . this object is achieved by the features of claim 1 and of the subclaims . the invention is based on the idea of providing the arm support with a guide which slides on guide noses — blocks — which are fastened on a rotary part mounted in a rotatable manner on the backrest carrier , and in the process of arranging the guide eccentrically in relation to the point of rotation of the rotary part . this allows for a combination of a longitudinal movement and rotary movement of the arm support , in the case of which , on account of the eccentricity of the rotation , it is possible to set a variety of clear distances between the two arm supports . the invention is explained in more detail hereinbelow with reference to an exemplary embodiment illustrated in drawings , in which : [ 0013 ] fig1 shows an armrest according to the invention in an exploded illustration , [ 0014 ] fig2 shows a plan view of the guide housing , and [ 0015 ] fig3 shows a plan view of an armrest according to the invention with an illustration of the various movement possibilities for the arm support . [ 0016 ] fig1 illustrates a carrier 1 on which a sleeve 2 is arranged for sliding action . the carrier 1 is connected to a seat flange 3 , which is fastened on the chair ( not shown ). the seat flange 3 has two slots and can be displaced transversely to the seat direction . the seat direction here is the direction from the backrest to the front edge of the chair . the height of the armrest can be adjusted by means of the sleeve 2 sliding on the carrier 1 . these technical measures are all known per se and will thus not be explained in any more detail . the rotary bearing 5 is provided at the top end of the sleeve 2 . the rotary part 4 is mounted in a rotatable manner in said bearing 5 . the rotary part 4 has the guide noses 6 , which are connected integrally to the rotary part 4 . the rotary part 4 is screwed in the rotary bearing 5 by the central screw 16 . elastic latching protrusions 15 are accommodated in recesses of the rotary part 4 and correspond with notches on the inner circumference of the rotary bearing 5 . in the installed state , the rotary part 4 is thus fixed in position , during rotation , wherever the latching protrusions 15 end up in a notch . in the installed state , the guide noses 6 engage from beneath in the two guides 7 in the guide housing 12 . a retaining plate 8 is provided on the other side of the guides 7 . this retaining plate is fastened on the guide noses 6 by means of the retaining screws 9 . the housing screws 13 are used to fasten the guide housing 12 on the carrying panel 10 , which bears the foamed - on pads 11 . in the installed state , the underside of the guide housing 12 slides between the two guide noses 6 on the surface of the rotary part 4 . in this case , the arm support is displaced in the longitudinal or seat direction . in order for it also to be possible for this displacement to take place in fixed latching positions , the horizontal latching protrusions 14 are provided in a rotary part 4 , and notches are provided on the underside of the guide housing 12 . fixed latching positions are thus produced whenever the expansible latching protrusions 14 end up in a notch on the underside of the guide housing 12 . the details of the guide housing 12 are illustrated again more specifically in fig2 . the two eccentrically located guides 7 in particular can better be seen . it is also possible to see the bores 18 , through which the housing screws 13 are screwed into the carrying panel 10 . the rotary bodies and crosspieces ( not designated ) form a skeleton for stabilizing the guide housing 12 . this comprises a plastic injection moulding , preferably made of pa / polyamide . [ 0022 ] fig3 shows the pad 11 from above in various positions . as can be seen , the axis of rotation 17 , that is the centre axis of the rotary part 4 , is located eccentrically in relation to the axis of symmetry of the pad 11 which runs in the seat direction . the pad 11 can be displaced longitudinally in direction b . this movement is made possible by the sliding movement in the guides 7 . it may also be rotated , however , about the axis 17 in accordance with the double arrow a . this rotation is made possible by the rotary part 4 . finally , however , it is also possible for the carrier 1 to be moved in direction c by means of the seat flange 3 . with all these movement possibilities , the result is not just a large number of adjustments for the arm support with the pad 11 ; the eccentricity of the guides 7 also makes possible a large number of clear distances between the two arm supports of a chair . the armrest according to the invention preferably consists of the following material : the carrier 1 and seat flange 3 consist of injection - moulded plastic , the sleeve 2 , rotary part 4 and housing 12 consist of injection - moulded plastic , preferably pa , the retaining plate 8 is a punched part made of sheet metal , and the carrying panel 10 with pad 11 is pa with a pur covering . the latching protrusions 14 and 15 consist of steel with resilient elements made of pur .

US-64481003-A

there is provided a flexible rubber or article having a coating of a hydrophilic hydrogel polymer . the coating is applied to at least one surface of the article prior to heat vulcanization of the article and prior to curing of the polymer to impart lubricant and moisture transmission properties after vulcanization and curing thereof . a solution of a trivalent cationic salt may be applied to the article prior to or simultaneously with the application of the polymer so as to provide for improved adhesion of the polymer to the article after curing . a powderless solution of an emulsion or a surfactant is applied to the article after curing to reduce the surface tack of both the surface of the article which has been coated by the polymer and the surface opposite such polymer - coated surface .

fig1 illustrates the invention in the form of a finished latex rubber surgeon &# 39 ; s glove 10 . the inner surface 30 of the glove 10 has been coated with a hydrogel polymer , during fabrication of the glove and prior to the final vulcanization of the rubber of the glove . the hydrogel coating becomes bound to the inner surface 30 so as to form an inner surface with excellent slip properties that provide for ease of donning the glove by the hand of a wearer and eliminate the requirement for conventional lubricating powders . the glove exhibits hypoallergenic properties in that wearers of the glove who are allergically responsive to conventional latex rubber gloves have reported a complete lack of any allergenic response , when wearing the glove of the invention . the hydrogel coating is of a hydrophilic nature and absorbs perspiration of the skin . wearers of the gloves of the invention report greater comfort and coolness to their hands as compared with the wear of conventional powdered gloves . the following description is of each of several processes employed in the fabrication of the invention . solutions will be defined as by weight , temperatures given in degrees celsius (° c . ), and &# 34 ; ambient temperature &# 34 ; taken to be in the range of 17 ° to 20 ° c . the surgical or surgeon &# 39 ; s glove 10 of the invention , is customarily initially fabricated by dipping processes well known in the art . for purposes of description in this application , the outer surface 20 of the glove 10 is defined as the glove surface which becomes the external glove surface 20u in the position of actual use , when worn , with the inner glove surface 30 defined as the surface 30u adjacent to the skin of the wearer , in use . it should be recognised that in the initial steps of fabrication of the invention , these glove surfaces are reversed . in normal fabrication , a surgical glove is formed about a porcelain mandrel 50 of the shape of a hand , with the outer surface 20 adjacent the glove mandrel , and the inner surface 30 externally exposed . this mandrel is initially dipped in a coagulant solution , dried and then dipped in a liquid rubber latex . the glove surface which forms adjacent to the mandrel , during such processing is the outer glove surface 20 , with the inner glove surface 30 being externally exposed on the glove mandrel . the rubber - coated mandrel is then dipped in a leach solution to dissolve out and wash away the coagulant salts and then heated at a temperature to partially vulcanize the rubber for a period of time . in the normal removal of the vulcanized glove from the mandrel after this heating step , the glove is manually pulled off the mandrel by gripping the uppermost cuff portion of the glove , and pulling it towards the finger section of the glove over the glove , causing reversal of the external and internal glove surfaces into the position of final use , as shown in fig2 . prior to our invention , removal of the gloves from the mandrel was accompanied by washihng the glove mandrel in a lubricating solution , such as a powder slurry to prevent adhesion of the otherwise tacky inner and outer glove surfaces . regardless of the lubricating solution employed , it was necessary to apply powder such as talc or a starch product to the glove surfaces prior to the final rinsing of this lubricant solution and to the gloves becoming dry . in one embodiment of the process of our invention , the rubber - coated glove mandrel , is dipped into one or more priming solutions after the above leach step , and subsequently dipped into one or more rinse and / or neutralization solutions and finally dipped into a solution of the hydrogel polymer prior to entering the heating oven for drying and vulcanization of the rubber latex and for curing of the hydrogel polymer . during these dipping operations , the mandrel may be vertically positioned with the finger sections 55 pointed downwards and with the uppermost section 57 of the mandrel maintained above the liquid level in each dipping tank . during the heating operation , the hydrogel polymer adheres to and permeates the rubber of the glove , to form a coating on the exposed inner glove surface of hydrogel polymer and to affect the structure of the rubber glove wall and outer glove surface which is adjacent the glove mandrel . after removal from the heating oven , the glove may be washed with a dilute soap solution or with water prior to and during the stripping operation from the mandrel . a subsequent aftertreatment results in the elimination of tack from the glove outer surface 20 , and this after - treatment may include a wash in a surfactant mixture that simultaneously improves the slipperiness of the inner glove surface 30 to the damp skin of a user . in all of the following examples a - d , the following conventional processing steps are initially performed and will be identified hereinafter as &# 34 ; stage i &# 34 ;: each glove mandrel is dipped in customary fashion in a coagulating solution such as that of a calcium salt . in customary fashion the coagulent is dried upon the mandrel surface by application of heat , or circulation of heated air . in customary fashion , the glove mandrel is now dipped in a conventional solution of latex rubber , after which the mandrel is heated for a few minutes to dry the latex rubber upon the form . the coated mandrel is now dipped in a leach tank of water preferably heated to a temperature above seventy degrees ( 70 °) celsius for several minutes . after step i , the coated mandrel is briefly rinsed in running water , and then dipped into a solution of dilute sulfuric acid , ranging in concentration from 2 % to 5 %. the acid is maintained at an ambient temperature of about twenty degrees celsius . acid solutions of up to 20 % may be employed , but such higher strengths may cause discoloration and damage to the unvulcanised rubber . the mandrel is held in the 2 % acid solution for a period of 15 to 30 seconds . after removal from the acid solution , the mandrel is quickly dipped in a rinse bath of water or of a dilute alkaline solution such as of ammonia , or ammonium hydroxide , and then dipped for a period ranging from 30 to 45 seconds in an aqueous solution of 4 % aluminum sulfate held at a temperature ranging from 60 ° c . to 80 ° c . the mandrel is then rinsed with hot running water at 70 ° c . and dipped in a polymer solution at ambient temperature for a period of 20 to 40 seconds . the polymer solution is a 1 . 5 % aqueous solution of a custom made hydrogel polymer ( our custom - made # mp - 83 , described hereinafter ) to which 20 phr ( parts per hundred parts polymer resin ) of cymel brand # 373 , a brand of hydroxymethylated melamine and 2 phr of para - toluenesulfonic acid monohydrate ( ptsa ) have been added . the polymer solution is brought to a ph of 6 . 5 - 7 . 0 by adjusting with ammonia as required . the treated mandrel is now heated in a circulating hot air oven for approximately 30 minutes . the oven temperature is intially at 80 ° c .- 90 ° c . but rises to reach a temperature of 105 ° c . for at least ten minutes of this heat cure cycle . the mandrel containing the vulcanized glove is removed from the oven and dipped into a bath of water , which may contain a few drops of a soap solution such as pluronic brand l - 51 . after this brief rinse , the glove is stripped from the mandrel , preferably under running water , or a rinse of running water and surfactant solution and then rinsed in the surfactant solution . the surfactant solution is a 1 % aqueous dispersion of sag - 10 brand of silicone emulsion ( 0 . 1 % solids ). after rinsing in the surfactant solution , the finished gloves are air - dried in a hot oven at a temperature of 105 ° c . for a period of thirty minutes . the dried gloves exhibit excellent slip when donned on relatively dry hands and require no additional lubricant or powder for the lubrication of the inner glove surface . the outer surface of the glove is tack - free and the finger sections may be manually squeezed together , with the finger sections separating completely from each other , without adhesion , after release of clamping pressure . to determine the extent of the water absorption properties of the hydrogel coating of the inner surface , a treated glove is immersed for a minute in an aqueous dye such as a 1 % solution of methyl violet , and then rinsed in clear water to wash off unabsorbed dye excess . the density of the dye color remaining after drying of the glove is a measure of the water absorbtion of the coating and the relative thickness of the coating . the procedure is similar to example a , except that the separate dip in dilute acid solution and subsequent rinse is omitted , and the parameters of the priming dip in aluminum sulfate solution were changed as follows : after removal from a leach rinse , and a fresh water rinse , the mandrel is dipped for a period of 30 to 80 seconds into a 6 % aqueous solution of aluminum sulfate ( 12 . 5 % of alum hydrate ) held at 70 ° c . with the ph of the solution adjusted to a ph of 2 . 0 by addition of sulfuric acid . after removal from the dip tank , the mandrel is washed with water at 70 ° c . to rinse off the excess aluminum sulfate and restore mandrel temperature . the mandrel is then dipped into the hydrogel solution as stated in example a . the concentration of the hydrogel solution may be varied from 3 / 4 % to 2 % to obtain desired thickness of coating , with the more concentrated solution resulting in thicker and more slippy coatings . the finished glove is of equal quality to that produced in example a . however a separate acid dip step has been eliminated . the process is similar to example b except that the dipping operation in the aluminum sulfate solution and the subsequent rinse has been eliminated , by the addition of aluminum sulfate into the polymer dipping solution , to result in a one dip process . after removal from the leach tank , and a rinse with water , the rubber latex coated mandrel is immediately dipped into an aqueous solution at ambient temperature made up as follows : 28 . 4 grams alum hydrate ( including 14 parts of water per molecule of aluminum sulfate ) this solution is a 63 / 8 % ( real ) solution of the polymer , with the ratio of the weight of aluminum sulfate ( dehydrated ) to polymer being of the order of 1 to 8 . 4 . in the preparation of this dipping solution , the aluminum sulfate is initially dissolved in a quantity of water and then brought to a ph of 5 . 5 . it is then gradually mixed with a solution containing the remainder of the water and the polymer , with vigorous stirring . the results achieved with the one coating dip process of example c exhibited hydrogel coatings on the inner glove surface of desirable slip and adhesion characteristics . the treated gloves were readily donned , without the need for any lubricating powders , when applied to the dry hands of the wearer . the coating process of example c does not require any additional dipping or priming operations aside from the single dip into the polymer - aluminum sulfate solution . after the vulcanization of the gloves , and their removal from the mandrel , the gloves are washed in an aqueous silicone solution of 0 . 5 % dc365 medical grade silicone ( dow corning ) and then dried by heat at 105 ° c . this one dip operation of example c may be employed substituting other trivalent cation salt solutions for the aluminum sulfate , or solutions of cation salts where the valence of the cation is greater than three . indeed similar results were achieved substituting ferric sulfate for the aluminum sulfate on a mol for mol basis . the ferric salt is unsatisfactory only in that it stains the finished glove . additional tests indicated that the salt could be formed using any of several anions which resulted in a soluble salt in solvent of the polymer solution . thus aluminum nitrate and aluminum chloride were found to be satisfactory equivalents of the aluminum sulfate when the polymer is held in an aqueous solution . satisfactory coatings resulted when the polymer was dissolved in an ethanol solution and the aluminum cation was added in the form of soluble aluminum nitrate . the process of example c was found to provide little or no coating results when other salts , formed of cations of lesser valence than three , ( instead of those of trivalent cations ), were added to the polymer solution instead of a salt of a trivalent cation . where the substituted salt was that of a cation in the form of a bivalent metal ion such as that of calcium , zinc , or the ferrous ion , the finished glove exhibited little slip on the inner surface and could not be satisfactorily donned by the dry hand of a user . the process of example d represents an improvement over the processes of these applicants for production of a hydrogel coated surgeon &# 39 ; s glove and is disclosed in uk provisional patent application no . 8225200 and u . s . application ser . no . 445 , 436 , now u . s . pat . no . 4 , 499 , 154 , directed to a dipped rubber article and filed simultaneously with the instant application . the improved process of example d was developed jointly by these and other inventors . the improved process of example d is disclosed herewith solely as an example of a preferred mode of making the surgical glove of the invention under production conditions . the applicants do not claim as their invention , in the instant application , the improved process nor product of example d , to the extent that it differs from the processes and products invented by the applicants and exemplified by examples a , b , and c of this application . the glove produced by the improved process of example d exhibits the desirable properties of the gloves of the invention of the applicant , but in addition exhibits additional desirable properties of increased slip of the coated surface when the glove is donned by a damp or wet hand , and other improved features as contrasted with the surgical gloves produced by examples a , b and c . after completion of step i , the rubber coated mandrel is dipped for 15 - 30 seconds into a solution of 1 - 2 % sulfuric acid at a temperature of 40 ° c . the mandrel is then rinsed with water and dipped for a similar period into a neutralizing bath of dilute caustic preferably held at a ph of 9 - 10 . the mandrel may then be dipped into one or more wash tanks of water heated to 40 ° c . and finally dipped for about 15 seconds into a coating solution of a polymer in ethanol . the polymer dip solution may be at a temperature ranging from ambient to 40 ° c . the polymer coating solution of example d is preferably a terpolymer of 2 - hydroxyethyl methacrylate ( hema ), methacrylic acid ( maa ) and 2 - ethylhexyl acrylate ( eha ) diluted to a concentration of 4 % in concentrated ethanol , with the monomers initially present in the mol ratio of 25 : 5 : 6 respectively . ten percent ( by weight ) of cymel 370 as a cross - linking agent and one percent of para - toluenesulfonic acid ( cycat brand # 4040 ) as a catalyst , is added to the coating solution . after being dipped in the hydrogel polymer solution , the mandrel is heated in an oven for 30 minutes with temperatures rising to 105 ° c . subsequently , the gloves of example d are stripped from the mandrel , as shown in fig2 and immersed for 15 minutes in a solution of surfactant (# d ). surfactant solution # d is an aqueous dispersion of 0 . 05 % of 35 % silicone medical grade emulsion dc365 ( dow corning brand ) and 0 . 5 % cetylpyridinium chloride . after draining , the gloves are heated and dried in an oven for 30 minutes at 70 ° c . gloves made in accordance with example d incorporate all of the desirable characteristics of the invention . the example d gloves are of hypoallergenic quality , and exhibit the increased moisture vapor transmission characteristics of the invention . the outer surface of the glove is tack - free . the inner coated surface is hydrophilic , has a high degree of slip and is readily donned on a dry hand . one of the additional improvements of the gloves produced by the process of example d over the gloves of the this instant invention of the applicants lies in the achievement of the high degree of slip that the coated hydrogel surface exhibits against damp or wet skin of a wearer &# 39 ; s hand , while being donned . the following are the results of tests made of the rate of moisture transmission through the wall of the glove across a gradient of 100 % relative humidity at an ambient temperature of 25 ° c . over a 72 hour period of time . ______________________________________ water vapor process transmittedtest sample example gm / m . sup . 2 / mm / 24 hr______________________________________i d 7 . 86ii 7 . 73iii c 9 . 76iv ( control ) prior art 4 . 22______________________________________ all test samples i - iv were produced from individual gloves , processed in the same fashion according to stage i . each mandrel was dipped for the same length of time in the same latex rubber , and subsequently dipped in the leach tank . the control sample iv was then processed in accordance with conventional procedure , going from the leach tank directly into the heating oven for final vulcanization , without any further treatment and without any process in accordance with the teaching of this application . the test sample i was subsequently processed in a similar fashion to the process described in example d , a process which is described in detail in co - pending u . s . application ser . no . 445 , 436 now u . s . pat . no . 4 , 499 , 154 , filed by the applicants jointly with other inventors on the same date as this application , entitled &# 34 ; dipped rubber article &# 34 ;. the test sample ii was subsequently processed in similar fashion to the process described in example c , except for the use of a polymer held in a solution of concentrated ethanol and with aluminum nitrate substituted for aluminum sulfate in the polymer solution . the polymer solution of test sample ii was a terpolymer as described in the process of example d . the test sample iii was subsequently processed in similar fashion to the process as described in example c . it is evident from these test results that there is a substantial increase of moisture vapor transmission through the wall of the gloves fabricated in accordance with the teachings of this invention ranging in magnitude from 86 % to 131 % increase . in other tests , made by comparing moisture vapor transmission rates using method 7032 of fed . test method std no . 406 an increase of moisture vapor transmission of 28 . 8 % was found in gloves processed in accordance with the described invention and conventional surgical gloves . it is to be noted that an increase of over 25 % of moisture vapor transmission through the glove will result in increased evaporation of perspiration on the enclosed hand of the wearer with a consequent considerable increase in cooling and in increased comfort to the hand of the wearer . the increase of moisture vapor transmissibility in gloves of the invention occurs from the reaction of the hydrogel processing solutions with the latex rubber on the glove mandrel prior to and during the final heat vulcanization of the latex rubber . various hydrogel polymers including those described in co - pending u . s . application ser . no . 408 , 094 filed on aug . 13 , 1982 may be employed as coating polymers to produce the invention . a preferred coating polymer employed by the applicants in the processes of examples a , b and c , identified as custom mix mp - 83 , is an aqueous solution of a copolymer of 90 % 2 - hydroxyethoxy methacrylate ( hema ) and 10 % acrylic acid ( acac ) that is produced as follows : ______________________________________in a 12 liter flask , charge : gelvatol 20 / 30 ( air . prod . co .) 43 . 0 g . polyvinylalcoholwater at 60 ° c . to 70 ° c . 5320 . 0 g . stir to dissolve the gelvatol ; sparge in nitrogen at therate of 0 . 4 liter / min . for 20 minutes . add : at 45 ° c . triton x305 ( rohm & amp ; haas ) 86 . 8 g . dispersion agentcool to 38 ° c . and add : hema liquid monomer 258 . 8 g . acac liquid monomer 28 . 4 g . continue to sparge with nitrogen @ 0 . 4 liter / min . for 30 min . add at 37 ° c ., consecutively : ammonium persulfate 13 . 76 g . in 40 ml . of watersodium bisulfite 2 . 84 g . in 20 ml . of wateradd at a temperature of 38 - 41 ° c ., the following mixture over aperiod of 21 / 2 hr . controlling the exotherm heat by cooling : hema liquid monomer 776 . 0 g . acac liquid monomer 86 . 8 g . then heat to 60 ° c . for 25 min . heat at 60 ° c .- 63 ° c . for 45 minutes and add : dow corning anti - foam 3 . 0 ml . agent # 544distill away , at 100 ° c ., 590 ml . of water , cool to 70 ° c . add appr . 110 ml . of 28 % ammonium hydroxide to reach 7 . 25 phappr ., thencool to room temperature . ______________________________________ the polymer solution after the above processing for a typical run tested out to 21 . 05 % solids with a viscosity of 296 cps as measured on a brookfield rvt ( spindle # 2 at 100 rpm ). it should be noted that conventional methods of preparation of a solution of a copolymer containing over 70 % hema required the use of an organic solvent since some of the hema would precipitate out of an aqueous solution , at such concentrations . however the step of adding the ammonium hydroxide at an elevated temperature of about 70 ° c . which is lower than the distillation temperature and substantially above the ambient temperature serves to maintain the hema in solution at the concentration of 90 % hema to 10 % acac , with the copolymer in a 21 % aqueous solution . in all polymer mixes , prepared for dipping , we have used a curing or cross - linking agent such as cymel brand 373 and an acid catalyst such as para - toluenesulfonic acid , or phosphoric acid , or an ammonium salt that decomposes to an acid under heat such as ammonium phosphate . we have coated other products in similar fashion such as finished rubber catheters , synthetic plastic threads and fabrics such as those formed of polyester , nylon and acrylic materials and have bonded hydrophilic water absorbing hydrogel coatings to such materials with improved adhesion of such coatings as compared to coatings obtained by methods of the prior art . it will be realized that such other coatings may be of greater or lesser thicknesses than those desired for surgical gloves . the variation of coating thickness is most readily obtained by variation of concentration of the polymer solution , although a variance in the dip time , temperatures and concentrations of other elements of the process may be employed for optimum results . the priming and coating operations described in examples a , b , and c may be employed in dipping fully vulcanized or fully cured materials . where the practice of the invention has been described in terms of a copolymer of hydroxyethoxy methacrylate and acrylic acid , it will be understood by those skilled in the art that other hydrophilic polymers may be used as equivalents to provide the features of the invention . thus methacrylic acid may be used as an alternative for acrylic acid , and 2 hydroxyethoxy ethyl acrylate or methacrylate , or a hydroxyalkyl acrylate or methacrylate may be employed instead of the 2 - hydroxyethoxy methacrylate , where the hydroxyethoxy alkyl group may be defined as hydroxy ethyl , hydroxy propyl , or 2 - 3di - hydroxy propyl . other hydrophilic polymers that may be employed instead of the described polymer include those which are copolymers containing n - vinyl - 2 - pyrrolidinone , glycerl methacrylate or acrylate , or graft copolymers of polyvinyl alcohol , or partially hydrolyzed polyacrylonitrile . it is thought that persons skilled in the art to which this invention pertains will be able to obtain a clear understanding of the invention after considering the foregoing description in connection with the accompanying drawing . therefore , a more lengthy description is deemed unnecessary . it is understood that various changes in the arrangement of the elements of this invention may be resorted to in actual practice , if desired , to achieve the described effects and such changes that are indicated from the above description of the invention are considered to be part of the invention of the applicants .

US-70005785-A

there is provided a physical fitness workout processing methodology and system for enabling remote scheduling and set - up of workout sessions for individual gym members or groups . in an exemplary embodiment , an individual or member is enabled to schedule a workout session in advance by using a wireless device or a personal computer from a location remote from the gymnasium where the workout session is to occur . the individual or user is enabled to schedule the use of various kinds of workout stations and equipment to insure that the proper equipment is available for use by the individual at the time during a workout session when it is needed . when the member enters the gym , his or her presence is detected and the member is tracked throughout the workout session . messages are displayed on display devices by workout stations to announce that the equipment has been reserved for the member at the appropriate time . in one implementation , the member carries a membership card which transmits signals used to determine the member identification and location within the gym . when the member enters a workout station area , the member &# 39 ; s individual settings for the exercise equipment at the workout station are automatically set and the workout data are automatically measured and entered into the member &# 39 ; s physical fitness database which is maintained in storage at the gym server .

it is noted that circuits and devices which are shown in block form in the drawings are generally known to those skilled in the art , and are not specified to any greater extent than that considered necessary as illustrated , for the understanding and appreciation of the underlying concepts of the present invention and in order not to obfuscate or distract from the teachings of the present invention . the various methods discussed herein may be implemented within any communication device capable of receiving and transmitting signals utilized in computer - based applications over any inter - connection network , including but not limited to the internet and the world wide web . in the present disclosure such devices include , but are not limited to , cellular and other wireless devices , personal digital assistant devices , laptop and personal computers and also desk top computers and servers connected in local area or wide area networks . the present discussion will be directed to a server - based gym application although it is understood that the principles involved in the present invention may be applied , inter alia , to all of the above noted receiving and transmitting devices and systems . in fig1 there is shown an exemplary system in which the present invention may be implemented . the illustration shows several user terminals 109 , 111 , and 113 which may be interconnected with several gymnasium or gym servers 101 , 103 and 105 through an interconnection network 107 such as the internet . the servers include gym scheduling and user database applications and the individual users &# 39 ; terminals also include communication programming to enable the users to communicate with servers over the interconnection network 107 . as noted above , the user terminals can be a desktop personal computer ( pc ) or any information processing device , such as a cellular phone or personal digital assistant device ( pda ), which may be connected as shown in fig1 through a hard - wired or wireless system arrangement . several of the major components of an example of the device 101 are illustrated in fig2 . a processor circuit 201 is connected to a system bus 203 . it is noted that the processing methodology disclosed herein will apply to many different bus and / or network configurations and is not limited to the configuration of the present example . a cache memory device 205 and a system memory unit 207 are also connected to the bus 203 . the exemplary system also includes a system storage device 209 . the system bus 203 is also connected through an input interface circuit 211 to a keypad or keyboard 213 as well as alternate input devices 215 which may include voice and / or stylus input devices , or touch - sensitive display screens which are capable of displaying menus for user selection of menu items as input . the bus 203 is also coupled to a transmitter / receiver section 217 which enables the receipt and transmission of digital information . the illustrated system may also be coupled to a network system through the transmitter / receiver section 217 and , as hereinafter explained , when implemented in a scaled down version within a workout station control unit , the receiver may also be used to receive signals effective to identify a user in the proximate area of the receiver . the exemplary system also includes a sound subsystem 224 . input means such as a microphone 226 and output means such as speaker 225 may also be included to enable a user to communicate with the device using voice commands and voiced menu and message playbacks . a video subsystem 227 , which may include a graphics subsystem , is connected between the bus 203 and a display device 228 . in general , the gym servers include the main components of the computer system shown in fig2 but need not include all of the components illustrated . similarly , the user terminals shown in fig1 also include the main components of the computer system shown in fig2 but need not include all of the components . also , as hereinafter disclosed , control devices associated with each of the workout stations may generally include a processor , receiver or reader device , memory , input , display and output components . the receiver / reader device is used for detecting member id numbers transmitted from a member card or entered as a bar code on the card by a member at the workout station . the station and equipment control devices may also be implemented using scaled - down control elements in which case much of the processing will be accomplished by the gym server and transmitted for display and / or equipment setting changes to the individual equipment control devices . fig3 illustrates an exemplary “ smart card ” 301 which may be used in connection with the present invention . instead of using a smart card however , which would have to be purchased separately , software can be installed on existing pervasive / handheld devices such as a cell phone or pda . with wireless networking capabilities , such devices can be enabled to transmit and receive signals which can be used for tracking and or processing including reservation processing , without additional cost . as shown in the smart card example in fig3 , the smart card 301 includes an on - off switch 303 , a code segment 305 such as a bar code or magnetic code , a user input area 307 , a section for processing , transmitting and receiving signals 309 and a display area 311 . the user input 307 may be embodied by a hardware keypad , or a virtual keypad could be presented on the display 311 for user interfacing . in one exemplary embodiment of an automated gym system , when the card 301 is turned “ on ”, the card begins to transmit a signal ( id signal ) which is coded to identify the authorized individual using the card . that signal is continuously transmitted on a repetitive basis . in one application , the id signal is received by a gym server and serves to establish that the individual using the card has entered the gym or is within a predetermined range of one of the workout stations . that information , in turn , is used to log - in the individual as present in the gym , or to perform a check on the reservation system to establish that the individual is present in accordance with a reservation schedule database maintained by the gym server . the transmitted id signal may also be used in connection with a global positioning system in order to precisely locate the individual within the gym building premises for tracking the individual &# 39 ; s workout progress . in another embodiment , the card 301 may be used by sliding the bar code through sensing and reading devices at the gym entrance and / or at each workout station in order to track the individual &# 39 ; s presence and the individual &# 39 ; s progress as compared with a workout schedule . the display 311 is used to alert and inform the individual relative to pertinent matters such as to display the individual &# 39 ; s workout schedule for any given day . the card 305 may also be used to request a workout reservation from the gym server and input setting changes to equipment which is to be used during a workout session . the transmission of the user id from a user &# 39 ; s smart card may be accomplished , for example , in accordance with the methods disclosed in u . s . pat . no . 5 , 960 , 085 which is included herein by reference . fig4 illustrates an overall system including a gym server 401 which is connected through , for example , the internet 107 to other servers and individual terminals as shown in fig1 . the gym includes , for example , one or more cycle workstations 403 . each workstation 403 includes a seat 409 and an exercise element 411 such as a pedaling device . the station 403 , as well as all other workstations shown in fig4 , has a control unit which further includes a reader / receiver device , display device , processor , memory , input devices including a keypad and output means as discussed earlier . the reader / receiver is used to identify a user by receiving a transmitted id signal from a smart card or reading a bar or magnetic coded user card . such reading devices are commercially available and are not shown in the drawing in order to avoid unnecessary obfuscation . the cycle control unit 413 is arranged to communicate with the gym server 401 to transmit and receive workout data and schedule information associated with the cycle station 403 and the individual using the station . the gym illustration shown in fig4 also includes one or more treadmill stations such as treadmill station 405 . treadmill station 405 includes a moving belt 415 and measuring elements to gather and transmit workout data ( such as speed , distance , time etc .) to a control unit 417 . the control unit 417 includes a display device , processor , memory , input device , id reader / receiver and output as discussed earlier . the treadmill control unit 417 is arranged to receive signals to identify a user and communicate with the gym server 401 to transmit and receive workout data and schedule information associated with the treadmill station 405 and the individual using the station . the gym illustration shown in fig4 also includes one or more “ weight ” stations such as weight station 407 . weight station 407 includes a storage section 419 for storing weights that may be installed on a lifting bar for use in a weight lifting workout session . the weight station 407 includes a scale 423 and when a weighted lifting bar 421 is placed on the scale 423 , the exercise weight of the lifting bar and attached weights is determined and recorded . the exercise weight is saved in a weight control unit 427 and may be displayed on an associated weight station display device 429 . the weight control unit 427 also includes a user id reader / receiver , an input device such as a keyboard . the display device 429 is arranged to display various kinds of information to a user , such as the value of the weight used , the schedule of the individual &# 39 ; s weight program , the reps required and also the reps actually achieved . the number of weight lifting reps achieved may be determined by a rep measuring arrangement 425 as the user lifts the weight bar up and down along the axis of the measuring arrangement 425 . the weight control unit 427 is arranged to communicate with the gym server 401 to transmit and receive workout data and schedule information associated with the weight station 407 and the individual using the station . fig5 is an illustration of an example of the rep measuring device 425 , and includes a linearly displaced series of light emitting sources 437 such as low power laser devices . the sources are arranged to transmit light along light paths 439 across a lifting area to receiving devices 441 . the receiving devices 441 are arranged for connection to the control unit 427 . with the arrangement shown in fig5 , the interruption of the light paths 439 , as the weighted lifting bar 421 is raised and lowered through the paths 439 , is tracked and used in determining the number of reps that a given weight set has been lifted and also the extent or dimension of the lifting . this provides useful information in establishing and measuring an effective weight lifting workout program for gym member users of the weight - related equipment . in accordance with the present disclosure , an individual is enabled to reserve specific workstations within a gymnasium in a user - preferred sequence and at specific times by accessing a gym server through any appropriately programmed personal computing device . in one example , when a user wishes to make a workout reservation , the user will send a reservation request to the gym server . the format 601 shown in fig6 may be used for this purpose . the format 601 will identify the user by member number and the date of the workout reservation request . this information is transmitted from the user to the gym server when the user points to 603 and clicks on a hypertext command such as “ submit request ” shown in fig6 . in response to that request , the gym server will hold a current schedule from other input to avoid conflicts , and transmit the current gym schedule for the requested day to the requesting user on the user &# 39 ; s display device . an exemplary gym schedule is illustrated in fig7 . as shown in fig7 , the gym schedule 700 shows incremental time slots throughout the day for each gym workstation . in the illustration , times for workstations that have previously been reserved by others are shown as “ filled - in ” or blackened - out 701 and other time slots for workout stations that are currently available are shown in phantom 703 . as a user points to and clicks on an available time slot and workout station with pointer 7057 the phantom outline of the time slot will change to a solid perimeter indicating a request for that time slot . later when the request is confirmed , the time slot will change to a blackened rectangle such as slot 701 . the user may also see that convenient time slots are not available and request another day &# 39 ; s schedule . after the user has made reservation selections , the user will point and click 707 to enter the selections at the server . in response to the receipt of the reservation request , the gym server will schedule the request , change the gym schedule to show that the selected slots are now taken and unavailable to others , and return a reservation confirmation notice to the user . an example of a reservation confirmation notice is shown in fig8 and includes the date , the member number , and the times and specific workout stations reserved for the user . the notice may also include means to enable the user to change and / or view the settings 801 of the various exercise equipment units to be used during the scheduled workout session . these settings are maintained at the gym server in a member workout data and setting database which is maintained on each member of the gym . if the user wished to change or view any of the equipment settings , such as miles for the cycle station , weights for the weight station , etc ., the user is enabled to point and click 803 on the change / view hypertext 801 . if the user does not wish any changes or does not wish to view the current settings , the user may point to and click on an “ exit ” hypertext to terminate the program . if a member wishes to view and / or change the settings 801 , the database is displayed to the user and the user is enabled to make changes and enter the changes in a convenient protocol ( not shown ). fig9 shows several information fields which may be maintained by the gym server regarding the reservation system data 900 including setting data . reservation system information which may be recorded and saved includes such things as reservation id used to identify specific reservations , as well as member id , check - in time when a member checks into the gym , check - out time when a member leaves the gym , workout name to identify and distinguish one workout from others , exercise or machine names , alert time which is a time period , for example ten minutes , used to display a message on display devices associated with the various pieces of equipment stating that the equipment has been reserved by member number in ten minutes . this will provide notice to anyone using the equipment to vacate the equipment prior to the reserved time . similarly , fig1 shows several exemplary data fields which may be maintained by the gym server regarding tracking system data 1000 for workout sessions . such data items include a tracking id number assigned by the server for tracking workout sessions , member number , workout number , settings and others as shown . all of the information shown is saved and recorded for each member workout session for use in developing a total comprehensive workout program . fig1 shows an exemplary flow sequence in the disclosed reservation methodology for reserving selected equipment for selected times on selected dates . the process begins 1101 when a schedule request is received 1103 . when a request is received 1103 , the server temporarily locks further scheduling 1105 to prevent conflicts . scheduling may be locked for only a predetermined “ n ” number of minutes in order to facilitate efficient reservation scheduling . the schedule is then transmitted to the requesting user 1107 to be displayed on the user &# 39 ; s display device . if a reservation request is not received 1109 after “ n ” minutes have past 1111 , then the schedule is unlocked 1113 for others to make reservations , and a message is displayed to the user to resubmit the request 1115 . if a reservation request is received before the expiration of “ n ” minutes 1109 , then the schedule is unlocked 1117 to enable the entering of the reservation request 1119 . a confirmation number is then caused to be displayed to the user / member 1121 and the process continues to block 1201 ( fig1 ) for setting or viewing setting changes and equipment programming as appropriate . in the exemplary flow chart for the “ change / view settings ” 801 function illustrated in fig1 , if the change settings hypertext 801 is not selected 1203 , and instead the exit hypertext is selected 1211 , the member settings file is retrieved 1213 and the equipment reserved by the member along with the appropriate settings for the equipment as gathered from the member settings file , is programmed for the times as reserved by the member 1209 . the member settings on the reserved equipment may be set automatically by the server directly sending programming signals to the designated equipment at the reserved workout stations such that at the reserved time , or n minutes prior to the reserved time , the equipment settings are automatically set in accordance with the member &# 39 ; s settings file . this can be accomplished following a display of an n minute warning message on the display device associated with the particular workout station . the warning message , stating that the workout station has been reserved , can be displayed or flashed on the station display device and operating feedback from the station can be monitored and checked to insure that there is no individual using the reserved equipment when the equipment settings for the next user are programmed into the reserved equipment . if the user selects to change or view the settings 1203 from the reservation screen 800 , a view / change settings routine is called 1205 to display the settings and receive and enter the users changes if any are made . a portion of a displayed change settings screen ( not shown ) showing the user settings file would show only the settings and equipment used , and the date of the user &# 39 ; s last workout session , and enable the user , under the user &# 39 ; s actual id or under an anonymous id or alias , to enter any new settings to be applied for a reserved workout session . the file would be updated accordingly 1207 and the equipment may be programmed 1209 for automatic settings application to the equipment at the appropriate reserved time . in fig1 , an example of a member or user settings file 1300 is illustrated . as shown , the file or database would contain all relevant information including but no limited to the equipment and settings on the corresponding equipment along with the dates of past workout sessions . in fig1 , an exemplary daily routine is illustrated in flow chart form . when the gym opens 1401 the schedule for the day is retrieved 1403 and the various stations are programmed 1405 to set the equipment for the appropriate settings at the appropriate times in accordance with the reservation schedule . for security and another level of verification , this can be managed by a gym administrator &# 39 ; s visual inspection / approval process . thereafter , a check 1409 is made n minutes before a scheduled workout session for each station to determine if the scheduled member for that station is present in the gym 1411 . if the member is not present 1411 , the station is released from the scheduled reservation and other members are then free to use or reserve the station . whether or not a member is present is determined either by detection of the member &# 39 ; s broadcast id or by detection of the use of the card bar code on a reading device in the control unit of the appropriate workout station . closing time is continuously checked 1407 and at closing time , the processing is ended for the day . other functions can also be initiated at closing time such as the display and / or printout of members currently in the gym . this is useful to insure that everyone is out of the gym when it is closed . in fig1 , another exemplary routine is presented for tracking members who have entered the gym . as shown , all of the detected members are tracked after they enter the gym and at closing time 1501 a listing of personnel in the gym is displayed 1503 . this listing may be automatically displayed at several locations throughout the gym and may also be printed out . as members enter the gym , they will be detected as “ present ” either by detection of the transmitted member id from the member card by a sensor located at the entrance or by detection of the bar code as the member slides the member card through a reader at the gym entrance . sensors at the gym entrance also detect the entrance of any person entering the gym whether or not they have a member card . when anyone enters the gym , a check is made to determine if the person is a member 1505 . if the person is not a member 1505 , an appropriate message is sent to a management unit to alert them that a non - member has entered the gym . if the member id is compared to a member listing which is maintained at the gym server , and the entering person is a member 1505 , then the member is marked as “ present ” 1509 in the gym on a “ members present ” listing maintained on the gym server . a check is then made to determine if the member has made a reservation for that day 1511 , and if so , the reservation and settings or workout profile are retrieved 1513 and data from the reserved workout stations is tracked and saved 1515 as the member proceeds through the member &# 39 ; s workout routine . if the entering member did not have a reservation for the day 1511 , the workout profile or workout settings file is not retrieved for that member . when it is detected that an entered member leaves the gym 1517 that member is marked as not present 1519 as the routine cycles through a closing time check 1501 and the detection of members entering the gym . services can be programmed for members using a selected training program , the equipment used , frequency of visits , or any combination , and members would pay only for equipment or services used rather than a flat monthly fee . if no workout routine has been reserved but workout stations are available for use , a user can identify himself to the workout station by using the smart card or code card , then use the workout station and have workout data saved to a separate account or to his own account / profile workout database , with or without correlating the saved data to the user &# 39 ; s regular workout routine tracking . in fig1 , an exemplary workout station flow sequence is illustrated . as shown , when a member id is detected 1601 by a workout station detection device or reader in the control box ( e . g . 413 , 417 , 427 ), a check is made to determine if that station has been reserved for the detected member id 1603 . if the detected member does not have a reservation for the workout station which has detected the member &# 39 ; s presence , then an appropriate message is displayed 1605 at the display unit of the workout station . if the detected member has a reservation , then the workout data , e . g . distance , time , weights , reps etc ., is accumulated and saved 1607 . in addition , the workout stations may be disabled when reserved for an individual user and only enabled for operation when the id signals of the reserving individual user have been detected at the workout station . when the member is detected as leaving the workout station 1609 , the accumulated workout data are entered to the member &# 39 ; s workout profile and / or settings file . a member is detected as leaving a workout station when the member passes his id coded card through a station reading device when the member is finished using the workout station . if a transmitting or “ smart ” card is used , a member is determined to be leaving the workout station when the member is far enough from the workout station that the id signal transmission is no longer picked - up by the id signal receiver at the particular workout station . this processing occurs at each workout station as each member is detected as being in a predetermined proximity to the workout station . workout data ( system , equipment , time , reps , sets , etc .) can be converted into a standard format such as xml , at the workout station control units before being inserted into the tracking system at the server . with that arrangement , members can download information from any computer with network connectivity using a browser , and feed the data into the tracking software of their choice . the method and apparatus of the present invention has been described in connection with a preferred embodiment as disclosed herein . the disclosed methodology may be implemented in a wide range of sequences , menus and screen designs to accomplish the desired results as herein illustrated . although an embodiment of the present invention has been shown and described in detail herein , along with certain variants thereof , many other varied embodiments that incorporate the teachings of the invention may be easily constructed by those skilled in the art , and even included or integrated into a processor or cpu or other larger system integrated circuit or chip . the disclosed methodology may also be implemented solely or partially in program code stored in a portable or fixed memory device , such as so - called “ flash ” memory , from which it may be loaded into other memory devices and executed to achieve the beneficial results as described herein . accordingly , the present invention is not intended to be limited to the specific form set forth herein , but on the contrary , it is intended to cover such alternatives , modifications , and equivalents , as can be reasonably included within the spirit and scope of the invention .

US-61752503-A

a device , system , and method for enhancing cooling uniformity and efficiency of cryogenic fluids and providing a treatment element the shape of which can be adjusted for multiple purposes . the device may include a balloon catheter and fluid dispersion element , the fluid dispersion element directing the flow of coolant from a fluid injection element the interior wall of the balloon . the method of changing the shape of the treatment element may include retracting and extending a shaft to which the distal neck of a balloon is coupled , so that the balloon goes from a first shape to a second shape .

referring now to fig1 a , a system including a first embodiment of a cryoablation treatment element is shown . the system 10 generally includes a device 12 for treating tissue and a console 14 that houses various system controls . the system 10 may be adapted for both radiofrequency ablation ( rfa ) and cryoablation . the console 14 may include one or more of a coolant reservoir 16 , coolant return reservoir 18 , and rf generator 20 , and may further include various displays , screens , user input controls , keyboards , buttons , valves , conduits , connectors , power sources , and computers for adjusting and monitoring system parameters . continuing to refer to fig1 a , the device 12 may be an ablation device generally including a handle 22 , an elongate body 24 having a distal end 26 and one or more treatment elements . the handle 22 may include various knobs , levers , user control devices , input ports , outlet ports , connectors , lumens , and wires . the one or more treatment elements may be expandable elements such as balloons 30 ( as shown in fig1 a ). further , the device may include one or more electrodes 32 , such as when thermoelectric cooling and / or rf energy is used in addition to joule - thomson cooling . the elongate body 24 may further include one or more lumens , such as a main lumen 34 , a fluid injection lumen 36 in fluid communication with the coolant reservoir 16 , and a fluid return lumen 37 in fluid communication with the coolant return reservoir 18 . in some embodiments , one or more other lumens may be disposed within the main lumen 34 , and / or the main lumen 34 may function as the fluid injection lumen 36 or the fluid return lumen 37 . if the device 12 also includes a thermoelectric cooler or rf electrodes , the elongate body 24 may include a lumen in communication with an rf generator 20 and / or a power source ( not shown ). even if not shown in the other figures , the device 12 shown in , for example , fig2 a , 3 , 4 , 5 a , 7 a , and 7 b may also include these lumens 34 , 36 , 37 . the elongate body may further include a shaft 38 having a proximal end 38 a and a distal end 38 b , which may be slidably disposed within the main lumen 34 ( as shown and described in fig7 a and 7b ). generally , the shaft 38 is any substantially rigid shaft to which at least a portion of the treatment element ( such as a balloon 30 , as shown in fig1 a ) may be attached , and may be a guidewire shaft . the coolant return reservoir 18 may be in fluid communication with a vacuum pump 39 that removes expended coolant from the treatment element ( such as a balloon 30 , as shown in fig1 a ). the combination of coolant injection and suction from the vacuum pump 39 forces coolant from the treatment element into the fluid return lumen 37 . continuing to refer to fig1 a , the treatment element may be an expandable element , such as the balloon 30 in fig1 a , defining a cooling chamber 40 having an interior wall 42 and an exterior wall 44 . the balloon 30 further includes a proximal neck 30 a and a distal neck 30 b . the balloon 30 further includes a fluid dispersion element ( fde ) 46 that directs the flow of coolant from the fluid injection element 46 to the interior wall 42 of the balloon 30 , and divides the cooling chamber 40 into a first portion 48 and a second portion 50 . a fluid injection element 52 is be disposed within the first portion 48 of the cooling chamber 40 , and may be a discrete element ( as shown in fig1 a ) or integrated with the shaft 38 ( as shown in fig2 a ). additionally , the fluid injection element 52 may be associated with the shaft 38 in a way that allows for an adjustment of the direction of fluid delivery corresponding to the direction and degree of shaft 38 movement ( as shown in fig8 a and 8b ). coolant is at its coldest temperature immediately after expanding once it enters the cooling chamber 40 ; therefore , quickly directing the cold coolant to the area of the cooling chamber closest to target tissue provides a more efficient use of coolant . the fde 46 shown in fig1 a is a deformable membrane oriented perpendicular to the primary direction of coolant flow ( depicted in the figures by arrows ). the membrane 46 includes a plurality of apertures 54 , the apertures 54 being located proximate at least a portion of the interior wall 42 . the membrane 46 has a first edge 56 and a second edge 58 , the first edge 56 being in contact with the interior wall 42 of the balloon 30 and the second edge 58 being in contact with the shaft 38 and / or the fluid injection element 52 . further , the first edge 56 may be affixed to the interior wall 42 of the balloon 30 . the membrane 46 may be between approximately 0 . 0001 inch and approximately 0 . 002 inch thick as measured on the first edge 56 , and the thickness may be substantially constant throughout the membrane 46 , or it may vary . for example , the thickness may be greater near the first edge 56 and lesser near the second edge 58 . continuing to refer to fig1 a , the apertures 54 may be any shape that preserves the integrity of the membrane 46 , including circular , angular , flap - like ( creating a flap of membrane material that is only partially attached to the membrane 46 ), or slit - like ( an elongated aperture not having a flap of membrane material ). further , the apertures 54 may be located around the entire circumference of the membrane 46 proximate the first edge 56 , or only a portion thereof . further , the apertures 54 may be arranged in a single row , multiple rows , or any other configuration that meters coolant flow from the first portion 48 to the second portion 50 of the balloon 30 . the membrane may be composed of a material such as polyester , nylon , pebax ®, polyurethane or silicone , for example . further , the membrane 46 may be composed of a material that is gas permeable , liquid permeable , or both , or may be permeable to the coolant by virtue of the apertures 54 alone . referring now to fig1 b , a cross - sectional view of a first embodiment of a cryoablation treatment element is shown . fig1 b shows the first portion 48 of the cooling chamber 40 as taken along axis b - b in fig1 a . as shown and described in fig1 a , the balloon 30 defines a cooling chamber 40 ( the first portion 48 of the cooling chamber 40 is shown in fig1 b ) and includes an fde 46 that is a membrane having a plurality of apertures 54 . coolant is injected into the first portion 48 of the cooling chamber 40 and directed through the apertures 54 of the membrane 46 and into the second portion 50 ( not shown in fig1 b ). the flow of coolant is depicted with arrows . referring now to fig2 a and 2b , cross - sectional views of a second embodiment of a cryoablation treatment element are shown . fig2 b shows the first portion 48 of the cooling chamber 40 as taken along axis b - b in fig1 a . like fig1 a and 1b , the treatment element of fig2 a and 2b is a balloon 30 defining a cooling chamber 40 having a first portion 48 and a second portion 50 . the balloon 30 further includes an fde 46 that is a membrane having a plurality of apertures 54 . in fig2 a and 2b , the fluid injection element 52 is integrated with the shaft 38 , rather than being a separate element disposed about the shaft 38 , as shown in fig1 a and 1b . in this embodiment , the fluid injection lumen 36 is within the shaft 38 and the shaft 38 includes a plurality of apertures or outlet ports in fluid communication with the fluid injection lumen 36 . expanded coolant flows from the second portion 50 into the fluid return lumen 37 . the cross section shown in fig2 b is along the b - b axis shown in fig2 a . the flow of coolant is depicted with arrows . referring now to fig3 , a cross - sectional view of a third embodiment of a cryoablation treatment element is shown . like fig1 a , the treatment element of fig3 is a balloon 30 defining a cooling chamber 40 and having an interior wall 42 and an exterior wall 44 . the balloon 30 further includes an fde 46 disposed within the cooling chamber 40 , dividing the cooling chamber 40 into a first portion 48 and a second portion 50 . unlike the membrane 46 of fig1 a , the fde 46 of fig3 is not in contact with the interior wall 42 of the balloon 30 . rather , the fde 46 in fig3 is a second balloon 62 of smaller size than the balloon 30 (“ first balloon 30 ”). the second balloon 62 includes a plurality of apertures 64 , and the fluid injection element 52 is located within the second balloon 62 . the fluid injection element of fig3 is shown as being integrated with the shaft 38 ( as shown in fig2 a ), but could also be disposed about or adjacent to the shaft 38 ( as shown in fig1 a ). the apertures 64 of the second balloon 62 direct and meter flow of coolant from the first portion 48 within the second balloon 62 to the second portion 50 between the first balloon 30 and second balloon 62 . expanded coolant flows from the second portion 50 into the fluid return lumen 37 ( as shown in fig1 a and 2a ). the flow of coolant is depicted with arrows . referring now to fig4 , a cross - sectional view of a fourth embodiment of a cryoablation treatment element is shown . like the treatment element of fig3 , the treatment element of fig4 is a balloon 30 defining a cooling chamber 40 and having an interior wall 42 and an exterior wall 44 . the balloon 30 further includes an fde 46 disposed within the cooling chamber 40 . like the fde 46 of fig3 , the fde 46 in fig4 is a second balloon 62 of a smaller size than the balloon 30 (“ first balloon 30 ”). the fluid injection element 52 is located between the first balloon 30 and the second balloon 62 . further , the second balloon 62 does not meter the flow of coolant from a first portion to a second portion , but does direct the flow of coolant from the fluid injection element 52 to the interior wall 42 of the cooling chamber 40 , from where the expanded coolant flows into the fluid return lumen 37 ( as shown in fig1 a and 2a ). the fluid injection element 52 may be a separate element ( as shown in fig4 ) or may be integrated with the shaft 38 ( as shown in fig2 a and 3 ). further , the second balloon 62 may include a second fluid injection element 66 for inflating the second balloon 62 . the flow of coolant is depicted with arrows . referring now to fig5 a and 5b , cross - sectional views of a fifth embodiment of a cryoablation treatment element are shown . fig5 b shows the first portion 48 of the cooling chamber 40 , as taken along axis b - b in fig1 a . like the treatment element of fig4 , the treatment element of fig5 a and 5b is a balloon 30 defining a cooling chamber 40 and having an interior wall 42 and an exterior wall 44 . the balloon 30 further includes an fde 46 disposed within the cooling chamber 40 . like the second balloon 62 of fig4 , the fde 46 of fig5 a and 5b does not meter the flow of coolant from a first portion to a second portion , but does direct the flow of coolant from the fluid injection element 52 to the interior wall 42 of the cooling chamber 40 , from where the expanded coolant flows into the fluid return lumen 37 ( as shown in fig1 a and 2a ). the center portion 68 ( general area depicted in dashed lines ) of the cooling chamber 40 is substantially bypassed ; that is , coolant may flow directly from the fluid injection element 52 , to the interior wall 42 , to the fluid return lumen 37 without flowing into the center portion 68 . unlike the fde 46 of fig1 - 4 , however , the fde 46 of fig5 a and 5b is also the fluid injection element 52 . the fde 46 may be a collapsible or deformable cage , basket , or mesh being in fluid communication with the fluid injection lumen 36 and having a plurality of outlet ports 72 . the outlet ports 72 may be directed toward the interior wall 42 of the cooling chamber 40 ( as shown in fig5 b ), and may be located along the splines 74 of the cage - type fde 46 . further , the fde 46 / fluid injection element 52 may ( as shown in fig1 a , 2 a , 3 , and 4 ) or may not ( as shown in fig4 ) be associated with a shaft 38 . expanded coolant flows from the second portion 50 into the fluid return lumen 37 ( as shown in fig1 a and 2a ). the flow of coolant is depicted with arrows . it will be understood that a device contemplated herein may include any combination of the features of the embodiments of fig1 - 5 . further , the balloon 30 may have any shape or form , and may further be double layered ( as in double - balloon catheters ) for enhanced safety . further , the balloon 30 and a second balloon 52 may have the same or different shapes , and may be made of the same or different materials . the figures may not be drawn to scale . referring now to fig6 , a cross - sectional view of a heart , with exemplary placement of a cryoablation device is shown . a mammalian heart includes pulmonary veins that lead blood from the lungs into the left atrium , and pulmonary vein ( pv ) ablation is a common treatment for cardiac arrhythmias . in a typical procedure , an ablation device 12 such as a balloon catheter ( as shown in fig1 - 7 ) is inserted into the left atrium and positioned at the opening of a pv . before ablating tissue , a visualization medium ( such as a dye or contrast medium ) may first be injected into the pv to ensure that the pv is completely occluded by the device 12 . once the occlusion is achieved , ablation may begin . even though a single balloon catheter having a static shape may provide both occlusion and ablation functionality , it has been found that ablating pv tissue with certain balloon shapes , such as the teardrop or ovate shape in fig7 a , may increase the risk of pv stenosis associated with ablation therapy . as shown and described in fig7 a and 7b , the balloons 30 of fig1 - 5 may be adjustable from a first shape (“ occlusion mode ”) to a second shape (“ ablation mode ”). referring now to fig7 a and 7b , a first embodiment of a shape - changing cryoablation treatment element having a first and second shape is shown . in fig7 a and 7b , the cryoablation treatment element is a balloon 30 , which defines a cooling chamber 40 and includes an interior wall 42 , an exterior wall 44 , a proximal neck 30 a , and a distal neck 30 b ( the balloon 30 may have the general characteristics of any of the balloons 30 of fig1 - 5 ). the proximal neck 30 a of the balloon is coupled to the distal end 26 of the elongate body 24 , and the distal neck 30 b is coupled to the distal end 38 b of the shaft 38 . movement of the shaft causes the balloon to assume a first shape (“ occlusion mode ”) or a second shape (“ ablation mode ”), and all intermediate shapes between the first shape and second shape . when in occlusion mode , the flow rate of the coolant may be lower than that required for ablation . for example , the flow of coolant may be sufficient to inflate the balloon 30 , but not enough to reach ablation temperatures . referring now to fig7 a , a cross sectional view of the balloon 30 having a first shape is shown . in the first shape , the cooling chamber 40 may have an elongated shape , such as a teardrop or ovate shape as shown in fig7 a . if the fde 46 is a membrane oriented perpendicular to coolant flow ( as in fig1 - 2 ) as the fluid travels from the first portion 48 to the second portion 50 and into the fluid return lumen 37 , the first portion 48 of the cooling chamber 40 may be extended to accommodate the shape change as shown and described in fig7 b . the distal neck 30 b may be coupled to the distal end 38 b of the shaft 38 such that the distal neck 30 b is directed outward ( as shown in fig7 a and 7b ). that is , the interior wall 42 of the distal neck 30 b is coupled to the distal end 38 b of the shaft 38 . however , the distal neck 30 b may alternatively be directed inward , with the exterior wall 44 of the balloon 30 coupled to the distal end 38 b of the shaft 38 ( as shown in fig8 a and 8b ). further , the shaft 38 may be slidably movable within the main lumen 34 of the elongate body 24 ( depicted with a double - headed arrow ). continuing to refer to fig7 a , the balloon 30 may further include one or more sensors 70 . the sensors 70 may be used to detect pressure , temperature , or other detectable parameters within the system 10 , device 12 , or patient &# 39 ; s body . the sensors 70 may be located anywhere within or on the surface of the balloon 30 , but at least one sensor 70 may be located such that movement of the shaft 38 will also effectively reposition the sensors 70 . for example , the sensors 70 may be located a distance away from the distal end 38 b of the shaft 38 when the balloon 30 is in the first position ( as seen in fig7 a ). as the balloon 30 transitions from the first position to the second position ( and the distal end 38 b of the shaft 38 is moved closer to the elongate body 24 ), the sensors 70 will be brought closer to the distal face 72 of the balloon 30 ( as shown in fig7 b ). the distal face 72 is shown as the bracketed area in fig7 b . referring now to fig7 b , a cross - sectional view of a shape - changing cryoablation treatment element having a second shape is shown . the balloon of fig7 b is in the second shape , or ablation mode . when in ablation mode , the flow rate of the coolant may be increased so that the balloon 30 reaches a temperature sufficient to ablation tissue . to change the balloon 30 to the second shape , the shaft is retracted a distance (“ d ”) within the main lumen 34 . moving the shaft 38 also moves the position of the distal neck 30 b of the balloon 30 , which may cause the distal neck 30 b to be retracted inward and the distal end of the balloon 30 to fold over on itself . the distal neck 30 b may be coupled to the distal end 38 b of the shaft 38 in other ways , such as folded under ( with the exterior wall 44 of the balloon 30 coupled to the distal end 38 of the shaft ); however , the method of affixing the balloon 30 to the shaft 38 should not hinder the shape - changing functionality of the device 12 . continuing to refer to fig7 b , the one or more sensors 70 are on the distal face 72 of the balloon 30 when the balloon 30 is in the second position . on the distal face 72 , the sensors 70 may be in an optimal position to contact surfaces within the patient &# 39 ; s body and / or to measure parameters detectable by the sensors . referring now to fig8 a and 8b , a second embodiment of a shape - changing cryoablation element having a first and second position is shown . like fig7 a and 7b , the cryoablation treatment element is a balloon 30 (“ first balloon ”), which defines a cooling chamber 40 and includes an interior wall 42 , an exterior wall 44 , a proximal neck 30 a , and a distal neck 30 b ( the first balloon 30 may have the general characteristics of any of the balloons 30 of fig1 - 5 ). the proximal neck 30 a of the first balloon 30 is coupled to the distal end 26 of the elongate body 24 , and the distal neck 30 b is coupled to the shaft 38 either at or proximate the distal end 38 b ). unlike the distal neck 30 b of the balloon 30 shown in fig7 a and 7b , the distal neck 30 b of the first balloon 30 in fig8 a and 8b may be oriented inward , with the exterior wall 44 of the balloon being coupled to the distal end 38 b of the shaft 38 . movement of the shaft causes the balloon to assume a first shape (“ occlusion mode ”) or a second shape (“ ablation mode ”), and all intermediate shapes between the first shape and second shape . referring now to fig8 a , a cross sectional view of the balloon 30 having a first shape is shown . the first balloon 30 may include an fde 46 that is a second balloon 62 ( as shown in fig4 ) having a proximal neck 62 a and distal neck 62 b , in which the fluid injection element 52 is located . the second balloon 62 may direct coolant in any of a variety of directions , depending on the movement of the shaft 38 . the second balloon 62 may include a plurality of apertures 64 through which coolant is injected into the cooling chamber 40 . as shown in fig8 a and 8b ( and in contrast to fig3 and 4 ), the proximal neck 62 a of the second balloon 62 may be coupled to the distal end 26 of the elongate body 24 , like the proximal neck 30 a of the first balloon 30 . the proximal neck 30 a of the balloon may be in contact with and coupled to the proximal neck 62 a of the second balloon 62 , the distal end 26 of the elongate body 24 , or both . further , the distal neck 62 b of the second balloon 62 may be coupled to the shaft 38 , like the distal neck 30 b of the first balloon 30 . thus , movement of the shaft 38 may not only affect the shape of the first balloon 30 , but also of the second balloon 62 . as shown in fig8 a , when the first balloon 30 is in the first position , the coolant may be directed through the second balloon 62 in directions substantially perpendicular to the shaft 38 ( that is , toward areas the interior wall 42 of the first balloon 30 that are not at the distal face 72 of the balloon 30 ). referring now to fig8 b , a cross sectional view of the balloon 30 having a second shape is shown . to change the balloon 30 to the second shape , the shaft is retracted a distance (“ d ”) within the main lumen 34 ( as shown in fig7 b ). moving the shaft 38 also moves the position of the distal neck 30 b of the balloon 30 , which may cause the distal neck 30 b to be retracted inward . because the distal neck 30 b of the balloon 30 is directed inward , the distal neck 30 b may not fold over on itself as shown in fig7 b , where the distal neck 30 b is directed outward . as the shaft 38 is retracted within the main lumen 34 of the device 12 , both the first balloon 30 and second balloon 62 are changed to a second shape . when the balloon 30 is in the second position , the distal neck 62 b of the second balloon 62 is also drawn toward the distal end 26 of the elongate body 24 ( as shown in fig8 b ). thus , the apertures of the fluid injection element 52 are oriented toward the distal face 72 of the balloon 30 ( similar to the way the sensors 70 are moved in fig7 a and 7b ). this orientation of the second balloon 62 may ensure more efficient cooling of the distal face 72 , which may be in contact with a surface within a patient &# 39 ; s body . the second balloon 62 may be any distance from the interior wall 42 of the first balloon 30 that provides sufficient cooling to the distal face 72 of the first balloon 30 in the second position . it will be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described herein above . in addition , unless mention was made above to the contrary , it should be noted that all of the accompanying drawings are not to scale . a variety of modifications and variations are possible in light of the above teachings without departing from the scope and spirit of the invention , which is limited only by the following claims .

US-201213360430-A

a nutrient or medicinal composition for administration to ruminants , which includes a core of one or more biologically active substances coated with a film of polyurethane , overcoated with an “ intermediate ” wax is disclosed . this polyurethane / wax coating is resistant to rumen conditions , but will release the biologically active substance in the abomasum and subsequent digestive tract of the ruminant animal .

the present invention will be described with respect to a ruminant feed additive composition comprising lysine as the inner core of biologically active material ; a polyurethane coating surrounding the inner core of biologically active material , and a wax coating surrounding the polyurethane coating . however , it is understood that other biologically active substances and coatings may be used in the invention as discussed herein and known to those skilled in the art . biologically active substances useful in the invention may comprise substances which will aid in milk and / or meat production of the ruminant animal and include amino acids including any lysine and methionine . it is further understood that the composition of the invention may include one or more biologically active substances . other biologically active substances known to those skilled in the art are included within the scope of the invention and the invention is not limited to the preferred embodiments disclosed herein . additionally , it is understood that the coating of the present invention may be useful on other biologically active substances including other nutrients or medicaments . a presently preferred biologically active substance is lysine . lysine is highly soluble and has been difficult to provide as an effective feed additive to the ruminant . when provided in effective amounts , as in the invention disclosed herein , it will aid in milk or meat production of cattle . the preferred lysine is a granulated lysine having the following attributes . the particle size is preferably in the range of about 0 . 8 mm to about 2 . 5 mm , and more preferably is in the range of about 0 . 8 mm to about 1 . 2 mm . the lysine assay is 50 % minimum . the moisture content is 5 . 0 % maximum , and the bulk density is 0 . 70 ˜ 0 . 07 grams / cc . a lysine product useful in the invention is biolys ® manufactured by degussa corporation . a presently preferred biologically active substance is lysine . lysine is highly soluble and has been difficult to provide as an effective feed additive to the ruminant . when provided in effective amounts , as in the invention disclosed herein , it will aid in milk or meat production of cattle . the preferred lysine is a granulated lysine having the following attributes . the particle size is preferably in the range of about 0 . 8 mm to about 2 . 5 mm , and more preferably is in the range of about 0 . 8 mm to about 1 . 2 rnm . the lysine assay is 50 % minimum . the moisture content is 5 . 0 % maximum , and the bulk density is 0 . 70 ˜ 0 . 07 grams / cc . a lysine product useful in the invention is biolys ® manufactured by degussa corporation . the coating material coating the biologically active substance is a polymer coating capable of not degrading in the rumen and providing for controlled - release of the biologically active substance in the abomasum and digestive tract . the preferred polymer coating is a polyurethane coating . the polyurethane coating is preferably in the range of about 8 to about 25 micrometers in thickness and more preferably in the range of about 12 to about 20 micrometers in thickness . it is understood that the thickness of the polymer coating may vary depending on the biologically active substance and the polymer , the primary emphasis being to allow rumen by - pass and release of the biologically active material in the abomasum and subsequent digestive tract . a polyurethane coating useful in the invention is formed using polymeric diphenylmethane diisocyanate (“ polymeric mdi ”) and a polymeric polyester polyol blended with triethanolamine . a preferred polyurethane coating is formed using polymeric mdi having the following attributes : 25 % to 35 % isocyanate value ; a viscosity in the range of 50 centipoise to 300 centipoise at 25 ° c . ( 77 ° f . ), and an average functionality of 2 . 3 to 2 . 7 . a polymeric mdi useful in the invention is mondur ® mr light manufactured by bayer corporation . a preferred polymeric polyester polyol is produced via the transesterification of dimethylterephthalate with glycol and having a viscosity of 2500 centipoise to 5000 centipoise at 25 ° c . ( 77 ° f . ), and an average functionality of 2 . a polymeric polyester polyol useful in the invention is terate ® 258 manufactured by investa corporation . a method of forming the polyurethane coating is generally disclosed in u . s . pat . no . 6 , 537 , 611 , assigned to the assignee of this application , and which is incorporated herein by reference . the polymeric coating is surrounded by a wax coating . the wax coating comprises an “ intermediate wax .” a presently preferred intermediate wax comprises a wax derived from a high boiling lubricating oil distillate and may have the following characteristics : initial boiling point , ° f . : 718 (° c . : 381 . 1 ); drop point , ° f ., minimum . via astm d - 127 : 160 (° c . : 71 . 1 ); oil content , maximum , %, via astm d - 1500 : 3 . 0 ; viscosity , cst @ 100c , via astm d - 445 : 7 . 07 - 8 . 53 , and needle penetration , in 0 . 1 mm , maximum , via astm d - 1321 : 14 . the wax coating is preferably in the range of about 2 to about 7 micrometers in thickness , and more preferably in the range of about 3 to about 6 micrometers in thickness . it is understood that the thickness of the wax coating may vary depending on the biologically active substance and the polymer coating . the following examples illustrate the novelty and benefits of the invention . example 1 is a comparative example illustrating a composition which does not provide the benefits of the present invention . examples 2 and 3 disclose preferred compositions of the invention and methods of making the compositions of the invention . 3000 grams of granulated lysine , biolys ® ( degussa corporation ), average diameter 1 . 14 mm , were transferred into a stainless steel coating drum which contains lifting and mixing flights and was rotated at 38 revolutions per minute . the 3000 grams of granulated lysine were heated to 175 ° f . ( 79 . 4 ° c .) using a laboratory heat gun . a first polyurethane coating layer was provided on the lysine as follows : 1 ) 2 . 8 grams of polymeric mdi ( p - mdi ) ( mondur ® mr light , bayer corporation ) were injected into the most active part of the bed of tumbling granules , and 30 seconds were allowed for the p - mdi to evenly spread over the surface of the granules . then 8 . 5 grams of a blend of 90 % polyester polyol ( terate ® 258 , investa corporation ) and 10 % triethanolamine , were injected into the most active part of the bed and 60 seconds were allowed for the polyester polyol / triethanolamine to evenly spread over the surface of the granules . at the conclusion of the 60 seconds , 4 . 3 grams of p - mdi were injected into the most active part of the bed and 30 seconds were allowed for the p - mdi to evenly spread over the surface of the granules . after the conclusion of the 30 second spread time for the p - mdi injection , an additional 60 seconds were allowed to complete the reaction to form the first polyurethane coating layer . the granules were maintained at a temperature of 175 ° f . ( 79 . 4 ° c .) during this coating process . 2 ) step ( 1 ) was repeated 7 more times to provide a total polyurethane coating of 124 . 8 grams on the granulated lysine or a coating thickness of approximately 8 . 8 micrometers . 3 ) at the conclusion of the last polyurethane coating layer , 27 grams of molten intermediate wax , citgo hi - 618 wax ( citgo petroleum corporation ) were injected into the most active part of the bed and 60 seconds were allowed for the wax to spread evenly over the granulated lysine and providing for a wax coating thickness of approximately 3 . 0 micrometers . 4 ) the coated product was then cooled down to 115 ° f . ( 46 . 1 ° c .) and removed from the coating drum . 5 ) the resulting coated lysine product has a polyurethane coating of 3 . 96 % ( thickness of approximately 8 . 8 micrometers ), and an outer wax coating of 0 . 86 % ( thickness of approximately 3 . 0 micrometers ). 20 grams of the coated product were placed in 100 ml of deionized water which was thermostated at 102 ° f . ( 38 . 9 ° c . ), and the release of the lysine was measured over a period of 18 hours . the results of this release test are shown in table 1 below . 6 ) the coated product from example 1 was tested for “ rumen bypass ” using ruminally cannulated jersey cows . the product was exposed to the rumen of the cows for 16 hours , and the amount of lysine still present in the coated product was measured . it was found that 18 . 7 % of the lysine originally present was still present at the end of the rumen exposure period . the uncoated lysine granules were also exposed to the rumen in a similar test , and after 16 hours of exposure , 16 . 5 % of the lysine originally present was still present . the difference between the coated and uncoated lysine results was not statistically significant . thus , the product from example 1 , coated with almost 4 % polyurethane , and almost 0 . 9 % intermediate wax , did not yield any better rumen bypass than the uncoated lysine granules . 2765 grams of granulated lysine , biolys ® ( degussa corporation ), average diameter 1 . 00 mm , were transferred into a stainless steel coating drum which contains lifting and mixing flights and was rotated at 38 revolutions per minute . the 2765 grams of granulated lysine were heated to 175 ° f . ( 79 . 4 ° c .) using a laboratory heat gun . a first polyurethane coating layer was provided on the lysine as follows : 1 ) 3 . 2 grams of polymeric mdi ( p - mdi ) ( mondur ® mr light , bayer corporation ) were injected into the most active part of the bed of tumbling granules , and 30 seconds were allowed for the p - mdi to evenly spread over the surface of the granules . then 7 . 1 grams of a blend of 90 % polyester polyol ( terate ® 258 , investa corporation ) and 10 % triethanolamine , were injected into the most active part of the bed and 60 seconds were allowed for the polyester polyol / triethanolamine to evenly spread over the surface of the granules . at the conclusion of the 60 seconds , 4 . 7 grams of p - mdi were injected into the most active part of the bed and 30 seconds were allowed for the p - mdi to evenly spread over the surface of the granules . after the conclusion of the 30 second spread time for the p - mdi injection , an additional 60 seconds were allowed to complete the reaction to form the first polyurethane coating layer . the granules were maintained at a temperature of 175 ° f . ( 79 . 4 ° c .) during this coating process . 2 ) step ( 1 ) was repeated 15 more times to provide a total polyurethane coating of 240 grams on the granulated lysine or a coating thickness of approximately 16 . 1 micrometers . 3 ) at the conclusion of the last polyurethane coating layer , 27 . 7 grams of molten intermediate wax , citgo hi - 618 wax ( citgo petroleum corporation ) were injected into the most active part of the bed and 60 seconds were allowed for the wax to spread evenly over the granulated lysine and providing for a wax coating thickness of approximately 3 . 0 micrometers . 4 ) the coated product was then cooled down to 115 ° f . ( 46 . 1 ° c .) and removed from the coating drum . 5 ) the resulting coated lysine product has a polyurethane coating of 7 . 91 % ( thickness of approximately 16 . 1 micrometers ), and an outer wax coating of 0 . 91 % ( thickness of approximately 3 . 0 micrometers ). 20 grams of the coated product were placed in 100 ml of deionized water which was thermostated at 102 ° f . ( 38 . 9 ° c . ), and the release of the lysine was measured over a period of 28 hours . the results of this release test are shown in table 2 below . ruminal and intestinal digestibility of the product from example 2 were determined in a replicated randomized block using three lactating jersey cows fitted with ruminal and duodenal cannulas . approximately 10 g of the test product was weighed into a 5cm × 10cm bags ( ankom # 510 , average pore size of 50 ± 15 microns ). each bag was heat sealed twice . twenty - four bags were prepared plus 12 blanks individual bags were placed into a laundry bag by cow and replicate and labeled accordingly . immediately before insertion into the rumen , bags were soaked in 39 ° c . ( 102 . 2 ° f .) water for approximately 5 minutes to wet the test material . bags were inserted in the rumen and removed 16 hours after insertion . upon removal from the rumen , the bags were immediately placed in ice water until they could be washed three times . the bags were then immediately dried in a forced air oven at 55 ° c . ( 131 ° f .) for 24 hours . the dried bags were weighed and contents composited by treatments within cow and replicate . ruminal digestibility of the lysine was calculated for each sample . intestinal digestibility was determined by mobile bag technique . approximately 0 . 8 g of sample was weighed into the 5 × 6 cm polyester bag ( ankom # 510 cut to approximately 6 cm in length ) and heat sealed twice . a total of sixteen , bags for each replicate were prepared for insertion . the bags for the intestinal digestibility phase were soaked in pepsin - hcl solution ( 100 mg pepsin per liter of 0 . 01 n hcl ) for 2 hours at 39 ° c . ( 102 . 2 ° f .) in a shaking water bath . enough hcl was added to decrease ph to 2 . 4 . upon removal , the bags were rinsed with distilled water and kept at − 18 ° c . (− 0 . 4 ° f .) until introduction into the duodenum . one bag was inserted into the duodenal cannula each day every 15 minutes following a meal for a three - hour period ( total of 12 bags per cow per insertion ). bags were collected from the feces from 8 to 20 hours after initial insertion . upon recovery , bags were rinsed under tap water until the rinse water was clear . bags were dried at 55 ° c . ( 131 ° f .) and residue pooled by replicate within cow for analyses of lysine . the results of the animal tests for the product from example 2 were : a ) lysine content after 16 hour exposure to rumen = 70 . 1 % of amount originally present . b ) lysine digestibility in intestine = 79 . 2 %. therefore , the amount of lysine that escapes the rumen and is digested in the intestine for the product from example 2 is 70 . 1 %× 0 . 792 = 55 . 5 % of amount originally present . 3000 grams of granulated lysine , biolys ® ( degussa corporation ), average diameter 1 . 10 mm , were transferred into a stainless steel coating drum which contains lifting and mixing flights and was rotated at 38 revolutions per minute . the 3000 grams of granulated lysine were heated to 175 ° f . ( 79 . 4 ° c .) using a laboratory heat gun . a first polyurethane coating layer was obtained as follows : 1 ) 3 . 3 grams of polymeric mdi ( p - mdi ) ( mondur ® mr light , bayer corporation ) were injected into the most active part of the bed of tumbling granules , and 30 seconds were allowed for the p - mdi to evenly spread over the surface of the granules . then 7 . 7 grams of a blend of 90 % polyester polyol ( terate ® 258 , investa corporation ) and 10 % triethanolamine , were injected into the most active part of the bed and 60 seconds were allowed for the polyester polyol / triethanolamine to evenly spread over the surface of the granules . at the conclusion of the 60 seconds , 5 . 1 grams of p - mdi were injected into the most active part of the bed and 30 seconds were allowed for the p - mdi to evenly spread over the surface of the granules . after the conclusion of the 30 second spread time for the p - mdi injection , an additional 60 seconds were allowed to complete the reaction to form the first polyurethane coating layer . the granules were maintained at a temperature of 175 ° f . ( 79 . 4 ° c .) during this coating process . 2 ) step ( 1 ) was repeated 14 more times to provide a total polyurethane coating of 241 . 5 grams on the granulated lysine or a coating thickness of approximately 16 . 5 micrometers . 3 ) at the conclusion of the last polyurethane coating layer , 45 . 0 grams of molten intermediate wax , citgo hi - 618 wax ( citgo petroleum corporation ) were injected into the most active part of the bed and 60 seconds were allowed for the wax to spread evenly over the granulated lysine and providing for a wax coating thickness of approximately 4 . 9 micrometers . 4 ) the coated product was then cooled down to 115 ° f . ( 46 . 1 ° c .) and removed from the coating drum . 5 ) the resulting coated lysine product has a polyurethane coating of 7 . 35 % ( thickness of approximately 16 . 5 micrometers ), and an outer wax coating of 1 . 37 % ( thickness of approximately 4 . 9 micrometers ). 20 grams of the coated product were placed in 100 ml of deionized water which was thermostated at 102 ° f . ( 38 . 9 ° c . ), and the release of the lysine was measured over a period of 28 hours . the results of this release test are shown in table 3 below . 6 ) the coated lysine product from example 3 was tested for ruminal and intestinal digestibility in the same way as was the coated lysine product from example 2 . the results of the animal tests for the product from example 3 were : b ) lysine digestibility in intestine = 62 . 0 %. therefore , the amount of lysine that escapes the rumen and is digested in the intestine for the product from example 3 is 97 . 6 %× 0 . 62 = 60 . 5 % the above examples 2 and 3 illustrate the effectiveness of the present invention . the ruminant feed of the present invention provides for a release of the lysine primarily in the abomasum and subsequent digestive tract of the ruminant . it provides for predictability of release and is generally inexpensive and not difficult to manufacture . thus , an effective composition of the invention comprises a composition which will have a lysine content after about 16 hours exposure to the rumen of at least 60 % of amount originally present , and more preferably in the range of about 70 % to about 100 % of amount originally present . the ruminant feed composition of the invention is preferably mixed with other ruminant feed rations . based on the predictability of the release of the biologically active substance those skilled in the art will be able to determine the appropriate amount of the ruminant feed additive for the ruminant &# 39 ; s diet . the ruminant feed composition of the invention is preferably mixed with other ruminant feed rations . based on the predictability of the release of the biologically active substance those skilled in the art will be able to determine the appropriate amount of the ruminant feed additive for the ruminant &# 39 ; s diet .

US-73073710-A

the present invention provides a needle arrangement comprising a plurality of injection needles , one or more needle containers for the plurality of injection needles , each of the one or more needle containers being structured to hold at least one of the plurality of injection needles , and a dedication of each of the plurality of injection needles held in the one or more needle containers to one of at least two predetermined dose sizes .

when in the following relative expressions , such as “ upwards ” and “ downwards ”, are used , these refer to the appended figures and not necessarily to an actual situation of use . the shown figures are schematic representations for which reason the configuration of the different structures as well as their relative dimensions are intended to serve illustrative purposes only . fig1 shows a dose titration system 100 according to a first embodiment of the invention . the dose titration system 100 comprises an injection device 1 and a needle box 10 . the injection device 1 comprises dose setting and injection mechanisms which are accommodated in a housing 5 , and is capable of delivering five predetermined dose sizes of a drug from an exchangeable drug cartridge ( not visible ) held in a cartridge holder 6 . a needle interface 7 is provided at the distal end of the injection device 1 for reception of an injection needle ( not shown ). the needle box 10 comprises a case 11 and a top cover 12 . the top cover 12 is visually divided into five columns 13 , and each column 13 is provided with a respective number 14 indicating a position in a sequence . further , each column 13 has seven needle wells 15 , each needle well 15 being structured to contain one sealed injection needle ( not shown ), as well as a specific dose size indication 16 , 17 . the dose titration system 100 is intended for use as follows . the needle box 10 initially holds one sealed injection needle in each of the 35 needle wells 15 . when a user starts a dose titration period the first injection needle to be used is taken from the column numbered “ 1 ”. this injection needle is mounted on the needle interface 7 of the injection device 1 and the injection device 1 is set to deliver a dose corresponding to the dose size indication 16 , i . e . a dose of 0 . 6 mg . after dose administration the injection needle is discarded and the needle interface 7 is thus ready to receive a new injection needle . for the next dose administration the user chooses another injection needle from column “ 1 ”, mounts it on the needle interface 7 , and operates the injection device 1 to deliver another dose of 0 . 6 mg . after seven injections and use of seven injection needles column “ 1 ” is empty and the user must select an injection needle from column “ 2 ” for the following dose administration . in doing that , the user is alerted to the fact that the second dose titration step has been reached and , accordingly , that the injection device 1 must be set to deliver a dose corresponding to the dose indication 17 , i . e . a dose of 1 . 2 mg . the sketched procedure is continued for the remainder of the dose titration period . the above described dose titration system 100 is i . a . useful for once daily dosing over a period of five weeks . the dose size associated with column “ 5 ” may be the target dose for subsequent regular administration . fig2 shows a dose titration system 200 according to a second embodiment of the invention . the dose titration system 200 functions in principle much like the dose titration system 100 according to the first embodiment of the invention . however , instead of a single injection device which is able to deliver a plurality of predetermined dose sizes , the dose titration system 200 comprises two fixed dose injection devices 2 , 2 ′ which are each able to deliver a single predetermined dose size . the dose titration scheme to be followed with this system consists of a first number of administrations of 1 . 8 mg and a second number of administrations of 3 . 0 mg . accordingly , the dose titration system 200 further comprises a needle casing 21 carrying the first number of injection needles 29 on a substrate 23 , and another needle casing 22 carrying the second number of injection needles 28 on a substrate 24 . the needle casing 21 comprises a dose size indication 27 of 1 . 8 mg and the needle casing 22 comprises a dose size indication 26 of 3 . 0 mg . the injection needles 29 carried in needle casing 21 are for use with the injection device 2 , which is structured to deliver 1 . 8 mg of a contained drug each time an accommodated injection mechanism is activated . similarly , the injection needles 28 carried in needle casing 22 are for use with the injection device 2 ′, which is structured to deliver 3 . 0 mg of its contained drug each time an accommodated injection mechanism is activated . fig3 shows a needle arrangement 30 for use in a dose titration system , e . g . of the type described in the above . the needle arrangement 30 comprises a needle box 31 holding a number of injection needles 39 in an interior space 35 , and a further needle box 32 , similarly holding a number of injection needles ( not visible ). the needle box 31 has a dose size indication 37 of 0 . 6 mg printed on one exterior surface and a sequence related indication 34 printed on a second exterior surface , informing the user that the injection needles 39 in that particular box are to be used in the first dose titration phase when delivering a dose of 0 . 6 mg . the needle box 32 has a dose size indication 36 of 1 . 8 mg printed on one exterior surface and a sequence related indication ( not visible ) printed on a second exterior surface , informing the user that the injection needles in that box are to be used in the second dose titration phase when delivering a dose of 1 . 8 mg .

US-201515119028-A

this invention consists of a range of easily attachable , disposable and sterilizable caps which can be fitted onto the output end of laser therapy heads to prevent the spread of transmissible diseases during laser therapy treatments of humans and animals over a range of laser wavelengths at power levels across the electro - magnetic spectrum while maintaining laser beam intensities of less than one milliwatt per circular area of 7 mm diameter .

in fig1 numeral 1 indicates a moulded plastic half - section of a direct beam laser therapy unit head , numeral 2 indicates a laser tube , functioning as a laser beam generator numeral 3 the ballast resistors and numeral 4 the multicore , shielded electrical cable which connects said head assembly to the laser power supply at control unit . the laser output beam is indicated by numeral 5 as it propagates through the channel indicated by numeral 6 which is completed when the second half of the mould is attached to said bottom half 1 . numeral 7 indicates the locating groove for correctly orientating the invention onto the laser therapy head whilst the groove indicated by numeral 8 is the one used to firmly attach said invention onto said head . numeral 9 indicates a groove to locate either an optically polished window or an optically polished laser beam attenuator which also acts as a stop for glass containers filled with various liquids which can be inserted in channel 6 and through which laser beam 5 can propagate . numeral 10 indicates the recess for the safety switch necesary on class ii therapy lasers to block beam 5 as required . numeral 11 indicates the moulded cradle which accepts the &# 34 ; o &# 34 ; ring mounting around the tube 2 . in fig2 numeral 12 indicates the grooves in body 1 into which are positioned the springed conductors to complete the electrical circuits for the skin resistance electrodes used to locate the acupuncture points and activate the laser beam once they have been found . numeral 13 indicates the location points used to firmly clip the top and bottom sections 1 together prior to gluing . in fig3 numeral 14 indicates the body of the invention which fits over the end cone of body 1 shown in the previous figures . numeral 15 indicates the circular rib which fits into groove 8 of the cone of body 1 shown in fig1 so as to lock the invention into position during operation . numeral 16 indicates the central tube of the invention which fits into channel 6 of fig1 to such a depth as to keep the possibility of contamination to an absolute minimum . numeral 17 indicates the two locating ribs to orient the invention , via grooves 7 of fig1 onto the output head of body 1 of fig1 . numeral 18 indicates the output aperture through which the laser beam emerges when the invention is attached to said laser therapy head . in fig4 numeral 19 indicates the electrodes used for the skin resistance measurements used for the location of acupuncture points . numeral 20 indicates the tips of electrodes 19 which come into contact with the body of the patient . for galvanic skin resistance measurements only one of the said electrodes 19 is connected to the electrical circuits because the other contact is made via a hand - held electrode . however , for localized skin resistance measurements ( lsr ) both electrodes 19 are used with the skin between the two electrodes 20 forming part of the circuit . in fig5 numeral 21 indicates the spring connectors used to complete the skin resistance measurement circuit when the invention shown in fig4 is attached to the laser therapy unit head 1 . in fig6 numeral 22 indicates the hollow extension stem through which laser beam 5 propagates to the solid transparent head indicated by numeral 23 . the laser beam 5 is then totally internally reflected via the flat surface indicated by numeral 24 onto the convex face indicated by numeral 25 via an external focus spot indicated by numeral 26 into the divergent beam indicated by numeral 27 . as far as eye safety is concerned , focus point 26 will not be harmful to the eye for class ii safety lasers because the low power beam 5 expands into low intensity beam 27 . also low intensity beam 27 can be used to illuminate a larger area of the patient &# 39 ; s body . on the other hand , fine focus point 26 is very useful for the treatment of delicate areas such as those on the ears or around the eyes where the standard laser beam output diameters are far too big for precision therapeutic treatments . in fig7 numeral 28 indicates a solid optical element through which laser beam 5 propagates after entering through the concave surface indicated by numeral 29 then expands via beam 30 , to exit via the convex surface indicated by numeral 31 to become the output beam indicated by numeral 32 which can have a rectangular or square cross - section . in fig8 numeral 33 indicates a transparent plastic cap atop stem 22 through which beam 5 propagates , to be reflected into a 360 deg planar distribution indicated by numeral 34 via reflection off a conically cut segment indicated by numeral 35 . the tip of the invention in this configuration is capped as indicated by numeral 36 . the invention has applications in conjunction with any laser therapy unit . the invention can be manufactured from a wide range of materials including both moulded plastics and metals such as stainless steel . the invention provides hygienic , disposable caps for laser therapy units operating both outside and within the human and animal bodies .

US-80588185-A

a wearable apparatus , comprising : a body capable of covering a mouth and / or a nose of a wearer wearing the apparatus , wherein , the body comprises : an air detection device for detecting quality of the air outside of the body . users can be acknowledged the air quality condition , etc ., by the wearable apparatus , and smart human - machine interaction function can be achieved .

in order to make objects , technical details and advantages of the embodiments of the invention apparent , the technical solutions of the embodiments will be described in a clearly and fully understandable way in connection with the drawings related to the embodiments of the invention . apparently , the described embodiments are just a part but not all of the embodiments of the invention . based on the described embodiments herein , those skilled in the art can obtain other embodiment ( s ), without any inventive work , which should be within the scope of the invention . in the description of the invention , it should be known that , the terms “ center ”, “ up ”, “ down ”, “ before ”, “ after ”, “ left ”, “ right ”, “ vertical ”, “ horizontal ”, “ top ”, “ bottom ”, “ inside ”, “ outside ” and the like , showing direction or position relationship , are all direction or position basing on the illustration of the drawings , and only for the convenience of describing the invention or simplify the description , but not for indicating or suggesting the pointed apparatuses or elements must have the special direction or be constructed or operated with the special position , thus they should not be considered a limitation of the invention . the terms “ first ”, “ second ” are only used to depict objective , should not be considered to indicate or suggest relative importance or imply the amount of the indicated technical features . therefore , the features limited with “ first ”, “ second ” may indicate or imply including one or more the features . in the description of this invention , the meaning of “ a plurality of ” is two or more than two except additional statement . referring to fig1 , fig1 a and fig1 b show a particular embodiment of a smart wearable apparatus of the present invention . the smart wearable apparatus in the embodiment includes a body 1 for covering a mouth and a nose of a wearer , the body 1 is provided with a detachable filter device 2 . for example , the filter device 2 can be a filter layer , for example , a layered filter film , a layered filter paper , a layered filter screen , or the like ; can also be formed by adding filter material on the material of the body 1 , and can also be a filter having automatic filter function . for example , the body 1 is provided with an air detection unit 8 ( shown in fig1 b ) for detecting air quality at a position adjacent to the filter device 2 , and the body 1 is also provided with a notification device at its outer surface . when the air detection unit 8 detects that the ambient air has poor quality , a notification can be sent to the user in alarm , voice , image , etc . ways . for example , the notification device can be a display screen 3 , the display screen 3 is connected with the air detection unit 8 , and the display screen 3 may display monitor data fed back from the air detection unit 8 . the notification device can also be a speaker , a vibration element , a led lamp , or the like . for the smart wearable apparatus provided by the embodiment of the present invention , when wearing , the wearer can cover the body 1 over his mouth and nose , and then fix a tether 4 on his ears or head , to complete wearing . since the wearer needs breath by the mouth and the nose , for the wearable apparatus such as a mouth mask , a face mask , or the like , after being used for a relative long time , dust will accumulated at positions corresponding to the mouth and the nose of the wearer , and thus the filter effect will be degraded . in the embodiment of the present invention , the filter device 2 is detachably so that the wearer can easily detach the failed filter device 2 for changing , it is avoided that the wearable apparatus is changed as a whole , and thus the resource is saved . in addition , the body 1 can still be provided with an air detection unit 8 for detecting air quality near the filter device 2 . the position of the air detection unit shown in fig1 b is only a schematic provision position , and the air detection unit 8 can be provided at various positions at outside , inside , or a side of the body 1 , or the like , so that the air detection unit can contact with ambient air and detect the air . the notification device , e . g . a display screen 3 is provided on an outer surface of the mask body 1 , the display screen 3 is connected with the air detection unit 8 , and the display screen 3 can display monitor data fed back from the air detection unit 9 , whereby , the user can acknowledge the air quality in real time , so that the user can be notified of wearing the apparatus , such as mouth mask and so on in time , and thus a smart human - machine interaction can be achieved . when the user is wearing the mouth mask , the display screen 3 may further display some other information , e . g . emotion of the user , whereby , when the user is wearing the mouth mask , the display screen may display smile emotion , travel entertainment of the user can be improved . according to one example of the present invention , referring to fig2 , when the filter device 2 is a filter layer , the filter device 2 can include a filter screen 21 and a filter screen support 22 . since the filter screen 21 is soft , and is difficult to keep its shape , it is preferably to connect the filter screen 21 with the body 21 through the filter screen support 22 . optionally , the filter screen support 22 is of ring shape and connected with the body 1 . the filter screen 21 is detachably connected to a ring shaped opening of the filter screen support 22 . for example , the body 1 can be provided with a through hole having a profile matched with the filter screen support 22 at its middle part , then the filter screen support 22 is connected with the through hole , and finally , edges of the filter screen 21 are adhered with the filter screen support 22 . thus , the filter screen 21 can be kept in a constant shape , which can prevents from being deformed when in used so as to affect its filter effect . in an example of the embodiment of the present invention , the filter screen support 22 can be connected with the body 1 in various ways . for example , the filter screen support 22 can be movably fitted with the body 1 , that is , the filter screen support 22 can be moved with respect to the body 1 , as shown in fig1 a , the filter screen support 22 can be hinged with the body 1 through a hinge 5 at one side thereof . when the filter screen 1 is needed to be changed , what is needed to do is only rotating the filter screen support 22 along the hinge 5 so as to open the filter screen support 22 and making the inner side of the filter screen support 22 to face outward , and then , the filter screen 21 provided inside of the filter screen support 22 can be easily changed . in addition , the filter screen support 22 can be detachably connected with the body 1 , for example , two of them are engaged to each other by an engaged connecting structure . for example , two sides of the filter screen support 22 are provided with snap grooves , and the body 1 is provided with two elastic snap joints , and then the filter screen support 22 can be detachably connected with the body 1 by fitting the snap grooves with the snap joints . in addition , the filter screen support 22 can be connected with the body 1 by screw connection , for example , a ring shaped protrusion is provided at the through hole of the body 1 , and a male thread is provided at an outer surface of the ring shaped protrusion , then the filter screen support 22 is formed into a cylinder shape , and a female thread matched with the above male thread is provided on an inner surface of the cylindrical filter screen support 22 . thus , upon assembly , what is to be done is to screw the female thread and the male thread . by the screw connection , the filter screen support 22 can be easily mounted , and protrusion height of the filter screen support 22 can be adjusted by the threads . in order to enable the wearable apparatus provided by the embodiment of the present invention to better fit with the face of the user , the display screen 3 is preferably a flexible display screen . due to flexible character , the flexible display screen can be bent according to the profile of the human face , and thus when the user wears it on his face , it can be better fit with the profile of the face of the user . for example , the air detection unit 8 may include a temperature sensor , a humid sensor and a pm 2 . 5 sensor , or any one of these sensors or their combination . pm 2 . 5 is the particles having a diameter less than or equal with 2 . 5 micrometer in the air . thus , by the air detection unit 8 , air temperature , air humid and pm 2 . 5 value of the air can be detected . after that , these monitor results can be provided to the user through the notification device , so that the wearer can wear the wearable apparatus such as the mouth mask according to the air condition in time . optionally , the wearable apparatus provided by the embodiment of the present invention may have a signal transmitting unit 9 ( shown in fig1 b ), thus , it is possible to achieve that the information of a smart wearable apparatus can be matched with other terminals , such as a smart phone , a wristband , and so on . the air quality information , weather information , etc . detected by the smart wearable apparatus can be sent to the other smart terminals , such as the smart phone , the wrist band , and so on . the residual amount of contamination on the mask filter device 2 can be displayed on the smart phone , the wristband , so that the user can easily acknowledge the environment information at anywhere and anytime , wear the wearable apparatus in time , or change the filter device 2 in the wearable apparatus . the signal transmitting unit 9 can transmit signals in wired manner or wireless manner . when transmitting in wired manner , the air detection unit 8 is provided with a connection interface , and the connection interface is used to connect the air detection unit 8 with an external smart terminal . when transmitting in wireless manner , bluetooth , wireless local area network , infrared transmission , etc . can be used . since the wearer need to breath with his mouth and nose , after wearing the mouth mask , breath becomes difficult due to blocking effect of the mouth mask , especially , the breath will become even more difficult when carrying out aerobic exercise . in order to solve this problem , as shown in fig3 a , it is preferable that a suction device can be provided inside of the filter device 2 , for example , a mini electric fan 6 can be provided , and the mini electric fan 6 is provided with its outlet side facing the mouth and nose of the wearer , so that the mini electric fan 6 blows to the wearer . thus , not only the filter effect can be improved , but also sufficient amount of air can be supplied to the inside of the mouth mask body 1 , which can meet the situation having increased oxygen demand . the mini electric fan 6 can be connected with the body 1 or the filter screen support 22 by a fan bracket 61 . for example , the mini electric fan 6 can be powered by a mini power source ( e . g . a primary battery or a secondary batter ) included in the smart wearable apparatus . in order to reduce weight , the embodiments of the present invention can also be externally provided with a mini power source which is connected with the mouth mask body by a wire . the mini power source can be put in a pocket of cloth . as shown in fig1 , a photovoltaic battery panel 7 is provided at the outer surface of the body 1 , and electric power converted by the photovoltaic battery panel 7 can be used to power the mini electric fan 6 . similarly , the photovoltaic battery panel 7 can also power the display screen 3 and the air detection unit 8 , thus , the solar energy can be used , and object of saving energy can be achieved . the wearable apparatus according to an embodiment of the present invention may further include a muffler device , e . g . a muffler layer , as shown in fig3 b , the muffler layer can be provided on an inner side of the filter screen 21 . thus , when the wearer read some documents loud in public , such as on a bus , the voice generated upon reading can be prevented from transmitting outside to influence on others , especially suitable to be worn by students . the muffler device can be provided by providing a muffler layer inside or outside of the body , the muffler layer can be made from sound insulation material , e . g . sound insulation cotton , and it is preferable that the muffler layer has a surface formed as rough structure , by which sound waves can be reflected multiple times , thus the sound can be dampened gradually and the sound insulation effect can be further improved . it is preferable that the filter device 2 is made by material capable of filtering particles having a diameter less than or equal with 2 . 5 micrometer . for example , the material for the filter device 2 is a nuclear pore film , the nuclear pore film has a lot of micro holes thereon , has very high hole density , and thus can filter most of particles . in addition , there are some function groups on surfaces and hole walls of the nuclear pore film , these function groups can function to effectively block pm 2 . 5 with efficiency over 98 %. for example , the body 1 is formed by a material which is preferably light plastic , the light plastic has low weight and also has a certain ductility , therefore , can better attach with the profile of the user face . the smart wearable apparatus provided by the embodiments of the present invention can be a mouth mask type wearable product , and also can be a face mask product , a scarf type product , and so on , all these should be fallen within the protection subject of the present invention , as long as the product itself has a function of covering the mouth and nose . in the smart wearable apparatus provided by the embodiments of the present invention , a detachable filter layer is provided on the body at the portion corresponding to the mouth and the nose of the wearer . since the user often breath with the mouth and the nose , for the wearable apparatus such as a mouth mask , a face mask , etc ., after being used for a long time , dust will be accumulated at the positions corresponding to the mouth and the nose of the wearer , thus the filter effect will be degraded . however , in the embodiments of the present invention , the filter layer is provided as a detachable structure , so that the wearer can easily change the failed filter layer , it is avoided to change the entire wearable apparatus , and thus resource is saved . in addition , an air detection unit for detecting air quality is provided on the body near the filter layer , and for example , a display screen is provided on an outer surface of the mouth mask , the display screen is connected with the air detection unit , and can display the monitor data fed back from the air detection unit , whereby the user can acknowledge the air quality condition in real time , and can be notified to wear the wearable apparatus like the mouth mask in time , and thus smart human - machine interaction can be achieved . in the description , the particular features , structures , materials or characters can be suitably combined in any one or more embodiments or examples . the present application claims the priority of chinese patent application no . 201510278623 . x filed on may 27 , 2015 , the chinese patent application is entirely incorporated therein as a part of the present application by reference .

US-201515129926-A

the present invention relates to a dishwasher and a method for controlling same , and the dishwasher may comprise a wash tub having an opening on at least one side thereof ; a spray nozzle , provided in the interior of the wash tub , for spraying wash water ; a reflecting module capable of moving in the interior of the wash tub , and reflecting the wash water sprayed by the spray nozzle ; and a moving module , to which the reflecting module is detachably attached , for moving same in at least one direction .

hereinafter , an overall structure of an embodiment of a dishwasher 1 will be generally described with reference to fig1 to 3 . fig1 is a perspective view of an embodiment of a dishwasher , fig2 is a perspective view illustrating a state in which a door of the dishwasher is open , and fig3 is a schematic cross - sectional view of the embodiment of the dishwasher . referring to what is illustrated in fig1 , the dishwasher 1 may include a main body 10 that forms an exterior and has a wash tub 30 provided therein . the main body 10 may be in the shape of a box as illustrated in fig1 . however , the shape of the main body 10 is not limited to that illustrated in fig1 , and may also be formed in the shape of a cylinder or a polygonal column , or may also be formed in the shape of a polygonal box besides a hexahedron . other than above , the dishwasher 1 may be formed in various shapes that may be applied as an outer shape . a user interface may be installed at an outer surface of the main body 10 . a user interface 20 may include an input unit that receives a predetermined instruction from a user . an input unit 20 a may include at least one of a keyboard , a mouse , a track - ball , a touch screen , a touch pad , a paddle , various types of levers or handles , a joystick , and other various input means . according to an embodiment , the input unit 20 a may also be installed at an external device connected to the dishwasher 1 . the external device may include a personal computer ( pc ), a smartphone , a tablet pc , a personal digital assistant ( pda ), a cellular phone , a remote controller , etc . the user interface 20 may include a display unit 20 b for displaying various types of information to the user . the display unit 20 b may include a display means using a plasma display panel ( pdp ), a light emitting diode ( led ), an organic light emitting diode ( oled ), a liquid crystal display ( lcd ), or the like . the display unit 20 b may also express a three - dimensional image . a door 11 through which dishes may be inserted and withdrawn may be provided at a side of the main body 10 . the door 11 may be opened and closed by being moved in a predetermined direction as illustrated in fig2 . according to an embodiment , a hinge that rotates a body of the door 11 in a predetermined direction may be provided at one end of the door 11 . according to an embodiment , the door 11 may also be opened and closed by a sliding means . the door 11 may be provided in front of an opening 11 a of a wash tub 30 , and the user may store dishes in the wash tub 30 through the open door 11 and the opening 11 a . a handle 11 b may be provided at the door 11 so that the user can easily open and close the door 11 . according to an embodiment , the user interface 20 such as the input unit 20 a or the display unit 20 b may also be installed at the door 11 . the user interface 20 may also be installed near the handle 11 b . referring to what is illustrated in fig2 and 3 , the wash tub 30 in which dishes are washed may be provided inside the main body 10 . the wash tub 30 may be formed in a shape corresponding to the outer shape of the main body 10 . for example , the wash tub 30 may be formed in the shape of a box . although an embodiment in which the wash tub 30 is formed in the shape of a hexahedral box is illustrated in fig3 , the shape of the wash tub 30 is not limited thereto . the wash tub 30 may also be formed in the shape of a cylinder or a polygonal column , or may also be formed in the shape of a polygonal box besides a hexahedron . in addition , the wash tub 30 does not always have to be formed in a shape corresponding to the outer shape of the main body 10 . the opening 11 a through which dishes may be inserted and withdrawn in at least one direction may be provided at one surface of the wash tub 30 . the opening 11 a may be opened and closed by the door 11 as illustrated in fig2 and 3 . the wash tub 30 may include a plurality of walls 31 to 34 and a bottom plate 35 . hereinafter , while describing the wash tub 30 , a direction and an area in which the bottom plate 35 is disposed will be referred to as a lower direction or a lower portion , and a direction opposite the direction in which the bottom plate 35 is disposed will be referred to as an upper direction or an upper portion . a direction in which the opening 11 a is disposed will be referred as the front , and a direction opposite the direction in which the opening 11 a is disposed will be referred to as the rear . in addition , a wall disposed at the opposite side of the opening 11 a will be referred to as a rear wall 32 , a wall disposed at the left when viewed from the opening 11 a will be referred to as a left wall 33 , and a wall disposed at the right when viewed from the opening 11 a will be referred to as a right wall 34 . furthermore , a wall disposed at the opposite side of the bottom plate 35 of the wash tub 30 will be referred to as an upper wall 31 . dish accommodation units 12 a and 12 b in which dishes are mounted , a nozzle assembly 300 that sprays wash water toward the dish accommodation units 12 a and 12 b or a reflecting module 400 , the reflecting module 400 that reflects the wash water sprayed from spray nozzles 311 , 313 , and 320 of the nozzle assembly 300 toward the dishes while moving inside the wash tub 30 , and a moving module 420 that moves the reflecting module 400 may be installed inside the wash tub 30 . the dish accommodation units 12 a and 12 b may be in the shape of a basket in which pins and the like are formed . the basket may be a wire rack formed of a wire so that the wash water can pass therethrough without pooling . the dish accommodation units 12 a and 12 b may be detached from the wash tub 30 . the dish accommodation units 12 a and 12 b may also be withdrawn outside of the opening 11 a using a rail and a roller ( not shown ), etc . provided at the left wall 33 and the right wall 34 inside the wash tub 30 . the withdrawal of the dish accommodation units 12 a and 12 b may be performed manually or automatically . the dish accommodation units 12 a and 12 b may include an upper dish accommodation unit 12 a disposed at an upper portion of the wash tub 30 and a lower dish accommodation unit 12 b disposed at a lower portion of the wash tub 30 . fig4 is a view illustrating an embodiment of a nozzle assembly . referring to what is illustrated in fig4 , the nozzle assembly 300 may include an upper rotary nozzle assembly 311 provided at the upper portion of the wash tub 30 , a middle rotary nozzle assembly 313 provided at a central portion of the wash tub 30 , and a fixed nozzle assembly 320 provided at the lower portion of the wash tub 30 . each of the nozzle assemblies 311 , 313 , 330 , and 340 may spray wash water with high pressure to wash dishes . the upper rotary nozzle assembly 311 may be provided above the upper dish accommodation unit 12 a and spray the wash water toward the upper dish accommodation unit 12 a while rotating by a water pressure . a spray hole 312 through which wash water is sprayed may be provided at a lower end of the upper rotary nozzle assembly 311 as illustrated in fig2 . the upper rotary nozzle assembly 311 may directly spray wash water toward the dishes stored in the upper dish accommodation unit 12 a . the middle rotary nozzle assembly 313 may be disposed between the upper dish accommodation unit 12 a and the lower dish accommodation unit 12 b . the middle rotary nozzle assembly 313 may spray the wash water in upper and lower directions while rotating by the water pressure like the upper rotary nozzle assembly 311 . a rotational direction of the middle rotary nozzle assembly 313 may be the same as or different from that of the upper rotary nozzle assembly 311 . spray holes 314 may be provided at an upper end and a lower end of the middle rotary nozzle assembly 313 . the wash water may be sprayed onto the dishes accommodated in the upper dish accommodation unit 12 a and the lower dish accommodation unit 12 b through the spray holes 314 . the fixed nozzle assembly 320 may be fixed at one side of the wash tub 30 as illustrated in fig3 . the fixed nozzle assembly 320 may be disposed adjacent to the rear wall 32 of the wash tub 30 . fig5 is a perspective view illustrating the embodiment of the fixed nozzle assembly and the reflecting module . as illustrated in fig5 , the fixed nozzle assembly 320 may include a left fixed nozzle 330 and a right fixed nozzle 340 . a plurality of spray holes 331 and 341 arranged in a horizontal direction may be provided at each of the left fixed nozzle 330 and the right fixed nozzle 340 . the spray holes 331 and 341 may spray the wash water toward the front of the wash tub 30 . according to an embodiment , the fixed nozzle assembly 320 may spray the wash water independent of the rotary nozzle assemblies 311 and 313 . consequently , the dishwasher 1 may also perform dish washing only with wash water sprayed in a particular direction . in addition , the left fixed nozzle 330 and the right fixed nozzle 340 of the fixed nozzle assembly 320 may also spray wash water independent of each other . consequently , the dishwasher 1 may be subdivided into particular areas . the wash water sprayed by the fixed nozzle assembly 320 may be reflected toward the dishes by the reflecting module 400 provided in front of the spray holes 331 and 341 . the reflecting module 400 may longitudinally extend in the horizontal direction of the wash tub 30 to be able to reflect the wash water sprayed by the plurality of spray holes 331 and 341 of the fixed nozzle assembly 320 as illustrated in fig5 . in other words , one end portion in a longitudinal direction of the reflecting module 400 may be provided to be adjacent to the left wall 33 of the wash tub 30 , and the other end portion in the longitudinal direction of the reflecting module 400 may be provided to be adjacent to the right wall 34 of the wash tub 30 . the reflecting module 400 may linearly reciprocate along front and rear directions of the wash tub 30 . consequently , the spray structure that includes the fixed nozzle assembly 320 and the reflecting module 400 may wash all areas of the wash tub 30 without a blind spot . this is differentiated from the case of a rotary nozzle in which wash water can only be sprayed within a boundary of a radius of rotation . the reflecting module 400 may reflect the wash water sprayed by the fixed nozzle assembly 320 in the upper direction or the lower direction . when the fixed nozzle assembly 320 is disposed below the lower dish accommodation unit 12 b as illustrated in fig5 , the reflecting module 400 may reflect the sprayed wash water in the upper direction to allow the wash water to reach dishes stored in the upper dish accommodation unit 12 a or dishes stored in the lower dish accommodation unit 12 b . when the fixed nozzle assembly 320 is disposed between the upper dish accommodation unit 12 a and the lower dish accommodation unit 12 b , the reflecting module 400 may reflect the wash water in the upper direction or the lower direction to allow the wash water to be transferred to dishes stored in the upper dish accommodation unit 12 a or the lower dish accommodation unit 12 b . when the fixed nozzle assembly 320 is disposed above the upper dish accommodation unit 12 a , the reflecting module 400 may reflect the wash water in the lower direction to allow the wash water to be transferred to the dishes stored in the upper dish accommodation unit 12 a or the lower dish accommodation unit 12 b . the wash water sprayed by the left fixed nozzle 330 may be reflected only to a left area of the wash tub 30 by the reflecting module 400 , and the wash water sprayed by the right fixed nozzle 340 may be reflected only to a right area of the wash tub 30 by the reflecting module 400 . in this case , when the left fixed nozzle 330 and the right fixed nozzle 340 of the fixed nozzle assembly 320 spray the wash water independent of each other , a left side and a right side of the dishwasher 1 may be separately washed independent of each other . of course , washing areas of the dishwasher 1 may be further subdivided and separately washed as necessary . fig6 is an exploded view of an embodiment of the reflecting module and a moving module . the moving module 420 may move the reflecting module 400 in at least one direction . the moving module 420 may include a rail assembly 430 , a moving body 490 that moves along a rail 440 of the rail assembly 430 , and a motor 530 that generates a driving force for moving the moving body 490 . the rail assembly 430 may include the rail 440 that guides the movement of the reflecting module 400 and has an inner space 441 , a drive pulley 500 that rotates by being connected to the motor 530 , a belt 520 that rotates by being connected to the drive pulley 500 and is disposed in the inner space 441 of the rail 440 , and an idle pulley 510 connected to the belt 520 to rotatably support the belt 520 . in addition , the rail assembly 430 may also include a rear holder 450 that rotatably supports the drive pulley 500 and is coupled to a rear end portion of the rail 440 , and a front holder 460 that rotatably supports the idle pulley 510 and is coupled to a front end portion of the rail 440 . the rail 440 may be formed with a metal material . the rail 440 may be provided to longitudinally extend in front and rear directions at the center with respect to the left wall 33 and the right wall 34 of the wash tub 30 . according to an embodiment , the rail assembly 430 may include one rail 440 as illustrated in fig5 or may also include a plurality of rails . the rail 440 may have a pipe shape in which an opening 445 is formed at a lower portion . for example , as illustrated in fig6 , the rail 440 may include the inner space 441 , an upper wall 442 , a plurality of lower walls 444 a and 444 b spaced apart from each other , both side walls 443 , and the lower opening 445 formed between the plurality of lower wall 444 a and 444 b . the lower opening 445 may be formed to be extended from one end portion to the other end portion in a longitudinal direction of the rail 440 . when the rail 440 has the shape above , since the belt 520 may be disposed in the inner space 441 of the rail 440 , an operation of the belt 520 being interfered with due to coming into contact with dishes in the wash tub 30 or the belt 520 being corroded due to coming into contact with the wash water in the wash tub 30 may be prevented . in addition , the driving force of the belt 520 may be transmitted to the reflecting module 400 through the opening 445 . the belt 520 may be disposed in the inner space 441 of the rail 440 . the belt 520 may form a closed loop by being wound around the drive pulley 500 and the idle pulley 510 and may rotate along a rotational direction of the motor 530 when the motor 530 operates . the belt 520 may be formed of a resin material including aramid fibers . a toothed form 521 that transmits the driving force of the belt 520 to a belt holder 480 may be formed at an inner surface of the belt 520 . fig7 is a view illustrating an embodiment of a rail , a belt , a drive pulley , and a rear holder of the moving module , and fig8 is a cross - sectional view of the embodiment of the rail , the belt , the drive pulley , and the rear holder of the moving module . according to an embodiment , the drive pulley 500 may include a shaft connection unit 503 that receives a driving force by being connected to a rotary shaft 501 and a drive shaft 531 of the motor 530 and a belt coupling unit 502 to which the belt 520 is coupled . the rear holder 450 may be coupled to the rear end portion of the rail 440 . the rear holder 450 may rotatably support the drive pulley 500 . according to an embodiment , the rear holder 450 may include a pulley support surface 451 that supports the rotary shaft 501 of the drive pulley 500 , a rail support surface 452 that supports the rear end portion of the rail 440 , and a bottom plate fastening groove 453 for being coupled to a bottom plate cover 600 . according to an embodiment , the rear holder 450 may also include a bottom plate fastening protrusion ( not shown ) instead of the bottom plate fastening groove 453 . fig9 is a view illustrating an embodiment of the rail , the belt , an idle pulley , and a front holder of the moving module , and fig1 is a cross - sectional view of the embodiment of the rail , the belt , the idle pulley , and the front holder of the moving module . the idle pulley 510 may include a rotary shaft 511 and a belt coupling unit 512 to which the belt 520 is coupled . the front holder 460 may include a front top holder 461 , a front bottom holder 465 coupled to a lower portion of the front top holder 461 , and a pulley bracket 467 disposed between the front top holder 461 and the front bottom holder 465 . the front top holder 461 may include a pulley support surface 462 that supports the rotary shaft 511 of the idle pulley 510 , and a rail support surface 463 that supports the front end portion of the rail 440 . the front bottom holder 465 may be coupled to the lower portion of the front top holder 461 by a locking structure . according to an embodiment , the front bottom holder 465 may include a bottom plate coupling protrusion 466 coupled to the bottom plate 35 of the wash tub 30 . according to another embodiment , the front bottom holder 465 may also include a bottom plate fastening groove ( not shown ) for coupling to the bottom plate 35 of the wash tub 30 . the pulley bracket 467 may be movably provided along the longitudinal direction of the rail 440 and may rotatably support the idle pulley 510 . the pulley bracket 467 may include a pulley support surface 468 that supports the rotary shaft 511 of the idle pulley 510 . the rail 440 , the belt 520 , the drive pulley 500 , the rear holder 450 , the idle pulley 510 , and the front holder 460 may be assembled to each other by a tension of the belt 520 . in other words , the drive pulley 500 is pressed in a direction approaching the rail 440 by the tension of the belt 520 , and a force is transmitted to the rear holder 450 through the pulley support surface 451 of the rear holder 450 such that the rear holder 450 is adhered and coupled to the rear end portion of the rail 440 . in addition , the idle pulley 510 is pressed in a direction approaching the rail 440 by the tension of the belt 520 , and a force is transmitted to the front holder 460 through the pulley support surface 462 of the front holder 460 such that the front holder 460 is adhered and coupled to the front end portion of the rail 440 . meanwhile , the front holder 460 may further include an elastic member 470 for maintaining the tension of the belt 520 . the elastic member 470 may also be provided at the rear holder 450 . the elastic member 470 may provide a function of preventing the tension of the belt 520 from decreasing due to thermal expansion of the belt 520 caused by hot air inside the wash tub 30 . one end portion of the elastic member 470 may be supported by the front holder 460 , and the other end portion of the elastic member 470 may be supported by the pulley bracket 467 . for this , elastic member support surfaces 464 and 469 may be respectively formed at the front holder 460 and the pulley bracket 467 . the elastic member 470 may be a compression spring . fig1 is a view illustrating the belt and a belt holder of the moving module . the moving body 490 may include a belt holder 480 that may be disposed in the inner space 441 of the rail 440 to linearly reciprocate by being coupled to the belt 520 , and a reflecting module holder 490 a disposed outside the rail 440 to linearly reciprocate by being coupled to the belt holder 480 and to which the reflecting module 400 is detachably coupled . the belt holder 480 and the reflecting module holder 490 a may be coupled and fixed by a fastening member 490 b such as a bolt . like the belt 520 , the belt holder 480 may be disposed in the inner space 441 of the rail 440 . a toothed form coupling part 481 coupled to the toothed form 521 of the belt 520 may be provided at the belt holder 480 so that the belt holder 480 moves according to movement of the belt 520 . in addition , the belt holder 480 may include legs 482 and 483 supported by the rail 440 . the legs 482 and 483 may include side legs 482 that protrude sideward to be supported by the side walls 443 of the rail 440 and at least one lower leg 483 that protrudes downward to be supported by the lower wall 444 of the rail 440 . the side legs 482 may be provided to be elastically deformable to reduce noise and vibration due to collision and friction with the rail 440 when the belt holder 480 moves and allow the belt holder 480 to smoothly move . the side legs 482 may be an elastic body of one type of a plate spring . the belt holder 480 may also include a fastening structure 484 . the fastening structure 484 of the belt holder 480 may include a fastening hole 485 into which the fastening member 490 b is inserted to be coupled to the reflecting module holder 490 a . the reflecting module holder 490 a may be coupled to the belt holder 480 to move together with the belt holder 480 and may transmit the driving force of the belt holder 480 to the reflecting module 400 . fig1 is a lateral cross - sectional view of an embodiment of the moving module . as illustrated in fig8 , the reflecting module holder 490 a may be provided to surround an outer surface of the rail 440 . according to an embodiment , the reflecting module holder 490 a may also surround the entire outer surface of the rail 440 or may surround only a part of the outer surface . the reflecting module holder 490 a may be coupled to the belt holder 480 through the lower opening 445 of the rail 440 . the reflecting module holder 490 a may have a fastening hole 490 c . the fastening hole 490 c of the reflecting module holder 490 a may be fastened to the fastening hole 485 of the belt holder 480 by the fastening member 490 b . accordingly , the reflecting module holder 490 a and the belt holder 480 may be coupled to each other . the reflecting module holder 490 a may include a second coupling member such as a coupling protrusion unit 491 coupled to a first coupling member of the reflecting module 400 . according to an embodiment , the second coupling member may be formed at an outer surface of the reflecting module holder 490 a . the first coupling member and the second coupling member may be detached from each other . hereinafter , the reflecting module 400 and several embodiments in which the reflecting module 400 and the moving body 490 are detachably coupled to each other will be described with reference to fig1 to 19 . fig1 is a view illustrating a first embodiment of the reflecting module and the moving body , and fig1 is a view illustrating a lower surface of the reflecting module . according to fig1 and 14 , the reflecting module 400 may include a reflecting unit 401 , an upper support unit 405 a , a rotation locking part 409 , a rear support unit 405 b , a reinforcing rib 406 , a horizontal support unit 407 a , a vertical support unit 407 b , and a roller 403 . the reflecting unit 401 may reflect the wash water sprayed by the fixed spray nozzle assemblies 330 and 340 . the reflecting unit 401 may include reflecting surfaces 402 a and 402 b obliquely provided to reflect the wash water . the reflecting surfaces 402 a and 402 b may have different slopes to reflect the wash water at different angles . the reflecting surfaces 402 a and 402 b having the different slopes may be alternately arranged in the longitudinal direction as illustrated in fig1 . the upper support unit 405 a may be provided by being bent from an upper end of the reflecting unit 401 . the rotation locking part 409 may be pressed by a rotation guide ( 610 in fig2 and 21 ) of the bottom plate cover 600 to allow the reflecting module 400 to rotate . the rear support unit 405 b may be provided to support the upper support unit 405 a and the reflecting unit 401 , and the reinforcing rib 406 may be provided to reinforce strengths of the reflecting unit 401 , the upper support unit 405 a , and the rear support unit 405 b . the horizontal support unit 407 a and the vertical support unit 407 b may be supported by an upper surface and a side surface of the moving body 490 to allow the reflecting module 400 to stably move along with the movement of the moving body 490 . the roller 403 may be provided at both longitudinal ends of the reflecting module 400 or at any position on a lower end of the reflecting module 400 and may provide a function of allowing smooth movement of the reflecting module 400 . when the roller 403 is provided at the reflecting module 400 , a roller support unit for supporting the roller 403 may be provided at the bottom plate 35 of the wash tub 30 . the upper support unit 405 a , the rotation locking part 409 , the rear support unit 405 b , the reinforcing rib 406 , the horizontal support unit 407 a , the vertical support unit 407 b , and the roller 403 may be omitted as necessary . according to the embodiment , the reflecting unit 401 may include a rail coupling unit 410 as illustrated in fig1 and 14 . the rail coupling unit 410 may be formed near the center in a longitudinal direction of the reflecting unit 401 . however , the rail coupling unit 410 is not limited to being formed near the center in the longitudinal direction of the reflecting unit 401 , it may also be provided on at least one of the both ends of the reflecting unit 401 , and it may also be provided on at least one of the center and the both ends of the reflecting unit 401 . in addition , only one rail coupling unit 410 or two or more rail coupling units 410 may be provided at the reflecting module 400 . the rail coupling unit 410 may include a first coupling member for coupling to a second coupling member provided at the moving body 490 . the first coupling member may be a coupling groove 411 . the rail coupling unit 410 may further include a rotation stopper unit 408 . the rotation stopper unit 408 may provide a function of limiting a range of rotation of the reflecting module 400 when the reflecting module 400 rotates by the rotation guide 610 of the bottom plate cover 600 . fig1 is a lateral cross - sectional view illustrating the first embodiment of the reflecting module and the moving body . as illustrated in fig1 and 15 , according to the first embodiment , the first coupling member may be the first coupling groove 411 . as illustrated in fig1 , the first coupling groove 411 may be provided as a pair of grooves at the rail coupling unit 410 of the reflecting module 400 . according to the embodiment , the first coupling groove 411 of the rail coupling unit 410 may be formed between first elastic hooks 411 a and 411 b which are elastically deformable . the first coupling groove 411 may have a circular shape . according to the first embodiment , the second coupling member of the reflecting module holder 490 a of the moving body 490 may be a first coupling protrusion unit 491 that protrudes sideward . the first coupling protrusion unit 491 may be in a cylindrical shape as illustrated in fig1 . the first coupling protrusion unit 491 may be provided at the moving body 490 corresponding to the first coupling groove 411 of the rail coupling unit 410 . the first coupling protrusion unit 491 may be provided as a pair of units as illustrated in fig1 . according to an embodiment , the first coupling protrusion unit 491 may also include a first coupling shaft part 491 a and a first deviation prevention part 491 b formed at an end portion of the first coupling shaft part 491 a to prevent the deviation of the reflecting module 400 . the first elastic hooks 411 a and 411 b may be slightly opened during a process in which the coupling shaft part 491 a of the moving body 490 is inserted into or deviated from the first coupling groove 411 of the reflecting module 400 to allow the first coupling shaft part 491 a of the moving body 490 to move up to a position of the first coupling groove 411 . when the first coupling shaft part 491 a of the moving body 490 has moved up to the position of the first coupling groove 411 , the first elastic hooks 411 a and 411 b may be restored to their original states . consequently , the reflecting module 400 may be mounted on or detached from the moving body 490 . when the first coupling protrusion unit 491 is in a cylindrical shape and the first coupling groove 411 is in a circular shape , the first coupling member may rotate about the first coupling shaft part 491 a . fig1 is a view for describing a second embodiment of the reflecting module and the moving body . as illustrated in fig1 , according to the second embodiment , the first coupling member may be a second coupling protrusion unit 412 . the second coupling protrusion unit 412 may be provided as a pair of units at the rail coupling unit 410 of the reflecting module 400 . according to an embodiment , the second coupling protrusion unit 412 may also include a second coupling shaft part 412 a and a deviation prevention unit 412 b formed at an end portion of the second coupling shaft part 412 a to prevent the deviation of the reflecting module 400 . according to the second embodiment , the second coupling member of the reflecting module holder 490 a of the moving body 490 may be a second coupling groove 492 . the second coupling groove 492 may also be provided as a pair of grooves at the moving body 490 corresponding to the second coupling protrusion unit 412 of the rail coupling unit 410 . according to an embodiment , like the first coupling groove 411 of the rail coupling unit 410 of fig1 , the second coupling groove 492 may be formed between second elastic hooks 492 a and 492 b which are elastically deformable . similar to what is described above , the second elastic hooks 492 a and 492 b of the second coupling groove 492 of the moving body 490 may be elastically deformed during a process in which the second coupling shaft part 412 a of the rail coupling unit 410 is inserted into or deviated from the second coupling groove 492 of the moving body 490 and may be restored to their original states when the insertion or the deviation is completed . as a result , the reflecting module 400 may be mounted on or detached from the moving body 490 . similar to the case of the first embodiment , the first coupling member may rotate about the second coupling shaft part 412 a . fig1 is a view for describing a third embodiment of the reflecting module and the moving body . as illustrated in fig1 , according to the third embodiment , the first coupling member of the reflecting module 400 may be a first coupling plate unit 413 that includes a flat plate 413 b and a third coupling groove 413 a provided on the flat plate 413 b . the first coupling plate unit 413 may be provided at the rail coupling unit 410 . one first coupling plate unit 413 may be provided at the rail coupling unit 410 , and a plurality of first coupling plate units 413 may also be provided as illustrated in fig1 . the second coupling member of the moving body 490 may be provided at an outer surface of the moving body 490 and may be a fourth coupling groove 493 corresponding to the third coupling groove 413 a . the number of fourth coupling grooves 493 may be singular or plural . the third coupling groove 413 a and the fourth coupling groove 493 may be coupled to each other by a fastening member that may be inserted into and pass through the third coupling groove 413 a and the fourth coupling groove 493 . the fastening member may be , for example , a bolt 493 a or a pin . the fastening member such as the bolt 493 a may be inserted into any one third coupling groove 413 a of the rail coupling unit 410 and then inserted into the fourth coupling groove 493 formed at a side of the moving body 490 to couple the any one third coupling groove 413 a and the fourth coupling groove 493 formed at the side of the moving body 490 to each other . the fastening member inserted into the third coupling groove 413 a and the fourth coupling groove 493 may pass through the moving body 490 , pass through the fourth coupling groove 493 formed at another side of the moving body 490 , and pass through another third coupling groove 413 a of the rail coupling unit 410 to couple the fourth coupling groove 493 formed at the other side of the moving body 490 and the other third coupling groove 413 a to each other . when the fastening member is the bolt 493 a , screw valleys and screw peaks may be formed at one end of the bolt 493 a . in this case , a nut 493 c may be coupled to the end of the bolt 493 a to prevent the bolt 493 a from freely deviating from the third coupling groove 413 a and the fourth coupling groove 493 to stably couple the rail coupling unit 410 and the moving body 490 to each other . the reflecting module 400 may be mounted on or detached from the moving body 490 using the fastening member . the first coupling member may be rotated about the fastening member . fig1 is a view for describing a fourth embodiment of the reflecting module and the moving body . as illustrated in fig1 , according to the fourth embodiment , the first coupling member of the reflecting module 400 may be a plurality of fifth coupling grooves 414 a provided at a second coupling plate unit 414 of the rail coupling unit 410 , and the second coupling member of the moving body 490 may be a plurality of sixth coupling grooves 494 provided at an outer surface of the moving body 490 and respectively corresponding to the plurality of fifth coupling grooves 414 a . the fifth coupling grooves 414 a may be formed at the flat plate 413 b of the second coupling plate unit 414 . the fifth coupling grooves 414 a and the sixth coupling grooves 494 may be coupled by a fastening member inserted into both of the fifth coupling grooves 414 a and the sixth coupling grooves 494 . the fastening member is , for example , a bolt 494 a or a pin . referring to what is illustrated in fig1 , the fastening member such as the bolt 494 a may be inserted into each of the fifth coupling grooves 414 a and then inserted into each of the sixth coupling grooves 494 corresponding to each of the fifth coupling grooves 414 a to couple each of the fifth coupling grooves 414 a and each of the sixth coupling grooves 494 to each other . screw peaks may be formed at an outer surface of the fastening member and screw valleys corresponding to the screw peaks of the fastening member may be formed at inner surfaces of the fifth coupling grooves 414 a and the sixth coupling grooves 494 as needed to stably fix each of the fifth coupling grooves 414 a and each of the sixth coupling grooves 494 . the reflecting module 400 may be mounted on or detached from the moving body 490 using the fastening member . as described above , the first coupling member may rotate about the fastening member . fig1 is a view for describing a fifth embodiment of the reflecting module and the moving body . as illustrated in fig1 , according to the fifth embodiment , the first coupling member may be a third coupling protrusion unit 415 . the third coupling protrusion unit 415 may include a protrusion 415 b protruding toward an inside or outside of the rail coupling unit 410 from an elastic flat plate 415 a and an elastic flat plate 415 a . the elastic flat plate 415 a may be bent toward the inside or the outside of the rail coupling unit 410 . the bent elastic flat plate 415 a may be restored to the original state by an elastic force . the third coupling protrusion unit 415 may be provided as a pair of units at the rail coupling unit 410 . according to the fifth embodiment , the second coupling member of the reflecting module holder 490 a of the moving body 490 may be a seventh coupling groove 495 . the seventh coupling groove 495 may be provided corresponding to the protrusion 415 b of the third coupling protrusion unit 415 . in other words , the seventh coupling groove 495 may be provided at a predetermined position of the reflecting module holder 490 a so that the protrusion 415 b may be inserted thereinto and may have a predetermined shape . the seventh coupling groove 495 may be provided as a pair of grooves corresponding to the third coupling protrusion unit 415 . a user may bend the elastic flat plate 415 a of the third coupling protrusion unit 415 toward the outside or the inside of the rail coupling unit 410 and then insert the protrusion 415 b into the seventh coupling groove 495 to couple the rail coupling unit 410 and the reflecting module holder 490 a to each other . in this case , the protrusion 415 b and the seventh coupling groove 495 may remain stably coupled to each other by the elastic force of the elastic flat plate 415 a . as a result , the reflecting module 400 may be mounted on or detached from the moving body 490 . the first coupling member may rotate about the protrusion 415 b . hereinafter , an operation of the reflecting module will be described with reference to fig2 to 24 . fig2 to 22 are views for describing an operation of the reflecting module , and fig2 and 24 are views for describing a process of reflecting wash water by the reflecting module . as described above , when the fixed spray nozzle assemblies 330 and 340 of the dishwasher 1 spray wash water , the sprayed wash water may be reflected toward dishes by the reflecting module 400 . consequently , the reflecting module 400 may be disposed at a position at which the wash water sprayed from the fixed spray nozzle assemblies 330 and 340 may be reflected . when the fixed spray nozzle assemblies 330 and 340 substantially horizontally spray wash water , the reflecting module 400 may be disposed substantially horizontal to fixed spray nozzle assemblies 330 and 340 . according to fig2 to 22 , the bottom plate cover 600 may include the rotation guide 610 that protrudes to guide movement of the reflecting module 400 . meanwhile , as described above , the reflecting module 400 may include the rotation locking part 409 to interfere with the rotation guide 610 . the rotation locking part 409 forms a rotation shaft of the reflecting module 400 while being formed above the coupling protrusion unit 491 of the reflecting module holder 490 a that transmits the driving force to the reflecting module 400 . the rotation guide 610 may include a guide surface 611 formed as a curved surface to come into contact with the rotation locking part 409 and allow the reflecting module 400 to smoothly rotate . as illustrated in fig2 , when the reflecting module 400 reaches the rotation locking part 409 while moving toward the fixed spray nozzle assemblies 300 and 340 along the rail 440 , the rotation locking part 409 of the reflecting module 400 may interfere with the guide surface 611 of the rotation guide 610 . when the first coupling member is the first coupling groove 411 and the second coupling member is the first coupling protrusion unit 491 as illustrated in fig1 to 15 , the reflecting module 400 may rotate about the first coupling protrusion unit 491 as illustrated in fig2 . consequently , as illustrated in fig2 and 24 , a direction in which the wash water reflected by the reflecting module 400 moves when the reflecting module 400 is disposed at a section away from the fixed spray nozzle assemblies 330 and 340 and a direction in which the wash water reflected by the reflecting module 400 moves when the reflecting module 400 is disposed at a section near the fixed spray nozzle assemblies 330 and 340 may be different from each other . hereinafter , a flow channel structure will be described with reference to fig2 . fig2 is a view illustrating a flow channel structure of the dishwasher . referring to what is illustrated in fig3 and 25 , the wash tub 30 may include the sump 100 that retains wash water , the circulation pump 51 that pumps the wash water in the sump 100 to supply the wash water to the nozzle assembly 300 , and a drainage pump 52 that discharges the wash water in the sump 100 to the outside of the main body 10 together with scraps . a circulation pipe 51 a that is a passage of wash water moving to the circulation pump 51 and a drainage hole 52 a for discharging the wash water and scraps to the outside may be provided in the sump 100 . the circulation pump 51 may be connected to a distribution device 200 that distributes wash water to each of the nozzle assemblies 311 , 313 , 330 , and 340 of the nozzle assembly 300 . the distribution device 200 may be connected to the nozzle assembly 300 via a hose to distribute the wash water to each of the nozzle assemblies 311 , 313 , 330 , and 340 . meanwhile , each of the nozzle assemblies 311 , 313 , 330 , and 340 may spray the wash water onto dishes or the reflecting module 400 . the wash water used in washing dishes may move to a lower end of the wash tub 30 and be stored in the sump 100 . hereinafter , a washing process of the dishwasher 1 will be described . the dishwasher 1 may wash dishes according to a water supply process , a washing process , a draining process , and a drying process . the water supply process refers to a process in which wash water is supplied into the wash tub 30 through a water supply pipe ( not shown ). the wash water supplied into the wash tub 30 may flow into the sump 100 provided at the lower portion of the wash tub 30 by a gradient of the bottom plate 35 of the wash tub 30 and be stored in the sump 100 . the washing process refers to a process of performing dish washing . in the washing process , the circulation pump 51 may be operated to pump the wash water in the sump 100 , and the pumped wash water may be distributed to each of the nozzle assemblies 311 , 313 , and 320 of the nozzle assembly 300 . the wash water pumped by the circulation pump 51 in the washing process may be distributed to at least one of the rotary nozzles 311 and 313 , the left fixed nozzle 330 , and the right fixed nozzle 340 by the distribution device 200 . according to an embodiment , the left fixed nozzle 330 may receive the wash water from the distribution device 200 through a first hose 271 a , and the upper rotary nozzle assembly 311 and the middle rotary nozzle assembly 313 may receive the wash water from the distribution device 200 through a second hose 271 b . the wash water may be sprayed with high pressure by each of the nozzle assemblies 311 , 313 , 330 , and 340 by a pumping force of the circulation pump 51 . the sprayed wash water may directly reach dishes or may reach the dishes after being reflected by the reflecting module 400 to wash the dishes . the wash water sprayed by the nozzle assemblies 311 , 313 , 330 , and 340 may strike the dishes to remove scraps on the dishes and may fall together with the scraps to be stored in the sump 100 again . the circulation pump 51 may pump the wash water stored in the sump 100 again to circulate the wash water within the flow channel structure of the dishwasher to repeat the process described above . during the washing process , the circulation pump 51 may repeat being operated and stopped at least once . the operation and stoppage of the circulation pump 51 may be performed based on a predefined pattern . the predefined pattern may be defined by a user or may be defined by a designer of the apparatus . the scraps that have fallen into the sump 100 together with the wash water in the washing process may be collected by a filter mounted on the sump 100 . consequently , the scraps remain in the sump 100 without being circulated . the draining process refers to a process of draining the scraps remaining in the sump 100 to the outside of the main body 10 . the draining process may be performed according to an operation of the drainage pump 52 . during the draining process , the wash water may be drained to the outside together with the scraps . the drying process refers to a process of drying washed dishes . the drying process may be performed by operating a heater ( not shown ) mounted on the wash tub 30 . fig2 is a structural view of a dishwasher for describing a process of controlling the dishwasher . according to fig2 , the dishwasher 1 may include the user interface 20 , a control unit 700 , a spray driving unit 710 , a moving body driving unit 720 , the spray nozzles 311 , 313 , and 320 , the moving body 490 , and the reflecting module 400 . the user interface 20 may be provided at the outer surface of the main body 10 as described above . the user interface 20 may include the input unit 20 a or the display unit 20 b as described above . fig2 is a view illustrating an embodiment of a user interface of the dishwasher . as illustrated in fig2 , according to an embodiment , the user interface 20 may include a plurality of buttons 21 to 25 and 27 to receive an instruction from the user . the plurality of buttons 21 to 25 and 27 may include a power button 21 to operate the dishwasher 1 , a washing method selection button 22 to select a dish washing method , a cleaning mode selection button 23 to operate the dishwasher 1 in the cleaning mode , a washing position selection button 24 to select a position for washing , an option button 25 to select various types of settings , and a washing start button 27 to instruct the dishwasher 1 to start the washing operation . in addition , the user interface 20 may include a display unit 26 to display washing time , remaining washing time , a current operation mode , or various types of errors . the control unit 700 may control an operation of the dishwasher 1 according to a user &# 39 ; s instruction input through the input unit 20 a of the user interface 20 or predefined settings . according to an embodiment , the control unit 700 may determine at least one control mode among a plurality of control modes for controlling the dishwasher and may also control the operation of the dishwasher 1 according to the determined control mode . in this case , the plurality of control modes may include a dish washing mode , an operation standby mode , and a cleaning mode . the dish washing mode is a mode for performing an operation of washing dishes . in the case of the dish washing mode , the control unit 700 may transmit a control command to the spray driving unit 710 or the moving body driving unit 720 to allow dishes to be washed . the operation standby mode is a mode for waiting to prepare dish washing or receive a new instruction and the like . in the case of the operation standby mode , the control unit 700 may cut off power applied to various types of parts or devices that are not operating to minimize standby power . the cleaning mode is a mode for performing various types of operations for washing the inside of the wash tub 30 or cleaning the reflecting module 400 . in addition , the control unit 700 may generate various control commands other than the above to control an overall operation of the dishwasher 1 . for example , the control unit 700 may control the door 11 not to open during the dish washing mode and may control the door 11 to open during the cleaning mode . the control unit 700 may be implemented with a semiconductor chip and a printed circuit board on which the semiconductor chip may be installed . the semiconductor chip may perform at least one of controlling , computing , and storing functions . the semiconductor chip and the printed circuit board may be installed at any place of the dishwasher 1 according to the designer &# 39 ; s choice . for example , the semiconductor chip and the printed circuit board may be installed inside a housing that forms the door 11 of the dishwasher 1 or may be installed at an upper portion or lower portion of the main body 10 of the dishwasher 1 . the spray driving unit 710 may generate a driving force to allow the wash water to be sprayed by the nozzles 311 , 313 , 330 , and 340 according to a control command of the control unit 700 . according to an embodiment , the spray driving unit 710 may include the circulation pump 51 and the drainage pump 52 . the moving body driving unit 720 may generate a driving force that moves the moving body 490 to which the reflecting module 400 is coupled in a predetermined direction to allow the reflecting module 400 to move inside the wash tub 30 . the moving body driving unit 720 may include the motor 530 connected to the drive pulley 500 . according to an embodiment , the moving body driving unit 720 may also include a pneumatic actuator or a hydraulic actuator . fig2 is a flowchart of an embodiment of a method for controlling a dishwasher . according to an embodiment of a method for controlling the dishwasher 1 , first , the dishwasher 1 may operate in an operation standby mode ( s 10 ). of course , according to an embodiment , the dishwasher 1 may not always have to operate in the operation standby mode . fig2 and 30 are views for describing an operation of the dishwasher in an operation standby mode . as illustrated in fig2 and 29 , when a user manipulates the power button 21 of the dishwasher 1 , power is applied to the dishwasher 1 , and the control unit 700 may generate a control command related to an operation standby mode . then , the dishwasher 1 may operate in the operation standby mode for preparing dish washing . in the operation standby mode , the dishwasher 1 may wait until the user &# 39 ; s instruction is input through the input unit 20 a and the like . according to fig3 , a position of the reflecting module 400 inside the wash tub 30 may be initialized in the operation standby mode . in other words , the reflecting module 400 may move to an initial position provided near the fixed spray nozzle assembly 320 from a random position 400 a ( a ). fig3 to 33 are views for describing an operation of the reflecting module in a dish washing mode . when the user manipulates at least one of the washing method selection button 22 and the washing start button 27 as illustrated in fig3 and the dish washing mode is selected ( s 20 ), the control unit 700 may generate a control command according to the dish washing mode and may transmit the control command to the spray driving unit 710 and the moving body driving unit 720 to perform dish washing ( s 21 ). in the dish washing mode , the reflecting module 400 may reflect the wash water sprayed by the fixed nozzles while moving in an opposite direction ( b ) of the fixed nozzle assembly 320 or in a direction ( c ) toward the fixed nozzle assembly 320 together with the moving body 490 that moves by the motor 530 and the belt 520 ( s 22 ). when the dish washing is finished , an operation of the spray driving unit 710 , e . g . the circulation pump 51 , ends and each of the nozzles 311 , 313 , 330 , and 340 of the nozzle assembly 300 no longer sprays the wash water ( s 23 ). furthermore , an operation of the moving body driving unit 720 , e . g . the motor 530 , also ends and the moving body 490 and the reflecting module 400 coupled to the moving body 490 may also not operate . according to an embodiment , the reflecting module 400 may move to the initial position ( a ) as illustrated in fig3 after the dish washing is finished ( 40 ). fig3 to 39 are views for describing a process of cleaning the reflecting module in a cleaning mode . when the user manipulates the cleaning mode selection button 23 as illustrated in fig3 and the cleaning mode is selected ( s 30 ), the control unit 700 may generate a control command according to the cleaning mode and transmit the control command to the moving body driving unit 720 . according to an embodiment , the control unit 700 may also generate a control command related to whether the door 11 is openable and closable . according to fig3 , in the cleaning mode , the reflecting module 400 may move in a direction in which the opening 11 a is formed inside the wash tub 30 ( s 31 ). when the fixed nozzle assembly 320 is formed at the rear wall 32 that faces the opening 11 a inside the wash tub 30 , the reflecting module 400 may move in the opposite direction of a direction in which the fixed nozzle assembly 320 is installed ( d ). according to fig3 , the reflecting module 400 that has been moving toward the opening 11 a may stop near the opening ( e ). in this way , movement and stoppage of the reflecting module 400 may be performed by operating the moving body driving unit 720 based on the control command of the control unit 700 . according to an embodiment , when the reflecting module 400 is stopped as illustrated in fig3 , the door 11 may be openable ( s 32 ). in other words , safety may be improved since the user can open the door 11 of the dishwasher 1 after the movement of the reflecting module 400 is finished to detach the reflecting module 400 from the moving body 490 . whether the door 11 is openable and closable may be determined according to a control signal transmitted from the control unit 700 . of course , step ( s 32 ) may also be omitted . after the door 11 is open , the user may separate the first coupling member of the reflecting module 400 and the second coupling member of the moving body 490 from each other to detach the reflecting module 400 from the moving body 490 . for example , as illustrated in fig3 , the user may separate the reflecting module 400 and the moving body 490 from each other by deviating the first coupling groove 411 of the reflecting module 400 from the first coupling protrusion unit 491 of the moving body 490 ( s 33 ). when the reflecting module 400 is separated , the user may wash and clean the reflecting module 400 using water and the like as illustrated in fig3 ( s 34 ). when the cleaning of the reflecting module 400 is finished , the user may again couple the reflecting module 400 to the moving body 490 using the first coupling member of the reflecting module 400 and the second coupling member of the moving body 490 ( s 35 ). according to an embodiment , when the reflecting module 400 is coupled again to the moving body 490 , a separate sensor ( not shown ) may detect whether the reflecting module 400 and the moving body 490 are coupled to each other . when the coupling between the reflecting module 400 and the moving body 490 is detected , the control unit 700 may generate a control command for moving the reflecting module 400 to the initial position as illustrated in fig3 as needed , and the reflecting module 400 may move to the initial position ( a ) ( s 24 ). the dishwasher and the method for controlling the same are industrially applicable due to being able to be used in households or industrial sites for washing dishes and the like .

US-201415108900-A

the invention is a method for estimating a skeletal maturity value of a human from a radiograph of one or more bones in the hand . the borders of the bones are represented by shape points , which are subjected to principal component analysis . image intensities are sampled at points located relative to the shape point , and also compressed with pca . from the features a skeletal maturity value is determined .

in the following are given some details to describe exactly how to implement the steps mentioned so far . the input to the method ( fig5 , s 1 ) is a digital image , for instance in the form of a tiff file with a number indicating the intensity at every pixel . the image can be obtained from a radiographic film , which has been digitised using an optical scanner , or it can be obtained from a cr image recording it on a phosphor plate which is read off and digitised by the cr equipment , or by using a direct digital radiography detector outputting the intensities directly from the electronics . the image can also be from dexa scanner of good spatial resolution and can then either be a mono - energetic image or a subtracted image . associated with the image is also the spatial resolution in mm per pixels . also the sex of the child has to be known to derive the bone age . the identification of the bone borders ( fig5 , s 2 ) can be performed with active appearance models ( aam ). in the first step the process searches simultaneously for 3 or 4 of the metacarpals because they form a pattern , which is simple to search for exhaustively at all locations and in all orientations , see [ 12 ] for details . the process searches both for left and right hands and the best search - result determines the interpretation . subsequently the process locates the remaining bones by predicting a start search location based on the bones found so far . such a complete framework for aam reconstruction of bones in the adult hand was reported in reference [ 5 ]. in the present method the age is unknown and every time a bone is searched the process can apply several models corresponding to different maturity stages . for instance the process can use three models covering the age ranges 2 - 6 years , 6 - 13 years and 13 - 18 years , and the model that fits best is the selected reconstruction . in some of the younger models , the epiphysis is separated form the metaphysis . once the process has reconstructed the border , it extracts the shape points to represent the bone border ( fig5 , s 3 ). if the reconstruction model is aam or asm , this already provides shape points from the underlying pca shape model . otherwise the process can fit the border to a pca - based shape model , i . e . parameterise the border as the mean shape transformed to a given pose ( using a translation vector , a rotation angle and scaling factor , see [ 13 ]), and determine a deformation in terms of the shape parameters . asm can be used to implement this as demonstrated in [ 10 ]. the extraction of a vector of sampled image intensities ( fig5 , s 4 ) is illustrated in fig3 and 4 , which show the mean shape points in large squares ( 1 ), defined at the border of the bone . auxiliary points can be defined away from the bone border , shown with smaller squares in fig3 and 4 . in the interior ( 2 ), these points can be defined as interpolations between border points . at the exterior ( 3 ), each point can be defined relative to one of the border points at a certain angle and distance from this . the angle is defined relative to the axis of the bone and the distance is computed relative to the size of the bone . the border and auxiliary points define the corners of the triangles ; the auxiliary points ensure that the triangles span also a margin of the bone and avoids occurrence of triangles with very small angles . inside the triangulated area of the mean shape the process places sampling points for instance in a regular grid , as shown with the smallest points ( 4 ) in fig3 and 4 . as exemplified in the embodiment in fig4 , which is a detailed view of part of fig3 , only part of the triangulated area can be used for sampling since the most important changes of the density are known to be in this part of the bone where growth occurs . the process can in one embodiment also form texture features by defining a texture vector in each location of the image ( fig5 , s 5 ). each element of the texture vector can reflect a certain wavelength and direction . the standard choice is the gabor filters [ 9 ], but most other texture measures would give the same effect . a wavelength of 1 or 2 mm is appropriate to catch the signal of the border between the epiphysis and the metaphysis and its fusion . four to six directions are appropriate . in the simplest scheme , four directions and a single wavelength is used . this means that the image is filtered with four gabor filters , each comprising a real and an imaginary part . the real and imaginary outputs are squared and added to form four energies per location . the square root can be taken to compress the dynamic range . the textures can be normalised with some number indicative of the image contrast derived from the same image , e . g . the standard deviation of the intensities in the bone region , leading to the final four bands of the texture image . in an embodiment , the process samples four texture band images at the sampling points e . g . as those in fig3 or 4 , and the vector of samplings is subjected to a pca defined previously on a training set . j . m . tanner , r . h . whitehouse , n . cameron , w . a . marshall , m . j . r . healy , and h . goldstein : assessment of skeletal maturity and prediction of adult height ( tw2 method ). academic press , london , 2nd edition , 1975 . m . niemeijer : automating skeletal age assessment , master &# 39 ; s thesis , utrecht university ( 2002 ). m . kotcheff and c . j . taylor : automatic construction of eigenshape models by direct optimisation , med . image anal ., vol . 2 ( 1998 ) 303 - 314 . t . f . cootes and c . j . taylor : statistical models of appearance for computer vision . technical report , wolfson image analysis unit , imaging science and biomedical engineering , university of manchester , 2001 . h . h . thodberg : hands - on experience with active appearance models , medical imaging 2002 : image proc ., eds . sonka & amp ; fitzpatrick , proc . spie vol . 4684 , 495 - 506 ( 2002 ). dxr - bmd u . s . pat . no . 6 , 763 , 257 b1 , by rosholm and thodberg . ( this patent contains a lot of references and general discussion which serves as background for the present application ). r . larsen : shape modelling using maximum autocorrelation factors in proceedings of scia &# 39 ; 01 , bergen , ( 2001 ) p 98 - 103 . m . uzumcu , a . f . frangi , j . h . c . reiber , b . p . f . lelieveldt ( 2003 ): ica vs . pca active appearance models : application to cardiac mr segmentation . in medical image computing and computer - assisted intervention — miccai &# 39 ; 03 , r . e . ellis , t . m . peters ( eds ). lecture notes in computer science , vol . 2878 , springer verlag , berlin , germany , pp . 451 - 8 . a . bovik , m . clark , and w . geisler . multichannel texture analysis using localized spatial filters . ieee transactions on pattern analysis and machine intelligence , 12 ( 1 ): 55 - 73 ( 1990 ). k . b . hilger , r . r . paulsen , r . larsen , markov random field restoration of point correspondences for active shape modelling , spie — medical imaging 2004 . h . h . thodberg and a . rosholm , application of the active shape model in a commercial medical device for bone densitometry . image and vision computing 21 , pp 1155 - 1161 ( 2003 ). w . w . greulich and s . i . pyle , radiographic atlas of skeletal development of hand and wrist , 2 . ed ., stanford univ . press ( 1959 ). i . l . dryden and k . v . mardia , statistical shape analysis , wiley ( 1998 ).

US-92115306-A

a bale turning apparatus for attachment to a baler to generally align the cylindrical of the bales in each row as the bales are released from the baler . using the disclosed invention , the bales are essentially turned ninety degrees from the orientation of bales from the position that they are typically released from a round baler . by accomplishing this general alignment of the cylindrical axis of each bale in each row , when baling corn stover or other row crops , the bale loading operation can later be done more efficiently by driving down the rows in the same direction as the combine and baler have traveled .

referring now to the drawings , wherein like reference numerals indicate identical or similar parts throughout the several views , fig1 shows a baler 10 being towed by a tractor 1 , in the process of making a bale 2 , the baler 10 having a bale turning apparatus 11 attached thereto . after the bale 2 has been completed , the rear gate 12 is pivoted up about horizontal axis 12 a as shown in fig2 , allowing the bale to move rearwardly onto a cradle 13 which is part of turning device 11 of the present invention . fig3 - 5 show sequentially the next few steps of how the present invention operates in two of its most useful modes , fig3 showing the fig2 position with the bale 2 resting on cradle 13 . then , the bale turning apparatus 11 pivots the cradle 13 and bale 2 ninety degrees ( 90 °) along vertical axis 13 v to a position to one side of the baler 12 as shown looking from the tractor 1 in fig4 and looking from the rear of the baler in fig5 . fig6 is an alternate embodiment where the mostly vertical axis 13 vt is tipped to one side that shows how the cradle 13 , having been turned ninety degrees about a vertical axis ( 90 °) from the position shown in fig3 also tips the cradle 13 from the fig3 position to the fig6 position due only to the turning about the axis 13 vt . the mostly vertical axis 13 vt of fig6 is straight up and down vertical when viewed from the side as shown in fig6 and is identical to the vertical axis 13 v when viewed from the angle shown in fig3 . the round baler 10 has a baler frame 10 f with a carriage support structure 14 ( see fig1 , 22 and 23 ) attached to the baler frame 10 f about the mostly vertical support axis 13 v as shown in fig7 - 9 . ground engaging wheels 15 are rotatably attached to the baler frame 10 f about a mostly horizontal axis . the rear gate 12 , is pivotally attached to the baler frame 10 f about a horizontal gate pivot axis 12 h and has at least two positions including a closed position shown in fig1 wherein the rear gate defines a portion of a baling chamber and an open position , shown in fig2 and 6 , wherein the baling chamber is open to allow a formed bale 2 to be discharged . a carriage frame 13 f is attached to the carriage support structure 14 of the baler frame 10 f rearwardly of the horizontal axis of the ground engaging wheels 15 and to one side of the rear gate 12 . the carriage frame 13 f is pivotally attached along axis 13 v to the carriage support structure 14 , via carriage frame hinge pin 13 p extending through clevis like carriage support hinge part 14 fh ( fig2 ), the carriage 13 having a first vertically pivoted position shown in fig1 , 3 and 7 - 9 wherein a first carriage side 13 a is closest to the front of the baler 10 and positioned below the rear gate 12 and a second carriage side 13 b closest to the rear of the baler 10 . it is important to note that the mostly vertical support axis 13 v is fixed with respect to the baler frame 10 f . the carriage frame 13 f also has a second vertically pivoted position shown in fig1 - 18 wherein the carriage frame 13 f is pivoted approximately 90 degrees about the mostly vertical support axis 13 v wherein the second side 13 b of the carriage 13 is behind one of the ground engaging wheels and offset from the rear gate 12 . note that when the carriage 13 is pivoting between the fig1 , 3 and 7 - 9 position to the fig1 - 19 position , it will transition through intermediate positions between the first and second positions , one example of such intermediate position being shown in fig1 - 15 . a hydraulic cylinder 13 vhc is pivotally attached along a vertical axis at pin 13 pa to the carriage support structure 14 ( ) and pivotally attached along another vertical axis 13 pb to the carriage 13 itself ( see fig2 .) the carriage 13 , except in the fig6 embodiment , is pivotally mounted about the horizontal axis 13 h to the carriage frame 13 f as can best be seen in fig1 . this permits the carriage 13 to not only pivot about vertical axis 13 v about the carriage support frame 13 f but allows the carriage to pivot about horizontal axis 13 h as well . the carriage 13 is selectively pivoted by using a hydraulic cylinder 13 hc pivotally attached at pin 13 hch to the first end 13 a of the carriage 13 . the hydraulic system for this embodiment is illustrated in fig3 including a hydraulic circuit specifically for controlling the position of hydraulic cylinder 13 hc . this circuit will allow the carriage to be rotated about the horizontal axis 13 h independent of the position of the carriage frame about the vertical axis 13 v . the hydraulic cylinder 13 hc is also pivotally attached at the other end thereof to an arm 13 arm , the arm 13 arm being rigidly attached to the carriage 13 at one end thereof . the carriage 13 has a first position ( fig7 - 9 and 16 - 18 ) wherein the second side 13 b of the carriage is a first distance above the ground and a second position ( fig1 - 12 and 19 - 21 ) wherein the second side 13 b of the carriage 13 is a second distance that is less than the first distance for urging a bale resting on the carriage to roll off of the second side 13 b of the carriage . pivoting the carriage 13 about a horizontal axis is one way to get the bale to fall off of the carriage . referring now again to fig6 , an alternate embodiment , the bale is urged to fall off of the carriage 13 by merely tipping the mostly vertical axis 13 vt . after the bale has been turned ninety degrees from the fig3 position to the fig6 position the carriage is pivoted about a substantially vertical axis that is tipped out to one side and as the carriage moves from the level position shown in fig3 to the tipped position shown in fig6 and that is what causes the bale to drop off of the carriage to the right as shown in fig6 immediately after the carriage has been so pivoted . a third way to urge the bale off of the carriage 13 is to use a cam device shown in fig2 , which is a front left perspective view of the embodiment of fig2 - 26 showing a cam and cam follower . these components automatically pivot the carriage about the horizontal axis as it moves between the position shown in fig2 and the position shown in fig3 . fig2 shows the tilted position , accomplishing the tipping of the carriage using a cam 22 and cam follower 21 . assisting the process is the fact that when the outer end of the cam follower 21 hits the outer end of the cam 22 it acts as a stop so that sudden stopping of the carriage 13 results in the momentum and inertia of the bale to cause the bale to drop off of the carriage . this stop can be provided without a cam / cam follower or tipping function and it will still operate to cause the inertia alone to cause the bale to fall off of the carriage 13 . fig2 is a rear left perspective view of the embodiment of fig2 - 26 showing a cam 22 and cam follower 21 . fig2 is a perspective view of the embodiment of fig2 - 26 showing a cam and cam follower . fig2 - 31 are schematic representations of the carriage , cam and cam follower . fig2 is a side view that corresponds to fig3 , of the cam 22 and cam follower 21 in solid and dashed / hidden lines shown where the carriage is in a level position to receive a bale from the baling chamber when the rear gate is opened like what is shown in fig2 . in fig2 the cam follower 21 is in the section 22 a of the cam follower 22 . fig3 is a side view of the cam and cam follower in solid and dashed / hidden lines shown in the position approximately half way between the positions of the fig2 and 27 . the movement of the carriage frame and cam follower relative to the cam is illustrated in this series of schematic drawings as a translation . in the actual embodiment this movement is actually caused by the rotation of the carriage frame about the vertical axis 13 v ( see fig2 and 26 ). the cam is an arcuate plate , wherein it is illustrated in these schematic drawings as a flat plate . section 22 b of the cam can be positioned to cause the carriage to rotate about the horizontal axis 13 h in a direction to improve the capability of the carriage to hold the bale securely as it moves out of the bale forming chamber of the baler . as the carriage frame rotates about the vertical axis 13 v , the cam follower 21 moves through the part 22 c to the part 22 d shown in fig3 corresponding to the position that the carriage is finally in the position shown in fig2 and 28 , and wherein the carriage 13 is fully pivoted ninety degrees from the fig2 position . as a result of and at the same time , the cam 22 and cam follower 21 has caused the carriage to pivot about horizontal axis 13 h to a tipped position to urge the bale to roll off other carriage 13 in a direction away from the baler . fig3 illustrates the hydraulic system associated with this embodiment , wherein there is not a separate hydraulic circuit for controlling the position of the carriage relative to the carriage frame . this fig3 also illustrates an additional aspect of this invention , an l - shaped arm useful for controlling the movement of the bale across the ground after it drops off of the carriage . fig3 is a rear view of the baler 10 similar to fig6 , but showing the bale 2 having moved to the ground and prevented from rolling to the right as shown in this view by an l - shaped arm 30 pivotally attached about a substantially vertical axis 30 v . the arm 30 , with horizontal leg 30 a and vertical leg 30 b can be folded against the side of the baler when the carriage 13 is not in the position shown in fig3 . fig3 is a rear view of the baler similar to the device of fig3 , but showing the bale having moved to the ground and prevented from rolling to the right as shown in this view by an l - shaped arm with adjustable parts 42 / 42 t / 42 s which are also shown in fig3 - 36 , which l - shaped arm is pivotally attached about a substantially horizontal axis 40 h . fig3 is perspective view of the device of fig3 using the cam operated embodiment of fig2 - 31 to pivot the carriage and bale ninety degrees and pivot the carriage 13 to cause the bale 2 to fall off of the carriage 13 , while also moving a bale 2 catching arm 42 / 42 t / 42 s to the right side of the bale as shown in fig3 to prevent the bale from moving too far to the right before coming to rest , thereby making it easier for bale loading equipment to travel the same basic path as the baler during a bale loading operation . fig3 is a rear view of the fig3 and 34 bale alignment arm just before it is deployed to the fig3 and 34 position thereof , when the carriage is in the position of fig4 and 5 . fig3 is a perspective view of the carriage and bale catching arm in the position shown in fig3 . fig3 and 38 illustrate hydraulic systems utilized to coordinate the movements of the associated components . fig3 illustrates , as noted previously , the embodiment wherein the carriage is rotated in the carriage frame about axis 13 h by a hydraulic cylinder . this allows the carriage 13 to be rotated to drop the bale 2 at any desired position of the carriage frame 13 f . with this arrangement the bale 2 can be dropped straight behind the baler 10 , with its axis perpendicular to the travel direction , or rotated 90 degrees so that the axis of the bale 2 is parallel to the travel direction , or any angle there between , as controlled by the cylinder 13 vhc that causes the carriage frame to rotate about vertical axis 13 v . the cylinder 13 vhc that causes the carriage frame to rotate about vertical axis 13 v is activated by a hydraulic line that is connected in this embodiment to two sequence valves 112 / 113 . the first sequence valve 112 is activated by the position of the tailgate 12 . when the tailgate 12 is in its open position , this valve 112 opens to allow oil to flow to the second sequence valve 113 that is activated by the position of a bale sensor 114 . the bale sensor 114 is activated by a bale 2 as it falls into the carriage 13 , once in the carriage 13 the bale 2 causes a linkage 115 to activate the second sequence valve 113 that will allow oil to flow the cylinder 13 vhc that rotates the carriage 13 about the vertical axis 13 v . this circuit is connected in series to the cylinder 116 that raises the tailgate 12 , which cylinder 116 is connected to a remote valve 117 of the tractor . the operator then controls the bale discharge by moving a remote valve 117 to the position to raise the tailgate 12 , and then continues to hold the remote valve 117 in that position to subsequently rotate the carriage 13 to move and discharge the bale 2 . the rotation of the carriage 13 will determine the orientation of the axis of the bale 2 relative to the baler 10 . this control can be accomplished manually , allowing the operator to control the remote valve 118 of the tractor 1 . it could also be accomplished automatically , if a control device on the tractor 1 or the baler 10 was allowed to automatically control the cylinder 13 hc that rotates the carriage frame 13 f ( fig1 and 18 ). fig3 illustrates an alternate embodiment that works in conjunction with the embodiment illustrated in fig6 , wherein the pivot axis 13 vt is oriented to reliably discharge the bale 2 when turned 90 degrees , or with the embodiment that utilizes the cam and cam follower ( see fig2 - 33 ), to rotate the carriage 13 about the axis 13 h to discharge the bale 2 . thus , there is no need for a separate hydraulic circuit to control the position of the carriage 13 relative to the carriage frame 13 . this embodiment illustrates the same sequence valves 112 / 113 , but also illustrates the additional mechanism 40 used to stop the bale 2 as it is discharged . the arm 41 / 42 / 42 s is activated by a cylinder 43 that is directly connected to the tailgate cylinder 116 . the butt - end of the cylinder 43 is connected to the butt - end of the cylinder 116 that raises the tailgate 12 . the pressure required to raise the tailgate 12 is substantially higher than the pressure required to lower the stop arm 40 , so this direct connection is adequate to cause the correct sequence of actions , for proper operation the stop arm 40 needs to be lowered before the bale 2 is discharged . thus this direct connection provides a simple and reliable operation . in the following operation , wherein the tailgate 12 is closed , the direct connection of the opposite end of the cylinder 43 to the tailgate cylinder 116 also provides the correct sequence . as the tailgate 12 is lowered , oil is directed to the rod - end of the tailgate cylinder 116 and at the same time oil is directed to the rod - end of the cylinder 43 that positions the stop - arm . this arrangement ensures that the stop arm 40 will be raised as the tailgate 12 closes . although fig3 and 38 illustrate specific combinations of components , these combinations can be varied . for instance a bale stop arm 40 could be added to the system illustrated in fig3 , if the bale stop arm mechanism 40 was mounted to the carriage frame 13 f so that the stop arm 40 was in the correct position to stop the bale 2 regardless of when the carriage 13 was rotated to discharge a bale 2 . those skilled in the art will recognize that a wide variety of modifications , alterations , and combinations can be made with respect to the above described embodiments without departing from the spirit and scope of the invention , and that such modifications , alterations , and combinations are to be viewed as being within the ambit of the inventive concept as expressed by the attached claims .

US-201213628555-A

a compressor driven by a motor sends to a nasal mask a breathable gas at a low positive relative pressure whereby the motor is controlled to maintain the pressure in the delivery pipe of the compressor substantially equal to a set point , independently of the inspiration and expiration of the patient , a computer receiving on an input a motor speed signal as a parameter representative of the respiratory activity of the patient and analyzing the motor speed variations whereby the computer will increase the pressure set point if necessary or reduces the pressure set point by a predetermined amount depending upon whether there is a hypopnoea or the absence thereof .

the apparatus represented in fig1 comprises a compressor 1 capable of producing through its delivery pipe 2 a breathable gas at a positive relative pressure , i . e . measured relative to atmospheric pressure , which depends on the rotational speed of the drive motor 3 . in a non - represented manner , the compressor 1 is of a type which produces the positive relative pressure by a turbine for propelling breathable gas . the delivery pipe 2 is connected to a nasal mask 4 by a flexible tube 6 . the nasal mask 4 is intended to be applied to the patient &# 39 ; s face , for example by means of a strap . the mask 4 includes an opening 7 allowing the patient to expire despite the flow in the opposite direction coming from the compressor 1 . a comparator 8 permanently compares the pressure p m detected in the delivery pipe 2 of the compressor 1 by a pressure detector 9 with a pressure set point p c applied to the other input 11 of the comparator 8 . as a function of the result of the comparison , the comparator 8 supplies at its output 12 a signal applied to a motor control device 13 to reduce the rotational speed of the motor 3 when the pressure measured by the detector 9 is greater than the pressure set point , and to increase the rotational speed of the motor 3 and therefore the pressure at the delivery pipe 2 when the pressure measured by the detector 9 is lower than the pressure set point . in this way , the pressure at the delivery pipe 2 and therefore in the nasal mask 4 , is approximately the same during the inspiration phases and during the expiration phases of the patient . during the inspiration phases , a relative low pressure tends to be created at the delivery pipe 2 of the compressor 1 , and maintaining the pressure at the set point value requires an increase in the rotational speed of the motor 3 . on the other hand , during the expiration phases of the patient , an excess pressure tends to be created at the delivery pipe 2 , and maintaining the pressure at the set point value requires a decrease in the rotational speed of the motor 3 . consequently , when the respiration of the patient is normal , the rotational speed of the motor 3 follows a periodical curve . according to the embodiment in fig1 a signal representative of the rotational speed of the motor 3 is applied by the control device 13 to the input 14 of a computer 16 whose function is to analyze the curve of the speed of the motor 3 as a parameter representative of the respiratory activity of the patient , and to modify the pressure set point p c applied to the input 11 of the comparator 8 as a function of the result of this analysis . in a general fashion , when the analysis of the curve of the rotational speed of the motor reveals a hypopnoea situation , the computer 16 increases the pressure set point . on the other hand , if the analysis of the curve of the speed of the motor reveals an absence of hypopnoea for a certain predetermined period of time , the computer reduces by a predetermined amount the pressure set point . the computer 16 is connected to a manual control 17 allowing the minimum pressure set point p min authorized by the doctor for each patient to be adjusted . there will now be described with reference to fig2 the flow chart according to which , essentially , the computer 16 is programmed . in what follows , by “ hypopnoea ” is meant the symptom consisting either of an abnormal lowering ( for example by 50 %) of the respiratory activity , or the symptom of total apnoea consisting of the complete disappearance of respiratory activity . at the start , the pressure set point p c is chosen to be equal to p min , i . e . the minimum pressure set point chosen using the manual control 17 ( stage 18 ). in stage 19 , the values an − 8 , an − 7 , . . . , an − 1 of the amplitude of the motor speed variation during the eight respiratory cycles before the one which is currently being analyzed , are arbitrarily set equal to a value a 0 which is relatively low . then , in stage 21 , the average of the amplitudes of the eight previous cycles ( average m ) is calculated and two thresholds s 1 and s 2 are calculated with for example : in stage 22 , the extreme values of the rotational speed of the motor are sought . in order to do this , the rotational speed of the motor at each execution cycle of the program is stored in memory . a maximum or minimum is only validated if the speed has then varied sufficiently so as to be back from this maximum or minimum by a value at least equal to threshold s 2 . in other words , as the threshold s 2 is greater than half of the average of the previous amplitudes , a given extreme value will only be processed if the speed again then reaches a value beyond that of the average of the speeds . in particular , if respiration stops ( total apnoea ), the speed of the motor assumes its average value and the previous extreme value is not validated . more generally , if an amplitude lower than threshold s 2 tends to become established , it will no longer be possible to validate the extreme values . after a period of time t 1 equal for example to 10 seconds , this is detected in the following test 23 . in the absence of an extreme value for 10 seconds , one follows the path “ detection of strong hypopnoea ” 24 of the flow chart , in which the four amplitudes an − 8 . . . an − 5 which are the oldest values still in memory are reduced to the relatively low value of a 0 . the aim of this is to reduce the thresholds s 1 and s 2 for the next calculation cycle so as to make the resumption of respiratory activity easier to detect . returning to test 23 , if an extreme value was found within the 10 previous seconds and if this extreme value is the same as that already processed during the previous calculation cycle , one returns to stage 23 in order to search for extreme values . if , on the other hand , the extreme value is new , one passes via stage 26 for calculating the new amplitude an , then , stage 27 , storing in memory the amplitude an while simultaneously deleting the oldest amplitude in memory an − 8 . in stage 28 , the newly - calculated amplitude an is compared with the largest s 1 of the two thresholds . if the newly - calculated amplitude an is greater than threshold s 1 , one follows normal respiration path 29 which will be described further on . in the opposite case , i . e . if the amplitude is between thresholds s 1 and s 2 , it is considered that a weak hypopnoea 31 exists . whether strong hypopnoea 24 or weak hypopnoea 31 has been recorded , a test 32 is carried out in order to determine whether there was already a hypopnoea during the previous 30 seconds . if the result is negative a number map is reset to zero . map corresponds to the total increase in pressure in the previous 30 seconds . if , on the other hand , there was hypopnoea during the previous 30 seconds , the map number is not reset to zero . the following stage 33 consists of adding a relatively high increment to the map number if strong hypopnoea was detected , and a relatively low increment if weak hypopnoea was detected . then , in stage 34 , a test is carried out to establish whether the map number is greater than 6 cm of water ( 6 hp a ). if the result is negative , stage 36 , an increment x , being high or low depending on the strength of the hypopnoea , is added to the pressure set point p c . if , on the other hand , map exceeds 6 , the pressure set point p c is only increased to the extent that the total increase in the previous 30 seconds is equal to 6 ( stage 37 ). the aim of this is to avoid increasing the pressure excessively to treat a single hypopnoea : if an increase of more than 6 cm of water is necessary to treat a hypopnoea , it is because there is some anomaly and it would be better to wake the patient up . then , the new pressure set point is applied to the comparator 8 in fig1 on the condition that it does not exceed the maximum pressure set point p max . if the pressure p c exceeds p max , the set point applied to the comparator 8 is equal to p max ( stage 38 ). one is then returned to stage 21 in which the thresholds are calculated . if the strong or weak hypopnoea which was detected during the previous cycle is still not alleviated , the pressure set point will be increased by a new increment and so on until the total pressure increase map within 30 seconds reaches 6 cm of water or until the hypopnoea is alleviated . in this way , the amplitude is compared to two different thresholds , one to detect strong hypopnoeas , including the total hypopnoeas , and to apply a relatively swift increase in the pressure set point , the other to detect weak hypopnoeas , resulting from a partial obstruction of the upper respiratory tract , and to apply a clearly milder increase in pressure . one of the important features of the invention consists of analyzing the parameter representative of respiratory activity ( the speed of the motor 3 ) not by comparison with absolute thresholds , but by comparison with the respiratory activity which has just preceded the respiratory anomaly . in fact , it has been noted that respiratory activity varies greatly during sleep , to the extent that an activity which would be considered normal during a certain phase of sleep can correspond to a hypopnoea in another phase of sleep . returning to path 29 of the flow chart , this leads to a test 39 for determining whether a time t has passed without detecting a hypopnoea . if the result is negative , one returns to stage 21 in which the thresholds are calculated . if , on the other hand , a time t 2 , for example equal to 30 minutes , has passed without a hypopnoea , the pressure set point is reduced by , for example , 2 cm of water . in this way one provides an opportunity to bring the pressure applied to the patient to a lower value if this is possible . however , if the new pressure set point thus became lower than the minimum pressure as set with the manual control 17 of fig1 the pressure set point is simply reset equal to the minimum pressure set . then , once again , one is returned to stage 21 in which the thresholds are calculated . in the example represented in fig3 which will only be described with regard to its differences relative to that of fig1 a flow rate detector 41 is placed on the delivery pipe 2 of the compressor 1 whose signal is sent to an input 42 of the computer . on the other hand the computer no longer receives a signal corresponding to the rotational speed of the motor . it is now the flow rate signal provided by the detector 41 which provides the computer with the parameter representative of the respiratory activity . when the patient inspires , the flow rate detector 41 reveals a higher flow rate than when the patient expires . in other words , the variations in flow rate work in the opposite sense to those of the speed of the motor 3 . apart from that , nothing is changed , and the flow chart of fig2 is valid for the embodiment of fig3 with the exception that in stage 22 in which the extreme values are sought , the word “ speed ” must be replaced by the words “ flow rate ”. in this example , which will only be described with regard to its differences relative to that of fig1 there is no pressure regulation at the delivery pipe 2 , i . e ., apart from situations of apnoea or hypopnoea , the motor 3 rotates at the same speed whether the patient inspires or expires . the pressure at the delivery pipe 2 is therefore relatively low when the patient inspires and relatively high when he expires . therefore , the pressure at the delivery pipe 2 constitutes a parameter representative of the respiratory activity and it is , as such , detected by the pressure sensor 9 . the computer 16 , which receives the pressure signal 9 on an input 43 , analyzes the pressure curve and provides the control device 13 of the motor 3 with a signal for increasing the speed of the motor 3 when the variations in pressure indicate a situation of hypopnoea , and for decreasing the speed of the motor 3 when any situation of hypopnoea has not been alleviated within a predetermined period of time , for example 30 minutes . fig5 represents a schematic flow chart according to which the computer 17 of fig4 can be programmed . at the start , the speed v of the motor is adjusted to a value v min ( stage 44 ) set with a manual control 46 ( fig4 ). then one passes to stage 47 in which hypopnoeas are detected according to the amplitude of the variations in pressure . this stage can correspond to stages 21 and 22 of fig2 except that it is then applied to the pressure instead of being applied to the speed of the motor . in the absence of hypopnoea , one passes via path 48 in which the speed of the motor is reduced by a predetermined value n ′ if a time t 2 , for example 30 minutes , has passed without hypopnoea , without however lowering the speed to a value which is less than the set speed v min . in the case of a hypopnoea being detected during a period of time greater than or equal to a value t 1 of for example 10 seconds , the speed v is incremented by a predetermined value n , without however allowing the speed to exceed a value v max . consequently , in this simplified example , only a single degree of intensity of hypopnoea is distinguished and when the hypopnoea is detected , one and the same mode of action is envisaged in every case , i . e . an incrementation of the speed of the motor according to one predetermined step and one only . of course , the invention is not limited to the examples as described and represented . in the computers of the embodiments according to fig1 and 3 a program could be envisaged which distinguishes only one type of hypopnoea , or on the other hand , the embodiment according to fig4 could be equipped with a program which processes in a different way the weak hypopnoeas and the strong hypopnoeas as was described with reference to fig2 . while particular forms of the invention have been illustrated and described , it will also be apparent to those skilled in the art that various modifications can be made without departing from the spirit and scope of the invention . accordingly , it is not intended that the invention be limited , except as by the appended claims .

US-77542401-A

it is described a new method for the preparation of pharmaceutical tablets carrying poorly soluble in water principle ; this method allows to obtain tablets with fast and / or slow release of the active principle . the peculiar feature is the fact that the poorly soluble in water active principle is treated with a surfactant , during the granulation phase or whatever during the preparation process ; the obtained product , subjected to a compression , produces pharmaceutical tablets which show high bioavailability of the carried active principle . this procedure can be used to prepare polymeric matrixes , formed by tablets with one or more layers . the procedure of manufacture and the characteristics of the new finished tablet are described .

now we have unexpectedly found , and it is the object of the present industrial patent , that , the use of particular concentrations of surface - active agents in a hydrophilic matrix , allow to obtain an increase of the dissolution speed of a poorly soluble drug and , in this way , also an improvement of the absorption and bioavailability of the active principle carried in this matrix . these systems of matrix release , composed by pharmaceutical tablets of one or more layers , one of which contains the active principle , can be produced by using precise productive and high industrial reproducible technologies . moreover , we have , unexpectedly found that these systems do not determine “ burst effect ” and especially , they allow to eliminate the variability of the absorption caused by differences in the granulometry of the poorly soluble active principle . in this way we have carried out and experimentally proved a new therapeutic system , with modified and controlled release , that solves the problem of the “ burst effect ” bound to the matrix systems . this system shows innovative advantages of safety and therapeutic efficacy , because the release of the active principle happens in a complete and reproducible way and the absorption results effective and high , like it is showed by the data relative to the plasma concentrations ( c max ), obtained after the administration to the healthy volunteer , as it will be reported in the examples of the present patent . object of the present invention is a tablet of one or more layers one of which , at least , carries the active principle while the other one , or the others layers , have mostly the function of barrier with the purpose to modulate , for a determinable period of time , the release of the carried drug from the layer including the drug ( for the geometry of the systems with more layers it refers back to what described in the above u . s . pat . no . 5 , 422 , 123 ). one of the characteristics of the tablet of the invention consists in the fact that in the preparation of the treated layer ( or nucleus ), beyond the active principle and a surface - active agent , also polymeric substances are utilized able to modulate ( to slow down and / or to speed up ) the release of the active principle . as poorly very soluble in water substances ( which show a solubility at 20 ° c . less then 50 mg / ml ) many drugs can be used , including , in order to illustrate and not to limit : nifedipine , ricardipina , nitrendipine , nimodipine , niludipine , nilvadipine , nisoldipine , fenofibrate , naftazone , terfenadine . these poorly soluble in water active substances are included in the treated layer ( or nucleous ) in a percentage from 9 to 80 % of the weight , preferably from 20 to 60 %. the system is characterized by the fact that in the preparation of said nucleus or layer which containing the active principle , surfactant substances or substances with hydrophilic characteristics of acceptable pharmaceutical type , are used , selected from the group consisting of : in order to illustrate and not to limit , the substances with surfactant properties , the following ones are reported : sodium lauryl sulphate , aluminium monostereate , sodium cetostearyl sulphate , magnesium and ammonium lauryl stearate , mono -, di -, triethanolamine laurylstearate , glycerylmonostearate , glycerylmonoleate , lauromacrogols ( polyethoxylated laurylic alcohol ), polysorbates of different pharmaceutical degree ( they usually contain from 20 to 120 mols of c 2 h 4 o ), esters of sorbitane with fatty acids , alkyldimethyl -( phenylmethyl ) ammonium hydrochloride , cholesterol , bile acids and relative salts or esters or derivatives , lecithines , nonoxynoles or macrogolnonylphenylethers ( polyethoxylated nonylphenols ). said surfactants can be added to the active agent either with simple mixing or , in the case of a previously prepared granulated , using other components , too , like coadjuvants . these surfactants can be added , for example , to the binder solution , like it is well known in the prior art . these hydrophyle or surfactants substances are included in the pharmaceutical formulation in a percentage from 1 % to 40 % of the weight of the treated layer , preferably from 2 % to 30 %. as polymeric substances in the preparation of said layer ( or nucleus ) can be used , for example , reticulated polyvinylpyrrolidone , hydroxypropylmethylcellulose , reticulated sodium carboxymethyl - cellulose , carboxymethylstarch , potassium methacrylate - divinylbenzene copolymer , polyvinylalcohols , hydroxypropylcellulose at molecular weight from 2 , 000 to 4 , 000 , 000 , carboxyvinylpolymers , glucanes , scleroglucanes , mannanes , galattomannanes , gellanes , xanthanes , alginic acid and derivatives , polyanhydrydes , polyaminoacids , poly -( methyl vinyl ethers / maleic anhydryde ), carboxymethylcellulose and derivatives , ethylcellulose , methylcellulose and in general cellulosic derivatives , starchs , starch derivatives , alfa , beta , gamma cyclodextrins and in general dextrin derivatives . these polymeric substances form from 3 % to 90 % of the weight of the layer ( or nucleous ), but preferably from 5 % to 50 %. for all above polymers , many types characterized by different chemical and physical properties , solubility and gelling are present in the market , in particular , regarding the hydroxypropylmethylcellulose many types with different molecular weight ( from 1 , 000 to 4 , 000 , 000 ) and different level of substitution can be used . said types of hydroxypropylmethylcellulose show different characteristics because they are usually erodible and able to produce gels , by the way of the viscosity and the degree of substitution ( d . s .) shown in the polymeric chain . at least , usually in pharmaceutical technique excipients like : mannitol , lactose , sorbitol , xylitol , talc , stearic acid , sodium benzoate , magnesium stearate , colloidal silica and others like glyceryl monostearate , hydrogenated ricine oil , waxes , mono , bi -, trisubstituted glycerides , glycerilpalmitostearate , glyceryl behenate , cetylic alcohol can be used . when it is desired to allow the penetration of water and / or aqueous fluids in the layer or nucleous , hydrophilic diluents are included like mannitol , lactose , starchs of different source , sorbitol , xylitol , or to carry in the formulation moistening substances and / or in general favouring the penetration of water in the compact . when it is desired to slow down the penetration of water and / or aqueous fluid in the treated layer or nucleus , hydropholic diluents are included like glyceryl monostearate , hydrogenated castor oil , waxes , mono - bi - trisubstituted glycerides . moreover substances can be used like diluents , binders , lubricants , buffers , not adhesives , glydants , plasticizers and other substances , able to give to this layer the wanted characteristics like in the examples afterwards reported . the pharmaceutical tablets of the invention have the advantage to release the carried active principle in a programmed way . the system , in the simplest achievement , is a tablet with one or more layer at least one of which contains the active agent . the formulation of the “ barrier ” layers includes polymeric substances and coadjuvants and plasticizer substances ; when this tablet is of three layers called “ barrier ”, they either can be similar one each other both for the composition and the thickness or they can be different . the polymeric substances carried out in the different “ barrier layers ” are reported in the previous description of the nucleus or treated layer . these polymeric substances occur in a percentage from 5 % to 90 % of the total weight of this layer and preferably from 50 % to 90 %. similarly , for the preparation of said layers , the coadjuvant substances previous described can be utilized . it is possible to produce these systems with one or more layers , by using installations and equipments of widely consolidate use in pharmaceutical field and able to assure a safe and precise realization of the system with not much expensive cost ( es : elisabeth hata ). over these finished tablets , further polymeric coating material can be applied in order to cover the system , and to allow a protection for the tablet or a protection against light for the photosensitive active principle carried by this tablet or it can be a further slowing down in the beginning phase of the release . said coating can be soluble in an acid medium or permeable or it can be gastric resistant and enterosoluble , in order to allow the activation of the system only after the arrival of the tablet in the intestinal tract . for the coating of these systems , the classical materials for the sugar coating or either natural and / or synthetic rubbers , like shellac , sandarac rubber , etc . or lypophylic material like natural waxes ( white or yellow ) or semi - synthetic derivatives can be used . moreover film forming polymeric materials can be used , like : cellulose derivatives ( hydroxypropylmethylcellulose , hydroxyethylcellulose , hydroxypropylcellulose and their derivatives ), acrylic and methacrylic copolymers of different molecular weight . in order to obtain the gastric resistance , many materials can be employed , like : zein , cellulose acetophthalate , cellulose acetopropionate , cellulose trimellitate , polyvinyl acetate phthalate , acrylic and methacrylic polymers and copolymers of different molecular weight and with a solubility that depends from different values of ph . said materials can be applied on the finished pharmaceutical formulation ( tablet with one or more layers ) through the classic method of film coating by using solutions in organic solvents or aqueous dispersions and working with a basin for atomization or in fluidized bed . said both gastric - soluble or gastric - resistant and entero - soluble materials can be employed in association with other retardant polymers and in association with other substances which have the function of plasticizers like : triethylcitrate , diethylphthalate , benzylbenzoate , dibutylsebacate , sorbitol , propylenglycol , diacetin , triacetin , dibutylphthalate , tributylacetate , castor oil , cetyl alcohol , cetylstearyl alcohol , fatty acids , polyoxyethylenglycols , usually selected from the group having a molecular weight from 200 to 200 , 000 . the coating layer can be applied , too , through the method of dry coating by using the above described materials , possibly previously granulated , like every expert of the field well knows . the examples and the obtained results in the described experimental trials put better in evidence the characteristics and the functionalities of the new system . in any case , the innovation of the realization is characterized by the fact that the claimed therapeutic system can be obtained by using the usually productive technologies , that is the system is transferable in an industrial process . fig1 shows the drug release in percent on the starting whole content , during the time , for the tablets according to example 1 , 2 , and 3 . fig2 shows a drug release in percent on the starting whole content , during the time , for the tablets according to example 4 , 5 , and 6 . preparation of a series of ( 5 , 000 ) tablets containing nifedipine 60 mg as active principle . a quantity of granulate necessary to obtain 5 , 000 tablets with two layers is prepared . the procedure of manufacture consists in the preparation of a wet granulate by using sigma mod . erweka type k 5 mixer ( frankfurt a . m ., d . ), and by wetting the mixture of powders with an aqueous solution of polyvinylpyrrolidone at 10 % ( w / v ) in which ( in the case of the granulate of the first layer ) the sodium laurylsulphate has been solubilized . the granulate is dried in a fluid bed apparatus ( aeromatic mod . strea ) and then added up by lubricants . the obtained granulates , like previously reported and according schemes well known by all the experts of the field , are carried out on the two charging hoppers of a rotary compression equipment which is suitable to produce two layer tablets ( es . elisabeth hata ). in particular in the first one the described granulate at 1 - b point is carried ; while in the second charging hopper the previously described granulate at 1 - a point is carried . the compression equipment , equipped with punches of 7 . 0 mm of diameter , is regulated in order to produce systems with two layers which are formed by a first layer of 144 . 0 mg containing the active principle ( 60 mg nifedipine ) and by a second layer of 100 mg of barrier granulate . the film forming process is done by using a coating apparatus ( a basin ) for rapid coating ( manesty accela - cota ) by spraying , through an “ air less ” system an aqueous dispersion at the 30 % of acrylic and metacrylic acid copolymer ( eudragit l 30 d ) in which the triethylacetate is solubilized . a temperature of about 40 - 50 ° c . is used for the entrance air , according to the known art , obtaining tablets completely covered by a uniform coating film of the previously reported polymeric materials . preparation of a series of ( 5 , 000 ) tablets containing nifedipine 60 mg as active principle . a two layers tablet is prepared with a composition exactly identical to that reported in the example 1 with only the substitution in the first layer formulation of the hydroxypropylmethylcellulose ( methocel k 100 m ,) 20 . 0 mg with an identical quantity of hydroxypropylmethylcellulose ( methocel k 15 m ). the second layer maintains identical composition . preparation of a series of ( 5 , 000 ) tablets containing nifedipine 60 mg as active principle . a two layers tablet is prepared with a composition exactly identical to that reported in the example 1 with only the substitution in the first layer formulation of the hydroxypropylmethylcellulose ( methocel k 100 m ,) 20 . 0 mg with an identical quantity of hydroxypropylmethylcellulose ( methocel k 4 m ). the second layer maintains identical composition . in order to estimate the characteristics of the active principle release by the prepared and described systems in the example 1 , 2 , and 3 , the apparatus 2 is used , paddle ( usp xxii ) by working at 100 r . p . m . and using as dissolution fluid 1 l of buffer solution at ph 6 . 8 formed by tris - hydroxy - methylaminomethane 0 . 1m , which contains 1 % of polysorbate 80 . the release of the active principle is followed through the spectrophotometric uv determination by using an automatic system of sampling and reading ( beckman ). from the analysis of table 1 , it &# 39 ; s evident that the utilization of hydroxypropylmethylcellulose of different molecular weight deeply modifies the release speed of the active principle . in particular in the example 1 hydroxypropylmethylcellulose is used at high molecular weight ( methocel k 100 m ,) in the example 2 hydroxypropylmethylcellulose is employed at medium molecular weight ( methocel k 15 m ) and in the example 3 at low molecular weight ( methocel k 4m ) ( see fig1 too ). in order to estimate the characteristics of bioavailability of the active principle carried out in the pharmaceutical formulation described in the example 1 , a “ cross over ” experiment has been done with 12 healthy volunteers by using the medical speciality procardia xl , as reference formulation , containing the same quantity of nifedipine . the results are expressed as percentage in respect to the reference formulation . from the “ in vivo ” reported data , the pharmaceutical formulation described in the example 1 results bioequivalent in respect to the reference formulation , being auc clearly over the 80 %. preparation of a series of ( 5 , 000 ) tablets containing nifedipine 60 mg as active principle . a two layer tablet is prepared with a composition exactly identical to that reported in the example 1 with the only substitution in the first layer formulation of the quantity of sodium laurylsulphate used : instead of 10 . 0 mg 15 . 0 mg are employed . the method of production is the same too . the second layer maintains identical composition . preparation of a series of ( 5 , 000 ) tablets containing nifedipine 60 mg as active principle . a two layer tablet is prepared with a composition exactly identical to that reported in the example 1 with the only substitution in the first layer formulation of the quantity of sodium laurylsulphate used : instead of 10 . 0 mg , 20 . 0 mg are employed . the method of production is the same too . the second layer maintains identical composition . preparation of a series of ( 5 , 000 ) tablets containing nifedipine 60 mg as active principle . a two layer tablet is prepared with a composition exactly identical to that reported in the example 1 with the only substitution in the first layer formulation of the quantity of sodium laurylsulphate used : instead of 10 . 0 mg , 30 . 0 mg are employed . the method of production is the same too . the second layer maintains identical composition . in order to estimate the characteristic of the active agent release by the prepared and described systems in the example 4 , 5 , and 6 , the apparatus 2 is used , paddle ( usp xxii ) by working at 100 r . p . m . and using as dissolution fluid 1 l of buffer solution at ph 6 . 8 composed by tris - hydroxy - methylaminomethane 0 . 1m , which contains 1 % of polysorbate 80 . the release of the active agent is followed through the spettrophotometric uv determination by using a automatic system of sampling and reading ( beckman ). from the analysis of table 2 it appears evident that the employment of growing quantities of sodium laurylsulphate in the preparation determines a great increase of the of release speed of the active principle from the pharmaceutical formulation ( see fig2 too ). preparation of a series of ( 5 , 000 ) tablets containing nifedipine 60 mg as active principle . a quantity of granulate necessary to obtaining 5 , 000 tablets with two layers is prepared . the procedure of manufacture consists in the preparation of a wet granulate by using sigma mod . erweka type k 5 mixer ( frankfurt a . m ., d . ), and by wetting the mixture of powders with an aqueous solutions of polyvinylpyrrolidone at 10 % ( w / v ) in which ( in the case of the granulate of the first layer ) the polyoxyethylenglycol has been solubilized . the granulate is dried in a fluid bed apparatus ( aeromatic mod . strea ) and then added up by lubricants . the obtained granulates , like previously reported and like schemes well known by all the experts of the field , are carried out on the two charging hoppers of a rotary compression equipment which is suitable to produce two layers tablets ( es . elisabeth hata ). in particular in the first one the described granulate at 7 - b point is carried ; while in the second charging hopper the previously described granulate at 7 - a point is carried . the compression - equipment , equipped with punches of 7 . 0 mm of diameter , is regulated in order to produce systems with two layers which are formed by a first layer of 144 . 0 mg including the active principle ( like 60 mg nifedipine ) and by a second layer of 70 mg of barrier granulate . in order to estimate the characteristic of active principle release by the prepared and described system in the example 7 , the apparatus 2 is used , paddle ( usp xxii ) by working a 100 r . p . m . and using as dissolution fluid 1 l of distilled water , which contains 1 % of polysorbate 80 . the active principle release is followed through the spectrophotometric uv determination by using an automatic system of sampling and reading ( beckman ). in order to estimate the characteristics of bioavailability of the active principle carried in the pharmaceutical formulation described in the example 7 , a “ cross over ” experiment has been done with 12 healthy volunteers by using the medical speciality procardia xl , as reference formulation , containing the same quantity of nifedipine . the results are referred as percentage compared to the reference formulation : from the “ in vivo ” reported data , the pharmaceutical formulation described in the example 7 results bioequivalent in respect to the reference formulation , being auc clearly over the 80 %.

US-14471198-A

a method and apparatus that facilitates the prevention of type ii endoleaks in stent - graft treated arterial aneurysmal sacs comprising a catheter having an elongate tubular body with a balloon or wire mesh basket attached to the body adjacent its distal end . the balloon preferably comprising a plurality of energy conducting elements attached thereto for transmitting rf energy to tissue to be treated . in operation , the catheter is inserted into the femoral artery of a patient and then advanced through the femoral artery into the aorta until the balloon or basket is positioned within an aneurysmal sac . once in place , the balloon or basket is expanded to compress the clot material within the aneurysmal sack under a pressure in the range of about 2 - 5 atmospheres . while compressed , the clot material is then heated by transmitting rf energy to the wire basket or the conducting elements on the balloon until the clot material is cauterized and collateral blood flow channels in the clot material are occluded . the balloon or basket is then returned to an unexpanded state and the catheter is removed from the aorta . once the catheter is removed , a stent - graft may be placed within the aorta in accordance with conventional procedures .

referring in detail to the drawings , an improved method and apparatus for preventing or eliminating type ii endoleaks in arterial aneurysms is described and illustrated herein . for exemplary purposes only , the following discussion focuses on the treatment of type ii endoleaks in abdominal aorta aneurysms . however , one skilled in the art will understand that the method and apparatus discussed herein may be used to treat type ii endoleak of other arterial aneurysms in such arteries as the iliac , the thoracic aorta and the like . turning to fig1 a diagrammatic view of an abdominal aorta 10 is provided . as depicted , the abdominal aorta 10 includes a section in which its walls are ballooned out forming an abdominal aortic aneurysm ( aaa ). as is typical , numerous collateral vessels 14 are shown to be interconnected with the aneurysmal sac 12 and / or the non - aneurysm portion of the aorta 10 . referring to fig2 the aneurysmal sac 12 typically includes a gelatinous clot material 18 filling the space bounded by the expanded arterial wall 15 . the main blood flow from the aorta 10 to the femoral arteries 11 and 13 passes through the aneurysmal sac 12 through a channel 16 formed in the gelatinous clot material 18 . as depicted , blood also flows through collateral pathways 21 , 23 and 25 formed in the gelatinous clot material 18 to an internal mammary artery ( ima ) 20 and a pair of lumbar arteries 22 and 24 . turning to fig3 and 4 , a stent - graft 30 is shown centrally placed within the aneurysmal sac 12 . a typical ima 20 to lumbar 22 and 24 type ii endoleak 26 is depicted in fig3 wherein blood enters from the ima 20 , fills the endoleak 26 and then exits through the lumbar vessels 22 and 24 . in such leaks , the blood tends to channel in circuitous routes through the gelatinous clot material 18 passing through collateral pathways 21 , 23 and 25 between the ima 10 and the lumbar arteries 22 and 24 . in fig4 embolization of the ima 20 , with a coil , embolics or the like 28 , is shown to be ineffective in stopping such leaks . for instance , once the ima 20 is blocked , blood simply flows into the sac 12 from one of the lumbar arteries 22 instead of the ima 20 , fills the endoleak 26 , and then exits through the other lumbar artery 24 . because the aneurysmal sac 12 tends to act like a nidas of an arterial venous malformation ( avm ) 40 having multiple entering 42 , 44 , 46 and 48 and exiting 43 , 45 and 47 pathways ( see fig5 ), it is difficult to stop the flow entirely without destroying the “ nidas .” once the stent - graft 30 has been endoluminally placed so that blood flow by - passes the aneurysmal sac 12 , and an endoleak 26 has formed , current endoluminal graft technology can not enable a physician to endoluminally treat or eliminate the endoleak 26 . accordingly , the present invention is directed to a method and apparatus that tends to prevent the formation of such leaks by treating the aneurysmal sac 12 prior to endoluminal placement of the stent - graft 30 . referring to fig6 an illustrated embodiment of a perfusion - type balloon catheter 50 of the present invention is shown to include an elongate tubular body 52 having proximal and distal ends and a balloon 54 attached to the body 52 adjacent its distal end . the balloon 54 is shown in an operative or expanded state . however , one of skill in the art would understand that the balloon 54 may be rolled or folded about the catheter body 52 to create a low profile for insertion of the catheter 50 into a patient . the catheter body 52 is preferably formed from a semi - compliant material to enable the catheter 50 to easily pass through a vessel or artery , such as the femoral artery , and make its way into the interior regions of a patient &# 39 ; s aorta 10 . the body 52 , which is open at its distal end , includes at least three lumens — a main or perfusion lumen 53 , a guidewire lumen 57 and a fill / evacuate lumen 59 . a hole ( not shown ) in the wall of the catheter body 52 enables the fill / evacuate lumen 59 to communicate with the interior of the balloon 54 . the guidewire lumen 57 generally extends the length of the body 52 . the perfusion lumen 53 extends from the axial opening at the distal end of the body 52 to a radial perfusion opening 55 extending longitudinally in the wall of the body 52 just beyond where a proximal end of the balloon 54 attaches to the body 52 . the perfusion catheter 50 may also be in the form shown in u . s . pat . nos . 5 , 458 , 579 , 5 , 087 , 247 , or 4 , 581 , 017 , the disclosures of which are incorporated herein by reference . the perfusion catheter 150 may include a multi - lobular balloon 156 as shown in fig6 a . individual balloon lobes 154 are attached to the catheter body 152 and , when inflated , form gaps 155 therebetween . instead of passing through a catheter lumen , blood passes through the gaps 155 between the balloon lobes 154 . the balloon 54 is generally cylindrical in shape and is preferably formed from compliant or semi - compliant material to minimize risk of rupture and to enable conformability within the aneurysmal sac 12 . rf conductive elements 56 , such as metallic wire or circuit traces , are attached to the outer surface of the balloon 54 and are used to transmit energy to tissue such as the gelatinous clot material 18 in a monopolar or bipolar manner . a wire ( not shown ) for providing power to the wire traces 56 on the balloon 54 may extend as a trace along the body 52 or may be encapsulated in the body 52 of the body . the wire preferably connects to an electrical cable 61 that extends from the proximal end of the body 52 of the catheter 50 . the cable 61 ends with a plug 62 that connects with an energy source and appropriate conventional catheter control equipment ( not shown ). preferably , the energy source is capable of supplying power in a range of about 20 - 200 watts . as shown in fig6 and 8 , the body 52 also includes a fill / evacuate lumen 59 and a fill / evacuate port 60 extending from catheter body 52 toward its proximal end . multiple wire lumens 51 may also be provided as shown . in addition , the distal end of the catheter body 52 may include a conically shaped slit 63 forming a radially directed and longitudinally extending opening into the perfusion lumen 53 to improve blood flow into the perfusion lumen 53 . with the slit 63 , the distal tip 64 of the catheter body tends to have a semi - annular or horse - shoe like shape . as shown in fig7 a , the balloon 54 may be attached to the distal tip 64 and have an inflated shape that directs blood flow toward the slit 63 and into the lumen 53 . as noted above , the catheter 50 of the present invention is preferably used to treat the gelatinous clot material 18 of the aneurysmal sac 12 prior to placement of the stent - graft 30 . in operation , as shown in fig9 and 10 , the catheter 50 , with the balloon 54 in an uninflated state , is inserted into one of the femoral arteries 11 in the groin region of the patient . the catheter 50 is then guided through the femoral artery 11 into the abdominal aortic artery 10 along a guidewire 58 . the catheter 50 is positioned within the aorta 10 such that the balloon 54 of the catheter is positioned within the aneurysmal sac 12 using well known visualization techniques such as x - ray , ultrasound , and the like . once in position , the balloon 54 is inflated with about 2 - 5 atmospheres of pressure , such that the gelatinous clot material 18 is compressed . with the balloon 54 inflated , blood flow through the aorta 10 is occluded and must flow through the perfusion lumen 53 of the catheter 50 . blood flow enters the perfusion lumen 53 through the opening in the distal end of the catheter body 52 and the conically shaped slit 63 . after passing through the perfusion lumen 53 , blood flows out of the perfusion opening 55 toward the proximal end of the catheter body 52 into the lower aorta 10 and femoral arteries 11 and 13 . if the balloon catheter 150 shown in fig6 a is used , the blood would flow through the gaps 155 between the balloon lobes 156 . with the clot material 18 compressed or condensed , flow through the collateral pathways 19 is blocked . rf energy is then transmitted to the conductive elements 56 on the exterior of the balloon 54 . as shown , the energy e is directed from the elements 56 on the balloon 54 into the clot material 18 in the aneurysmal sac 12 . alternatively , heating may be accomplished inductively or with dc . depending on the size of the lesion and the heat transfer parameters of the gelatinous clot material 18 , energy may be applied in a power range of about 20 - 200 watts . the heat tends to cauterize or coagulate the clot material 18 . optionally , the clot material 18 may be cauterized by rapidly pulsing the rf energy e into the clot material 18 to a depth of about 1 - 2 mm . the heating of blood is preferably minimized to the point of coagulation of the blood or other non - target tissue to avoid creating distal embolisms and / or other unnecessary vessel injury responses . the cauterized tissue tends to form an inner egg shell layer 17 , occluding or blocking collateral pathways 19 formed in the clot material 18 that had connected the collateral arteries 14 . as shown in fig1 , the collateral pathways 21 , 23 and 25 through the clot material 18 are blocked , thus preventing the channeling of blood through the clot material 18 between the ima 20 and lumbar arteries 22 and 24 . the cauterized tissue tends to scar over time and form a permanent occlusion such that no new collateral pathways may form within the clot 18 . after deflation of the balloon 54 and removal of the catheter 50 from the aneurysmal sac 12 , the stent - graft 30 may be installed in a routine manner in accordance with conventional procedures . turning to fig1 - 14 , an alternate embodiment of the present invention is shown to comprise a catheter 150 having an elongate tubular body 152 with distal and proximal ends . an expandable wire mesh basket 154 extends from the distal end of the catheter body 152 and a cable ( not shown ) extends from the proximal end of the catheter body 152 . the cable includes a plug ( not shown ) that connects with an energy source and conventional catheter control equipment ( not shown ). the wire basket 154 , as shown in fig1 , includes a mesh of criss - crossing wires that are uninsulated at a mid - section 156 of the basket 154 and insulated at proximal and distal end portions 155 and 157 of the basket 154 . the basket 154 may include a membrane such as a braided fabric to prevent the basket 154 from slicing or cutting into the gelatinous clot material 18 too deeply such that the basket becomes lodged or creates emboli upon removal . an articulating wire 151 extends through the interior of the catheter body 152 and basket 154 to a ring attached to the distal end of the basket 154 . when the articulating wire 151 is withdrawn from or pulled out of the catheter body 152 , the corresponding force applied to the distal end of the basket 154 causes the basket 154 to longitudinally compress and radially expand . ( see fig1 ). when the articulating wire 151 is released , the basket 154 returns in spring - like fashion to its unexpanded , low profile state . in operation , the catheter 150 , with the basket 154 in an unexpanded state , is inserted into one of the femoral arteries 11 in the groin region of the patient . the catheter 150 is then guided through the femoral artery 11 into the abdominal aorta 10 along a guidewire ( not shown ). the catheter 150 is positioned within the aortic artery 10 such that the basket 154 of the catheter 150 is positioned within the aneurysmal sac 12 . once in position , as shown in fig1 , the basket 154 is expanded by drawing or pulling on the articulating wire 151 such that the gelatinous clot material 18 is compressed . with the basket 154 expanded , blood flow through the aorta 10 flows through the basket 154 into the lower aorta 10 and femoral arteries 11 and 13 . with the clot material 18 compressed or condensed , flow through the collateral pathways 19 is blocked . rf energy is then transmitted to the basket 154 . as shown , the energy e is directed from the basket 154 into the clot material 18 in the aneurysmal sac 12 . depending on the size of the lesion and the heat transfer parameters of the gelatinous clot material 18 , energy may be applied in a range of about 20 - 200 watts . the heat tends to cauterize the clot material 18 . as with the previous embodiment , the heating of blood is preferably minimized to the point of coagulation of the blood or other non - target tissue to avoid creating distal embolisms and / or other unnecessary vessel injury responses . after the basket 154 is returned to its unexpanded state and the catheter 150 is removed from the aneurysmal sac 12 , the stent - graft 30 may be installed in a routine manner in accordance with conventional procedures . while various preferred embodiments of the invention have been shown for purposes of illustration , it will be understood that those skilled in the art may make modifications thereof without departing from the true scope of the invention as set forth in the appended claims including equivalents thereof .

US-17004302-A

the invention provides a spinal disc implant comprising two side walls which are opposed and substantially parallel spaced apart by a front wall and a back wall to define an interior space . the side walls define substantially elliptical curves joining the front and back walls . the front wall is also curved and the back wall may be either curved or straight . the walls may have openings or holes which may be circular or elliptical in shape . the upper and lower edges of the implant have a plurality of teeth extending therefrom for engaging adjacent vertebrae . the implant is made of a biocompatible metal such as titanium or an alloy thereof , and the first and second sides tapering from the second end to the first end . the interior space has a porous hydroxyapatite block shaped to fill the interior space . the porous hydroxyapatite substance helps the prosthesis integrate into the vertebral structure by allowing into the pores .

fig1 illustrates a spinal disc implant of the present invention , generally indicated by the reference numeral 10 . the implant 10 has a generally d - shaped body 12 including a central opening 14 . the implant further includes upper and lower faces 16 , 18 having a plurality of teeth 19 or other gripping means included on each face . the implant 10 has a front wall 20 , a back wall 22 , and first and second side walls 24 , 26 , which are all joined . the back wall 22 is relatively straight , while the front wall 20 and side walls 24 and 26 are curved . the openings or holes 28 in the walls are preferably of an elliptical shape , although they may be square , circular , or rectangular . the embodiment of fig1 has a hole or opening 28 in the center of the back wall 18 and in the center of the front wall 20 . there is an opening or hole 28 at the junction between each side wall 24 , 26 and the front wall 20 , as well as in the approximate center of each side wall 24 , 26 for a total of six openings or holes 28 in the implant 10 . teeth 19 appear on the upper or lower surfaces 16 , 18 of the side walls 24 , 26 , but not on the upper or lower surfaces of the front and rear walls 20 , 22 . the upper and lower surfaces 30 , 32 of the rear wall 22 includes notches 34 , 36 to provide a structure to engage a gripping tool ( not shown ) to aid in placement of the implant 10 in the intervertebral space . the space defined by the central opening 14 ( best viewed in fig2 ) openings are preferrably filled with hydroxyapatite combined with any biological factor or composition which helps to induce growth of bone and cartilage against the surface of the implant and in the spaces defined by the teeth 19 . the teeth 19 ( shown in fig1 and 5 ) are preferably steeply sloped four - sided pyramids of approximately 0 . 08 inches in height . they are preferably arranged in straight rows across and down the upper and lower faces 16 , 18 of the side walls 24 , 26 of the implant 10 , as shown in fig2 . the pyramidal faces of each tooth 19 preferably form a 45 ° angle with the vertical . they can be formed by machining the implant 10 , or as part of the casting process . an important aspect of the present invention is its geometric compatibility with its environment . referring to fig1 and 3 , the implant 10 slopes from the rear wall 22 to the front wall 20 . this shape enables the implant 10 to fit between adjacent vertebral bodies ( not shown ) when the spine is in an upright position . the exact angle formed at the vertex defined by the top and bottom faces varies depending on which disc is being replaced . in the lumbar region of the spine , for example , the opposed faces adjacent vertebral bodies define an angle ranging from about 0 to about 20 degrees . similarly , since the vertebral body , which engages the first and second faces 16 , 18 of the implant 10 from above , has a defined curvature , the implant 10 has a curvature which mimics that of the intervertebral space to allow it to conform to the domed shape of the vertebral body surface . the implant 10 is preferably made from pure titanium or an alloy thereof , preferably anodized to increase its biocompatibility by making it more inert . the implant 10 may be made from bar stock , or tubing or by molding , or from titanium powder using powder metallurgy techniques . the dimensions of the implant 10 vary depending on where in the spine the implant will be inserted . the vertebral bodies in the lumbar area of spine , for example , are larger than the vertebral bodies in the thoracic area . therefore , an implant intended for the thoracic region would be smaller than one for the lumbar region . likewise , lower lumbar disc replacements would be larger than upper ones . by way of example , an implant sized for implantation between the third and fourth lumbar vertebrae may have approximate dimensions of 2 . 7 cm long , 2 . 5 cm wide , about 2 cm high anteriorly , and would slope down to about 1 . 3 cm high posteriorly . the slope from rear to front in a typical implant increases by about 3 mm . a person of ordinary skill could adapt the basic dimensions of the implant 10 to make the implant 10 suitable for the space formerly occupied by the particular vertebral disc which needs replacement . the present invention therefore includes implants having varying angles and dimensions to allow implantation at different levels of the spine . the shape and curvature of the implant 10 provide several advantages . in the lumbar region of the spine , the discs and vertebral bodies are held at an angle creating a lordosis or curvature of the lumbar spine . to have the implant 10 parallel or coplanar would be physiologically and anatomically unacceptable . the natural discs in the lumbar spine are wider anteriorly than they are posteriorly . the disc replacement implant 10 of the present invention is therefore also wider posteriorly than it is anteriorly . this recreates the natural anatomic curvature of the spine . further , the implant 10 of the present invention takes into consideration the anatomy of the undersurface of the vertebral body or end plate of the vertebra on which the lower face of the implant 10 rests . the end plate is made of very compact bone circumferentially , but as the bone centralizes towards the middle , it becomes thinner . the thinner portion is dome shaped , and is responsible for the hydraulic stress middle of the end plate . this shape is mimicked by the secondary curvature in the disc implant of the present invention . the secondary arc which corresponds to the dome in the vertebral body provides a mechanism to lock the cage in place and prevent slippage or extrusion . the teeth 19 disposed on portions of the top and bottom faces of the side walls 24 , 26 of the implant 10 grip the vertebral body and cause a mechanical interface between the prosthesis and the end plate of the vertebral body . preferably , the implant 10 optionally includes an insert of synthetic bone material , such as porous hydroxyapatite or other equivalent substance . preferably , the synthetic bone material is interpore proosteon 500 brand of porous coralline hydroxyapatite , available from interpore cross international , irvine , calif . the porous synthetic bone material is held in place by press fit ( friction ), or by set screws on the sides of the implant 10 ( not shown ). the porous synthetic bone allows independent placement of the implant 10 into the intervertebral disc space without use of a bone graft . this will help reduce morbidity and complications associated with harvesting a bone graft from the patient , reported to be as high as 21 %. it will also obviate the need for use of an allograft , which carries the risk of disease transmission and added expense . the implant 10 provides a non - articulating disc prosthesis which can be provided in multiple sizes depending on the size needed for the specific lumbar region , and can be furnished in smaller sizes for the cervical and thoracic spine , as miniature cages for placement using endoscopic techniques for minimally invasive spine surgery . in addition to titanium or a biocompatible alloy thereof , or other biocompatible metal or alloy known to those of skill in the art , the implant of the present invention may be made of other biomaterials including biocompatible metals , metal alloys , ceramics , and polymers or combinations thereof , having suitable hardness and strength characteristics . for example , the implant may be made of a synthetic biocompatible material , as disclosed in u . s . pat . no . 5 , 306 , 309 ( wagner ); u . s . pat . no . 5 , 192 , 327 ( brantigan ); u . s . pat . no . 5 , 171 , 281 ( parsons ); u . s . pat . no . 4 , 911 , 718 ( lee ); and u . s . pat . no . 4 , 655 , 777 ( dunn ). the entire contents of the foregoing references is incorporated herein by reference . of particular interest , in addition to titanium or an alloy thereof , is a fiber reinforced synthetic material , such as a carbon fiber reinforced polymer . the implants may have ceramic portions , facings , or coatings , and may also include or be coated with one or more bone growth inducing factors or compositions . optionally , the implant may include an elastomeric layer or portion , to add compressibility to the implant . during implantation surgery , the surgeon exposes the herniated or damaged disc , and removes it . a spinal disc implant 10 ( optionally including a central core of porous synthetic bone ), is inserted with a tool which grips the implant 10 to enable the surgeon to lift and insert the implant 10 in the intervertebral space defined by adjacent vertebral bodies from which the damaged or diseases disc was removed . the implant 10 is positioned on the vertebral body so that its transverse curvature conforms to the dome shape of the vertebral body . at the same time , the implant 10 is positioned so that its anterior to posterior position will create the proper angulation between vertebrae to help to restore the natural anatomic curvature of the human spine . the implant 10 , once implanted , encourages osseointegration in two distinct ways . the teeth 19 form an irregular surface which grip the vertebral body and allow bone tissue to grow in and around the teeth 20 . also , the synthetic porous bone segment , if present , allows bone tissue to grow into the pores , to help anchor the implant 10 in place without resorting to bone grafts orallografts . the advantages to the present implant 10 include the following : ( 1 ) the pattern of teeth is different than previous discs ; ( 2 ) the front of the device fits within the end plates of the vertebral bodies in a much more anatomic fashion as compared with previous discs ; and ( 3 ) the implant provided herein can be used in the lumbar spine . however , smaller versions for use in the cervical and thoracic spine are intended to be part of the invention . various modifications will be apparent to those skilled in the art . such modifications and changes are intended to be included within the scope of the invention , which is defined by the following claims .

US-26067702-A

a headset for detecting brain electrical activity may include a flexible substrate having first and second ends each configured to engage an ear of a subject and dimensioned to fit across the forehead of a subject . the headset may also include a plurality of electrodes disposed on the substrate and configured to contact the subject when the headset is positioned on the subject . first and second electrodes may contact top center and lower center regions of the forehead , respectively , third and fourth electrodes may contact front right and front left regions of the forehead , respectively , fifth and sixth electrodes may contact right side and left side regions of the forehead , respectively , and electrodes included within the securing devices may contact the ear regions . the third and fourth electrodes may be moveable in at least a vertical direction relative to the other electrodes .

reference will now be made in detail to the embodiments of the present disclosure described below and illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to same or like parts . while the present disclosure is described herein with reference to illustrative embodiments for particular applications , it should be understood that the disclosure is not limited thereto . those having ordinary skill in the art and access to the teachings provided herein will recognize additional modifications , applications , embodiments , and substitutions of equivalents all fall within the scope of the invention . accordingly , the disclosure is not to be considered as limited by the foregoing or following descriptions . other features and advantages and potential uses of the present disclosure will become apparent to someone skilled in the art from the following description of the disclosure , which refers to the accompanying drawings . in an exemplary embodiment , data corresponding to electrical brain activity may be used to detect neurological injury and / or disease in subjects . fig1 depicts one embodiment of a neuro - assessment apparatus 10 for acquiring and processing electrical brain signals and evaluating a subject &# 39 ; s neurological condition . in some embodiments , neuro - assessment apparatus 10 may be implemented as a portable device for point - of - care applications . apparatus 10 may include a base unit 42 , which may be configured either as a handheld unit or as larger , stationary unit . base unit 42 may be capable of storing , processing , or further transmitting data corresponding to electrical brain activity . for example , base unit 42 may include an analog electronics module 30 and a digital electronics module 50 for receiving and converting eeg signals , a processor 51 , a memory 52 , a user interface 46 for allowing user input and for outputting data to a user , and a rechargeable and / or replaceable battery 44 for powering apparatus 10 . if rechargeable , battery 44 may interface with a charger 39 , which in turn may be connectable to an ac power source 37 , which may also include appropriate filtering of powerline noise components that could impact signal quality . further , base 42 may be configured to transmit and / or receive data from any number of suitable components external to apparatus 10 , e . g ., a printer 49 , an external memory 47 , or an external processor 48 . memory 47 and / or processor 48 may be included in the same component or in different components , e . g ., a computer , a smartphone , a larger database system , a patient monitoring system , etc . further , base 42 may be operably coupled to these external components either through a hard connection or wirelessly . apparatus 10 may also include a subject sensor 40 operably coupled to base unit 42 , either by a hard connection or wirelessly . subject sensor 40 may be configured to detect eeg signals from the subject and transmit this data to base 42 , as indicated by arrow 41 a . in some embodiments , subject sensor 40 may include an electrode array 20 with one or more disposable neurological sensors , such as electrodes , configured to attach to a subject &# 39 ; s head for acquiring electrical brain signals . the electrodes may be configured for sensing spontaneous electrical brain activity and / or evoked potentials generated in response to applied stimuli ( e . g . auditory , visual , tactile , etc . ), as depicted by optional stimuli generator 54 in base 42 , stimulus delivery device 31 either incorporated into or separate from subject sensor 40 , and arrow 41 b relaying signals between the two . in one embodiment , array 20 may include 8 electrodes , for example , five active channels and three reference channels . array 20 may include anterior ( frontal ) electrodes fp 1 , fp 2 , f 7 , f 8 , afz ( also referred to as fz ′) and fpz ( ground electrode ) configured to attach to a subject &# 39 ; s forehead , and electrodes a 1 and a 2 configured to attach to the front or back side of the ear lobes , or on the mastoids , roughly in accordance with the international 10 / 20 electrode placement system ( with the exception of afz ), as is shown in fig2 a . while the international 10 / 20 system typically requires at least 19 electrodes placed at intervals across a subject &# 39 ; s scalp , reducing the number of electrodes in array 20 may allow array 20 to be positioned on a subject &# 39 ; s forehead , thereby eliminating the need to place electrodes over the subject &# 39 ; s hair . this may reduce any conduction problems caused by hair and eliminate the need for hair removal . apparatus 10 may be configured to compensate for the reduced number of electrodes in array 20 by employing signal processing algorithms capable of accommodating for the missing electrodes . such processing may be performed by processor 51 in base unit 42 or by external processor 48 . although not shown , a processor may be placed on array 20 itself , facilitating data gathering and transmission , or the data processing described herein . adapting apparatus 10 to work with array 20 having fewer electrodes may allow for quicker placement of the electrodes on a subject , which may in turn facilitate efficient subject monitoring and point - of - care use . in accordance with the embodiments depicted in fig2 a and 2b , electrodes fp 1 , fp 2 , f 7 , f 8 , afz , fpz , a 1 , and a 2 , as known from the international 10 / 20 system , may be placed on the right ear lobe at position 302 , on the far right of the forehead at position 304 , on the near right of the forehead at position 306 , on the center top of the forehead at position 308 , on the near left of the forehead at position 310 , on the far left of the forehead at position 312 , and on the left ear lobe at position 314 . additionally , in an illustrative embodiment , a grounded electrode may be placed on the center of the forehead at position 318 . though a general desired arrangement of electrodes on the forehead may be known , achieving consistent placement of electrodes across subjects in locations capable of generating usable signals from each electrode has proven very difficult . individually placing , testing , and adjusting each electrode on a subject using free electrodes may yield the best eeg signals , but individual placement requires more time and a trained technician , as discussed above . this would negate the ease - of - use and portability requirements for a point - of - care embodiment of apparatus 10 . prior art “ one - size - fits - all ” headsets were created to enable rapid and repeated placement of electrodes on a subject . electrode nets were designed that adjust in proportion to the size of a subject &# 39 ; s head . thus , though the relative location of the electrodes to one another was not fixed , the electrodes were automatically placed according to the characteristics of the net structure , e . g ., the rigidity or elasticity of the net , as it conformed to the subject &# 39 ; s head . such nets did not allow for adjustment of the electrodes once the nets were fitted in place . in addition , headsets were produced that fixed the location of the electrodes relative to each other within the headset , so that when the headset was applied to the subject , the headset dictated the arrangement of the electrodes on the subject &# 39 ; s head . these prior art headsets were configured to fit on each subject in substantially the same orientation in an attempt to minimize the risk that an untrained user would not achieve consistent placement of the electrodes . by fixing the location of the electrodes relative to each other , affixing the headset as a unitary whole to the subject essentially simultaneously completed placement of the electrodes , because the headset substrate substantially determined the relative arrangement of the electrodes within it . thus , the headset itself almost completely dictated the placement of the electrodes rather than the user , notwithstanding differences in facial morphology between subjects . this fixed - electrode design may generate usable eeg signals in some contexts . for example , headsets with fixed electrode placement have in some instances been used to measure the sedation level of subjects undergoing anesthesia . in this context , the fixed electrode headset may generate eeg signals that are usable to compare and distinguish between a subject &# 39 ; s alert levels of electrical brain activity and electrical brain activity indicative of various levels of sedation within that subject . surprisingly , however , headsets that uniformly fix the placement of electrodes may produce insufficient eeg signals that are incapable of reliably comparing and distinguishing between levels of normal versus abnormal electrical brain activity for an individual subject relative to a population . while not being bound to the theory , this may occur because changes in eeg signals may be more substantial when anesthetizing a subject , but the changes in eeg indicative of brain abnormalities in a subject may be more subtle . thus , the adverse consequences of fixed - headset designs may be more apparent in more subtle applications , rendering the fixed headsets unusable . although fixed - electrode headsets may ensure the ‘ correct ’ relative positioning of electrodes as defined by the headset , the subject eeg readings provided by these electrodes surprisingly are not actually usable for all applications , which may be unexpected to one of skill in the art . further , adjusting the headset to accommodate the anatomy of different subjects ( e . g ., moving the headset to avoid the hair line or other anatomical feature ) or offering different sizes of fixed electrode headsets ( e . g ., youth or adult ) did not appear to achieve more usable eeg readings . thus , the problem of providing an easy - to - apply set of electrodes for a point - of - care neuro - assessment apparatus remained , and a need persisted for a headset and method for accurately and efficiently applying electrodes to a subject . according to an embodiment of the present disclosure , fig3 depicts an electrode array 400 configured to solve at least some of the above problems . array 400 includes a substrate 401 ; right and left ear lobe electrodes 402 , 414 ; far right and far left forehead electrodes 404 , 412 ; near right and near left forehead electrodes 406 , 410 ; center top forehead electrode 408 ; and grounded center electrode 418 . though grounded electrode 418 is shown in the lower center of array 400 , electrode 418 may be located in any suitable position on array 400 . in some embodiments , including the one shown in fig3 , array 400 may include two bilateral “ branches ” ( e . g ., extensions left and right of a centerline corresponding approximately with the nose ), each configured to extend laterally along respective approximate halves of a subject &# 39 ; s forehead region . the electrodes may be arranged along the branching portions of array 400 . in the embodiments of fig3 - 5 , the electrodes may connect to the branching portions of array 400 via , e . g ., connector regions 430 . while some of the electrodes may be attached directly to neighboring electrodes in array 400 ( e . g ., central electrode 408 and ground electrode 418 ), some of the electrodes may be independently connected to each branch of array 400 and , for example , may extend from the branching portions of headset 400 via separate , individual connections . the array 400 depicted in fig3 is bilaterally symmetrical , with the connector region 450 aligning approximately with the nasal centerline , but this needn &# 39 ; t be the case . array 400 may be sized and shaped to conform to a subject &# 39 ; s forehead . array 400 may be configured to extend from an ear region of the subject and across the forehead , and may include securing devices 424 , such as ear loops , to fit over a subject &# 39 ; s ears and hold array 400 in place . further , ear loops 424 may position electrodes 402 and 414 on a subject &# 39 ; s ear lobes . though ear loops 424 are depicted as maintaining array 400 in place , any suitable mechanism , for example , bands , straps , adhesives , snaps , velcro ® or clamps , either completely or partially encircling or affixing array 400 to the head , may be used in addition to or instead of ear loops 424 to maintain array 400 in place . further , although a branching configuration is described in the exemplary embodiment , array 400 may have any suitable shape , size and configuration . the electrodes may be incorporated into array 400 on the side of array 400 configured for contacting the subject . the portion of the electrodes configured for subject contact may be exposed and may either lie flush with array 400 or may slightly recess into or project from array 400 . to protect the electrodes prior to use , the exposed surfaces may be covered , for example with a removable cover or covers , until array 400 is applied to a subject . further , array 400 may also include a wet or dry gel over the electrodes and protected by the cover to aid in electrode placement . alternatively , gel may be applied to the subject or to the electrode directly before use . in some embodiments , the electrodes ( with the possible exception of electrodes 402 , 414 ) may be spatially arranged in array 400 to reflect the approximate 10 % and 20 % distance away from a center nasion tab 420 ( discussed further below ), according to the international 10 / 20 system , as estimated for the head size of an average subject . array 400 may include circuitry embedded into or printed , coated , etched , deposited or bonded onto array 400 to operate in conjunction with the electrodes . the circuitry may be composed of any suitable electrically conductive material , such as , for example , copper , silver , silver - chloride , gold , tin , or any combination of materials known in the art . the circuitry may electrically connect each electrode , either individually or jointly , to connector region 450 and / or to a transmitter capable of relaying the detected electrical brain activity data from the electrodes to base 42 or external processor 48 . array 400 may include a base interface region 450 configured to connect with base 42 , either wirelessly or through a hard connection . though interface region 450 is depicted at the center of array 400 and array 400 is depicted as symmetrical , base interface region may be any suitable size and shape and may be positioned anywhere on array 400 . further , in wireless embodiments , base interface region may include a transmitter for transmitting data , or may be entirely missing from array 400 . unlike previous electrode headsets , array 400 may be configured to achieve accurate application of electrodes by an untrained person while generating usable eeg readings for assessing normal versus abnormal brain function . array 400 will be further described below in reference to the application of array 400 to the subject . array 400 may be applied to the forehead of a subject with ear loops 424 disposed around a subject &# 39 ; s ears , as depicted in fig4 a , generally positioning array 400 across the subject &# 39 ; s forehead and maintaining array 400 in place . once array 400 is preliminarily in place , as is depicted in fig4 b , a nasion point 420 on headset 400 may be aligned with the subject &# 39 ; s nasion region , located at the top of the nose in a depressed region directly between the subject &# 39 ; s eyes . positioning nasion point 420 so that the lower tip aligns with the patient &# 39 ; s nasion may substantially align the front , center portion of array 400 on the subject . next , the position of center electrode 408 may be checked and adjusted if necessary . if positioning the tip of nasion point 420 directly at the subject &# 39 ; s nasion causes electrode 408 to fall within the subject &# 39 ; s hairline , then electrode 408 and array 400 may be lowered on the subject &# 39 ; s forehead so that electrode 408 is located just below the hairline . this allows electrode 408 to be positioned on the skin of the forehead rather than in the hair , reducing the interference that may be created by positioning the electrode over the hair . this may allow array 400 to be adjusted for the unique anatomical features of the subject . positioning nasion point 420 and center electrode 408 may occur either before or after arranging ear loops 424 around the subject &# 39 ; s ears . once ear loops 424 are positioned over the ears , electrodes 402 and 414 may be attached to the subject &# 39 ; s ear lobes . once electrode 408 is positioned , electrodes 406 and 410 may require adjusting . the position of electrodes 406 and 410 may be adjusted relative to the subject &# 39 ; s supraorbital foramen , which is located above the eye socket where the subject &# 39 ; s eyebrows are located . for the purpose of this application , the words ‘ eyebrow ’ and ‘ supraorbital foramen ’ may be used interchangeably . to allow the person applying array 400 to position electrodes 406 and 410 on a subject , array 400 may include one or more distance indication gauges . in fig4 a through fig5 , the depicted distance indication gauge includes tabs 422 extending down from electrodes 406 and 410 . the distance from the bottom tips of tabs 422 to the center of electrodes 406 and 410 corresponds to the optimal predetermined distance between electrodes 406 and 410 and the top of the subject &# 39 ; s eyebrows . tabs 422 are positioned on the subject so that the bottom of tabs 422 sits above , preferably directly above , the peak of the subject &# 39 ; s eyebrow so that the bottom of tabs 422 does not touch the subject &# 39 ; s eyebrows . if the subject does not have any eyebrows , then the bottom of tabs 422 is positioned above the peak of the subject &# 39 ; s supraorbital foramen , which lies in substantially the same location as the eyebrows . positioning tabs 422 directly above the subject &# 39 ; s eyebrows may locate electrodes 406 and 410 in an optimal location for recording usable eeg readings from the subject using array 400 . prior electrode arrays and headsets focused predominantly on the positioning of each electrode relative to each other and attempted to provide a way to maintain uniform positioning of the electrodes relative to each other for each subject . accordingly , in such devices , electrodes 406 , 410 , and 408 had fixed , non - adjustable positions in the headset and were applied all together to a subject . thus , the position of electrodes 406 and 410 relative to center electrode 408 could not be adjusted . while this fixed arrangement worked for some uses , as discussed above in reference to sedation - monitoring purposes , this fixed arrangement of electrodes 406 , 410 , and 408 unexpectedly provided inadequate eeg readings for discriminating between normal and abnormal electrical brain activity indicative of normal or abnormal brain function . for example , fig6 a through 6c show data from experiments that measured and compared several exemplary properties of eeg signals recorded using free electrodes , a fixed headset , and an adjustable headset according to an exemplary embodiment of the disclosure . the graphs of fig6 a through 6c depict 12 frontal features that were extracted from the eeg readings of normal subjects and the mean statistical z - score value of each feature calculated for all subjects tested in each of the free electrode , the fixed headset , and the adjustable headset groups . thus , the mean z - scores of each feature are compared using the different eeg recording devices . features 1 through 12 shown in fig6 a through 6c were achieved by calculating the bipolar absolute power for a pair of electrodes for each headset type within selected frequency bands , ( a left and right feature across 6 frequency bands for a total of 12 features ), and the phase symmetry and coherence relationships among these spectral measurements within and between pairs of electrodes . measurements may be made between pairs of electrodes in a given headset in order to detect signal differences and to reject input signals common to both electrodes . this is because each electrode may acquire different brain activity , but noise influence may be similar on both electrode channels within the pair due to their close proximity on the subject &# 39 ; s forehead . the computed measures were combined into a single measure of eeg signal per channel and transformed for gaussianity , and a statistical z transformation was performed to produce z - scores . the z - transform was used to describe the deviations from normal eeg values . the z - scores were calculated using a database of response signals from a large population of subjects believed to be normal . thus , the z - scores were used to calculate the probability that the extracted feature observed in a subject conformed to a normal value . in the exemplary data of fig6 a through 6c , a mean value of any feature for a “ more normal ” population would lie closer to the mean value for the normative population ( i . e . mean = 0 , standard deviation = 1 ) than the mean values of any feature in the “ less normal ” population . fig6 a through 6c depict eeg measurements from normal subjects , thus the z - scores would be expected to lie closer to 0 , with some normal variation . as the data shows , the mean z - score values for the fixed headset and the adjustable headset varied greatly , while the z - score values of the adjustable headset and the free electrodes more closely resembled each other and generally lie closer to a mean of 0 . while the sample sizes for the fixed and adjustable headset groups were smaller than the sample size used for the free electrode group ( which may explain why both of these groups displayed z - scores further from 0 ), the z - scores of the fixed headset group were noticeably different than the adjustable headset group across the exemplary set of features . fig6 a compares features from bipolar absolute power measurements recorded with fixed and adjustable headset designs and free electrodes . bipolar absolute power indicates the amount of energy being acquired by the electrodes . this property should be substantially consistent across the headset designs , as each headset should in theory be measuring similar brain electrical activity . fig6 a shows that the amount of energy detected by the fixed headset was substantially greater than that of free electrodes , which may imply that the fixed headset detected more than simply the eeg signal . such noise may have been caused , e . g ., by muscle activity due to placement of the electrodes near the eyebrows . fig6 b compares features from coherence measurements recorded across the various electrode placement techniques . coherence indicates the similarity of frequency content between the detected eeg signals . a more negative coherence value implies that the acquired eeg signal frequencies are less correlated , while a more positive value implies that detected signal frequencies detected are more correlated . once again , across each feature , free electrodes and the adjustable headset displayed substantially similar coherence values , and , on average , these coherence values were noticeably different from those of the fixed headset . the more negative coherence values acquired by the fixed headset indicate that the detected signals are less correlated than they should be , which may again indicate signal contamination . fig6 c compares features from phase synchrony measurements recorded with each electrode placement technique . phase synchrony is similar to coherence , but includes measurement of the phase relationship between the pair of electrodes recorded . thus , this feature analysis indicates that eeg recordings measured with the fixed headset were not only of a different frequency than expected , but also that these frequencies were not in phase . by contrast , recordings of the exemplary features taken with the free electrodes and the adjustable headset generally displayed more similar phase synchronies . as the inventors &# 39 ; data illustrates , the eeg readings detected using array 400 are substantially different from those of fixed headsets , which marked a surprising discovery . it was previously believed that electrodes 406 and 410 should be located a set distance from center electrode 408 . thus , previous , fixed - headset devices reflected the concern that placing electrodes 406 and 410 too close to center electrode 408 would cause electrical shunting , increasing the noise and decreasing the amplitude of any detected eeg signals . thus , previous headsets were designed to fix the distance between these electrodes , and the entire block of electrodes , as well as the grounding electrode , were applied in a predetermined , uniform position to a subject . only the block of electrodes could be repositioned slightly on the subject ; the electrodes could not be individually adjusted relative to each other . yet , this approach produced eeg readings that did not accurately allow for detection of normal versus abnormal brain activity , as discussed above . by contrast , as a result of much experimentation , the disclosed array shifts away from this fixed design and reflects the surprising discovery that achieving usable eeg readings involves a compromise between the proximity of electrodes 406 and 410 to electrode 408 and the proximity of electrodes 406 and 410 to the supraorbital foramen . electrodes placed in the eyebrows of a subject may induce unwanted physiological effects on recorded eeg data , such as undesirable noise . the human face contains a number of muscles to control the movement of the eyes and eyebrows . positioning electrodes 406 and 410 too close to the eyebrows may cause interference from the electrical activity of these muscles . by contrast , the forehead contains fewer muscles , and so positioning electrodes 406 and 410 away from the eyebrows by a set distance may result in clearer , more accurate , and more usable signals , as long as electrodes 406 and 410 are not placed too close to electrode 408 . after gathering much experimental data , it was discovered that there may be a calculable , average distance above a subject &# 39 ; s eyebrows that may correlate to an optimum electrode position for generating signals usable to determine normal versus abnormal brain activity . when collecting and analyzing data , the preferred international 10 / 20 system location was used to determine ‘ ideal ’ placement of the fp 1 and fp 2 electrodes ( electrodes 406 and 410 in array 400 ). the 10 / 20 electrode location is a subject - specific measurement that is determined based on the head size of each subject . accordingly , the ‘ ideal ’ 10 / 20 location varies from subject - to - subject and must be calculated on an individual basis . to determine the average ‘ ideal ’ electrode placement across a population , head measurements were recorded from a group of subjects and averaged to calculate where the 10 / 20 location of the fp 1 and fp 2 electrodes should be relative to the average position of eyebrows and the average head size of the subjects . fig7 graphically depicts the relationship between the calculated 10 / 20 location of the fp 1 and fp 2 electrodes based on the measured nasion - to - inion distance in 20 subjects and the distance of this location from the top of a subject &# 39 ; s eyebrows . as is demonstrated in fig7 , with the exception of a few outliers , the ideal electrode placement for fp 1 and fp 2 for most subjects tends to fall within an identifiable range , indicated in fig7 by dashed lines . this range corresponds to between approximately 12 millimeters and 24 millimeters above a subject &# 39 ; s eyebrow . array 400 may be configured to reflect the discovery that placing electrodes 406 and 410 a predetermined , consistent distance away from the subject &# 39 ; s eyebrows may achieve an optimum placement for electrodes 406 and 410 to generate reliable eeg readings that are usable for determining levels of abnormal versus normal electrical brain function . for example , in some exemplary embodiments , the predetermined distance from the eyebrows to the center of electrodes 406 and 410 may equal approximately 17 . 7 millimeters . as is demonstrated by the solid line in fig7 , for the average person , centering the fp 1 and fp 2 electrodes 17 . 7 millimeters above the eyebrow may achieve the average optimal electrode placement across a population of subjects . in some embodiments , the predetermined distance used may vary , and the electrodes may be positioned slightly closer to or slightly farther from the eyebrow . as is demonstrated by the dotted lines in fig7 , positioning the fp 1 and fp 2 electrodes between approximately 12 millimeters and 24 millimeters may achieve an optimum placement . in addition , the electrodes may be sized so that when the center of the electrodes are placed 17 . 7 millimeters above the eyebrows , the size of the electrode itself spans a portion or substantially all of this range . further , this range may change for given populations . for example , array 400 may be designed for youths and may position electrodes 406 and 410 closer to the eyebrows to reflect a smaller average head size . in some embodiments , array 400 may be designed for a population of professional athletes , e . g ., football , soccer , or hockey players , and the electrodes may be positioned farther from the eyebrows to reflect a larger average head size . accordingly , measurements from a specialized sub - population may be taken to create a specialized array 400 . in some embodiments , the predetermined average distance may also vary depending on the configuration of array 400 used , including , e . g ., the size of the electrodes or the configuration of substrate 401 . once the predetermined distance is calculated , the distance indication gauge of array 400 may be formed to achieve this predetermined distance . based on the size and location of the electrodes and the size and shape of substrate 401 depicted in the exemplary array 400 of fig3 through 5 , the length of tabs 422 may be approximately 5 millimeters in length in order to position electrodes 406 and 410 a predetermined distance of approximately 17 . 7 millimeters away from a subject &# 39 ; s eyebrows . one will appreciate that the length of tabs 422 may vary in order to achieve the predetermined distance depending on the placement of electrodes within array 400 , the size and shape of substrate 401 , or any other variations in configuration of array 400 and / or the calculated predetermined distance . for example , if substrate 401 extends further in a distal direction below electrodes 406 and 410 , then tabs 422 may be shortened to achieve the same predetermined distance from the bottom of tabs 422 to the center of the electrodes . as can be seen in fig3 - 5 , electrodes 410 and 406 are not directly laterally tethered to electrode 408 and grounded electrode 418 by array 400 , allowing the electrodes to be applied to a subject independently of one another . decoupling electrodes 406 , 410 , and 408 may also have the benefit of reducing muscle - induced interaction that may otherwise occur between the electrodes . yet , removing the fixed arrangement of electrodes once again decreases the likelihood that a lay person at the point - of - care would be able to effectively apply array 400 to the subject . thus , array 400 may be configured to dictate to the user what adjustments should be made and how to accomplish them . incorporating tabs 422 into array 400 allows an untrained person to rapidly and accurately place electrodes 406 and 410 onto a subject properly for signal acquisition . ready visual confirmation that tabs 422 do not rest at the top of the subject &# 39 ; s eyebrows once electrode 408 is in place can be quickly remedied by manual adjustment of the placement of electrodes 406 and 410 . as is shown in fig4 b , when array 400 is first placed on a subject , tabs 422 may extend beyond the top of the subject &# 39 ; s eyebrows once electrode 408 is set in place below the subject &# 39 ; s hair line . this suboptimal placement could compromise signal quality , and ultimately reliability of calculated results . fig4 c shows electrodes 406 and 410 adjusted so that the bottom of gauge tabs 422 are aligned in a prescribed way , which for the purposes of this example , is with the tip of the tabs 422 just above the eyebrow . of course , other indicia of alignment may be employed without limitation . as is shown in fig4 c , electrodes 406 and 410 may be connected to array 400 via connector regions 430 . connector regions 430 may be flexible and may allow electrodes 406 and 410 to be moved upwards towards electrode 408 so that connector regions 430 bow out , as is shown in fig4 c . in some embodiments , connector regions 430 may be retractable into the branching portions of array 400 , or may be otherwise folded or configured to allow at least vertical movement of electrodes 406 and 410 . thus , a user may adjust the relative spacing of electrodes on array 400 by moving electrodes 406 and 410 so that the bottom of tabs 422 rest above the subject &# 39 ; s eyebrows , as discussed above . incorporating distance indication gauges , such as tabs 422 , into array 400 may promote consistent headset orientation and application while achieving the adaptability required to obtain usable eeg readings , based on the recognition by the present inventors of the relationship between signal quality and the distance between the supraorbital foramen and electrodes 406 and 410 , and the further recognition that while relative electrode placement laterally can vary with facial morphology , this distance is substantially stable among subjects . while the exemplary embodiments depict distance indication gauges in the form of tabs 422 , any suitable distance indication gauge , indicia , device , or combinations thereof may be included in array 400 . for example , the portions of array 400 containing electrodes 406 and 410 could themselves be sized and shaped so that the distance between the bottom of the these portions and the electrodes reflects the ideal distance from the supraorbital foramen . in such embodiments , array 400 may not include tabs 422 , and instead , the portions of array 400 around electrodes 406 and 410 may simply extend down to where the bottom of tabs 422 is shown in fig3 - 5 . thus , rather than aligning tabs 422 , a user applying array 400 may simply adjust 406 and 410 so that the bottom of each rests directly above the eyebrow . in such embodiments , portions 406 and 410 containing the electrodes may be elongated , oval , rectangular , triangular , or any other suitable shape . in some embodiments , a distance indication gauge for array 400 may include one or more sensors configured to detect when ideal electrode placement has been achieved . for example , the area of array 400 around electrodes 406 and 410 may include sensors to detect whether the electrode is positioned too close to the muscles underlying the eyebrow region . such sensors may , e . g ., emit a wavelength of light and measure one or more properties of a reflected light wavelength to determine whether the electrode is located too close to muscles to avoid the introduction of unwanted noise into subsequently recorded signals . similar sensors may be included in other electrodes , e . g ., 404 and 412 , to indicate whether an electrode is being placed too close to an underlying artery , vein , or other anatomical structure . in some embodiments , electrodes 406 and 410 and base 42 may be configured so that if electrical brain activity outside of a given range is recorded , a user may be prompted to check the placement of these , or any other , electrodes . such distance indication gauges are purely exemplary , and array 400 may include any suitable type of distance indication gauge for any indicating preferable placement of any electrode , or any combination thereof . once electrodes 406 and 410 have been positioned on the subject , electrodes 404 and 412 may be attached to the outer forehead region . once array 400 is in place on the subject and each of the electrodes has been attached to the subject , array 400 may be operably coupled , either through a direct connection or wirelessly , to base 42 , and eeg readings may be commenced . for example , in the embodiment depicted in fig3 , array 400 may include a base interface region 450 configured to couple with a suitable connection device attached to base 42 . thus , a method of attaching array 400 to a subject may include positioning tab 420 at the nasion region of the subject to align electrodes 418 and 408 , then adjusting the location of electrode 408 so that electrode 408 sits on the forehead directly below the hairline , and attaching electrodes 408 and 418 to the forehead . the method may further include engaging ear loops 424 with the ears of the subject so that array 400 is positioned across the forehead , and attaching electrodes 402 and 414 to the ear lobes of the subject . in some embodiments , these first two steps may be performed in reverse order , and electrodes 402 and 414 may be attached at any point during application . next , electrodes 406 and 410 may be positioned by aligning tabs 422 directly above the eyebrows of the subject , so that the bottoms of tabs 422 do not touch the eyebrows of the subject . electrodes 406 and 410 may then be attached to the subject . electrodes 404 and 412 may then be attached to the forehead of the subject . the electrodes of array 400 may be attached to the subject in any suitable manner . the electrodes included in array 400 may be any suitable type of electrode , e . g ., wet gel or solid gel electrodes , or any combination thereof . the electrodes of array 400 may have backings or covers that may protect the electrode until being placed on the subject . a user may uncover the electrode prior to attaching the electrode to the subject . any suitable backings may be used , such as removable , tear - able , or peel - able backings with or without an adhesive . in some embodiments , electrodes with , e . g ., adhesive - free peel backings , may be used that allow for repositioning of the electrode on a subject . for example , a user applying headset 400 may accidently attach the electrode in the wrong place , such as accidently placing electrode 406 or 410 into , or at the wrong distance from , the eyebrow of a subject . this repositioning feature is desirable in urgent care or battlefield conditions , where placement of array 400 might take place in stressful or distracting situations . additionally , an electrode site revealed as having a high impedance value when recording eeg signals may require the electrode to be removed , the skin re - prepped , and the electrode re - attached . in such instances , the user may need to adjust the placement of the electrode on the subject . in such an embodiment , tabs 422 may aid in repositioning . for example , a user may lift tab 422 to pull the corresponding electrode off of the subject &# 39 ; s skin while allowing the user to avoid touching any adhesive , gel , or the electrode , so as to preserve usability of the electrode . in this manner , tabs 422 may serve a secondary function of aiding in the repositioning of electrodes on the subject , if necessary . this is another desirable feature in a battlefield or urgent - care setting , where the skin surface might be contaminated with dried blood , or the subject may exhibit individual features such as facial scarring , wrinkling , eczema , dermatitis , etc . further , tabs 422 may also enable a user to more easily remove the electrodes and array 400 from the subject after completion of the eeg testing . to this end , other electrodes , such as electrodes 404 and 412 , e . g ., may include one or more tabs to achieve these secondary functions of repositioning and removal of the electrodes . accordingly , array 400 may be configured to allow multi - axis , independent control over the placement of individual electrodes . to further aid with the multi - axis adjustability of array 400 , array 400 may also include visual indicia indicators on array 400 to instruct the user in proper alignment and use of array 400 . for example , as is shown in fig5 , array 400 may include graphical indicators , text , or other symbols to indicate the preferred placement of array 400 on a subject . for example , nasion point 420 and tabs 422 may include arrows 610 and 602 , or other suitable symbols , indicating where these components of array 400 may be positioned by the user . in some embodiments , portions of array 400 may include illustrations 606 pictorially demonstrating to a user where on the anatomy of a subject a given electrode may be placed . further , indicators 604 may be included and may mark the position of the underlying electrode , e . g ., the center or the edge of the electrode , to aid positioning . in the embodiment shown in fig5 , indicators 604 are used in combination with illustrations 606 to together demonstrate to a user where to place the underlying electrode on a subject . further , textual indicators may be included on array 400 . for example , in fig5 nasion point 420 includes instructions to align the nasion point first , and electrodes 406 , 410 may include text instructing a user to place tab 422 above the eyebrow . additionally , textual indicators may warn to avoid other anatomical features , e . g ., electrodes 404 , 412 , and 408 may warn a user to avoid placing the electrodes over an artery , muscles , or hair , for example . in some embodiments , one or more electrodes may include electrode labels to aid a user in distinguishing the electrodes from one another and for reference , e . g ., in a set of instructions . in some embodiments , text or graphics may be incorporated that convey to the user the order in which electrodes should be placed or may include instructions for performing eeg recordings . any suitable number , arrangement , or type of visual indicators may be included , including , e . g ., color coding or shading . in some embodiments , visual indicators may change , for example , to signal to a user that an electrode is or is not correctly in place . in some embodiments , e . g ., array 400 may include one or more lights that change color to indicate that a sensor is or is not correctly in place , e . g ., by performing a preliminary impedance check . further , any suitable non - visual indicators may be used , for example tactile ( e . g ., texture ) or auditory indicators . referring back to fig1 , the memory 52 of brain - state assessment device 10 may contain interactive instructions for placing and adjusting array 400 and operating the device , which may be displayed , e . g ., on the screen of user interface 46 or output from a speaker ( not shown ). instructions may include , e . g ., audio and / or visual instructions for operating the device , such as text or graphics displayed on the screen to illustrate instructions for placing and attaching array 400 and / or operating and using the device . these instructions may refer to one or more of the visual indications on array 400 , if such indications are included . the inclusion of interactive instructions with the device may also promote point - of - care deployment and use of apparatus 10 by persons other than medical professionals . in some embodiments , once array 400 has been applied to a subject and connected ( either physically or wirelessly ) to base unit 42 , base unit 42 may be configured to aid a user in determining whether suitable placement of array 400 has been achieved . for example , base unit 42 may run a preliminary impedance check to determine whether array 400 is ready to begin recording and testing or whether additional modifications to array 400 on the subject are necessary . in some embodiments , once array 400 is positioned on the subject and connected to base unit 42 , the user may employ user interface 46 to initiate a pre - test sequence , or a pre - test sequence may be initiated automatically . during a pre - test sequence , impedance may be automatically measured on each electrode channel , either simultaneously , individually , or in groups , by sending a small amplitude sinusoidal signal to the electrodes via grounded electrode 418 . the resulting current , which is proportional to impedance , may then be measured for each electrode . base unit 42 may then output data regarding the status of each electrode to the user . for example , a display in base 42 may indicate the current and / or impedance value measured for each electrode and may indicate whether the measured value falls within an normal range for that electrode . this may be accomplished using visual output ( e . g ., text or graphics ), auditory output , or a combination thereof . for example , a display in user interface 46 may depict a diagram of each electrode on the subject and the corresponding measured impedance value for each . the expected impedance range and / or whether an electrode falls in the expected range may also be depicted . these values may either be depicted using text or graphics or a combination . in some embodiments , the electrodes may be color - coded according to the measured impedance of each to indicate whether the recorded value is within an optimal range or not . for example , green may indicate that an electrode has a normal impedance value , yellow may indicate an acceptable impedance value , and orange may indicate an unacceptable impedance value . a normal impedance value may be identified as between approximately 0 . 5 and 5 . 0 kω , an acceptable impedance value may be between approximately 5 . 0 and 10 . 0 kω , and an unacceptable impedance value may be greater than approximately 10 . 0 kω . based on this information , a user may adjust one or more electrodes before initiating testing . tabs 422 may assist with the adjustment of one or more electrodes , as discussed above . adjusting may include lifting the problem electrode , re - prepping the underlying area on a subject , and re - attaching the electrode . once the electrodes are adjusted , this pre - check sequence may be performed again . once normal and / or acceptable values are achieved for each electrode in array 400 , testing may begin either automatically or via user input . in some embodiments , apparatus 10 may not allow testing to begin until base 42 detects that all of the electrodes have impedance values falling within a predetermined range . in some exemplary embodiments , array 400 may be applied to a subject , base 42 may be powered on , and a user may indicate that a new test will be performed . at this step , patient information ( such as date of birth , name , patient id number , sex , age , physiological parameters , etc .) or array 400 information ( such as model number , lot number , calibration information , etc .) may be entered using user interface 46 . at this point , an impedance pre - check screen may be selected or may automatically appear , and an impedance check as described above may be initiated . in some embodiments , placement of array 400 on a subject and connection of array 400 to base 42 may initiate other communications between array 400 and base 42 , instead of , or in addition to , an impedance check . for example , connecting array 400 may prompt base 42 to power on or may cause base 42 to receive and / or relay information about array 400 , e . g ., its expiration date , model number , lot number , calibration information , the number of times array 400 has been used , or any other suitable information or combination of information . such information may promote proper use of and / or accurate readings from system 10 . array 400 may be disposable or reusable . in some embodiments , the electrodes of array 400 may be mounted on a low - cost , disposable platform . array 400 may be formed of any suitable flexible or rigid materials , including , e . g ., plastic , foam , rubber , silicone , or any combination thereof . in some embodiments , array 400 may be formed of multiple layers , for example , portions of array 400 may include reinforcement layers to provide structural stability , dielectric layers , or adhesive layers for maintaining array 400 on a subject . for example , ear loops 424 may include an additional layer of foam or padding for stability or to increase subject comfort . ear loops 424 may also include a malleable , internal layer or wire to allow an operator to bend the ear loops around a subject &# 39 ; s ears , providing improved anchoring of array 400 on a wider range of head shapes and sizes . further , any circuitry on array 400 may be covered by a dielectric layer to help insulate or protect the circuitry , which may be formed of , e . g ., polyamide , polyester , aramid , or any dielectric or combination thereof . such layers may extend across the entire array 400 or may extend across only a portion of array 400 . in multi - layer embodiments , the layers of array 400 may be attached in any suitable manner , e . g ., bonding , adhesives , mechanical fasteners , or any combination thereof . in some embodiments , array 400 may be configured to adjust to any number of subject head sizes or geometries . for example , array 400 may include adjustable bands , straps or loops , or may stretch or include any suitable mechanism for conforming to a range of subject head sizes and anatomical variations . in some embodiments , array 400 may include one or more expansible regions , for example , outward - bowing humps or accordion - shaped articulation ridges , capable of flattening to expand or contracting to adjust to a subject &# 39 ; s head shape and / or size . such regions may include flexures , elastics , corrugations , serpentine geometries , or any other suitable construction to allow variation in overall size , e . g ., height or length , of array 400 . for example , securing ear loops 424 to the ears of a subject and positioning array 400 across the forehead may cause any expansible regions to stretch or contract to accommodate the head geometry and size of the subject . additionally , by permitting independent placement of the electrodes , array 400 may further be able to accommodate an increased range of subject sizes and anatomies . further , array 400 may also come in different sizes , e . g ., for youths or adults . in some embodiments , array 400 may be configured for easy and / or rapid placement on a subject . surprisingly , when testing prior headset designs , it was discovered that the bulk and design of the array itself may also affect eeg readings , beyond just determining or influencing the spacing and arrangement of electrodes . for example , when free electrodes were applied to a subject and then the space between the electrodes on the subject &# 39 ; s skin was filled in and covered with an inert material ( e . g ., tape , paper , or foam ), the eeg readings received from the headset in some instances were less useful for discriminating between levels of normal and abnormal brain activity for diagnosing disease or injury and more closely resembled the readings from the fixed headset designs . without being bound by theory , the present inventors speculate that this phenomenon may be because the placement of more material into contact with a subject &# 39 ; s forehead may induce electrical activity , for example , by muscular twitching or by the activation of sensory neurons responsive to touch . this electrical activity in turn may introduce noise into the eeg signals . accordingly , some embodiments of the present disclosure may include arrays 400 that are configured to reduce the amount of material in contact with the subject , as well as to allow for adjustability of electrodes . for example , portions of array 400 may be streamlined or have geometries configured to decrease contact between array 400 and the subject . for example , portions of array 400 that are configured to flex or extend to fit various head sizes or to allow for adjustment of individual electrodes may be configured to bow away from the subject when flexed , so as to decrease contact between the subject and the headset . decreased contact and / or streamlined configurations may have the added benefit of allowing a user placing array 400 on a subject to see more of the subject &# 39 ; s forehead when placing array 400 on the subject and when adjusting and attaching electrodes 406 and 410 , which may promote quick application of array 400 . thus , different embodiments of the disclosure may be configured to offer different degrees of contact between array 400 and the subject and may have different widths , for example , of the branching portions of array 400 or connector regions 430 . referring back to fig1 , the electrodes in array 400 may be configured to measure the electrical fields that are produced as a result of a subject &# 39 ; s electrical brain activity . the activity may be spontaneous , evoked or a combination thereof . in some embodiments , spontaneous brain activity may be measured while a subject is at rest or while the subject &# 39 ; s eyes are closed , to reduce the number of stimuli the subject is exposed to during the testing ( i . e ., remove visual stimuli ). in some embodiments , both spontaneous and evoked responses may be measured . the evoked response may be obtained by stimulating the subject using visual , physical , aural or other suitable stimulation . in such an embodiment , one or more stimuli may be delivered to the subject via a stimulus delivery device 31 , which may be separate from or incorporated into array 400 . stimuli generator 54 in base 42 may relay a signal to stimulus delivery device 31 , initiating the delivery of one or more stimuli to a subject to obtain an auditory evoked response ( aep ). in some embodiments , array 400 may also include sensors in addition to the electrodes discussed above , for example , to measure the heart rate , temperature , blood pressure , or other suitable physiological parameters of the patient to relay to base 42 . such additional information may be monitored , either continuously or intermittently , and / or used in addition to the eeg readings to assess brain function and subject condition . functional brain state assessment may be made by recording and analyzing electrical brain activity of subjects with suspected neurological injury . a handheld , easy - to - administer brain wave assessment device may facilitate neurological evaluation of subjects at the point - of - care , which in turn may allow rapid and accurate initiation of therapy . once array 400 is applied to a subject , a subject &# 39 ; s brain electrical impulses detected by the electrodes may be transmitted to base unit 42 and / or an external processor 48 for signal analysis and data processing . additionally , these components may perform other steps , including signal amplification , artifact rejection , signal extraction , and classification of signal features . base 42 and / or external devices may process eeg data using any combination of signal processing methods , algorithms , and statistical analysis to extract and / or organize signal features , including , e . g ., fast fourier transform ( fft ) analysis , wavelet analysis , linear discriminant analysis , spectral analysis , microstate analysis , fractal mathematics , nonlinear signal processing , and diffusion geometric analysis , to analyze and classify electrical brain activity . advanced signal processing algorithms may be used in conjunction with a database of pre - recorded brain activity received from thousands of subjects having different neurological indications to assess the neurological function of a subject , e . g ., whether it falls within normal or abnormal ranges , or varying degrees thereof . the dysfunctions detected may include , for example , seizure , ischemic stroke , elevated intracranial pressure , hematoma , concussion / contusion / tbi , dementia , and depression . the results of such analysis may be displayed to a user on user interface 46 or communicated to a user in any suitable manner , or transmitted to or recorded by any suitable end point , e . g ., a memory , printer , or emergency response team . exemplary systems for point - of - care neuro - assessment are disclosed in commonly assigned u . s . publication nos . 2011 / 0144520 and 2012 / 0065536 and u . s . pat . nos . 8 , 364 , 254 ; 7 , 904 , 144 ; 7 , 720 , 530 , which are each incorporated herein by reference in their entirety . accordingly , the disclosed electrode array may be used in conjunction with a portable handheld device for rapid , point - of - care , neurological evaluation to determine an appropriate course of treatment at an early stage of injury , or other brain disorder requiring medical attention . other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the disclosure herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims .

US-201615014342-A

this comprises a mechanical system and a pneumatic system that are interconnected to perform three phases . in the first one a walking mechanism is activated consisting of an oscillating plate connected to the doll &# 39 ; s legs . the second phase takes place when the doll is supplied with air and water through the mouth , connected by tubes to a pneumatic accumulator and an output valve capable of being manually placed in an opened or closed position . during this phase , the doll repeatedly moves its hand towards its crotch , while it changes from walking to a restless movement , accomplished thanks to the alternating axial movement from a moveable toothed crown and to the dissipation of energy in an arm clutch . the third phase consists in the ejection through the output valve of a squirt of pressurized water , previously stored in the pneumatic accumulator .

as can be seen in fig1 and 9 the doll object of the invention has in its interior a mechanical system ( 1 ), an electronic system ( 2 ) and a pneumatic system ( 3 ). the mechanical system consists of an electric motor ( 4 ) that transmits the movement from its drive pulley ( 5 ) by means of a belt ( 6 ) to a receptor pulley ( 7 ) connected to a shaft that has on one side a receptor pulley gear ( 8 ). on the receptor pulley gear ( 8 ) fits an alternating shaft crown ( 10 ) on the alternating shaft ( 11 ) of which can freely turn two toothed crowns ( 12 ) ( 13 ), whose number of teeth differ by one unit and that , having two opposing circular cams ( 14 ) ( 15 ) on its facing sides , they receive their movement from a long drive gear ( 16 ) connected to a drive gear crown ( 17 ) that fits into a an alternating shaft gear ( 18 ), that is likewise connected to the alternating shaft ( 11 ). in this way the moveable crown ( 12 ) and the fixed crown ( 13 ) freely turn on the alternating shaft ( 11 ) at slightly different speeds driven by the drive gear ( 16 ) in such a way that the moveable crown ( 12 ) is submitted to a large alternating period along the alternating shaft ( 11 ) itself , on which it freely turns depending on whether the opposing circular cams ( 14 ) ( 15 ) are facing each other or not . this axial movement on the alternating shaft ( 11 ) is accomplished against the action of an alternating shaft spring ( 19 ), that tends to bring both crowns ( 12 ) ( 13 ) nearer . the movable crown ( 12 ) moves between two plans perpendicular to the alternating shaft ( 11 ), one of which coincides with that defined by a pneumatic clutch drive crown ( 20 ) connected to a pneumatic clutch drive gear ( 21 ) into which a pneumatic clutch receptor crown ( 22 ) fits at 90 ° when it is pushed by a pneumatic clutch sector ( 23 ), and that activated by a pneumatic accumulator ( 24 ) is articulated on a sector shaft ( 25 ) that has a fixed cube ( 26 ). a pneumatic clutch spring ( 27 ) that is supported on a pneumatic clutch output gear ( 28 ) and on the fixed cube ( 26 ) pushes both the pneumatic clutch receptor crown ( 22 ) and the pneumatic clutch output gear ( 28 ) upwards , maintaining the first item separated from the pneumatic clutch drive gear ( 21 ). the mechanical system is completed with an arm clutch ( 29 ) ( see fig1 and 3 ) consisting of an arm receptor crown ( 30 ) connected to an arm shaft ( 31 ) fitted permanently with the pneumatic clutch output gear ( 28 ). an arm coupling part ( 32 ) on which is mounted a flexible arm ( 33 ) can freely turn on the arm shaft ( 31 ) overcoming the produced friction against a friction washer that separates it from an interior bushing connected to the arm shaft ( 31 ). a second exterior bushing is mounted by pressure on the arm shaft ( 31 ) controlling the distance between both bushings ( 35 ) ( 36 ) in such a way that the arm coupling ( 32 ) and the friction washer ( 34 ) are locked between them . thus , when the arm shaft ( 31 ) receives the movement from the arm receptor crown ( 30 ) and the pneumatic clutch output gear ( 28 ) draws the arm coupling ( 32 ) by friction until the coupling lever ( 38 ) connected to it hits against a butt end ( 39 ′) fixed to a coupling receptor part ( 39 ) on the doll &# 39 ; s torso . the conventional electronic system ( 2 ) consists of a basic electronic circuit ( 40 ) with an output speaker ( 41 ), which is all fed , as well as the electric motor ( 4 ) by means of a set of batteries ( 42 ) ( see fig9 ). the pneumatic system ( 3 ) starts at the doll &# 39 ; s mouth ( 43 ) which is united by tubes ( 44 ) to an accumulator ( 24 ) and an outlet valve ( 45 ). this is made up of a fixed interior conduct ( 46 ) with a central spherical area ( 47 ) on which an exterior body ( 48 ) can turn , also having a moveable interior conduct ( 49 ) that can be facing the fixed interior conduct ( 46 ) or not . on the moveable interior conduct ( 49 ) an elastic cylindrical body ( 50 ) is mounted , simulating an infant &# 39 ; s penis . the pneumatic accumulator ( 24 ) consists of an elastic bellows ( 51 ) capable of expanding against the action of an accumulator spring ( 52 ), located between a bellows cover ( 53 ) and the accumulator cover ( 54 ) that closes an accumulator box ( 55 ). the bellows cover ( 53 ) prolongs to a bellows cover rod ( 56 ) that , sliding through the accumulator cover ( 54 ) articulately connects to a prolongation ( 57 ) on the pneumatic clutch sector ( 23 ). notice that in fig1 the sector prolongation ( 57 ) is represented cut off , in its two extreme positions , on the left , united to the rod ( 56 ) it is in the high position while on the right of the figure it is in a low position . in a first phase , when a main switch ( 58 ) is closed the electric motor ( 4 ) is activated , which by means of the drive pulley ( 5 ), the transmission belt ( 6 ), the receptor pulley ( 7 ), the receptor pulley gear ( 8 ), the alternating shaft crown ( 10 ), the alternating shaft gear ( 18 ) and the drive gear ( 16 ), causes the turning of the moveable crown ( 12 ) and the fixed crown ( 13 ), with a slight difference of speeds due to the fact that the number of teeth differ by one unit . in this way , the moveable crown &# 39 ; s circular cam ( 14 ) and the fixed crown &# 39 ; s circular cam ( 15 ) change their relative position , causing an alternative movement of the moveable crown ( 12 ) between a fitted position with the pneumatic clutch receptor crown ( 20 ) and another disengaged parallel position . in any case , the pneumatic clutch output gear ( 28 ) does not move since the pneumatic clutch receptor crown ( 22 ) is separated from the pneumatic clutch drive gear ( 21 ) as it is submitted to an upwards stress caused by the action of the pneumatic clutch spring ( 27 ) on the pneumatic clutch output gear ( 28 ) itself . during this first phase the doll does not emit any sound while it walks , driven by the conventional walking mechanism ( 59 ) moved by a walking mechanism gear ( 9 ) connected to a receptor pulley ( 7 ). the second operating phase takes place when water and air are supplied to the doll through the mouth ( 43 ) using a special flexible baby - bottle ( 61 ). this baby - bottle is designed to inject into the pneumatic accumulator ( 24 ) a minimum and absolutely controlled amount of water , which is achieved by installing on its base a non - return valve ( 62 ), consisting of two cylindrical bodies ( 63 ) ( 64 ) that define an interior cavity ( 65 ) in which an elastic disc ( 66 ) slides . this closes the valve when it rests on the origin assembly ( 63 ), while it lets water and air pass through when it rests on the destination assembly ( 64 ) since it does so on various projections that are inside it . thus , the suction capacity of the baby - bottle ( 61 ) can be quite limited when its elastic walls are repeatedly pressed and released , which will assure that , after this operation , there will always be in the baby - bottle a very small amount of water . in this way the elastic bellows ( 51 ) expands when it fills with air , with a small amount of water remaining at the bottom of it and in the pneumatic tubes ( 44 ). the system does not lose pressure due to the existence of a non - return valve ( 68 ) located on the pneumatic tube ( 44 ) near to the doll &# 39 ; s mouth ( 43 ) and also because the outlet valve ( 45 ) remains closed . consequently , the bellows cover rod ( 56 ) moves upwards making the sector ( 23 ) turn and it applies the pneumatic clutch receptor crown ( 22 ) against the pneumatic clutch drive gear ( 21 ), fitting both together . this allows the pneumatic clutch output gear ( 28 ) to turn when the moveable toothed crown ( 12 ) fits with the pneumatic clutch drive crown ( 20 ) in its alternating movement on the alternating shaft ( 11 ) itself transmitting a turning movement to the arm coupling ( 32 ), through the arm receptor crown ( 30 ), the arm shaft ( 31 ) and the friction washer ( 34 ), the turning of which will not stop until the coupling lever ( 38 ) hits against the butt end ( 39 ′) when the movement of the friction washer ( 34 ) will be produced and the arm spring ( 37 ) will have reached its maximum extended position . when the moveable crown ( 12 ) disengages from the pneumatic clutch drive crown ( 20 ) in the alternating movement of the former , the entire mechanical system from the latter up to the arm coupling ( 32 ) is freed , so the arm spring ( 37 ) will make the arm coupling ( 32 ) turn until it reaches its initial position . consequently , the effect is that the doll repeatedly moves its hand to its crotch . since in this position of the arm the arm clutch ( 29 ) is moving , the consumption of the electric motor ( 4 ) increases considerably , thus lowering the speed of the walking device ( 59 ) that can no longer make the doll walk , only transmitting an oscillating movement that simulates restlessness . during this second phase and while the doll moves its hand to its crotch , it emits a sound such as “ mommy , pee . . . pee ,” or something similar . the third phase takes place when once the user has taken the doll &# 39 ; s clothes off , lifts the elastic cylindrical body ( 50 ) from the position represented in fig4 to the position represented in fig5 making the outlet valve ( 45 ) go from a closed position to an opened one and the retained water in the interior of the pneumatic tubes ( 44 ) is expelled to the exterior with force under the action of the overpressure created in the elastic bellows ( 51 ) by the accumulator spring ( 52 ) simulating that the doll is urinating . it is of interest to point out that this third phase can be accomplished with the doll moving or static , whether the main switch ( 58 ) is kept connected or not . during this third phase , the doll emits the sound of passing water “ drip . . . drip . . . drip .” when the arm shaft ( 31 ) turns , a stub ( 70 ) eccentrically mounted on the arm coupling ( 32 ) also does so , transmitting a translation movement to an arm connecting rod ( 71 ) that articulates on it and that also ends eccentrically articulated on a prolongation ( 72 ) of the forearm ( 73 ) that can turn around an elbow pivot ( 74 ) on the arm ( 33 ). see fig3 . the walking mechanism ( 59 ) is already known from the application of the prior utility model u9002535 from the same applicant , so a very superficial description of its operation will be done . the walking mechanism gear ( 9 ) is connected to a primary crown ( 75 ), fitted into a secondary crown ( 75 ′), likewise connected to an eccentric ( 76 ) encased between the “ u ” branches of a flat plate ( 77 ), itself oscillating on a fixed shaft ( 78 ). the movement of the walking mechanism gear ( 9 ) is produced continuously , for which we will also continuously have an oscillating movement of the flat plate ( 77 ), that will be accomplished at two different speeds , depending on whether the arm clutch ( 29 ) is moving or not . this flat plate ( 77 ) has two side windows ( 79 ) designed to receive the radial prolongations ( 80 ) of each leg shafts ( 81 ) finishing in a ball joint ( 82 ) on which the legs ( 69 ) themselves are mounted . with the objective to simplify , to the degree possible , the description of a preferred embodiment and maintain relatively controlled the number of references to the figures , only those elements have been described that are essential to characterize the invention , omitting the electrical schematic or the synchronizing between the electrical and pneumatic systems . which will be performed preferably by means of magnets connected to the moving elements and fixed reed relays , such as is usual and will be perfectly known , to any expert on the matter .

US-75541001-A

a method for collecting micro samples of arterial or venous blood from patients and for transporting and delivering such samples to suitable blood analysis equipment such as a conventional blood gas analyzer . an essential component of the device is a tubular elastomeric adapter - handle having integral body and tip sections , the body section having a tapered bore for receiving and holding the end portion of a heparinized glass microcapillary tube and the tip being both internally and externally tapered to permit releasable attachment of the tip to the hub of a hypodermic needle and , after a sample has been collected , to the inlet of a blood analyzer .

referring to the drawings , the numeral 10 generally designates a device comprising an adapter - handle 11 , a needle assembly 12 , and a microcapillary tube 13 . such components may be supplied to the user in assembled form as shown , or they may be supplied as separate parts to be assembled by the user . in either case , a suitable cover 14 should be attached to the needle 12 to maintain sterility of the needle until use . an end cap 15 may be fitted upon the distal end of the capillary tube , and the entire assembly may be supplied in sterile condition within a suitable wrapper ( not shown ). the needle assembly 12 , shown most clearly in fig2 is conventional in construction and includes a hollow needle 16 secured to a cup - shaped hub 17 . in the illustration given , hub 17 is formed of rigid plastic such as , for example , polystyrene , although it is to be understood that other materials such as metals might be used . the open end of the hub provides the entrance to a tapered cavity 18 dimensioned to receive and frictionally engage the tip of adapter 11 . the inward taper of the cavity 18 is commonly referred to as a standard luer taper , meaning that the hub will mate tightly with a tapered syringe tip identified by the name of its originator . such taper is described in federal specification gg - n - 196 and corresponds to an angle approximately 1 ° 43 &# 39 ; 6 &# 34 ; measured from the axis of the needle assembly 12 ( or an included angle of about 3 ° 26 &# 39 ; 12 &# 34 ;). in a preferred embodiment , the metal needle 16 should be of relatively small gauge ( no . 25 or less ) and the opening at the mouth of the cavity should be approximately 0 . 165 of an inch in diameter . the tubular needle cover 14 is entirely conventional and serves simply to protect the pointed hollow needle 16 as well as objects which the needle might otherwise contact , and to help maintain sterility of the needle . the cover may be formed of any of a variety of rigid or semi - rigid polymers such as , for example , polypropylene or other polyolefins . the microcapillary tube is also conventional , being formed of glass and usually being of a standard length of 100 millimeters . such a tube has a through - bore which is precisely dimensioned to contain a sample of predetermined volume , ordinarily either 100 or 200 microliters ( μl ). color coded bands 19 and 20 indicate to the user both the capacity of the tube and the fact that its interior surfaces have been heparinized to prevent coagulation of a blood sample drawn into the tube . end cap 15 is preferably formed of ethyl vinyl acetate , silicone rubber , or some other suitable resilient plastic material and defines a tapered cavity for snugly and sealingly receiving the end of glass capillary tube 13 . while only a single end cap is needed in certain uses of the blood collection device , a second identical end cap may be supplied to the user where temporary sealing of the opposite end of the capillary tube is also deemed necessary or desirable . the adapter - handle 11 is also formed from a relatively soft resilient elastomer such as ethyl vinyl acetate or silicone rubber and is composed of integral body and tip sections 11a and 11b , respectively . a bore 21 extends through the adapter with that portion 21a of the bore within body section 11a tapering gradually inwardly for receiving and frictionally retaining one end of microcapillary tube 13 . the gradual taper of bore portion 21a and the resiliency of the material from which the adapter is formed not only insure that a tight frictional seal will be formed between the end of the capillary tube and the adapter but also permits the adapter to form such engagement with standard capillary tubes of different diameters and capacities . it will be noted from the enlarged view of fig3 that slight deformation of the wall of the adapter takes place when the end of a capillary tube is formed into the tapered bore portion 21a , such deformation assisting in the frictional retention of the capillary tube without danger of chipping or fracturing that tube . in addition , retention of a capillary tube by the adapter is enhanced by the squeezing force normally applied ( in the direction of arrows 22 in fig2 ) when the resilient adapter is gripped between the fingers and used as a handle . the angle of taper x ( fig3 ) measured from the longitudinal axis of the adapter should fall within 2 ° to 6 ° and should encompass a range of diameters of at least 0 . 08 to 0 . 10 of an inch . in a preferred embodiment , an angle of taper of 4 ° and a size range of approximately 0 . 070 to 0 . 110 of an inch have been found effective for coupling the adapter to standard microcapillary tubes . in some cases it may be desirable to draw a larger sample of arterial or venous blood and for that purpose the tapered bore of the body section 11a may be stepped outwardly to provide an enlarged entrance portion 21b . bore portion 21b has a luer taper similar to that of hub cavity 18 and , consequently , is adapted to mate with the luer tip of a standard syringe . like the cavity 18 of the needle hub , bore portion 21b should have a maximum diameter at its mouth of approximately 0 . 165 of an inch . the tip section 11b of the adapter is reduced in outside dimensions and has a standard male luer taper allowing the distal portion of the tip to be received tightly within the cavity 18 of the needle hub . the angle of taper of the tip &# 39 ; s outer surface should match closely the angle of inside taper of the hub with the maximum outside diameter of the tip at point 23 exceeding the inside diameter at the mouth of cavity 18 . a differential of at least 0 . 003 of an inch should be provided ( 0 . 005 preferred ) to insure a snug fluid - tight friction fit between the parts . beyond the luer tapered outer surface , between point 23 and the generally cylindrical outer surface of body section 11a , the tip is provided with a flared or frusto - conical outer surface 24 . the angle of that frusto - conical surface , measured from the axis of the adapter , should fall within the general range of 10 ° to 30 °, an angle of approximately 20 ° being found particularly effective . as described hereinafter , the frusto - conical surface is not merely a transitional surface between the luer taper of the tip and the cylindrical surface of the body ; it provides an inclined stop for limiting the extent of insertion of the adapter into the inlet port of a blood analyzer , and for sealingly engaging that port when delivery of a sample to such an analyzer takes place . it will be noted that the internal and external longitudinal surfaces of the tip section 11b are reversely tapered ; that is , in addition to having a luer taper along its outer surface the tip has a reversely - tapered bore portion 21c which gradually and progressively increases in size towards the free end of the tip section . the angle of taper y ( fig2 ) should fall generally within the range of 1 ° to 3 ° measured from the longitudinal axis of the adapter , the preferred angle of taper being approximately 2 °. at its mouth the bore portion 21c should have a diameter of at least 0 . 08 of an inch , a preferred dimension being about 0 . 09 of an inch . as shown , bore portion 21c tapers smoothly and gradually inwardly to merge with bore portion 21a of body section 11a . for use , the device 10 may be supplied in assembled condition as shown in fig1 . alternatively , the device may be supplied in disassembled condition , requiring interfitting of the major components by the user . assuming that the device is in the assembled condition of fig1 the user removes end cap 15 , detaches the protective needle cover 14 , and , holding the device by means of the resilient adapter - handle 11 , inserts the sterile needle 16 into the blood vessel from which the sample is to be taken . for blood gas analysis arterial blood is preferred . such blood may be obtained by inserting the fine - gauge needle 16 into an artery such as the brachial , radial , femoral , or jugular arteries . fig4 depicts the sampling step , the outline of the patient &# 39 ; s body being generally represented by line 25 and the transparent collection tube shown to be filled with blood taken from the patient . entry of the needle into an artery is confirmed by the pulsatile filling of the bore of the glass capillary tube , such filling action generally being completed within three seconds and occuring by reason of arterial ( or venous ) pressure . the user then withdraws the needle and immediately caps the remote end of the capillary tube with cap 15 ( fig5 ). still holding the device by means of the adapter - handle , the user detaches ( and discards ) the needle assembly 12 . if the blood analyzing equipment is close at hand , the adapter is then simply coupled to the inlet connector of the analyzer to allow the collected blood sample to be drawn into the analyzer where it is tested ( fig6 and 6a ). after taking a sample , and before introducing that sample into an analyzer , a user should make sure that the sample is thoroughly mixed with the heparin salt coating the inside surfaces of the capillary tube . a suitable magnetic stirrer , commonly referred to as a &# 34 ; flea &# 34 ;, may be inserted into the bore of the tube and reciprocated therein by means of an external magnet . particularly effective results may be achieved where end cap 15 is formed and used as set forth in my copending u . s . pat . application ser . no . 10 , 234 , filed feb . 8 , 1979 , the disclosure of which is incorporated by reference herein , so that upon completion of the mixing step the flea may be captured and removed by means of the cap , thereby preventing the possibility that such a flea might be left within the capillary tube and be drawn accidentally into the blood analyzer . in fig6 the numeral 26 generally designates that type of commercially - available blood analyzer having an inlet port 27 , the mouth of which is engagable with the tip section of the adapter 11 to provide a temporary seal as the blood sample is aspirated from the capillary tube into the machine . the frusto - conical outer surface 24 of the adapter is particularly effective in forming such a seal with the mouth of the instrument and for limiting the extent of insertion of the resilient adapter into the inlet . fig6 a schematically depicts a different type of blood analyzer 26 &# 39 ; in which the inlet takes the form of a protruding nipple or tube 28 having an outside diameter of approximately 0 . 08 of an inch . in delivering a blood sample to such an analyzer , the user , holding the device by its resilient adapter 11 , simply fits the internally tapered tip section 11b on to the inlet tube 28 and allows the blood sample to be drawn into the machine . in those cases where the blood analyzer is remote from the collection site , adapter - handle 11 may be removed from the filled capillary tube 13 and replaced by a second end cap 15 ( fig5 a ). with both ends of the capillary tube so capped , the collected sample may be mixed , transported , and temporarily stored under refrigeration . upon arrival at the blood analyzer , one of the end caps is removed and replaced by a fresh adapter 11 . the procedure represented in fig6 or 6a is then performed with the distal end cap 15 removed from the capillary tube to permit aspiration of the blood sample into the analyzer . it is believed evident from the foregoing that the adapter 11 is constructed to perform a multiplicity of functions . in addition to its coupling functions the adapter serves as a resilient handle . in the operations depicted in fig4 , 6 , and 6a , the user grips the sampling device by holding the resilient adapter between his fingers . as already described , the squeezing forces tend to assist in maintaining the capillary tube and adapter in interconnected relation . in addition , the danger of breakage of the fragile capillary tube , and the risks of possible contamination of the user , are reduced . for example , should a patient move suddenly during arterial or venous puncture , the resilient handle provides limited articulation between the rigid glass tube 13 and the needle assembly 12 , thereby reducing the chances of breakage of either rigid part , and , should such breakage happen to occur , the handle serves as a protective sheath between the fractured tube and the user &# 39 ; s fingers to prevent injury and possible contamination . while in the foregoing i have disclosed an embodiment of this invention in considerable detail for purposes of illustration it will be understood by those skilled in the art that many of these details may be varied without departing from the spirit and scope of the invention .

US-7170279-A

a dental mirror tool having a body comprises a manifold disposed on the tool body proximate the mirror , a plurality of output ports disposed in an outlet side of the manifold and disposed to emit streams of light and fluid and air or suction toward a predetermined target , and a selection system for selecting the light , fluid , or air or suction emitted toward the predetermined target . in another aspect , a method for directing streams of light , fluid , air , or suction toward a target during a dental procedure , comprising the steps of attaching a manifold having output orifices for light , fluids , air , or suction to a body of the tool ; connecting the orifices to sources of light , fluid , air , or suction ; and controlling a substance emitted from the orifices to be directed toward the target .

in the following description , reference numbers identifying the same structures are repeated in the successive drawings . the drawings illustrate one complete , preferred embodiment that utilizes the principles and concepts of the present invention set forth in the appended claims . fig1 illustrates a first perspective or isometric view of one embodiment of a multi - function dental tool 10 according to the present invention . the dental tool 10 includes a main body 12 , a removable head piece 14 , a mirror 16 , and a supply line 18 having internal tubes connected to sources of fluid such as water , and air or vacuum . an air supply line may be connected to an air compressor ( not shown ) or a vacuum pump ( not shown ). the fluid supply line may typically be connected to a water supply such as a storage tank or mains system ( not shown ). the main body 12 of the dental tool 10 preferably includes an outer sleeve 20 . a main body cap 22 is disposed at a rearward end of the main body 12 , which encloses a connection interface and may also function as a strain relief for the supply line 18 . a retaining collar 24 is disposed at a forward end of the main body 12 , which secures the removable head piece 14 to the main body 12 as will be described . the removable head piece 14 includes a fluid / light manifold 26 attached to and integrated with the head piece 14 . the fluid / light manifold 26 provides a termination structure for the passages conducting fluid ( e . g ., water ), air ( either under pressure or a vacuum ), and light to the outlet end of the dental tool 10 that provides the primary functionality of the tool . this manifold 26 includes the necessary orifices to provide outlets for fluids such as water and air , and a light beam output . for example , a first fluid / air orifice 28 may provide an outlet for a stream of air or water aimed toward a tooth of interest . a second fluid orifice 30 may provide an outlet for another stream of air or water aimed at the surface of the mirror for cleaning the mirror surface . it should be appreciated that , while water is contemplated for use in the dental tool 10 as described herein , fluids other than water may be used in certain treatment operations . a third light output orifice 32 may provide an outlet for a beam of light aimed at the surface of the mirror 16 to provide for illuminating a tooth or other structure of interest within a patient &# 39 ; s mouth . the angles of the fluid , air and light outputs may be configured to suit particular applications for directing these materials or beams toward targets of interest . a mirror 16 may be supported by an angled mirror holder 50 of the removable head piece 14 . the mirror , as depicted in fig6 a is preferably supported at an angle θ of approximately 30 degrees with the longitudinal axis c l of the main body 12 of the dental tool 10 . this angle permits a dentist , hygienist , or assistant to enable viewing a patient &# 39 ; s upper teeth without undue discomfort . however , other angles may be used , for example within a range of 10 to 60 degrees . in some embodiments of the dental tool 10 this angle may be adjustable . the angle o is shown in fig6 a . a principle concept of the present invention — to provide multiple functions useful to a dentist or other dental care worker in a single implement — is made possible by the fluid / light manifold 26 component that is attached to or made integral with the body of a dental mirror tool proximate or nearby the mirror . this configuration enables embodiments that can direct streams of fluid ( e . g ., water ) or air ( either an air jet or an air suction or vacuum ) or a light beam either toward the mirror or toward a target region in a patient &# 39 ; s mouth in the vicinity of the mirror . supplies of the fluid , air , and light may be provided for in the body of the multi - function dental tool and easily controlled using buttons accessible on the external surface of the tool that are placed to be readily operated with one hand . fluids and air may be supplied to the tool from an external or portable source through a supply line or hose connected to the tool . it should be appreciated that the external source may be compact and portable to facilitate use of the dental tool in both civilian and military field situations because of the high utility of the multiple functions provided in the tool . in a preferred embodiment the tool requires no external connection to electricity because of its battery operation that energizes the light source within the tool . however , in alternate embodiments , a connection to an external source of electricity may be advantageously provided . continuing with fig1 , a row of control buttons is disposed along an upper side of the main body 12 . button 40 controls a light supply circuit ( see fig8 ) to provide the light output from the light output orifice 32 . buttons 42 , 44 , and 46 are configured as a bar that tilts about a pivot axis directly below the center button 42 , to provide control of the flow of air and / or fluid , either individually or combined as will be described in fig4 and 5 . a selector bar 48 , for selecting the direction of fluid or air to be emitted from the fluid / light manifold 26 toward the mirror 16 or toward the patient &# 39 ; s teeth , is seen protruding from the side of the main body 12 . in operation , the selector bar 48 is pressed from one side of the main body 12 to the opposite side to direct the flow via one passage or the other , that is , toward the mirror or toward a tooth . an opening 140 in a center portion of the selector bar 48 acts as a valve for directing the flow of fluid — air and / or water , for example . see fig4 and 5 for internal details of this structural feature . materials preferred for use in fabricating most of the parts used in the dental tool 10 are generally either stainless steel , such as “ alloy 304 ,” a readily available alloy of steel , chromium and nickel , or an fda ( u . s . food and drug administration )- compliant plastic material , such as nylon . generally , an engineering plastic suitable for high quality , precision manufactured small parts that can withstand repeated exposure to high temperatures ( above 100 degrees centigrade ), which is fda - compliant and meets the requirements for use in dentistry may be considered . in particular , the removable headpiece 14 must be able to withstand the heating of an autoclave used for sterilizing the dental tool 10 before each use , and be manufacturable with threads ( see fig3 ) that are sufficiently durable and accurate to enable many cycles of removal from and secure re - attachment of the head piece 14 to the main body 12 . the material ( s ) selected may be fabricated by conventional methods for manufacturing precision parts , alone or used in combination , such as casting , machining or injection molding . these same materials are suitable for the rest of the solid or rigid parts . materials referred to herein as “ stainless steel ” or “ plastic ” will be understood to mean the materials described in this paragraph unless otherwise noted . further , as will be described , the dental tool 10 also contains several metal springs and a number of resilient sealing components fabricated from an fda - compliant elastomer . the mirror 16 may be fabricated of glass with mirror finish or rhodium - plated stainless steel . persons skilled in the art will be familiar with suitable manufacturing methods for the embodiment described herein . the versatile multi - function dental tool illustrated in fig1 provides , in a single instrument a dental mirror , a light beam , an oral irrigation unit , an oral suction unit and may include , in an alternate embodiment through the use of an interchangeable head piece , an oral air jet unit for drying moist surfaces or clearing fluid or debris . the interchangeable head piece may also be used to enable the fluid or air to be directed alternately toward the mirror or toward a patient &# 39 ; s teeth . other combinations of the functional dental tools , simply by re - arranging the tubes in the head piece with ones of the appropriate configuration may be realized by persons skilled in the art . the remaining figures will illustrate and describe the various features and construction of the invention . fig2 illustrates a second , partially disassembled perspective view of the embodiment of fig1 with the removable headpiece 14 removed from the main body 12 and exposing the bulkhead 38 within the proximate end of the headpiece 14 . the bulkhead 38 , to be described further in fig3 and 4 , includes supporting passages 61 , 63 for the air / fluid tubes 60 , 62 ( see fig3 ) and 65 for the light tube 64 to pass through from the control body 72 within the main body 12 to the head piece 14 . the passages 61 and 63 are supported and sealed in the bulkhead 38 by an elastomer seal 68 . an alignment pin 66 to be described is also shown in fig2 . the remaining structures shown in fig2 are as described in fig1 . the removable headpiece 14 is secured in the present example by the retaining collar 24 , which is itself retained by a lip formed into the end of the control body 70 , to be described as shown in fig5 . the head piece 14 is secured to the control body 70 by rotating the retaining collar 24 around the external threads 34 formed in the aft end of the removable headpiece 14 . alignment of the head piece 14 and the control body 70 is keyed by an alignment pin 66 shown in fig3 , further described in fig5 and 6a . as the headpiece 14 is drawn into contact with the control body 70 , the passages 61 , 63 , and 65 will align with corresponding passages in the control body 70 . fig3 illustrates an exploded view of the removable head piece 14 of the embodiment of fig2 . in addition to the structures previously described , which bear the same reference numbers , the drawing depicts several internal parts of the illustrative embodiment , including the tubes for conducting air or fluid and light between the bulkhead 38 and the fluid / light manifold 26 . a first fluid tube 60 includes an inlet end 170 that connects to the bulkhead 38 at an opening 61 and an outlet end 172 that connects to a first fluid ( or air ) outlet orifice 28 in the fluid / air / light manifold 26 . a second fluid tube 62 includes an inlet end 174 that connects to the bulkhead 38 at an opening 63 and an outlet end 176 that connects to a second fluid ( or air ) outlet orifice 30 in the fluid / light manifold 26 . a third light tube 64 includes an inlet end 178 that connects to the bulkhead 38 at an opening 65 and an outlet end 180 that connects to a third light outlet orifice 32 in the fluid / light manifold 26 . the bulkhead 38 and the first 60 and second 62 fluid tubes may be fabricated of stainless steel or fda - compliant plastic as mentioned previously . the light tube assembly 64 may include a stainless steel sheath that contains a fiber optic strand or bundle of strands for conducting light emitted by a light assembly 100 to be described in fig4 . an alignment pin 66 may be used to facilitate alignment of each of the fluid and light tubes through the bulkhead 38 structure as the head piece 14 is connected to the control body 70 . the alignment pin 66 may be disposed in an upper portion of the bulkhead 38 in the illustrated example . the tubes 60 , 62 and 64 includes output ends that are directed respectively to the mirror 16 , and to a region in a patient &# 39 ; s mouth , i . e ., away from the mirror . it should be understood that the output ends of these tubes may be oriented differently than illustrated in fig3 . it is possible that the removable head piece 14 may be configured with several different combinations of the output orientations of the tubes 60 , 62 , and 64 to provide a set of head pieces to suit particular applications . the removable head piece 14 thus may function as an interchangeable part of the multi - function dental tool of the present invention . continuing with the exploded view in fig3 , the mirror 16 is shown detached from the mirror holder 50 and the mirror holder 50 is shown as a separate structure that may be attached to a seat 51 formed in the nose end of the removable head piece 14 . the mirror 16 may be provided as , for example , a rhodium - plated stainless steel component , or a more conventional glass with silvered backing . however , a disadvantage of the latter is the parallax error introduced by a mirror of clear material backed by a reflective surface . other equivalent reflective surfaces that can withstand the stresses placed upon the materials and structure thereof may be used . the mirror 16 may be secured in the mirror holder by welding or bonding or press fit according to the particular materials used , as will be understood by persons skilled in the art . the mirror holder 50 may be assembled to the seat 51 by welding or using an epoxy adhesive or equivalent cement capable of withstanding the temperatures of an autoclave and the nominal mechanical stress of handling and manipulating the dental tool . in some applications , particularly those where interchangeable mirrors might be included , the mirror holder may be supported by a threaded engagement with the nose portion of the head piece 14 . the seat 51 may be configured to support the mirror holder 50 at the desired angle o depicted in fig5 . the angle θ , to be described further with fig6 a , is defined relative to the longitudinal axis c l of the main body 12 of the dental tool 10 . this angle permits a dentist , hygienist , or assistant to enable viewing a patient &# 39 ; s upper teeth without undue discomfort . however , other angles may be used , for example within a range of 10 to 60 degrees . in some embodiments of the dental tool 10 this angle may be adjustable . fig4 illustrates an exploded view of the main body portion of the embodiment shown in fig2 . it will be observed that the orientation of the dental tool 10 in fig4 is opposite that shown in fig1 , 2 , and 3 . in other words , the head piece 14 end of the tool ( and the forward end 52 of the main body 12 in fig1 ) is oriented to the left in the drawing in fig1 , 2 , and 3 , and to the right in fig4 . this orientation of the figures is chosen to best illustrate some of the detail features of the construction of the tool . component parts in this drawing bearing the same reference numbers as described in fig1 , 2 , and 3 describe the same structural components . further , this exploded view includes fasteners such as screws 90 , which are used in a number of places in assembling the parts as shown . the locations of these screw fasteners and the parts involved are clearly apparent in the drawing and will not be further described . in some applications , fda - compliant epoxy adhesives may be used to assemble certain components together , as will be understood by persons skilled in the art . the assembly shown in fig4 includes the control body 70 and its chassis 72 that are enclosed within the main body cover 20 . after the main body cap 22 and the main body cover 20 are threaded onto the supply hose 18 , and the fluid and air lines in the supply hose 18 are attached to the barbed fluid fittings 116 , 118 in the control body 70 , the main body cover 20 may be slipped over the control body 70 and secured by the main body cap 22 , which may be screwed into the bracket 74 . in a similar fashion , the internal passages within the control body 70 for the fluid and air 199 a and 199 b ( see fig7 b to be described ) may be connected through first and second junction tubes 66 a and 66 b inserted through passages 61 and 63 in the bulkhead 38 . the junction tubes 66 a and 66 b may be sealed by an fda - compliant elastomer junction tube seal 68 as shown in fig4 . the bulkhead 38 is retained within the forward end 52 of the control body 70 using the stainless steel retaining ring 150 . the retaining collar 24 is screwed onto the ( externally ) threaded forward end 52 of the control body . then , the removable head piece 14 is mated to the forward end of the main body 12 such that the fluid and light passages and tubes are aligned with the ports in the bulkhead 38 assembly , the retaining collar 24 , previously installed on the forward end 52 of the control body 70 may be screwed to the threaded portion of the removable head piece . the control body 70 contains the fluid / air poppet valve assemblies 92 through 108 , the control buttons 40 through 46 and their related parts , and the light assembly 100 to be described . the control body 70 and the bracket 74 are secured to the chassis 72 using the screws 90 as shown . the chassis 72 also supports a circuit board assembly 120 that includes an electric circuit 200 ( see fig8 ) and a battery 130 ( shown as battery 220 in fig8 ) for powering the electric circuit 200 and the light assembly 100 . the circuit board 120 is secured to the chassis 72 using the screws 90 as shown . the control body 70 , chassis 72 , and bracket 74 may be fabricated from the same stainless steel and fda - compliant plastic materials described herein above . the circuit board 120 includes a battery 130 mounted thereon in first and second clips 122 , 132 , which may be attached to the circuit board 120 with rivets 124 , 134 . the battery 130 may be any small battery capable of supplying at least 3 . 3 volts to operate an led as the light source for the dental tool 10 . in the illustrated embodiment , which includes a regulated power supply , a lithium - ion , rechargeable type cr123 battery rated at 3 . 6 volts may be provided . the circuit board 120 may be a printed circuit board ( pcb ) having circuit trace contacts 228 , 230 ( not shown in fig4 , but see fig8 for the circuit diagram ) disposed parallel with and spaced closely to each other on the upward side of the circuit board 120 on the upper surface of the tab 136 . the circuit board 120 is mounted on the upper surface 72 a of the chassis 72 such that the light button actuator 86 is positioned immediately above the pair of closely spaced circuit board traces 228 , 230 . these contacts 228 , 230 of the switch 40 shown in fig8 are connected together whenever the light button actuator 86 is pressed downward into contact with the contacts 228 , 230 against the tension of the return spring 82 that is seated in a recess 81 in the control body 70 . the light button actuator 86 slides within a sleeve 84 disposed in the control body 70 just below the light button 40 and return spring 82 . the contact closure thus provided whenever the switch button 40 is pressed connects a signal to the circuit to be described that energizes a light assembly 100 . the light assembly 100 is also depicted in fig4 . when assembled , it is supported within a recess in the control body 70 with a forward end butted up against the bulkhead 38 . the light assembly 100 includes a small diameter tube serving as a light assembly body 186 containing a double convex lens 182 in the forward end that is butted up against the bulkhead 38 and a light emitting diode ( led ) 184 disposed in the light assembly body 186 just behind the lens 182 such that the terminals of the led 184 extend toward the pc board 120 . the led 184 , preferably in this example a round , 5 mm diameter led lamp providing a white light , is connected to the circuit board 120 through a wiring harness 212 ( see fig7 c ) routed from the terminals of a header 188 on the circuit board 120 to the first and second terminals of the led 184 . the pair of wires in the wiring harness 212 , which may preferably be approximately 24 gauge stranded , insulated wire , may be dressed along and against the underside of the chassis 72 between the circuit board 120 and the light assembly 100 , where the wires of the wiring harness 212 may be soldered to the terminals of the led 184 . details of the wiring harness 212 shown in fig7 c to be described herein below . the circuit for driving the led 184 is shown in fig8 . the light switch assembly is controlled by the light switch button 40 and the contacts 228 , 230 on the circuit board 120 , which thus form a momentary switch to control the light beam of the dental tool 10 . each operation of the switch button 40 applies a ground signal to pin 2 of a pic microcontroller u 1 ( see microcontroller 232 in the circuit 200 shown in fig8 ) on the circuit board 120 to turn on a mosfet 236 to draw current through the led 184 in the light assembly 100 until a subsequent operation of the light switch button 40 . the subsequent operation of the light switch button 40 signals the mosfet 236 to turn off , opening the led 184 circuit to extinguish the light source . in other applications , the light switch assembly may be a latching type such as , for example , a mechanical push on , push off type so that the light may remain energized during use without having to hold the light switch button 40 in a depressed position . however , the pic microcontroller 232 and mosfet 236 combination was chosen for this application because of the mechanical simplicity and tight space requirements of the dental tool 10 . continuing with fig4 , the poppet valves 92 - 98 and 102 - 108 contained within the control body 70 for controlling the flow of fluids will be described . the control body 70 may be a solid machined , cast , or molded structure of material such as alloy 304 stainless steel or nylon having bodies 92 , 102 for receiving the valve poppets 96 , 106 therein . the valve poppets 96 , 106 are disposed within the respective valve bodies 92 , 102 . the valve seals 94 , 104 of an fda - compliant elastomer are also seated against valve seats 93 , 103 formed respectively in the chassis 72 when the control body 70 and the chassis 72 are assembled together . the side view of the control body assembly shown in fig7 a and 7b illustrate the assembled relationship of these poppet valve 92 - 98 and 102 - 108 assemblies . actuation of the poppet valves 92 - 98 and 102 - 108 for controlling the flow of fluids through the dental tool 10 is provided by the button assembly 76 . the button assembly 76 is seated into an elongated relief 77 formed into the upper side of the control body 70 . a loop 43 formed into the underside of the button assembly 76 is secured with a pin 78 that is inserted into a bore 79 passing through the control body 70 as shown . in operation , the button assembly 76 rocks about the pin 78 so that either end , 44 or 46 of the button assembly 76 , when pressed , operates its respective poppet valve 92 - 98 or 102 - 108 to release a flow of fluid — typically air or water — into the removable head piece 14 . if the user presses the center button 42 , both poppet valves 92 - 98 and 102 - 108 may be operated to release fluids into both the first and second fluid tubes 60 , 62 in the removable head piece 12 . thus , the button assembly 76 functions as a three - way control in the manner of a , b , or a and b . the selector bar 48 , for selecting the direction of fluid or air to be emitted from the fluid / light manifold 26 toward the mirror 16 or toward the patient &# 39 ; s teeth , is installed laterally within a selector passage 141 through the side of the main body 12 . the selector bar 48 is sealed in the selector passage 141 by the four elastomer o - rings 142 , and secured there within by a screw 141 as shown in the exploded view of fig4 . in operation , the selector bar 48 is pressed from one side of the main body 12 to the opposite side to direct the flow one direction or the other . an opening 140 in a center portion of the selector bar 48 acts as a valve for directing the flow of fluid — air and / or water , for example . in one position the opening 140 is aligned with a passage that permits the flow of fluid or air to be directed toward the mirror ; in the other ( second ) position , the opening 140 is aligned with a passage that permits the flow of fluid or air to be directed to the patient &# 39 ; s teeth . fig5 illustrates an internal cross section view from a first side of the embodiment of fig1 , showing the assembled relationship of many of the component parts illustrated in the exploded view of fig4 . it should be noted that the control body 70 and its chassis 72 , as assembled , include the bulkhead assembly 38 , the selector bar 48 , the first and second poppet valve assemblies 92 - 98 and 102 - 108 , the light assembly 100 and its light switch button 40 and actuator 86 assembly , and the circuit board 120 and battery 130 . as enclosed in the main body cover 20 , this assembly makes up the main body 12 of the dental tool 10 . the main body cover 20 is secured to the control body by the main body cap 22 when it is screwed into the bracket 74 that is attached to the control body chassis 72 as described in fig4 . the fluid supply line 18 containing the fluid and air lines 160 , 162 is connected to the barbed fluid fittings 116 , 118 respectively . the barbed fluid fittings 116 , 118 are screwed into the control body 70 at the location shown in fig5 behind the light switch actuator 86 . finally , after the removable head piece 14 is mated to the forward end of the main body 12 such that the fluid and light passages and tubes are aligned with the ports in the bulkhead 38 assembly , the retaining collar 24 , previously installed on the forward end 52 of the control body 70 may be screwed to the threaded portion of the removable head piece . the alignment of the passages is facilitated by the alignment pin 66 shown in the figure as the retaining collar 24 is drawn into a secured position . this completes the assembly of the major subassemblies of the dental tool 10 . continuing with fig5 , a portion of a longitudinal axis c l runs lengthwise through the body of the dental tool 10 is shown in fig6 a as a straight line . it will be understood that the longitudinal axis c l extends through the entire dental tool 10 . however , persons skilled in the art may recognize that this axis may be curved or bent at a defined angle to provide a dental tool that is balanced a certain way or formed for ease of manipulation . such considerations may arise from the use of certain materials that are lighter than others used in the tool or , when used near one end of the tool may have a substantial affect on the center of gravity . providing a dental tool 10 that is curved or bent at an angle along its length is among the alternative configurations contemplated in this invention . for example , in some embodiments it may be reasonable to provide a dental tool configured with the multiple functions described herein that is formed with a handle aligned away from the longitudinal axis cl instead of aligned with it . alternatively , other embodiments , which may be intended to be supported other than by hand , may be configured to be supported by or suspended from other apparatus , thus requiring alternative forms and / or features in the tool without departing from the concepts described herein . fig6 a , 6 b , and 6 c depict the removable head piece 14 shown in fig3 but as assembled in cross section . all of the structures identified in the fig6 a , 6 b , and 6 c are the same ones described in fig3 and bear the same reference numbers . fig6 a illustrates a first side cross section view of the removable head piece 14 of the embodiment of fig2 showing an air and water tube 60 installed within the body of the removable head piece 14 and directed toward the mirror 16 . the air and water tube 60 includes an inlet end 170 supported by the bulkhead 38 and sealed by an elastomer seal 68 , and an outlet end with orifice 172 supported in the fluid / light manifold 26 . also shown in this view is an alignment pin 66 to ensure correct alignment between the removable head piece 14 and the control body 70 in the main body 12 when they are assembled together . further , the light passage 64 to be described in fig6 c is also shown in profile . continuing with fig6 a , the longitudinal axis c l that runs lengthwise through the body of the dental tool 10 defines a reference line for other aspects of the invention . for example , the angle θ of the mirror 50 ( and the mirror 16 ) relative to the longitudinal axis c l of the main body 12 is shown in this illustrative example as approximately 30 degrees . this angle , in other embodiments , may be set within the range of 10 to 60 degrees . further , in some embodiments the angle θ may be made adjustable . fig6 b illustrates a second side cross section view of the removable head piece 14 of the embodiment of fig2 showing an air and water tube 62 installed within the body of the removable head piece 14 and directed toward a patient &# 39 ; s teeth . the air and water tube 62 includes an inlet end 174 supported by the bulkhead 38 and sealed by the elastomer seal 68 , and an outlet end with orifice 176 supported in the fluid / light manifold 26 . fig6 c illustrates a third side cross section view of the removable head piece portion of the embodiment of fig2 showing a light passage 64 installed within the body of the removable head piece 14 and directed at an outlet end toward a patient &# 39 ; s teeth . the light passage 64 includes a fiber optic bundle installed within a tube or sheath , an inlet end 178 supported by the bulkhead 38 and an outlet end with orifice 180 supported in the fluid / light manifold 26 . the fiber optic bundle is preferably polished on both ends and sealed with an fda - compliant epoxy . the alignment pin 66 , provided to ensure that the passages for water , air , and light are correctly aligned when the removable head piece 14 is installed to the control body 70 is clearly shown in fig6 c . fig7 a illustrates a side cross section view of the control body sub - assembly 180 portion of the main body 12 of fig5 , detached from the chassis 72 and other structures supported by the chassis 72 for clarity . fig7 b illustrates a bottom view of the control body sub assembly 180 shown in fig7 a . structures identified in fig7 a and 7b having the same reference numbers that appear in previous figures — primarily fig4 and 5 — refer to the same structures . the view in fig7 a of the control body 70 illustrates the light assembly 100 , the poppet valve assemblies 92 - 98 and 102 - 108 and the fluid control button 76 , the selector bar 48 and the light switch assembly 82 - 86 and the light button 40 . the light assembly 100 shown in fig7 a includes a double convex lens 182 , a light emitting diode 184 , and a light assembly housing 186 . the double convex lens 182 may be preferably be formed of glass or fda - compliant plastic materials . the light emitting diode (“ led ”) 184 used in the illustrative example may be a 5 mm round unit designed to emit a cool white light having a minimum color temperature of 4600 ° k ( degrees kelvin ) and a minimum luminous intensity of approximately 20 , 000 mcd ( millicandles ) at a nominal forward current of approximately 30 ma ( milliamperes ) when operated at its rated forward voltage . persons skilled in the art will recognize that the particular choice of led depends closely on the application and may vary depending on additional design considerations . the light assembly housing may be molded or machined of fda - compliant plastic or alloy 304 stainless steel . the internal dimensions of the housing 186 may be calculated to allow a nominal press fit of the lens 182 and led 184 . the poppet valve assemblies shown in fig7 a and 7b control the flow of fluid and or air according to how the button 76 is pressed , as described previously in fig4 . when released , the button 76 blocks the flow of fluid ( e . g ., water ) and or air ; when one end ( either 44 or 46 of the button 76 is pressed the fluid or air in the associated passage 194 or 196 machined in the control body 70 is allowed to flow through the respective poppet valve to a common passage 198 , and thence through bypass passages 199 a or 199 b and the bulkhead 38 to a corresponding tube 60 , 62 in the removable head piece 14 . the passages 194 , 196 , 198 , 199 a and 199 b may be preferably machined in the control body ( such as by routing and drilling , for example ) similar to the valve body used in a typical automatic transmission for automobiles . when the button 76 is pressed at its midpoint 42 ( or , alternatively , at both ends 44 , 46 simultaneously ) fluid and or air will both be admitted to the common passage 198 for dispersal through the passages 198 and 199 and fluid tubes 60 , 62 . the button 76 , retained in the control body 70 by a pivot pin 78 positioned in a slot 43 in the button 76 , is urged into its released position by first 98 and second 108 poppet springs as shown in fig4 . continuing with fig7 a and 7b , the selector bar 48 , which slides laterally in a bore 79 passing through the control body 70 , provides control to cause the fluid or air selected by one of the poppet valve assemblies 92 - 98 or 102 - 108 to be directed to one or the other of the two fluid tubes 60 , 62 , depending whether the user wishes to direct the fluid or air toward the mirror 16 or to the patient &# 39 ; s teeth . the selector bar 48 is retained within its bore 79 by a retaining screw 141 . the light switch assembly 80 includes the light button 40 , return spring 82 , sleeve 84 , and switch actuator 86 contained within a bore 81 in the control body 70 . also depicted in fig7 a and 7b are the first and second barbed fluid fittings 116 , 118 that are screwed into threaded bores in the control body 70 . the barbed fluid fittings 116 and 118 provide connection points for the fluid and air lines 160 and 162 within the supply line 18 shown in fig5 . fig7 c illustrates an underside view of the control body chassis 72 assembled with a retaining collar 24 and wiring harness 212 for the light assembly 100 . the chassis 72 is secured to the control body 70 with screws 90 , several of which are not illustrated for clarity of the wiring harness 212 that is dressed along the surface of the chassis 72 as shown . the chassis 72 is depicted between the retaining collar 24 and the bracket 74 . the circuit board 120 is also visible in this view through the elongated opening 203 in the chassis 72 . the wiring harness 212 connects between first and second terminal pins 202 , 204 that are positioned in the opening 203 and connect to the circuit board 120 . the connection between the individual wires of the harness 212 and the terminal pins 202 , 204 is via a receptacle 206 . the opposite ends of the wires in the harness 212 may be soldered to the first 208 and second 210 pins of the led 184 or connected using a receptacle ( not shown ) suitable for the purpose as readily understood by persons skilled in the art . the led 184 is disposed within the light assembly 100 and thus not visible in this view , except for the first and second pins 208 , 210 . please refer to fig5 and 7a for the detail of the light assembly . the first and second wires of the harness 212 may preferably be twisted to assist in maintaining a neat dress against the surface of the chassis 72 . fig8 illustrates an electrical circuit diagram 200 of the light source portion of the embodiment of fig4 and 5 . a voltage regulator 224 powered by a battery 220 having an output 222 applied to an input terminal of the voltage regulator is provided to produce a stable voltage at an output terminal 226 . the battery voltage may be rated at 3 to 9 volts , depending on the input voltage requirements of the voltage regulator 224 and the type available that meets the small physical size and current requirements . in the present embodiment a 3 . 6 volt lithium ion rechargeable battery may be used . the voltage at the output terminal 226 “ 3 . 3 vcc ” may preferably be 3 . 3 volts in the illustrated example , which is sufficient to power the led 184 light source and the pic microcontroller 232 programmed to control the current supplied to the led 184 light source and to provide a debounce function to ensure reliable operation of the light switch 40 . light switch 40 includes first and second terminals , which may be first 228 and second 230 pc board traces disposed in an extension tab portion 136 of the circuit board 120 as shown in fig4 . the pc board traces 228 and 230 are not shown in fig4 but are represented by the terminal symbols 228 , 230 in fig8 . the light switch 40 is connected to a gp5 terminal of the pic microcontroller 232 , and to a pull up resistor 248 such that the gp5 pin of the microcontroller 232 is pulled high ( toward the 3 . 3 volt supply ) except when the switch 40 is activated by pressing on the light switch button 40 to pull the gp5 terminal low to energize the light source . this action causes the gate drive signal to be output from terminal gpo of the microcontroller 232 on signal line 238 to the gate of the mosfet switch 236 , causing it to conduct current through the led 184 , which is connected to the regulated supply voltage through a resistor 240 . in the illustrated embodiment , one suitable led is a type c503d - wan available from cree , inc , durham , n . c . 27703 . continuing with fig8 , the 3 . 3 volt regulated supply is shown connected to a v dd terminal pin of the microcontroller 232 . further , a second pullup resistor 246 is shown connected to an mclr * terminal of the microcontroller 232 . a voltage divider formed by two equal valued resistors 242 , 244 provides a voltage of one half the regulated supply voltage to a gp4 / an3 terminal of the microcontroller . the microcontroller 232 is programmed to cause the led 184 to blink , indicating low battery voltage , if this value equal to one - half the supply voltage falls below an internal reference level . in the illustrated embodiment one suitable microcontroller may be a type pic12c671 . persons skilled in the art will understand that numerous variations are possible or that additional features may be included in the illustrated circuit to adapt it to particular applications . the present circuit is illustrated to provide one generalized method of replicating the present invention . in the illustrated embodiment a separate on - off switch to control application of power to the circuit from the battery is not included because the circuit draws negligible current when the dental tool 10 is not in use , and the circuit is thus always in a stand - by , ready to use condition as long as the battery provides sufficient voltage . a quick tap on the button 40 to test the light can be used to confirm the readiness of the dental tool 10 for use . this particular approach eliminates a separate on - off switch , which is both a cost and an ergonomic issue in the use of the tool . while the invention has been shown in only one of its forms , it is not thus limited but is susceptible to various changes and modifications without departing from the spirit thereof .

US-201113186622-A

a camera shoulder case is provided which permits rapid opening , full visibility , and easy access to one layer of securely held equipment in the case while the case remains supported by a shoulder strap on the user . the assembly includes a lower case part which holds the equipment , a cover pivotally mounted to the rear of the lower case part , and a shoulder strap having opposite ends mounted to opposite sides of the lower case part . a flexible loop member which is mounted to the cover , slidably receives the shoulder strap . with the case supported on a person , access is obtained by pulling up on the cover to pivot down the lower case part until it is horizontal , the strap - receiving loop then resisting closing of the cover . the lower case part can be partitioned by the user to securely hold equipment by the use of pylon devices that can be installed in selected holes of an array of holes formed at the bottom of the lower case part .

fig1 illustrates an instrument case apparatus 10 ( which is sometimes referred to as a case or camera bag ) that includes a flexible shoulder strap 12 held on the shoulder of a person p to suspend a container or case 14 at the side of a person . the case 14 includes a lower case part 16 having a considerable depth d to receive equipment carried by the apparatus , and a cover 18 pivotally mounted to the rear of the lower case part at 20 . when a person wishes to gain access to the lower case part 16 , he first unzips a zipper 22 . he then lifts a pull - up tab 24 , which causes the lower case part 16 to pivot down to the position shown in fig2 . with the case open as in fig2 the cover 18 tends to remain open largely because of the provision of a retainer member or loop 26 extending from the cover , which slidably engages the shoulder strap 12 . a more secure positioning of the cover in its open position is achieved by the person pressing a location on the strap against the cover , to engage another retainer formed by a velcro ( hook - and - loop fastener type ) pad 28 with a corresponding velcro pad 30 at the side of the cover . the velcro pads allow the cover 18 to be firmly supported by the shoulder strap , so the cover 18 , in turn , supports the rear 52 of the lower case part to prevent the case from rotating closed . the loop 26 serves as a safety device to avoid overturning of the lower case part , since such overturning would require lifting of the cover which is resisted by the loop 26 . with the cover open , the person can view the open top 32 of the lower case part 16 to gain access to it so as to remove or replace equipment therein . it may be noted that a person may swing the lower case part 16 slightly forward around his body to facilitate such access to the opened case . a person can close the cover by lifting up the outer or forward end 34 of the lower case part towards the cover 18 . either before or after this , he also may pull the velcro pads 28 , 30 away from one another , to permit the strap to extend tautly to the lower case part , to again achieve the configuration shown in fig1 . the case apparatus will remain in this configuration even without closing the zipper 22 , so long as the case continues to be held by the shoulder strap on the shoulder of a person . when the strap is removed from the person &# 39 ; s shoulder , as to set the case on the ground , the loop 26 prevents the case from opening so long as the apparatus is held by the strap . as also shown in fig3 the lower case part 16 has a soft outer shell or case wall 40 and a coupling belt 42 that extends partially about the outer case wall . a d - ring 44 connects the coupling belt 42 to the end 46 of the strap 12 . the end 46 of the strap is looped about a curved portion of the d - ring , so that the strap end can slide along the ring , to engage the ring portion 44a when the case is closed and to engage another ring portion 44b when the case is open . the d - ring prevents the strap from twisting ( which could occur if the strap ends were merely sewn to the lower case sides ), which could prevent the velcro pads from engaging . the loop 26 which engages the shoulder strap is formed of a length of flexible material similar to that of the strap , and with opposite end of the length of material fastened to the cover 18 . this provides a loop with an inner end 26i fastened to the cover and a free loop end 26f . when the case is closed as shown in fig1 the loop 26 extends towards the bottom 53 of the case to lie beside the lower case part 16 , under the influence of the strap 12 . however , when the case is opened so that the front portion 50 of the cover is raised to the position of fig2 the flexible loop extends in an opposite direction away from the lower case part . with the loop 26 at the position shown in fig2 the loop engagement with the strap 12 prevents unintentional closing of the cover , since closing of the cover without movement of the lower case part 16 is prevented by the loop . since the loop 26 is a flexible member , however , it would allow some movement of the cover towards and away from the lower case part in the open position of fig2 . such &# 34 ; floppiness &# 34 ; of the cover position is avoided by the use of the velcro fastener pads 28 , 30 . the engagement of these pads 28 , 30 , plus the fact that the shoulder strap 12 is under tension and therefore acts like a rigid member , results in the pad 28 preventing the cover from pivoting closed or further open . the lower case part 16 lying in the open position of fig2 is supported in a relatively stable manner against the hip portion of the person p . this is partially due to the fact that the lower case part 16 is of appreciable depth and presses with some force against the side of the person when open due to the angle of the strap 12 . also , the strap - supported cover supports the rear 42 of the lower case part . the lower end 46 of the strap is attached to a location not far from the mid point between the front 34 and rear 42 of the lower case part , to avoid any large tendency for the lower case part to pivot . the actual mounting location for the lower strap end at 46 is somewhat closer to the front 34 of the lower case part than the rear 52 to avoid falling over of the lower case part which could be catostrophic . a more detailed analysis shows that the centerline of the strap is spaced a horizontal distance s from the center of gravity of the lower case part , and the d - ring 44 does not permit any further movement of the strap towards the center of gravity , all of which helps avoid falling over of the lower case part . the case apparatus is constructed symmetrically , with its opposite sides 54 , 56 each coupled by a d - ring to a lower end of the strap 12 , with a flexible loop 26 extending from each side of the cover , and with a velcro pad 28 mounted on the inner face of each end portion of the shoulder strap . fig4 and 5 show the inside of the case , and particularly the lower case part 16 . it is well recognized that delicate instruments should be securely held to the case to prevent movement relative to it , which could cause damage when the instruments strike one another or the case walls . in accordance with another feature of the present invention , pylon devices 60 are provided which can be mounted at any of a large number of positions within the case lower part so as to conform with the shape of an instrument to be held . the pylon devices have foam plastic coverings around them , as do the inside walls of the lower case part , to gently hold the instrument and minimize the transmission of shocks to them . the pylon devices have rigid cores , to prevent shifting of the equipment when the case is pivoted to the vertical . as shown in fig5 the lower case part 16 includes a rigid tray 62 which is in the form of a container with four sides and a bottom wall 64 . the bottom tray wall 64 has an array of holes 66 therein for mounting the pylon devices . a cushion layer 68 lies over the rigid bottom tray wall 64 to cushion and prevent scratching of equipment . the cushion layer 68 also has an array of holes 70 which are aligned with those 66 of the rigid tray wall . each pylon device 60 includes a rigid upstanding post 72 with a base 74 lying on the cushion layer 68 , and a stud 76 which projects through aligned holes in the cushion layer and rigid tray wall 68 , 64 . a nut 78 is fastened to a threaded end of the stud 76 to securely hold the pylon in place . the pylon device also has a thick - wall resilient foam tube 80 surrounding the upstanding post 72 . it may be noted that instead of using a nut 78 on a threaded stud , a bolt can be used whose threaded stud screws into a hole in the post , but this would make initial positioning of the pylon devices less convenient . it is also possible to thread the holes in the bottom tray wall , although this can be more expensive , even though more convenient . the pylon device 60 can be mounted to securely hold an instrument i between the pylon 60 and another pylon or a foam pad 82 at the inside wall of the case . this is accomplished by positioning the pylon device so that the space between it and the other pylon device or the pad 82 , is less than the width of the instrument to compress the elastic foam material at 80 and 82 . since the foam tube or layer 80 on the pylon device is of substantially constant diameter along the depth direction of the lower case part , the equipment can be easily removed by lifting it directly upwardly ( when the bottom tray wall 64 is horizontal ). the cover 18 of the case apparatus is formed with a molded elastic foam pad 84 having multiple protuberances 86 thereon that deform against any instrument i of sufficient height . the cover also has a soft outer wall 86 . in the lower case part 16 , the bottom tray wall 64 is spaced from the soft outer wall 54 by a foam pad 88 . the foam pad can readily deform to receive the indentations applied thereto by the nuts 78 of the pylon devices . the pylon devices 60 permit secure holding of an instrument such as a camera c ( fig4 ) with telephoto lens thereon . this can be accomplished by removing the tray 62 from the rest of the lower case part , so that the lower surface 64s ( fig5 ) of the bottom tray wall 64 is exposed . then , a group of pylon devices 60 can be positioned by inserting their studs 76 through appropriate holes of the cushion and bottom tray walls 68 , 64 , so that the equipment is snugly held between the pylons and / or the inner foam side walls 82 mounted on the tray . each pylon device is fastened in place by attaching a nut 78 to it . the tray with pylon devices attached thereon then can be replaced in the rest of the lower case part . thereafter , the camera or other equipment for which the pylons have been fitted can be fitted out or reinserted into the spaces left between the pylons . the pylons occupy only a small amount of space , so that the gaps left by large irregularly - shaped equipment , can be utilized to hold other equipment . the fact that the pylons have rigid upstanding posts or covers , permits them to very securely hold equipment so it will not fall out even if the case is accidently turned over . however , the cushioned outside of each pylon permits equipment to be pulled out and later reinstalled . thus , the invention provides an instrument case or bag apparatus which is of relatively simple construction , but which enables highly convenient utilization . the case is of the &# 34 ; attache case &# 34 ; type with a large cover permitting wide area access , and yet can be easily opened and closed while remaining held on the shoulder of a person . this is accomplished by supporting a lower case part at the ends of a shoulder strap and by utilizing a loop on the cover which slidably engages the strap . when the cover is pulled up to thereby pivot down the lower case part so the case is opened , the loop which slidably engages the strap thereafter prevents automatic closing of the case . an additional fastener device such as of the velcro type can be utilized to provide a more rigid holding - open of the case . the inside space of the case can be divided so as to securely hold instruments of irregular shape , by the provision of pylon devices that can be mounted at a large number of different selected positions within the case . the pylon devices permits utilization of a large proportion of the space , because the pylon devices do not occupy a large amount of space even when holding irregular equipment . the case can include a bottom tray wall having an array of holes therein , and the pylon devices can be provided with studs that project through the holes and are fastened thereto . a cushion layer can be provided on the rigid bottom tray wall to cushion instruments , and the cushion and tray can be provided with aligned holes through which the pylon studs can be projected . the pylons have upstanding posts with elastic foam tubes thereon to securely hold and cushion the instruments . although particular embodiments of the invention have been described and illustrated herein , it is recognized that modifications and variations may readily occur to those skilled in the art and consequently , it is intended that the claims be interpreted to cover such modifications and equivalents .

US-13418380-A

this allows for modular floating gardens that can be fabricated into forms chosen by the end user to be aesthetically pleasing even before planting has matured . because composite floating gardens created from these modules can be large , their form can be pleasing from a distance . because these are significant structures , they can be incorporated into a process to improve water quality .

this invention consists of modules that can be connected together to form a composite floating garden that has aesthetically pleasing form to the end user even before plantings mature . there are 3 module types envisioned to form composite floating gardens : structural modules , garden modules , and buoy modules . it is an essential part of this invention that the end user have the freedom to combine modules to create any feasible design through the connection of supplied modules that is attractive or practical to that end user . because the resulting composite structure can be large and , alone or in combination with other composite gardens , can conceivably cover a significant portion of the water - body on which it sits , it may also have significant desirable effect on water quality or on aquatic biota not directly associated with the floating gardens . structural modules will be thin sheets of any shape ( probably one to 4 inches thick ) having some flotation — preferably supplied by closed - cell foam but the flotation will not be great . instead , flexibility , ruggedness and strength of connections will be emphasized . flexibility and strength of connection can be enhanced by organic or metal line molded into the module ( in this case , ruggedness would primarily be determined by choice of close - celled foam ), enhanced by any acceptable durable substance ( organic or metal fabric or sheets ) embedded between buoyant layers , or enhanced by external organic or metal reinforcement near attachment points ( if this material possesses sufficient flexibility , it can even surround the perimeter of the structural module . because these structural modules will generally be connected to multiple garden modules and because the garden modules will have different net buoyancies as plants develop ( or different from the start because different styles of garden module are attached to one structural module ) and because each garden module may be independently acted on by waves , etc ., flexibility will be important to avoid great disturbance of one garden module to another through the structural module ( if necessary for a particular aquatic environment , the structural module can be spoke shaped rather than sheet shaped to enhance flexibility — possibly with a rugged fabric covering the spokes much like the membrane at the base of an octopus &# 39 ; tentacles ). there are a wide range of conventional connectors suitable for attachment but best connection may be achieved through a connector fabricated specifically for attaching these modules . envisioned is a metal cylindrical peg with two circumferential groves machined into it to allow for a retainer clip . the clip would have two cylindrical studs threaded or embedded into it and these studs would fit into the peg &# 39 ; s grooves and secure it to both the structural module or the garden module through shafts to accept the studs . rather than a cylinder , a bar shaped peg could be used with a hole drilled through it to line up with holes for a retainer pin in the module . a combination peg - retainer and snap or tie connector may also be practical . garden modules will have any practical shape or color . they will all have necessary buoyancy to float any soil or plants on the module without assistance from any other module . buoyancy can be achieved through any of a wide range of conventional materials and can be given a durable finish — when necessary — either through choice of buoyant material or through conventional means such as electroplating , gel - coat , or epoxy paints . just as there will be differing color or shape , there will be choices in modules that are functionally different . here , uniqueness will generally result from the modular construction . through conventional designs employing either molded one piece buoyant pads or buoyant frames with inserts , garden modules will be designed to support plants growing in soil with roots only in the soil , plants growing in soil with roots extending into the water , plants growing in conventional pots ( either draining to the water - body or in contact with the water - body ), hydrophytic or aquatic plants growing up through a buoyant pad and supported by a porous membrane or mesh , plants growing on a hydrophilic pad sitting atop a rigid porous support or spacer pad , and submerged trued aquatic plants growing in pots on an aquatically inert perforated metal or plastic tray . unique features will include : 1 ) weighted pendants , weighted perforated curtains , or relatively dense perforated inserts to provide stability on ponds with moderate wind and some wave action ; 2 ) a transparent plastic riser to prevent fish from jumping into the gardens and minimizing wave effects ( with a conventional greenhouse dome possible as an attachment ); 3 ) a below - the - flotation indent for holding suitable hydrophilic or aquatic bulbs ( held in place with mesh or by a lofty fabric if this buoyant pad is underlain by an insert as describe in item 6 ); 4 ) a means for holding seeds or transplants in place ( and add slow release fertilizer ) on the floating garden modules using reclaimed home carpeting or using a specially fabricated loft fabric material to wick water up from the water - body and sandwich the plant between 2 high pile layers that press enough against the plant to hold it in place particularly when roots fill irregularities in the surface between two fabric layers enough to add stability — while have gentle enough pressure to allow roots and stem to adventure along the face ( and in an extreme case the fabric can extend like a sock into the water column ); 5 ) a deep perforated metal or plastic insert ( or shaped rugged and aquatically inert fabric bag with a rigid collar ) for holding soil or a soil equivalent suspended well into the water - body ( to increase interactive surface area with the water - body while also allowing hydrophytic plant roots to remove nutrient exchanged from the water to the soil to supplement that which they take up directly ); 6 ) an metal or rugged formed / molded plastic insert that sits upon and partly encloses a buoyant frame of any suitable conventional buoyant material ( the insert acts as an exoskeleton and gives shape to the garden module , secures the buoyant framework in place through its weight upon that frame , provides for stability in the water - body , and provides that base for any planting method already described ( possibly having a concave depression to support a pile material to press upward against a bulb if a buoyant pad with bulb indent partly rests upon the insert ); 7 ) a soil or soil - equivalent used where soil is inserted into the water column as described above ( or where plants grow in soil with roots allowed to enter the water - body ) can be enriched in those nutrients that chemostat studies have determined are not the limiting nutrient for that water - body ( that allows these plants some level of robust growth while actively competing for the limiting nutrient ). an important aspect to this invention is the composite effect from placing these floating gardens on a water - body . because they can cover a large surface area , they can effectively compete for sunlight with algae ( that can quickly becomes so numerous that their respiration needs outstrip their oxygen output and they die and cause aesthetically unpleasing effects ). because differences in water transpiration , absorbed sunlight , and evaporation between the water - body and the garden can create surface water temperature differences , convection currents can result which will also result in changing biotic and chemical conditions . the gardens can pull nutrients directly from water - body and this may be enhanced where soil columns from the gardens extend into the water column . this may be further enhanced if fertilizers deficient in the limiting aquatic nutrient for the water - body on which the garden sits are applied to the soil or through slow release in the pads described above to support plants . because of irregularity in the bottom of these gardens , the structural complexity of the aquatic environment is increased . the greater the protrusion into the water column , the greater the complexity . this results in many new micro - environments . obvious will be attachment locations for periphyton and hiding places for small aquatic creatures . but just adding to the complexity may also change such things as how a predator seeks prey ( hidden or not ), etc . many of the changes made are likely yield results agreeable to most people .

US-22380302-A

the present invention discloses a method for making a multi - grain , whole grain baked snack food product with a soft , crunchy texture similar to a cracker . ingredient formula ranges have been determined that maximize the amount and number of nutritious whole grains present in the snack food , while still keeping the texture soft and crunchy , and the color and flavor acceptable . the ingredients are combined with water to make a dough , which is then sheeted and cut into pieces . the pieces are baked to produce a multi - grain , whole grain baked snack food .

the whole - grain , multi - grain baked snack food of the present invention is prepared using several different whole grain flours . as used herein , whole grains are cereal grains which retain the bran and germ of the grain kernel as well as the endosperm . by contrast , refined grains retain only the endosperm . the bran is the outer shell of the kernel , and is high in fiber , vitamins and minerals . the germ is located inside the seed , and is high in antioxidants ( especially vitamin e ) and b vitamins . the remainder of the interior of the kernel is the endosperm , which is mostly composed of carbohydrates and protein . thus , whole grains are nutritionally superior to refined grains , and richer in dietary fiber , antioxidants , protein ( particularly lysine ), dietary minerals ( including magnesium , manganese , phosphorus , and selenium ), and vitamins ( including niacin , vitamin b6 , and vitamin e ). moreover , the three different whole grain flours used in the present invention ( whole wheat flour , whole oat flour , and brown rice flour ) each contain different levels of these nutritious contents relative to one another . it is therefore understood that the use of several different whole grain flours in the present invention makes the snack food described herein nutritionally superior to whole grain products that only utilize one or two whole grain flours . the whole wheat flour used in the present invention is preferably stone ground , with a minimum protein content of 14 %, a maximum moisture content of 14 %, and a total amount of dietary fiber of about 10 . 5 % by weight . it is produced by conagra foods , inc . in omaha , nebr . under the brand name medium , whole wheat flour , stone ground . stone grinding creates the specific medium coarse granulation of this flour . the whole oat flour preferably has a maximum moisture content of about 11 % and a dietary fiber content of at least about 10 % by weight on a dry basis . it is produced by can - oat milling in portage la prarie , manitoba , canada under the brand name whole oat flour : 105 - 002 . the brown rice flour preferably has a moisture content of about 12 % and a total dietary fiber content of at least about 4 . 5 %. it is produced by sage v foods , llc in los angeles , calif . under the brand name stabilized brown rice flour bf - l04080 - 12 . this flour has been stabilized for extended shelf life . using high amounts of whole grain flours in baked snack foods typically imparts a rough , coarse texture into the snack food . thus , one novel aspect of the present invention relates to the methods employed to create a soft and smooth , yet crunchy texture into the snack food , instead of the rough , gritty texture generally associated with whole grain flours while still using relatively high levels of whole grain flours . one of the ingredients that helps soften the texture of this whole - grain snack food is starch that has a high content of amylopectin , or waxy starch . amylopectin is a branch - chained polysaccharide , whereas the other component of most starches , amylose , is a straight - chained polysaccharide . the starch used in the present invention is preferably waxy corn starch . while normal corn starch typically has a ratio of about 25 % amylose to about 75 % amylopectin , waxy corn starch contains about 100 % amylopectin . the waxy starch used in the present invention preferably contains about 100 % amylopectin starch and about 0 % amylose starch . the waxy texture of the amylopectin starch used in the present invention contributes to the final product characteristic softness . a waxy starch that can be used in the present invention is staley 7350 waxy no . 1 starch from tate & amp ; lyle , plc in london , u . k . this waxy starch contains about 100 % amylopectin . another ingredient in the snack foods described herein that contributes to the final product softness is the addition of potato flakes . potato flakes are made from potatoes that have been cooked , mashed , and dried . for example , idaho pacific corporation in ririe , id . produces potato flakes under the brand name potato flakes # 124 that can be used as herein described . the potato flakes impart a soft , light and flaky texture to the snack food of the present invention that helps counteract the roughness of the whole grain flours used . other ingredients that contribute to the final product softness are the emulsifiers and leavening agent used in the present invention . the first emulsifier is a soy based lecithin powder , for example solec g - ex available at the solae company in st . louis , mo . lecithin is a mixture of various phospholipids , and is extracted from soybean oil . the second emulsifier is a mixture of mono and diglycerides . glycerides are esters formed from glycerol and fatty acids . a monoglyceride comprises one fatty acid chain covalently bonded to a glycerol molecule through an ester linkage . a diglyceride comprises two fatty acid chains covalently bonded to a glycerol molecule through ester linkages . the ratio of monoglycerides to diglycerides in the emulsifier used in the present invention is about 44 % to about 48 % monoglycerides , and about 38 % to about 42 % diglycerides . such a mixture of mono and diglycerides can be obtained from american ingredients company in kansas city , mo . under the brand name bfp 64k . another ingredient that contributes to overall product softness is double acting baking powder , for example eagle brand double acting baking powder . double acting baking powder contains two acid salts , one which reacts at room temperature , causing the dough to rise as soon as it is prepared , and another which reacts at a higher temperature , causing a further rise during baking . the double acting baking powder gives the final snack product a light texture that is interpreted by the consumer as a soft texture , and helps counteract the roughness of the whole - grain flour . the double acting baking powder can impart a bad aftertaste used in quantities higher than about 3 % of the dough by weight . the low levels of leavening agents used in this invention to produce a cracker - like snack food with a soft , crunchy texture comprise yet another novel aspect of this invention . as stated previously , the whole grain flour contributes to the crunchiness of the final snack product . another ingredient that gives the product crunchiness is the addition of pregelatinized and / or chemically modified starch from corn , potato or other origin . pregelatinized starches have been thermally processed so that they can form pastes or gels when mixed with cold water . these starches , when cooked , impart the desirable crunchy texture to the snack food product of the present invention . chemically modified starches have been chemically processed to alter their physical properties to provide an expanded and crunchy product . examples of chemical modifications include , without limitation , cross - linking , substitution , and conversions . in one preferred embodiment , water is added to the dry ingredients to make a multi - grain , whole grain dough . the resultant dough comprises about 5 % to about 25 % whole wheat flour , about 5 % to about 20 % refined wheat flour , about 5 % to about 15 % modified and / or pregelatinized starch , about 5 % to about 15 % waxy starch , about 1 % to about 8 % brown rice flour , about 1 % to about 8 % whole oat flour , about 1 % to about 8 % potato flakes , less than about 3 % lecithin powder , less than about 1 % mono and diglycerides , less than about 2 % double acting baking powder , and about 15 % to about 30 % added water . all percentages used herein are by weight unless otherwise noted . in a more preferred embodiment , the resultant dough comprises about 10 % to about 20 % whole wheat flour , about 5 % to about 15 % refined wheat flour , about 7 % to about 13 % modified and / or pregelatinized starch , about 7 % to about 13 % waxy starch , about 2 % to about 6 % brown rice flour , about 2 % to about 6 % whole oat flour , about 2 % to about 6 % potato flakes , less than about 2 % lecithin powder , less than about 1 % mono and diglycerides , less than about 1 % double acting baking powder , and about 15 % to about 25 % water . in the most preferred embodiment , the resultant dough comprises about 15 % to about 20 % whole wheat flour , about 10 % to about 15 % refined wheat flour , about 9 % to about 12 % modified and / or pregelatinized starch , about 9 % to about 12 % waxy starch , about 3 % to about 6 % brown rice flour , about 3 % to about 6 % whole oat flour , about 3 % to about 6 % potato flakes , less than about 2 % lecithin powder , less than about 1 % mono and diglycerides , less than about 1 % double acting baking powder , and about 18 % to about 25 % water . referring to fig1 , therein is depicted a flowchart indicating the general processing steps for producing the baked snack food product of the present invention . in the first processing step , the dry ingredients 102 are mixed with water 104 and other ingredients in a continuous , batch or other mixer 106 to produce a dough . the mixing preferably occurs at ambient temperature , generally about 60 ° f . to about 95 ° f ., and the dough exits the mixer between about 85 ° f . and about 95 ° f . more preferably , the water is chilled to about 40 ° f . to about 60 ° f . before it is added to the mixer in order to reduce the temperature of the dough exiting the mixer , thus reducing the likelihood of the dough sticking to the rollers during the sheeting step . using chilled water will reduce the dough temperature by about 5 to about 20 degrees , depending on the extent of the water chilling and the amount of heat generated during mixing . the dough then undergoes a sheeting step 108 , whereby the dough is compressed between a pair of counter rotating sheeter / cutter rollers that are located closely together , thereby providing a pinch point through which the dough is formed into sheets . the sheet of dough is preferably between about 0 . 050 inches and about 0 . 055 inches thick , and more preferably about 0 . 053 inches thick after the sheeting step . the preferred thickness is preferably accomplished by passing the dough through several successive stages , with each successive stage having the rollers located progressively closer together , more preferably 2 , 3 or 4 stages of rollers . passing the dough through several stages of rollers minimizes the amount of work done on the dough during the sheeting step by any particular set of rollers , thereby reducing the influence of the sheeting step on the physical properties of the dough that are established during the mixing step . the pregelatinized starch and / or modified starch in the dough aids in holding the dough together in order to form a continuous sheet . the sheet of dough is then cut into a plurality of pieces 110 , preferably using a rotary cutting unit . the pieces are then baked in an oven 112 at between about 240 ° f . and about 500 ° f . to form a snack food having a moisture content between about 1 % and about 3 % of the total product weight . the snack food can then be seasoned 114 in a seasoning tumbler and then packaged . the resultant snack piece in one preferred embodiment comprises about 10 % to about 25 % whole wheat flour , about 5 % to about 20 % enriched wheat flour , about 5 % to about 20 % modified starch , about 5 % to about 20 % waxy starch , about 1 % to about 9 % potato flakes , about 1 % to about 9 % whole oat flour , about 1 % to about 9 % whole rice flour , about 1 % to about 3 % water , less than about 3 % lecithin , less than about 1 % glycerides , and less than about 2 % leavening . the resultant snack piece in another preferred embodiment comprises about 15 % to about 25 % whole wheat flour , about 10 % to about 20 % enriched wheat flour , about 10 % to about 20 % modified starch , about 10 % to about 20 % waxy starch , about 2 % to about 8 % potato flakes , about 2 % to about 8 % whole oat four , about 2 % to about 8 % whole rice flour , about 1 . 5 % to about 3 % water , less than about 2 % lecithin , less than about 1 % glycerides , and less than about 1 % leavening . the table below illustrates the ingredients and their relative amounts that were used to make a multi - grain , whole grain snack food product with a soft , crunchy texture similar to that of a cracker : in this embodiment , dry ingredients were combined in a dry ribbon batch mixer for approximately 4 minutes . the dry ingredient mix then passed through a twin - screw extrusion continuous dough mixer for about 42 seconds that added the honey , water and oil to create the dough . the dough exited the mixer at between 85 ° f . and 92 ° f . the dough was then sheeted using 2 stages of rollers to produce a sheet of dough about 0 . 053 inches thick . the sheet of dough then passed through a rotary cutting step that produced a plurality of square shaped pieces . the pieces were then baked in a wolverine jet impingement oven for 65 seconds at 425 ° f . to produce partially baked snack pieces having a total moisture content between 3 . 5 % and 6 . 5 % by weight . the partially baked pieces were then dried in a wenger convection oven for 7 minutes at 240 ° f . to a final moisture content between 2 % and 2 . 5 %. the final snack pieces were then seasoned using a tumbler , where they were lightly sprayed with oil and salt . the table below illustrates the ingredients and their relative amounts that were used to make a multi - grain , whole grain snack food product with a soft , crunchy texture similar to that of a cracker : table ii wt . % wt . % dry wt . % seasoned ingredient ingredients dough product whole wheat flour 21 . 25 % 16 . 39 % 19 . 82 % refined wheat flour 14 . 16 % 10 . 93 % 12 . 66 % modified starch 12 . 75 % 9 . 84 % 12 . 45 % waxy starch 12 . 75 % 9 . 84 % 11 . 53 % corn oil 10 . 62 % 8 . 20 % 13 . 00 % corn syrup 4 . 53 % 3 . 50 % 3 . 86 % sugar ( granulated ) 3 . 40 % 2 . 62 % 3 . 53 % honey 4 . 25 % 3 . 28 % 3 . 60 % brown rice flour 4 . 25 % 3 . 28 % 3 . 89 % whole oat flour 4 . 25 % 3 . 28 % 3 . 97 % potato flakes 4 . 25 % 3 . 28 % 4 . 09 % lecithin powder 0 . 00 % 0 . 00 % 0 . 00 % wheat germ 1 . 42 % 1 . 09 % 1 . 37 % mono & amp ; diglycerides 0 . 85 % 0 . 66 % 0 . 88 % double acting baking 0 . 42 % 0 . 33 % 0 . 42 % powder ammonium bicarbonate 0 . 42 % 0 . 33 % 0 . 42 % salt 0 . 28 % 0 . 22 % 0 . 90 % annatto 0 . 14 % 0 . 11 % 0 . 13 % seasoning — — 1 . 99 % added water — 22 . 84 % 1 . 91 % in the above embodiment , all of the ingredients were mixed in a batch mixer for about 8 minutes . the resulting dough exited the mixer at between 88 ° f . and 95 ° f ., and was allowed to rest for about 20 minutes . the dough was then sheeted using 4 stages of rollers , which produced a sheet of dough approximately 0 . 053 inches thick . the sheet of dough was cut into individual pieces of dough square in shape . the dough pieces were then baked in an apv direct fired gas oven at 400 ° f . for 5 . 5 minutes to produce baked snack pieces having a moisture content of between about 2 % and about 2 . 5 %. the baked snack pieces were then seasoned using a tumbler , where they were lightly sprayed with oil and salt . the baked snack pieces produced by both of the above examples had the desired soft , crunchy texture similar to the texture of a cracker . the hardness and crunchiness of the snack pieces were measured using a 6 millimeter diameter magness taylor probe mounted on a texture analyzer such as a ta . xt2 texture analyzer manufactured by stable micro systems , ltd . in godalming , surrey , u . k . and distributed in north america by texture technologies corp . in scarsdale , n . y . in order to determine the texture of the snack piece , it undergoes a texture testing protocol . for purposes of this application , the texture testing protocol for the present invention is as follows : ( 1 ) mount the snack piece on a solid base support with a diameter of about 20 millimeters and a hole centered under the probe ; ( 2 ) puncture a hole in the snack piece using a magness taylor probe having a 6 millimeter diameter traveling at a speed between about 1 millimeter per second and about 20 millimeters per second through a distance of about 3 millimeters ; ( 3 ) measure and plot the force required for the probe to break through the snack piece in grain force versus time . the maximum force ( in grams ) of the resulting puncture curve is the characteristic hardness of the snack piece . the slope of the puncture curve reflects how fast the cracker crumbles and disintegrates , which is the characteristic crunchiness of the snack piece . the crunchiness is expressed in force per time or , with respect to the present invention , grams per second . the snack piece of the present invention has a hardness measured pursuant to the texture testing protocol of between about 8000 grams of force to about 13000 grams of force . the snack piece of the present invention has a crunchiness measured pursuant to the texture testing protocol that ranges from about 8000 grams per second to about 12000 grams per second . hereinafter , when applicants refer to the texture testing protocol in either the specification or the claims , applicants intend that the term texture testing protocol means using the specific testing methods and equipment described above . in addition , the snack pieces contained high levels of multi - grains and whole grains , and met the other industry established guidelines for nutrition . specifically , the baked snack pieces had less than 35 % of their calories from fat , 1 gram or less of saturated fat per serving , zero trans fat , no more than 60 mg of cholesterol and no more than 270 milligrams of sodium per serving , and more than 10 % of the fda recommended daily value of fiber per serving . in sum , the result is a healthy , nutritious , multi - grain , whole grain snack having a soft , crunchy texture similar to a cracker .

US-37029409-A

the apparatus paces a heart in accordance with the heart / pacer rate needed to produce a required cardiac output while a person is exercising or undergoes emotional stress in response to changes in venous blood vessel diameter . the apparatus includes a pacer adapted to be implanted in a human body and having a pulse generator and control circuitry , which may be realized by a microprocessor , therein ; a pacing lead adapted to be implanted in a heart having a tip electrode adapted to engage and supply pacing pulses to a right ventricle of a heart ; a piezoelectric sensor for determining changes in diameter of a vein in the human body ; and computing circuitry including the control circuitry , for relating the changes in venous blood vessel diameter with the required pacing rate needed to supply a desired cardiac output and for causing the pacer to pace the heart at the required rate when the heart is not naturally paced .

referring now to the drawings in greater detail , there is illustrated therein a pacing system 10 constructed according to the teachings of the present invention which includes a pacer 12 having a microprocessor 14 therein , a pacing lead 16 which extends from the pacer 12 through a vein 18 which connects with the superior vena cava 20 leading to the right atrium 22 of a heart 24 . the lead 16 extends through the right atrium and into the right ventricle 25 where a tip electrode 26 of the lead 16 is positioned adjacent the apex of the right ventricle 25 . although the pacing system 10 is shown as being a single chamber unipolar system , it is to be understood that it could be a bipolar system or a dual chamber unipolar or bipolar system . in accordance with the teachings of the present invention , a portion 30 of the lead 16 which is adapted to be received in a portion 32 of the vein 18 has a sensor 34 mounted in the body 36 of the lead 16 so as to be exposed to or be positioned on the outer cylindrical surface 38 of the lead body 36 . the sensor 34 can be of any conventional type and is preferably a piezoelectric or bimorph type sensor 34 which can be made very thin . a pair of conductors 41 and 42 are mounted in the wall of the lead body 36 and connected between the piezoelectric sensor 34 and the pacer 12 for providing electrical signals when a pressure or force is exerted upon the sensor 34 such as the force of the contracting vein 18 . also , in the unipolar lead 16 illustrated in the figs ., the lead body 16 has mounted therein a coiled conductor 44 ( or multiple conductors which are connected in parallel ) that extends between the tip electrode 26 and the pacer 12 for transmitting electrical signals picked up by the tip electrode 26 or for supplying electrical pulses from the pacer 12 to the tip electrode 26 . as a result of exercise , stress or emotion , a decrease in po 2 and increase in pco 2 in the blood will occur . also , a change in ph can occur . such changes result from the increased metabolism in the body and such changes are not anticipatory in nature . however , cardiovascular changes appear in the body in anticipation of a behavior . in this respect , immediately prior to or during the early stages of exercise , stress or emotion , the sympathetic nervous system acts to constrict the lumen of central , visceral and peripheral veins , such as vein 18 which can be a cephalic , external jugular , or other vein on either the right or left side of the body . this constriction increases venous return of blood to the heart 24 . such increased venous return brings about an increase in atrial and ventricular contractions ( heart rate ) resulting in an increased cardiac output ( cardiac output = heart rate x stroke volume ). also , this sympathetic neural component of regulating heart rate is independent of the fluid conduction system of the heart or the electrical stimulation system for stimulating the heart and is anticipatory of a need , i . e . a need for increased cardiac output . according to the teachings of the present invention , the rate of pacing is controlled by the microprocessor 14 in the pacer 12 relative to changes in the diameter of the vein 18 so that a closed loop cardiac pacing system is provided with the sensor 34 , the pacer 12 and the tip electrode 26 . as shown in fig2 the vein 18 is shown in a relaxed non - constricted or dilated state with an inner diameter d 1 . with the vein 18 in this state , no pressure is exerted on the pressure sensor 34 and accordingly , no signal is transmitted from the sensor to the cardiac pacer 12 . however , when a need is anticipated by the sympathetic nervous system , the wall of the vein 18 is contracted and constricted so as to exert pressure on the sensor 34 . a change of potential generated by the deformation of the piezoelectric sensor 34 is transmitted to the cardiac pacer 12 by the wire conductors 41 and 42 . it is to be noted that the piezoelectric sensor 34 is used to detect the force of the constricting vein 18 and not blood pressure . the amount of change in the diameter of the venous blood vessel 18 is indicative of the anticipated need for increased cardiac output and the electrical signals generated by the piezoelectric sensor 34 and transmitted to the cardiac pacer 12 indicate to the microprocessor 14 that a change in the rate of stimulation of the heart is required . the changes in the rate of stimulation relative to changes in the diameter of the vein 18 are controlled by a program or algorithm stored in the microprocessor 14 . the steps carried out by the program or routine for controlling changes in the rate of stimulation relative to changes in the venous blood vessel diameter are shown in fig4 and can be defined as follows : step 1 . here the changes in blood vessel diameter relative to measurements of blood vessel diameter are calculated . step 2 . here the microprocessor makes use of the calculated change in blood vessel diameter to determine the appropriate change in rate of stimulation relative to the change in blood vessel diameter as determined from a lookup table of such values . step 3 . here the rate r t is calculated . the rate r t is the rate at which the cardiac pacer should stimulate the heart based upon the change in rate and the existing rate . step 4 . at step 4 , the newly calculated value for the rate r t is compared to a programmed maximum rate r max at which the cardiac pacer 12 can stimulate the heart . if the cardiac pacer 12 is operating at its programmed maximum rate , the prior rate is replaced by the programmed maximum rate at step 5 and the program loops to step 9 where the venous blood vessel diameter value is stored in the memory of the microprocessor 14 for comparative purposes . step 5 . if the newly determined rate r t is at or above the programmed maximum rate , the programmed maximum rate replaces the prior rate . step 6 . if the newly determined rate r t is not at the programmed maximum rate of the cardiac pacer 12 , the new value of the rate r t is compared to the programmed mimimum rate r min at which the cardiac pacer 12 can stimulate the heart . if the cardiac pacer 12 is operating at its programmed minimum rate , and the newly determined rate is at or less than the programmed minimum rate , the prior rate is replaced by the programmed minimum rate at step 7 and the program loops to step 9 for storing of the present blood vessel diameter in the memory of the microprocessor 14 for comparative purposes . step 7 . if the newly determined rate r t is less than or equal to the programmed minimum rate , then the prior rate is replaced by programmed minimum rate . step 8 . if the newly determined or calculated rate r t is between the maximum rate and the minimum rate , then the program replaces the previously calculated rate r t - 1 with the newly calculated rate r t . step 9 . at this step , the present value of the blood vessel diameter is stored in the memory of the microprocessor 14 . in the program represented by the flow chart shown in fig4 the pacer rate changes , δr t , may be smoothed by smoothing the changes in venous blood vessel diameter , δd t . this can be done in several ways . one approach is to compute the sign ( positive or negative ) of the result of δd = d t -( d t - 1 ) when d t is measured and compare the sig ( positive or negative ) to the sign of the n - 1 previously computed differences which have been stored in the memory . if no sign change has occurred in n consecutive samples , the algorithm then proceeds to determine the appropriate rate change . this is done with a subroutine as shown in fig5 which is inserted between steps 1 and 2 of the flow clart shown in flg . 4 . steps 1b - 1d . these steps define a counting loop for indexing the subscripts of the previously calculated δd &# 39 ; s stored in the memory of the microprocessor 14 starting with a count k = 0 . step 1e . if k = n + 1 at step 1d , at step 1e the sign of δd t is stored and all the subscripts are decremented by 1 . then the microprocessor 14 , or algorithm carried out therein , continues to step 2 of the program shown in fig4 . step 1f . if k ≠ n + 1 at step 1d , at step 1f , a determination of the sign of the present δd is made to see if it is equal to that of one of the previous n - 1 δd &# 39 ; s stored in the memory . if the answer is yes , the microprocessor / program loops back to step 1c to increment the subscript of a previously stored δd for the next comparison . step 1g . if the sign of the present δd is not equal to that of one of the previous n - 1 δd &# 39 ; s , the sign of the present δd is stored and all stored signs are decremented or moved down one level in the memory stack having a height n - 1 . then the microprocessor / program returns to step 1a . from the foregoing description , it will be apparent that the pacing system 10 of the present invention has a number of advantages , some of which have been described above and others of which are inherent in the invention . in particular , the system 10 can be used solely by itself for controlling pacing rate relative to changes in venous blood vessel diameter alternatively , the pacing system 10 can be utilized in conjunction with another system for controlling pacing relative to the change of a physiological parameter which changes during exercise but which may change as a result of exercise such that there is a time lag between the need for increased cardiac output as exercise begins and before the change in the physiological parameter is sensed . see for example u . s . pat . no . 4 , 566 , 456 issued on jan . 28 , 1986 to gerrit koning and edward schroeppel for : apparatus and method for adjusting heart / pacer rate relative to right ventricular systolic pressure to obtain a required cardiac output , u . s . pat . no . 4 , 716 , 887 issued on jan . 5 , 1988 to gerrit koning and edward schroeppel for apparatus and method for adjusting heart / pacer rate relative to cardiac pco 2 to obtain a required cardiac output and u . s . pat . no . 4 , 768 , 143 issued on nov . 24 , 1987 to edward schroeppel for method for controlling pacing of a heart in response to changes in stroke volume the disclosures of which are incorporated herein by reference . in such a system , the sensor for sensing changes in venous blood vessel diameter of the present invention can be added to a lead having another heart function parameter sensor , such as sensor 50 shown in fig1 and a suitable program can be provided for enabling that sensor to initially control changes in pacing rate as the body anticipates the need for exercise . then such other system can take over the control of adjustment of pacing rate as the physiological parameter sensed by that system changes and such changes are sensed by that system . the manner in which the sensors 34 and 50 are coupled to the microprocessor 14 in the pacer 12 and utilized by the microprocessor 14 to control pacing of the heart will be readily apparent to those skilled in the art . however , to the extent that further details as to how such control can be effected will be helpful to the understanding and utilization of the method and apparatus of the present invention , reference is made to u . s . pat . nos . 4 , 428 , 378 and 4 , 566 , 456 , the disclosures of which are incorporated herein by reference . the anderson et al u . s . pat . no . 4 , 428 , 378 and the koning et al u . s . pat . no . 4 , 566 , 456 each disclose a pacer and a pacing lead with a pacing electrode which is controlled by variation in a human function parameter according to an algorithm and each discloses a microprocessor , a sensor , circuit connections therebetween and circuitry in , or associated with , the microprocessor for carrying out the algorithm to control pacing rate during exercise when the heart is not naturally paced at the rate required during exercise . anderson et al teaches control of pacing relative to sensed human body mechanical activity and koning et al teaches control of pacing relative to changes in maximum pressure sensed in a right ventricle . also it will be apparent from the foregoing description that modifications can be made to the pacing system 10 of the present invention without departing from the teachings of the present invention . for example , the means for detecting or sensing changes in venous blood vessel diameter could be other than a piezoelectric sensor . for example , an ultrasound sensor or an optical sensor could be utilized for sensing venous blood vessel diameter changes . accordingly , the scope of the present invention is only to be limited as necessitated by the accompanying claims .

US-83008986-A

a device is disclosed for dispensing a fluid supplied from an external fluid source . the device comprises a transducer adapted to receive a fluid from the fluid source , and a collapsible linkage coupling the transducer and the fluid source . the linkage has a collapsible joint inhibiting discharge of the fluid source when in a locked orientation . the device further comprises a movable member coupled to the linkage such that inhalation forces on the device cause the linkage to collapse thereby discharging the fluid from the fluid source . the device may further include a dose counter coupled to the fluid source for registering the amount of doses administered from the fluid source .

referring more specifically to the drawings , for illustrative purposes the present invention is embodied in the apparatus generally shown in fig1 a through fig2 d . it will be appreciated that the apparatus may vary as to configuration and as to details of the parts , and that the method may vary as to the specific steps and sequence , without departing from the basic concepts as disclosed herein . referring first to fig1 a and 1b , an inhaler 20 of the present invention is shown in an exploded view with a breath actuation assembly 100 and a dose counter assembly 130 . the breath actuation assembly 100 and the dose counter assembly 130 are housed along with medicament fluid source 22 inside front cover 42 , back cover 44 , and top cap 54 , all preferably comprising medical grade plastic or other suitable materials known in the art . fluid source 22 may comprise a conventional metered dose inhaler ( mdi ) container or other propellant based medicament readily available in the art . fluid source 22 generally comprises container 108 holding a mixture of medicament and propellant , and nozzle 110 , which is in line with the discharge axis 86 of the container 108 , as shown in fig6 b . when the container 108 is advanced relative to the nozzle 110 in the direction of the discharge axis 86 ( i . e . the nozzle 110 is pushed into the container 108 ), the medicament is discharged out the nozzle 110 in the direction of the discharge axis 86 . turning now to fig2 a through 2c , inhaler 20 is shown in an assembled configuration with dust cover 40 pivotally mounted to cover inhalation horn 58 . the dust cover 40 may be rotated away from horn 58 to expose opening 60 , as shown in fig2 b . a manual release button 62 , as shown in fig2 c , may also be incorporated into the back cover 44 . top cap 54 has an opening 56 to give visual access to display wheel 52 . referring also to fig1 b and 3a through 3 e , the breath actuation assembly 100 comprises a housing or transducer 32 that rotatably houses lower link 28 at pivot 78 . lower link 28 is connected to upper link 26 at collapsible joint 66 . reference may also be made to fig5 a - 6b , wherein the transducer is illustrated in greater detail . container holder 24 is shaped to receive the nozzle end of container 108 such that the nozzle 110 passes through to contact surface 112 of the transducer 32 . container holder 24 also has a pair of guides 122 having slots 90 sized to house a pair of bosses 92 as shown in fig7 a at the upper end of upper link 26 . as shown in fig3 a through 4b , flap 34 is rotatably mounted to the transducer 32 via peg 98 , which extends across the top surface of flap 34 , and holes 114 in the sidewalls of transducer 32 . the bottom and side extremities of flap 34 are sized to fit within the internal surface of transducer 32 to form gap 76 . the flap 34 has an upper restraining surface 72 configured to retain arm 74 of lower link 28 when the flap is in its nominal position shown in fig4 b . as illustrated in fig6 a and 6b , the transducer 32 is configured to receive nozzle 110 of fluid source 22 at surface 112 . the transducer also comprises an inlet 106 that spans from surface 112 to a first chamber 102 . the inlet 106 is configured to be in line with the nozzle 110 and discharge axis 86 such that medicament discharged from the fluid source 22 is received through the inlet 106 and downstream into first chamber 102 . the transducer 32 is also configured to receive plug 38 having bluff surface 104 . fluid entering chamber 102 through inlet 106 is dispersed and redirected by plug 38 and into outlet 124 that terminates downstream at section 68 of second chamber 64 . the fluid dispersion characteristics of transducer 32 can be seen in greater detail with reference to u . s . pat . no . 4 , 972 , 830 and ep308524b , which are expressly incorporated by reference herein . the fluid source 22 is biased to discharge along axis 86 by compressing a loading member , such as biasing spring 48 , between the top cap 54 and container sleeve 46 , which is adapted to receive the other end of the container 108 opposite the nozzle 110 . biasing spring 48 preloads the container 108 to move in the direction of surface 112 of transducer 32 along the discharge axis 86 . in the stowed configuration shown in fig3 a , the fluid source container 108 is retained from translating along axis 86 by a collapsible linkage comprising upper link 26 and lower link 28 . upper link 26 and lower link 28 are rotatably coupled at a collapsible knee - type joint 66 . the upper end of upper link 26 has a pair of bosses 92 that are retained by a pair of guides 122 in the container holder 24 having slots 90 . the guides are generally in - line , or at least parallel with the discharge axis 86 , and allow motion of the bosses 92 ( see fig7 a ) of the upper link to slideably translate upward and downward in the discharge axis 86 , as well as allow the boss to rotate as necessary . the lower link 28 has one end fixed to the transducer 32 at pivot 78 . as illustrated in fig3 a , the boss 92 of the upper link 26 and pivot 78 of the lower link are essentially in - line with discharge axis 86 , i . e . they form a loading path that is parallel to , or aligned with the discharge axis 86 . because collapsible joint 66 is off - center , i . e . positioned away from the loading path formed by the boss 92 of the upper link 26 and pivot 78 , the downward force imposed by biasing spring 48 on the container 108 in the stowed position predisposes the knee joint 66 to collapse . such collapse is restrained in the stowed position by imposition of arm 74 of lower link 28 on flap 34 . fig3 b illustrates the initiation of the breath actuation mechanism 100 caused by inhalation by a patient through the opening 60 of horn 58 . as shown in fig3 b - 3c and 4 a , an outward airflow 80 is created in the second chamber 64 , which pulls through a plurality of slots 70 in the transducer . suction of air through slots 70 creates a small pressure differential 82 across the inner surface of flap 34 , causing the flap to rotate about peg 98 and into the cavity of the transducer 32 , as illustrated in fig3 a and 3b . the gap 76 between the flap 34 and the transducer 32 provides enough clearance to allow the flap to rotate into the cavity of the transducer , while also being small enough to allow a pressure differential with minimal suction on the horn . as the flap 34 rotates , arm 74 of the lower link 28 is no longer retained by the upper surface 72 of the flap , and the arm 74 clears the flap 34 through recess 88 as the lower link 28 is allowed to rotate about pivot 78 . with rotation of the lower link 28 as shown in fig3 c , the collapsible joint 66 moves over center , allowing the container holder 24 and container 108 to translate downward along axis 86 , forcing a portion of the nozzle 110 into the container 108 to stimulate discharge of the medicament from the container 108 . the medicament travels through the first chamber 102 and into the second chamber 64 where it is entrained with air flowing through slots 70 , as described in further detail in u . s . pat . no . 4 , 972 , 830 , previously incorporated by reference . in the embodiment shown , the second chamber 64 has an internal cross section that is shaped like a parabola . the entrained medicament flows through the second chamber 64 and out of the opening 60 of horn 58 to be inhaled by the patient . therefore , the release of the metered dose of medicament is timed to be inhaled by the patient at an optimal moment during the inhalation phase of the patient &# 39 ; s breath cycle . after the inhalation of the dose by the patient , the flap is returned to its nominal position shown in fig3 d by a return force exerted by flap spring 36 . flap spring 36 is a metallic rod or wire assembled between retention arms 96 of the transducer 32 and flange 94 on the flap 34 . rotation of the flap bends the spring to create a return force to return the flap 94 to its nominal position after the inhalation forces have subsided . the upper and lower links 26 , 28 , container holder 24 , and container 108 remain in the collapsed discharge position as seen in fig3 d due to the force imposed by the biasing spring 48 . the return of the dust cover 40 ( described in greater detail with reference to fig7 a - 7e below ) to cover the horn 58 manually forces the container holder 24 and container 108 to return to the stowed position under compression from biasing spring 48 . return torsion spring 30 is mounted on lower link 28 to engage the transducer 32 such that a torsional force is exerted on the collapsible linkage to return to the locked configuration . the collapsible joint 66 is thus retained from collapsing once the dust cover 40 is again opened . turning to fig7 a - 7e , the operation of the dust cover 40 will now be described . in the present embodiment , the dust cover 40 not only serves as a shield to cover horn entrance 60 , but it also serves to reset the container to the stowed position after discharge of the medicament . fig7 a illustrates inhaler 20 in a stowed configuration with the dust cover 40 shielding the entrance 60 to horn 58 . the dust cover 40 is pivotably connected to the transducer 32 such that it can be rotated out of place to allow access to the horn opening 60 . in alternative embodiments , the dust cover may be pivotably connected to either the front or back covers 42 , 44 . the dust cover 40 has two cams 120 , which are configured to engage the bottom surface of guides 122 of container holder 24 through its entire range of motion along axis 86 . when the dust cover 40 is rotated about pivot 118 ( shown in fig7 b ), the cams disengage guides 122 . the container holder 24 and container 108 remain in the stowed position from the over - center orientation of the collapsible linkage . fig7 c illustrates the breath actuation assembly 100 in the collapsed configuration with the container holder 24 and container 108 in the discharge position . the breath actuation assembly 100 is biased to remain in this configuration due to the compressive force of the biasing spring 48 . when the dust cover is rotated back toward the horn opening 60 , as shown in fig7 d , the cams 120 engage the bottom surface of guide 122 , pushing the container holder 24 and container 108 upward along axis 86 . when the dust cover 40 is in its final stowed position covering the horn entrance 60 , the cams 120 have pushed the container holder 24 to the stowed position , as shown in fig7 a . in this configuration , the return spring 30 has reset the breath actuation assembly 100 to the locked position , and movement of the container 108 will be retained by the dust cover cams independent of the collapsible linkage . the inhaler 20 preferably includes a dose counter for automatically counting the remaining doses left in the container after each discharge of the medicament . the inhaler may be configured with a dose counter having a number of different configurations , including mechanical or electrical counters . the operation of a preferred embodiment utilizing a mechanical dose counter assembly 130 will be described with respect to fig8 a to 12e . fig8 a illustrates inhaler 20 with dose counter assembly 130 configured above the container sleeve 46 . the container sleeve 46 is sized to receive the non - dispensing end of the container 108 . the container sleeve preferably has one or more tabs 132 having a boss 136 configured to engage the teeth of first wheel 50 disposed just above the container sleeve 46 . the embodiment shown in fig9 has two tabs 132 and bosses 136 . however , it will be appreciated that any number of tabs and bosses may be employed . referring back to fig8 a , first wheel 50 is a gear rotatably mounted in a horizontal orientation to top cap 54 . wheel 50 has a plurality of lower teeth 140 and upper teeth 138 disposed along the outer perimeter of wheel 50 . in a preferred embodiment , display wheel 52 is also rotatably mounted to top cap 54 in a horizontal orientation between first wheel 50 and the top cap . display wheel 52 has an opening 154 to allow clearance for column 142 of first wheel 50 that is vertically disposed to mount to top cap 54 . display wheel 52 has markings 150 to indicate the number of doses left in the container 108 based on the position of the display wheel 52 . as seen in fig2 a and 2b , the markings 150 that are showing through opening 56 in top cap 54 indicate the number of remaining doses . fig8 a - 8d illustrate the interaction between the container sleeve 46 and the first wheel 50 upon discharge of the fluid source 22 . when the container 108 is in the stowed position , boss 136 lines up on the perimeter of wheel 50 between two of the upper teeth 138 . as the container 108 and container sleeve 46 moves downward along the discharge axis as a result of the breath actuation mechanism , boss 136 contacts the upper incline of one of the lower teeth 140 , as shown in fig8 b . the boss 136 continues its translation along axis 86 , forcing the first wheel 50 to turn clockwise ( looking down from the top ) until the container 108 reaches the discharge position , as shown in fig8 c . when the dust cover 40 is closed to return the container 108 to the stowed position , boss 136 translates upward until contacting the lower incline of upper tooth 138 , as shown in fig8 d . the boss 136 continues its upward translation , forcing the wheel 50 to further turn clockwise until the container 108 reaches the stowed position , shown in fig8 a . when another dose is dispensed , the cycle repeats . the lower wheel 50 may be configured to vary the number of doses required to turn the lower wheel 360 degrees by varying the number of teeth . in the above embodiment , a 40 - tooth index was used . however , this number may be varied depending on the number of doses included in the container . fig1 a - 12c illustrate the interaction between the display wheel 52 and the lower wheel 50 . as shown in fig1 and in hidden line in fig1 a - 12c , the lower wheel 50 has a drive peg 144 disposed on the upper surface of the lower wheel . display wheel 52 has a plurality of semi - circular receiving pegs 152 disposed on the lower surface of the display wheel . as first wheel rotates about column mount 142 , drive peg 144 engages a first of the receiving pegs 152 and causes the display wheel 52 to rotate about mount 156 a specified distance along mark 150 , the specified distance indicating the range of doses left ( e . g . “ full 200 to 160 ”) ( see fig1 a ). at a portion of first wheel &# 39 ; s rotation , the drive peg 144 slips past the first of the receiving pegs 152 ( see fig1 b ) and continues to complete one full rotation ( 40 doses ) until contacting the second of the receiving pegs 152 ( fig1 c ). the cycle repeats itself until all the receiving pegs 152 are driven such that the “ empty ” indicator is displayed at window 56 when the specified number of doses has been dispensed . the effect of the gearing as shown in fig1 a - c is to scale the motion of the display wheel 52 with respect to the first wheel 50 . to change the scale of the motion , one or more additional driving pegs 144 may be disposed on the upper surface of the first wheel 50 . for example , a second driving peg ( not shown ) may be disposed 180 degrees from the first such that the display wheel would advances twice as fast relative to the first wheel for a container having 100 total doses . fig1 illustrates an alternative embodiment showing an inhaler having a breath actuated release mechanism 200 using a diaphragm 202 rather than the flap 34 shown in fig1 - 7e . the diaphragm 202 is configured to mount to transducer 204 and be sized so that a portion of the diaphragm deflects in response to inhalation forces from the patient . release mechanism 200 further includes a catch 204 coupled to the diaphragm and the lower link 208 to retain the collapsible linkage comprised of the lower link 208 and the upper link 210 . during use , inhalation forces from the patient deflect the portion of the diaphragm in communication with catch 204 . motion of the catch 204 allows lower link 208 to rotate past the catch , thereby allowing the 208 / 210 linkage to collapse and discharge fluid source 22 . fig1 - 17 illustrate another alternative embodiment of inhaler 300 having a load lever 302 and a breath actuated release mechanism 350 on top of fluid source 22 . by placing the release mechanism above the mdi container , the mechanism can be applied to any mdi actuator with minimal mold modification . inhaler 300 has a lower portion 304 housing fluid source 22 and a transducer ( not shown ) for dispersing the medicament . middle body 308 interfaces with lower portion 304 and slideably houses plunger 318 to selectively advance fluid source 22 downward to discharge the medicament . plunger 318 is retained from moving relative to middle body 308 by a collapsible linkage comprising lower link 320 and upper link 322 . plunger 308 is also configured to receive biasing spring 312 at its up extremity . the biasing spring 312 is shaped to receive spring cap 310 which may be depressed to compress spring 312 against plunger 318 in a downward discharge direction , as shown in fig1 a . to depress spring cap 310 , load lever 302 is rotatably attached to top shell 306 such that rotation of load lever 302 to a vertical orientation forces the spring cap 310 down to bias the plunger to discharge fluid source 22 . motion of the collapsible link 320 , and linkage 320 / 322 , is restrained by flap 316 . flap 16 is pivotably mounted such that inhalation forces cause it to rotate as illustrated in fig1 b , thereby allowing the lower link 320 to rotate downward such that linkage 320 / 322 collapses . the biasing force from spring 312 forces the plunger downward as illustrated in fig1 c . the load lever 302 is then reset to the first position , allowing the fluid source 22 to translate back to the stowed position illustrated in fig1 d . fig1 illustrates an embodiment of the inhaler 300 incorporating an electronic dose counter 324 . in such a configuration , flap 316 is coupled to trigger 326 , which depresses a sensor in dose counter 324 each time the flap is tripped to dispense a dose of medicament . dose counter 324 generally comprises a printed circuit board ( pcb ) and other electronic components such as an lcd to digitally display the dose count . alternatively , a mechanical dose counter may instead be incorporated into inhaler 300 in much the same way as the inhaler disclosed in fig9 - 12 , or fig2 a - 23 . fig1 through 20b illustrate another alternative embodiment of the present invention with inhaler 400 having a mechanical dose counter 420 that has a vertically mounted display wheel 422 . inhaler 400 has a load lever 402 that manually biases the fluid source 22 discharge upon downward motion . as illustrated in fig1 a , fluid source 22 is retained from discharging by collapsible joint 416 , which is formed by the junction of upper link 406 and lower link 408 . lower link is coupled to horizontally oriented flap 410 . inhalation forces on horn 404 cause air flow through port 412 into negative pressure chamber 414 such that a negative pressure is exerted on flap 410 to force flap 410 to rotate downward , as shown in fig1 b . with collapsible joint 416 away from the locked position , the fluid source is free to translate downward and discharge the medicament . fig2 a and 20b illustrate an alternative embodiment of using a dose counter 420 with a vertically oriented display wheel 422 . container sleeve 426 , adapted to receive the non - dispending end of container 22 , has a plurality of protrusions 434 . when the container cycles downward upon discharge , translation of the container sleeve 426 causes protrusions 434 to strike the teeth 432 of gear 424 , forcing the gear 424 to rotate clockwise . the clockwise rotation of gear 424 engages vertically oriented sprocket 430 of display wheel 422 , causing the display wheel 422 to turn . sprocket 430 may be configured to engage gear 424 at specified intervals to vary the rate of rotation of the display wheel 422 with respect to the rate of rotation of the gear 424 . referring now to fig2 a - f , another preferred embodiment is shown as dose counter mechanism 450 . in fig2 a , the mechanism 450 is in ready state ( prior to breath actuation ) with the canister sleeve 46 in the upward - most position in its travel . the canister sleeve 46 has a plurality of teeth 456 that are shaped to mate with and lock with the teeth 454 of a rotational member , or top link 452 . i . e ., both teeth 456 and 454 have opposing angled surfaces that shift the angular position of the top link 452 with the canister sleeve 46 when engaged . when mdi canister 22 ( shown in fig1 b ) is actuated , the canister sleeve 46 and top link 452 move downward . a compression load is generated on the top link 452 from count spring 462 , which is disposed between the display wheel 464 and top link 452 . the top link has a plurality of radial protrusions , or keys 460 which are positioned and sized to mate with the columnar tines 458 of cap bottom 466 . cap bottom 466 may be bonded to or integral with top cap 470 ( shown in fig2 ), such that the cap bottom 58 remains fixed during motion of the canister sleeve 46 . because of the compression force applied by the count spring 462 , the opposing inclined surfaces of the key 460 and cap bottom 466 cause the top link 452 to lift from the canister sleeve 46 and rotate 4 . 5 °, sliding on the opposing angled surfaces as seen in fig2 b . the top link is coupled to gear column 468 a such that gear column 468 rotates incrementally with rotation of the top link 452 referring now to fig2 c , the canister sleeve 46 continues to travel downward , following the keys 460 of the top link to push in between the columnar tines 458 of the cap bottom 466 . when the canister sleeve 46 has bottomed out , as shown in fig2 d , it will then rebound and then start moving up toward its original ready state position , pushing the top link 460 up with it . as the canister sleeve 46 moves up , the key 460 clears the tines 458 of the cap bottom 466 as shown in fig2 e . the teeth 456 of the canister sleeve 46 then re - engage the teeth 454 of the top link 452 , causing the top link 452 to rotate another 4 . 5 ° clockwise , as shown in fig2 f . this completes the full cycle of mdi canister actuation and the indexing mechanism rotated a total of 9 °. the indexing mechanism top link 452 has advanced 1 / 40th of a full revolution per actuation . referring now to fig2 a , the dose counter mechanism 450 is mounted on top of the breath actuation assembly 100 ( see fig1 b ). top cap 470 surrounds canister sleeve 46 , shown in fig2 b with a section of the top cap 470 removed for clarity . the top cap has a window 472 for showing the dose count as provided by the display wheel 464 . display wheel 464 has a display label 474 showing remaining dose counts from 0 to 200 in ten dose increments ( e . g . markings of 200 , 190 , 180 , etc .) fig2 illustrates a top portion of the top cap 470 cut out and display label 474 removed to show planetary gear mechanism 478 . the display wheel 464 is rotationally coupled to gear column 468 via three intermediary gears 476 . the three intermediary gears 476 of the planetary gear mechanism 478 are driven by the rotation of center gear column 468 . the teeth of the three intermediary gears 476 mate with the internal geared surface of the top cap 470 such that the display wheel 464 rotates clockwise . when the center gear column 468 rotates 9 ° due to motion of the indexing mechanism , the planetary gear will rotate the display wheel 1 / 10 of a graduation . the label is set to a resolution of 10 shots per indication , however may be altered to reflect different increments . after 200 actuations , the label will have advanced total of 260 °— going from “ 200 ” to “ 0 ” or “ empty ”. the planetary gear mechanism 478 has the effect of scaling down the rotational motion of the top link 452 and gear column so that the display wheel may rotate through 200 actuations in less than one full rotation . for smaller dose counts ( e . g . 120 or 60 count canisters ), the display wheel may simply be positioned so that the correct count is initially viewed through window 472 . alternatively , a different tooth count for the planetary gear mechanism 478 may be implemented along with changing the display label 474 to accommodate different total dose counts . referring to fig2 a - d , the breath actuation mechanism 500 is another preferred embodiment that incorporates a trip link 502 to increase the operational range of previously described breath actuation mechanism 100 shown in fig3 a through 4e . fig2 illustrates the breath actuation mechanism in ready ( non actuated , and loaded ) state . instead of interfacing directly with flap 34 , lower link 504 interfaces indirectly with flap 34 via trip link 502 . the upper link 506 and lower link 504 retain motion of the fluid source 22 and load f from biasing spring via locking knee joint 66 . knee joint 66 is located off - center from load f in discharge axis 86 ( i . e . the discharge axis 86 passes through pivot 78 and the boss 516 of upper link 506 throughout fig2 a - d ), thus the downward force imposed by biasing spring 48 on the container 108 in the ready position predisposes the knee joint 66 to collapse . the upper link 506 and lower link 504 are restrained from rotating or collapsing because the lower link 504 is locked from rotation from a catch , or trip edge 510 in trip link 502 . trip link 502 is locked from rotating because of impingement of upper surface ( contact surface ) 512 of the trip link 502 with a restraining surface , or circular cutout 514 , in flap 508 . referring now to fig2 b , when flap 508 rotates due to the force created by patent inhalation ( vacuum ), upper edge 512 if the trip link clears the cutout 514 , allowing the trip link 502 to rotate to rotate clockwise . trip edge 510 correspondingly rotates to release the contacting surface of the lower link 504 . with lower link 504 now unrestrained , as shown in fig2 c , knee joint 66 collapses and shifts to the left . because of constraints on the top edges of upper link 506 with container holder 24 , the upper link can only travel in line with the force load path f , and trip link 502 further rotates clockwise , causing lower link 504 to further rotate counter clockwise . referring now to fig2 d , the mechanism further collapses as lower link 504 continues to rotate counter - clockwise on joint 78 , 26 travels down allowing the mdi canister 22 to travel downward causing the valve stem to activate . after the activation , the canister travels upward such that the knee joint moves back toward its stowed orientation with lower link rotating clockwise toward trip link 502 . the trip link 502 is able to catch lower link 504 in trip edge 510 for retention of the knee joint 66 until subsequent breath actuation of flap 508 . the addition of trip link 502 over previously described embodiments expands the operational margin of the lower 504 with the flap 508 , improving overlap on trip edges to ease manufacturing tolerances while maintaining breath actuation sensitivity . although the description above contains many details , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . therefore , it will be appreciated that the scope of the present invention fully encompasses other embodiments which may become obvious to those skilled in the art , and that the scope of the present invention is accordingly to be limited by nothing other than the appended claims , in which reference to an element in the singular is not intended to mean “ one and only one ” unless explicitly so stated , but rather “ one or more .” all structural , chemical , and functional equivalents to the elements of the above - described preferred embodiment that are known to those of ordinary skill in the art are expressly incorporated herein by reference and are intended to be encompassed by the present claims . moreover , it is not necessary for a device or method to address each and every problem sought to be solved by the present invention , for it to be encompassed by the present claims . furthermore , no element , component , or method step in the present disclosure is intended to be dedicated to the public regardless of whether the element , component , or method step is explicitly recited in the claims . no claim element herein is to be construed under the provisions of 35 u . s . c . 112 , sixth paragraph , unless the element is expressly recited using the phrase “ means for .”

US-29930705-A

apparatus for providing image registration of a target , comprising a gamma camera that acquires a nuclear image of said target , an optical imager in a fixed or known relationship with respect to said gamma camera that acquires an optical image of said target and an image registrator operative to receive and register said nuclear image and said optical image .

[ 0036 ] fig1 is a representation of a nuclear image 120 , including a tumor 112 and nodes 240 that have absorbed a nuclear medicine agent , and an optical skin image 110 of a target 430 on a subject 438 . nuclear image 120 and optical skin image 110 are registered to provide a registered image 230 that includes an image of tumor 112 and nodes 240 and surface features of skin image 110 . by utilizing guideposts from optical skin image 110 in respect to image of tumor 112 and nodes 240 , the surgeon draws an incision tracing image on registered image 230 corresponding to the planned physical incision . in an exemplary embodiment , guideposts that aid in locating incision tracing image 310 consist of skin anatomy , for example a bone protrusion 258 . additionally or alternatively , landmarks comprise , for example , hair , birthmarks , scars , surface contours and / or tattoos . in an embodiment of the present invention , skin markers 464 are placed on target 430 to provide skin marker images 264 in optical skin image 110 that appear in registered image 230 . the surgeon makes an incision 190 in relation to skin markings 464 by viewing skin marking images 264 on registered image 230 . to accommodate a possible long delay between placement of skin markers 464 and the onset of surgery , skin markers 464 may be indelible , for example , for about 12 hours . optionally , skin markers 464 comprise a radiopaque paint that , for example , appears in nuclear image 120 as markers 264 and in optical skin image 110 as skin markers 264 ′. in an embodiment of the invention , an operator superimposes a picture of optical image 120 with skin markers 264 ′ on a picture of nuclear image 120 with markers 264 to provide registered image 230 with skin marking images 264 ′. in an embodiment of the present invention , an image registrator 450 ( fig3 ) registers images 110 and 120 to provide a single picture 488 that is , for example a hard copy , of registered image 230 . to provide registered image 230 , for example , image registrator 450 aligns markers 264 in received nuclear image 120 with skin markers 264 ′ in received optical skin image 110 . additionally or alternatively , the fields of view of a gamma camera 422 and an optical imager 420 are precisely aligned , for example on a gantry 400 , and received nuclear image 120 and optical skin image 110 are automatically registered by image registrator 450 . picture 488 includes landmarks and / or skin markers 264 ′, corresponding to skin markings 464 that appear on target 430 and is , for example , placed on an image viewer 392 ( fig3 ) in the surgical theater . prior to , or as surgery begins , the surgeon makes incision tracing image 310 on picture 488 that most efficiently encompasses tumor 112 and nodes 240 and uses it as a map for making incision 190 . additionally or alternatively , registered image 230 is provided on a viewing station 452 , or projected as an image from a projector 478 ( fig2 ) within the surgical theater that is viewed by the surgeon and used as a map by which the surgeon cuts skin incision 190 on target 430 . optionally , prior to donning sterile surgical garb , the surgeon manipulates controls 482 to produce incision tracing image 310 on viewing station 452 . optionally , viewing station 452 provides picture 488 and / or image from projector 478 that includes incision tracing 310 . the surgeon duplicates incision tracing image 310 on subject 438 as incision 190 , using the location of skin marker images 264 and / or anatomic landmarks as guideposts . optionally , viewing station 452 is programmable so an operator can program it to show multiple images , each image including , for example , incision tracing 310 , along with one or more anatomic landmarks , for example , nerves , cartilage , tumor or vascular tissue , as will be explained below . these images provide the surgeon with maps of the target 430 as he cuts incision 190 deeper to different levels of tissue . [ 0045 ] fig2 is a representation of projector 478 that projects registered image 230 , comprising registered images 110 and 120 onto a viewing area , for example target 430 . orientation controls 476 are used to change the position , orientation and / or size of projected registered image 230 so that skin marker images 264 properly align with skin markings 464 and registered image 230 is properly aligned with target 430 . registered image 230 , for example , is shown on screen 452 and controls 482 , for example , are used to draw incision tracing image 310 on screen 452 so that it appears on projected registered image 230 . registered image 230 , including incision tracing image 310 , is projected onto target 430 and manipulated , for example with orientation and size controls 476 to line up with target 430 . at the onset of surgery , the surgeon cuts physical incision 190 directly into the patient skin , following projected incision tracing image 310 . additionally or alternatively , the surgeon draws a guide on the patient skin following projected incision tracing image 310 , turns off projected image 230 and makes incision 190 along the guide . in an embodiment of the present invention , a non - sterile assistant operates orientation controls 476 to change position , orientation and / or size of projected registered image 230 . additionally or alternatively , sterile covers on controls 476 allow the surgeon to manipulate controls 476 while in the sterile operating theater . optionally , controls 476 are operated by surgeon voice activation in the operating theater . additionally or alternatively , controls 476 are non - sterile foot pedals accessible by the surgeon in the operating theater . in an embodiment of the invention , registered image 230 is aligned on target 430 and then skin image 110 is de - emphasized in projected registered image 230 , leaving nuclear image 120 projection and / or skin markers image 264 ′ projected on target 430 . the surgeon physically makes incision 190 directly on target 430 to encompass tumor 112 and nodes 240 . additionally or alternatively , skin image 110 is emphasized in registered image 230 and projected with skin markers 264 ′ and the surgeon makes incision 190 on target 430 according to skin markers 264 ′. additionally or alternatively , components of registered image 230 , for example anatomic structures , are emphasized or de - emphasized as will be explained below . in an embodiment of the present invention , a laparoscopic probe 352 with a control panel 354 is used to take , for example , a biopsy from target 430 . using skin marker images 264 on viewing station image 356 and skin markings 464 on patient target 430 , the surgeon can accurately position probe 352 to take a biopsy . [ 0051 ] fig4 is a representation of optical image 110 and nuclear image 120 registered with an x - ray image 444 to provide a registered image 410 on viewing screen 452 . optionally , image 410 can be manipulated with controls 482 to demonstrate individual images 110 , 120 and / or 444 and / or multiple images that are overlaid in any combination as required by the surgeon . emphasizing different images , 110 , 120 and / or 444 of registered image 410 allows the surgeon , for example , to accurately estimate the tissue planes in which tumor 112 and / or individual nodes 240 are located . for example , one or more sentinel nodes 240 may be on a plane below a specific organ , such as a spine 462 on x - ray image 444 . by emphasizing bony spine image 462 in registered image 410 , while de - emphasizing optical image 110 and / or nuclear image 120 , the surgeon clarifies the location of sentinel nodes 240 . considering this knowledge , he revises his initial incision tracing image 310 , for example , to be two small incisions on either side of spine 462 , rather than a single incision encompassing spine 462 . in an embodiment of the invention , as shown in fig5 image registrator 450 , produces registered image 410 on viewing screen 452 and the operator uses controls 482 to highlight specific anatomic structures and / or regions , for example , a nerve n , an area of cartilage c vascular tissue v and / or tissue that has absorbed a nuclear medicine agent , for example , tumor 112 . the operator , for example , may produce an image 510 with emphasized incision 310 and nerve n and de - emphasized optical image 110 . additionally or alternatively , image 510 is produced using a software - based program that is operational by the operator and / or an automatic program . using image 510 at the outset of surgery , the surgeon for example , avoids over - extending incision 310 and possibly severing nerve n . additionally or alternatively , the operator may produce an image 520 with emphasized incision 310 , cartilage area c and tumor 112 . the surgeon , for example , may call for display of image 520 to provide an accurate map of structures as he deepens incision 310 into cartilage area c . additionally or alternatively , the operator may produce an image 544 with emphasized spine 462 and tumor nodes 240 that have absorbed a nuclear medicine agent . the surgeon , for example , may call for display of image 544 as he begins deep dissection of nodes 240 . images 510 , 520 and / or 544 , for example , are displayed , for example , according to the surgeon &# 39 ; s wishes throughout the surgical procedure , as pictures 488 on a picture viewing apparatus , as images on viewing station 452 and / or as projections from image projector 420 . additionally or alternatively , images 510 , 520 , 544 or other images composed from registered image 410 , are shown on multiple viewing stations 456 , located for example throughout a hospital , that can be viewed by qualified professionals . this provides an opportunity , for example , for multi - disciplinary participation in planning and / or observation of surgery of target 430 . [ 0057 ] fig3 is a representation of gantry 400 comprising gamma camera 422 and optical imager 420 . optionally , gantry 400 includes x - ray imager 412 . gantry 400 , for example , moves in direction 434 until a field of view 432 of subject 438 can be taken of target 430 . for further details of gantry 400 , please refer to balan , et al ., wo 00 / 75691 a1 . in an embodiment of the invention , gantry 400 takes images with gamma camera 422 , optical imager 420 and optionally x - ray imager 412 and sends these images to image registrator 450 . image registrator 450 registers the images to produce picture 488 , an image for projector 478 and / or an image on viewing station 452 . optionally , output 452 is connected to a storage device 454 that records registered image 230 on appropriate storage media that can be retrieved to be viewed on multiple viewers 456 , for example , located in different hospital areas and / or departments , allowing intra - disciplinary consultation over registered image 230 . in an embodiment of the present invention , x - ray imager 412 comprises a planer x - ray imager . additionally or alternatively , x - ray imager 412 comprises a planer x - ray imager that provides digital planer x - ray images . additionally or alternatively , x - ray imager 412 comprises an x - ray tomograph . in an exemplary embodiment , gamma camera 422 registers an image of a radioactive nuclear medicine agent , for example gallium - 67 citrate or any other appropriate radioactive nuclear medicine agent , that has concentrated in , for example , tumor 112 and nodes 240 . optical imager 420 is , for example , a digital camera that provides digital images that are , for example , registered in registered image 230 . additionally or alternatively , camera 420 is a video camera that provides video images that are registered in registered image 230 . additionally or alternatively , camera 420 is held separately from gantry 400 and is moveable with respect to gantry 400 in a measurable relationship to gantry 400 . the present invention has been described using non - limiting detailed descriptions of embodiments thereof that are provided by way of example and are not intended to limit the scope of the invention . it should be understood that features and / or steps described with respect to one embodiment may be used with other embodiments and that not all embodiments of the invention have all of the features and / or steps shown in a particular figure or described with respect to one of the embodiments . variations of embodiments described will occur to persons of the art . furthermore , the terms “ comprise ,” “ include ,” “ have ” and their conjugates , shall mean , when used in the claims , “ including but not necessarily limited to .” it is noted that some of the above described embodiments may describe the best mode contemplated by the inventors and therefore may include structure , acts or details of structures and acts that may not be essential to the invention and which are described as examples . structure and acts described herein are replaceable by equivalents which perform the same function , even if the structure or acts are different , as known in the art . therefore , the scope of the invention is limited only by the elements and limitations as used in the claims .

US-35492603-A

stable oil containing long - chain polyunsaturated essential fatty acids in the form of triacylglycerols , in particular arachidonic acid , dihomogammalinolenic acid , docosahexaenoic acid or eicosapentaenoic acid . such an oil may be prepared by bringing a carrier oil into contact with a biomass obtained from the culture of a microorganism , in particular a fungus or a microalga containing the acids ara , dhgla , dha or epa . these oils can be incorporated into the composition of a foodstuff , of a cosmetic or pharmaceutical product .

the conversion is carried out by bringing the carrier oil into contact with a biomass containing the lc - pufas . the oil is suitable for application in foodstuffs , in particular infant formulas or for use as a nutritional supplement . it may also be used in cosmetic or pharmaceutical products . furthermore , the biomass residue obtained is also a product of the process which may be upgraded directly without subsequent treatment , for example as animal feed , in particular for pets . the preparation of such an oil may take place by simply mixing the carrier oil with the dried biomass and subsequently separating the oil from the non - lipid solids by pressing . in order to increase the yield of lc - pufa obtained it is preferable to reduce the sizes of the particles of dry biomass in order to break the walls of the cells of microorganisms and to thereby increase the surface area of contact between the oil and the biomass . this may be appropriately carried out using various methods , for example : the biomass may be laminated before mixing it with the carrier oil ; the biomass may be treated at high pressure in the presence of the carrier oil , and then the oil obtained may be separated from the biomass by pressing and final filtration ; the biomass may be treated with enzymes capable of degrading the walls of the cells . because the carrier is an oil , the oil obtained after contact with the biomass has a minimum content of phospholipids , free fatty acids , pigments , polymers and other substances obtained or derived from the biomass which are not triacylglycerols . this means that the process according to the invention constitutes a selective method for preparing a stable purified oil containing lc - pufas . it is not necessary to purify the unsaturated oil containing the lc - pufas by the aggressive and cumbersome methods used prior to the invention such as the stages of degumming , neutralization , dewaxing and decolorization . according to the invention the oil is solely subjected to a stage of deodorization , for example by steam distillation or molecular distillation at a relatively low temperature . the result is that the oil contains a particularly small quantity of trans fatty acids . the process does not use an organic solvent and , since the operation is preferably carried out under a nitrogen atmosphere and in the presence of tocopherols which are naturally present or which are added to the carrier oil , in an amount sufficient to protect the lc - pufas from oxidative degradation during the preparation process . in addition to the quality of the oil obtained , another advantage of the process is that the biomass residue is not contaminated with an organic solvent and may thus be directly upgraded , without subsequent treatment , for example in animal feed , in particular for pets . the detailed description of the process which follows is targeted at the preparation of an oil containing ara , taken by way of non - limiting example . the working conditions for transferring other lc - pufas to a carrier oil from appropriate biomasses , for example for dha or dhgla , are very similar . the oil is obtained by mixing the carrier oil with the dry biomass and separating the oil from the solid components by pressing . to increase the level of incorporation of ara , it is desirable to break the microbial cells by high - pressure treatments , by enzymatic processes or to reduce the sizes of the dry particles of biomass by grinding or laminating . the grinding step used may be one of many techniques known in the prior art , for example , the biomass may be laminated , preferably at low temperature , and then it may be mixed with the carrier oil . as a variant , the biomass may be ground in the presence of the carrier oil . in order to minimize as much as possible damage to the ara , the grinding conditions should be gentle . in this regard , grinding the biomass in the presence of the carrier oil under gentle conditions , at a moderate temperature , and under an inert atmosphere , for example under a nitrogen stream , is preferred . next , the oil containing the ara is separated from the biomass by filtration or pressing , preferably at high pressure , and then a final filtration is carried out so as to remove the fine particles of biomass . it was observed that the level of incorporation of the ara increased when the size of the biomass particles decreased ; it was & gt ; 90 % when for example 90 % of the particles had a size & lt ; 250 μm . by way of example , it is possible to use a ball mill or a colloidal mill . the parameters to be considered are the duration of grinding , the size of the biomass particles , the grinding temperature , the ratio between the quantities of biomass and of carrier oil . the duration of grinding has an influence on the size of the particles and the latter is also influenced by the grinding temperature . consequently , in practice , it is preferable to indicate the size of the particles as a parameter determining the grinding stage . thus , it is desirable that 90 % of the particles have a size & lt ; 500 μm , preferably that 90 % of the particles have a size & lt ; 300 μm and more preferably still that 90 % of the particles have a size & lt ; 200 μm . the grinding temperature is chosen at a value greater than the melting point of the carrier oil , and is preferably about 20 to 80 ° c . to obtain an optimum level of incorporation , a brief grinding may be carried out at a high temperature or a prolonged grinding at a low temperature . the weight ratio chosen between the biomass and the carrier oil determines the content of ara of the final oil . thus , for example , 30 parts of biomass are chosen per 70 parts of carrier oil in order to obtain at least 4 . 5 % of ara in the converted oil . the oil used as carrier may be any oil or mixture of oils which can be consumed as human food . an oil or a mixture entering into the composition of the product which it is desired to enrich with pufa is preferably used . there may be mentioned in particular for an infant formula high oleic acid sunflower oil ( hosfo ), sunflower oil ( sfo ), soya bean oil , palm olein and a medium - chain triacylglycerol ( mct , containing essentially triacylglycerols of saturated c 8 - c 10 fatty acids ). the next stage of the process consists in separating the spent biomass residue by any customary method such as , for example , pressing , filtration or centrifugation . to this end , a press operating at high pressure is preferably used . the oil obtained should be made free of fine insoluble particles by fine filtration . this operation may be carried out , where appropriate , by exposing the oil to a mineral adsorbent as a filter aid , for example dicalite . finally , the filtered oil is deodorized in order to remove the volatile substances . this may be carried out by any known method provided that moderate conditions are used in order to be gentle with the ara . there may be mentioned , for example , steam distillation , preferably under vacuum , or molecular distillation . the oil obtained may be used in food compositions for human consumption as it is or in the form of an emulsion such as , for example , oils , salad dressings or mayonnaise . it may be a constituent of a dietetic milk for teenagers or adults , an infant formula for premature babies , full - term unweaned babies or a follow - on milk for small children . it may be incorporated into a nutritive or supplemental composition for oral consumption . it may be incorporated into a pharmaceutical composition for oral , enteral or parenteral ingestion , or for topical , dermatological or ophthalmological application . it may constitute an ingredient for a cosmetic , topical or oral composition . finally , it may constitute an ingredient for a pet food , for example a dry or moist food or even a milk . the biomass residue , after separation of the oil , may be advantageously used in animal feed , particularly for pets . the examples below illustrate the invention . therein , the parts and percentages are by weight , unless otherwise stated . the biomass : carrier oil ratio is 3 : 7 . in these examples , the process parameters and the quality of the oil obtained , before the final deodorization stage , compared with the starting carrier oil ( reference 1 ) are studied . for the grinding , a ball mill is used . the results are summarized in table 1 below : the phosphorus content is very low , a few ppm , approximately 100 × less than in the case of the crude oil extracted with hexane which was about 500 ppm . in these examples , the process parameters and the quality of the oil obtained , after the final deodorization stage , during the use of various carrier oils , are studied . in these examples , the grinding of the biomass is carried out using a ball mill . the characteristics of the oils obtained are compared with the crude oil obtained by extraction with hexane , without refining ( reference 2 ) and compared with the oil obtained by direct pressing , and therefore with no carrier oil ( reference 3 ). the grinding temperature and time are linked : a grinding of 10 min at 30 ° c . gives the same level of incorporation of ara as a grinding of 5 min at 70 ° c . the level of incorporation depends only slightly on the type of carrier oil when the procedure is carried out at the same grinding temperature / time : high oleic acid sunflower oil ( 4 . 9 % ara at 70 ° c ./ 5 min ), mct ( 5 . 0 % ara at 70 ° c ./ 5 min ) and palm olein ( 5 . 0 % ara at 70 ° c ./ 5 min ). a very small quantity of phosphorus is obtained compared to that obtained by extraction with hexane , which shows the purity of the final oil . the examples below show the preparation of an oil containing ara in the form of triacylglycerols by a process which is gentle with the quality of the ara by using several routes , without grinding ( example 11 ) and with various types of grinding equipment ( examples 12 - 14 ). stirred glass reactor of 1000 ml with a double jacket , linked to a thermostatted bath . laboratory deodorizer according to j . heide - jensen ( jaocs ; vol . 40 , 223 - 224 ; 1963 ) with a 1000 ml round - bottomed flask . 260 g of high oleic acid sunflower oil and 112 g of biomass are introduced into the reactor . the vessel is placed under vacuum and the air is replaced with nitrogen three times for the inerting . the reactor is then stirred at 50 ° c . for 2 h , and then the mixture is recovered in a filtration cartridge . the oil is separated from the biomass by pressing . 260 g of oil and 110 g of cake are recovered . the pressed oil is filtered at 50 ° c ., and then it is deodorized at 180 ° c ., 1 mbar for 2 . 6 h . 240 g of a clear oil having a neutral odour and a light yellow colour are finally obtained . the ara content of the oil is determined by gas chromatography ( gc ) analysis and the level of incorporation of ara is calculated . dyno - mill type kdl ball mill with 0 . 3 l grinding vessel , double jacket linked to a thermostatted bath . laboratory deodorizer according to j . heide - jensen ( jaocs ; vol . 40 , 223 - 224 ; 1963 ) with 1000 ml round - bottomed flask . 130 g of palm olein and 56 g of biomass are introduced into the mill vessel . the vessel is placed in a vacuum and the air is replaced with nitrogen three times for the inerting . 220 ml of glass beads having a diameter of 2 mm are added and the vessel is heated to 65 ° c . with the aid of a thermostatted bath . the mixture is then ground for 5 min at a temperature of 65 to 75 ° c ., and then the vessel is emptied . the beads are separated from the mixture by filtration on a grid having a diameter of 1 mm , the mixture is recovered in a filtration cartridge and a sample is collected for measuring the size of the particles . the oil is separated from the biomass by pressing . the procedure is repeated a second time . 225 g of oil and 75 g of cake are recovered . the pressed oil is filtered at 50 ° c ., and then it is deodorized at 180 ° c ., 1 mbar for 2 . 2 h . 210 g of a clear oil having a neutral odour and a light yellow colour are finally obtained . the ara content of the oil is determined by gc analysis and the level of incorporation of ara is calculated . the trial described in example 12 is repeated using mct oil as a replacement for palm olein . 235 g of oil and 65 g of cake are finally recovered . the pressed oil is filtered at 50 ° c ., and then it is deodorized at 180 ° c ., 1 mbar for 2 . 3 h . 220 g of a clear oil having a neutral odor and a light yellow color are finally obtained . the ara content of the oil is determined by gc analysis and the level of incorporation of ara is calculated . preparation by grinding with high oleic acid sunflower oil in a colloid mill laboratory deodorizer according to j . heide - jensen ( jaocs ; vol . 40 , 223 - 224 ; 1963 ) with a 1000 ml round - bottomed flask . 2800 g of high oleic acid sunflower oil and 1200 g of biomass are introduced into the mill vessel . the grinding is carried out by recirculating the mixture in the grinder under an inert atmosphere for 10 minutes at a temperature of 40 to 70 ° c . the mixture is recovered and a sample is collected for measuring the size of the particles . the oil is separated from the biomass with the aid of the basket centrifuge . 2400 g of oil and 1400 g of cake are finally recovered . 200 g of centrifuged oil are filtered at 50 ° c ., and then it is deodorized at 180 ° c ., 1 millibar for 2 hours . 190 g of a clear oil having a neutral odour and a light yellow colour are finally obtained . the ara content of the oil is determined by gc analysis and the level of incorporation of ara is calculated . the results are indicated in table 3 below : the procedure of example 14 is repeated by treating 1200 g of a biomass containing 25 % of an oil with a dha content of 40 %. 2500 g of oil with a dha content of 3 . 5 % are recovered , which oil is deodorized . an infant formula for premature babies enriched with ara is prepared from the oil prepared by the process of examples 12 or 13 and there are added thereto other oils , for example in the proportions indicated in table 4 below , proteins , where appropriate hydrolyzed , carbohydrates and where appropriate vitamins and trace elements . an infant formula for full - term unweaned babies enriched with ara is prepared from the carrier oil prepared by the process of examples 13 or 14 and there are added thereto other oils , for example in the proportions indicated in table 5 below , proteins , where appropriate hydrolyzed , carbohydrates and where appropriate vitamins and trace elements . a follow - on milk for small children enriched with ara is prepared from the carrier oil prepared by the process of example 12 or enriched with dha from the carrier oil prepared by the process of example 15 , and there are added thereto other oils in the proportions indicated in table 6 below , proteins , where appropriate hydrolyzed , carbohydrates and where appropriate vitamins and trace elements . a whole milk containing 3 . 92 % of fat and 8 . 58 % of solids - not - fat and a low - fat milk containing 0 . 05 % of fat and 9 % of solids - not - fat are pasteurized separately by treating them at 87 ° c . for 12 s . 34 . 69 kg of whole milk and 160 . 26 kg of low - fat milk , cooled to 15 ° c . are then mixed , and then a premix of 1 . 08 kg of oil obtained according to example 15 ( high oleic acid sunflower oil , containing 3 . 5 % of dha ), 1 . 08 kg of soya bean oil and 1 g of vitamin e heated to 50 ° c . is incorporated into this mixture by means of a colloid mill . after heating to 80 ° c . in a plate exchanger , the liquid is uht sterilized at 148 ° c . for 5 s . after cooling at 78 ° c ., it is homogenized in two stages , at 200 bar , and then at 50 bar ; it is cooled to 20 ° c . and it is aseptically packaged in carton - type packaging which has been previously sterilized , the homogenization , cooling and filling stages taking place aseptically . the liquid is heated at 72 ° c . for 15 s in a plate exchanger ; it is homogenized in two stages at 200 bar , and then at 50 bar ; it is cooled to 4 ° c . and it is packaged in carton - type packaging . as a nutritional supplement , an oil prepared according to example 12 , 13 or 14 containing ara or an oil prepared according to example 15 containing dha , is encapsulated in an amount of 500 mg of oil in gelatine capsules .

US-65852203-A

the invention comprises a raised platform having a vibrator pad embedded therein . the platform has a ramp at its forward end and a raised platform portion extending forwardly from the forward end of the ramp . the vibrator pad is embedded in the raised platform portion . a vertically adjustable handrail is provided at the opposite sides of the platform . a plurality of patient restraint members are provided to enable a person to stand upright on the vibrator pad .

embodiments are described more fully below with reference to the accompanying figures , which form a part hereof and show , by way of illustration , specific exemplary embodiments . these embodiments are disclosed in sufficient detail to enable those skilled in the art to practice the invention . however , embodiments may be implemented in many different forms and should not be construed as being limited to the embodiments set forth herein . the following detailed description is , therefore , not to be taken in a limiting sense in that the scope of the present invention is defined only by the appended claims . the numeral 10 refers to the apparatus of this invention for primarily increasing the bone density of a patient . apparatus 10 includes a raised platform 12 which is generally rectangular in shape and which has a forward end 14 , a rearward end 16 , a first side 18 and a second side 20 . platform 12 includes an inclined ramp 22 at its rearward end which terminates in a horizontally disposed and raised platform portion 24 . a first vertically disposed support tube 26 has its lower end secured to side 18 of platform 12 forwardly of the upper end of ramp 22 . the upper end of support tube 26 has a pin opening 28 extending therethrough which is adapted to receive a retaining pin 30 therein . a horizontally disposed tube 32 has its forward end secured to support tube 26 , by welding , below the upper end of support tube 26 . the numeral 34 refers to a first gate arm which has its one end pivotally received by the rearward end of tube 32 . gate arm 34 is selectively pivotally movable between an inwardly extending horizontally disposed position ( fig1 and 5 ) and an upwardly extending vertical position ( fig8 ). a second vertically disposed support tube 36 has its lower end secured to side 20 of platform 12 forwardly of the upper end of ramp 22 . the upper end of support tube 36 has a pin opening 38 extending therethrough which is adapted to receive a retaining pin 40 therein . a horizontally disposed tube 42 has its forward end secured to support tube 36 , by welding , below the upper end of support tube 36 . the numeral 44 refers to a second gate arm which has its one end pivotally received by the rearward end of tube 42 . gate arm 44 is selectively pivotally movable between an inwardly extending horizontally disposed position ( fig1 and 5 ) and an upwardly extending vertical position . means is provided for maintaining gate arms 34 and 44 in their horizontal and vertical positions . a third vertically disposed support tube 46 has its lower end secured to side 18 of platform 12 rearwardly of the forward end 14 of platform 12 . the upper end of support tube 46 has a pin opening 48 formed therein which is adapted to receive a retaining pin 50 therein . a fourth vertically disposed support tube 52 has its lower end secured to side 20 of platform 12 rearwardly of the forward end 14 of platform 12 . support tube 52 has pin opening 54 formed therein which is adapted to receive a retaining pin 56 therein . the numeral 58 refers to a first hand rail support arm which includes a vertically disposed lower end portion 60 and an inclined upper end portion 62 which extends upwardly and inwardly from the upper end of lower end portion 60 . lower end portion 60 is selectively vertically adjustably and slidably received in the upper end of support tube 26 and has a plurality of vertically spaced - apart pin openings 64 formed therein which are adapted to receive retain pin 30 therein . the numeral 66 refers to a second hand rail support arm which includes a vertically disposed lower end portion 68 and an inclined upper end portion 70 which extends upwardly and inwardly from the upper end of lower end portion 68 . lower end portion 68 is selectively vertically adjustably and slidably received in the upper end of support tube 36 and has a plurality of vertically spaced - apart pin openings 72 formed therein which are adapted to receive retaining pin 40 therein . the numeral 74 refers to a third hand rail support arm which includes a vertically disposed lower end portion 76 and an inclined upper end portion 78 which extends upwardly and inwardly from the upper end of lower end portion 76 . lower end portion 76 is selectively vertically adjustably and slidably received in the upper end of support tube 46 and has a plurality of vertically spaced - apart pin openings 80 formed therein which are adapted to receive retaining pin 50 therein . the numeral 82 refers to a fourth hand rail support arm which includes a vertically disposed lower end portion 84 and an inclined upper end portion 86 which extends upwardly and inwardly from the upper end of lower end portion 84 . lower end portion 84 is selectively vertically adjustably and slidably received in the upper end of support tube 52 and has a plurality of vertically spaced - apart pin openings 88 formed therein which are adapted to receive retaining pin 56 therein . the numeral 90 refers to a first elongated first handrail having a forward end 92 and a rearward end 94 . the upper ends of upper end portions 62 and 78 of handrail supports 58 and 74 respectively are welded to handrail 90 . the numeral 96 refers to a second handrail having a forward end 98 and a rearward end 100 . the upper ends of upper end portions 70 and 86 of handrail supports 66 and 82 respectively are welded to handrail 96 . an elongated and horizontally disposed slide bar 102 has its rearward end 104 welded to upper end portion 62 of handrail support 58 below the upper end of upper end portion 62 . slide bar 102 is welded to upper end portion 78 of handrail support 74 and has its forward end 106 positioned forwardly of upper end portion 78 . slide members 108 and 110 are selectively slidably adjustably mounted on slide bar 102 as seen in the drawings . an elongated and horizontally disposed slide bar 112 has its rearward end 114 welded to upper end portion 70 of handrail support 66 below the upper end of upper end portion 70 . slide bar 112 is welded to upper end portion 86 of handrail support 82 and has its forward end 116 positioned forwardly of upper end portion 86 . slide members 118 and 120 are slidably adjustably mounted on slide bar 112 . the numeral 122 refers to a first restraint member having a cylindrical portion 124 with shafts 126 and 128 extending outwardly from the ends of cylindrical portion 124 . shaft 128 is pivotally secured to the upper end of support member 118 . shaft 128 is selectively locked into the upper end of support member 108 . restraint member 122 is selectively pivotally movable between vertical and horizontal positions . the lower end of a vertically disposed support tube 130 is secured to slide member 110 and has a support tube 132 selectively vertically adjustably received therein as seen in the drawings . a lock block 134 is mounted on the upper end of support tube 132 . the lower end of a vertically disposed support tube 136 is secured to slide member 120 and has a support tube 138 selectively vertically adjustably received therein as seen in the drawings . a block or saddle 140 is mounted on the upper end of support tube 138 . shafts 142 and 144 extend outwardly from the ends of a cylindrical restraint member 146 . shaft 144 is selectively pivotally secured to block 140 . shaft 142 is selectively locked into lock block 134 . restraint member 146 is selectively pivotally movable between a vertically disposed position and a horizontally disposed position . a sleeve or collar 148 is selectively vertically adjustably mounted on lower end portion 76 of handrail support 74 . a retractably plunger or pin 150 locks sleeve 148 in various vertical positions on lower end portion 76 . a sleeve or collar 152 is similarly selectively vertically adjustably mounted on lower end portion 84 of handrail support 82 . the shafts 154 and 156 of a cylindrical restraint member 158 are welded to sleeves 148 and 152 respectively . the numeral 160 refers to a vibrating pad which is embedded in platform portion 24 and which is connected to a suitable power source in a conventional manner . the instant invention is used as illustrated in fig8 - 12 . initially , the gate arms 34 and 44 will be in their vertically disposed positions . the restraint member 122 will be in the vertically disposed position as seen in fig8 . at that same time , patient restraint member 146 will normally be in its vertically disposed position as also seen in fig8 , but the restraint member 146 could be in its horizontally disposed position . the first and second handrails will usually have been adjusted upwardly or downwardly in anticipation of the particular patient who uses the invention . additionally , the restraint member 158 will have been vertically adjusted in anticipation of the forthcoming patient . the patient rolls his / her wheelchair upwardly onto the ramp 22 and will pass through the vertically disposed gate arms 34 and 44 ( fig8 ). when the wheelchair patient has moved onto the platform portion 24 ( fig9 ), the patient or attendant will lower the gate arms 34 and 44 to prevent the wheelchair from moving rearwardly from the platform portion 24 ( fig1 ). the patient or an attendant will then lower restraint member 146 to its horizontally disposed position . the patient will then stand up so that the patient &# 39 ; s chest abuts against restraint member 158 ( fig1 ) and so that the patient &# 39 ; s legs abut against restraint member 158 ( fig1 ). at that time , the patient or attendant will lower restraint member 132 to its horizontal position rearwardly of the patient ( fig1 ). the patient or attendant will then energize the vibration pad 160 so that the patient will be subjected to vibration to increase the bone density of the patient &# 39 ; s legs , etc . the apparatus of this invention is primarily designed to increase the bone density of the patient but is believed to increase blood flow and muscle mass . the invention also provides exercise for the patient and improves the digestive system of the patient . when the patient &# 39 ; s treatment has been concluded , the restraint member 122 is moved to its vertically disposed position to enable the patient to sit in his / her wheelchair . the gate arms 34 and 44 are then opened to permit the patient to roll rearwardly from the platform . thus it can be seen that the invention accomplishes at least all of its stated objectives . although the invention has been described in language that is specific to certain structures and methodological steps , it is to be understood that the invention defined in the appended claims is not necessarily limited to the specific structures and / or steps described . rather , the specific aspects and steps are described as forms of implementing the claimed invention . since many embodiments of the invention can be practiced without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended .

US-201414444203-A

a method of stimulating neuronal growth or repair comprising exposing a target neuron or neuronal area to a solution of the metallothionein isoform mt - iia .

fig1 shows some effects of human mt - iia on neuronal survival and neurite elongation of cultured rat cortical neurons . fig2 shows by immunocytochemistry the effect of human mt - iia on reactive neurite sprouting following axonal injury . fig3 shows by immunocytochemistry the effects of human mt - iia on reactive neurite sprouting following axonal injury . fig4 and 5 show the effect of human mt - iia on lesions in the rat neocortex formed by physical injury . fig6 shows the effect of human mt - iii and mt - iia on neurite formation and initial neurite outgrowth of cultured rat cortical neurons . fig7 shows the effect of human mt - iii and mt - iia on the extent and rate of neurite elongation of cultured rat cortical neurons . fig8 shows the effect of human mt - iii and mt - iia on the distribution of neurite length of cultured rat cortical neurons . fig9 a shows immunocytochemistry the effect of human mt - iii and mt - iia on reactive neurite sprouting . fig9 b shows by immunocytochemistry the effect of human mt - iii and mt - iia on reactive axonal growth . fig1 shows the quantitative effect of human mt - iii and mt - iia on reactive neurite sprouting and growth . fig1 shows by immunohistochemistry the effect of human mt - iia on axonal sprouting into a lesion site following physical injury in the rat neocortex . fig1 shows by immunohistochemistry the effect of human mt - iia on neuronal injury tract repair . fig1 shows a size frequently histogram of rgcs in retinal whole - mounts . fig1 shows gap43 labelled axons in the proximal optic nerve of pbs and mt - i / ii injected animals at 4 weeks after optic nerve transection surgery . arrows indicate site of transection . fig1 shows location of rgc axons within the proximal nerve 4 weeks after on transection . fig1 shows fluorescent images showing dii labelled rgc axons after on transection . the action of mt - iia ( a major human metallothionein of the mt - i /- ii class ) in two distinct culture models of rat cortical neurons , and in a rat in vivo model of cortical damage was examined . in culture , it was found that administration of mt - iia increases neuronal survival , and enhances the rate of axonal extension . in lesioned rat brains , it was found that mt - iia enhances regenerative axonal growth into the lesion , and replacement of damaged tissue . culture model 1 : rat cortical neurons ( e18 ) were plated at low density in neurobasal medium + b27 supplement , including 150 μg / ml of a rat brain extract . recombinant mt - iia was produced ( the major human metallothionein i / ii isoform ) in e . coli cultures and reconstituted as a zincthionein ( 7 moles zinc / mole protein ). culture model 2 : rat cortical neurons ( e18 ) were plated at a higher density in neurobasal medium + b27 supplement ( but without brain extract ) and cultured in vitro for 21 days , allowing the formation of neuronal clusters connected by fasciculated axonal bundles . rat cortical injury model : focal injuries were performed to the adult rat neocortex by insertion of a 25 gauge beveled needle into the par 1 region of the rat somatosensory cortex to a depth of 1 . 5 mm into the brain . the invention will now be described with reference to a selection of embodiments and examples and fig1 to 12 . referring in turn to fig1 to 7 a series of experiments were conducted using the composition made up of 0 . 1 to 5 μg / ml of mt - iia in a pharmaceutically and neurologically acceptable carrier . such a composition when applied topically to a range of in vivo and in vitro neuronal situations clearly demonstrates that mt - iia functions as an active ingredient in enhancing neurite elongation . mt - iia also dramatically increases the extension of processes between clusters following lesions formed by microscapel and ultimately demonstrates the ability of mt - iia to have a dramatic effect on increasing the rate of recovery from physical injuries . referring to fig1 , the bar graph in fig1 a demonstrates that human mt - iia promotes neuronal survival in the presence of adult rat brain extract ( 150 μg / ml ) after three days . ( p & lt ; 0 . 01 , anova ). accordingly zn - mt is not detrimental to the survival of cultured neurons . referring now to fig6 e and 6f , under the same conditions human mt - iia does not increase the initiation of new neurite sprouting over three days , expressed as either the percentage of neurite bearing neurons as shown in fig6 e or the number of neurites per neurone as shown in fig6 f . p & gt ; 0 . 01 anova ). this observation has important clinical ramifications as inappropriate sprouting of neurons has been associated with premature neuronal death . referring now to fig7 b the bar graph shows mt - iia demonstrating dose dependent promotion of neurite elongation during this period . ( p & lt ; 0 . 01 , anova ). from the above experiments it has been demonstrated that mt - iia is capable of enhancing neurite elongation of cultured rat cortical neurons without increasing the rate of undesirable neurite sprouting . referring now to fig2 a culture of rat cortical neurons was maintained for twenty - one days in order to allow formation of clusters which are interconnected by fasciculated bundles of axons . the axons were cut with a microscapel and a composition as previously described , including recombinant mt - iia , was added . the immunocytochemical results shown in fig2 a to 2 d show that twelve hours after cutting the neuronal bundles with a microscapel there is a marked retraction by transected neurites from the lesion site ( which is indicated with a broken line ) of up to 100 μm . whilst in the absence of mt - iia ( fig2 a ), there are very few neurite extensions , as assessed by nf - m immunoreactive processes ( red ) extending into the area of retraction ( indicated by arrows ) in untreated neurons , there are many in the mt - iia treated neurons ( fig2 c ). tau and βiii - tubulin immunocytochemical analysis also indicates very few processes extending into the area of retraction ( indicated by arrows ) in the absence of mt - iia ( fig2 b ). however , after twelve hours of incubation with mt - iia at a concentration of 1 μg / ml , these processes are significantly longer and have extended into the lesion site ( fig2 d ). referring now to fig3 the experiments detailed in fig2 were repeated with a longer exposure period of eighteen hours to recombinant mt - iia . eighteen hours after cutting the axonal bundles , the tissue was assessed by immunocytochemical markers and analysis of neurite extension into the lesion . in untreated samples , shown in fig3 a , there is minimal neurite growth into lesion site . however , as shown in fig3 c when a sample is treated with mt - iia at a concentration of 1 μg / ml , the processes have completely traversed the lesion site with the immunoreactive processes shown in red extending from the neurite stumps indicated by arrows and have grown towards the central lesion site indicated by the broken line . from this experimental work it has been demonstrated that mt - iia promotes growth of nf - m immunoreactive processes which are indicated by the arrows across the central lesion site . tau and βiii - tubulin immunocytochemical analysis also indicates that a number of processes extend into the area of retraction indicated by arrows in untreated neurons . however , these processes do not cross the transection site shown in fig3 b . mt - iia treated samples shown in fig3 d have been sufficiently promoted such that the growth of processes occurs and extends beyond the transection site indicated by arrows to the opposite stump of the transected neurite bundle . accordingly , these experiments clearly show that mt - iia dramatically increases the extension of processes , including axons between clusters . this occurs following lesion by microscapel and after eighteen hours of exposure to mt - iia the axonal bundles have bridged the region between the clusters . this effect of mt - iia is a result of a direct topical interaction between the protein , the neurons and the culture medium . referring now to fig4 , 11 and 12 the action of mt - iia on a rat model of cortical injury was investigated . the rat model of physical damage to the cortex has been previously developed by the inventors and extensively characterised in terms of neuronal damage , orthology , pathology and subsequent recovery . fig4 , 11 and 12 show the extent of the physical injury , and microglial invasion of the cavity . mt - iia administration reduced microglial infiltration and promoted formation of a tissue bridge across the lesion , from the pial surface down . mt - iia also promoted axonal extension into the lesion site . very few axonal extensions were seen in the rats treated with vehicle alone ( control rats ). fig4 shows the global location of needle stick injuries as indicated in panel a . brain sections underwent immunohistochemistry against smi - 312 ( green ) and ferritin ( red ) 4 days post injury . needle stick injury resulted in a large injury tract , and microglial migration into and surrounding the injury site ( b ). mt - iia treatment reduced microglial infiltration , and promoted the formation of a tissue bridge enclosing the lesion site from the pial surface down , forming a teardrop like invagination ( c ). microglia at the pial surface were small and round , in contrast to the large , amoeboid microglia observed in deeper cortical layers ( d , e respectively ). mt - iia promoted regenerative axonal growth into the lesion site at both the pial layer ( d ) and deeper cortical layers ( e ). in contrast , very few axonal extensions were visualised in control rats , at the pial level ( f ) or deeper cortical layers ( g ). arrowheads indicate the injury tract . fig5 shows immunohistochemical staining against smi - 312 ( green ) and ferritin ( red ) 4 days post injury . smi - 312 immunoreactive axonal extensions were often found in close association with small round microglia at the pial surface ( a , b ). contrastingly , axonal extensions in deeper cortical layers were often not associated with larger , amoeboid microglia ( c , d ). regenerating axons often exhibited a wavy morphology , as if they were constantly changing direction . occasionally , pyramidal ( indicated by arrow , c ) and bulb - like ( indicated by arrow , d ) accumulations were observed along axonal sprouts . the above experiments clearly indicated that the administration of recombinant mt - iia dramatically increases the rate of recovery from physical injuries . in combination with the tissue culture experiments , this work indicates that the administration of mt - iia following central nervous system injury acts directly on neurons to increase the rate of axonal extension into the lesion . turning now to the effect of human mt - iii as contrasted to mt - iia , a series of experiments were conducted as detailed in fig6 to 12 . referring firstly to fig6 , the effect of mt - iii on neurite formation is shown in fig6 a in the presence of adult rat brain extract at 150 μg / ml after three days . fig6 b shows neurite bearing neurons indicated by the arrows . the percentage of neurite bearing neurons is shown in fig6 c and the number of neurites per neurite - bearing neuron is shown in fig6 d . from the above it can be seen that mt - iii significantly inhibits neurite outgrowth in both instances at the concentrations tested ( p & lt ; 0 . 01 , anova ). referring now to fig6 e human mt - iia had no effect on initial neurite outgrowth over three days . as assessed by both the percentage of neurite bearing neurons or as detailed in fig6 f , the number of neurites per neurite - bearing neurons . referring now to fig7 , it has been shown that human mt - iii prolongs the process of neurite retraction from 0 - 2 and 2 - 4 hours after plating as can be seen with reference to fig7 a . following this , the rate of neurite elongation is reduced . referring now to fig7 b , in contrast to this , application with human mt - iia significantly increases the rate of neurite elongation . the distribution of neurite lengths three days after mt - iii treatment is shown in fig8 a , where it is clearly indicated that while mt - iii significantly inhibits neurite growth , a small percentage of neurites were unaffected and grew to lengths comparable to vehicle treated neurites . in contrast to this the distribution of neurite lengths following mt - iia treatment indicated that a number of neurites grew to lengths greater than that of vehicle treated neurites as can be seen with reference to fig8 b . fluorescent double immunocytochemical labelling of cytoskeletal changes both tau shown in red and βiii - tubulin shown in green twelve hours after axonal transection are shown in fig9 a panel a and 9 a panel b . in contrast to this , treatment with mt - iii reduced regenerative neurite sprouting compared to vehicle treated samples as shown in fig9 a panel c and 9 a panel d . the transection site is indicated by a broken line and there is a large area of retraction away from this line . sprouting neurites are indicated by arrows . the mt - iia treatment increased both the number and length of reactive sprouts following injury and this is detailed in fig9 a panel e which details the vehicle example and 9 a panel f which indicates the mt - iia example at 1 μg / ml ( check , please ). referring now to the eighteen hours post axonal transection . this is shown by flourescent double immunocytochemcial labelling of cytoskeletal changes , both tau shown in red and βiii - tubulin shown in green . the mt - iia can be seen to have promoted reactive axonal growth across the entire transection site shown in fig9 b panel a . in contrast such axonal growth is not observed following treatment with either vehicle as shown in fig9 b panel b or mt - iii shown in 9 b panel c . treatment of samples with human mt - iii significantly inhibited both the number and length of reactive sprouts at a twelve hour interval after axonal transection in culture . however , treatment with human mt - iia significantly increased the mean neurite length of reactive sprouts at 12 hours after transection . these findings are detailed in fig1 a and 10b . further experimental work was done to test the effect of mt - iia and these results are shown in fig1 and 12 under immunohistochemical studies for smi - 312 ( green axonal marker ) and ferritin ( red microglial marker ). referring firstly to fig1 , the results at four days post injury are shown where the needle stick injury resulted in a large injury tract and microglial migration into and surrounding the injury site shown in fig1 a . mt - iia treatment promoted the formation of a tissue bridge enclosing the lesion site from the pial surface down so as to form a tear drop like invagination shown in fig1 b . mt - iia further promoted axonal sprouting into the lesion site at both the pial layer as shown in fig1 c and deeper cortical layers shown in fig1 d . in contrast to this , very few axonal sprouts were visualised in control rats as shown at the pial level in fig1 e and deeper cortical layers as shown in fig1 f . the arrow heads indicate the injury tract . fig1 shows details of further experimental work on brain sections at 7 days post injury . in vehicle treated rats , the injury tract was smaller compared to four days post injury shown in fig1 ; although it had not completely closed over a degree of reactive sprouting is evident in all animals at this time point as shown in fig1 a . reactive processes exhibited greater smi - 312 reactivity than uninjured neuronal processes in surrounding neural tissue . reactive astrocytes also aligned along the borders of the injury tract as shown in fig1 b . in mt - iia treated rats , the entire injury tract had closed over , and was demarcated only by a fine line of ferritin immunoreactivity as shown in fig1 c . reactive astrocytes also enclose the injury tract , and were found at lower density in adjacent uninjured tissue shown in fig1 d . in mt - iia treated animals , numerous reactive axonal processes were observed as shown by the arrows within the injury tract at both deeper cortical levels shown in fig1 e and pial levels shown in fig1 f . the current example examined the neuroprotective and / or neuroregenerative properties of exogenous mt - i / ii at four weeks after complete transection of the optic nerve in adult rat . retinal ganglion cell ( rgc ) survival was assessed in retinal wholemounts using tuj - 1 immunoreactivity . following intra - vitreal mt - i / ii administration , 24 % of rgcs survived compared to 8 % and 11 % survival in transection only and transection + pbs injected controls . furthermore , rgc axons were visualised by gap43 immunoreactivity or by dii labelling . in the optic nerve of transection only and transection + pbs injected animals rgc axons had retracted from the transection site , extending approximately 50 - 70 % of the length of the proximal nerve . for mt - i / ii injected animals , rgc axons persisted at the transection site ; furthermore , in 5 / 8 animals , a minority of axons had regenerated across the lesion and extended up to 720 m into the distal nerve . the neuroprotective and neuroregenerative effects of mt - i /- ii observed in this extreme injury model suggest that exogenous administration represents a promising therapeutic strategy for central nerve tract repair . mt - i / ii administration via intravitreal injection and via a gelfoam cuff around the transection site induced significantly greater rgc survival compared with on transection only animals and pbs / znso4 controls . increases in rgc survival observed in pbs and znso 4 injection , and pbs cuff groups were not statistically significant . asterisks denote significance ( scheffe post - hoc test ). results are mean density values ± sd . following on transection , there was a decrease in the number of large rgcs and a relative increase in small rgcs . however , following mt - i /- ii administration , medium and large rgcs were more numerous than in the on cut only group . data are presented as the prevalence of rgc soma size (%) within each retinal quadrant . ( a ) confocal image at 4 days after optic nerve transection illustrating abrupt termination of dii labelled axons at the transection site ( large arrow ). ( b , c ) dii anterograde labelling at 4 weeks after on transection + mt - i / ii injection showing regenerating axons crossing the lesion site ( large arrow ) and extending into the distal nerve ( b ). leading axons extend approximately 1000 μm into the distal nerve ( small arrows ). fifty seven adult female pvg hooded rats ( 180 - 200 g bw ) were used . surgical anaesthesia involved injections of ilium xylazil - 20 6 mg / kg and ketamine 50 mg / kg ( i . p .). terminal anaesthesia was by injection of pentobarbitone ( 0 . 1 ml / 100 g bw ). procedures conformed to the national health & amp ; medical research council ( australia ) guidelines for the care and the use of experimental animals and with approval from the animal ethics and experimentation committee of the university of western australia experimental animals underwent right on transection with concomitant administration of mt - i /- ii ( 100 ng / l in pbs ) to the intravitreal cavity of the right eye ( n = 4 ) or to a gelfoam cuff surrounding the transection site ( n = 6 ). control animals underwent either on transection alone ( n = 8 ) or transection + intravitreal injection with either pbs ( n = 4 ) or znso4 ( n = 4 ; 32 ng / μl ), or on transection + pbs administration to a gelfoam cuff ( n = 4 ) around the transection site . in further controls , ons remained intact but animals received an intravitreal injection of mt - i /- ii ( n = 4 ) or pbs ( n = 5 ). normal animals were also investigated ( n = 7 ). rats were deeply anaesthetised , the right on exposed intraorbitally , and the nerve sheath cut transversely except for the ventral aspect that was left intact to avoid damage to the ophthalmic blood vessels . the nerve parenchyma was lifted using hooked forceps and completely transected with iridectomy scissors approximately 1 mm from the back of the eye . the cut ends of the nerve sheath were then sutured together ( 10 - 0 thread ). the completeness of transection was confirmed by anterograde labelling ( see methods : tissue preparation ). any animals with ischaemic retinae ( determined ophthalmoscopically ) were discarded . rats were maintained for 4 weeks . intravitreal injection intravitreal injections were performed immediately following on transection . mt - i /- ii or control solutions ( pbs or znso 4 ) were administered via a stereotactically positioned 30 - gauge needle attached to a 10 μl hamilton syringe . a final volume of 2 . 5 μl was administered via two injection sites ( nasal and temporal ). after on transection a gelfoam cuff soaked in mt - i / ii ( 100 ng / l ) or pbs was inserted under the nerve sheath at the transection site . gelfoam was applied at multiple locations around the nerve to ensure that the injury site was completely encapsulated . to determine any potential toxic effects of the injected substances we examined non - on transected animals receiving intravitreal injections of mt - i / ii or pbs and compared them to normal animals . rats were maintained for 4 weeks following intravitreal injection . to label rgcs retrogradely , a crystal of the tracer fluorogold ( fg ) was applied to the on approximately 2 mm from the back of the eye 3 days before terminal anaesthesia non - specific leakage of the tracer beyond the local insertion site was minimal . rats were terminally anaesthetized and transcardially perfused with 0 . 9 % sodium chloride followed by 4 % paraformaldehyde . the right eye and on were dissected from the surrounding orbital tissue and post - fixed in 4 % paraformaldehyde for 24 hours . both rgc counts and axon measurements were made within the same animal by separating the retina from the nerve prior to labelling with tuj1 ( retina ) or gap - 43 ( on ). rgc counts were made from retinal wholemounts ; axon measurements from on sections . nerves were cryoprotected by immersion in 15 % sucrose in pbs overnight . horizontal serial sections ( 16 m ) were collected onto superfrost ® plus glass slides and stored at − 70 ° c . anterograde dii ( 1 , 1 - dioctadecyl - 3 , 3 , 3 ′, 3 ′- tetramethylindocarbocyanine perchlorate ) tracing was performed on 2 groups of rats : mt - i / ii injected on transected animals that survived for 4 weeks ( n = 6 ) and animals that had undergone on transection and survived for 4 days only , to verify the completeness of transection ( n = 3 ). crystals of dii were placed on the on head and allowed to transport in a 37 ° c . incubator for 4 weeks . nerves were then sectioned horizontally at 120 m using a vibratome . anxons were traced by confocal microscopy ( biorad ). labelling of optic nerves at 4 days after transection demonstrated that rgc axons did not extend beyond the site of transection , confirming the completeness of surgery ( fig1 a ). retinae were incubated with tuj - 1 ( βiii microtubulin ) primary antibody diluted 1 : 500 with pbs + 0 . 2 % tritonx100 in a humid chamber overnight at 4 ° c . antibody binding was visualised following incubation ( 2 hours ) with anti - mouse ( 1 : 400 , alexa 488 , molecular probes ) secondary antibody . retinae were wholemounted onto glass slides , coverslipped using fluoromount g and viewed using a conventional fluorescence microscope . on sections were air - dried for 1 - 2 hours at room temperature prior to use . tissue was re - hydrated in pbs + 0 . 2 % triton x100 for 10 minutes , followed by overnight incubation with an antibody to growth associated protein ( gap43 , rabbit polyclonal 1 : 500 . binding was visualised with an anti - rabbit ( 1 : 400 , alexa 546 , molecular probes ) secondary . gap43 labelling was viewed using conventional fluorescence microscopy . rgcs labelled with fg ( bp 340 - 380 excitation filter ) and tuj1 ( bp 450 - 490 filter ) were counted in 24 representative , non - overlapping rectangular sample fields of 191 . 16 μm × 257 . 14 μm ( 6 fields in each retinal quadrant ; 3 retinal eccentricities , ⅙ , ½ and ⅚ of the retinal radius ). each sample area was photographed at a final magnification of 250 × using a digital camera . manual cell counts were made using imagepro ® image analysis software . the total number of labelled rgcs per retina was calculated by multiplying the mean cell number per sample area by the area of the retina . counts were made whilst blind to the treatment group . rgc soma area was calculated for normal animals , on transection only animals and on transection + intravitreal mt - i / ii . two hundred cells were analysed per retina , similar to the procedure of vidal - sanz et al . ( 1987 ). rgcs were analysed in sample frames taken from peripheral retina only , since cell size within classes has been shown to vary with retinal eccentricity . fifty cells each from dorsal , nasal , ventral and temporal retina were manually traced and the soma area computed . rgcs were allocated to one of three broad groups based on their area : small (& lt ; 99 μm 2 ), medium ( 100 - 250 μm 2 ) and large (& gt ; 250 μm 2 ). the transected on was analysed as segments proximal and distal to the lesion . for the proximal segment , the distance from the on head to the point at which gap43 - positive rgc axons terminated was measured and expressed as a percentage of the length of the proximal nerve . for the distal nerve segment the distance that regenerated rgc axons projected beyond the transection site was measured and is presented as raw data rgc axons were photographed at a final magnification of 250 × and distances measured using a calibrated measurement tool . analyses were performed only on on sections in which the nerve head , proximal nerve , transection site and distal nerve were visible . rgc counts and axon measurements were analysed using anova ( statview ) and p values calculated using the scheffe post hoc test . in normals , there was an almost 100 % correlation between fg tracing and tuj1 labelling ( not shown ), supporting the use of tuj1 as a specific marker for rgcs . the average rgc density for normal animals was 2145 + 179 cells / mm 2 , equivalent to a total population of 114 , 032 . intravitreal injection of mt - i /- ii or pbs in animals with intact ons did not significantly alter ( p & gt ; 0 . 05 ) rgc survival ( mt - i / ii : 1962 + 70 rgcs / mm 2 ; pbs : 1966 + 18 rgcs / mm 2 ). indeed the distribution and morphology of rgcs was indistinguishable between animals receiving mt - i /- ii or pbs and normals . at 4 weeks following on transection alone , rgc numbers had decreased to 170 + 20 rgcs / mm 2 , equivalent to 8 % of the normal population ( fig1 ). values were not significantly different ( p & gt ; 0 . 05 ) from on transection animals with pbs - injection ( 244 + 49 rgcs / mm 2 ) or znso 4 - injection ( 245 + 85 rgcs / mm 2 ). intravitreal mt - i /- ii administration produced a significant increase ( p & lt ; 0 . 05 ) in rgc survival with an average of 483 + 76 rgcs / mm 2 . this value is equivalent to 24 % of the normal rgc population or 27 , 200 rgcs in total . rgc survival following pbs administration to a gelfoam cuff surrounding the transection site was 233 + 39 rgcs / mm 2 . this was similar to the result for intravitreal pbs administration and , again , was not significantly different ( p & gt ; 0 . 05 ) from survival in on transection only animals . however , mt - i / ii administration via a gelfoam cuff resulted in a significant increase in survival compared to on transection only and pbs cuff animals ( p & lt ; 0 . 05 ) with 404 + 91 rgcs / mm 2 . the value is equivalent to 19 % of the normal rgc population . across the three groups : normals , on transection only and on transection + mt - i / ii injection , rgc sizes ranged from 54 μm 2 - 486 μm 2 in area in normal rats , approximately 75 % of rgcs were medium sized ( soma area 100 - 250 μm 2 ), 20 % were small ( area & lt ; 99 μm 2 ) and 5 % large (& gt ; 250 μm 2 ). after on transection , there was a marked increase in the prevalence of small rgcs , and a selective loss or atrophy of large and medium sized rgcs within the surviving population . following intravitreal mt - i /- ii administration , smaller cells were again more prevalent relative to normal animals , however the decrease in large and medium sized cells was less severe than in the on transection only group . qualitatively , gap43 - labelled rgc axons at 4 weeks after on transection only or on transection + pbs injection , demonstrated degenerative morphology ( fig1 ). axons were sparsely arranged within the nerve , had retracted from the transection site and exhibited punctate labelling . by contrast , axons in animals undergoing on transection + mt - i / ii injection not only retained their positions at the transection site , but the proximal nerve was open observed to swell , becoming engorged with axons . quantitatively , axons in the on transection only group extended 47 + 10 % of the length of the proximal nerve , on transection + pbs injected animals projected 67 + 23 %, whereas axons in mt - i / ii injected animals extended significantly further ( p & lt ; 0 . 05 ) remaining at 100 + 0 % of the proximal nerve ( ie . at the transection site ; fig4 ). moreover , animals in the on transection only or pbs injection + on transection groups consistently lacked gap43 - labelled axons beyond the transection site . however , five out of eight animals with intravitreal mt - i / ii administration demonstrated axons projecting an average of 346 + 288 m past the site - of on transection , with the most successful axons extending 720 m . the result was confirmed with dii tracing , in which axons were observed up to 1000 m beyond the site of optic nerve transection ( fig1 b , c ). this example shows that a single administration of exogenous mt - i /- ii following complete optic nerve ( on ) transection in adult rat has profound neuroprotective and neuroregenerative properties . the protein rescues a substantial proportion of axotomised rgcs from death , as well as stimulating rgc axon regeneration across the site of transection into the distal nerve . twenty - four percent of the total rgc population survived 4 weeks after on transection when animals were injected intravitreally with mt - i /- ii , compared to 8 % survival in on transection only controls . the result is consistent with previous studies indicating that mt - i /- ii is neuroprotective following a variety of physical and chemical insults . for example , transgenic mice lacking mt - i /- ii recover poorly from various types of brain injury including cortical cryolesion and focal cerebral ischemia . conversely , mt - i /- ii over - expression leads to clinical improvement in experimental autoimmune encephalomyelitis , and improves recovery from cortical damage caused by over - expression of inflammatory cytokines . the molecular mechanisms underlying mt - induced neuroprotection are not yet understood . suggestions include the ability of mts to scavenge free radicals and modulate the inflammatory response . mt - i /- ii null mice have a prolonged and impaired inflammatory response to injury . whereas exogenous mt has been shown to modulate the immune response following cortical cryolesion and experimental autoimmune encephalomyelitis . alternatively , it has been suggested that the protective effect of mt - i /- ii relates to its ability to inhibit apoptosis by interacting with the anti - apoptotic transcription factor , nuclear factor kappa b . indeed , mice lacking mt - i /- ii show increased susceptibility to apoptosis compared to wild type mice . other studies suggest that the protective action of mt is effected by altering zinc or copper homeostasis , assisting the action of antioxidants such as superoxide dismustase . furthermore , zinc has also been shown to interact with other enzymes and proteins , including transcription factors , that contribute to inhibition of apoptosis . we have demonstrated that , following on transection , the neuroprotective action of mt - i / ii is not a function of its regulation of the bio - availability of zinc . indeed , rgc survival in the presence of znso 4 was similar to that following pbs administration and was not significantly elevated compared to controls . transection of the on and sheath 1 mm behind the eye and in the absence of a facilitatory peripheral nerve graft or neurotrophic factors , represents one of the most severe and intractable injury paradigms . nevertheless , immnunohistochemical and anterograde axon tracing studies revealed that mt - i /- ii supports rgc axon regeneration across the lesion site and into the distal nerve . by contrast , rgc axons in control animals had retracted from the vicinity of the transection site , filling only 50 - 70 % of the proximal nerve . the result highlights the regenerative potential of mt - i /- ii , indicating that an even more favourable outcome might be expected under less severe conditions such as nerve crush . the mechanism by which mt - i / ii exerts its neuroregenerative action is unknown . however , the differential response we observed for the application of mt - i / ii intravitreally or to the site of on transection indicates that the protein is likely to operate directly on the nerve cell body . survival of adult rat rgcs was promoted by a single intravitreal injection of inosine ( a purine derivative ) after on transection . inosine rescued 25 % of the normal rgc population 2 weeks after injury . although the results indicate a similar extent of rgc survival to that reported here ( 24 % survival ), the on transected controls demonstrated a surprisingly high level of survival at 19 % indicating that protection was only 1 . 3 fold greater than controls . by contrast , in the present study , on transected controls exhibited only 8 % rgc survival , matching previous reports and representing a 3 fold increase in survival . two other aspects differ between the studies and argue a possibly greater efficacy for mt - i / ii . rgc survival was examined at a later time point ( 4 weeks compared to 2 weeks ), during which time many rgcs would die after simple axotomy . the on was transected closer to the back of the eye ( 1 mm compared with 1 . 5 mm ), a location leading to a more rapid onset of rgc death compared to more distal surgery it is possible that mt - i /- ii would yield greater neuroprotection and neuroregeneration if it were injected more frequently than the single application performed in the current study . for example , multiple applications of macrophage inhibitory factor ( mif ) increased rgc neuroprotection at four weeks after on transection in adult rat to 37 % compared to 17 % after a single dose . other studies have noted modest protection of rgcs after on transection . in recent studies examining rgc survival 2 weeks after on transection , intravitreal administration of erythropoietin at 0 , 3 , 7 and 10 days produced a 0 . 9 fold increase in survival compared to controls , whereas the antibacterial drug rifampicin was found to produce a 0 . 6 fold increase in survival in on transected mice . the results are lower than the 3 fold increase demonstrated following mt administration in the current study . the extent of rgc axon regeneration stimulated by mt - i / ii after transecting the adult rat on suggests that the protein is one of the most potent of reported neuroregenerative factors . the applicant did not estimate the proportion of rgc axons that regenerated beyond the lesion site due to inherent inaccuracy in quantifying axon numbers , as regenerating axons may follow contorted paths and may bifurcate or even trifurcate . nevertheless , the regeneration appears similar in extent ( see fig3 ) to a recent study in which rgcs growth - sensitised by lens injury were transfected with adeno - associated viruses carrying a gene for c3 ribosyltransferase to inactivate rho - a . transfecting growth - sensitized rgcs with adeno - associated viruses expressing a dominant - negative form of ngr ( ngr ( dn )) also increased axon regeneration several - fold ; however , when the growth program of rgcs was not activated , ngr ( dn ) expression lacked beneficial effects . studies by leon et al ., ( 2000 ) and yin et al ., ( 2003 ), increased numbers of activated macrophages within the eye following lens injury and zymosan injection , respectively . lens injury was found to result in around 200 axons extending 1 mm beyond the on crush site 2 weeks after injury , whereas zymosan produced 500 axons extending 1 mm beyond the crush site after 2 weeks , with the most successful axons extending 4 - 5 mm . similarly , berry et al ., ( 1996 ) reported rgc axons regenerating 3 - 4 mm when a segment of peripheral nerve was implanted within the eye . although in both instances regeneration appears superior to that induced by mt - i /- ii ( maximum axon regrowth of ≈ 0 . 75 mm ), the studies employed a less severe injury model , on crush rather than transection and were performed at a greater distance ( 2 mm ) from the posterior pole of the eye . modest regeneration has been reported following treatment with group b - streptococcus exotoxin leading to macrophage stimulation , increased phagocytosis of inhibitory debris , and a less dense reactive gliosis , which in turn allows for regrowth of axons through the glial scar . rgc axons more readily regenerate into a peripheral nerve graft an effect enhanced by the synergistic effects of increased camp levels or of nogo - neutralizing antibody in - 1 along with ciliary neurotrophic factor . similarly , brain derived neurotrophic factor ( bdnf ) induced rgc axon regeneration into autologous connective tissue chambers implanted into a gap - injury site in the adult rat optic nerve . the above detailed examples demonstrate the clinical application of mt - iia in promoting nerve cell survival , promoting neuronal regeneration and generally enhancing neurite elongation without causing inappropriate neuronal sprouting . the findings and experimental results support many clinical applications of the invention as detailed below . disease indication role of mti / ii ( iia ) alzheimer &# 39 ; s disease promote nerve cell survival . it was demonstrated that promote neuronal regeneration . mti / ii is upregulated in buffer metals implicated in early stages of the disease development of pathological ( published ) hallmarks . parkinson &# 39 ; s disease buffer metals implicated in promote nerve cell toxicity . survival . promote evidence of abnormal regeneration . metal homeostasis in the brain as well as neurodegeneration . motor neuron promote nerve cell survival . evidence of abnormal disease promote neuronal regeneration . metal homeostasis in the buffer metals implicated in brain and spinal cord as toxicity . reduce oxidative stress well as neurodegeneration . implicated in neuronal degeneration . head injury promote nerve cell survival . it was shown that mt promote neuronal regeneration . i / ii is upregulated at zone of injury . recombinant protein promotes brain healing and axonal regeneration spinal cord trauma promote nerve cell survival . evidence of delayed promote neuronal regeneration . neurodegeneration and spinal cavitation following injury . the recombinant protein is potentially capable of promoting neural healing and regeneration . glaucoma promote nerve cell survival . axonal damage followed promote neuronal regeneration . by neurodegeneration underlies the disease . mti / ii may potentially promote survival of nerve cells and / or appropriate regeneration . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive .

US-51765303-A

presented is a curl bar used for lifting weight which has a compressible section in the bar , so a user can compress and uncompress the bar laterally , as well as use the bar for lifting weights or resistance in a direction perpendicular to the bar .

while the presently disclosed inventive concept ( s ) is susceptible of various modifications and alternative constructions , certain illustrated embodiments thereof have been shown in the drawings and will be described below in detail . it should be understood , however , that there is no intention to limit the inventive concept ( s ) to the specific form disclosed , but , on the contrary , the presently disclosed and claimed inventive concept ( s ) is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the inventive concept ( s ) as defined in the claims . in the following description and in the figures , like elements are identified with like reference numerals . the use of “ e . g .,” “ etc ,” and “ or ” indicates non - exclusive alternatives without limitation unless otherwise noted . the use of “ including ” means “ including , but not limited to ,” unless otherwise noted . shown in fig1 is the curl bar 10 which includes a left grip handle 12 , a right grip handle 14 , a slide bar 34 , and a left attachment yoke 16 and a right attachment yoke 18 . part of the curl bar 10 is the cylindrical curl bar body 22 which has an obvious long axis . the curl bar of the invention is shown in the enclosed figure . one figure shows the curl bar assembled and another figure shows the curl bar in an exploded view . the curl bar attaches to a resistance assembly by the attachment yokes 3 which are positioned at either end of the curl bar . the resistance assembly can be a stack of weights , which would typically be enclosed within a conventional weight stack machine in a gym . other resistance assemblies are possible such as air pistons . the weight can be lifted from a position above the curl bar or below the curl bar , from a low pulley or a high pulley . it would typically be used as a bicep curl , with a cable going from the attachment yokes 3 to a low pulley . while the curl bar of the invention is used to lift a stack of weights , such as in a bicep curl motion , the two grip handles of the curl bar can be pressed together , which provides additional work for the biceps , and work for a different part of the biceps . the left grip handle 12 is a tubular piece of metal threaded at both ends , and has no moving parts . the slide bar 34 passes through collar 38 threaded sleeve 40 and collar 38 , and screws into the plunger tip 36 , which is preferably brass . the slide bar 9 is also screwed into the cap 10 , with 10 being screwed into the end of the left grip handle 12 . the left side of left grip handle 12 is sealed by the threaded end cap 42 , into which the bolt 44 is screwed through a hole in the left attachment yoke 16 . the collar 38 is preferably brass , and is a tubular cylinder and is fitted into threaded sleeve 40 . the collar 38 in one version is made of “ oil light ”, which is a self lubricating form of sintered brass . the slide bar 34 passes through both collar 38 and threaded sleeve 40 , and screws into the plunger tip 36 . the slide bar 34 freely rotates within the collar 38 and the threaded sleeve 40 . a plunger tip 36 which fits inside the left grip handle 12 on the left hand side . the bolt 44 on the left has a seal which seals the air from escaping from the hollow chamber in the left grip handle 12 . plunger tip 36 also has a seal in the form of an o ring which stops air from escaping from the right side of the left handle . when the handles are pressed together the air pressure inside the left handle causes resistance so that it is hard to push the right grip handle 14 towards the left grip handle 12 . part 1 on the left grip handle 12 also has a hole drilled from the end of the screw through the length of the screw and out through the threads . when cap 44 is unscrewed from the handle a little , it allows air to escape through this hole which decreases the resistance to the plunger 36 being inserted into the left grip handle 12 . this hole forms the air release valve 24 . there is a spring 28 which is inside the left grip handle 12 between the end cap 42 and the plunger tip 36 . the spring helps the bar return to its original position after it is compressed , thus moving the two grip handles apart . attachment yoke 16 is present on both the left and the right sides , and provides attachment points to connect the curl bar 10 to a source of resistance , such as a weight stack . the person using the bar will grab each handle and do a normal curl using the weight stack or an air cylinder as resistance while the user does a normal curl he may also compress the bar and experience resistance from two different directions . the inward compression targets the inside of the bicep very powerfully . the right side of the curl bar is similar to the left side , but may not include a hollow chamber with piston that fits inside . in one embodiment of the invention both sides have the piston and the hollow chamber , and the version shown in fig2 is a version in which the hollow chamber is only on the left side . the right side of the curl bar starts at the threaded sleeve 40 which is equivalent to the threaded sleeve 40 on the left side . the slide bar 34 passes through the threaded sleeve 40 on the right side and screws into threads in the right grip handle 14 . a threaded end cap 42 fits into the end of the right grip handle 14 and is similar to the threaded end cap 42 on the left side , but it does not have an air release valve . the right side also includes a right attachment yoke 18 which is attached to the curl bar by a threaded end cap 42 . shown in fig3 is the end cap 42 which shows the air release valve 24 . fig3 shows the threaded end cap as being hollow , but in a version which did not include the air release valve , the threaded end cap would not need to be hollow . shown in fig4 is the plunger tip 36 which in this embodiment includes a groove 46 in which is placed an o - ring ( not shown ). while certain exemplary embodiments are shown in figures and in this disclosure , it is to be distinctly understood that the presently disclosed inventive concept ( s ) is not limited thereto but may be variously embodied to practice within the scope of the following claims . from the foregoing description , it will be apparent that various changes may be made without departing from the spirit and scope of the disclosure as defined by the following claims .

US-71865110-A

a rotary tiller blade for mounting along with other similar blades , on a driven tiller shaft in a rotary tiller machine , which blade is configured and arranged to provide two cutting teeth per blade which enables a faster , smoother running and more thorough ground breaking action than any other tiller blade design .

the front end rotary tiller 10 shown in fig1 of the drawings includes a motor 12 mounted on the frame 14 , a handle 16 with governor control 18 and forward control 20 , a worm gear 22 , operated by the forward control 20 , to drive the tiller blade shaft 24 , and a plurality of tiller blade supports 26 for mounting the dual end rotary tiller blades 28 , which are constructed in accordance with the teachings of the present invention . as shown in fig1 - 2 of the drawings , there are four tiller blade supports 26 , each of which have four rotary tiller blades 28 mounted thereon . since each rotary tiller blade 28 is provided with two earth cutting teeth or sections , there will be sixteen rotary tiller blades 28 with thirty - two earth cutting teeth for engagement with the earth . at the present time , the majority of tiller manufacturers use sixteen rotary tiller blades which have sixteen earth cutting teeth , although there is at least one manufacturer which has thirty - two blades with thirty - two cutting teeth . however , no one is known to have sixteen rotary tiller blades which provide thirty - two earth cutting teeth . the advantages of thirty - two earth cutting teeth on sixteen rotary tiller blades include : faster tilling which substantially reduces tilling time , more thorough ground breaking or pulverization sometimes with the first pass of the rotary tiller , and smoother handling , particularly of front end tillers in various soil conditions . in addition , as will be seen from the ensuing discussion , the rotary tiller blades of the present invention do not have to be made in right and left hand configurations , but rather , are made in one standard blade configuration . this greatly facilitates the ease and economy of manufacture , as well as assembly and disassembly of the rotary tiller blades on the driven tiller shaft by the user . accordingly , attention is now directed to the configuration are arrangement of the dual end rotary tiller blades 28 as shown in the drawings . although two embodiments of the dual end rotary tiller blade 28 are shown in fig3 - 6 and fig7 - 10 respectively , it will be appreciated that other structural configurations and arrangements , within the purview of the present invention , can be made . in the fig3 - 6 and fig7 - 10 embodiments , the same reference numerals will be used to designate like parts with the difference between the embodiments being denoted by the suffix &# 34 ; a &# 34 ; for the fig3 - 6 embodiment and the suffix &# 34 ; b &# 34 ; for the fig7 - 10 embodiment . in the fig3 - 6 embodiment , the dual end rotary tiller blade 28a is shown in fig3 as being formed by a generally scrapless method from sheet steel material . more specifically , it will be seen that each rotary tiller blade 28a is formed , from flattened sheet material , with a flattened intermediate section 30a and with opposite marginal end portions 32a , 34a respectively which are angularly offset relative to the flattened intermediate section 30a ( at approximately 221 / 2 degrees offset from the intermediate section ). since each dual end rotary tiller blade 28a is identical , it can be seen in fig3 that little scrap is lost because the dual end rotary tiller blades 28a can be easily cut or sheared from the sheet steel material one right after the other . following the initial forming step as shown in fig3 the marginal end portions 32a , 34a of each rotary tiller blade 28a are bent in opposite directions from the intermediate flattened section 30a to provide oppositely directed cutting sections or teeth . as best seen in fig3 - 4 , the marginal end portion 32a is bent at 36a in the area of the juncture between the marginal end portion 32a and intermediate section , while the marginal end portion 34a is bent in an opposite direction to the marginal end portion 32a in an area which is spaced from the juncture between the marginal end portion 34a and intermediate section 30a and is at an angle thereto ( approximately 30 degrees offset from the intermediate section ). in the fig4 position , the marginal end portion 32a is shown as being bent upwardly while the marginal end portion 34a is shown as being bent downwardly . when thus formed and bent , the dual end rotary tiller blades 28a provide oppositely directed cutting edges or teeth 40a on marginal end portion 32a and 42a on marginal end portion 34a . this is best seen in fig5 - 6 of the drawings . as a result , each blade 28a has a pair of oppositely directed cutting edges or teeth 40a , 42a for engaging the earth . preferably , the cutting teeth 40a , 42a are sharpened or formed in such a way to slice into the earth . it will be seen in fig1 - 2 that when four dual end rotary tiller blades 28a are mounted on the tiller blade supports 26 , adjacent blades 28a are mounted at 90 degrees relative to one another as shown to provide engagement with the earth at 45 degree increments , by alternating adjacent cutting edges or teeth 40a , 42a of adjacent blades 28a . further , it will be seen that there are four tiller blade supports 26 , which secure the blades 28a thereto by suitable fasteners , each of which carry four blades 28i a or a total of 16 rotary tiller blades 28a with thirty - two cutting edges or teeth 40a , 42 . in the fig7 - 10 embodiment , the dual end rotary tiller blades 28b are shown in the initial scrapless method forming step of fig7 as being generally similar in shape to the rotary tiller blades 28a as illustrated in fig3 except that the rotary tiller blades 28b are somewhat longer in order that the blades 28b can overlap adjacent tiller blade support 26 . this blade overlapping feature of the fig7 - 10 embodiment is best seen in fig2 of the drawings . each of the dual end rotary tiller blades 28b , as shown in fig7 include a flattened intermediate section 30b with opposite marginal end portions 32b , 34b that are angularly offset relative to the flattened intermediate section 30b , at approximately 221 / 2 degrees relative thereto . after the initial forming step shown in fig7 the marginal end portions 32b , 34b of each dual end rotary tiller blade 28b are bent in opposite directions from the intermediate flattened section 30b to provide oppositely directed cutting teeth . as best seen in fig7 - 8 , the marginal end portions 32b , 34b are both bent in an area spaced from the juncture between the marginal end portions 32b , 34b and the intermediate section 30b . more specifically , it will be seen that the marginal end portion is bent at 36b , at an angle of approximately 50 degrees from the marginal end portion 32b , while the marginal end portion 34b is bent at 38b , at an angle of approximately 621 / 2 degrees from the marginal end portion 34b . fig8 - 10 best illustrate the desired form of the dual end rotary tiller blade 28b . as best seen in fig8 the marginal end portion 32b is bent upwardly at 36b while the marginal end portion 34b is bent downwardly at 38b . when formed and bent in this manner , the dual end rotary tiller blades 28b provide oppositely directed cutting edges to teeth 40b , 42b on the marginal end portions 32b , 34b respectively . the oppositely directed cutting edges or teeth 40b , 42b are best shown in fig9 - 10 . as compared with the fig3 - 6 embodiment , the marginal end portions 32b , 34b , and therefore , the cutting edges or teeth 40b , 42b of the fig7 - 10 embodiment , are designed to overlap adjacent marginal end portions 32b , 34b of dual end rotary tiller blades 28b which are mounted on adjacent rotary tiller supports 26 of the driven tiller shaft 24 , as is shown in fig2 . this overlapping feature assures complete tilling to the depth desired across the full width of earth engagement by the rotary tiller blades . from the foregoing , it will be appreciated that the dual end rotary tiller blades of the present invention provide improved tiller performance by unique blade design that assures faster tilling , smoother tiller operation and more complete pulverization or ground breaking , and at the same time , will allow simple and economical manufacture of standard type blades .

US-1872379-A

the sprayer is designed to be operated on standing crops by utilizing a rounded boom with a deflector plate at the front to gently deflect the crops and induce mechanical turbulence into which the liquid to be sprayed is introduced so as to provide complete coverage of the crop . large spans are accommodated by providing folding booms which are held in place by front and rear sets of cables . the height of the booms is adjustable to accommodate the particular crop being sprayed .

the sprayer , generally designated 10 , of the instant invention is comprised generally of a main frame 12 and a pair of booms 14 extending from either side of the main frame 12 and is designed for attachment to a tractor or other vehicle which can tow sprayer 10 through a field . extending rearwardly from tongue 16 are longitudinal rails 18 upon which are mounted main wheels 20 and tank 22 . lower rear frame rail 24 extends across the back of frame 12 and an upper rear frame rail 28 is spaced above lower rail 24 by means of rear uprights 26 ( as shown in detail in fig4 ). a belly pan 30 is located beneath main frame 12 and serves to allow the smooth passage of sprayer 10 over a standing crop and minimize the damage thereto . a tongue portion 30a of belly pan 30 extends forward beneath tongue 16 and skid portions 30b extend forwardly and upwardly from the point at which they join the main portion of belly pan 30 . a vertical adjustment mechanism is shown and designated in general as fig3 and is shown in fig4 . in particular , a rectangular sleeve 36 is slidably mounted over rear upright 26 . a crossbar 38 connects the two sleeves 36 . a clevis 40 is located on outer ends of crossbar 38 as shown in fig5 . a pivot pin 42 connects clevis 40 to u - joint 44 while a second pivot point 46 connects u - joint 44 to clevis 48 . in turn , clevis 48 is attached to the proximal end of boom tube 50 . boom tube 50 is preferably formed of eight inch diameter auger tubing although of course any other suitable material may be utilized as long as the diameter is sufficient as will be more fully described hereinafter . the adjustment mechanism 34 is further comprised of a cable 52 which is attached at one end to cable mount 54 and thereafter passes about a pulley 56 located on sleeve 36 and thence upwardly terminating at a winch 58 mounted on upper rear frame rail 28 . a chain 60 is utilized to maintain the adjustment which has initially been provided by winch 58 and in particular chain 60 is affixed at one end by pin 62 and at its other end by a removable pin 64 . thus , when the vertical adjustment mechanism 34 has reached the desired height , pin 64 may be placed through the appropriate length of chain to provide a height adjustment to booms 14 . an alternate embodiment of the height adjustment mechanism 34 shown in fig4 is shown in fig6 . in particular , a hydraulic cylinder 66 extends between an upper attachment point 68 on upper rear frame rail 28 and a lower attachment point 70 on crossbar 38 . while the manual mechanism shown in fig4 has the advantage of being relatively inexpensive and uncomplicated , the hydraulic arrangement shown in fig6 can be valuable to the farmer by allowing the farmer to raise and lower booms 14 as he travels through the field to suit crop conditions which might vary from one portion of the field to another . outboard wheels 72 are mounted toward the distal ends of booms 14 . in particular , outboard wheels 72 are provided with an adjustable mounting point 74 which may be hydraulically adjusted or manually adjusted by means of a pin and multiple hole arrangement to allow coordination of the height of the distal end of booms 14 with the proximal end adjustment provided by mechanism 34 . as can be seen in fig1 , 3 and 5 , a fill tube 76 runs through boom tube 50 . in particular , fill tube 76 is designed to run from the distal end of boom 14 inwardly for connection to tank 22 . the filling connector 78 is provided at the outboard end of fill tube 76 for connection to a source of water or mixed chemical which will be sprayed . fill tube 76 can be run through one or both of booms 14 depending on the needs of the farmer and the layout of the farm . by providing such a remote connector 78 , the sprayer 10 may be refilled without resorting to folding sprayer 10 into the transport position for refilling . such provision also negates the need for long hoses which would normally be provided were the tank 22 to be filled directly from the liquid source . a rear cable frame 80 extends rearwardly from rear frame rail 24 and 28 where it is pivotably mounted at mounting point 82 . attached at mounting point 84 at the rearward end of rear frame 80 are rear cables 86 which extend forwardly and outwardly to mounting points 74 on boom 14 distal ends . a first front cable 88 is attached at removable pin joint 90 to mounting point 74 and extends forwardly to pin joint 92 on tongue 16 . second front cable 94 extends from pin joint 96 forwardly and terminates in a chain section 98 adjacent tongue 16 . a chain binder 100 is attached at one end to tongue 16 and engages chain section 98 at its other end to provide adjustment and allow the taking up of the slack in the various cables of the system . turning particularly to fig2 a deflector panel 102 is mounted to the forward edge of boom tube 50 and extends forwardly and upwardly from boom 15 . deflector panel 102 is mounted on a mount 104 which is attached to boom tube 50 . a plurality of nozzles 106 extends across the full width of sprayer 10 and is mounted to boom 14 by means of nozzle mount 108 . as can be seen in fig2 nozzles 106 are located above boom 14 and yet below the upper end of deflector plate 102 . nozzles 106 direct spray s downwardly on the grained g immediately behind boom 14 . as boom 14 moves forwardly through the field , it contacts the grain and pushes it downwardly as shown in fig2 . after the grain is released , grain springs back upwardly and waves back and forth for a short while . this mechanically induced turbulence allows the spray s to effectively and completely cover the grain g and provides the most effective spraying of all parts of the plant . nozzle piping 110 is conventional in nature and connects nozzles 106 with tank 22 . of course , it is contemplated that conventional pumping equipment and the like will also be utilized in this regard , but such equipment is not shown further due to its conventional nature . initially , sprayer 10 is in the operative position shown in fig1 . when it is desired to transport or store sprayer 10 , one need merely release chain binder 100 and remove pin joints 90 , 92 and 96 and thence , store cables 88 and 94 on the tractor or sprayer . by driving forwardly , booms 14 will swing rearwardly into the position shown in fig3 . due to the pivoting of booms 14 as well as the pivotable nature of rear cable frame 80 , sprayer 14 may be maneuvered through spaces much tighter than would be possible without the inventive arrangement . while the preferred embodiments of the present invention have been described , it should be understood that various changes , adaptions and modifications may be made therein without departing from the spirit of the invention and the scope of the appended claims .

US-54257583-A

a mounting apparatus for mounting a data storage device that defines a locking hole in a sidewall thereof includes a bracket for holding the data storage device , and a locking member . the bracket includes a first side wall defining a through - hole . the locking member includes a mounting member mounted to the first side wall of the bracket , and a securing member rotatably mounted to the mounting member . the securing member includes a post extending therefrom . the securing member is selectively located in two positions . in a first position , the post passes through the through - hole of the bracket to engage with the locking hole of the data storage device . in a second position , the post is disengaged from the locking hole .

referring to fig1 , a mounting apparatus of an electronic device like a computer in accordance with a preferred embodiment of the present invention is shown for mounting a functional component like a data storage device 100 to an enclosure of the computer . the data storage device 100 defines a pair of locking holes 104 in a sidewall 102 thereof . the mounting apparatus includes a bracket 10 mounted to the computer enclosure , and a pair of locking members 40 . referring also to fig2 , the bracket 10 includes a first side wall 12 , a second side wall 14 parallel to the first side wall 12 , a top wall 16 connecting tops of the first side wall 12 and the second side wall 14 , and a bottom wall 18 connecting bottoms of the first side wall 12 and the second side wall 14 . the first side wall 12 defines a pair of through - holes 22 therein . two pairs of locating holes 24 are defined in the first side wall 12 . the locating holes 24 of each pair are located at opposite sides of a corresponding through - hole 22 . two pairs of arc - shaped rails 26 are stamped outwardly from the first side wall 12 . the rails 26 of each pair are located at opposite sides of a corresponding through - hole 22 and extend along a circumference round the through - hole 22 . the rails 26 are symmetrically alternated with the locating holes 24 . a blocking tab 28 is bent toward the inside of the circumference from a first end of each rail 26 in a clockwise direction . a pair of resilient tabs 30 is stamped from the second side wall 14 . referring also to fig3 to 5 , each locking member 40 includes a securing member 42 , a resilient member 60 , a mounting member 62 , and an elastic operating member 90 . the securing member 42 includes a circular body 44 , a pillar 46 extending from a center of the body 44 , and a post 48 opposite to the pillar 46 extending from the center of the body 44 . a pair of ears 50 parallel to the pillar 46 and opposite to each other extends from a circumference of the body 44 . l - shaped retaining slots 52 are defined in the securing member 42 extending from opposite sides of the body 44 to each ear 50 . a guiding rib 54 protrudes out from one of the pair of ears 50 adjacent the corresponding retaining slot 52 . the resilient member 60 having a truncated conical shape is a coil spring . the mounting member 62 includes a circular main part 64 and a cylinder 66 extending from a circumference of the main part 64 . a receiving hole 68 is defined in a center of the main part 64 for holding a distal end of the pillar 46 of the securing member 42 therein . a first locating slot 70 is defined in each of two opposite edges of the mounting member 62 at junctions of the main part 64 and the cylinder 66 . a second locating slot 72 is defined adjacent each first locating slot 70 in the mounting member 62 . a depth of each first locating slot 70 is greater than that of each second locating slot 72 . an opening 74 is defined between each first locating slot and the receiving hole 68 in the main part 64 . each opening 74 communicates with a corresponding first locating slot 70 and a corresponding second locating slot 72 . each of a pair of projecting portions 76 are formed on opposite sides of , and protrudes outwardly from , a bottom of the cylinder 66 . the projecting portions 76 extend along a circumference of the cylinder 66 . an elastic arm 78 extends along the circumference of the cylinder 66 from a second end of each projection portion 76 in a clockwise direction . a locating post 80 protrudes from a distal end of each elastic arm 78 for being engaged in a corresponding locating hole 24 of the bracket 10 . a limiting post 82 and a supporting tab 84 therebelow protrude out from the cylinder 66 adjacent a corresponding first locating slot 70 . a guiding slot 86 is defined in an inner surface of the cylinder 66 for the guiding rib 54 of the securing member 42 sliding therein . the operating member 90 includes a hemicyclic operating portion 92 having two distal ends . an extension portion 94 extends from each distal end of the operating portion 92 . a connecting portion 96 extends perpendicularly inward from a distal end of each extension portions 94 . an orientating portion 98 extends perpendicularly inward from a distal end of each connecting portion 96 . referring also to fig6 - 9 , in assembling each locking member 40 , the resilient member 60 fits about the pillar 46 of the securing member 42 . the securing member 42 is received in the cylinder 66 of the mounting member 62 . a distal end of the pillar 46 is received in the receiving hole 68 of the mounting member 62 . the ears 50 of the securing member 42 are received in the corresponding openings 74 of the mounting member 62 . the guiding rib 54 of the securing member 42 is received in the guiding slot 86 of the mounting member 62 . the connecting portions 96 and the orientating portions 98 of the operating member 90 are inserted through the corresponding first locating slots 70 , and the corresponding retaining slots 52 of the locking member 50 . the orientating portions 98 of the operating member 90 are received in the retaining slots 52 . thus , the locking member 40 is formed . in assembling each locking member 40 to the bracket 10 , the post 48 aligns with the through - hole 22 of the bracket 10 . the projection portions 76 of the mounting member 62 are received in the corresponding rails 26 of the bracket 10 from a second end in the clockwise direction and slide on the rails 26 in an anti - clockwise direction . the locating posts 80 are engaged with the corresponding locating holes 24 of the bracket 10 . the blocking tabs 28 of the bracket 10 block corresponding ends of the projection portions 76 . thus , the locking member 40 is mounted to the bracket 10 . in preparation for assembling the data storage device 100 , pulling each operating member 90 causes the corresponding securing member 42 to move in a direction away from the bracket 10 thereby depressing the resilient member 60 within the mounting member 62 . thus , ensuring the post 48 of the securing member 42 is not penetrating beyond an edge of the through - hole 22 of the bracket 10 . after the connecting portions 96 of the operation member 90 are separated from the corresponding first locating slots 70 of the mounting member 62 , the operating member 90 is rotated . when the connecting portions 96 move above the corresponding second locating slots 72 of the mounting member 62 , the operating member 90 is released . the resilient member 60 is elastically restored . the securing member 42 moves toward the bracket 10 . the connecting portions 96 of the operating member 90 are located in the corresponding second locating slots 72 of the mounting member 62 . in assembling the data storage device 100 , the data storage device 100 is inserted into the bracket 10 . the locking holes 104 of the data storage device 100 align with the corresponding through - holes 22 of the bracket 10 . each operating member 90 is pulled away from the bracket 10 , and then is rotated . when the connecting portions 96 of the operating member 90 become aligned with the corresponding first locating slots 70 , the operating member 90 is released . the corresponding resilient member 60 is elastically restored . the securing member 42 moves toward the bracket 10 . the post 48 of the securing member 42 passes through the corresponding through - hole 22 of the bracket 10 and engages with the corresponding locking hole 104 of the data storage device 100 . the connecting portions 96 of the operating member 90 are located in the corresponding first locating holes 70 of the mounting member 62 . the resilient tabs 30 of the bracket 10 are elastically attached to an opposite sidewall of the data storage device 100 . thus , the data storage device 100 is secured . then , each operating member 90 is rotated to make a corresponding extension portion 94 thereof to be located between a corresponding limiting post 82 and a corresponding supporting tab 84 of the mounting members 62 . in disassembling the data storage device 100 , pulling each operating member 90 to move from corresponding first locating slots 70 to corresponding second locating slots 72 will disengage the posts 48 from the locking holes 104 . it is believed that the present embodiment and its advantages will be understood from the foregoing description , and it will be apparent that various changes may be made thereto without departing from the spirit and scope of the invention or sacrificing all of its material advantages , the example hereinbefore described merely being a preferred or exemplary embodiment of the invention .

US-30895206-A

the present invention relates to a biodegradable disposable syringe and more particularly , to the biodegradable disposable syringe by using a novel polyester resin composition under a specific injection molding condition , thus being able to be disposed of without causing environmental contamination .

the present invention relates to a disposable syringe manufactured by means of injection molding using biodegradable polyester resin having 9 , 000 - 90 , 000 of number average molecular weight , 30 , 000 - 600 , 000 of weight average molecular weight , 40 - 150 ° c . of melting point , 0 . 1 - 50g / 10 min of melt index ( 190 ° c ., 2160g ). the resin composition used in the present invention comprises an aromatic dicarboxylic acid ( or an acid anhydride thereof ) such as dimethyl terephthalate and terephthalic acid ; an aliphatic ( including cyclic type ) dicarboxylic acid ( or an acid anhydride thereof ), one or more selected from the group consisting of succinic acid and adipic acid ; and an aliphatic ( including cyclic type ) glycol , one or more selected from the group consisting of 1 , 4 - butanediol and ethylene glycol , by means of esterification and polycondensation reactions as disclosed in unexamined korean patent publication nos 98 - 33837 , 98 - 33834 , 99 - 56991 and 99 - 58816 . the polyester resin in the present invention is an aliphatic polyester resin which has superior physical properties sufficient to resolve the limitations used to be present in the conventional biodegradable types of resins by improved biodegradability ascribed to its peculiar molecular structure . the specific physical properties of the biodegradable polyester resin in the present invention can be represented as shown in the following table 1 . according to the present invention , the appropriate melting point of the resin ranges from 40 to 150 ° c ., preferably from 100 to 150 ° c . if the melting point is below the above range the forming becomes hard to adjust properly due to low crystallinity . products manufactured by means of injection molding as in the syringe of the present invention are used in general for producing relatively hard and durable parts , and those polyester resins with higher melting point will be more suitable for injection molding . if the temperature of injection molding is too low , the resulting syringe products will become too soft to retain its physical properties . the melting point of conventional polypropylene plastic materials falls between 180 and 220 ° c . and thus the properties of those materials are totally different from the one in the present invention . injection molding using the biodegradable resins of the present invention may be performed under general temperature conditions , however , the preferred temperature ranges from 120 to 190 ° c . if the molding is performed at a temperature lower than 120 ° c . it is hard to produce a desirable product because the resin kept within the screw will not be completely melted , while physical properties become poor due to heat decomposition if it is performed at a temperature higher than 190 ° c . the conventional pp resin for syringes has different injection molding temperature range , 230 - 275 ° c . however , if the resins in the present invention are molded under temperatures use for conventional resins , the resins will be inappropriate for molding because they will decomposed by heat and their physical properties will become extremely poor . further , if the resins in the present invention are kept to stay within the screw of injection for more than 10 min the molding cannot be well proceeded or the molded product would not be able to carry the proper properties of syringe if they are molded due to heat decomposition . for the production of highly durable syringes , the resin may be combined with a strength fortifying additive selected from the group consisting of talc , calcium carbonate , magnesium stearate , calcium sulfate , starches , sugar powder , particular anhydrous silicate and calcium phosphate , and preferably by adding 1 - 60 wt . % of talc or calcium carbonate based on the 100 wt . % of resin , which then enables to improve the strength of the resins in the present invention comparable to the conventional resins such as polypropylene , polystyrene or abs resin . calcium carbonate is inferior to talc in fortifying strength , however , it can serve as a fertilizer and prevent the soils from acidifying when it becomes biodegraded and left on the surface of soils after burial . in addition , the combustion rate of calcium carbonate added resin was better than those of resin alone or talc - added resin in the present invention . the syringes produced in accordance with the present invention can be produced in various forms disposable syringe , pre - filled type syringe , general syringe and the like . for example , fig1 shows a biodegradable disposable syringe of the present invention having a needle cap 1 , a barrel 2 and a plunger 3 manufactured by using a polyester resin composition of the present invention under a specific injection molding condition with the exception of the needle . the following examples are intended to be illustrative of the present invention and should not be construed as limiting the scope of this invention defined by the appended claims . to a 500 ml erlenmeyer &# 39 ; s flask filled with nitrogen gas 118 g of succinic acid , 121 . 7 g of 1 , 4 - butanediol and 0 . 1 g of tetrabutyltitanate as a catalyst , were added while slowly increasing the temperature until it reached 200 ° c . when the temperature reached 200 ° c ., the reaction mixture was allowed to react for 2 hrs and then theoretical mass of water was effused . then 0 . 1 g of antimony acetate , 0 . 2 g of dibutyltin oxide , 0 . 07 g of tetrabutyltitanate as catalysts , and 0 . 2 g of trimethyl phosphate as a stabilizer were added . the temperature was raised and a polycondensation reaction was performed under 0 . 3 torr at 245 ° c . for 1 . 55 min . the sample of biodegradable resin taken at this point had a melt index of 15 ( 190 ° c ., 2160 g ), number average molecular weight of 31 , 000 , weight average molecular weight of 190 , 000 and melting point of 117 ° c . as measured by dsc method . to a 500 ml erlenmeyer &# 39 ; s flask filled with nitrogen gas , 5 . 9 g of succinic acid , 6 . 3 g of 1 , 4 - butanediol and 0 . 1 g of tetrabutyltitanate as a catalyst were added to carry esterification by effusing water while slowly increasing the temperature . when the temperature reached 200 ° c ., theoretical mass of water was effused completely to give 8 . 6 g of aliphatic low molecular weight polymer with its molecular weight around 10 , 000 . then , 76 . 1 g of terephthalic acid , 135 . 2 g of 1 , 4 - butanediol , and 0 . 2 g of tetrabutyltitanate a catalyst were added to the reaction mixture to carry esterification by effusing methanol while slowly increasing the temperature . after methanol was effused completely while keeping the temperature at 205 ° c ., 29 . 5 g of succinic acid and 43 . 8 g of adipic acid were added to carry further esterification . after water was effused while keeping the temperature at 180 ° c ., 0 . 1 g of antimony trioxide , 0 . 3 g of dibutyltin oxide , 0 . 07 g of tetrabutyltitanate as catalysts , and 0 . 2 g of trimethyl phosphate as a stabilizer were added . the temperature was raised until it reached 245 ° c . and a polycondensation reaction was performed under 0 . 3 torr at 245 ° c . for 200 min . the sample of biodegradable resin taken at this point had a melt index of 2 ( 1 . 90 ° c ., 2160 g ), number average molecular weight of 61 , 000 , weight average molecular weight of 290 , 000 and melting point of 117 ° c . as measured by dsc method . disposable syringes were manufactured by using polyester resins having 117 ° c . of melting point produced in the above preparation examples 1 and 2 under 1 . 30 - 1 . 40 ° c . by means of injection molding . the test results of syringes showed that 400 kg / cm 2 and 410 kg / cm 2 for tensile strength , 300 % and 320 % for elongation , and 90 % and 92 % for biodegradability rate after 45 days , respectively . the biodegradability was measured by organic waste systems [ o . w . s . n . v . ]( dok noord 4 , b - 9000 gent , belgium ), and tensile strength and elongation were measured by utm .

US-59458900-A

a cleaning tool for the removal of debris and subsequent cleaning of lug nuts for a wheel includes an elongate handle removably mounted to a socket , wherein the socket includes a cylindrical or alternatively , a conical configuration to receive an associated lug nut therewithin . rotation of the socket effects a cleaning of an associated lug nut .

with reference now to the drawings , and in particular to fig1 to 8 thereof , a new and improved wheel lug cleaning tool embodying the principles and concepts of the present invention and generally designated by the reference numerals 10 , 10a , and 10b will be described . more specifically , the wheel lug cleaning tool 10 of the instant invention essentially comprises an elongate coaxially aligned handle 11 that includes a handle mounting shaft 12 coaxially directed through the handle extending forwardly thereof in a coaxially aligned relationship to permit selective securement within a square drive bore 15 coaxially directed through a floor of an associated lug receiving socket 13 . the lug receiving socket 13 may define cylindrical or a truncated conical interior cavity to receive a wheel lug therewithin . the conical cavity is at times advantageous to accommodate various sizes of lug nuts and effect greater frictional interrelationship between the associated walls of the socket and a fibrous covering 16 that is mounted about interior and exterior surfaces of the side walls of the socket 13 to effect cleaning and polishing of the lug nut received within the cavity 14 . the covering is positioned on exterior surfaces of the side walls of the socket 13 to provide for a cleaning surface that is readily manually manipulated about a lug nut to effect access to portions of a lug nut that may not be readily available when directed interiorly of the socket 13 within the cavity 14 . the square drive bore 15 removably mounted relative to the shaft 12 permits selective securement of the socket 13 to various drive tools , such as socket wrenches and the like , should enhanced speed be desired in a cleaning procedure . fig4 and 5 illustrate a modified cleaning tool 10a , wherein a modified handle 11a includes an internally threaded upper handle end 18 that is threadedly secured to an externally threaded socket shank 17 coaxially aligned with the socket 13 that may also be formed with conical walls , as desired and noted above , with the socket shank 17 extending rearwardly thereof . the modified handle 11a includes a piston rod 21 reciprocatably directed through a handle lower web 19a that is orthogonally oriented relative an axis defined by the handle , including a coaxial bore to receive the piston rod 21 slidably therethrough . a piston 22 is mounted fixedly and orthogonally to an upper terminal end of the piston rod 21 and includes a piston rod annular seal 23 formed thereabout to provide a sealing relationship between an interior wall surface of the cylindrical handle 11a , wherein a reservoir chamber 19 is defined between a forward terminal end of the piston 22 and the bore 15 to direct fluid from the reservoir 19 therethrough into the cavity 14 , wherein the fluid may be of a cleaning fluid solution or polishing fluid to enhance cleaning in a lug cleaning procedure . the piston rod includes a piston rod handle 24 mounted fixedly and orthogonally to an outer terminal end of the rod 21 as it projects exteriorly of the lower web 19a to permit ease of manipulation of the piston rod 21 . a further modified tool 10b , as illustrated in fig6 and 7 , where additionally to the organization , a resilient flap valve 26 is positioned within the bore 15 to maintain the cleaning fluid 25 within the reservoir 19 until the valve 26 is deflected upon pressurizing of the reservoir 19 by projecting of the piston 22 interiorly of the reservoir 19 and thereby direct the cleaning fluid interiorly within the cavity 14 . a spring 27 is coaxially mounted within the cavity 14 , including a magnet 28 mounted at a forward terminal end thereof and is coaxially aligned within the cavity 14 to thereby permit selective securement of the lug nut to the magnet 28 , with the spring permitting compression thereof to enhance mounting of a lug nut onto an associated lug nut stud ( not shown ) of an associated automotive wheel , wherein the spring 27 is coaxially retracted within the socket 14 upon compression of the spring 27 , with the walls 13 defining a conical interior cavity defined by the modified wall 13a , as illustrated in fig7 to enhance grasping of the lug nut for its mounting upon an associated lug nut stud and thereby permit subsequent cleaning and mounting of the lug nut in a single procedure . as to the manner of usage and operation of the instant invention , the same should be apparent from the above disclosure , and accordingly no further discussion relative to the manner of usage and operation of the instant invention shall be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .

US-72917991-A

the invention relates to transparent sunscreen compositions containing an ester of a α - hydroxy carboxylic acid and a solid organic uv - filter , which is present in the dissolved state , and which are essentially free of water and ethanol , and to the use thereof as a sunscreen , in particular sun protection gel or sun protection spray .

α - hydroxycarboxylic acids such as , for example , lactic acid , citric acid , malic acid or tartaric acid , are used extensively in cosmetic preparations . they are used as moisturizer and for exciting the cell metabolism in the skin in case of stressed and aging skin . since α - hydroxycarboxylic acids can lead to skin irritation already at low concentrations , their use in cosmetic preparations is strongly limited . a remedy is provided by esters of α - hydroxycarboxylic acids , which can be considered to be carriers of α - hydroxycarboxylic acids and which are cleaved slowly by the esterases present on and in the skin , releasing the α - hydroxycarboxylic acids . this cleavage occurs slowly , so that esters of α - hydroxycarboxylic acid exert a long - term treatment effect on the skin . due to the slow release of the α - hydroxycarboxylic acids on the skin , it is possible , in comparison to free o - hydroxycarboxylic acids , to apply large amounts of the esters of the α - hydroxycarboxylic acids by means of cosmetic preparations on the skin , where they have a moisture - releasing and calming effect . all of the acid groups of the α - hydroxycarboxylic acid ( s ) used according to the invention are therefore esterified , the transparent sunscreen compositions according to the invention contain at least one ester of an α - hydroxycarboxylic acid as acid component , and r — oh as alcohol component , where r ═ c 8 - c 20 alkyl , saturated or unsaturated , linear or branched , or their mixtures . it is particularly preferable if the esters are esters of lactic acid , citric acid , malic acid , tartaric acid or their mixtures as acid component , and r — o ( h ) as alcohol component , where r ═ c 8 - c 20 alkyl , saturated or unsaturated , linear or branched , or their mixtures . such esters of α - hydroxycarboxylic acids are commercially available from sasol / italy under the names cosmacol ® eli ( inci : c12 - 13 alkyl lactate ), cosmacol ® eci ( inci : tri - c12 - 13 alkyl citrate ), cosmacol ® ecl ( inci : tri - c14 - 15 alkyl citrate ), cosmacol ® emi ( inci : di - c12 - 13 alkyl malate ), cosmacol ® eti ( inci : di - c12 - 13 alkyl tartrate ) as well as cosmacol ® etlp ( inci : dimyristyl tartrate ). in addition to having a moisture - releasing and calming effect on the sun stressed skin , these esters are characterized in that they represent good solvents for organic uv filters , particularly solid organic uv filters . moreover , the sunscreen compositions according to the invention contain at least one water - insoluble and solid organic uv and / or uvb filter as mentioned in appendix vi of the european cosmetic agents regulation no . 1223 / 2009 . particularly preferable are diethylamino hydroxybenzoyl hexyl benzoate ( uvinul ® a plus , basf ), ethylhexyl methoxycinnamate ( for example , eusole ® 2292 , merck ), ethyl triazone ( uvinul ® t 150 , basf ), bis - ethylhexyloxyphenol methoxyphenyl triazine ( tinosorb ® s . basf ) as well as butyl methoxydibenzoylmethane ( eusolex ® 9020 , merck ). the water - insoluble and solid organic uv filters are soluble in the esters of the α - hydroxycarboxylic acids or their mixtures and in the sunscreen compositions . therefore , the sunscreen compositions are also transparent . in addition to the at least one water - insoluble and solid organic uva or uvb filter or their mixtures , liquid soluble uva or uvb filters or their mixtures , for example , can also be present . the transparent sunscreen composition according to the invention contain at most 1 wt % of water and at most 1 wt % of ethanol and are thus substantially free of water and substantially free of ethanol . moreover , the transparent sunscreen compositions according to the invention preferentially contain at most 1 wt % of a c3 alcohol and preferably at most 1 wt % of a c4 alcohol . in an additional embodiment of the present invention , as a result of the use of one or more thickeners comprising hydrophilic amorphous silicates , hydrophobic amorphous silicates , silicate salts or their mixtures , transparent and gel - like sunscreen compositions can be produced . examples are the aerosil ® and sipernat ® types from evonik industries and the wacker ® hdk types from wacker chemie . when used as sprays , the transparent sunscreen compositions according to the invention contain 0 to 2 wt %, in particular 0 to 1 wt %, such as 0 . 01 to 0 . 1 wt %, of the above thickeners . when used as gels , the transparent sunscreen compositions according to the invention contain 0 - 10 wt %, in particular 1 to 8 wt % and particularly preferably 1 . 5 to 4 wt % of the above thickeners . moreover , in addition to the esters of the α - hydroxycarboxylic acids , the transparent sunscreen compositions according to the invention can contain additional oils or waxes or their mixtures . preferentially , the oils and / or waxes are selected from the group of the lecithins , triglycerides of saturated or unsaturated , branched and / or linear alkylcarboxylic acids having a chain length of 6 to 24 , in particular 12 to 18 c atoms , including their mixtures . the triglycerides preferentially can be synthetic , semisynthetic or natural oils and / or waxes such as , for example , triisostearin , soybean oil , castor - bean oil , olive oil , safflower oil , wheat germ oil , grape seed oil , peanut oil , sunflower oil , almond oil , palm oil , palm kernel oil , coconut oil , thistle oil , evening primrose oil , rapeseed oil and the like . moreover , the oils and / or waxes can consist of the group of the branched and / or linear hydrocarbons such as , for example , paraffin waxes . vaseline ( petrolatum ), mineral oil , paraffin oil , isohexadecane , dodecane , tetradecane , hexadecane , octadecane , docosane and polyolefins . according to the present invention , the oils and / or waxes can also be selected preferentially from the group of the esters of saturated and / or unsaturated , branched and / or linear alkylcarboxylic acids having a chain length of 3 to 30 c atoms , and of saturated or unsaturated , branched or linear alcohols having a chain length of 3 to 30 c atoms , including their mixtures . as examples are mentioned : jojoba oil , isopropyl myristate , isopropyl palmitate , isopropyl stearate , isopropyl oleate , n - butyl stearate , n - hexyl laurate , n - decyl oleate , isooctyl stearate , isononyl stearate , isononyl isononanoate , 2 - ethylhexyl palmitate , 2 - ethylhexyl laurate , 2 - hexyldecyl stearate , 2 - octyldodecyl palmitate , oleyl oleate , oleyl erucate , erucyl oleate and erucyl erucate . furthermore , the emulsions according to the invention can contain oils and / or waxes from the groups of the silicone oils ( cyclic and / or linear ) and the group of the dialkyl ethers such as , for example , dicaprylyl ether or distearyl ether , or the group of the dialkyl carbonates . esters of aromatic carboxylic acids with saturated or unsaturated , branched or linear alcohols having a chain length of 3 to 30 c atoms , including their mixtures such as c 12 - 15 alkyl benzoate , for example , can also be used in the transparent sunscreens according to the invention . in addition , any mixtures of such oil and wax components can be used preferentially in the sense of the present invention . the transparent sunscreen compositions according to the invention preferably contain saturated or unsaturated , branched or linear alcohols having a chain length of 10 to 30 c atoms , including their mixtures . guerbet alcohols are particularly preferable , such as isofol ® 12 ( inci : butyloctanol , sasol germany ), isofol ® 16 ( inci : hexyldecanol ), isofol ® 18 t ( inci : octyldecanol ) or isofol ® 20 ( inci : octyldodecanol ), including their mixtures . moreover , the transparent sunscreen compositions according to the invention can contain other cosmetic and / or pharmaceutical excipients , additives and / or active substances . they are , for example : cooling substances such as , for example , menthol , dyes , perfume , antioxidants , plant extracts , antiperspiration agents , tanning agents , film formers , protein hydrolysates , vitamins , antimicrobial substances and the like . the following examples are intended to illustrate the invention without limiting it . all the quantity indications are based on the weight and the total quantity of the preparations . phase a was heated at approximately 60 ° c . and stirred until the sample turned transparent . the sample was allowed to cool to approximately 30 ° c ., and phase b was added and homogenized . for the production of the gels , phase c was added and homogenized using an ultra - turrax . subsequently , the gel was defoamed under a vacuum . determination of the clear melt point : a test tube or shukoff flask was filled with 5 - 10 of the clear product to be tested and provided with a low - temperature thermometer . the sample was cooled in the cryostat bath to at least − 20 ° c ., until the sample was completely frozen . subsequently , the sample was slowly thawed at room temperature . the temperature at which the sample no longer displays any detectable turbidity was considered the clear melting point . as the result , the arithmetic mean from two determinations was indicated , provided their difference did not exceed 1 ° c . the respective formulations and results of the investigations are represented in tables 1a , 1 b , 2a and 2b .

US-201414904808-A

this invention relates to portable duck blind stools in general , and more specifically to a heated stool construction that can be inverted to serve as a carrying case for transporting articles to and from a duck blind , and which is further provided with a securable lid member having a plurality of closed fuel receptacles attached thereto , to create a heat source for the stool proper .

as can be seen by reference to fig1 the combined heater , stool , and carrying case of the present invention is designated generally as 10 , and comprises an elongated generally cylindrical metal receptacle member 20 , and a lid member 30 . as can best be seen in fig2 the elongated receptacle member 20 is provided with a shallow recess 21 on the exterior surface of its closed end 22 ; and the dimension of the closed end , is such as to provide an ample seating surface for an adult . a thin resilient seat pad element 24 is also provided , which is dimensioned to fit within the shallow recess , and cover the closed end 22 of the receptacle . in one form of the invention , the seat pad 24 may optionally be provided with a plurality of apertures 25 ( shown in phantom ), whose purpose and function are to allow more heat to be transmitted to the user . in addition to the above mentioned structural elements , the receptacle member 20 is further provided with a handle element 26 , pivotally disposed on opposite sides of the receptacle , proximate its open end 23 , and an adjustable damper element 40 , which cooperates with a single enlarged damper aperture 28 disposed proximate to , but spaced from , the open end of the receptacle member 20 . in one form of the preferred embodiment illustrated in fig4 the damper element 40 comprises a disk 41 that is pivotally secured to the receptacle 20 by pivot means 42 disposed proximate the single enlarged damper aperture 28 ; wherein the the disk 41 may be selectively rotated , to cover a portion or all of the damper opening 28 . in another form of the preferred embodiment illustrated in fig5 the damper element 40 comprises an elongated , generally rectangular damper plate 43 , that is frictionally and slidingly engaged by a pair of elongated retaining members 44 , disposed on opposite sides of the single damper aperture 28 , wherein the damper plate may be selectively moved to progressively cover or ultimately block off the aperture opening . it should be appreciated at this point , that in both of the aforementioned forms of the preferred embodiment , the damper element 40 is adapted to completely seal off the passage of air through the damper aperture 28 , when the damper element 40 is in the position indicated by the phantom lines in fig4 and 5 respectively . this may be accomplished by the use of a rubber gasket ( not shown ) or other resilient sealing means disposed intermediate the damper element and the side of the receptacle member 20 . the lid member 30 illustrated in fig1 and 3 , comprises a flat cylindrical lid element 31 , which is adapted to sealingly engage the open end 23 of the enlarged receptacle 20 in a generally snap - fit , or frictionally snug , relationship . the sealing engagement of the lid member 30 and the receptacle member 20 ; not only keeps the miscellaneous articles contained within the device 10 dry , when the device is being used as a carrying case ; but also forms a sealed receptacle that will deprive the combustion process of oxygen , when it is desired to terminate the heater function of the device 10 . as can best be seen by reference to fig3 the heat producing means 50 for the device 10 comprises a plurality of fuel cylinders 51 that are rigidly secured to the underside of the lid member 30 . each of the fuel cylinders 51 is further provided with a cap member 52 , that is adapted to sealingly engage the open end of the cylinders 51 , and flexible retaining means 53 that maintain the cap members adjacent to their respective cylinders , when they are not disposed in sealing engagement therewith . the flexible retaining means 53 are preferably in the form of a length of chain , that may be attached to the underside of the lid member 30 , or directly to the fuel cylinders themselves . since it is desirable to produce the maximum amount of heat with the least amount of muss and fuss , gel type or paraffin based fuels are recommended for use in the fuel cylinders . not only are these fuels relatively inexpensive , but they also exhibit the desired property of tending to solidify at temperatures below 50 ° f . this shared characteristic makes it extremely unlikely that any of the fuel will leak from the cylinders , when the device 10 is inverted to function as an article carrying case . obviously since sandwiches and other food items will be transported to the blind in this device , it is imperative that relatively solid fuels and secure cap members are employed . while contamination of foodstuffs is one consideration , the primary reason that a plurality of fuel cylinders are employed , as opposed to a single large fuel cylinder , is so that the heat generated within the stool can be controlled in a safe , simple , and efficient manner . the function and operation of the device 10 proceeds as follows . the hunter places his shotgun sheels , thermos , food , calls , etc ., into the receptacle member 20 , and secures the lid member 30 in place . he then grasps the handle 26 and transports the aforementioned items to the duck blind in a waterproof container . once in the blind the articles are removed , and depending on how cold the day is , one or more of the fuel cylinders are ignited . the receptacle member is inverted and placed over the lid member so that the device is once again sealed , and the flow of oxygen into the interior , to maintain and regulate combustion , can be accomplished by the selective manipulation of the single damper element 40 . if for some reason the heat generated by the cylinders is excessive or insufficient ; it is a simple matter to cause combustion to cease , by simply closing off the damper . the receptacle member is then removed , and the proper number of fuel cylinders may then be re - ignited . the invention to this point has been described as to its basic components and broad functional design ; however , the device 10 is not quite as simple as it might initially be perceived . first of all , by providing a plurality of fuel cylinders , a large volume of fuel can be stored , and selectively ignited , a substantial distance from the seat portion of the device . in fact the tops of the fuel cylinders in the preferred embodiment will extend into the receptacle member a maximum of one third of the depth of the receptacle . this not only insures that the user should not be exposed to excessively high temperatures , but also provides a large carrying capacity for the other articles mentioned supra . in addition , the single damper aperture is disposed at the same level as the tops of the fuel cylinders ( i . e ., approximately a third of the way down the side of the receptacle member 20 ). the reasons for the positioning of the aperture 28 , and the fact that only a single aperture is employed , are as follows . since heat rises , the maximum amount of heat will be retained , by positioning the aperture as far away from the seat surface as possible . positioning the aperture , at approximately the same height as the tops of the fuel cylinders , allows the effects of the progressive closing of the damper to be observed . providing only a single aperture , not only insures that the heater can be positioned such that any smoke or fumes will exist from the receptacle on the downwind side ; but also makes it easier to fabricate the damper so that the closed receptacle is not only watertight , but air tight as well . this latter feature is particularly significant to hunters that gun from water blinds ; in as much as the carrying case can also function as a life preserver in an emergency . having thereby described the subject matter of this invention it should be obvious that many substitutions , modifications and variations are possible in light of the above teachings . it is therefore to be understood that the invention as taught and described is only to be limited as to the breadth and scope of the accompanying claims .

US-50475683-A

a seed delivery device including a frame defining at least one seed chamber . the frame includes a sidewall and an air permeable floor . seed can be received and deposited on the air permeable floor through an input port . an air input channel is utilized to introduce an air stream into the seed chamber and direct it through the air permeable floor such that seed is lifted from the air permeable floor to an outlet port . an air bypass channel is configured to separate the air stream into a first stream that is directed through the air permeable floor and a second stream that is directed through the bypass channel and recombined with the first stream , at a point prior to the output port .

referring first to fig1 , reference numeral 10 designates a central or main seed hopper for an agricultural row crop planter . in fig1 , the planter &# 39 ; s forward direction of travel is toward the upper right . the hopper 10 stores seed and feeds it through a lower distribution tray 11 ( which may be elongated laterally and mounted to the bottom of the hopper housing ) under gravity . the seed is delivered directly from the distribution tray 11 to one or more air entrainment devices in an air entrainment assembly 12 . the function of the air entrainment assembly 12 , as described in more detail below , is to receive and distribute seed from the hopper 10 to individual seed meters 36 , as will be further described below . the seed meters 36 may be conventional air seed meters , for example , the meter disclosed in u . s . pat . nos . 7 , 093 , 548 and 7 , 152 , 542 , but other air seed meters may be used , as well , and mechanical seed meters may also be used with the present invention . the seed meters 36 are integral with conventional planter row units schematically represented at 35 , 35 a . . . 35 n . thus , the seed meters 36 and row units need not be described in further detail for a complete understanding of the instant invention . the system can be set up such that the air entrainment assembly 12 has an individual outlet conduit 45 for each individual air seed meter 36 . thus , persons skilled in the art will fully understand the invention , and all its modifications by understanding one air entrainment device 12 a and its associated distribution and usage . as shown in fig1 , a fan 20 , or other source of pressurized air , forces air through conduit 21 ( shown diagrammatically as a line , for simplicity ). as explained , the conduit 21 could be a single conduit ( as illustrated ) or a number of separate conduits , all coupled to the same source of pressurized air , or if there are a number of seed delivery conduits , they also could be grouped so that one or more individual seed delivery conduits could be fed by a single source of pressurized air . similarly , plural sources of pressurized air could be used with plural seed delivery conduits and seed meters . one feature of the present invention is the flexibility with which desired systems could be arranged , without substantial increase in costs and with use of standardized , interchangeable sub - assemblies and components . still referring to fig1 , the blocks 35 , 35 a , 35 n represent individual planter row units which may be conventional , each including a seed meter adapted to receive a seed delivery inlet assembly , such as the one designated 38 . the seed meter 36 may be of the type disclosed in the above - identified u . s . patents . a seed inlet assembly 38 is mounted to and provides each individual seed meter 36 with seed . each inlet assembly 38 includes an input port 39 that is connected to conduit 45 . seed is delivered to the seed reservoir of each meter 36 through an input port 39 within the seed inlet assembly . as further shown in fig1 , fan 20 is connected by a manifold 20 a by a means of a hose or conduit diagrammatically shown at 21 . manifold section 20 a has plural outlet ports one of which is connected to an input of an associated section of the air entrainment assembly 12 . the air source 20 may feed additional manifold sections , as persons skilled in the art will appreciate . the manifold sections 20 a may comprise a single , integral conduit feeding pressurized air to all outlets in common . each manifold section 20 a feeds an associated air entrainment assembly 12 as will be described presently , depending on the size of the planter . each air entrainment assembly 12 has a plurality of outlets each connected to a respective conduit 45 for providing seed under pressure to plural seed meters 36 . referring to fig2 and 3 , upper and lower perspective views of an exemplary air entrainment assembly frame 12 are respectively shown for illustrative purposes . air entrainment assembly 12 includes a base assembly 121 and an air distribution assembly 127 . in the embodiment shown , base assembly 121 includes eight bases 121 a - 121 h which are each shaped and configured to receive a respective air entrainment device 12 a and an air distribution unit 127 . base assembly 121 may include more or less than eight bases , each adapted for attachment to a respective air distribution assembly and air entrainment device . only one base assembly 121 is shown in the figures for simplicity . it should be noted , however , that base assembly 121 could include more or less bases and each base could include a corresponding air entrainment device depending on need . each base is in communication with one or more air distribution assemblies 127 attached to that base . referring further to fig4 , there is shown an upper perspective view of an individual air entrainment device 12 a in accordance with the present invention . base 121 of air entrainment device 12 a includes plural spaced recesses 122 in an upper portion of the air entrainment device . each recess 122 is shaped and configured to receive a hinge portion 128 of distribution assembly 127 . a screw or pin 140 is inserted through aligned apertures 123 disposed in an upper portion of base 121 . the screw or pin 140 spans each recess 122 and engages a corresponding hinge portion 128 to secure base 121 to the air entrainment device 12 a . further , the hinged relationship allows base to be rotated downwardly about the connecting pin 140 to provide clean - out access for air entrainment device 12 a . referring also to fig4 as well as to fig5 and 6 , which are also upper perspective views of air entrainment device 12 a , additional details of the invention will now be described . air under pressure is introduced into an air manifold 500 of the air entrainment device 12 a . the air manifolds of adjacent air entrainment devices 12 a are aligned with one another and form a common air distribution assembly 127 ( described above ) for plural air entrainment devices attached to a common base 121 a . each base 121 a includes an air permeable surface or floor , such as a perforated surface 124 . as will be described further herein , seed is distributed to air entrainment device 12 from hopper 10 through a seed conduit . the seed falls onto perforated surface 124 . when air entrainment device 12 a is operational , air flows through perforated surface 124 in the direction of arrow 132 shown in the sectional view of the air entrainment device of fig7 . the properties of the perforated surface 124 and the air flow cause agitation of the seeds . this agitation causes mixing and lifting of the seeds into the air flow passing through air entrainment device 12 a for discharge through outlet port 22 . the dimensions of perforated surface 124 can vary depending on the desired air flow and the seed transported through the air entrainment device 12 a . however , openings 0 . 125 inch in diameter in perforated surface 124 have been shown to be effective . similarly , the shape of the perforations in the surface 124 can vary , but substantially circular perforations have been shown to be effective . air entrainment device 12 further includes an air bypass channel 130 running therethrough as shown in the sectional review of fig7 . air is introduced into the air bypass channel 130 via opening 134 at the lower end of the bypass channel as shown by arrow 136 in fig7 . the air bypass channel 130 exits into outlet port 22 via bypass outlets 125 . an inner partition 138 within air entrainment device 12 a air separates the air flowing through the air entrainment device into two streams . a first stream passes upward through perforated surface 124 and urges seed upward within a seed and air mixing chamber 505 and through outlet port 22 . a second stream bypasses perforated surface 124 ( and the seed disposed thereon ), passes upward through opening 134 and into air bypass channel 130 , and recombines with the first air stream at outlet port 22 . with the second air stream not encumbered by seed and the cross sectional area of the bypass channel 130 appropriately dimensioned relative to the seed and air mixing chamber 505 , the force and / or velocity of the second air stream through bypass channel will be generally greater than that of the first air stream . accordingly , when recombination of the streams occurs , the second stream will assist the first stream in discharging seed through outlet port 22 . this air flow feature is especially helpful in diluting seed flow to prevent blockages and to reduce seed flow in the event of a blockage . this increased air flow more effectively maintains the seed and air flow at outlet 22 as well as in downstream portions of the seed delivery system to prevent blockages . this arrangement also facilitates the flow of seed through the seed and air mixing chamber 505 and reduces the possibility of blockages within the seed entrainment device 12 a . thus , as the number of seeds within the seed throat 503 and the seed and air mixing chamber 505 increases and the air flow through this portion of the air entrainment device decreases , air flow through the air bypass channel 130 increases to clear the seed and air outlet port 22 . with the seed and air outlet port 22 cleared , additional seed can be discharged from the seed and air mixing chamber 505 into the seed and air outlet port 22 allowing additional air to flow through the seed and air mixing chamber to facilitate increased seed flow . as was described in connection with fig1 , air is provided from air source 20 into the air distribution unit 127 a of each air entrainment device 12 a . air entrainment device 12 a includes an air flow channel 500 within its air distribution unit 127 a through which air from source 20 is directed . the air flow channel 500 directs air into a chamber 502 located beneath perforated surface 124 as shown in the sectional view of fig7 . meanwhile , seed is provided from hopper 10 through an input port to seed throat 503 and into the seed and air mixing chamber 505 . the seed is deposited on inclined wall or surface 504 , which is dimensioned such that the seed is deflected onto perforated surface 124 . an exemplary angle for inclined surface 504 is on the order of 52 ° relative to perforated surface 124 . as seed is deflected onto perforated surface 124 , air exits chamber 502 , agitates and mixes the seed , and causes the seed to rise within the air and seed mixing chamber 505 . simultaneously , air is allowed to pass through opening 134 and into bypass channel 130 . air - entrained seed from mixing chamber 505 is then recombined with the air stream from bypass channel 130 at outlet port 22 . seed and air then flows out of outlet port 22 to an associated seed meter 36 through one of the conduits 45 as shown in fig1 . a partition 506 separates the seed throat 503 from the seed and air mixing chamber 505 . the length of partition 506 is selected so as to limit the rate of seed flow from the seed throat 503 to the seed and air mixing chamber 505 and prevent bridging ( blockage ) of the seed within the seed and air mixing chamber , particularly when the planter is transiting a steep slope in a field being planted . also shown in fig7 are details of the attachment of base 121 a to air entrainment device 12 a at hinge 128 . air entrainment device 12 a includes plural bolts 507 to secure base 121 a to the air entrainment device when in use . bolts 507 can be removed or released allowing base 121 a to be rotated in the direction of arrow a such that seed can be removed from seed throat 503 , mixing chamber 505 , perforated surface 124 , and / or outlet port 22 for cleaning out the air entrainment device 12 a . air entrainment device 12 a further includes a mounting flange 508 that can be used to secure multiple air entrainment devices together , or in the case of an end unit , to attach an end cover . mounting flange 508 includes apertures 509 adapted to receive bolts , pins , screws , etc ., for securing plural air entrainment devices together . referring to fig8 , there is shown a partially cutaway side elevation view of air entrainment device 12 a in operation . an air source ( not shown ) provides air through flow channel 500 air distribution unit 127 a to air entrainment device 12 a . air flows from air distribution unit 127 a through channel 501 , into chamber 502 , and upward through perforated surface 124 . air engages seed 601 that is deposited in seed throat 503 , contacts angled surface 504 , and is deflected onto perforated surface 124 . this seed 601 is lifted upward through air and mixing chamber 505 . a second stream of air flows upward through air bypass channel 130 and is recombined with the air - entrained seed at outlet port 22 . the seed is then provided to a seed meter 36 through conduit 45 . a trap insert 603 is removably inserted in the air entrainment device 12 a distribution so as to subtend its seed throat 503 to stop the flow of seed from hopper 10 should the operator find it necessary , such as during transit over non - planting area , or when its base 121 a is lowered to clear blockage or remove a foreign object or unwanted material . while particular embodiments have been shown and described , it will be apparent to those skilled in the art that changes and modifications may be made without departing from the broader aspects of applicants &# 39 ; contribution . the actual scope of the protection sought is intended to be defined in the following claims when viewed in their proper perspective based on the prior art .

US-201414206872-A

information is shared among users in a system by the use of a service . the service receives information from at least two different game applications that each have a configuration file that defines information from the game application to share with a service . an intermediary program executing on a computer that is also executing one of said game applications receives information from the application as defined by said configuration files and stores at least a portion of the information received from the application . at least a portion of the information is sent to the service when the intermediary is in communication with the service over a network wherein the service provides information about a user of said at least two game applications based on information received by said service .

fig1 is diagram of an exemplary computer network that serves to illustrate aspects of the invention . here computers 100 a - 100 e may host various ones of the computing objects such as games and other applications . although the physical environment shows the connected devices as computers , such illustration is merely exemplary and may comprise various digital devices such as pdas , game consoles , etc . moreover , communications network 160 may itself comprise a number of computers , servers and network devices such as routers and the like . there are a variety of systems , components , and network configurations that support distributed computing environments . for example , computing systems may be connected together by wireline or wireless systems , by local networks or widely distributed networks . currently , many of the networks are coupled to the internet which provides the infrastructure for widely distributed computing and encompasses many different networks . aspects of the present invention could be usable to distribute computer - readable instructions , code fragments , applications and the like to various distributed computing devices . the network infrastructure enables a host of network topologies such as client / server , peer - to - peer , or hybrid architectures . the “ client ” is a member of a class or group that uses the services of another class or group to which it is not related . thus , in computing , a client is a process ( i . e ., roughly a set of instructions or tasks ) that requests a service provided by another program . the client process utilizes the requested service without having to “ know ” any working details about the other program or the service itself . in a client / server architecture , particularly a networked system , a client is usually a computer that accesses shared network resources provided by another computer ( i . e ., a server ). a server is typically a remote computer system accessible over a remote network such as the internet . the client process may be active in a first computer system , and the server process may be active in a second computer system , communicating with one another over a communications medium , thus providing distributed functionality and allowing multiple clients to take advantage of the information - gathering capabilities of the server . clients and servers communicate with one another utilizing the functionality provided by a protocol layer . for example , hypertext - transfer protocol ( http ) is a common protocol that is used in conjunction with the world wide web ( www ) or , simply , the “ web .” typically , a computer network address such as a uniform resource locator ( url ) or an internet protocol ( ip ) address is used to identify the server or client computers to each other . communication among computing devices is provided over a communications medium . in particular , the client and server may be coupled to one another via tcp / ip connections for high - capacity communication . in general , the computer network may comprise both server devices and client devices deployed in a network environment ( in a peer - to - peer environment devices may be both clients and servers ). communications network 160 may be a lan , wan , intranet or the internet , or a combination of any of these that facilitates communication among a number of computing devices 10 a - 10 e . moreover , communication network 160 may comprise wireless , wireline , or combination wireless and wireline connections . additionally , the computer network may comprises a distributed computing environment . in such an environment a computing task may be spread over a number of computing devices that are addressable elements in a computer network . according to an aspect of the invention , communication network 160 may host a service 150 that is accessible from the plurality of computers 100 a - 100 e . the service 150 gathers information and tracks users of computers 100 a - 100 e to provide computing services for all of the users of the service . fig2 illustrates the functional components of a multimedia / gaming console 100 that may be used as the computers 100 a - 100 e in the network of fig1 . the multimedia console 100 has a central processing unit ( cpu ) 101 having a level 1 cache 102 , a level 2 cache 104 , and a flash rom ( read only memory ) 106 . the level 1 cache 102 and a level 2 cache 104 temporarily store data and hence reduce the number of memory access cycles , thereby improving processing speed and throughput . the cpu 101 may be provided having more than one core , and thus , additional level 1 and level 2 caches 102 and 104 . the flash rom 106 may store executable code that is loaded during an initial phase of a boot process when the multimedia console 100 is powered on . a graphics processing unit ( gpu ) 108 and a video encoder / video codec ( coder / decoder ) 114 form a video processing pipeline for high speed and high resolution graphics processing . data is carried from the graphics processing unit 108 to the video encoder / video codec 114 via a bus . the video processing pipeline outputs data to an a / v ( audio / video ) port 140 for transmission to a television or other display . a memory controller 110 is connected to the gpu 108 to facilitate processor access to various types of memory 112 , such as , but not limited to , a ram ( random access memory ). the multimedia console 100 includes an i / o controller 120 , a system management controller 122 , an audio processing unit 123 , a network interface controller 124 , a first usb host controller 126 , a second usb controller 128 and a front panel i / o subassembly 130 that are preferably implemented on a module 118 . the usb controllers 126 and 128 serve as hosts for peripheral controllers 142 ( 1 )- 142 ( 2 ), a wireless adapter 148 , and an external memory device 146 ( e . g ., flash memory , external cd / dvd rom drive , removable media , etc .). the network interface 124 and / or wireless adapter 148 provide access to a network ( e . g ., the internet , home network , etc .) and may be any of a wide variety of various wired or wireless adapter components including an ethernet card , a modem , a bluetooth module , a cable modem , and the like . system memory 143 is provided to store application data that is loaded during the boot process . a media drive 144 is provided and may comprise a dvd / cd drive , hard drive , or other removable media drive , etc . the media drive 144 may be internal or external to the multimedia console 100 . application data may be accessed via the media drive 144 for execution , playback , etc . by the multimedia console 100 . the media drive 144 is connected to the i / o controller 120 via a bus , such as a serial ata bus or other high speed connection ( e . g ., ieee 1394 ). the system management controller 122 provides a variety of service functions related to assuring availability of the multimedia console 100 . the audio processing unit 123 and an audio codec 132 form a corresponding audio processing pipeline with high fidelity and stereo processing . audio data is carried between the audio processing unit 123 and the audio codec 132 via a communication link . the audio processing pipeline outputs data to the a / v port 140 for reproduction by an external audio player or device having audio capabilities . the front panel i / o subassembly 130 supports the functionality of the power button 150 and the eject button 152 , as well as any leds ( light emitting diodes ) or other indicators exposed on the outer surface of the multimedia console 100 . a system power supply module 136 provides power to the components of the multimedia console 100 . a fan 138 cools the circuitry within the multimedia console 100 . the cpu 101 , gpu 108 , memory controller 110 , and various other components within the multimedia console 100 are interconnected via one or more buses , including serial and parallel buses , a memory bus , a peripheral bus , and a processor or local bus using any of a variety of bus architectures . by way of example , such architectures can include a peripheral component interconnects ( pci ) bus , pci - express bus , etc . when the multimedia console 100 is powered on , application data may be loaded from the system memory 143 into memory 112 and / or caches 102 , 104 and executed on the cpu 101 . the application may present a graphical user interface that provides a consistent user experience when navigating to different media types available on the multimedia console 100 . in operation , applications and / or other media contained within the media drive 144 may be launched or played from the media drive 144 to provide additional functionalities to the multimedia console 100 . the multimedia console 100 may be operated as a standalone system by simply connecting the system to a television or other display . in this standalone mode , the multimedia console 100 allows one or more users to interact with the system , watch movies , or listen to music . however , with the integration of broadband connectivity made available through the network interface 124 or the wireless adapter 148 , the multimedia console 100 may further be operated as a participant in the larger network community as illustrated in fig1 . according to an aspect of the invention , when a game is executed on console 100 , it provides information to a service operating on communications network 160 . the service tracks the information for all of the users connected to the service to provide a rich user experience . the service tracks user information across games , consoles , computing devices , etc . by tracking the information for all users of the service , the service can aggregate statistics for all users and measure game playing ability , provide a richer user experience by providing information about friends ( e . g ., what game they are playing and what skill level they have attained ), track user achievements and generally measure statistics for a game aggregated over a large user community . in order to provide a consistent data set across games , the invention contemplates a schema driven process where each game generates a schema that defines the game data for a particular game . through a game configuration process , games use a service - defined schema to describe the data the game generates about each game player . by using the configuration process , the service will be able to understand the data as it flows from the game , and it will be able to integrate it in meaningful ways with the other data that the service understands to create a rich profile of each user of the service . the profile will follow the user wherever he goes on the service , i . e . it is game and location independent . some of the profile , in fact , will be viewable by every user of the service . fig3 illustrates the overall process that allows a game developer to configure a game for use with the service . a game developer 301 wants to create a game for use with the service by user 302 . to that end , the developer provides a set of game configuration data 304 that will be shared with the service using the tools described more fully below . the output from the use of the tool is a set of api header files 306 that are included with the game to communicate with the service and a set of xml files 308 that define the schema of the data to be shared with the service . game developer 301 then burns a game disk 310 or creates a game program that contains the game code instrumented with the apis 306 an the xml schema files 306 ( or an equivalent representation ). the xml files are also communicated to the service 312 so that the service can use the data output from the game to update the online user profile 312 for user 302 when user 302 uses the game 310 online . when user 302 uses game 310 without a network connection , information is collected and stored on the users offline profile in a hard drive or memory unit 316 . thereafter , when user 302 connects to the service , the online and offline profile is synchronized . user 302 can then view profile information locally 318 , i . e . on the console 100 or pc or log on to the service and view the user profile 314 . fig4 further illustrates the flow of configuration tool 400 used to generate the xml files 308 for use with the service . initially , game developer 301 selects the game genre 402 , e . g ., shooter , racing , etc . the genre selection is then used to generate a set of templates that have predefined types of data that would generally be collected by the service when such a game is being played . game developer 301 then reviews and edits the various session information and competition information generated by the templates at steps 404 , 406 , 408 . the edits are used to modify xml file 308 that underlies the tool . game developer 302 then edits the xml file ( via the tool ) with respect to the presence data to be generated by the game 410 , statistics 412 , trophy achievements 414 , game usage 416 and competition statistics 420 . after completing those edits , the system checks for unused genre tags and suggests alternative tag usage in order to enforce a certain level of cross game compliance with genre information ( step 422 ). thereafter , api header files are automatically generated ( step 424 ) based on the xml definition , and a list of tags is create for localized views of the information ( e . g ., japanese , spanish , and so on ) ( step 426 ). a set of identifiers are created that are specific to achievements defined for a specific game ( step 428 ) and the process is complete ( step 434 ). the pre - defined , genre - specific values , which will be extensible , will capture the key bits of stats , achievements , presence , and other data that the service will need to understand and show a user &# 39 ; s activity inside and outside of the game . the game developers do not have to interact directly with these values ; instead , they can adopt them using the configuration tool . the configuration tool allows game developers to input their game &# 39 ; s description using both values pre - defined in the tool and the game &# 39 ; s own extended set of trackable values . on the back end , the tool produces an xml configuration file that provides a formatted enumeration of all of the values entered in the tool . match session editor : here , the game tells the console the steps a user will need to go through to create a gameplay session for matchmaking . this definition makes sure that the console understands all of the key game permutations ( from map names to difficulty levels ) so that console can capture the starting point of a game session . view editor : view editors are the pieces of the tool that allow game developers to tell the service how particular bits of game data are to be used to construct key service features like stats and presence . the views allow the developer literally to specify the types of stats they want to track and which aggregations methods to use on the stats ( e . g . “ track total kills per map ” or “ track kills / deaths per map ”). the config toole will provide a number of default views to make sure that each game has a minimum set of required stats and presence fields defined . context , property , and achievements editor : the tool includes a mechanism for game developers to define an achievement and display it ( including description , title , and trophy image ), to create a context ( e . g . map and its enumerations ), and to create a new property ( e . g . kills stat ). rich presence mode editor : a game developer uses the rich presence mode editor to author a rich presence string that contains static text and variable tokens ( defined by contexts and properties that can be updated during the game ). outputs for developers : the tool outputs api header files , a list of strings to localize , the format of a “ start session ” message that games will receive from the service when gamers create a session outside of the game , and a config file that the game will need to include on the game disk ( so that the console client , even offline , can interpret the data flowing out of the game ). the game talks to the service with the setcontext , setproperty and session apis . since most of the complex structure of the game is captured in the configuration tool , the apis for writing data to the service are relatively simple . in fact , there are essentially only three things a game needs to tell the service for the service to be able to construct a user profile : setcontext : game “ contexts ” are sets of discrete , enumerate values like maps , vehicles , guns , and other game states that may change but that don &# 39 ; t have any aggregation methods associated with them . the setcontext api , then , tells the service when a context has changed ( and how it has changed ). setproperty : game “ properties ” are game elements or events that have an operation or aggregation methods that need to be applied to them . properties include such things as kills ( add ), bullets fired ( add ), wins ( add ), health ( subtract or add ), or time ( take lowest time , in a racing game ). the setproperty api , then , is a message to the service that a property is coming in and it needs to operate on it in the appropriate way . setachievement : game achievements are trophies earned during game play . the setachievement api is a message to the service ( or offline storage ) that a user has earned an achievement . session information : games must tell the service when a session has begun , when a user has been added ( or has left ) the session , and when the session has ended . the session information , coupled with context and property information and a view definition , allows the client software to know which properties need to be aggregated together in a game , who they belong to , and when the data set is complete for exporting . localization : to make stats , presence , and achievements visible on the console and on the web world wide , it is essential that games provided localized strings for all of the extensions xml values . the config tool includes a localization tool that will allow games to track which strings still need to be localized . pre - defined values will already have localized strings associated with them . read apis : user profile data feature that the service provides to games will have an associated api for reading data back for display or other purposes ( stats , achievements , matchmaking etc .). with this process completed , games are connected to the user profile data stream . this means that stats , presence , and achievement information for each gamer is advertised to the entire community even after the game disk is removed . it means that features built into the system that leverage the game &# 39 ; s user profile data will be improved over time after the game has shipped . it means that matchmaking players for a game will draw from a host of data that virtually insures a good fit for the players even if none of them have ever played the game before . in conjunction with fig5 , the paragraphs that follow detail the ways in which all of this user profile data being sent by games to the service will be consumed and reflected back to users , games , and the entire user community . as illustrated in fig5 , after use of configuration tool 400 , the game program 310 has configuration file 308 a that describes the information to be written during the use of the game and shared with service 150 . additionally service 150 has copies of the xml configuration file 308 b so that it understands the data points that it will collect from the game . thereafter , when console 100 is connected to service 150 , the game communicates typical game data for multiplayer online gaming . this communication happens via a console gateway component 502 which aggregates data on the client and communicates information about the user during game play that is collected in accordance with the configuration file 308 a . this console gateway component prevents the network from being flooded with overly frequent updates from the game program . that information is periodically routed to service 150 by way of game service gateway 504 . notably , the system contemplates that data about the game play can be collected even when a user is offline . various information and statistics are recorded to memory unit 146 and then shared with service 150 when the console 100 connects to service 150 . similarly , even when the user is online the information collected can be buffered in memory unit 146 so that it can be uploaded to the service in an efficient way ( i . e . not necessarily in real - time ). further , the service can , by parsing the game &# 39 ; s xml configuration file , determine the one or more service features that need to consume the game data ( for example , services such as 510 , 512 , 514 and 516 , representing game usage data , rich presence , achievements and statistics , respectively ). the following paragraphs further illustrate the use of the collected information . statistics service 516 assists in tracking and displaying a wide - variety of in - game stats , such as number of kills , best lap times or high scores . all stats have to be schematized in terms of properties , contexts and views . for example , a first - person shooter title may want to define a ‘ kills ’ property to be tracked independently for each ‘ map ’ context ( e . g . 5 kills on blood creek vs . 10 kills on battle range ). the last step needed to display these stats ( in - game or on the web or elsewhere ) is to define a view , e . g . : in the example above , the ‘ kills ’ property uses the sum aggregation method to combine the series of stats updates from every game session . in addition to sum , the system supports other aggregation methods , such as min , max , elo and last . by virtue of being captured in the game &# 39 ; s xml config file in a stats view , properties are aggregated on the client and set to the service where they are correctly stored and made available for formatting and display . each game should support a minimal set of properties , contexts and views that match the character of the game . achievements service 514 takes a different approach to tracking player stats by emphasizing individual progress and accomplishments ( e . g . a trophy case ) over global ranking against the entire population of players . achievements are intended to track check - point completion , advancing to a new skill level , hitting a career milestone , earning / unlocking new content , placing in live events , such as tournaments and / or any notable in - game events . achievements are explicitly called out in the xml config file and are written via the setachievement api . each game title should support several pre - defined achievements , such as “ ten hours played ” and “ 100 sessions played ”. additionally , each game should define a minimum of five game - specific achievements that are associated with points awards . rich presence service 512 compiles online presence / status information for all players . as a result , a user will not just be able to tell if his or her friend is online , and what title the friend is playing , but also where the friend is in the game , what the score is , and / or how much time is left in the game . for use with rich presence service 512 games should update the context and property associated with the current game state of a user . games have the ability to create a custom , localizable context based rich presence string / parser for their game . the rich presence strings can consist of the predefined , genre - specific properties or contexts or game customizable properties or contexts . some of the same contexts or properties used in rich presence ( e . g . map ) may also be used for setting the matchmaking session parameters . the rich presence string / parser can be thought of as a printf statement where properties or lookups can be substituted in . client software will manage the ui and presence requirements for friends , groups , and recent players . it will also provide a richer cross - title view of gamers who are online and offline . the game does not have to have code to deal with how the user defines their state , time online , idle etc . the game only needs to have code to deal with the context and properties that are most important for other people to broadcast from their game . playing halo 2 [ 3 rd place ] ( match ends in 1 : 13 ) fig6 - 8 further illustrates the tools used for generating the configuration files for communication between the console and the service . in general , the configuration tools make it easy for the game developer to standardize the communication process . fig6 illustrates the process for determining which statistics information will be shared between the game and the service . this figure illustrates the tool view 602 after the developer ( e . g ., 301 ) selects stats view at step 620 . thereafter , at step 624 the developer begins creating a statistics configuration . insert button 604 a allows the developer to specify one or more contexts from the insert context menu shown in box 604 b ( step 626 ) and gets back to the main screen 602 . boxes 608 allows a developer to set a number of properties to track . the example here shows that developer has selected four properties to track . box 610 allows a developer to add a label for the property . box 612 , allows the developer to select an aggregation method , e . g ., sum . box 616 lets the developer set a min and max ranges , e . g ., 2 to 100 . box 620 allows the developer to set a format for the property e . g ., number , time , percentage , etc . after the developer has entered all of the information for a particular context , button 618 saves the configuration and allows the developer to review and edit the data . fig7 further illustrates the rich presence editor . starting at step 704 , a user selects rich presence and determines whether to edit an existing string ( step 706 ), create a new string ( step 708 ), or choose an existing presence string to translate ( step 718 ). if step 706 is chosen , then the developer selects , e . g ., from a menu , a presence string to edit . as shown in box 702 a , the developer enters a string and inserts it into the configuration file using the insert button 716 . if step 708 is chosen , a presence id and a string id are generated at step 712 . thereafter at step 714 , the developer fills in the string name , description , etc . if step 718 is selected , the developer enters the translation for the text as shown in box 702 b . finally , in fig8 , the context and property editor is further illustrated . at step 808 , a developer desires to create a new context or property . if a context is selected , a unique id and string id is assigned . at step 816 , the developer fills in the name , description , enum type ( string or number ). if the enum type is set to string , the developer enters the enumeration in box 820 as shown in box 818 . for example , the developer can list the various map names that exist for a game . as each is defined , a unique id and string id is assigned . if the enum type is set to number , box 822 allows the developer to enter the number information in box 824 . at box 828 , the developer defines which enums are locked and which one is the default in a menu displayed to a user as shown in check box 826 . if at step 808 the developer selects a property , then a unique id and string id are assigned for the property ( step 810 ) and the developer fills in the property names , description and types . as a result of all of the information entered by the developer , an xml file is generated describing the various statistics , rich presence , etc . information for the game that describes the various contexts and properties . this information is used by gateway 502 to determine which information the console should aggregate before sending to the service , which information should be sent to the service raw , how the information should be formatted and how , what labels should be displayed for the information and so on . an example xml output file is provided in a computer program listing appendix stored on an accompanying text file for the instant patent application , and hereby incorporated by reference in its entirety . of course , the xml is but one example of an output format . other output formats could also be used . moreover , the xml can be converted to a different form such as a binary file format . while the present invention has been described in connection with the preferred embodiments of the various figs ., it is to be understood that other similar embodiments may be used or modifications and additions may be made to the described embodiment for performing the same function of the present invention without deviating therefrom .

US-201113227198-A

liposomes encapsulating anticancerous drugs and the use thereof in the treatment of malignant tumors . the liposomes are coated with a lipopeptide composed of three substructures : a lipid fragment , an active oligopeptide and an oligopeptide spacer between the other two fragments . applicable in intravenous administration for treatment of malignant tumors .

the present invention is related with the preparation and use of liposomes containing anticancerous drugs . the liposomes of the present invention have as their main characteristic that they are coated with fragments of hydrophobically derivatized peptides ( overlaid lipopeptides ) in such a manner that the liposome so prepared offer a high targeting capability with regard to tumoral cells , thereby increasing the effectiveness of the encapsulated anticancerous drug . surprisingly it was shown that the active overlaid lipopeptides in vitro prior to being incorporated in liposomes , would totally lose their targeting capability when incorporated in liposomes , for which reason , according to the invention , peptide spacers were developed which , intercalated between the sequence and the lipophile chain of the overlaid lipopeptide would , strangely , permit the targeting ability of the active peptide sequence to be maintained . in this way the structure of the overlaid lipopeptide ( hydrophobically derivatized peptide ) is as follows : consequently , the object of the present invention resides in the preparation and use of liposomes containing anticancerous drugs which on their surface have peptide fragments derivatized from laminin ( overlaid lipopeptides ), made up of the following three structural blocks : a lipid fragment , an active oligopeptide and an oligopeptide spacer among other fragments . the lipid fragments are fatty acids of carbonated chain length between c6 and c20 . more specifically decanoyl , myristoyl and stearoyl . the spacer fragment consists of oligopeptides inactive with respect to laminin having a length lying between five and ten amino acid residues . more specifically , with a length of seven to nine amino acid residues , and more specifically the sequences aaaaacye , ssaaacye and rkerkecye . the liposome - forming lipids are well known . generally phospholipids are included , with net neutral or negative charge , and a sterol , like cholesterol . the choice of the lipids is performed based on the requirements with respect to the final liposome size , to the drug to be encapsulated and to the desired stability for the preparation . usually the largest lipid component of the liposomes is the phosphatidyl choline ( pc ). the pcs differ from each other in the length and degree of saturation of their acylic chains and can isolated from natural or synthesised sources . the inclusion of a negatively charged phospholipid favours the stability of the liposome solution and prevents the spontaneous aggregation of the liposomes . the negatively charged phospholipids most employed are the phosphatidyl glycerol ( pg ), phosphatidyl serine ( ps ) and the phosphatidyl inositol ( pi ), among others . the proportion used , of neutral phospholipid to negatively charged phospholipid ranges from 10 : 2 to 10 : 10 respectively . the inclusion of cholesterol generally favours the stability of the liposomes by causing the permeability of the membrane to diminish with respect to ions and small polar molecules and likewise reduces the penetration capacity of a series of proteins between the bilayers that could result in a greater disorder among these . typically the proportion of cholesterol used runs from 0 to 50 % of total lipids . optionally , the liposomes object of the present invention , can contain additives that permit enhancement of their stability properties or reduce the toxicity of the encapsulated drug . for example , mention can be made of the lipid oxidation inhibitors such as those described in the patents u . s . pat . no . 5 , 605 , 703 , ep 0274174 , wo - 8500968 and wo 9202208 . the anticancerous drugs that can be encapsulated in the liposomes of the present invention include , but are not limited to : nirogenated mustard analogues like cyclophosphamide ; melphalan ; iphosphamide ; or trophosphamide ; ethylenimines like thiotepa ; nitrosoureas like carmustine ; leased agents like temozolomide ; or dacarbazine ; analogous antimetabolites of folic acid like methotrexate or raltitrexed ; analogues of purines like thioguanine , cladribine or fludarabine ; analogues of pyrimidines like fluorouracil , tegafur or gemcitabine ; alkaloids of vinca and analogues like vinblastine , vincristine or vinorelbine ; derivatives of podophyllotoxin like etoposide , taxanes , docetaxel or paclitaxel ; anthracyclines and similar like doxorubicin , epirubicin , idarubicin and mitoxantrone ; other cytotoxic antibiotics like bleomycin and mitomycin ; platinum compounds like cisplatin , carboplatin and oxaliplatin ; monoclonal antibodies like rituximab ; other antineoplastic agents like pentostatin , miltefosine , estramustine , topotecan , irinotecan and bicalutamide . in accordance with that described above , the liposomes of the present invention present the following characteristics : a ) a lipid concentration of 1 and 100 mg / ml , and preferably around 10 mg / ml . b ) the component lipids are phospholipids , of both natural and synthetic origin , and cholesterol . c ) the proportion of cholesterol , with respect to the quantity of total lipids , is between 0 and 50 %, preferably between 35 and 50 %. d ) the phospholipids present are phosphatidyl choline , which has no net charge , and optionally another , negatively - charged phospholipid , preferentially phosphatidyl glycerol . e ) the ratio of the neutral phospholipid to that negatively charged lies between 10 : 2 and 10 : 10 and preferably between 10 : 7 and 10 : 10 respectively . f ) optionally the liposomes can contain other additives like for example lipid oxidation inhibitors like those described in the patents u . s . pat . no . 5 , 605 , 703 , ep 0274174 , wo - 8500968 and wo - 9202208 . g ) the concentration of peptide would oscillate between 0 . 1 and 1 mg / ml , and preferably around 0 . 5 mg / ml . h ) the liposomes are formed in an aqueous solution , tamponed or not , physiologically isotonic . for example , 0 . 9 % nacl . i ) the size of the liposomes shall be in any case less than 500 nm , and preferably less than 300 nm and more specifically between 50 nm and 250 nm . a preferred method is that presented by bangham et al . in which multilamellar liposomes ( mlvs ) are obtained which heterogeneous in size . in this method the forming lipids are dissolved in a suitable organic solvent that is subsequently removed by rotary evaporation under vacuum . the lipid film formed is subjected to hydration with an adequate aqueous medium containing the drug , by means of manual or mechanical agitation . the heterogeneous suspension of mlvs is subjected to whatever of the known procedures for reduction and homogenisation of sizes . for example , two preferred procedures are that of sonication with titanium probe to obtain suv liposomes and the extrusion through polycarbonate filters of the mlv solution to obtain vet liposomes . the sysnthesis of the peptides is carried out using the solid phase method of merrifield ( 1962 ) with fmoc / tbu approach . the lipopeptides employed were acyl - oligopeptides , being of preference the acyl group with linear saturated hydrocarbon chains of length c6 to c20 — preferentially the decanoyl , myristoyl or stearoyl . the lipopeptides were mixed with the rest of the components that were to constitute the liposomes , or else they were incorporated in the liposomes by incubation at 60 ° c . of these lipopeptides and the vesicles , since , as the bilayers were in a gel state , permitted the incorporation of the hydrophobic part of these derivatives in their interior . in both cases the hydrophobic zone of the derivatives ought to remain forming the bilayer , whilst the peptide sequence would remain on the hydrophilic exterior . by way of illustration , but not restrictively , the procedure detailed in the present patent is described hereunder by means of several practical examples . the synthesis of peptides derived from laminin is carried out following the solid phase method of merrifield ( 1962 ) with fmoc / tbu approach . in order to obtain a sequence with carboxylic end , as the solid synthesis support , a wang resin is employed with a degree of functionalisation of 0 . 72 meq / g of resin which was submitted to the treatment outlined in the table below : in general , the starting point was 1 gram of wang resin in a syringe with a filter coupled to a vacuum system , and it was dimethylformamide ( dmf ) was blown in for 30 minutes . in parallel , in a filter weight scale , the necessary amount was weighed of the first fmoc - amino acid and it was dissolved in dmf , adding to this solution the coupling agents 4 - dimethyl amino pyridine ( 4 - dmap ) and diisopropylcarbodiimide ( dipcdi ) ( 0 . 3 : 1 , molar ). all the reagents were used in an excess of 5 times with respect to the quantity required to complete the reaction . thereafter , this mixture was added to the previously drained resin and left to react for 2 hours at room temperature with occasional stirring . after this time the resin was washed with different solvents until completely dry . finally the joint quantity of amino acid was evaluated . in the cases where the reaction was incomplete , more reagents were added , in a quantity corresponding to one half the initial quantity employed , and left to react for a further two hours , repeating thereafter the same process of resin - drying and quantifying of the amino acid incorporated . the union of the remaining fmoc - amino acids was carried out through successive stages of deprotection of the amino group and formation of the amide bond . thus , for the suppression of the fmoc amino protector group , the peptidyl - resin was treated once with dmf / piperidine 20 % for a minute , the treatment being repeated a second time for 5 minutes . afterwards , the piperidine was removed with various washings with dmf and the ninhydrin test was carried out to check for the complete elimination of the fmoc group ( blue colouring ). in some cases the deprotection was performed with the reagent 1 . 8 - diazabicyclo [ 5 . 4 . 0 . ]- undec7 - eno ( dbu ) used in the mixture of dmf / piperidine / dbu ( 48 : 2 : 2 , v / v / v ) by means of a single treatment of the resin for 7 minutes . at the end of this time the resin was washed various times with dmf and the ninhydrin test performed again just as in the previous case . once the peptidyl - resin was unprotected , the pertinent fmoc - amino acid was added to it and the coupling reagents . depending on the difficulty the synthesised sequence presented , two different combination of reagents were used : hobt and dipcdi , in the molar proportion 1 : 1 , with the fmoc - amino acid . hobt , diea and 2 -( 1h - benzotriazol - 1 - il )- 1 , 1 , 3 , 3 - tetramethyluronium tetrafluoroborate ( tbtu ), in the molar proporation 1 : 2 : 1 . all the reagents were used in an excess of 2 . 5 times with respect to the quantity necessary . in both cases the reaction was left for 1 hour , the conclusion being controlled by means of the ninhydrin test for the disappearance of the free amino groups ( yellow colouring ). when the reaction was not complete , the mixture was left in contact with the resin for 1 more hour , after which the ninhydrin test was repeated . in the event that there were still free amino groups in the resin , the latter was washed several times with dmf and the reagents were added again in half the quantity initially employed . on some occasions , and despite the reaction being repeated , incomplete couplings were produced . in order to be able to continue with the synthesis without anomalous chains being formed , it was necessary to block the incomplete chains by acetylation of the amino groups that still remained free . to this end , the resin was treated with 2 mequivalents of acetic anhydride and 1 mequivalent of 4 - dmap for each mequivalent of peptidyl - resin during 30 minutes . next it was washed with dmf and a ninhydrin test was run to check the total disappearance of the amino groups ( yellow colouring ). the ninhydrin test was substituted by the chloranil test in the event of detecting secondary amino groups of amino acids like proline , since the ninhydrin does not react with said groups . the peptides with carboxamide end are obtained from the resin p - methylbenzhydrylamine ( mbha ). this resin needs a special initial treatment which comprises various washings with an acidic mixture of dcm / tfa at 40 %, being left finally in contact with the resin for 20 minutes . afterwards , to remove the acid , it was washed 5 times with dcm for 1 minute each time , and to neutralise it , the resin was treated with the base mixture dcm / diisopropylethylamine ( diea ) at 5 %, until it was found that the resin ph was base . finally , to remove the diea , it was washed various times with dcm . next , the coupling was carried out of the acidic spacer p -[( r , s )- alpha [ 1 - 9h - fluorene - 9 - e )- methoxy formamide ]- 2 , 4 - dimethoxybenzyl ]- phenoxyacetic ( am ), protected with the fmoc group , which is what provides the sequence with its amide end . for this , the fmoc - am was weighed in an excess of 1 . 5 times the quantity required , and it was added to the resin together with the reagents hydroxybenzotriazole ( hobt ) and dipcdi ( 1 : 1 , molar ), also in excess , leaving the reaction to take place for 90 minutes . the conclusion of the reaction was determined by means of the kaiser test or ninhydrin test , checking for the disappearance of free amino groups from the resin . in the event that all the spacer had not linked , the reaction was repeated once more , using half of the initial quanity of reagents employed . once all the spacer had linked , the resin was washed various times with dmf in order to remove the reagents in excess . the coupling of the remaining fmoc - amino acids was performed through successive stages of deprotection of the amino group and of amide link formation , just as described in example 1 . for the deprotection of the free peptide sequence , the fmoc : group is first removed from the terminal - amino end following the protocol given in the table below : next the peptide was de - anchored from the resin and the protector groups removed from the amino acid functional chains , in a single step . to achieve this , various tfa mixtures were prepared with different scavengers like anisol , thioanisole , phenol , mercaptoethanol , and water , according to the protector groups present in the peptide chains . an aliquot was weighed of the peptide - resin a syringe with filter coupled to a vacuum system and the acidic mixture of scavengers added to it , being left in contact with the resin for 2 to 3 hours , at room temperature with occasional stirring . after this time elapsed , resin was filtered and washed 3 times with tfa , the filtrates and the washing products being collected in a tube . first the tfa was evaporated off with nitrogen and afterwards cold diethyl ether was added , obtaining a white precipitate ( free peptide ). the precipitate was centrifuged at 3000 rpm for 15 minutes , the supernatant being drained off and the process repeated 5 more times . finally the traces of ether were removed from the solid with nitrogen , it was re - dissolved in water or acetic at 10 %, depending on the peptide solubility , and lyophilised to obtain the raw free peptide product completely dry . the fatty acids were coupled to the sequences in the same form as the fmoc - amino acids , by means of the formation of an amide bond with the carboxylic group of the fatty acid . thus , an aliquot was weighed of the peptidyl - resin in a syringe with filter attached to a vacuum pump and was swollen with dmf . next the deprotection of the fmoc group was carried out . once deprotected , the fatty acid employed in each case was added , in an excess of 2 . 5 times , together with the systhesis reagents dpcdi / hobt or , tbtu / diea / hobt , depending on the peptide sequence in question . the conclusion of the reaction was determined , just as during the synthesis , by the ninhydrin test for disappearance of free amine groups . to obtain the free hydrophobic derivative , the peptidyl - resin was treated with the same acidic mixture of tfa and scavengers , and under identical conditions to those employed in the de - anchoring of the initial peptide sequence . obtaining liposomes containing doxorubicin and a lipopeptide covering the surface of the liposome initially , and in all cases , large multilamellar liposomes ( mlv ) were prepared following the method described by bangham . from these , and by sonication , the small unilamellar liposomes ( suv ) were obtained . all the material and the solutions employed were sterile and , during the whole process , the work was carried out under a laminar flow hood to maintain sterility . the liposomes prepared with the hydrophobic derivatives of the two active sequences had in their composition : phosphatidyl choline ( pc ), phosphatidyl glycerol ( pg ), cholesterol and chroman - 6 . to obtain them the following procedure was adopted : thus , in the first place , suv liposomes were prepared . the pc , pg , cholesterol and the chroman - 6 were weighed , and dissolved in chloroform , the solvent being evaporated off in the rotary evaporator in order to form a lipid film . any traces of solvent that might remain were removed by lyophilisation lasting 1 hour . after this period had elapsed , the film was hydrated with 1 ml of nacl at 0 . 9 %, maintaining the ball in a bath at 60 degrees celsius for 1 hour . to the mlv liposomes obtained , 1 . 2 ml of a doxorubicin solution was added having a concentration equal to 2 mg / ml ( 2 . 4 mg ). the preparation was left in repose for 15 minutes in a bath at 60 degrees celsius and afterwards the ball was kept in a vacuum - free rotary evaporator which turned slowly for a period of 20 minutes . in order to obtain suv liposomes , the mlv were subjected to sonication in an ultrasonic bath for 8 cycles each lasting 2 minutes , separated by 5 - minute intervals of repose in a bath at 60 degrees celsius . the incorporation of the lipopeptides was carried out by mixing an aliquot of 200 μl of liposomes , 200 μl of nacl at 0 . 9 % and 12 μl of a solution of lipopeptide in dmso ( c = 10 mg / ml ). the mixture was left in repose at 60 degrees celsius for one hour and afterwards at room temperature for a further 30 minutes . alternatively , the liposomes were prepared incorporating the lipopeptide from the beginning . thus , the pc , pg , cholesterol and chroman - 6 lipids were mixed with an aliquot of the lipopeptide dissolved in chloroform / methanol , in the same molar ratio as in the previous case . the rest of the procedure is identical to the previous case . finally , to remove the doxorubicin not encalsulated and the lipopeptide not incorporated , the sample was placed in a pd - 10 column ( sephadex g - 25 ). for this , the column was first balanced with nacl at 0 . 9 %. once balanced , the sample was added , which was also eluted with nacl at 0 . 9 %, until it overflowed from the column . the volume of liposomes obtained was made up to 2 ml . following this process , the following types of liposomes were prepared incorporating doxorubicin : obtaining liposomes containing paclitaxel and a lipopeptide coating the surface of the liposome initially , and in all cases , large multilamellar liposomes ( mlv ) were prepared following the method described by bangham . from these , and by sonication , small unilamellar liposomes were obtained . all the material and the solutions employed were sterile and , during the whole process , the work was carried out under a laminar flow hood to maintain sterility . the liposomes prepared with the hydrophobic derivatives of the active sequences had in their composition : phosphatidyl choline ( pc ), phosphatidyl glycerol ( pg ) and cholesterol . to obtain them the following procedure was adopted : thus , in the first place , suv liposomes were prepared . the pc , and cholesterol were weighed , and dissolved in chloroform , the solvent being evaporated off in the rotary evaporator in order to form a lipid film . any traces of solvent that might remain were removed by lyophilisation lasting 1 hour . after this period had elapsed , the film was hydrated with 1 ml of nacl at 0 . 9 %, maintaining the ball in a bath at 60 degrees celsius for 1 hour . to the mlv liposomes obtained , 1 . 2 ml of a paclitaxel solution was added having a concentration equal to 0 . 5 mg / ml ( 0 . 6 mg ). the preparation was left in repose for 15 minutes in a bath at 60 degrees celsius and afterwards the ball was kept in a vacuum - free rotary evaporator which turned slowly for a period of 20 minutes . in order to obtain suv liposomes , the mlv were subjected to sonication in an ultrasonic bath for 8 cycles each lasting 2 minutes , separated by 5 - minute intervals of repose in a bath at 60 degrees celsius . the incorporation of the lipopeptides was carried out by mixing an aliquot of 200 μl of liposomes , 200 μl of nacl at 0 . 9 % and 12 μl of a solution of lipopeptide in dmso ( c = 10 mg / ml ). the mixture was left in repose at 60 degrees celsius for one hour and afterwards at room temperature for a further 30 minutes . alternatively , the liposomes were prepared incorporating the lipopeptide from the beginning . thus , the pc , pg and cholesterol lipids were mixed with an aliquot of the lipopeptide dissolved in chloroform / methanol , in the same molar ratio as in the previous case . the rest of the procedure is identical to the previous case . finally , to remove the paclitaxel not encapsulated and the lipopeptide not incorporated , the sample was placed in a pd - 10 column ( sephadex g - 25 ). for this , the column was first balanced with nacl at 0 . 9 %. once balanced , the sample was added , which was also eluted with nacl at 0 . 9 %, until it overflowed from the column . the volume of liposomes obtained was made up to 2 ml . following this process , the following types of liposomes were prepared incorporating paclitaxel : solutions of laminin - 1 and synthetic peptides ( 50 mg / well ) were fixed in wells of the 96 - well tissue culture plate of tpp ( switzerland ). the wells were dried at room temperature during the night . before using them , the wells were washed with tamponed saline solution free from calcium and magnesium ions . the remaining free radicals of the polystyrene were blocked by using a 1 % bsa solution . they were cultivated and marked with 51 cr cells of human fibrosarcoma ht1080 . the marked cells were placed ( 1 cpm / well ) in the wells which contained the laminin and the synthetic peptides . after 30 minutes of incubation at 37 degrees celsius , the unadhered cells were removed by washing . the adhered cells were smoothed and the radioactivity measured . the specific percentages of adhesion encountered are shown in the attached fig1 . inhibition of cellular adhesion to laminin ( complete molecule ) in vitro by peptides of the laminin following the procedure described under example 1 ht - 1080 cells marked with 51 cr were adhered , in wells ( 0 . 32 cm 2 ) coated with 1 μg of laminin . the adhered cells were incubated with different concentrations of of synthetic peptide fragments of laminins . the results obtained are shown in the attached fig2 . anti - proliferative effect of doxorubicin liposomes directed against specific receptors of laminin peptides in tumoral cells the anti - proliferative effect of doxorubicin was analysed by following the mtt method . ht1080 cells obtained from exponential cultures were sown in 0 . 36 cm 2 wells ( 96 - well tissue culture plates of tpp , switzerland ) with a density of 5000 cells per well . one day later , the cells were washed and incubated for two hours with liposomes containing doxorubicin . the different liposome formulations were adapted to the same drug concentration and the test was carried out in parallel wells ( increasing the concentration of doxorubicin from 0 . 01 μg / ml to 10 μg / ml . after the incubation , the cells were washed five times with pbs and incubated for three days in a complete medium . after this period , to each well was added 50 μl of pbs containing 1 mg / ml of mtt ( tetrazolium salt , sigma ) and they were incubated for a further four hours . the intracellular crystals of fromazan resulting from the reduction of the tetrazolium salt , only present in the active cells , were dissolved in dmso . the number of metabolically active cells was estimated by measuring the absorbance of this solution of dmso at 540 nm . the percentage of cytostatic activity was calculated according to the formula ( a − b )/ a × 100 , where a is the absorbance in tumoral cells incubated in a control medium and b is the absorbance in tumoral cells incubated with the liposome preparations . the results of the resulting cytostasis are shown in the attached fig3 , in which : the results present the mean +/− the standard desiccation of three independent experiments performed in triplicate ; the ic 50 is defined as the drug concentration at which 50 % of the cells survive in comparison with the control lot ; and p & gt ; 0 . 05 ; student test t . biodistribution of doxorubicin administered as free drug or liposome preparation ( pc / pg / chol / myristoyl - aaaaacyesikvavs )/ doxorubicin ) in tumour - bearing animals animals : the tests were performed on naked and immuno - suppressed balb / c mice obtained for the animal production area of iffa credo inc . ( lyons , france ). the animals were kept in laminar flow cabins in pathogen - free conditions and were used when they reached an age of 8 weeks . cellular culture conditions : cells of ht1080 human fibrosarcoma were made to grow in ham &# 39 ; s f - 12 medium ( gibco , grand island , n . y .) supplemented with 10 % of bovine fetal serum , sodium pyruvate , non - essential amino acids , l - glutamine , and vitamin solution ( gibco , grand island , n . y .). the cultures were kept in plastic and incubated in 5 % co2 – 95 % air at 37 degrees celsius in humidified incubators . the cellular line was examined to certify the absence of mycoplasma . the tumoral cells were harvested from the sub - confluent cultures ( 50 – 70 % confluence ) by treating with trypsin ( 0 . 25 %) and edita ( 0 . 02 %). the cells were washed in a supplemented medium and afterwards were re - suspended in a hank balanced saline solution ( hbss ) for their subsequent injection . only monocellular suspensions with a viability of more than 90 % ( determined by colouring with trypan blue ) were used for the in vivo studies . biodistribution test : ht - 1080 cells at a concentration of 1 × 107 cells / ml of hbss were pre - mixed with an equal volume of liquid matrigel ( collaborative biomedical products , bedford , mass .) 10 mg / ml . of the resulting suspension , 0 . 02 ml were inoculated subcutaneously into the left - hand flank of the mice . tumour growth was monitored twice weekly . when the tumours attained a volume of 1 cm 3 ( day 25 after injection of the cells ), the mice received a single intravenous dose of doxorubicin ( 5 mg / kg ) in liposome preparation or free drug form . at times of 30 minutes , 5 hours and 24 hours from the administration of the drug , the mice were sacrificed and samples were taken of tumoral tissue and plasma . the results obtained are shown in fig4 and 5 attached .

US-39862703-A

the invention relates to rehabilitation systems and methods for providing therapy to individuals who have suffered a stroke or other neurological insult . a rehabilitation system may comprise a depth sensing camera positioned to view a workspace into which a patient &# 39 ; s hands may be located , a display system viewable by the patient , and an electronic computer executing a stored program to display a representation of a virtual space holding at least one virtual object , display a representation of at least one hand of the patient , and monitor a virtual manipulation of the virtual object by the patient &# 39 ; s hand . other embodiments may include virtual reality goggles , head motion tracking , various exercises and of varying difficulty , tracking metrics and recording for subsequent playback .

referring now to fig1 , a rehabilitation system 10 of the present invention may provide for example a desktop unit 12 having an upper platform 14 supporting a computer monitor 16 ( for example an lcd display ) for viewing by a patient 18 seated on a chair 20 or the like in front of the desk unit 12 . a workspace 22 positioned beneath the upper platform 14 optionally shielded from vision of the patient 18 may be bounded by a lower platform 24 and the lower surface of the upper platform 14 . a depth sensing camera 26 may be attached to view the patient &# 39 ; s hands 27 when placed in the workspace 22 and provide a fine - grained resolution indicating hand position and finger position of the patient &# 39 ; s hands . a depth sensing camera believed to be suitable for the present invention is available commercially from primesense of tel aviv , israel . other examples of depth sensing cameras may include microsoft kinect commercially available from microsoft corporation of redmond , wash . and leap motion cameras commercially available from leap motion of san francisco , calif . the camera 26 and display 16 may communicate with a computer 28 executing a stored program as will be described . in an alternative embodiment depicted in fig2 , the display 10 may be replaced by virtual reality goggles 17 which may be worn directly on the head of the patient 18 to receive data from the computer 28 . the system also provides a head motion tracking unit 19 working with the stationary beacon 21 to relay a signal to the computer 28 indicating the position of the patient &# 39 ; s head 15 to provide for correction of the image displayed on the goggles 17 commensurate with that which would be in the field of view of the patient with the head movement were the patient immersed in the virtual reality space 30 . head tracking virtual - reality goggles are commercially available for example , from vuzix corporation of rochester , n . y . in an alternative embodiment depicted in fig3 , the camera 26 may be attached below the workspace 22 , instead of above as shown in fig1 , to view the patient &# 39 ; s hands 27 when placed in the workspace 22 . in this arrangement , the surface of the workspace may be a transparent material , such as glass , allowing the camera to view the workspace through the surface or the surface of the workspace may be removed . referring now to fig4 , the computer 28 may provide a display of a virtual space 30 depicted in two dimensions on the display 16 including one or more virtual objects such as a ball 32 and hoop 34 . each of these virtual objects 32 and 34 will have a defined location in the virtual space stored as a mathematical representation and a defined shape ( outer periphery ) and orientation . the program executing on the computer 28 may read information from the depth sensing camera 26 to reconstruct a virtual hand 36 in the display and to translate the actual hand location , orientation , and finger positions of the patient &# 39 ; s hand , using a predetermined mapping , to the virtual space 30 so that the hand 36 may be displayed relative to the objects 32 and 34 . typically such mapping will center the virtual space 30 with respect to the workspace 22 and will give each corresponding dimensions and orientation . by establishing the location of the patient &# 39 ; s hand as a virtual hand 36 in virtual space 30 and knowing finger positions , the patient may manipulate the virtual objects 32 and 34 by causing the virtual hand 36 to grasp the objects and allowing them to be moved with respect to each other . although the present invention does not contemplate any haptic feedback to the patient with respect to the grasping action , the virtual objects 32 , 34 and 36 will observe correct collisional physics preventing them from moving through each other . the orientation of the objects 32 and 34 may be changed or fixed according to the particular puzzle problem . it should be emphasized , however , that the correct collisional physics may also be disabled to simplify the tasks and to isolate or amplify problems the patient may be experiencing . referring now to fig5 , the computer 28 may include a processor 40 communicating with the memory 42 containing an operating system 44 and one or more application programs 46 as will be described that may be executed by the electronic computer . the memory may also hold a data table 50 for storing patient metrics for review by physical therapist or the like . the computer 28 may provide for an interface 52 communicating with the display 16 and the camera 26 according to techniques well known in the art . a keyboard or other user input device 54 may also be provided for initialization and starting of the program . in the depiction of fig4 a , the patient may grasp the ball 32 and pass it through the hoop 34 with the hoop 34 being maintained stationary and the hand blocked by physical structure of the hoop 34 or allowed to pass through the hoop 34 with the ball 32 not being allowed to pass through the physical structure of the hoop 34 but only through the opening in the hoop 34 or outside of the loop entirely . in the depiction of fig4 b , the ball 32 a has been decreased in size so that the patient must switch from a power grip to a precision grip in order to move the smaller object through the opening of the fixed hoop 34 . in the depiction of fig4 c , the opening of the fixed hoop 34 a has been decreased in size so that greater precision of motion is required for the patient to maneuver the ball 32 through the hoop 34 a . in the depiction of fig4 d , the hoop 34 b is no longer fixed but must also be grasped by the patient using a second virtual hand 36 ′. thus the patient must control both ball 32 and hoop 34 b in virtual space 30 in order to maneuver the ball 32 through the opening of hoop 34 b . in the depiction of fig4 e , the virtual objects consist of a rectangular prism 33 and rectangular hoop 35 . the rectangular hoop 35 may be stationary or moveable . the patient must move the prism 33 through the hoop 35 , but as prism 33 cannot pass through the physical structure of hoop 35 the orientations 37 of the virtual objects 33 and 35 must be considered to complete the task . significantly , the changes in the difficulty of the task , for example , changing the size of the opening in the fixed hoop 34 a or the size of the ball 32 a may be very gradually changed to be imperceptible to the patient allowing the task difficulty to be smoothly adjusted , for example , in response to changes in patient skill level . as will be described below , this change may be driven by a performance metric measuring how well the patient performs the task . alternatively , the changes in difficulty and in fact the tasks themselves may be adjusted according to a predetermined schedule executed by the computer to optimize the rehabilitation according to empirical information derived from the system or elsewhere . such a schedule may for example continuously change the difficulty to increase or decrease it , but more typically may alter tasks and difficulty levels both up and down in a pattern as may be determined to be therapeutically most effective . various exercises , including such as these described in fig4 a - 4 e , may essentially be performed in a virtual environment to simulate activities of daily living . the present invention importantly allows the activities of daily living to be broken into elemental tasks without regard to physical constraints . so , for example , an activity of daily living may be picking up a glass while retaining the orientation of the glass vertically and moving it to set it on a different surface . this task can be broken into the tasks of : ( a ) grasping , ( b ) maintaining an orientation , ( c ) moving an object between two locations , and ( d ) releasing an object placed on a surface . with actual physical structures , these different tasks are inextricably linked , however , in the virtual environment each can be dealt with separately . for example , a virtual glass may automatically maintain correct orientation independent of the patient &# 39 ; s hand so that the patient may work on task ( c ) without the distraction of task ( b ). further the patient &# 39 ; s ability with task ( c ), thus isolated , can be accurately measured . whereas with physical structure , practicing releasing an object ( d ) necessarily requires completion of each of tasks ( a )-( c ), this is not necessarily true with the virtual environment where , for example , a glass may be initialized to be “ attached ” to and thus grasped by the patient &# 39 ; s hand . each of these separate tasks may be practiced independently or together in a sequence that emulates the everyday activity . each of the tasks may nevertheless be independently monitored to permit reinforcement or practice of those tasks that represent the greatest challenge to the individual , in designing a therapeutic program . in the process of designing the tasks , the physics of the environment may also be adjusted , for example , the linear or rotational inertia of one or more of the manipulated items may be independently adjusted , friction may be increased or decreased , or items may be given local attraction to periodic coordinates as with a “ snap , grid ”. the computer 28 , program 42 and camera 26 will be constructed and organized to limit time delays to no more than approximately 16 to 33 ms in updating the position of the virtual hand 36 with respect to the objects 32 and 34 . referring now to fig6 , the patient &# 39 ; s success with the exercise of the type described with respect to fig4 above may be quantified according to one or more rehabilitation metrics 60 which may be tracked over time with the data provided to a physical therapist for review if desired . this data may include the metrics or may provide for an ability to review actual screen videos of the patient &# 39 ; s performance or may provide for other types of data with respect to the patient &# 39 ; s performance including for example data identifying particular muscle sets that remain poorly controlled , for example , by reverse kinematics techniques . the monitoring of the rehabilitation metrics 60 may be performed with respect to a predefined interest threshold 62 to change the task assigned to the patient to increase its challenge level a time t 0 to keep the challenge to the patient with in a zone 66 roughly established to maintain the patient &# 39 ; s interest without being overly challenging for the patient such as might be discouraging . change in the task or exercise given to the patient may be performed on extremely fine scale for example by incrementally shrinking the size of the hoop 34 to provide extremely tight control of the challenge reward of the system . the same or different exercises may be performed one after another , in repetitions , and each exercise may have the same or a varying degree of difficulty , and in various combinations . the degree of difficulty may be set arbitrarily , to a consistent value , or in a preferred embodiment , according to one or more metrics that may be measured from one or more previous exercise . metrics may include , for example , the total time to complete an exercise ( e . g . to move the ball through the hoop ), the maximum spatial distance encountered from the target while attempting the exercise ( e . g . maximum distance encountered from the ball to the hoop ) and / or the number of collisions encountered while attempting the exercise ( e . g . number of times the ball hit the hoop ). as noted above , the degree of difficulty may be varied both up and down according to a schedule as may be determined to be therapeutically valuable . in this latter embodiment , the difficulty of the exercise ( e . g . the relative size of the ball and hoop ) may be adjusted according to the metric obtained from a previous attempt at completing exercise . in this way the difficulty of the exercise , for example , may remain constant at a level that is neither too easy nor frustrating to the user . as the user proficiency increases as indicated by the metric , the difficulty of the task may automatically increase as well . limits to difficulty may be placed on the low and high sides of difficulty and the progress of the user as reflected in the measured metric may be plotted and output to a supervising healthcare worker . it will be understood that the process of changing the difficulty of the task may be substantially continuous ( for example by small increments of change in hoop diameter ) or may be accomplished through a changing of the tasks from simpler tasks to harder tasks or combination of both . the changing of the tasks , may for example , involve different virtual objects or different required manipulations of the virtual objects , for example balancing objects on top of each other versus inserting one object through another object where orientation does not matter ( e . g . ball and hoop ) or where orientation does matter cylinder and cylindrical opening . the patient may also perform each exercise at a location other than where the therapist may be monitoring the exercise , which monitoring may be communicated , for example , in real time via a local area network ( lan ), wide area network ( wan ) and / or the internet . in this regard the computer 28 may be attached to the internet using a standard interface circuit of the type well known in the art . certain terminology is used herein for purposes of reference only , and thus is not intended to be limiting . for example , terms such as “ upper ”, “ lower ”, “ above ”, and “ below ” refer to directions in the drawings to which reference is made . terms such as “ front ”, “ back ”, “ rear ”, “ bottom ” and “ side ”, describe the orientation of portions of the component within a consistent but arbitrary frame of reference which is made clear by reference to the text and the associated drawings describing the component under discussion . such terminology may include the words specifically mentioned above , derivatives thereof , and words of similar import . similarly , the terms “ first ”, “ second ” and other such numerical terms referring to structures do not imply a sequence or order unless clearly indicated by the context . when introducing elements or features of the present disclosure and the exemplary embodiments , the articles “ a ”, “ an ”, “ the ” and “ said ” are intended to mean that there are one or more of such elements or features . the terms “ comprising ”, “ including ” and “ having ” are intended to be inclusive and mean that there may be additional elements or features other than those specifically noted . it is further to be understood that the method steps , processes , and operations described herein are not to be construed as necessarily requiring their performance in the particular order discussed or illustrated , unless specifically identified as an order of performance . it is also to be understood that additional or alternative steps may be employed . references to “ a controller ” and “ a processor ” can be understood to include one or more controllers or processors that can communicate in a stand - alone and / or a distributed environment ( s ), and can thus be configured to communicate via wired or wireless communications with other processors , where such one or more processor can be configured to operate on one or more processor - controlled devices that can be similar or different devices . furthermore , references to memory , unless otherwise specified , can include one or more processor - readable and accessible memory elements and / or components that can be internal to the processor - controlled device , external to the processor - controlled device , and can be accessed via a wired or wireless network . it is specifically intended that the present invention not be limited to the embodiments and illustrations contained herein and the claims should be understood to include modified forms of those embodiments including portions of the embodiments and combinations of elements of different embodiments as come within the scope of the following claims . all of the publications described herein , including patents and non - patent publications , are hereby incorporated herein by reference in their entireties .

US-201213561537-A

the present application discloses a recirculating crushing and grinding device for crushing and grinding liquid - like materials or materials that contain liquid , said device comprises a motor , a hopper , a crushing and grinding part and a material recirculating part . said crushing and grinding part includes a coarse - crushing section and a fine - grinding section , said fine grinding section comprises a pair of grinding components , and said material recirculating part comprises a pump and recirculating ducts provided downstream of said crushing - grinding part . the present application also discloses a soybean milk maker employing said recirculating crushing - grinding device , and a method for crushing and grinding a recirculated material and a method for producing soybean milk . the equipment disclosed in the present invention is easy to manufacture , with the advantages of a low noise during operation and low energy consumption .

the present invention will be further discussed in conjunction with the accompanying drawings and embodiments to give a better description of the present invention . fig1 , 2 , 3 , 4 show a preferred embodiment of a crushing and grinding device of the present invention . a fine grinding section of said device includes a stationary grinder 6 and a rotary grinder 7 with mill teeth distributed uniformly on the inner wall of the stationary grinder 6 and the outer wall of the rotary grinder 7 . the rotary grinder 7 is fitted inside the stationary grinder 6 with a dynamic rotating gap therebetween , the gap size being around 0 . 03 ˜ 0 . 6 mm . the lower end of the stationary grinder 6 is fixed on a motor front cover 11 through bolts , with a bottom seal ring 9 of the stationary grinder provided between the lower side of the stationary grinder 6 and the motor front cover 11 ; the rotary grinder 7 is securely fitted on a motor shaft 10 with axial alignment and is fastened to the front end of the motor shaft 10 by screws ; crushing blade 2 is integrally formed on the upper end surface of the rotary grinder 7 so that a coarse crushing section is formed . a recirculating system comprises a hopper 1 , an impeller 8 of an impeller pump in a crushing and grinding chamber , an outlet duct 17 , a control valve assembly 19 , a recirculating duct 18 and a slurry discharge duct 20 ; the hopper 1 with a repose angle β is fixedly screwed on the outer wall of the upper end of the stationary grinder 6 , and a top seal ring 5 of the stationary grinder is provided at the top end of the stationary grinder 6 to ensure sealing ; an outlet 24 is provided on the motor front cover 11 ; the impeller 8 of the impeller pump is arranged below the rotary grinder 7 , and the impeller 8 is co - axial with the rotary grinder 7 . in said embodiment , the impeller 8 and the rotary grinder 7 are integrally configured so that the structure of the entire recirculating crushing device is compact . the outlet duct 17 is connected with an inlet of the control valve assembly 19 , and one end of the recirculating duct 18 is connected with one outlet of the control valve assembly 19 , while the other end of the recirculating duct 18 leads to the hopper 1 , and one end of the slurry discharge duct 20 is connected with the other outlet of the control valve assembly 19 ; a circuit controller 22 is connected with the motor and the control valve assembly 19 ; the motor front cover 11 is fastened on the motor casing 15 by bolts , and a shaft bearing 13 for the front end of the motor shaft 10 is securely embedded in the motor front cover 11 , and a seal ring 12 of the motor shaft is provided above the motor shaft bearing 13 , on the front end surface of which a capping 21 for the motor shaft seal ring is pressed . the motor can be forcedly cooled through the fan blades 23 . the control valve assembly 19 may be an electromagnetic valve , an electrically controlled change valve , and so on . the repose angle β of the hopper 1 is between 25 °˜ 40 °, most preferably between 29 °˜ 35 °, so that materials in the hopper 1 can flow downward smoothly . as shown in fig4 , a retainer ring 3 is provided at the lower end of the hopper 1 to prevent the material from overflowing upwardly during crushing , so as to ensure that the material is circulated through the crushing and grinding chamber from the top down to the bottom . when the rotary grinder 7 has a diameter of 46 mm , the inner diameter d of the retainer ring 3 should be between 15 ˜ 50 mm , most preferably between 36 ˜ 38 . 5 mm . when said size is between 36 ˜ 38 . 5 mm , the device can grind at high speed and with high efficiency , while a smaller or larger size would lead to an non - smooth down - flow of the material or result in a small amount of the material being unable to enter into the crushing chamber 4 when the grinding process approaches the end . meanwhile , the height h of the crushing chamber 4 should be between 10 ˜ 35 mm , most preferably between 18 ˜ 21 mm . in this most favorable height range , the device can achieve a high grinding velocity and a high efficiency . it is difficult for the material in the hopper 1 to enter into the crushing chamber 4 when h is greater than said value , or the material may not flow down smoothly when h is less than said value . another factor that affects the grinding speed is the height h of crushing blades 2 . when the rotary grinder 7 has a diameter of 46 mm , the height h of the crushing blade 2 should be between 3 ˜ 20 mm , most preferably between 7 ˜ 10 mm . a slow grinding may occur if h is less than said value , while the device tends to get blocked if h is greater than said value so that it fails to run correctly . meanwhile , the shape of the crushing blade 2 can also affect the grinding speed . a preferred structure of the crushing blade 2 is shown in fig5 a or 5 b . a crushing blade 2 includes a main blade area a 1 , a transition area a 2 , and a secondary blade area a 3 . the outer edges of these areas can be broken lines as shown in fig5 a or a curved line as shown in fig5 b , with smooth transition at the connections of said broken lines . the main blade area a 1 serves to pre - crush and take in the material particles , the transition area a 2 serves to transit the pre - crushed material to the secondary blade area a 3 , and the secondary blade area a 3 serves to eventually feed the delivered material to the crushing chamber between the rotating and stationary grinder . said main blade area a 1 of the crushing blades has an inclination α , i . e . ∠ t 1 o 1 n , of 100 °˜ 165 °, most preferably 135 °˜ 145 °, while the rake angle θ of secondary blade area a 3 , i . e . ∠ po 2 t 2 , is 10 °˜ 70 °, most preferably 35 °˜ 50 °; a distance from the crushing blade vertex o 1 of the feed inlet of the main blade area a 1 to the outer edge n of the rotary grinder 7 , i . e . x , is 2 ˜ 15 mm , most preferably 3 ˜ 8 mm , and x is most preferably between 6 . 5 ˜ 7 . 5 mm when the diameter φ of the rotary grinder 7 is 46 mm . this distance can lead to an optimum feed angle and improvement of the grinding speed of the device . the vertical contour line y of the crushing blade 2 can be an arc line shown in fig6 a or a straight line shown in fig6 b or 6 c which may be employed for different grinding materials , no matter the crushing blade 2 has a configuration of fig5 a or fig5 b . in the present embodiment , the rotary grinder 7 and stationary grinder 6 are both of formed with spurs , with a 0 . 03 ˜ 0 . 6 mm dynamic gap between the rotary grinder 7 and the stationary grinder 6 ; the rotary grinder 7 and stationary grinder 6 can also have a skewed - tooth or tapered - tooth configuration ; they can be single stepped or multiple stepped ; the cross - section of the teeth may be rectangular , stepped - shaped , or of taper . the fine grinding section consisting of the stationary grinder 6 and rotary grinder 7 can also be replaced by a pair of millstones counter - rotating with each other , and the grinding surface thereof may be horizontal . the coarse crushing section and fine grinding section of the crushing and grinding device may be integrally formed as shown in fig1 , and they may separate from each other , for example , the crushing blade 2 may be separately mounted on the motor shaft 10 . in another preferred embodiment of an integral structure , the gap between the top ends of the stationary grinder 6 and the rotary grinder 7 can be enlarged to form a v - shaped opening , so as to directly form the coarse crushing section which , in place of the crushing blade 2 , primarily crushes the material particles and makes them enter into the fine grinding section downstream for further grinding . the gap size of the opening depends on the size of material particles to be crushed . the impeller 8 of the pump employed in the recirculating system can also be an independent impeller and is mounted on the motor shaft 10 . said pump can be any suitable liquid pump in the prior art , which can also be mounted outside the grinding chamber . the steps for the crushing and grinding process are as following : ( a ) putting the liquid - like materials or materials that contain liquid which are to be crushed into the hopper 1 ; ( b ) initiating the motor according to programmed procedures through the circuit controller 22 so as to drive the rotary grinder 7 , the crushing blades 2 at the top of the rotary grinder and the impeller 8 of the impeller pump , and the control valve assembly 19 is set to circulation state ; ( c ) under the suction of the impeller 8 of the impeller pump , the material crushed by the crushing blade 2 and ground between the rotary grinder 7 and stationary grinder 6 is fed back into the hopper 1 by passing through the expelling outlet 24 , the outlet duct 17 , the control valve assembly 19 and the recirculating duct 18 ; ( d ) when the material meets the milking production standard after continuous recirculation through the crushing and grinding part , the circuit controller 22 operates the control valve assembly 19 according to the programmed procedures so that the control valve assembly 19 is in a state to discharge the slurry , the slurry then is discharged from the slurry discharge duct 20 ; ( e ) the circuit controller 22 controls the motor according to the programmed procedures so that the motor is in a stand - by state , and the whole grinding process is finished . after the slurry has been completely discharged , a cleaning process can be started . the device can be cleaned automatically by adding cleaning liquid from the hopper then repeating the above - described process . of course , for some materials , to meet the crushing requirements , upon using of the present crushing and grinding device , repeated crushing and grinding is not necessary . in this case , the present crushing and grinding device can directly discharge the crushed and ground materials under the control of the control valve 19 . according to the prior art , the rotary grinder 7 can also be connected to the motor shaft through a coupling joint . obviously , the structure of this coupling arrangement is relatively complex , and it brings about a higher installation requirement . as shown in fig7 , 8 , 9 , a preferred embodiment of soybean milk maker according to present invention comprises a milk - producing section , a milk - boiling section and a circuit control system : ( a ) the milk - producing section comprises a milk - producing device , a water supplying system , a recirculating system , a motor and a control circuit board . the milk - producing device mainly takes the form of the crushing and grinding device according to embodiment 1 to crush and grind beans and peas materials , wherein the structures , shapes and connections of the hopper 1 , crushing blades 2 , retainer ring 3 , crushing chamber 4 , top seal ring 5 of the stationary grinder , stationary grinder 6 , rotary grinder 7 , impeller 8 , bottom seal ring 9 of the stationary grinder , motor shaft 10 , motor front cover 11 , seal ring 12 of the motor shaft , bearing 13 of the motor shaft , motor rotor 14 , motor casing 15 , motor back cover 16 , outlet duct 17 , capping 21 for the seal ring of the motor shaft and fan blade 23 are all same as those in the crushing and grinding device of embodiment 1 , or may employ other alternative arrangements described in embodiment 1 . the water supplying system includes a water tank 45 , a water pump 49 , an inlet duct 47 of the water pump , an outlet duct 46 of the water pump , a water intake valve 50 , a water feeder 26 and an inlet duct 27 of the water feeder . a heating device is provided in the water tank . a fixing plate 42 for the heating device and a water level sensor 48 are secured on the wall of the water tank 45 , and an electrical heating tube 44 and a temperature sensor 43 are inserted on the fixing plate 42 for the heating device . the water intake valve 50 is connected with the water tank 45 . the recirculating system comprises the impeller 8 of the impeller pump , a recirculating duct 28 for feeding slurry , the outlet duct 17 , the recirculating duct 18 , the slurry discharge duct 20 and a drain duct 39 . an electrically controlled change valve may be taken as the control valve assembly 19 . a boiling cup 37 communicates with the other outlet of the electrically controlled change valve via the discharge duct 20 . the expelling outlet 24 is connected with the outlet duct 17 , while the other end of the outlet duct 17 is connected to the inlet of the electrically controlled change valve . one end of the recirculating duct 18 is connected with an outlet of the electrically controlled change valve , and the other end thereof connected with the recirculating duct for feeding slurry 28 secured on the water feeder 26 . one end of the slurry discharge duct 20 is connected with the other outlet of the electrically controlled change valve , and the other end thereof is coupled to the slurry inlet 31 on the cap 36 of the boiling cup with the centers thereof aligned . one end of the drain duct 39 is connected to a drain device ( not shown in figures , may be a container , or a connecting duct leading to a cloacae ), and the other end thereof is connected to an outlet of the electrically controlled change valve . the control circuit board 33 is connected with the motor and the electrically controlled change valve . the water feeder 26 is clapped on a hopper cover 25 . an outlet duct 46 of the water pump is connected with the inlet duct 27 of the water feeder 26 . the water feeder 26 distributes water so that water flows down along walls of the hopper 1 . ( b ) the boiling cup 37 of the milk - boiling section is provided on an electrical heating discus 40 . the bottom of the boiling cup 37 is preferred to be spherical , and said sphere r is preferred to be consistent with the top sphere r of the electrical heating discus 40 so as to achieve a larger thermal conducting area . the electrical heating discus 40 is fastened on a base 41 by screws . the slurry inlet 31 fixed on the cap 36 of the boiling cup is coupled to the slurry discharge duct 20 with centers thereof aligned . while an anti - overflow electrode 35 fixed on the cap 36 of the boiling cup is connected with an anti - overflow electrode support 34 secured on the housing 30 in the manner of elastic contact . in addition , the electrical heating discus 40 can also be embodied as an electromagnetic heating component . the boiling cup 37 may be taken off by means of a handle 38 of the boiling cup . ( c ) the circuit control system comprises a control circuit board 33 and a control panel 51 . the control circuit board 33 is connected with the motor , the electrically controlled change valve , the water pump 49 , the water intake valve 50 , the electrical heating tube 44 and temperature sensor 43 in the water tank 45 , the water level sensor 48 on the water tank 45 , the electrical heating discus 40 , the anti - overflow electrode support 34 , and the control panel 51 provided on the housing 30 , respectively ( neither connecting wires nor specific structure of the control circuit board are shown in figures , and it is not difficult for an ordinary person skilled in the art to realize these features ), to control the processes , such as feeding water into the water tank , heating water in the water tank , feeding the hopper with water , and so on . to facilitate a user to disassemble and use the soybean milk maker according to present invention , and to guarantee safety and sanitary condition , the hopper cover 25 of the milk producing device in the soybean milk maker according to the present invention is preferably connected with the housing 30 through a hinge structure , and all ducts are made of special food - safe materials . in addition , all of the ducts interconnects with each other through inserting & amp ; snapping structures . when the water feeder 26 supplies water to the hopper 1 , in order to facilitate the materials to flow downward more smoothly , especially to facilitate cleaning the milk producing , it is preferred to connect the inlet duct 27 of the water feeder to the water feeder 26 , and to provide blowholes 29 on the water feeder 26 , through which water is supplied to the hopper 1 , more specifically , the water is sprayed to the inner walls of the hopper by the blowholes . thus not only materials adhered on the inner wall of the hopper 1 can be rinsed off , which is advantageous for the down - flow of the material , but also foams produced in the hopper 1 is reduced during the recirculating milk producing process . turn on the soybean milk maker , then the control circuit board 33 gets into its operating state and gives an instruction to the water intake valve 50 to automatically feed water into the water tank 45 . when the water level reaches the design value , the water level sensor 48 on the wall of the water tank 45 sends a signal to the control circuit board 33 , and the control circuit board 33 gives an instruction to the water intake valve 50 to stop water feeding ( the operating principle of such a device is similar to that of a water - feeding device in a fully - automatic washer of prior art , and will not be described here ), then the soybean milk maker gets ready for the next operation procedure which was described above . thus , the degree of automation is improved and the equipment is more convenient to use . in a preferred embodiment of a soybean milk maker according to the present invention , as shown in fig7 , a filter 32 is screwed on the slurry inlet 31 of the cap 36 of the boiling cup . said filter 32 can either be a rigid filter mesh or a flexible filter bag , which is used for filtering the soybean slurry to fit the taste of a user who favors a finer soybean milk . the filter 32 may be taken off from the slurry inlet 31 while cleaning , and may be screwed on the slurry inlet 31 after cleaning . the operation is easy and convenient . the control valve assembly 19 may also be configured as an electromagnetic valve assembly . but an electrically controlled change valve , compared with an electromagnetic valve assembly , which is employed in a soybean milk maker would lead to a space saving and reduction in parts numbers . since the valve body of a change valve cannot keep water or sediments , and opening , closing , changeover , sealing thereof are more reliable , the lifespan of the soybean milk maker is extended . the milk producing procedures of a soybean milk maker according to the present invention are : ( 1 ) feeding soaked soybeans or dry soybeans into the hopper , then turning on the power via the control panel ; ( 2 ) feeding water into the water tank , and pre - heating the water to a predetermined temperature under the control of the control circuit board ; ( 3 ) a water pump supplies heated water to the hopper , and a motor of a recirculating crushing and grinding device operates to produce slurry ; ( 4 ) under the control of the control circuit board , the final soybean milk produced according to the design procedures is discharged into the boiling cup and boiled therein then poured out for drinking ; ( 5 ) the water pump is controlled by the control circuit board to feed the hopper with water once again , the motor of the recirculating crushing and grinding device is operated to clean the recirculating crushing and grinding device , and dirty water is discharged through the drain duct ; and , ( 6 ) the control circuit board 33 controls the equipment so that the equipment is in a stand - by state , and all processing procedures are finished .

US-12963808-A

myocardial perfusion can be measured and ischemia and infarction can be diagnosed using compounds having the formula . sub . n ]. sup .⊕ a . sup .⊖ wherein a is an anion ; n is 1 , 2 , 3 or 6 ; if n is 1 , l is a hexadentate ligand , if n is 2 , l is a tridentate ligand , if n is 3 , l is a monodentate ligand .

the complexes of this invention can be obtained using technetium - 99m in the form of its pertechnetate ion , the form obtained from commercially available technetium - 99m parent - daughter generators ; such technetium is in an oxidation state of + 7 . the generation of the pertechnetate ion using this type of generator is described in more detail in u . s . pat . nos . 3 , 369 , 121 and 3 , 920 , 995 . these generators are usually eluted with saline solution , and the pertechnetate ion is obtained as the sodium salt . to prepare the complexes of this invention , pertechnetate ion ( in the form of a salt ) is reduced by heating in the presence of a liquid ( l ). the reduction can be carried out in the presence of a chemical reducing agent , e . g ., sodium borohydride , stannous chloride , or sodium hyposulfite . the solvent system used for the reaction is not critical ; methanol , ethanol or a combination of either with water is preferred . if a chemical reducing agent ( other than the ligand ) is not present , the reaction will preferably be carried out in a pressure vessel at a temperature greater than about 100 ° c . if an added chemical reducing agent is used , the reaction will preferably be run under reflux conditions . in addition to pertechnetate , ligand , chemical reducing agent ( optional ) and solvent , the reaction mixture will also contain the anion &# 34 ; a &# 34 ; in the form of a salt . in carrying out the above described reduction reaction the molar ratio of ligand ( l ) to pertechnetate ion should be not less than about 6 : 1 . the larger the excess of ligand used , the more carrier - free the product . the concentration of anion ( a ) is not critical . however , the anion will preferably be chlorine , present as sodium chloride in an amount sufficient to provide an isotonic concentration of 0 . 15 molar after the pertechnetate ion has been added . the complexes of this invention can be used to measure myocardial perfusion and for the diagnosis of ischemia and infarction . to utilize a compound of formula i , it is first dissolved or suspended in pharmaceutically acceptable medium for administration ( e . g ., saline or mixtures of saline and ethanol , propylene glycol , or glycerol ; or aqueous media ). the formulation can also contain various adjuvants including preservatives , such as alkyl parabens ( e . g ., methyl paraben and propyl paraben ), and solubilizing agents ( e . g ., polyvinylpyrrolidone , ethylene glycol distearate , glycol and phenylsalicyclic acid ). imaging of the myocardium can be carried out using standard scanning techniques ; see , for example , andres , j . f . et al ., nuclear medicine , wiley & amp ; sons , new york , 1977 . ammonium pertechnetate ( 21 . 33 m ), lithium perchlorate ( 16 . 18 mg ) and methanol ( 1 . 0 ml ) were placed into a 2 - necked 10 ml round bottom flask equipped with a water - cooled condenser , inlet - outlet tubes and stir bar . the apparatus was flushed with nitrogen , and bis ( 1 , 2 - dimethylphosphino ) ethane ( 1 . 0 ml ) was added to the flask . the reaction mixture was refluxed for 2 hours , and then sodium borohydride ( ca . 5 mg .) was added to the flask . after an additional 2 hours of refluxing , the condenser was removed and the solution was allowed to go to dryness by heating . the resulting solid was dissolved in methanol , filtered to remove the resultant precipitate , and concentrated in vacuo to yield the title compound . after cooling to room temperature , the product was recrystallized from a warm methanol / water mixture . technetium ( i ) tris [ bis ( 1 , 2 - dimethylphosphino ) ethane ] perchlorate was dissolved in methanol and lithium phosphorous hexafluoride was added , yielding the title compound , which was recrystallized from a warm methanol / water mixture . ammonium pertechnetate ( 150 . 27 mg ), sodium phosphorous hexafluoride ( ca . 20 mg ), 95 % ethanol ( 20 ml ), and water ( 5 ml ) were added to a 50 ml 3 - neck flask equipped with a condenser . the solution was stirred with a magnetic stir bar while nitrogen was blown over the mixture for about 30 minutes . bis [( 1 , 2 - dimethylphosphino ) ethane ] ( 3 . 5 ml ) was injected from a glass syringe through a serum septum , and the solution was heated for about 2 hours . about 100 mg of sodium borohydride was added and heating was continued for about 4 hours . the condenser was disconnected and the solution allowed to evaporate to near dryness . methanol ( 30 ml ) was added and stirring was continued without heating . the solution was filtered through a fritted glass filter , and about 20 ml of water was added to the filtrate . the solution was condensed on a hot plate , and upon cooling and the addition of about 20 mg of additional sodium phosphorous hexafluoride a precipitate formed . the precipitate was collected and recrystallized from hot methanol / water slowly to yield crystalline product . ammonium pertechnetate ( 150 . 47 mg ), sodium fluoride ( 0 . 3422 g ), and absolute ethanol ( 30 ml ) were placed into a 50 ml 3 - necked round bottom flask equipped with a water - cooled condenser and stir bar . the apparatus was flushed with nitrogen for 30 minutes and then bis [( 1 , 2 - dimethylphosphino ) ethane ] ( 2 . 5 ml ) was added . the reaction mixture was refluxed for 4 hours and sodium borohydride was added . the mixture was refluxed for an additional 2 hours , the condenser was removed and the solution was allowed to concentrate to dryness under heat . the resulting solid was dissolved in methanol , filtered to remove an insoluble precipitate , and the filtrate concentrated , under vacuum , to dryness , yielding the title product . bis [( 1 , 2 - dimethylphosphino ) ethane ] ( 300 μl ), 95 % ethanol ( 570 μl ), 1n hydrogen bromide ( 50 μl ), and sodium pertechnetate ( 200 μl ) were added to a serum vial and heated to 130 ° c . for 60 minutes , allowed to cool to room temperature and diluted with 1 . 0 ml of 0 . 15n saline and 3 ml of sterile water . the mixture was filtered through a hydrophobic 0 . 2 micron sterile filter to obtain the product used for the biodistribution studies reported below . male sprague - dawley rats ( 200 - 300 g ) were allowed food and water ad libitum . the dose of test compound ( 0 . 10 ml of a 0 . 10 mci / ml solution ) was administered via the external jugular vein under ether anaesthesia . at each time point of 5 , 20 , 60 and 180 minutes post injection the four rats were re - anaesthetized with ether , a blood sample was withdrawn from the aorta and the heart , lungs , liver , kidneys , spleen , femoral bone , muscle , thyroid , brain and adrenals were dissected out . the tissues were weighed and then counted in a nuclear chicago auto gamma spectrophotrometer with the appropriate - volume corrected - standards to enable the results to be expressed as percent injected dose per organ and percent injected dose of tissue . the heart to tissue ratios were calculated on a per gram basis for blood , lungs and liver . the results are reported below . each point is an average of four animals ± one standard deviation . ______________________________________percent injected dose per organ heart lungs liver______________________________________5 min . 1 . 55 % ± . 16 2 . 42 % ± . 37 16 . 26 % ± 1 . 6220 min . 1 . 30 % ± . 14 1 . 65 % ± . 22 14 . 68 % ± 2 . 1760 min . 1 . 45 % ± . 27 1 . 41 % ± . 49 13 . 36 % ± 1 . 88180 min . 1 . 19 % ± . 24 1 . 24 % ± . 39 9 . 28 % ± 1 . 76______________________________________percent injected dose per gram of tissue heart blood lungs liver______________________________________5 min . 1 . 72 % ± . 21 . 21 ± . 03 1 . 78 ± . 22 1 . 45 ± . 1720 min . 1 . 57 % ± . 11 . 14 ± . 05 1 . 20 ± . 13 1 . 31 ± . 1760 min . 1 . 84 % ± . 42 . 09 ± . 01 . 85 ± . 29 1 . 40 ± . 25180 min . 1 . 47 % ± . 24 . 04 ± . 006 . 94 ± . 36 . 93 ± . 10______________________________________heart / organ ratios for determining image quality - contrast heart / blood heart / lung heart / liver______________________________________5 min . 8 . 2 . 97 1 . 220 min . 11 . 2 1 . 30 1 . 260 min . 20 . 4 2 . 20 1 . 3180 min . 36 . 8 1 . 56 1 . 6______________________________________

US-46595783-A

an apparatus for comminuting biological specimens includes a receiving component provided with a drive source , a sample retainer configured for retaining at least one biological specimen and for engagement in the receiving component , and a single use comminution mechanism in operational relationship with the sample retainer . the drive source is configured for driving the comminution mechanism . a collector is associated with the receiving component for receiving comminuted product generated by the comminution mechanism . a method for comminuting biological specimens is provided so that , upon comminution , the specimen is readily subject to rapid extraction and detection of drugs and their metabolites , compounds , chemicals , pesticides , steroids , growth enhancers , contaminants or other pharmacologic agents which may reside in the specimen .

referring now to fig1 , an apparatus or device for comminuting biological specimens or samples is generally designated 10 and is intended for comminuting specimens or samples such as hair , nails , fur , feathers , hooves or other materials having keratin , as well as other biological products such as muscle , organ and / or bone or which are known or believed to contain compounds accessible through chemical analysis and other detection systems . while the present apparatus 10 is depicted in a configuration for processing one specimen at a time , it is contemplated that the present principles of operation are convertible into an embodiment comminuting multiple specimens at a time , at least the latter having automatic control to maintain repeatability and consistency . more specifically , the apparatus 10 includes a base unit or receiving component , generally designated 12 having a housing 14 constructed and arranged for supporting various operational components described below . in the preferred embodiment , the housing 14 is configured for placement upon a table or other work surface , and the use of terms such as “ top ”, “ bottom ”, “ upper ” and “ lower ” refer to the apparatus 10 as depicted in fig1 , however other orientations are contemplated depending on the application . the apparatus 12 is provided with a drive source 16 preferably taking the form of an electric motor ( best seen in fig2 ), powered by either line voltage or battery power , which is located within the housing 14 so that a drive gear 18 driven by the motor is accessible . in the preferred embodiment , the drive gear 18 is disposed on a top surface 20 of the housing 14 in operational proximity to a sample well 22 . the generally cylindrical sample well 22 is defined by a chamber 24 depending from the top surface 20 and being in fluid communication with an interior cavity 26 , preferably through an open bottom 28 . at a lower end 30 of the chamber 24 , a pair of opposing “ l ”- brackets 32 is disposed in generally parallel , spaced relationship to each other . the brackets 32 are configured for slidingly receiving a generally funnel - shaped filter collar 34 provided with at least one laterally extending flange 36 on an upper end 38 of the collar for slidingly engaging the brackets 32 and is generally greater in diameter than a lower end 40 , which is configured for passing comminuted sample from the chamber 26 into a receiving collector 42 . in the preferred embodiment , the collector 42 is at least one conventional test tube provided in a size suitable for such specimen analysis as is well known in the art . among others , suitable test tube sizes include 12 × 75 mm , 10 × 40 mm , 13 × 45 mm , 13 × 50 mm and 13 × 60 mm . alternatively , the known “ hitachi ” cups are contemplated as well as other laboratory standard test tubes and other holding vessels known to those skilled in the art . the housing 14 of the receiving component 12 is preferably configured for retaining the collector 42 in a collecting position ( best seen in fig1 ). while a variety of clamping formations , clips or brackets are contemplated , the preferred structure is a clip 44 having a generally “ u ”- shape when viewed in lateral section , having a pair of generally parallel spaced vertically extending arms 46 . it will be appreciated that the spacing of the arms 46 is determined by the size of the desired test tube 42 , and it is contemplated that the clip 44 as well as an underlying panel 48 may be exchanged for other sizes when other test tube sizes are to be used with the apparatus 10 . thus , the spacing of the arms 46 will be sufficient to provide a slight yet positive gripping force on the test tube 42 without causing damage . it is also contemplated that the lower end 40 of the filter collar 34 will fit inside an upper end 50 of the test tube 42 . referring now to fig3 and 4 , an important portion of the comminution apparatus 10 is a sample retainer , generally designated 52 , configured both for retaining at least one biological specimen and for engagement in the sample well 22 of the receiving component 12 . the sample retainer 52 is operationally associated with a single use comminution mechanism configured for converting a raw specimen into a granular or powdery product more amenable to chemical analysis and other detection systems . in the preferred embodiment , this comminution is obtained by relative rotation of a first component of the sample retainer relative to a second component . this relative rotation is powered by the driving source 16 . the comminuted sample is received in the filter collar 34 and ultimately in the collector or test tube 42 . it is contemplated that the receiving component 12 may alternately have a separate single use comminution mechanism separate from the sample retainer . more specifically , in the embodiment of fig3 and 4 the sample retainer 52 , also referred in some cases as “ a consumable ” since it is designed for single use , includes a first component referred to as a cup 54 configured for retaining the above - identified sample or biological specimen 56 , which may be obtained from a variety of human and animal products . in the preferred embodiment , the sample 56 is depicted as a group of hair fibers cut to an approximate 1 . 5 inch length and having a weight of approximately 20 mg , which , when the hair is taken from the head , represents about 90 days of potential drug use . it is preferred that about 10 - 20 hairs are suitable as the sample 56 . however , it is contemplated that the size of the sample 56 may vary with the application and / or with the type of hair collected or the location on the body from which the specimen is collected . the dimensions of the sample retainer 52 are chosen based on the desired sample size . the cup 54 is generally cylindrical in shape , with an open upper end 58 defined by a generally tubular sidewall 60 . while other lengths and aspect ratios are contemplated , the present sidewall is at least approximately 1 . 5 inches in length and about 0 . 875 inch in diameter to adequately accommodate the sample 56 . opposite the upper end 58 is a lower end 62 provided with a supportive grid 64 . the grid 64 consists of first and second pluralities of spaced bars oriented normally to each other . as a result , a supportive yet porous surface is obtained . the grid 64 is secured to the lower end 62 either by being integrally molded to the sidewall 60 or held there by chemical adhesive , ultrasonic welding or similar fastening techniques . to enhance the retention of comminuted particles of the sample 56 , the grid 64 is preferably provided with a transition formation 65 preferably in the form of a depending , annular tapered lip configured for insertion into the upper end 38 of the collar 34 . atop the grid 64 is secured at least one first comminution surface 66 provided in the form of a generally planar perforated metal disk . in the preferred embodiment , the disk 66 is made from , or using techniques known in the electric shaver art for producing electric shaver foil having apertures in the approximate range of 0 . 025 inch , however the size and shape of the openings in the disk may vary to suit the application , provided they are large enough to pass comminuted hair fibers therethrough . human hair fibers typically have a diameter in the range of 0 . 002 - 0 . 004 inch . another desirable property of the disk 66 is that it is designed to serve as a fixed surface or “ anvil ” and as such is perforated but has a generally level upper surface . in the preferred embodiment , this surface is produced by electroplating or electrodeposition . the disk 66 is preferably secured to the grid 64 by chemical adhesive , ultrasonic welding , insert molding or similar fastening technology . while a shaver foil or similar perforated disk is the preferred material and construction for the comminution surface 66 , it is contemplated that other materials would be suitable provided they produce comminuted hair , feathers , nails , hooves , horns , fur , beaks , and other sources of keratin or other specimens found in humans and animals suitable for chemical analysis and other detection systems . it is also contemplated that the comminution surface 66 may be integrally formed with the grid 64 and even be made of the same material . a second component of the sample retainer 52 is referred to as a ram 68 and is configured for operational engagement with the cup 54 and having at least one second comminution surface 70 . the ram 68 pushes the sample 56 toward the first comminution surface 66 and maintains the sample there until comminution is complete . another function of the ram 68 is to provide the second comminution surface 70 , which acts against the first surface 66 to comminute the sample 56 . since the comminution process is obtained through relative rotation of the first and second surfaces 66 , 70 in the preferred embodiment the ram 68 is configured for being rotated by the motor 16 , and as such functionally serves as the “ hammer ” of the two comminution surfaces 66 , 70 . in a similar fashion to the attachment of the first comminution surface 66 to the cup 54 , the second comminution surface 70 is attached to a corresponding surface 71 of the ram 68 by chemical adhesive , ultrasonic welding , insert molding , or integral manufacturing with the ram as is known in the art . referring now to fig3 and 3 a , the disk 70 is secured to the ram 68 as described above to provide sufficient abrasive force when the surfaces 66 , 70 are rotated against each other to comminute strands of hair into a granular or powdery consistency . in the preferred embodiment , the disk 70 is preferably made of metal by stamping to form a bossed or dimpled , generally planar surface . the sharpness of the edges of the bosses 70 a may be enhanced by subsequent grinding or lapping operations . it has been found that , for desired results when human hair is being comminuted , the height of the bosses 70 a should be less than the diameter of the thickness of the hair strands 56 a . thus , in the preferred embodiment , the bosses 70 a have a height of approximately 0 . 002 - 0 . 0025 inch . it is contemplated that the boss height may vary to suit the application or the sample type and size , and that boss height may vary within or upon the same surface 70 . while shaver foil is the preferred material for the surface 70 , and while the comminution apparatus is presently disclosed in the form of opposed comminution surfaces 66 , 70 , other comminution surfaces or apparatus capable of comminuting hair , feathers , nails , hooves , horns , fur , beaks , and other sources of keratin or other types of specimens found in humans and animals are contemplated . for example , it is contemplated that the surfaces 66 , 70 may be made of other materials , including metals such as stainless steel , nickel , aluminum alloys of the above and similar metals , plastics , abrasives such as sandpaper , silica carbide or other suitable abrasive or grinding materials . it is further contemplated that the foil surfaces 66 , 70 may be exchanged on the respective cup 54 and ram 68 and also that the cup may rotate relative to the ram . since the ram 68 is movable relative to the cup 54 , it is provided with a gear 72 or equivalent drive formation opposite the comminution surface 70 . in the preferred embodiment , the gear 72 is integrally molded to the ram 68 and is provided with a radially extending tooth configuration which meshes with the drive gear 18 . the precise tooth pattern may vary to suit the application as is known in the art . as the ram 68 rotates relative to the cup 54 , a radially extending bearing surface 73 located beneath the gear 72 slidably engages the inner sidewall 60 for maintaining proper alignment of the ram in the cup , and also for maintaining proper engagement of the gears 72 , 18 . another feature of the ram is that it is preferably configured for retaining the sample 56 between the surfaces 66 , 70 . to that end , the ram 68 is provided with a sample retainer formation 74 for retaining the sample in place during comminution . it has been found that sample portions often creep upward away from the surfaces 66 , 70 . the present sample retainer formation 74 is preferably formed as a radially extending helical rib which prevents the sample 56 from migrating away from the surfaces 66 , 70 by forming a downward directing , moving barrier which acts like an auger against an inner surface of the cup 54 and rotates with the ram 68 . when provided as a helical rib , the formation 74 has to be oriented to accommodate the direction of rotation of the ram 68 to push the stray hair towards the comminution surfaces , 66 , 70 . through the use of the retainer formation 74 , the sample is maintained in operational relationship to the comminution surfaces 66 , 70 . an important feature of the present sample retainer 52 is that it is disposable to facilitate single use and avoid cross contamination of samples . accordingly , the cup 54 and the ram 68 are configured for easy detachability from the sample well 22 . in the preferred embodiment , the sample retainer 52 is vertically removable from the well 22 , however other disengagement configurations are contemplated . with the preferred configuration , when the sample retainer 52 is removed , the comminution surfaces 66 , 70 as well as the drive formation 72 and the retainer formation 74 are also removed , those being the surfaces subject to contact with the sample 56 , before and after comminution . in addition , the cup 54 and the ram 68 are made of relatively inexpensive materials , which may include an anti static property . alternatively , the cup 54 and / or the ram 68 may be made of material or otherwise equipped to neutralize positive or negative charges in the sample 56 or the cup 54 . referring now to fig2 , once the sample 56 is placed between the surfaces 66 , 70 and there is resulting relative rotation by the drive source 16 for a specified period of time , the comminuted sample passes through the apertures in the surface 66 , through the supportive grid 64 and into the filter collar 34 . it has been found that in some situations , the comminuted sample does not fall freely into the filter collar 34 and ultimately into the collector 42 . as such , the receiving component 12 is preferably provided with at least one flow enhancer 76 . in the preferred embodiment , one flow enhancer 76 is a vacuum fan ( fig2 ) which creates a negative pressure at the filter collar 34 by drawing air flow through an elbow duct 78 located within the receiving component 12 and which is in fluid communication with the filter collar . air flows through the filter collar 34 in a generally lateral direction by virtue of a porous filter screen 80 ( fig2 ) affixed in an opening in a wall - of the filter collar . the ram 68 is preferably provided with at least one air vent 81 for facilitating the flow of air through the sample retainer 52 . alternatively , air may flow through the collar 34 and the cup 54 through a filter at the bottom of the cup . a mesh size is selected for the filter screen 80 so that air flows through , but comminuted bits of sample 56 are caught on the screen . other types of filter material may be used as well to separate grades of comminuted particles as to size . in instances where there is a need for enhanced retention of the volume of comminuted sample , a motor 84 powering the vacuum fan 76 may be intermittently energized , instead of being constantly energized . it is believed that intermittent energization will enhance retention of comminuted sample 56 . the filter collar 34 is mounted in the receiving component 12 so that the filter screen 80 is in communication with the duct 78 . to provide adequate suction generated by the fan 76 , the duct 78 has a collar end 82 ( shown partially cut away ) configured for tightly engaging the conical wall of the filter collar 34 . it is also contemplated that a second flow enhancer is provided , designated 86 . in the preferred embodiment , the second flow enhancer 86 is a vibrator , which generates pulse impacts against the filter collar 34 to facilitate the downward flow of comminuted sample 56 into the collector 42 . more specifically , the vibrator 86 in one embodiment includes a motor 88 powering an eccentric cam 90 which is in periodic contact with the filter collar 34 . other configurations and orientations of vibrating mechanisms are contemplated , provided the flow of comminuted sample is enhanced . referring now to fig1 and 2 , for beneficial results , it is preferable that there be a biasing force exerted against the sample retainer 52 so that the respective comminution surfaces 66 , 70 exert sufficient pressure against the sample 56 to achieve desirable comminution . accordingly , the receiving component 12 is provided with least one biasing device 92 configured for exerting a biasing force on the sample retainer 52 . the preferred biasing device 92 is a releasable clamp affixed at a base 94 to the top surface 20 of the receiving component 12 . an over center lever / cam apparatus 96 is secured to the base 94 and includes a handle 98 and an actuator arm 100 . at a free end of the actuator arm 100 , a rotatable contact pad 102 is secured and is biased vertically by a spring 104 . the amount of spring force exerted by the contact pad 102 is determined by a threaded adjustment of an attachment rod 106 . when the handle 98 is pressed in a downward position ( fig1 ), the actuator arm 100 is fixed in a lowered position with the contact pad 102 impacting an end 108 of the ram 68 having the gear 72 . thus , the contact pad 102 exerts a vertical biasing force against the ram 68 , forcing the comminution surface 70 against the comminution surface 66 in the cup 54 . further , the contact pad 102 rotates with the ram 68 . it has been found that about 5 pounds of force provides suitable results , but other degrees of biasing force are contemplated depending on the application . in the biased position shown in fig1 , the gear 72 is meshed with the drive gear 18 . it is contemplated that the contact pad 102 rotates with the ram 68 when the drive gear is driving the ram to effect comminution . upon completion of the comminution process , the handle 98 is pulled upward to release the biasing force on the ram . at that point , the sample retainer . 52 may be withdrawn from the receiving component 12 . as the ram 68 rotates relative to the cup 54 , the cup is held stationary or prevented from rotation by being keyed to the sample well 22 . at least one radially projecting lug 110 on the cup 54 is received in a corresponding slot 112 in the sample well 22 . upon vertical insertion of the sample retainer 52 into the sample well 22 , the lug 110 is engaged in the slot 112 to properly seat the sample retainer . referring now to fig2 , control over the comminution operation is maintained by a control circuit 114 shown schematically . the circuit 114 includes a microprocessor 116 , programmable controller , central processing unit or similar device , and is actuated by an actuator 118 , represented by a start switch located on the receiving component 12 . the microprocessor 116 is connected to the drive motor 16 , the vacuum fan motor 84 , the eccentric vibrator motor 88 if included and other automated functions of the apparatus 10 . as is well known in the art , actuation of the switch 118 is configured for individually and cooperatively controlling the operation of the drive motor 16 as well as the vacuum fan motor 84 and the vibrator motor 88 if included . it is contemplated that the various motors 16 , 84 and 88 may be operated sequentially for facilitating the comminution and collection of comminuted sample 56 . for automatic operation of the apparatus 10 , it is helpful to be able to monitor the condition of the comminuted sample 56 once it reaches the collector 42 . many chemical analyses performed on comminuted samples 56 such as human hair are dependent upon the weight of the comminuted sample . also , when multiple samples 56 are comminuted at a time , a more automated apparatus is preferred for saving time as well as for maintaining consistency and repeatability of the process . accordingly , the microprocessor 116 is preferably connected to a sensor 120 in operational proximity to the collector 42 . the sensor 120 is schematically represented , since it is contemplated that the sensor may monitor various properties of the comminuted sample 56 including , but not limited to weight , height in the collector 42 , particle size , volume and opacity . appropriate types of sensors 120 for monitoring such properties include infrared , mechanical , scales , optical and electronic types as are known in the art . once connected to the microprocessor 116 , the sensor 120 provides feedback information in the form of signals which , when sent to the microprocessor , trigger predetermined operational cycles of the motors , 16 , 84 and 88 as desired . for example , upon reaching a predetermined weight of sample in the collector 42 , the main drive motor 16 is turned off to stop the comminution process . also , while only one sample retainer 52 and associated receiving portion 12 are discussed , it is contemplated that a unit incorporating the above - described principles of operation may be provided with the capability of simultaneously processing multiple samples at a time . the receiving portion 12 may be provided in a format suitable for processing single or small volumes of sample retainers 52 , or large volumes of such retainers . in the latter applications it is contemplated that the functions of driving the gear 72 on the ram 68 , exerting the biasing force to facilitate comminution and initiating the vacuum may be performed by the master control circuit 114 operating on multiples of the components described above . also , it is contemplated that the microprocessor 116 may be programmed for varying the time of comminution , vacuum and / or vibration as a function of the size of the sample 56 . it is also contemplated that replacement kits of consumables be provided to users of the receiving component 12 or similar device . such a kit would include at least a cup 54 with the grid 64 and the first comminution surface 66 , a ram 68 with the second comminution surface 70 . in addition , the kit would preferably include a filter collar 34 and a collector or test tube 42 . thus , any of the components coming in contact with the specimen are single use and disposable . in operation , the present invention also contemplates the following method of comminuting specimens or samples for obtaining subject matter upon which chemical analysis may be performed . while the method is preferably performed with the apparatus described above , it is contemplated that other apparatus may be provided for achieving the same goals of generating comminuted sample material suitable for chemical testing and other detection systems . more specifically , the method includes first providing a biological sample comminution device including the receiving component 12 provided with the drive source 16 , the sample retainer 52 configured for retaining at least one biological specimen 56 and for engagement in the receiving component 12 , the sample retainer associated with a single use comminution mechanism 66 , 70 , the drive source configured for driving the comminution mechanism and a collector 42 associated with the receiving component for receiving comminuted product generated by the comminution apparatus 10 . next , the filter collar 34 is loaded into the receiving component 12 , after which the collector 42 is also loaded onto the component . as an option , the biological sample 56 is prewashed while in the first component 54 with methanol or other suitable liquids or compounds , and possibly subject to sonication or agitation , for removing external substances from the sample which may skew the results of the analysis . a removable filter material or screen may be placed at the bottom of the first component or cup 54 to prevent pre - wash movement of the sample through the foil during the washing period , and then removed before the second component 68 is engaged . the biological sample 56 is then placed into the first component 54 of the sample retainer 52 , and the first component is then loaded into the receiving device . it has been found that the samples of hair are awkward to handle and are difficult to position suitably at the bottom of the cup 54 . the preferred orientation , in the case of human hair , is flat or generally coplanar with the first comminution disk surface 66 . it has been found that if the hair is moistened with methanol it is easier to locate in the cup 54 . the methanol holds the hair together in a temporary bond which is released as the liquid evaporates . also , the ethanol or methanol or other liquids quickly vaporizes without residue , especially when vacuum is used . alternately , tweezers , cardboard or otherwise disposable plungers , or a technician &# 39 ; s finger may be used for placing the sample . the source of vacuum 84 is then turned on for drawing air through the sample retainer to dry the sample . after the sample is dry , the second component 68 of the sample retainer 52 is engaged with the first component of the sample retainer with the biological sample 56 therebetween . a biasing force is exerted against the first component 54 of the sample retainer 52 so that the first comminution surface 66 on the first component engages a second comminution surface 70 on the second component 68 , and the drive source 16 is initiated to rotate the second component relative to the first component 54 to cause comminution of the specimen within the retainer 52 . using the microprocessor 116 , with or without the sensor 120 , the operation of the drive source 16 may be varied as to time of operation , direction of rotation and / or intermittent or constant rotation . if desired , vacuum and / or vibration are employed by controlling the motors 84 , 88 to facilitate movement of comminuted sample into the collector 42 . it will be seen that the present sample comminution apparatus 10 more efficiently provides comminuted sample for subsequent chemical analysis and other detection systems . it has been found that a typical 20 mg sample of hair requires about 2 to 5 minutes of comminution to reach a sufficiently comminuted consistency for chemical analysis and other detection systems . using the present system , the process of comminution and chemical extraction has been reduced from several hours to about 30 minutes , and can be performed onsite rather than in a remote laboratory . samples produced according to the present invention have been found to provide higher recovery in a shorter period of time in the subsequent chemical analysis than samples prepared according to prior techniques . the present system for comminuting hair samples has been found to expose the hair &# 39 ; s cortex to enhance the reactivity of the hair with the analytical chemicals and other detection systems . while specific embodiments of the present method and apparatus for the comminution of biological specimens has been shown and described , it will be appreciated by those skilled in the art that changes and modifications may be made thereto without departing from the invention in its broader aspects and as set forth in the following claims .

US-84970104-A

a tea maker provides a simple structural configuration , stable and rigid structure , and low manufacturing cost , and is adapted to effectively separate the tea leaves from the brewed tea for adjustably controlling the concentration of the brewed tea . the tea maker includes a supporting frame , a tea infusing container with a container lid , a tea basket disposed in the tea infusing container , and a control circuit . a sliding arrangement includes a vertical support , a sliding frame slidably coupled at the vertical support , and a resilient element . the sliding frame includes a hanger , an actuator , and a first permanent magnet . the hanger is supported above and aligned with an electromagnet . a second permanent magnet is provided at the outer side of the surrounding wall of the tea basket and is magnetically attracted with the first permanent magnet .

these and other objectives , features , and advantages of the present invention will become apparent from the following detailed description , the accompanying drawings , and the appended claims . referring to fig1 of the drawings , a tea maker according to a first embodiment of the present invention is illustrated , wherein the tea maker comprises a supporting frame 1 which is embodied as a vertical supporting post , a tea infusing container 3 with a container lid 31 supported by the supporting frame 1 , a tea basket 4 with a basket lid 41 disposed in the tea infusing container 3 , and a control circuit . the tea infusing container 3 is preferably integrated with the supporting frame 1 . the supporting frame 1 comprises a vertical support 12 supported adjacent to an outer side of the surrounding wall of the tea infusing container 3 , a handle 12 , and a slider switch 24 . a lid locker 310 is provided on top of the handle 13 , wherein the lid locker 310 is engaged with a protrusion of the container lid 31 to selectively lock up the container lid 31 on the tea infusing container 3 . the tea maker further comprises a sliding arrangement which comprises a sliding frame 2 slidably coupled at the vertical support 12 , and a resilient element 121 , wherein the resilient element 121 , which is preferably a compression spring , is supported below the sliding frame 2 . therefore , resilient element 121 is retained at a working mode that the resilient element 121 is compressed by the sliding frame 2 . ( when the resilient element 121 is supported above the sliding frame 2 , the resilient element 121 is retained at the working mode that the resilient element 121 is stretched out by the sliding frame 2 ). the sliding frame 2 is coupled at the vertical support 12 corresponding to the slider switch 24 which is coupled at the bottom end of the vertical support 12 . therefore , when the sliding frame 2 is slid downwardly along the vertical support 12 , the sliding frame 2 will contact with the slider switch 24 . the sliding frame 2 comprises a hanger 21 , which is made of magnetic attractive material , protruded therefrom , an actuator 22 protruded toward the handle 12 , and a first permanent magnet 23 coupled at the sliding frame 2 . the hanger 21 is positioned corresponding to an electromagnet 11 which is located at the bottom portion of the vertical support 12 , wherein the hanger 21 is supported above and aligned with the electromagnet 11 . the actuator 22 is positioned offset to the handle 13 such that the handle 13 will not block the actuation of the actuator 22 . the sliding arrangement further comprises a first guiding groove 32 vertically formed at the outer side of the surrounding wall of the tea infusing container 3 , wherein the first permanent magnet 23 is slidably engaged at the first guiding groove 32 . the sliding arrangement further comprises a second guiding groove 33 vertically formed at the inner side of the surrounding wall of the tea infusing container 3 and aligned with the first guiding groove 32 . the tea basket 4 further comprises a second permanent magnet 42 provided at the outer side of the surrounding wall of the tea basket 4 and slidably engaged with the second guiding groove 33 . in addition , the first and second permanent magnets 23 , 42 are magnetically attracted with each other . the basket lid 41 covers a top opening of the tea basket 4 . the container lid 31 covers a top opening of the tea infusing container 3 . a heater unit 5 is provided at a bottom side of the tea infusing container 3 , preferably provided therewithin . the tea infusing container 3 further has a tea discharging outlet 34 provided at the bottom side of the tea infusing container 3 at a position opposite to the handle 13 . a temperature sensor is provided adjacent to the tea discharging outlet 34 . accordingly , the control circuit comprises a counter for counting how many times the sliding frame 2 being slid downwardly . according to the first embodiment , the working principle and the operation is shown as follow : ( 1 ) fill up the water : before brewing the tea , the user is able to open up the container lid 31 and remove the tea basket 4 from the tea infusing container 3 . therefore , the user is able to fill a predetermined amount of water into the tea infusing container 3 . ( 2 ) place the tea leaves : the user is able to place the tea leaves in the tea basket 4 by opening up the basket lid 41 . once the tea leaves are properly placed in the tea basket 4 , the user is able to close the tea basket 4 by the basket lid 41 and to dispose the tea basket 4 in the tea infusing container 3 . ( 3 ) heat up the water : once the power is on , the user to able to press the “ boil water ” button on the control panel . therefore , the heater unit 5 is automatically activated for heating up the water in the tea infusing container 3 . when the temperature sensor detects the water temperature reaching a preset threshold , the control circuit will activate a buzzer for generating an audio notification . ( 4 ) drop down the tea basket 4 : the user is able to set the brewing time on the control panel . the user is able to apply a downward force at the actuator 22 to drive the sliding frame 2 moving downward along the vertical support 12 . at the same time , the first permanent magnet 23 is correspondingly driven downward along the first guiding groove 32 . due to the magnetically attraction , the second permanent magnet 42 will be slidably moved down along the second guiding groove 33 by the first permanent magnet 23 so as to drop down the tea basket 4 . in other words , the movement of the tea basket 4 is driven to move by means of magnetic means . once the tea basket 4 is dropped down at the lowest position , the hanger 11 is magnetically attracted by the electromagnet 11 so as to retain the tea basket 4 in position . ( 5 ) rinse the tea leave : ( a ) the tea basket 4 is retained in the boiling water for brewing process . ( b ) after a predetermined of time , such as 5 seconds , the coil of the electromagnet 11 is de - energized , such that the compressed resilient element 121 will bound to its original form to generate an upward pushing force along the vertical support 12 . as a result , the first permanent magnet 23 is correspondingly driven upward along the first guiding groove 32 by the resilient element 121 . due to the magnetically attraction , the second permanent magnet 42 will be slidably moved up along the second guiding groove 33 by the first permanent magnet 23 so as to lift up the tea basket 4 . it is worth mentioning that the tea basket 4 is lifted up at a position above the water level of the boiling water in the tea infusing container 3 . ( c ) the water in the tea infusing container 3 is drained via the tea discharging outlet 34 . it is worth mentioning that the user is able to actuate a “ discharge ” switch on the control panel to drain the water out of the tea infusing container 3 , wherein the water is used for rinsing the tea leaves as the tea rinsing water . ( 6 ) fill up the water again : the user is able to open up the container lid 31 and remove the tea basket 4 from the tea infusing container 3 . therefore , the user is able to fill a predetermined amount of water into the tea infusing container 3 . once the tea basket 4 is disposed in the tea infusing container 3 , the user is able to cover the top opening of the tea basket 4 by the basket lid 41 . ( 7 ) boil the water : the user is able to select which type of tea leave to brew the tea by selectively pressing a corresponding “ tea type ” button on the control panel . once the “ tea type ” button is pressed , the brewing time and temperature will be automatically set to brew the tea . the heater unit 5 is also automatically activated for heating up the water in the tea infusing container 3 . ( 8 ) drop down the tea basket 4 : when the water temperature reaches the preset threshold , the control circuit will activate the buzzer for generating an audio notification . the user is able to apply the downward force at the actuator 22 to drive the sliding frame 2 moving downward along the vertical support 12 . at the same time , the first permanent magnet 23 is correspondingly driven downward along the first guiding groove 32 . due to the magnetically attraction , the second permanent magnet 42 will be slidably moved down along the second guiding groove 33 by the first permanent magnet 23 so as to drop down the tea basket 4 . in other words , the movement of the tea basket 4 is driven to move by means of magnetic means . once the tea basket 4 is dropped down at the lowest position , the hanger 11 is magnetically attracted by the electromagnet 11 so as to retain the tea basket 4 in position . ( 9 ) drew the tea : the tea basket 4 is retained in the boiling water and the brewing time is started to brew the tea . ( 10 ) lift up the tea basket 4 : when the brewing time is finished , the coil of the electromagnet 11 is automatically de - energized , such that the compressed resilient element 121 will bound to its original form to generate the upward pushing force along the vertical support 12 . as a result , the first permanent magnet 23 is correspondingly driven upward along the first guiding groove 32 by the resilient element 121 . due to the magnetically attraction , the second permanent magnet 42 will be slidably moved up along the second guiding groove 33 by the first permanent magnet 23 so as to lift up the tea basket 4 . it is worth mentioning that the tea basket 4 is lifted up at a position above the water level of the boiling water in the tea infusing container 3 . ( 11 ) discharge the brewed tea : when the user wants a cup of tea , the user is able to actuate the “ discharge ” switch on the control panel to discharge the brewed water out of the tea infusing container 3 via the tea discharging outlet 34 . ( 12 ) heat preservation : when the temperature sensor detects the water temperature below a preset threshold , the heater unit 5 is automatically activated for heating up the water in the tea infusing container 3 so as to retain the brewed tea therein at a predetermined temperature . when replacing the tea leaves , the lid switch 310 is actuated once corresponding to the container lid 31 . the control circuit will initialize the counter as zero corresponding to the counting number of the sliding frame 2 being slid downwardly . every time when the sliding frame is slid downwardly , the slider switch 24 will be contacted once to add the counting number of the sliding frame 2 being slid downwardly . according to the first embodiment , the hanger 21 can be replaced by an armature 112 and the electromagnet 11 can be replaced by induction coil assembly 111 . as shown in fig2 , a tea maker according to a second embodiment illustrates an alternative mode of the first embodiment , wherein the tea maker further comprises a water tank 10 supported above the tea infusing container 3 . the supporting frame 1 further comprises a supporting shaft 100 . the water tank 10 is rotatably coupled at the supporting shaft 100 , wherein the water tank 10 and the tea infusing container 3 can be rotatably moved at the supporting shaft 100 . the tea infusing container 3 further comprises a first water inlet 36 which is provided at the top side thereof and is aligned with a water outlet of the water tank 10 . in particular , an electromagnetic water valve 102 is provided at the water outlet of the water tank 10 , wherein the water outlet of the water tank 10 is provided at the bottom side thereof . the water tank 10 further comprises a second water inlet 103 provided at the top side of the water tank 10 . an alignment unit 104 is provided between the water tank 10 and the tea infusing container 3 to ensure the correct alignment between the first water inlet 36 of the tea infusing container 3 and the electromagnetic water valve 102 at the water inlet of the water tank 10 when the water tank 10 and the tea infusing container 3 are rotated about the supporting shaft 100 . according to the second embodiment , the working principle and the operation is similar to that of the first embodiment , wherein the following shows the differences between the first and second embodiments : ( 1 ) fill up the water : ( a ) the user is able to directly fill up the water in the tea infusing container 3 by rotatably moving either the tea infusing container 3 or the water tank 10 to fill the water into the tea infusing container 3 via the first water inlet 36 . alternatively , the user is able to open up the container lid 31 to fill a predetermined amount of water into the tea infusing container 3 . after filling up the water , the tea infusing container 3 or the water tank 10 can be rotated back to its original position to align the first water inlet 36 of the tea infusing container 3 with the electromagnetic water valve 102 at the water inlet of the water tank 10 . ( b ) the user is also able to fill up the water in the tea infusing container 3 from the water tank 10 . the user is able to fill the water in the water tank 10 via the second water inlet 103 thereof . after filling the water in the water tank 10 , the water can be guided to fill into the tea infusing container 3 from the water tank 10 via the first water inlet 36 of the tea infusing container 3 . in particular , the user is able to press a button on the control panel to activate the electromagnetic water valve 102 through the control circuit so as to open the electromagnetic water valve 102 for allowing the water in the water tank 10 filling into the tea infusing container 3 . ( 6 ) fill up the water again : the user is able to fill the water into the tea infusing container 3 by any one of the filling methods in the above step ( 1 ). according to the second embodiment , the tea maker of the present invention provides the water tank 10 to enhance the practice use of the tea maker for easily filling up water into the tea infusing container 3 . as shown in fig3 , a tea maker according to a third embodiment illustrates another alternative mode of the first embodiment , wherein the tea maker comprises a tea infusing container 3 with a container lid 31 , a control circuit , and a tea basket 4 with a basket lid 41 disposed in the tea infusing container 3 . a handle 35 is provided at the tea infusing container 3 , wherein the control circuit and the coil assembly 111 are provided at the bottom of the handle 35 . the armature 112 is provided at the outer side of the surrounding wall of the tea basket 4 and is correspondingly aligned with the coil assembly 111 . the first guiding groove 32 is provided at the inner side of the surrounding wall of the tea infusing container 3 , wherein the armature 112 is slidably engaged with the first guiding groove 32 . a through slot of the container lid 31 is coaxially aligned with a through slot of the basket lid 41 to form a sliding channel , wherein a presser 6 is slidably extended through the through slots of the container lid 31 and the basket lid 41 along the sliding channel . accordingly , the presser 6 , which is a tubular member , has a bottom portion of the presser 6 is extended into the tea infusing container 3 to press the tea basket 6 toward the bottom side of the tea infusing container 3 . the vertical support 12 is extended from the bottom side of the tea infusing container 3 into the tea basket 4 and is coaxially and slidably inserted into the presser 6 through the tea basket 4 , so as to guide the presser 6 being slid at the vertical support 12 . the resilient element 121 is coaxially coupled at the vertical support 12 , wherein the upper end of the resilient element 121 is biased against the bottom of the tea basket 4 and the bottom end of the resilient element 121 is biased against the bottom side of the tea infusing container 3 . the heater unit 5 and temperature sensor are provided at the bottom side of the tea infusing container 3 . according to the third embodiment , the working principle and the operation is shown as follow : ( 1 ) fill up the water : before brewing the tea , the user is able to open up the container lid 31 and remove the tea basket 4 from the tea infusing container 3 by lifting up the presser 6 . therefore , the user is able to fill a predetermined amount of water into the tea infusing container 3 . ( 2 ) place the tea leaves : the user is able to place the tea leaves in the tea basket 4 by opening up the basket lid 41 . once the tea leaves are properly placed in the tea basket 4 , the user is able to close the tea basket 4 by the basket lid 41 and to dispose the tea basket 4 in the tea infusing container 3 . then , the user is able to close the tea infusing container 3 by the container lid 31 . ( 3 ) heat up the water : once the power is on , the user to able to press the “ boil water ” button on the control panel . therefore , the heater unit 5 is automatically activated for heating up the water in the tea infusing container 3 . ( 4 ) drop down the tea basket 4 : when the temperature sensor detects the water temperature reaching a preset threshold or when the water heating time reaches the preset time , the control circuit will activate the buzzer for generating an audio notification . the user is able to apply a downward force at the presser 6 to drive the tea basket 4 moving downwardly along the vertical support 12 . at the same time , the armature 112 is correspondingly driven downward along the first guiding groove 32 . once the tea basket 4 is dropped down at the preset position , the armature 112 is magnetically attracted to the coil assembly 111 so as to retain the tea basket 4 in position . ( 5 ) rinse the tea leave : ( a ) the tea basket 4 is retained in the boiling water for brewing process . ( b ) after a predetermined of time , such as 5 seconds , the coil of the coil assembly 111 is de - energized to magnetically disengage with the armature 112 , such that the compressed resilient element 121 will bound to its original form to generate an upward pushing force along the vertical support 12 . as a result , the armature 112 is correspondingly driven upward along the first guiding groove 32 by the resilient element 121 . ( c ) the user is able to drain out the water in the tea infusing container 3 as the tea rinsing water . ( 6 ) fill up the water again : the user is able to open up the container lid 31 . therefore , the user is able to fill a predetermined amount of water into the tea infusing container 3 . ( 7 ) boil the water : the user is able to select which type of tea leave to brew the tea by selectively pressing a corresponding “ tea type ” button on the control panel . once the “ tea type ” button is pressed , the brewing time and temperature will be automatically set to brew the tea . then , the user is able to press the “ brew ” button , such that the heater unit 5 is also automatically activated by the control circuit for heating up the water in the tea infusing container 3 . ( 8 ) drop down the tea basket 4 : when the water temperature reaches the preset threshold or when the water heating time reaches the preset time , the control circuit will activate the buzzer for generating an audio notification . the user is able to apply the downward force at the presser 6 to drive the tea basket 4 moving downward along the vertical support 12 . at the same time , the armature 112 is correspondingly driven downward along the first guiding groove 32 . once the tea basket 4 is dropped down at the preset position , the armature 112 is magnetically attracted to the electrified coil assembly 111 so as to retain the tea basket 4 in position . ( 9 ) drew the tea : the tea basket 4 is retained in the boiling water and the brewing time is started to brew the tea . ( 10 ) lift up the tea basket 4 : when the brewing time is finished , the coil of the coil assembly 111 is automatically de - energized to magnetically disengage with the armature 112 , such that the compressed resilient element 121 will bound to its original form to generate the upward pushing force along the vertical support 12 . as a result , the armature 112 is correspondingly driven upward along the first guiding groove 32 by the resilient element 121 . ( 11 ) discharge the brewed tea : when the user wants a cup of tea , the user is able to discharge the brewed water out of the tea infusing container 3 . ( 12 ) heat preservation : when the temperature sensor detects the water temperature below a preset threshold , the heater unit 5 is automatically activated for heating up the water in the tea infusing container 3 so as to retain the brewed tea therein at a predetermined temperature . according to the third embodiment , the vertical movement of the tea basket 4 is controlled by the presser 6 that the tea basket 4 can be moved up and down along the vertical support 12 . in addition , the brewing time for the tea basket 4 within the tea infusing container 3 is adjustably controlled that when the brewing time is up , the tea basket 4 is automatically lifted above the water level in the tea infusing container 3 so as to adjustably control the concentration of the brewed tea . through the heat preservation process , the brewed tea in the tea infusing container 3 will be kept at a predetermined temperature to ensure the hot brewed tea being served for the user . as shown in fig4 , a tea maker according to a fourth embodiment illustrates an alternative mode of the third embodiment , wherein the tea maker comprises a tea infusing container 3 with a container lid 31 , a control circuit , and a tea basket 4 with a basket lid 41 disposed in the tea infusing container 3 . a handle 35 is provided at the tea infusing container 3 , wherein the armature 112 is provided at the bottom side of the tea basket 4 , i . e . underneath the tea basket 4 . the coil assembly 111 is provided at the bottom side of the tea infusing container 3 and is correspondingly aligned with the armature 112 . a through slot of the container lid 31 is coaxially aligned with a through slot of the basket lid 41 to form a sliding channel , wherein a presser 6 is slidably extended through the through slots of the container lid 31 and the basket lid 41 along the sliding channel . accordingly , the presser 6 , which is a tubular member , has a bottom portion of the presser 6 is extended into the tea infusing container 3 and is pressed against the bottom side of the tea basket 4 . two vertical supports 12 are spacedly extended from the bottom side of the tea infusing container 3 to slidably extend through the bottom side of with the tea basket 4 . in particular , the tea basket 4 has two tubular sleeves 122 extended from the bottom side of the tea basket 4 , wherein the vertical supports 12 are slidably extended through the tubular sleeves 122 respectively to enable the tea basket 4 being slid up and down along the vertical supports 12 . two resilient elements 122 are coaxially coupled at the vertical supports 12 respectively , wherein the upper end of each resilient element 121 is biased against the bottom of the tea basket 4 and the bottom end of each resilient element 121 is biased against the bottom side of the tea infusing container 3 . the heater unit 5 and temperature sensor are provided at the bottom side of the tea infusing container 3 . according to the fourth embodiment , the working principle and the operation is shown as follow : ( 1 ) fill up the water : before brewing the tea , the user is able to open up the container lid 31 and remove the tea basket 4 from the tea infusing container 3 by lifting up the presser 6 . therefore , the user is able to fill a predetermined amount of water into the tea infusing container 3 . ( 2 ) place the tea leaves : the user is able to place the tea leaves in the tea basket 4 by opening up the basket lid 41 . once the tea leaves are properly placed in the tea basket 4 , the user is able to close the tea basket 4 by the basket lid 41 and to dispose the tea basket 4 in the tea infusing container 3 . then , the user is able to close the tea infusing container 3 by the container lid 31 . ( 3 ) heat up the water : once the power is on , the user to able to select the setting of heating time or heating temperature on the control panel . therefore , the heater unit 5 is automatically activated for heating up the water in the tea infusing container 3 . ( 4 ) drop down the tea basket 4 : when the temperature sensor detects the water temperature reaching a preset threshold or when the water heating time reaches the preset time , the control circuit will activate the buzzer for generating an audio notification . the user is able to apply a downward force at the presser 6 to drive the tea basket 4 moving downwardly along the vertical support 12 . at the same time , the armature 112 is correspondingly driven downward along the first guiding groove 32 . once the tea basket 4 is dropped down at the preset position , the armature 112 is magnetically attracted to the coil assembly 111 so as to retain the tea basket 4 in position . ( 5 ) rinse the tea leave : ( a ) the tea basket 4 is retained in the boiling water for brewing process . ( b ) after a predetermined of brewing time , the coil of the coil assembly 111 is de - energized to magnetically disengage with the armature 112 , such that the compressed resilient elements 121 will bound to the original form to generate an upward pushing force along the vertical support 12 . ( c ) the user is able to drain out the water in the tea infusing container 3 as the tea rinsing water . ( 6 ) fill up the water again : the user is able to open up the container lid 31 . therefore , the user is able to fill a predetermined amount of water into the tea infusing container 3 . ( 7 ) boil the water : the user is able to select which type of tea leave to brew the tea by selectively pressing a corresponding “ tea type ” button on the control panel . once the “ tea type ” button is pressed , the brewing time and temperature will be automatically set to brew the tea . then , the user is able to press the “ brew ” button , such that the heater unit 5 is also automatically activated by the control circuit for heating up the water in the tea infusing container 3 . ( 8 ) drop down the tea basket 4 : when the water temperature reaches the preset threshold or when the water heating time reaches the preset time , the control circuit will activate the buzzer for generating an audio notification . the user is able to apply the downward force at the presser 6 to drive the tea basket 4 moving downward along the vertical supports 12 . once the tea basket 4 is dropped down at the preset position , the armature 112 is magnetically attracted to the electrified coil assembly 111 so as to retain the tea basket 4 in position . ( 9 ) drew the tea : the tea basket 4 is retained in the boiling water and the brewing time is started to brew the tea . ( 10 ) lift up the tea basket 4 : when the brewing time is finished , the coil of the coil assembly 111 is automatically de - energized to magnetically disengage with the armature 112 , such that the compressed resilient elements 121 will bound to the original form to generate the upward pushing force along the vertical supports 12 . as a result , the armature 112 is correspondingly driven upward by the resilient element 121 . ( 11 ) discharge the brewed tea : when the user wants a cup of tea , the user is able to discharge the brewed water out of the tea infusing container 3 . ( 12 ) heat preservation : when the temperature sensor detects the water temperature below a preset threshold , the heater unit 5 is automatically activated for heating up the water in the tea infusing container 3 so as to retain the brewed tea therein at a predetermined temperature . according to the fourth embodiment , the vertical movement of the tea basket 4 is controlled by the presser 6 that the tea basket 4 can be moved up and down along the vertical support 12 . in addition , the brewing time for the tea basket 4 within the tea infusing container 3 is adjustably controlled that when the brewing time is up , the tea basket 4 is automatically lifted above the water level in the tea infusing container 3 so as to adjustably control the concentration of the brewed tea . through the heat preservation process , the brewed tea in the tea infusing container 3 will be kept at a predetermined temperature to ensure the hot brewed tea being served for the user . according to the present invention , the heater unit 5 can be a heating plate or heating tube . according to the present invention , the tea infusing container 3 can configured to have a circular shape or rectangular shape . or , the tea infusing container 3 can configured to have a flat sidewall integrated with a curved sidewall to form an irregular surrounding wall of the tea infusing container 3 . according to the present invention , when less amount of water is used for brewing tea , i . e . below the top of the tea basket 4 , the basket lid 41 can be omitted to cover at the tea basket 4 . one skilled in the art will understand that the embodiment of the present invention as shown in the drawings and described above is exemplary only and not intended to be limiting . it will thus be seen that the objects of the present invention have been fully and effectively accomplished . it embodiments have been shown and described for the purposes of illustrating the functional and structural principles of the present invention and is subject to change without departure from such principles . therefore , this invention includes all modifications encompassed within the spirit and scope of the following claims .

US-201113697004-A

a tubular medical fluid flow set comprises a pressure sensing chamber connected in flow - through relation to fluid flow tubing of the set . the pressure sensing chamber defines a movable , flexible , impermeable diaphragm dividing the chamber into two separate compartments . the fluid flow tubing communicates with one of the compartments and is isolated from the other of the compartments . a port is carried on the chamber , the port having a seal therein , and communicating with the other of the compartments . thus , the other of the compartments is hermetically sealed until the port is opened for connection with a pressure measuring device , to keep the flexible diaphragm in a desired , initial position prior to opening of the seal .

referring to the drawings , fig1 shows a portion of a venous set 10 for hemodialysis , conventional except as otherwise shown . set 10 is shown to comprise a length of roller pump tubing 11 , which is conventionally attached to one end of pressure sensing pod chamber 12 of this invention . the opposed end 14 of pod 12 may connect to a length of set tubing 16 , which may connect to other set components , which may be of conventional design for an extracorporeal blood conveying set . particularly , tubing 16 may fit within the inner diameter of end portion 14 so that such tubing is of a different inner diameter from that of pump tubing 11 , if desired . thus , pressure pod 12 also includes the function of a connector for joining together tubing of differing diameters in the blood set . similarly , the end 18 of pump tubing 11 may connect through a conventional connector , such as one shown in u . s . pat . no . 5 , 360 , 395 , ( the disclosures of which are incorporated by reference ) to a length of tubing 20 to connect additional , conventional portions of a tubular blood set for hemodialysis or another extracorporeal blood treatment procedure . for both tubes 20 and 16 these may include injection sites , y sites , and end connectors , which may connect in this present embodiment respectively with a dialyzer and the patient , but in other embodiments could connect with a different , extracorporeal blood processing device , or any other conventional connection . fig2 shows an exploded view of pressure pod 12 , comprising a lower compartment - defining portion 22 , an upper compartment - defining portion 24 , and a flexible diaphragm 26 , which defines a convex , central portion 28 shown to be bulging outwardly from the blood flow portion of the chamber . compartment defining portion 22 defines a blood inlet port 30 and a blood outlet port 32 , as well as an access port 34 , which communicates with the interior of the chamber . each of these ports 30 , 32 , 34 may be connected to flexible tubing in a conventional manner . as shown in fig1 , ports 30 , 32 connect with blood flow tubing , while port 34 can connect with tubing 35 which , in turn , may connect with a source of parenteral solution such as saline , or a source of heparin solution , or any other desired or conventional use . tubing 35 connects with the interior of pressure pod 12 through aperture 38 . the three components 22 , 24 , 26 of pressure pod 12 seal together with peripheral , circumferential connection , and may be conventionally bonded together by conventional means such as ultrasound sealing or solvent bonding , the components being made typically of conventional thermoplastic and / or thermoset materials , to form the completed chamber as shown in fig3 to 6 . upper compartment - defining portion 24 as shown in fig2 may be rotated by 180 degrees to form the assembled device shown in fig1 and 4 . thus , flexible diaphragm 26 is shown in the assembled pod 12 as being sealingly mounted within a pressure sensing pod between connections of the blood flow tubing 30 , 32 and a connection port 40 , which may have a seal such as a known valve , or a frangible barrier . port 40 may connect with a length of pressure tubing 42 ( fig1 ), which is thus connected with the interior of upper compartment - defining portion 24 of pressure sensing pod 12 . in fig1 , diaphragm 26 is shown to be occupying its first position as previously described , where diaphragm 26 initially bows outwardly to maximize the chamber volume communicating with the blood flow tubing 11 , 16 . when the blood flow within pod 12 is under negative or subatmospheric pressure , as is the case for portions of set 10 which are upstream of roller pump tubing 11 , a suction is induced on diaphragm 26 , causing it to be urged downwardly toward inlet and outlet ports 30 , 32 in position 26 a . pressure tubing 42 is long enough so that it will reach pressure measuring equipment connector 41 mounted anywhere on the equipment . equipment pressure connector 41 communicates with a pressure transducer 43 as in a conventional hemodialysis machine , for example , communicating by the joined end connector 44 of tube 42 and connector 41 with the air space within tube 42 and above diaphragm 26 . this air space can be sealed when connectors 44 and 41 are joined , so that air neither is added to nor escapes from the volume of air present . thus , as suction from the negatively pressurized blood below diaphragm 26 is exerted , an expansion of the fixed volume of air described above takes place , which will allow diaphragm 26 to move downwardly until the negative ( subatmospheric ) pressures on both sides of the diaphragm are balanced . thus , the air pressure in tube 42 will match the pressure of the blood below diaphragm 26 , and that air pressure can be sensed by pressure sensor 43 , and reported by an appropriate signal on preferably a moment - by - moment , real time basis , as is important in the field of extracorporeal blood handling . fig4 shows how diaphragm 26 can be moved to its second position 26 a , in which it bows inwardly with respect to the blood flow path , to significantly reduce the blood volume in chamber 10 . diaphragm 26 may be initially held in this position for the measurement of positive , super - atmospheric pressures in the blood flow path 46 , where increases in pressure urge diaphragm 28 outwardly from near the second position 26 a ( fig4 ) toward the first position 26 ( fig1 ). however , as before , this movement is resisted by the fact that there is a constant amount of air the space 48 above diaphragm 26 and in pressure tube 42 . the air pressure in pressure tube 42 equals the blood pressure in flow path portion 46 , with diaphragm 26 moving to make it so , so that the blood pressure can be monitored by transducer 43 while the unsterile pressure connectors 41 , 44 remain remote from any blood , being conventionally carried on the face of a dialysis machine or the like at a position spaced from the arrangement of the roller pump , pump tubing 11 , and chamber 12 . because of the presence of pressure tubing 42 , which extends to connector 41 and pressure transducer 43 , wherever it may be located on or in the dialysis machine , it is possible to shorten the overall length of the blood tubing 16 , 11 , 20 , which is desirable for reasons stated above . the lower compartment portion 22 of pod 12 has a bottom wall which defines a transverse channel 50 , which extends between blood inlet port 30 and blood outlet blood port 32 . channel 50 is shown to be of u - shaped cross - section , being substantially aligned with , and having a size similar to , the inner diameter of the blood flow port 30 , 32 and the tubing which they carry , to provide efficient fluid flow , even when diaphragm 26 is in its second position , as shown in fig4 as diaphragm 26 a . the presence of channel 50 assures that there will not be major blocking of blood flow when diaphragm 26 is in its second position . when the extracorporeal blood processing procedure is complete , it is necessary to rinse the blood back to the patient in a step known as “ rinse back .” to accomplish this , pressure tubing 42 may be disconnected from the pressure monitor transducer 43 , and the portion of the set which draws blood from the patient can be removed from the patient . then , pressure tubing 42 is connected with a conventional syringe 52 ( fig1 ), which is depressed to add air or other fluid to the system to cause diaphragm 26 to assume its second position as shown in fig4 ( 26 a ). a slide clamp 54 or other type of clamp then may close off pressure tubing 42 , to keep diaphragm 26 under pressure and firmly in its second position 26 a during the rinse back process , so that the blood containing volume of pod 12 is minimized . saline solution or the like flows into the system through an access site such as parenteral solution line 35 , to replace blood in the set with saline solution , and to return blood back to the patient through the remaining patient connection . alternatively or additionally , saline solution may be added to the separated end of the set of set portion 16 for rinseback , to terminate the procedure . thus , by one embodiment of this invention , blood pressure in a blood flow tube may be monitored through a length of pressure tubing 42 connecting to a diaphragm pod 12 as described , with the diaphragm being positioned near a first position that essentially maximizes the blood holding volume in the pod , although varying , for example negative , pressures in the chamber can result in differing positions of the diaphragm . then , at the end of the extracorporeal blood flow procedure , pressure sensing pod 12 may be pressurized to move diaphragm 26 to its second position 26 a , to cause the blood holding volume of the pod to be substantially minimized , without blocking flow through the blood flow tube and pod . parenteral solution such as saline is then passed into the tube and pod to replace the blood , while the blood is returned to the patient . referring to fig7 - 11 , another embodiment of the invention is shown for an extracorporeal system for hemodialysis . arterial set 60 , for removing blood from the patient , comprises a connector 62 for connection with a patient fistula . a length of flexible tubing 64 communicates with an injection site 66 which , in turn , is directly connected to a pressure sensing pod 68 , similar to that shown in fig8 . pressure sensing pod 68 connects with pump tubing 70 , having a larger diameter than tubing 64 . tubing 70 , in turn connects with a connector 72 for connection with lesser diameter blood flow tubing 74 , which , in turn , connects with dialyzer 76 . the dialysis solution flow lines are eliminated for clarity of disclosure . solution line 69 connects with pod 68 in a manner similar to line 35 of fig2 . dialyzer 76 , in turn , connects directly to a connector 78 , of conventional design , which , in turn , connects directly to another pressure sensing pod 80 of a type disclosed in fig8 and other drawings . thus , pressure sensing pod 80 can be disconnected from dialyzer 76 to permit reuse of dialyzer 76 , coupled with disposability for pressure sensing pod 80 and the connected venous set 82 . connector 78 may be an appropriate threaded , locking connector or the like , preferably one that meets the din specifications or any other means for a secure connection , including an adhesively bonded connection , to dialyzer 76 via its conventional connector 77 . pressure sensing pod 80 connects with blood flow tubing 84 which , in turn , connects with an air trap chamber 86 which may be conventional , for example of a design similar to that disclosed in u . s . pat . no . 6 , 517 , 508 , the disclosures of which are incorporated by reference , in which bubbles are separated by centrifugal flow without suction of the bubbles downwardly by the formation of a vortex . preferably , air trap chamber 86 may be operated with no upper liquid level or airspace for a completely airless extracorporeal system , but for bubbles collected . tubing 88 connects to the bottom of air trap chamber 86 at one end , and connects to a conventional patient fistula connector 90 . connector port 87 is also provided . turning to fig8 , an exploded view of pressure sensing pod 80 is shown , the structure of pressure sensing pod 68 being also similar to it , except for the elements to which it is connected . pressure sensing pod 80 defines a lower compartment portion 22 a , generally similar to the embodiment shown in fig2 , including the bottom flow groove 50 a similar to groove 50 . diaphragm 26 a is generally of similar design to diaphragm 26 , having a bulge 28 a of slightly different design . pressure sensing pod 80 is then closed with upper compartment portion 24 a , the peripheries of the portions being sealed together in a conventional manner . port 112 may be used for testing in manufacturing , and may be sealed with an amount of sealant 114 . pressure sensing pod 80 carries sealed port 116 , which may be generally of the design of a female luer lock connector , having lugs or screw threads 118 in conventional manner , or other sealing and / or locking means . port 116 is sealed by partition 120 , so that the volume 92 , which is spaced by diaphragm 28 a from flow ports 30 a , 32 a , is hermetically sealed when the periphery 94 of pressure sensing pod 80 is sealed . partition 120 has a peripheral connection with lumen wall 96 of sealed port 116 . the pressure sensing diaphragm in pod 80 defines a dome 28 a which has a maximum depth 29 of about 6 - 7 mm . ( such as 6 . 3 mm ), and a width of the chamber defined by the dome of about 23 - 25 mm ., specifically 24 mm . as shown particularly in fig9 , partition 120 has a 360 ° peripheral connection with lumen wall 96 , with a major portion 98 of the peripheral connection being relatively thin , typically a film of sealing material about 0 . 2 to 0 . 4 mm thick . this thin , frangible peripheral band 98 comprises the major portion of the circumference of partition 120 , for example extending from about 270 °- 330 ° of the circumference , specifically about 300 °. at the periphery of the remaining portion of the circumference of partition 120 , a minor portion 100 of the peripheral connection may be thicker , on the order of 1 mm thick , so that it is not frangible but , rather , serves as a hinge to permit partition 120 to pivot as it is broken open by the pressure of an advancing tubular member , such as a male luer lock connector , advancing through lumen wall 96 of connector 116 . additionally , as shown in fig8 and 9 , a first section 102 of partition 120 is positioned adjacent to at least some of the major , thin , peripheral portion 98 . this first section 102 is thicker than the corresponding , opposite section 104 of partition 120 adjacent to the periphery of minor portion 100 . thus , when a tubular connector 106 , as shown in fig1 , is advanced into the lumen of connector 116 , in the normal circumstance when tubular male luer lock connector 106 has a flush , tubular end , it engages first , thickened portion 102 of partition 120 , which is positioned adjacent to major , peripheral portion 98 , to focus rupturing force to at least some of major peripheral portion 98 . thus , inward pressure of tubular connector 106 causes rupturing force that is focused onto at least a portion of the thin , major , peripheral portion 98 , causing major portion 98 to rip open . minor peripheral portion 100 , however , is thick enough , typically on the order of 1 mm , to not rip , but rather to bend as a hinge , to open connector 116 . it is accordingly desirable for connector 116 and particularly partition 120 to be made of a material such as polyethylene , which is capable of forming a reliable , strong hinge upon bending at the hinge thickness used . as shown in fig8 , pressure sensing pod 80 is attached to a blood flow connector 78 , and thus may be directly , releasably or permanently connected with an extracorporeal blood processing device such as dialyzer 76 ( fig1 ). connector 78 may be a connector that complies with din standards in a conventional manner . as shown in fig1 , male luer connector 106 may be carried on the end of pressure tubing 42 a in a manner similar to tubing 42 of fig1 , except that pressure tubing 42 a is not shown permanently bonded to pod 80 . thus , pod 80 may be reversibly or permanently attached to a connector 41 ( fig1 ) which communicates with an electronic pressure monitor 43 of the machine . in this present embodiment of fig1 and 11 , tubing 42 a , end connector 44 a , and male luer connector 106 , having locking sleeve 108 , may be reusable for a large number of connections with different pressure sensing pods 80 , since connector 116 communicates with volume 92 inside of pressure sensing pod 80 , which volume is sealed from the blood flow path 31 a , by diaphragm 26 a . thus , sterility does not have to be an attribute of pressure tubing 42 a . this permits the long term or even permanent communication of tubing 42 a and electronic pressure sensing device 43 , wherever remotely located on the machine , and its sequential use with a large number of separate blood flow sets , such as that of fig7 . saline line 69 of set 60 provides a connection with pressure chamber or pod 68 in a manner similar to the saline line connection 34 of fig2 . pressure sensing pod 68 also carries a connector 116 a similar in structure and function to connector 116 . the particular design of partition 120 and sealed connector 116 and other disclosed designs , may be used in other modes of use for medical fluid flow sets , for example , as a sealed port for a y or t connector , or a connector to another kind of pod or chamber for any of various uses . the connectors disclosed may be connected to a pump tubing segment connector 72 to receive a heparin branch line ( not shown ), and / or the connectors may be carried on arterial inlet connectors to receive an attachable injection site . in this way , branch tubing components of the blood set can be reduced or eliminated , for cost savings . referring to fig1 - 17 , a diaphragm chamber or pod 80 a is similar to chamber 80 except as otherwise described . pod 80 a carries a sealed port 116 a , similar to port 116 , attached to pod 80 a , and generally of the design of a female luer lock connector , having lugs or screw threads 118 a in conventional manner or other sealing and / or locking means . port 116 a is sealed by partition 120 a , so that the volume 92 a which is spaced by the diaphragm of pod 80 a ( similar to diaphragm 28 a in the previous embodiment ) is hermetically sealed when the periphery of pod 80 a is sealed , as in the previous embodiment . partition 120 a has a peripheral connection with the lumen - defining wall 96 a of port 116 a . as shown particularly in fig1 , partition 120 a has 360 degree peripheral connection with lumen wall 96 a , with a diametrically opposed pair of peripheral , thin walled tear lines 130 , being positioned adjacent to lumen wall 96 a and comprising a major portion of the circumference of partition 120 a . these tear lines are relatively thin , comprising lines partition wall of material typically about 0 . 2 - 0 . 4 mm thick , depending of course upon the particular plastic used . these thin , frangible peripheral tear lines may extend , for example , at least about 250 degrees of the total circumference , and typically no more than about 340 degrees . partition 120 a also defines a similarly thin - walled tear line 132 extending substantially as a diameter across partition 120 a , to generally bisect partition 120 a by separating it into two , generally similar halves . at the periphery of the remaining portions of the circumference of partition 120 a , minor portions of the periphery 134 , which are the remaining portions of the circumference , may be thicker than portions 130 and 132 , being generally on the order of 1 mm thick or more , so as not to be frangible , but , rather , to serve as hinges to respectively permit the two halves of partition 120 a on either side of central , thin tear line 132 to pivot as partition 120 a is broken open by the pressure of an advancing tubular member such as male connector 136 , which may be connected to pressure connection tubing 138 , for similar purpose as tubing 42 , 42 a , or for any other desired medical purpose . connector 136 may define a projecting , frustoconical sealing member 140 which mates in the manner of a luer connector with tapered , frustoconical lumen wall 96 a . projecting member 140 further carries a partition opening member 142 at its forward end , which , in turn , may comprise a frustoconical member of greater wall angle to the axis of connector 136 , or it may comprise a pointed member with open lumen flow ports positioned beside it , or any member which can press against partition 120 a to rupture lines 130 , 132 , to open partition 120 a . thus , instead of a thickened partition broken by a regular male luer or other tube having a flush end , as in the previous embodiment , in this embodiment , a partition is provided without thick sections ( but having the thinned tear lines 130 , 132 ) and which uses an extension 142 on a male connector 140 to break partition 120 a . this has advantage when one does not want a regular male luer lock connector or the like to mistakenly access the device , since it can be formed so that a male connector engages and seals with frustoconical lumen surface 96 a before the male luer can reach partition 120 a to press it , to cause possible premature opening . thus , a special set with a special connector 136 may be required to open sealed port 116 a . this special male connector 136 is carried on the end of pressure tubing 138 , which may be similar to pressure tubing 42 a of fig1 , except that pressure tubing 138 is not permanently bonded to pod 80 a and upper compartment portion 92 a , and may be reversibly or permanently attached to a pressure port similar to port 41 , which communicates with an electronic pressure monitor 43 of a pressure measuring machine . in the embodiment of fig1 - 17 , tubing 138 and special male connector 136 , having locking sleeve 143 , may be reusable for a large number of connections with different diaphragmatic chambers or pods 80 a , since connector 116 a is sealed from the blood flow path by its diaphragm . sterility thus does not have to be an attribute of pressure tubing 138 ( or tubing 42 a ), permitting the long term and even permanent connection of tubing 138 to electronic pressure sensing system 41 , 43 , wherever remotely located on the machine , such as a dialysis machine . thus , a significant economy may be achieved by the sequential use of tubing 138 and connector 136 with a large number of separate blood flow sets . referring to fig1 and 19 , a pod 150 , defining a chamber 152 and a flexible diaphragm 154 , defining a dome in a manner similar to those of previous embodiments such as diaphragm 26 , is disclosed . pod 150 may be used in a manner described with respect to pods of the previous embodiments , being connected through tubular connectors 156 , 158 to tubular components of an extracorporeal blood set , or directly connected at one of the connectors 156 , 158 to a dialyzer or the like , as previously described . port 160 is provided , being for a similar purpose as is port 116 , 116 a of the previous embodiment , carrying a partition 163 , which may be of design similar to the partitions of the previous embodiments and for similar purpose . it can be seen that pod 150 is elongated , and in some embodiments of this invention , the length of pod chamber 152 along its longest axis 153 may be at least twice its width 162 . this provides a greater volume to pod 150 compared with a round pod having a diameter similar to the width 162 of pod 150 . the dome of diaphragm 154 can flip back and forth in a manner described with respect to previous embodiments , and thus , the overall volume of the air side 164 of the chamber and go from essentially zero as shown in fig1 to a volume which is at least 2 . 5 cc , preferably 3 . 0 cc ., and specifically more than 3 . 2 cc ., typically , so that an air volume of that amount can form when flexible diaphragm 154 is displaced to its maximum position on the right of fig1 , to minimize the volume of blood compartment 166 in pod 150 , for the advantages previously discussed . thus , as flexible diaphragm 154 flips its dome between its two positions , there is a volume displacement , displacing at least 2 . 5 cc . of air and typically greater amounts as specified above . this amount of displacement assures that a broad pressure range in pod 150 can be monitored despite using a lengthy tube several feet in length which connects port 160 with a pressure transducer mounted within a pressure sensing component of , for example , an extracorporeal blood processing machine , as in previous embodiments . specifically , it is desirable for the system to be able to register a range of 500 mmhg of positive pressure to minus 250 mmhg of reduced or negative pressure without the dome of diaphragm 154 coming into contact with a wall of pod 150 so that it can no longer move its position responsive to pressure change . it can also be seen that stretching of the elastomer of diaphragm 154 is minimized by the dome configuration as the dome moves back and forth . in fact , in some embodiments , flexible but non elastomeric materials may be used for the dome 154 . specifically , to achieve the desired volumes in a small pod , the width 162 of diaphragm 154 ( essentially the same as the chamber width ) should be at least twice the depth 168 of the dome of diaphragm 154 and in some embodiments the width 162 should be at least three times the depth 168 of dome 164 . this helps to provide a blood flow path , having a maximum thickness which is not too deep , causing a risk of blood stagnation and clotting , while at the same time providing an adequate amount of air displacement on the air side of diaphragm 154 so that a wide range of pressures can be measured . the above has been offered for illustrative purposes only , and is not intended to limit the scope of the invention of this application , which is as defined in the claims below .

US-201313928454-A

a nurse receiver header for an agricultural planting implement is cooperable with a nurse mechanism that conveys seeds entrained in an air stream from a central hopper . a receiver is positioned at the planting mechanism to receive the seeds entrained in the air stream and accumulate a supply of seeds for utilization by the associated planting mechanism . the receiver header includes a plurality of legs and a rotatable baffle positioned internally at an uppermost position of at least one leg of the receiver header . the baffle is pivoted by an external lever that is positioned in the same orientation as the baffle to indicate the position of the baffle . the header can be placed in a closed configuration by positioning the baffle across the leg to be blocked . when in an open configuration , the baffle is positioned parallel to the leg and all of the legs of the header are open .

referring first to fig1 - 4 , the principles of the nurse induction apparatus can best be seen . the nurse inductor 20 enables the use of a standard air cart 10 for both the central hopper and the nurse system air source . the air cart fan can be used for both fertilizing and nursing operations simultaneously . the inductor 20 can be designed in an adapter arrangement which enables the air cart 10 to be readily converted from a roller type volumetric metering system to the nurse inductor system , and vice versa . such nurse mechanisms are described in , e . g ., u . s . pat . nos . 6 , 289 , 830 , 6 , 298 , 797 , and 6 , 267 , 067 , to mayerle et al ., the contents of which are incorporated herein by reference in their entirety . the nurse induction adapter is mounted on a conventional air seeder or air cart , and redirects the air stream 13 coming from the fan 11 in an air cart meter box 16 into a path that leads through the nurse inductor 20 . the air stream is guided into a nozzle region 30 that directs the air along a flow path that tangentially engages a pile of seed particles s exiting the opening 19 at the bottom of the seed hopper 12 . the turbulence of the blast of air from the nozzle 30 loosens the seed particles from this assemblage of seed particles s exiting the opening 19 in the bottom of the seed hopper 12 , entraining the individual seed particles into the air stream as it follows a path to the distribution lines 22 above the seed particle pile . the individual seed particles remain suspended in the air stream where the air bleeds off and the individual seed particles fall by gravity into a second pile or mass at the planting mechanism . as best seen in fig3 - 7 , the air stream 13 through the nurse inductor apparatus 20 is split at the general location of the seed particle mass at the bottom of the central seed hopper 12 on the air cart 10 into individual sections 31 that are isolated by generally vertical walls 32 . each individual section 31 leads to a different seed distribution tube 22 and , ultimately , to a different receiver header 45 and associated receivers 40 . the nurse inductor 20 induces seed particles into the air stream when and where there is demand for the particles . the demand for particles is controlled by the level of product in each respective receiver header on the output end of the seed distribution tube . in smaller planting systems , the primary nurse lines 22 run directly to the receivers 40 without benefit of a receiver header 45 . the nurse inductor 20 induces seed particles into the air stream when and where there is demand for the particles . the demand for particles is controlled by the level of product in each respective receiver 40 or receiver header 45 on the output end of the seed distribution tube . when the receiver header 45 is full , air is restricted from escaping from the seed distribution tube by the massed seed particles within the seed distribution tube . as a result of the filled receiver header 45 , which prevents the passage of air there through , the air flow and air velocity reduce due to increased pressurization of the line . this resultant reduction in potential air pressure reduces the capacity of the flow of air to induce the seed particles into the corresponding seed distribution tube 22 . since the flow of air through the nurse inductor 20 is spread across the entire unit , the flow of air will tend to go to the lines that have open receivers because of the less airflow resistance . the divider walls 32 , that separate the air and entrained seed particle flows to each respective seed distribution tube 22 , are sealed such that air cannot get into the seed distribution tubes 22 downstream of the pickup area . the sealed vertical walls 32 also prevent cross over of air and entrained seed to different seed distribution tubes 22 . this division of airflow enhances operation since each line is operable to run at different times , depending on demand as represented by the massed seed particles in the output end of the seed distribution tubes 22 . the shape of the air and entrained seed particle flow path has an impact on the performance of the inductor . when the receiver 40 or receiver header 45 is filled , only a small volume of air flows through the receiver and seed delivery is stopped . air is still capable of traveling through the lines , through the massed seed particles , and past the seed particles at the vent . if seed particles were to be allowed to be induced into the lines with airflows that are less than carrying velocity , a blocking of the seed distribution tubes 22 can occur . this problem of blocking the seed distribution tube 22 can be avoided by forming the portion of the inductor structure , just above the area adjacent to the bottom of the central seed hopper where the individual seed particles are entrained into the airflow , larger so that the air velocity slows down in this region . with the slowed air velocity , any seed particles that had been entrained into the slow flowing air stream fall out of the airflow and are dropped back into the seed particle mass region . thus , the seed particles are picked up and carried by the air stream only when the air velocity is above the minimum carry velocity , thereby allowing air to be flowing slowly without transporting any entrained seed particles into the full seed distribution tube . correspondingly , the cross - sectional area of the seed distribution tubes is smaller than the cross - sectional area between the generally vertical walls dividing the plenum into discreet channels . as a result , the air velocity increases once entering the seed distribution tube , allowing the seed particle to be retained within the air stream once it enters the seed tube . the regulator 25 for the flow of seed particles into the area for entrainment within the air stream is defined by a movable gate 29 forming a common edge along which seed particles flow into the particle pick - up area . the product regulator 25 extends across the entire nurse induction apparatus 20 . as the seed particles flow under the product regulator , the seed particles form a pile falling naturally at the angle of repose of the seed particles . the angled surface of the pile of seed particles forms the bottom wall of the air channel in the pick - up area . the proximity of the air nozzle 30 to the wall of product affects the amount of product carried in the air stream . as the regulator 25 is rotated and more or less product is permitted to pass through the opening 19 a at the bottom of the central seed hopper 12 , the seed particles fall either closer to or farther from the air nozzle 30 . since different products , such as different seed types , have properties that affect how easily the air stream picks them up , as well as the differences in the angle of repose at which the products slump , the ideal distance between the product surface and the air nozzle varies with the product being distributed . the product regulator 25 is adjustable to enable the optimum distance to be set for each product type , as well as the desired flow rate . as the air stream 13 strips the product away close to the bottom of the product regulator 25 , product from the hopper 12 replenishes the created cavity . the closer to the bottom of the regulator 25 the product is stripped away , the more quickly the product is replenished . thus , when the regulator 25 is positioned correctly for the specific type of product being nursed , the induction of product into the air stream is relatively steady . during testing , it was found that steady induction of product into the air stream reduced plugging problems within the distribution tubes 22 while maximizing product delivery efficiency . the product regulator 25 is located on the hopper side of the induction box so that it does not interfere with the seal of the divider walls 32 . the product regulator 25 is formed as a single crescent shaped plate 29 that extends across the entire width of the induction unit 20 . the regulator plate 29 is attached to a shaft that is rotated by an external handle 28 . thus , the flow of product across the induction box is controlled with the adjustment of a single handle 28 . as a result , the flow rate of seed particles can be controlled for all of the tubes 22 simultaneously , and can be completely shut - off to permit clean - out during which process the air will still be guided through the distribution tubes 22 without carrying seed particles . the rotatable regulator plate 29 can be adapted easily for remote control by appropriate actuators connected to the regulator 25 . such a configuration is particularly advantageous in precision farming practices , as the flow of seed particles through the seed distribution tubes 22 can be turned on and off easily . alternatively , the inductor box 20 could be configured to control the flow of air through the nozzle 30 instead of the flow of seeds . the generally vertical divider walls 32 are constructed such that the nurse inductor apparatus is made in pair segments that are stacked to fit the width of the induction box . the vertical nature of this modular design allows the inductor apparatus to be compact . the modularity of such a design allows the nurse inductor to be easily adapted to different widths and numbers of product lines , including a compact induction box width having a large number of product lines . to allow more space on the particle hopper side of the inductor unit , the distribution tubes 22 forming the outlet pipes are stacked in vertical pairs . the additional space between outlet pipes reduces bridging of the particles as they flow past the pipes and into the region of the product regulator 25 . each distribution tube 22 is independent . the walls 32 dividing the distribution tubes are curved to direct the air and entrained seed particle stream as shown in fig5 . the air and entrained seed make relatively small directional changes in the inductor apparatus , which improves the efficiency of the air system . this efficiency enables both the nursing of more than 12 rows and the use of the second air cart tank for simultaneous fertilizer operations . alternatively , the nurse induction unit 20 is adaptable for use with a stand - alone tank , as well as for with an air cart . furthermore , the nurse induction unit 20 can also be adaptable to other planter units . as best seen in fig1 and 2 , the nurse induction apparatus is preferably formed as a modular unit that can be inserted into a standard air cart structure to convert the air cart from a straight meter box into a nurse induction box . the conventional air delivery tubes 17 are sealed and remain on the air cart 10 , while the nurse induction unit 20 is interposed to receive the air stream 13 from the fan 11 . a connection mechanism 16 facilitates the convenient connection of the nurse unit 20 to the air cart 10 as a modular component . one skilled in the art will recognize that the present invention is not limited to the conveyance of seed particles , as other particulate matter is commonly distributed through an air cart system , such as fertilizer . furthermore , the typical air cart 10 is provided with multiple hoppers or tanks containing different product to be planted in the ground . one tank could have seed stored therein , while another tank would have fertilizer and yet another tank could have herbicides or still another reservoir of fertilizer . in such multi - tank configurations , one of the tanks could be provided with a nurse induction unit 20 to convey seeds to the planting devices , while a conventional meter box is used to control the flow of fertilizer or other product to the planting devices by separate distribution tubes . such a conventional meter box could apply the fertilizer or other product at a variable rate and could be controlled by an electronic controller , as is known for precision farming techniques . other alternative configurations can include one tank nursing seed to all the singulators , as well as multiple tanks nursing seeds to any one particular singulator . referring now to fig8 - 18 , the nurse system receiver 40 and receiver header 45 can best be seen . the receiver 40 and receiver header 45 are used in conjunction with the nurse inductor system 20 , such as the one described above . one skilled in the art will recognize that the header 45 is needed in configurations where the flow is to be split between multiple receivers . the nurse inductor 20 sends an air and entrained particle stream to the receiver header 45 when the receiver header 45 has less than a desired level of product particles in it . the receiver header 45 is designed to allow air from the air and entrained particle stream to escape when the particle level is below the air vent 50 , but to limit the amount of air to escape when the particle level is above the air vent 50 . the nurse line 22 leading to the header 45 is smaller than the lines 42 between the header and the receiver 40 to reduce the velocity of the air flow at the receiver header 45 , thus allowing the entrained seed particles to drop out of the air stream and fall by gravity to the receiver 40 . to stop particle blocking in the nurse line 22 , the receiver header 45 is mounted such that the inlet line 48 is always vertically above the outlet lines 42 , regardless of the position of the implement . moreover , the header 45 never inverts , so the seed particles stay in the receivers 40 when the implement is moved between operating and transport positions . in operation , the seeds are massed in the receiver 40 and in the line 42 from the receiver 40 up to the receiver header 45 , which is formed of two legs 46 , 47 in fluid communication with an inlet line 48 . as shown in fig1 , a rotatable baffle 63 a is located in the header y to enable an operator to close off one leg of the header 45 . the baffle can be operated in the header 45 by an external lever 63 that is pivotable at a pivot 61 . the external lever 63 is positioned in the same orientation as the baffle . therefore , the position of the external lever 63 also designates the position of the rotatable baffle . if the operator desires both legs of the header 45 to be operational , such as for narrow row plantings , e . g ., 15 inches apart , the header 45 can be placed into the open configuration by positioning lever 63 such that it is parallel with leg 47 . in the open configuration , the seed particles are directed into both leg 46 and leg 47 of the header 45 . the receiver 40 , as best seen in fig1 - 13 , provides a small mass of seeds in the location of the singulator meter &# 39 ; s pickup area 41 . in the open configuration , when the seeds are accumulated up to the top of one leg , e . g ., leg 46 , they block the flow of air through the air vent 50 near the header bottom . when the air does not flow freely through the air vent 50 , the flow of seeds from the nurse inductor unit diminishes . only the small flow of air that can escape through the seeds and vent 50 will continue to flow . this airflow is too low to entrain or pick up seeds . if only one leg is full , seeds will continue to be nursed into the empty leg , e . g ., leg 47 , until the air vent 50 is covered in the second leg . then , the airflow to the header 45 will drop off and seeds will not be sent in the nurse line 22 until such a time that one of the receivers 40 empties the receiver header 45 below the air vent 50 . the vent hood 52 makes a roof over the vent 50 to allow the air to be vented out and guard against rain and contaminants getting in . the orientation of the receiver header 45 always keeps the hood 52 opening facing down , even when the toolbar is rotated into the transport configuration . in an alternative embodiment , the vent and rain guard may be incorporated directly into the receiver design if a separate header is not desirable . alternatively , if the operator desires to plant in wide rows , e . g ., 30 inches apart , the rotatable baffle 63 a can placed into the closed configuration by positioning the external lever 63 such that it is positioned across leg 47 . as discussed above , the position of the external lever 63 indicates the position of the rotatable baffle 63 a . in this closed configuration , all of the seed flowing from the receiver 40 is directed into leg 46 of the header 45 . by blocking the flow of air to leg 47 , seeds are not unnecessarily placed in an unoperational unit . as shown in fig1 - 16 , the lever 63 on the outside of the header 45 is designed to allow only one leg of the header 45 to be shut off . however , the header 45 can be mounted on either the top or the bottom surface to allow either the left or right side ( i . e ., leg 46 or 47 ) to be controlled . furthermore , because lever 63 indicates the position of the rotatable baffle 63 a in the header 45 , the operator can quickly go across the implement and determine the baffle position for appropriate seed placement into the field ( i . e ., narrow or wide rows ), or quickly change from a narrow seed placement to a wide seed placement and vice versa . it should be noted that although a two legged header is described herein , other embodiments of the receiver header 45 would use the header in triple or other variations . for example , the triple configuration would be similar to the double configuration described above with the addition of another leg and another baffle . a preferred embodiment for use with smaller planters using a parallel distribution system ( i . e ., where a primary nurse line runs directly to a receiver ) includes an internally reconfigured inductor box so that seed cannot be picked up and delivered to inactive receivers , singulator meters , or row units . an internal baffle covers the entry to the inactive rows , thereby preventing the product to be picked up . an external lever corresponding to the internal baffle position allows the operator to determine the operational position . because one lever adjusts the position / operation of many lines , there is only one simple , central adjustment necessary to activate or inactivate rows . in a second preferred embodiment for use with smaller planters using a parallel distribution system , a valve , such as a ball valve , is located on distribution tubes associated with inactive rows during wide row planting to stop airflow in the tube . typically , the ball valve is actuated by a lever . when the valve is closed , air is not permitted to flow through the distribution tube , and , as a result , no seed is delivered to the receiver header and associated receiver . because air and entrained seed is not permitted to flow through a particular distribution tube , the seed cannot enter the tube or plug the tube . the lever on the ball valve serves as an indicator for the operator to quickly determine whether the distribution tube is open or closed . referring now to fig1 - 21 , an alternative embodiment of the present invention for use in a series planting system can best be seen . in a series planting system , as shown in fig1 - 20 , a single primary line 50 directs seed to an entire row of receiver headers 55 . the headers are formed of a first leg 56 and a second leg 57 in fluid communication with an outlet line 58 . when narrow row spacing is desired , a baffle 59 located at the interface of legs 56 and 57 and outlet line 58 is in an open configuration where the baffle 59 is positioned by an external lever ( not shown ) to a position parallel with the outlet line 58 ( shown in phantom ). the baffle is pivotable about pivot point 66 . in this open configuration , seed flows from the hopper 51 through the primary line 50 to headers 55 , where a portion of the seeds flowing through line 50 is diverted through outlet line 58 and into storage bins 53 . seeds flow into the bins 53 until all the bins 53 are filled with seed . when all of the bins 53 are filled with seed , the operator is able to start planting on a narrow row spacing . on the other hand , if an operator wishes to utilize the parallel system illustrated in fig1 and 20 to plant in wide rows , he simply shuts off the desired headers 55 by actuating the baffle 59 located in outlet line 58 such as by the external lever ( not shown ) to close off outlet line 58 . air and entrained seed is therefore not permitted to flow down the closed outlet line 58 , and will continue down the primary line 50 to the next header 55 . as described above with respect to the parallel distribution systems , the lever indicates the position of rotatable baffle 59 in the header 55 . as a result , the operator can quickly determine the baffle position for the appropriate placement of product into the field ( i . e ., narrow or wide rows ), or quickly change from a narrow seed placement to a wide seed placement and vice versa . the invention of this application has been described above both generically and with regard to specific embodiments . although the invention has been set forth in what is believed to be the preferred embodiments , a wide variety of alternatives known to those of skill in the art can be selected within the generic disclosure . the invention is not otherwise limited , except for the recitation of the claims set forth below .

US-40966403-A

carbonates and carbamates of the formula and related steroid carbonates and carbamates are disclosed . the compounds are useful for treating rhinitis and asthma , particularly by inhalation , and for treating inflammation , particularly by local or topical administration .

in which the substituents are as defined above . in preferred embodiments the steroid has the absolute stereochemistry shown : examples of steroids having the foregoing structure include budesonide , ciclesonide and triamcinolone . the most preferred embodiment comprises compounds of formula : wherein r 7 is hydrogen or lower alkyl ; and r 8 is lower alkyl . in particularly preferred embodiments , r 4 is c 11 to c 14 alkyl , c 12 to c 24 alkyl , c 12 to c 20 alkyl , c 7 to c 24 alkyl , c 8 to c 24 alkyl , c 9 to c 24 alkyl , c 10 to c 24 alkyl , c 11 to c 24 alkyl , c 8 to c 18 alkyl , c 10 to c 16 alkyl or c 8 to c 20 alkyl . in preferred embodiments the steroid is budesonide , ciclesonide or triamcinolone . budesonide dodecyl carbonate is most preferred . in embodiments in which r 3 is — or 4 and r 4 is —( c 7 to c 24 hydrocarbon )- nr 9 r 10 , it is preferred that the total number of carbons in r 3 be eight to twenty - four . similarly , in embodiments in which r 3 is — nr 5 r 6 , it is preferred that the sum of the number of carbons in r 5 plus the number of carbons in r 6 be seven to twenty - four . the underlying guideline is that the total number of carbons in the residue r 3 is optimally seven to twenty - four , but an amino function could be interposed at any point that results in an r 3 residue that is chemically stable in combination with the adjacent o ( c ═ o ) residue . and r 6 is c 11 to c 14 alkyl , c 12 to c 24 alkyl , c 12 to c 20 alkyl , c 7 to c 24 alkyl , c 8 to c 24 alkyl , c 9 to c 24 alkyl , c 10 to c 24 alkyl , c 11 to c 24 alkyl , c 8 to c 18 alkyl , c 10 to c 16 alkyl or c 8 to c 20 alkyl . alkyl is intended to include linear , branched , or cyclic hydrocarbon structures and combinations thereof . preferred alkyl groups are those of c 7 to c 24 . cycloalkyl is a subset of alkyl and includes cyclic hydrocarbon groups , in this case preferably from 6 to 8 carbon atoms . lower acyl is acyl of one to six carbons , e . g . acetyl , propionyl , isopropanoyl , butanoyl , sec - butanoyl , valeroyl , and hexanoyl . c 7 to c 24 hydrocarbon includes alkyl , cycloalkyl , alkenyl , alkynyl , aryl and combinations thereof . examples include phenethyl , cyclohexylmethyl , camphoryl and naphthylethyl . the compounds described herein contain one or more asymmetric centers and may thus give rise to enantiomers , diastereomers , and other stereoisomeric forms that may be defined , in terms of absolute stereochemistry , as ( r )— or ( s )—. the present invention is meant to include all such possible isomers , as well as , their racemic and optically pure forms . optically active isomers may be prepared using chiral synthons or chiral reagents , or resolved using conventional techniques . when the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry , and unless specified otherwise , it is intended that the compounds include both e and z geometric isomers . likewise , all tautomeric forms are also intended to be included . the graphic representations of racemic , ambiscalemic and scalemic or enantiomerically pure compounds used herein are taken from maehr j . chem . ed . 62 , 114 - 120 ( 1985 ): solid and broken wedges are used to denote the absolute configuration of a chiral element ; wavy lines indicate disavowal of any stereochemical implication which the bond it represents could generate ; solid and broken bold lines are geometric descriptors indicating the relative configuration shown but denoting racemic character ; and wedge outlines and dotted or broken lines denote enantiomerically pure compounds of indeterminate absolute configuration . the abbreviations me , et , ph , tf , ts and ms represent methyl , ethyl , phenyl , trifluoromethanesulfonyl , toluensulfonyl and methanesulfonyl respectively . a comprehensive list of abbreviations utilized by organic chemists ( i . e . persons of ordinary skill in the art ) appears in the first issue of each volume of the journal of organic chemistry . the list , which is typically presented in a table entitled “ standard list of abbreviations ” is incorporated herein by reference . the term “ methods of treating ” when used in connection with the present invention means amelioration , prevention or relief from the symptoms and / or effects associated with asthma and rhinitis . the person of ordinary skill in the medical art recognizes that “ prevention ” of the symptoms and / or effects associated with asthma and rhinitis is not an absolute term . in the medical art it is understood to refer to the prophylactic administration of a drug to substantially diminish the likelihood or seriousness of the condition . the compounds of the invention are useful for treating copd , asthma and rhinitis . they are also useful for intra - articular injection for alleviating the joint pain , swelling and stiffness associated with rheumatoid arthritis and osteoarthritis with an inflammatory component ; also for bursitis , epicondylitis and tenosynovitis . they may be used topically , transdermally and intradermally ( intra - lesional ) in lichen simplex chronicus , granuloma annulare , lichen planus , keloids , alopecia areata , discoid lupus erythematosus , localised neurodermatitis , cystic acne , granuloma annulare , nummular and dyshydrotic eczema , and hypertrophic scars ( keloids ). the treatment of macular degeneration with compounds of the invention is analogous to that described in billson , u . s . pat . no . 5 , 770 , 589 , which is incorporated herein by reference . in general , the compounds of the present invention may be prepared by the methods illustrated in the general reaction schemes as , for example , described below , or by modifications thereof , using readily available starting materials , reagents and conventional synthesis procedures . in these reactions , it is also possible to make use of variants that are in themselves known , but are not mentioned here . exemplary syntheses of a budesonide carbonate and a carbamate are shown in schemes 1 and 2 . one skilled in the art will recognize that the syntheses can be adapted to prepare a variety of carbonate or carbamate modified budesonide , ciclesonide , fluticasone or triamcinolone analogs . to the solution of budesonide ( 750 mg , 1 . 74 mmol ) in dcm ( 7 . 5 ml ) was added dodecyl chloroformate ( 513 ml , 1 . 617 mmol ) and et 3 n ( 533 μl , 3 . 825 mmol ) at room temperature . the reaction mixture was stirred at room temperature for 7 hours . during this 7 hours more dodecyl chloroformate ( 510 μl , 1 . 616 mmol ) and et 3 n ( 440 μl , 3 . 18 mmol ) were added . the reaction was followed by hplc . the reaction mixture was poured into water ( 20 ml ) and dcm ( 10 ml ); the aqueous phase was extracted with dcm ( 10 ml ). the combined organic phases were washed with water ( 10 ml ) and brine ( 10 ml ), dried over na 2 so 4 , filtered , and concentrated in vacuo to provide crude budesonide dodecylcarbonate . the product was purified by chromatography , eluted with hexane : acoet = 9 : 1 to 3 : 1 to provide 983 mg of 1 : 1 mixture of epimers ( originated from budesonide ) ( 96 . 78 area % purity on hplc ). 1 h nmr ( cdcl 3 ) δ 0 . 80 - 2 . 25 ( m , 45h ), 2 . 36 ( d , 1h , 13 . 4 hz ), 2 . 58 ( t , 1h , 13 . 2 hz ), 4 . 19 ( t , 2h , 6 . 7 hz ), 4 . 52 ( bs , 1h ), 4 . 6 - 5 . 2 ( m , 5h ), 6 . 03 ( s , 1h ), 6 . 30 ( d , 1h , 10 . 1 hz ), 7 . 29 ( d , 1h , 10 . 1 hz ). 13 c nmr ( cdcl 3 ) δ 14 . 21 , 14 . 38 , 17 . 22 , 17 . 35 , 17 . 50 , 17 . 78 , 21 . 35 , 22 . 94 , 25 . 86 , 28 . 83 , 29 . 45 , 29 . 60 , 29 . 74 , 29 . 80 , 29 . 88 , 30 . 57 , 31 . 24 , 32 . 16 , 33 . 18 , 33 . 68 , 34 . 26 , 35 . 26 , 37 . 36 , 41 . 17 , 41 . 41 , 44 . 24 , 46 . 18 , 47 . 61 , 50 . 01 , 53 . 14 , 55 . 41 , 55 . 52 , 69 . 12 , 69 . 18 , 70 . 11 , 70 . 22 , 82 . 32 , 83 . 57 , 97 . 76 , 98 . 62 , 104 . 88 , 108 . 63 , 122 . 83 , 128 . 24 , 156 . 14 , 169 . 81 , 169 . 92 , 186 . 74 , 202 . 16 and 203 . 46 . mass spectrum ( m / e ) 643 ( m + ). to the solution of budesonide ( 431 mg , 1 . 0 mmol ) in dcm ( 4 . 5 ml ) was added heaxdecyl chloroformate ( 655 μl , 2 . 0 mmol ) and et 3 n ( 512 μl , 3 . 7 mmol ) at room temperature . after reaction mixture was stirred at room temperature over night , it was poured into water ( 20 ml ) and dcm ( 10 ml ); the aqueous phase was extracted with dcm ( 10 ml ). the combined organic phases were washed with water ( 10 ml ) and brine ( 10 ml ), dried over na 2 so 4 , filtered , and concentrated in vacuo to provide crude budesonide hexadecylcarbonate . the product was purified by chromatography , eluted with hexane : acoet = 9 : 1 to 3 : 1 to provide 432 mg of 1 : 1 mixture of epimers ( originated from budesonide ) ( 99 . 38 area % purity on hplc ). 1 h nmr ( cdcl 3 ) δ 0 . 80 - 2 . 40 ( m , 53h ), 2 . 56 ( dt , 1h , 13 . 1 and 4 . 6 hz ), 4 . 30 ( t , 2h , 6 . 7 hz ), 4 . 5 - 5 . 2 ( m , 7h ), 6 . 00 ( s , 1h ), 6 . 26 ( d , 1h , 10 . 1 hz ), 7 . 3 ( d , 1h , 10 . 1 hz ). 13 c nmr ( cdcl 3 ) δ 14 . 16 , 14 . 18 , 14 . 34 , 17 . 10 , 17 . 27 , 17 . 39 , 17 . 71 , 21 . 21 , 22 . 88 , 25 . 81 , 28 . 79 , 29 . 41 , 29 . 56 , 29 . 70 , 29 . 76 , 29 . 87 , 30 . 54 , 31 . 19 , 32 . 11 , 33 . 08 , 33 . 59 , 34 . 23 , 35 . 19 , 37 . 28 , 40 . 68 , 40 . 98 , 44 . 37 , 46 . 08 , 47 . 52 , 50 . 00 , 53 . 07 , 55 . 39 , 55 . 49 , 68 . 98 , 69 . 73 , 69 . 83 , 69 . 95 , 70 . 04 , 82 . 10 , 83 . 38 , 97 . 71 , 98 . 58 , 104 . 70 , 108 . 51 , 122 . 57 , 127 . 91 , 155 . 08 , 156 . 85 , 170 . 48 , 170 . 59 , 186 . 84 , 186 . 88 , 202 . 10 and 203 . 38 . mass spectrum ( m / e ) 699 ( m + ). to the solution of budesonide ( 431 mg , 1 . 0 mmol ) in dcm ( 4 . 5 ml ) was added decyl chloroformate ( 460 μl , 2 . 0 mmol ) and et 3 n ( 512 μl , 3 . 7 mmol ) at room temperature . after the reaction mixture was stirred at room temperature over night , it was poured into water ( 20 ml ) and dcm ( 10 ml ); the aqueous phase was extracted with dcm ( 10 ml ). the combined organic phases were washed with water ( 10 ml ) and brine ( 10 ml ), dried over na 2 so 4 , filtered , and concentrated in vacuo to provide crude budesonide decylcarbonate . the product was purified by chromatography , eluted with hexane : acoet = 9 : 1 to 3 : 1 to provide 348 mg of 1 : 1 mixture of epimers ( originated from budesonide ) ( 99 . 22 area % purity on hplc ). 1 h nmr ( cdcl 3 ) δ 0 . 85 - 2 . 24 ( m , 42h ), 2 . 36 ( dd , 1h , 13 . 4 and 2 . 9 hz ), 2 . 59 ( dt , 1h , 13 . 5 and 4 . 5 hz ), 4 . 18 ( t , 1h , 6 . 7 hz ), 4 . 51 ( s , 1h ), 4 . 6 - 5 . 2 ( m , 5h ), 6 . 03 ( s , 1h ), 6 . 30 ( d , 1h , 10 . 1 hz ), 7 . 49 ( d , 1h , 10 . 1 hz ). 13 c nmr ( cdcl 3 ) δ 14 . 14 , 14 . 17 , 14 . 31 , 17 . 06 , 17 . 24 , 17 . 36 , 17 . 68 , 21 . 19 , 22 . 83 , 25 . 78 , 28 . 76 , 29 . 37 , 29 . 40 , 29 . 66 , 30 . 52 , 31 . 16 , 32 . 04 , 33 . 05 , 33 . 56 , 34 . 22 , 35 . 16 , 37 . 25 , 40 . 58 , 40 . 89 , 44 . 38 , 46 . 06 , 47 . 49 , 49 . 98 , 53 . 05 , 55 . 38 , 55 . 48 , 68 . 90 , 68 . 94 , 69 . 65 , 69 . 75 , 69 . 92 , 70 . 01 , 82 . 05 , 83 . 34 , 97 . 69 , 98 . 56 , 104 . 65 , 108 . 47 , 122 . 51 , 127 . 84 , 155 . 04 , 156 . 96 , 170 . 61 , 170 . 71 , 186 . 84 , 186 . 89 , 202 . 08 and 203 . 37 . mass spectrum ( m / e ) 615 ( m + ). to the solution of budesonide ( 500 mg , 1 . 16 mmol ) in dcm ( 5 . 0 ml ) was added butyl isocyanate ( 144 μl , 1 . 28 mmol ) and dmap ( 312 mg , 2 . 55 mmol ) at room temperature . the reaction mixture was stirred at room temperature for 24 hours . during this 24 hours more butyl isocyanate ( 72 μl , 0 . 64 mmol ) and dmap ( 156 mg , 1 . 27 mmol ). the reaction was followed by hplc . the reaction mixture was poured into water ( 20 ml ) and dcm ( 10 ml ); the aqueous phase was extracted with dcm ( 10 ml ). the combined organic phases were washed with water ( 10 ml ) and brine ( 10 ml ), dried over na 2 so 4 , filtered , and concentrated in vacuo to provide crude budesonide butylcarbamate . the product was purified by chromatography , eluted with hexane : acoet = 9 : 1 to 3 : 1 to provide 560 mg of 1 : 1 mixture of epimers ( originated from budesonide ) ( 99 . 22 area % purity on hplc ). 1 h nmr ( cdcl 3 ) δ 0 . 82 - 2 . 7 ( m , 30h ), 3 . 06 - 3 . 20 ( m , 3h ), 4 . 45 ( m , 1h ), 4 . 58 ( t , 1h , 4 . 5 hz ), 4 . 75 - 5 . 36 ( m , 5h ), 5 . 99 ( s , 1h ), 6 . 24 ( d , 1h , 10 . 1 hz ), 7 . 29 ( d , 1h , 10 . 1 hz ). 13 c nmr ( cdcl 3 ) δ 13 . 98 , 14 . 08 , 14 . 22 , 17 . 09 , 17 . 30 , 17 . 37 , 17 . 73 , 20 . 09 , 20 . 28 , 21 . 26 , 30 . 56 , 31 . 22 , 32 . 11 , 32 . 59 , 33 . 13 , 33 . 65 , 34 . 27 , 35 . 23 , 37 . 34 , 40 . 30 , 40 . 73 , 40 . 99 , 41 . 17 , 44 . 37 , 46 . 09 , 47 . 49 , 50 . 01 , 53 . 15 , 55 . 43 , 55 . 52 , 67 . 82 , 69 . 82 , 69 . 93 , 82 . 11 , 83 . 37 , 97 . 84 , 98 . 75 , 104 . 66 , 108 . 43 , 122 . 61 , 127 . 97 , 155 . 94 , 156 . 03 , 156 . 79 , 170 . 45 , 170 . 56 , 186 . 95 , 203 . 89 and 205 . 21 . to the solution of budesonide ( 600 mg , 1 . 394 mmol ) in dcm ( 5 . 0 ml ) was added cdi ( 249 mg , 1 . 53 mmol ) at rt . after 3 hr stirring , n , n - dimethylethanolamine ( 308 μl , 3 . 07 mmol ) was added at room temperature . after the reaction mixture was stirred at room temperature for 3 . 5 hours , it was poured into water ( 20 ml ) and dcm ( 10 ml ); the aqueous phase was extracted with dcm ( 10 ml ). the combined organic phases were washed with water ( 10 ml ) and brine ( 10 ml ), dried over na 2 so 4 , filtered , and concentrated in vacuo to provide crude budesonide 2 - dimethylaminoethyl carbonate . the product was purified by chromatography , eluted with acoet , then acoet : meoh = 98 : 2 to 99 : 5 to provide 307 mg of 1 : 1 mixture of epimers ( originated from budesonide ) ( 98 : 49 area % purity on hplc ). 1 h nmr ( cdcl 3 ) δ 0 . 80 - 2 . 55 ( m , 29h ), 3 . 69 ( bs , 1h ) 4 . 17 ( t , 2h , 5 . 8 hz ), 4 . 42 ( bs , 1h ), 4 . 4 - 4 . 95 ( m , 3h ), 5 . 05 ( dd , 1h , 12 . 5 and 7 . 2 hz ), 5 . 92 ( s , 1h ), 6 . 28 ( d , 1h , 10 . 1 hz ), 7 . 29 ( d , 1h , 10 . 1 hz ). 13 c nmr ( cdcl 3 ) δ 14 . 16 , 14 . 21 , 17 . 08 , 17 . 20 , 17 . 37 , 17 . 69 , 21 . 22 , 30 . 52 , 31 . 18 , 32 . 10 , 33 . 06 , 33 . 60 , 34 . 28 , 35 . 16 , 37 . 24 , 40 . 65 , 40 . 94 , 44 . 46 , 45 . 86 , 46 . 23 , 47 . 64 , 49 . 99 , 53 . 11 , 55 . 36 , 55 . 45 , 57 . 56 , 66 . 27 , 66 . 30 , 69 . 34 , 69 . 45 , 70 . 14 , 70 . 18 , 82 . 14 , 83 . 41 , 97 . 76 , 98 . 62 , 104 . 64 , 108 . 42 , 122 . 48 , 127 . 73 , 154 . 92 , 157 . 26 , 157 . 37 , 170 . 75 , 170 . 89 , 187 . 00 , 187 . 08 , 201 . 97 and 203 . 29 . for administration to treat asthma , rhinitis , copd and respiratory conditions , the drug is suitably inhaled from a nebulizer , from a pressurized metered dose inhaler or as a dry powder from a dry powder inhaler ( e . g . sold as turbuhaler ®) or from a dry powder inhaler utilizing gelatin , plastic or other capsules , cartridges or blister packs . a diluent or carrier , generally non - toxic and chemically inert to the medicament , e . g . lactose , dextran , mannitol or glucose or any additives that will give the medicament a desired taste , can be added to the powdered medicament . formulations and devices for nebulizers , metered dose inhalers and dry powder inhalers are well known to those skilled in the art . in formulations where the active ingredient is in a suspension it is important that the particles are below 20 μm in size and preferably below 5 μm in size . this may be achieved by micronization , crystallization , spray drying or other known techniques . the solvent or suspension agent utilized for nebulization may be any pharmacologically suitable fluid such as water , aqueous saline , alcohols or glycols , e . g ., ethanol , isopropylalcohol , glycerol , propylene glycol , polyethylene glycol , etc . or mixtures thereof . saline solutions utilize salts which display little or no pharmacological activity after administration . both inorganic salts , such as alkali metal or ammonium halogen salts e . g . sodium chloride , potassium chloride or organic salts , such as potassium , sodium and ammonium salts of organic acids , e . g ., ascorbic acid , citric acid , acetic acid , tartaric acid , etc . may be used for this purpose . other excipients and additives may be added to the formulation . the active ingredient may be stabilized by the addition of an inorganic acid , e . g ., hydrochloric acid , nitric acid , sulphuric acid and / or phosphoric acid ; an organic acid , e . g ., ascorbic acid , citric acid , acetic acid , and tartaric acid etc . ; a complexing agent such as edta or citric acid and salts thereof ; or an antioxidant such as vitamin e or ascorbic acid . these may be used alone or together to stabilize the active ingredient . preservatives can also be added such as benzalkonium chloride or benzoic acid and salts thereof . surfactant may be added particularly to improve the physical stability of suspensions . these include lecithins , disodium dioctylsulphosuccinate , oleic acid and sorbitan esters . the active ingredient may also be suspended or dissolved in a liquified propellant , sealed in a container with a metering valve and fitted into an actuator . such metered dose inhalers are well known in the art . the metering valve may meter 10 to 500 μl and preferably 25 to 150 μl . the propellants used may be halocarbons , hydrocarbons or other liquified gasses . the most frequently used are trichlorofluoromethane ( propellant 11 ), dichlorfluoromethane ( propellant 12 ), dichlortetrafluoroethane ( propellant 114 ), tetrafluoroethane ( hfa - 134a ), 1 , 1 - difluoroethane ( hfa - 152a ), difluoromethane ( hfa - 32 ), pentafluoroethane ( hfa - 125 ), heptafluoropropane ( hfa - 227ea ), perfluoropropane , perfluorobutane , perfluorpentane , butane , isobutane , and pentane . in particular , tetrafluoroethane ( hfa - 134a ) and heptafluoropropane ( hfa - 227ea ) and mixtures thereof are used . as well as propellant , formulations may contain other excipients . surfactant may be added particularly to improve the physical stability of suspensions and valve performance . these include lecithins , disodium dioctylsulphosuccinate , oleic acid and sorbitan esters . cosolvents may also be added to improve solubility of surfactant in propellant or modify the pharmacological performance . these include alcohols and glycols , e . g ., ethanol , isopropylalcohol , glycerol , propylene glycol , polyethylene glycol , etc ., or mixtures thereof . further excipients may be added to improve performance or taste , e . g ., fatty acids and salts thereof such as magnesium stearate , menthol oil etc . dry powder inhalers include devices which meter drug from a chamber within the device or those that deliver pre - metered doses utilizing gelatin , plastic or other capsules , cartridges , or blister packs and / or strips . for topical application , there are employed as non - sprayable forms , viscous to semi - solid or solid forms comprising a carrier compatible with topical application and having a dynamic viscosity preferably greater than water . suitable formulations include but are not limited to solutions , suspensions , emulsions , creams , ointments , powders , liniments , salves , aerosols , etc ., which are , if desired , sterilized or mixed with auxiliary agents , e . g ., preservatives , stabilizers , wetting agents , buffers or salts for influencing osmotic pressure , etc . for topical application , also suitable are sprayable aerosol preparations wherein the active ingredient , preferably in combination with a solid or liquid inert carrier material , is packaged in a squeeze bottle or in admixture with a pressurized volatile , normally gaseous propellant , e . g ., a freon . the topical pharmaceutical carrier may include any substance capable of dispersing and maintaining contact between the active ingredients and the skin . the vehicle may be glycerin , alcohol or water based . examples of such vehicles include aloe vera , which is a gel base , together with ethanol , isopropyl alcohol , water , propylene glycol and a non - ionic surfactant such as laureth - 4 . other water - based alcohol / glycerin vehicles and carriers are within the scope of the present invention . a typical water - based lotion will contain from 45 to 50 parts of glycerin , one to three parts tween 80tm , from 45 to 50 parts of water and from 1 to 50 parts of the compound of the invention . also included in the scope of the invention are ointments , emulsions or dispersions in which water , if present , is a minor constituent . typical ointment formulation comprises from 90 to 98 parts of a mixture of petrolatum , mineral oil , mineral wax and wool wax alcohol , from 0 . 5 to 3 parts of a mixture of polyoxyethylene and sorbitan monooleate ( tween 80 ™), from 1 to 5 parts of water , and from 1 to 50 parts of the compound of the invention . another suitable non - aqueous ointment can be prepared from 95 parts of liquid petrolatum usp , 5 parts polyethylene and from 1 to 50 parts of the compound of the invention . the resulting ointment spreads easily and has an even consistency over wide temperature extremes . it is , in addition , non - irritating and non - sensitizing . formulations of the compounds of the invention may also be prepared containing from 0 to 25 % by weight of urea . in general , in such urea containing ointments , the water content will vary from 5 to 50 % by weight of the composition . any suitable ointment carrier may be used such as lanolin , ethylene glycol polymers and the like . in the case of formulations containing urea , it is known in the art that borate salts may often be added to stabilize the pharmaceutical composition ( see u . s . pat . no . 2 , 917 , 433 , the disclosure of which is incorporated herein by reference ). water based compositions may also be employed , in which case the compound of the invention will commonly be in solution , and the aqueous solution may , if desired , be thickened with a suitable gel to provide a less mobile composition . such compositions are well known in the art compounds as described above were tested in the following assay for biological activity . the wi - 38 human lung fibroblast line was obtained from the atcc ( catalog number 75 - ccl ) and maintained in basal medium eagle with earle &# 39 ; s salts ( gibcobrl product number 21010 - 046 ) supplemented with 2 mm glutamine and 10 % fetal calf serum at 37 ° c . in a 7 % co 2 ( balance air ), humidified atmosphere . one week before experiments were done , the wi - 38 cells were seeded into 48 - well tissue culture dishes and maintained in media containing 10 % fetal calf serum . the cells were used when confluent . the day before the experiment the cells were fed fresh media containing 10 % fetal calf serum ( 0 . 25 ml per well ). on the day of the experiment the media was removed from the cells and 0 . 25 ml of media containing 5 % fetal calf serum added . the rat alveolar macrophage cell line raw 264 . 7 was obtained from the atcc ( catalog number 71 - tib ) and maintained in dulbecco &# 39 ; s modified eagle medium ( gibcobrl product number 11960 - 044 ) supplemented with 2 mm glutamine , 1 mm sodium pyruvate and 10 % fetal calf serum at 37 ° c . in a 10 % co 2 ( balance air ), humidified atmosphere . one week before experiments were done , the wi - 38 cells were seeded into 48 - well tissue culture dishes and maintained in media containing 10 % fetal calf serum . the cells were used when confluent . the day before the experiment the cells were fed fresh media containing 10 % fetal calf serum ( 0 . 25 ml per well ). one the day of the experiment the media was removed from the cells and 0 . 25 ml of media containing 5 % fetal calf serum added . to determine the ic 50 values for the compounds , 1 to 1000 dilutions were made of the 5 mm stock solutions in dmso to give 5 um solutions . these solutions were serially diluted 1 : 2 in dmso to give a series of 12 dilutions ranging from 5 um to 2 . 4 nm . 0 . 0025 ml aliquots of the 12 dilutions were added to wells of the wi - 38 cells to give final compound concentrations ranging from 50 nm to 0 . 024 nm . the cells were stimulated by addition of 0 . 001 ml of 0 . 025 ug / ml recombinant human interleukin - 1β ( il - 1β - calbiochem catalog number 407615 ) in 0 . 1 % bovine serum albumin in phosphate buffered saline . the cells were incubated for 24 hours and the supernatants harvested . the level of pge 2 in the supernatants was assayed using a commercial enzyme immuno assay ( eia ) kit ( cayman chemical catalog number 514010 ) after diluting 1 : 10 in eia buffer according to the manufacturer &# 39 ; s directions . the data from these experiments was fit to a 4 parameter logistic function using the ic 50 routine in the grafit 4 program ( erithecus software ). ic 50 values determined in this manner were : budesonide 0 . 20 nm ; budesonide isobutylcarbonate 0 . 12 nm ; budesonide dodecylcarbonate 0 . 53 nm ; budesonide hexylcarbonate 0 . 14 nm . the compounds of the invention were also tested in vivo in a rat paw edema model [ hirschelmann , r . and bekemeier , h ., int j tissue react 6 , 471 - 475 ( 1984 )], which persons of skill in the art accept as predictive of efficacy in treating asthma and rhinitis in humans . rat paw edema protocol : male sprague dawley rats rj : sd ( iops han ) ( cej , france ) weighing between 140 and 160 grams were used in the studies . animals were housed in a temperature ( 19 . 5 - 24 . 5 ° c . ), relative humidity ( 40 - 70 %) and 12 - hour light / dark cycle ( light 6 : 00 a . m . to 6 : 00 p . m . )- controlled room , with ad libitum access to filtered tap - water and standard pelleted laboratory chow ( u . a . r ., france ) throughout the studies . carrageenan lambda type iv ( sigma , france ) was prepared as a 2 % ( w / v ) solution in saline . compounds to be tested were dissolved in dimethylsulfoxide ( dmso ) such that the indicated doses were in a final volume of 0 . 05 ml . doses were expressed as mg / paw free active substance . from 17 to 19 hours before the studies the rats were fasted with free access to water . the paw volumes of the left hindpaws of the rats were measured using an electronic plethysmometer type 7140 ( ugo basile - italy ) at time = 0 . paw edema was then induced by injection of 0 . 05 ml of 2 % carrageenan solution into the left hindpaws of the rats . immediately after injection of the carrageenan , compounds in dmso or vehicle alone were injected into the same paw in a volume of 0 . 05 ml in a blind and random fashion . the paw volumes were measured at 1 . 5 hours , 3 hours , 4 . 5 hours and 24 hours after administration of the compounds . the edema volume of each rat at each time point was expressed as the change from the initial paw volume ( time = 0 ). a total of 5 rats were used for each compound dose and the average edema volume calculated for each dose . the anti - inflammatory effect in treated groups was expressed as the percent inhibition of edema volume compared to the vehicle - treated group at 1 . 5 hours , 3 hours , 4 . 5 hours and 24 hours . the results are shown in fig1 , in which the efficacies of equimolar doses ( equivalent to 10 μg per paw of budesonide ) are compared at 24 hours . budesonide itself reduces swelling by 46 %. the formation of a carbonate ester at c21 decreases the efficacy of budesonide when the ester is c 6 or smaller . unexpectedly , at c 6 the curve reverses , and the efficacy increases . thus , although one would expect c 7 to be less efficacious than c 6 , in fact it is surprisingly found more efficacious , and the c 10 carbonate is 30 % more efficacious than budesonide itself . the correlation between numbers of carbons in the carbonate ester and efficacy reaches a peak at c 12 with an 88 % reduction of swelling . other carbonates showed similar behavior . the phytol ( example 16 ) and farnesol ( example 17 ) carbonates exhibited normal onset of action and maximum activity at 24 hours of 69 and 86 percent respectively . the amine - terminal alkylcarbonate , example 15 , exhibited a maximum activity at 24 hours of 73 percent . the enhanced effect of the carbonates and carbamates compared to the parent steroid is most dramatic at the 24 - hour observation , as can be seen by comparing fig2 and 3 , in which budesonide carbonate is compared to budesonide .

US-36982803-A

a total shoulder prosthesis is provided giving greater freedom of movement than structures heretofor available . the invention also includes a novel humeral component which can be used for a partial prosthesis .

referring now to the drawings by reference characters , the prosthesis of the present invention comprises two parts , namely a glenoidal component generally designated 10 and a humeral component designated 12 . the glenoid component 10 has a concave hemispherical articular surface 14 . the glenoidal component replaces most or all of the glenoid cavity , i . e . the articular surface of the glenoid , and has a back surface which extends to the spine 16 of the acromion behind and the coracoid process 18 in front . in this manner there is created a coraco - acromial arch . the glenoidal component 10 is fixed to bone with glue or cement at points of contact with the glenoid , acromion and coracoid process in a manner well known to those skilled in the art . the humeral component has a spherical head 20 and a shaft or stem 22 for connecting it to the medullary canal of the humerus . the head 20 has a lower edge with a front v - shaped notch 24 and a rear notch 26 . a series of holes 28 surrounds the v - shaped notches , the purpose of which will be brought out later . according to the present invention the radius of curvature of the glenoid component is much greater than that of the humeral component and the ratio of the two radii can vary from one and one - half to three times . the greater freedom of movement provided by this relationship is most clearly shown in fig2 and 3 . in fig2 a right shoulder is shown with the arm in a down position with the area of contact shown at 30 . fig3 shows the arm in a raised position and now the point of contact has moved to 32 . it can thus be seen that greater freedom of movement is provided than with the usual ball and socket joint . although this has only been illustrated in conjunction with up and down movement , it will be apparent that the same freedom of motion is achieved with front to rear movement . the method of utilizing the prosthesis of the present invention is shown in fig4 . the upper half of the glenoid is removed to the base of the coracoid and the glenoid is excavated except for the outer rim . the glenoid component 10 is then fastened between the spine of the acromion 16 and the coracoid process 18 . the glenoid component is fixed to the bone with glue or cement as is well known to those skilled in the art . the humerus 36 is prepared for the prosthesis by decapitating it substantially on the line 38 and the entire upper end of the humerus is removed and not just the articular portion . shaft 22 is then placed in the medullary canal and fastened to the cancellous bone with glue or cement . the holes in the v - shaped notches at the bottom of the spherical portion 20 of the humeral component are used for the passage of sutures and the fixation of tendons to bone . thus , as is shown in fig8 the subscapularis tendons 40 are attached to the front of the ball . the infraspinatus and teres minor tendons 42 and 44 , respectively , are both fastened at the rear of the ball as is shown in fig9 . although the prosthesis of the present invention was primarily designed as a total shoulder prosthesis , in those cases where the glenoid is intact , the humeral component can be used in a partial prosthesis . in such a case , the radius of curvature of the humeral component bears the same ratio to the natural glenoid as it would to the prosthetic glenoid described above . it is believed apparent in the foregoing that i have provided shoulder prosthesis which allows much greater freedom of action than the shoulder prosthesis heretofore known . i have also provided humeral components of generally improved design which allows the preservation and reattachment of the subscapularis and infraspinatus and teres minor tendons , and allows a greater range of motion by replacing the tuberosites ( which impede abduction ) with a spherical ball replacing the entire upper end of the humerus .

US-64887676-A

a cleaner assembly includes a main body having a first end with a handle portion and a second end with a removable cleaner head ; a motor contained with in said main body ; an actuator operatively associated with said motor ; a rotational shaft operatively associated with said motor and with a rotational cleaner head support ; and a cleaner head removably attached to said rotational shaft .

as generally understood , described herein and the present invention relates to an improved cleaning device . in one embodiment , assembly 200 includes a main body 20 having a first , or handle end including a handle portion 32 and actuator 28 a battery compartment 22 and a battery compartment closure 26 . body 20 further includes a second and whereby a cleaner head 34 is mounted upon a cleaner head support 24 . in one embodiment , cleaner head 34 is a cleaner brush . however , additional cleaner heads are contemplated as being used with the present invention including a cleaner mop 36 a cleaner buffer 38 and other similar cleaner head configurations . in one embodiment , a support brace 30 is provided with main body 20 . it is contemplated in use values or will grasp handle portion 32 with one hand and support brace 30 with the other hand in using the device of the present invention . in one embodiment , as demonstrated in fig6 through nine , a rotational motor nut 44 is operatively associated with motor 64 and is configured to interact with shaft nut 46 . shaft 54 extends from motor 64 towards the cleaner head . shaft 54 contacts fitting 56 which is operatively associated with adapter 48 but and attachment connector 58 that ultimately provides rotational movement on clear head 34 or other clear heads attached to the assembly . motor 64 is actuated by actuator 28 associated with electrical actuator assembly 66 . batteries 72 are connected with stem connector 74 and electrical connectors seven the supply power to electrical actuator assembly 66 and ultimately to motor 64 . battery compartment 22 is closed by battery assembly closure 26 having a closure pin 76 configured there with . although a particular closure is demonstrated in the figures , battery compartment 22 is contemplated as being opened and subsequently closed through any acceptable means . as demonstrated in the embodiment of fig1 shaft 54 is configured with a bearing spacer 42 that connects to middle bearing 40 . middle bearing 40 is associated with fitting 56 and front bearing 50 . the front bearing 50 is configured to interact with adapter 48 which contact shaft nut 46 ultimately turning head support 24 . in one embodiment , as demonstrated in fig1 through 17 , a water hose 82 is provided whereby hose 82 supplies water that is mixed with so provided in soap reservoir 84 . although the reservoir is designated for so , any cleaning solution or liquid is contemplated use therein . a flow valve 86 is provided to selectively adjust the mixture of water supplied by water hose 82 and soap in soap reservoir 84 . a water control valve 80 is provided to regulate only the amount of water entering the system . the selected amounts of water and / or soap proceeds through dispenser shaft 88 and ultimately exits the device through dispenser shaft outlet 92 . in one embodiment , dispenser shaft 88 is secured with dispenser shaft bracket 90 . in an embodiment demonstrated in fig1 , dispenser shaft outlet 92 is movable and adjustable in order to direct solution that is exiting the outlet . in using the device demonstrated in fig1 through 10 , a user will grasp the assembly with one hand positioned within the cavity of handle portion 32 and a second hand grasping a support brace 30 . actuator 28 is provided as a spring - loaded trigger whereby pressure on the trigger when graphs by a user actuates motor 64 and ultimately rotates clear head 34 or in the other cleaner head attached to the assembly . the user will then move cleaner had 34 in directions as desired in order to clean particular surfaces and / or areas . in the embodiment demonstrated in fig1 through 17 , a user will utilize water inlet 82 and or solution chamber 84 adjusting appropriately supplied valves to provide desired water and or water mixed with cleaning solution . the cleaning solution will exit through the spencer shaft outlet 92 which is positioned near cleaner head support 24 . a user will provide the appropriate cleaning liquid and utilize cleaner had 34 or other incorporated cleaner head in order to clean a desired surface . while the invention has been described in its preferred form or embodiment with some degree of particularity , it is understood that this description has been given only by way of example and that numerous changes in the details of construction , fabrication , and use , including the combination and arrangement of parts , may be made without departing from the spirit and scope of the invention .

US-201414256340-A

in an x - ray equipment stand designed to perform isocentric scanning movements and having three axes of rotation concurrent to the isocenter o , the isocenter can be caused to rotate about a fourth axis perpendicular to the second axis and parallel to the third axis . this permits displacement of the isocenter in the horizontal plane , especially along straight lines which are secant with the third axis .

in fig1 which is a view showing diagrammatically the relative positions of the different axes of rotation of an equipment stand in accordance with the invention , there are shown the three orthogonal axes x &# 39 ; x and y &# 39 ; y in the horizontal plane and z &# 39 ; z in the vertical plane which are concurrent to a point 0 . the stand comprises an arcuate member 13 which supports an x - ray source 11 and a detector 12 placed along the diameter of the arcuate member . said arcuate member is supported by a sleeve or guide 14 within which it is capable of sliding under the control of the operator . a patient support table 15 or so - called examination table is placed between the x - ray source 11 and the detector 12 in the longitudinal direction x &# 39 ; x and slightly beneath the horizontal plane defined by the axes x &# 39 ; x and y &# 39 ; y . a displacement of the arcuate member 13 in sliding motion makes it possible to carry out a rotation of the x - ray source and of the detector about an axis 1 perpendicular to the plane which contains these two elements , which means that the axis of the x - ray beam describes a surface in a plane parallel to said plane . in the particular case of fig1 the axis 1 coincides with the axis y &# 39 ; y . the sleeve 14 is capable of rotating about an axis 2 located in a horizontal plane which passes through the point 0 known as the isocenter . in this particular case of fig1 said axis 2 coincides with the axis x &# 39 ; x . as a result of rotation of the arcuate member 13 about the axis 2 , the axis of the x - ray beam can be caused to describe a surface perpendicular to the plane of the arcuate member . the support of the axis 2 ( not shown in the drawings ) is capable of rotating about an axis 3 which coincides with the vertical axis z &# 39 ; z and therefore passes through the isocenter 0 . this rotation about the axis 3 makes it possible to displace the arcuate member 13 on each side of the examination table or in other words to provide freedom of access to the patient &# 39 ; s head . these three rotations about the axes 1 , 2 and 3 serve to scan zones of the patient &# 39 ; s body at angles of incidence which have any directions in space but which all pass through the isocenter 0 . it is accordingly apparent that , in order to examine another organ of the patient &# 39 ; s body , this latter or in other words the examination table has to be displaced with a view to bringing the center of this other organ to the isocenter 0 . in accordance with the invention , it is proposed to displace the isocenter 0 so that this latter can be made to coincide with the center of the zone of the patient to be observed by providing for rotation of the axis 2 about an axis 4 which is perpendicular to the axis 2 and located in the plane containing the axis 3 in the case of the particular position of fig1 . this rotation about the axis 4 makes it possible to displace the isocenter 0 in the horizontal plane defined by the axes x &# 39 ; x and y &# 39 ; y by causing it to describe a circular arc . since the axis 4 is in any case capable of rotating about the axis 3 , it is possible to cause the isocenter 0 to describe any curve in the horizontal plane by combining the two angular movements about the axes 3 and 4 . the geometrical diagram of fig2 serves to gain an understanding of the movements which can be performed by virtue of the presence of said axis 4 . this diagram has been drawn in the horizontal plane and the point a materializes the position of the isocenter as well as that of the axis z &# 39 ; z or axis 3 . the axis 4 is therefore capable of moving on a circle 16 having a center a so as to cover approximately an angle of 135 ° on each side of the axis x &# 39 ; x as it passes on the side corresponding to the patient &# 39 ; s head . the fact that the angle is limited to approximately 135 ° on each side is due to the presence of the examination table support on the side corresponding to the patient &# 39 ; s feet . in respect of each position on said circle 16 , the equipment stand has three concurrent axes , thus permitting all angles of incidence about the isocenter . it may also be understood from fig2 that , by virtue of the combination of the angular movement about the axis 3 and of the angular movement of the axis 2 about the axis 4 , the isocenter can be made to describe the segment db on the axis x &# 39 ; x and the segment ec on the axis y &# 39 ; y . the law which associates the two angular movements must be such that , when the axis 4 rotates through an angle α about the axis 3 , the axis 2 must rotate through an angle 2α about the axis 4 . thus , when the axis 4 is in position n , that is to say on the axis y &# 39 ; y , the isocenter is at the point a . if the axis 4 rotates through the angle α in order to move to position m , the isocenter will be on x &# 39 ; x at the point d if the axis 2 rotates through an angle 2α about the axis 4 in the direction 4 defined by the arrow 21 . in fact , the triangle defined by the points a , m and d must always be isosceles with the side b equal to the distance between axes of the equipment stand or in other words the distance between the isocenter and the axis 4 . as a result , the vertex angle must be equal to 2α if the angle man is equal to α . when the axis 4 passes from n to p , the isocenter will describe the segment ab if the axis 2 rotates in the direction defined by the arrow 22 . it is understood that the isocenter can describe the segments ab and ad when the axis 4 describes respectively the circular arcs n &# 39 ; m &# 39 ; and n &# 39 ; p &# 39 ;. in order to ensure that the isocenter describes the segment ea , the axis 4 must describe the circular arc pq whilst the axis 2 must rotate in the direction indicated by the arrow 23 . in the case of ac , the axis 4 must describe the circular arc qm &# 39 ; whilst the axis 2 must rotate in the direction of the arrow 24 . it will be understood that , in this case also , the isocenter can describe the segments ae and ac when the axis 4 describes the circular arcs q &# 39 ; m and q &# 39 ; p &# 39 ; but this possibility is not put to use since the support of the examination table prevents displacement over part of the circular arc p &# 39 ; q &# 39 ; m . the length of the segments described by the isocenter on the axes x &# 39 ; x and y &# 39 ; y is given by the formula as determined by means of the trigonometric relations of the isosceles triangle dma , for example . the principles demonstrated in the foregoing in regard to displacement of the isocenter on the axes x &# 39 ; x and y &# 39 ; y can be demonstrated in the case of any other system of orthogonal axes which is inclined with respect to the axes x &# 39 ; x / y &# 39 ; y . this shows that the isocenter can be displaced to any point of the horizontal plane defined by x &# 39 ; x and y &# 39 ; y but within a circle having a radius 2b sin α and having a center a . it is worthy of note that the radius of this circle is limited by the maximum value which can be assumed by the angle α , taking into account the presence of the examination table . when the isocenter describes the segments ad , ab , ae and ac , the x - ray beam follows the angular movement about the axis 3 and rotates through an angle α . as a result , the image received by the detector also rotates and corrections therefore have to be made in order to ensure that it retains the same orientation in space . these corrections can be obtained by making use of electronic means and / or methods for producing action on the image itself or by making use of means for producing action directly on the orientation of the detector as a function of the value of the angle α . fig3 is a view in elevation of one example of construction of an equipment stand for carrying out the invention described with reference to fig1 and 2 . in fig3 the elements which are identical with those of fig1 are designated by the same references . the sleeve 14 is carried by an element 16 and this latter carries the rotating shaft which materializes the axis 2 . said shaft is capable of rotating through an angle of plus or minus 180 °, which means that the arcuate member is capable of performing one complete revolution about the axis 2 . the element 16 is carried at the upper end of a rigid structure 17 having the shape of a circular arc , the lower end of which is capable of pivoting about the axis 3 between - 135 ° and + 135 °. this axis 3 is materialized by a shaft which is fixed on the ground 18 by means of a base 19 . in accordance with the invention , the element 16 is mounted for pivotal displacement about the axis 4 which is vertically mounted at the upper end of the pivoting structure 17 . the angular movement is limited between the positions - 90 ° and + 90 °. the detector 12 is pivotally mounted so as to rotate about the axis of the x - ray beam . this makes it possible to maintain the same orientation for the image irrespective of the angular movements about the axes 3 and 4 . the equipment stand which has just been described can be associated with elements which are employed in equipment stands of the prior art . it is thus possible to associate a collimation 191 with the x - ray source and an imaging chain 181 with the x - ray detector 12 . it is also possible to mount the x - ray source and the detector on sliding devices 20 and 21 respectively so as to carry out their relative displacement on the axis rx . it is also possible to mount the x - ray source and the detector on axes 22 and 23 respectively in order to operate with incident rays on the detector or on an ancillary detector . it is also possible to displace the axis 2 vertically so as to obtain a variable position of the isocenter in height . fig4 is a diagram in isometric perspective showing another example of construction of an equipment stand in accordance with the invention in which the pivot of the axis 4 is located at ground level and not in elevation as is the case with the equipment stand of fig3 . provision is accordingly made for an arm 17 which rests and moves on the ground , thus avoiding the need to have a cantilevered arm 17 . in this figure , elements which are identical with those of the previous figures are designated by the same references . fig4 shows two positions of the equipment stand , namely one position in which the isocenter 0 is located at the center on the patient &# 39 ; s head and the other position in which the isocenter 0 has been brought to the level of the patient &# 39 ; s lower limbs . this figure has the main advantage of showing that the equipment stand in accordance with the invention makes it possible to obtain a scan of the isocenter 0 over a patient &# 39 ; s entire body without having to displace the examination table . it also shows that this equipment stand permits freedom of access to the patient &# 39 ; s head or to one of the longitudinal sides according to the operator &# 39 ; s requirements . this results in reduced bulk of the x - ray installation while providing greater flexiblity of use of the equipment stand . more precisely , the equipment stand of fig4 differs from that of fig3 in regard to the manner in which the rigid structure 17 is constructed . the arcuate structure 17 has been replaced by an equivalent structure having a horizontal portion 24 which rests on the ground and moves in rotation on this latter by pivoting about the axis 3 . that end of said horizontal portion 24 which is opposite to the end of the axis 3 supports a vertical portion 25 mounted for pivotal motion about the axis 4 which is in rigidly fixed relation to the horizontal portion 24 . this vertical portion 25 in turn supports the arcuate member 13 and its associated rotation means . the invention has been described in connection with particular examples of construction but may clearly be carried out in different ways without thereby departing from its scope as defined by the appended claims :

US-36060889-A

a composition comprising a physically discrete pet food oral intake composition coated with a physically stable film , the film comprising a component which is a ) capable of carrying a beneficial agent to a site in the pet wherein the benefit agent is effective in producing a beneficial effect or b ) capable of releasing the benefit agent into the mouth or alimentary canal with the benefit agent traveling to a site in the pet wherein the benefit agent is effective in producing a beneficial effect .

the pet food composition which can be employed in carrying out the invention is the usual , physically discrete portion of the pet food . for example these include a dry pet food comprising kibbles , bits , any other discrete materials , solid treat , supplements and the like , and even “ chunks ” in a chunk and gravy wet diet assuming the film can be properly applied to the chunk in the food processing and remain stable in the liquid environment of the container . by coating the surface is meant that at least enough of the surface of the discrete particle is covered with the film so as to achieve the desired effect . the entire surface need not be coated . for certain aspects such as delivering a benefit agent the coated surface need only be minimum of about 10 % of the surface area , preferably about 20 %. however in order to attenuate particle malodor a substantial amount of the surface area should be coated , for example at least about 75 %, preferably at least about 85 % and most preferably 95 - 100 %. the process of applying the polymer to the surface of the physically discrete pet food can be done through any of the common procedures known to be effective in applying films to objects . these procedures include casting , spraying , grafting sputtering , flowing , calendaring , extruding and the like . it can be done to the pet food composition prior to being cut into physical discrete portion but is preferably done after the physically discrete portions are formed , thus ensuring an even distribution on the entire particle , if so desired . the chemical used in coating the pet food is a polymer which should be physically stable during the process of its application and also stable during its lifetime on the pet food composition surface while being subjected to any further processing steps . it should remain essentially chemically inert with the surface , itself or its environment but can be somewhat reactive as long as its function in the system is not significant jeopardized . its compatibility with the oral cavity and digestive tract of the pet should also be present . examples of these polymers include zein , casein , starch ( es ), cellulose ( s ), gum ( s ), gelatin , starch / synthetic polymer ( s ), e . g starch / low density polyethylene , and the like . the polymer preferably has the attribute of rapid dissociation in the oral cavity , particularly in the presence of saliva . the thickness of the coating is not as important . it can vary from about 1 to about 2000 microns , or from about 2 to about 1000 microns , as long as the function of the film is maintained . the film can be present on the discrete particle with no benefit agent therein or with a benefit agent within the film matrix . the benefit agent can be totally soluble within the film or partly soluble within the film matrix and the remainder suspended therein . when the matrix rapidly dissolves , this can be in a matter of about 1 - 10 , preferably about 1 - 5 and more preferably about 1 - 2 seconds . after exposure to the oral cavity and the saliva therein , these times are within the normal residence time of pet food in the pet &# 39 ; s oral cavity . the film dissolves releasing the benefit agent for action in the oral cavity or further in the digestive tract including systemic absorption where appropriate and dependent upon the specific benefit agent . where it is not important that the film rapidly dissolve in the oral cavity , other film components can be employed , for example pva , polysaccharides , and pe - starch . these materials are slower to dissolve and can release a benefit agent , if present , further down the alimentary canal for example the stomach or small intestine . additionally if the benefit agent needs to be protected from the environment it is to reach the point where it can be effectively released . the benefit agent can be “ coated ” prior to its incorporation into the film making component . an example of such a coating is an enteric coating such as a polysaccharide , cellulose , methacrylate , and commercially available coating such as eudragit ™. as shown above , a benefit agent as used in the application is any material which can provide a benefit to the mammal ingesting it . a typical diet is extruded and cut into kibble . it is cooled off to 18 - 15 ° c . then it is sprayed with a starch such as cornstarch providing a coating which covers or essentially ( 95 - 100 %) covers the surface . such coating can suppress any malodor ( s ) such as fish oil from the kibble , thereby increasing the palatability of the kibble . the coating rapidly dissolves in the oral cavity of the pet , for example a dog or cat , eating the kibble . the kibble of example 1 is alternatively sprayed with one of a group consisting of zein , casein , cellulose , gum , gelatin , starch / synthetic polymer and a mixture thereof and similar results are obtained . the coating of examples 1 and 2 are applied by a process of sputtering , grafting , casting , blowing , extruding or calendaring . similar results are obtained as in example 1 . a benefit agent to be effective through absorption in the mouth , a zinc salt , is suspended in a zein solution and sprayed on a dog diet which has been cut in kibbles . the diet is ingested by the dog and the zinc salt released in the mouth after the film is dissolved . the zinc salt is now available for its activity in the mouth . a benefit agent such as a probiotic which is inactivated in the stomach , is coated with cellulose . the coated probiotic is suspended in casein and sprayed onto a dog diet which has been cut into kibbles . the diet is ingested by the dog and the coated probiotic released in the mouth after the film has dissolved . the coated probiotic makes its way down the alimentary canal until it reaches the small intestine wherein the cellulose coating breaks down and the probiotic is absorbed into the small intestine .

US-27195908-A

the present invention relates to a pure tone audiometer , and more particularly , to a pure tone audiometer with automated masking which is capable of automatically performing air - conduction and bone - conduction hearing tests and automatically performing a masking test , if necessary , so that a person obtains an accurate pure tone hearing threshold without others &# 39 ; assistance . the pure tone audiometer of the present invention can accurately perform the pure tone hearing test with automated masking without assistance from a doctor or an audiologist . thus , with the pure tone audiometer , people can easily check their hearing ability for prevention and early detection of hearing loss and take swift action to cure hearing loss .

hereinafter , exemplary embodiments of the present invention will be described in detail . however , the present invention is not limited to the exemplary embodiments disclosed below , but can be implemented in various types . therefore , the present exemplary embodiments are provided for complete disclosure of the present invention and to fully inform the scope of the present invention to those ordinarily skilled in the art . referring to fig1 , a pure tone audiometer of the present invention comprises a display unit 10 , a sound generating circuit 20 , an output unit 30 , an input unit 40 , an air - conduction hearing tester 50 , a bone - conduction hearing tester 60 , a masking tester 70 , and a controller 80 . the display unit 10 displays a use - procedure guide or a test result . in an exemplary embodiment of the present invention , the display unit 10 may be a monitor for a computer . alternatively , the display unit 10 may be a unit for printing a guide at one side of the device , turning a plurality of electric bulbs located at one side of the guide on for illuminating the guide according to a procedure , and displaying a test result on a liquid crystal display disposed at another side of the device . when a control signal is input , the sound generating circuit 20 generates a sound in response to the input control signal . the control signal includes an indication of the frequency and intensity of the sound to be generated and an indication of whether the sound is to be generated toward any one of left and right ears . the sound generating circuit 20 generates the sound having the required frequency and intensity , and outputs the sound as an electrical signal . in the present invention , the sound generating circuit 20 may be a commercially available sound card for a computer . the output unit 30 includes a headphone and a bone - conduction vibrator . the headphone converts the electrical signal from the sound generating circuit 20 into sound . the bone - conduction vibrator is mounted to a mastoid at a rear side of the ear , and converts the electrical signal from the sound generating circuit 20 into vibration and delivers the vibration toward the skull . the headphone and the bone - conduction vibrator vibrating and generating sound in response to the electrical signal from the sound generating circuit 20 is well known to those skilled in the art and a detailed description thereof will be omitted . the input unit 40 allows the user to indicate that he / she has heard the sound from the output unit 30 . in the exemplary embodiment of the present invention , the input unit 40 is a keyboard for a computer . alternatively , the input unit 40 may be a switch or a touch screen . the air - conduction hearing tester 50 will now be described . the air - conduction hearing tester 50 performs a hearing test in order to obtain the hearing threshold via a test to see whether the user can hear the pure tone propagated to his / her eardrum via his / her external auditory meatus by generating a pure tone to the headphone of the user . specifically , the air - conduction hearing tester 50 generates a control signal to adjust sound pressure of the pure tone that is generated depending on a user &# 39 ; s response input from the input unit 40 . for example , the air - conduction hearing tester 50 outputs the control signal to increase the sound pressure to 45 db when the user does not hear a 40 db sound and to decrease the sound pressure to 35 db when the user hears the 40 db sound . the air - conduction hearing tester 50 performs a hearing test on the left and right ears . first , the air - conduction hearing tester 50 generates a pure tone at a predetermined frequency . the air - conduction hearing tester 50 initially provides a predetermined sound pressure ( 40 db ) and increases or decreases the sound pressure at intervals of 5 db depending on response . a minimum sound pressure of a sound that the user can hear is a hearing threshold . the test is performed with several frequencies to obtain a hearing threshold corresponding to each frequency . the bone - conduction hearing tester 60 will now be described . the bone - conduction hearing tester 60 performs a hearing test on the user by using the sound propagated through the skull . the air - conduction hearing test cannot exactly perform the hearing test when the user suffers from an external or middle ear disease , such as an external ear disease induced change or a middle ear inflammation . in this case , it is necessary to perform the hearing test based on vibration propagated via the skull . the bone - conduction hearing tester 60 sends an electrical signal to the bone - conduction vibrator rather than the headphone so that the bone - conduction vibrator generates a vibration - induced pure tone , and obtains an ear &# 39 ; s bone - conduction hearing threshold . since the bone - conduction hearing tester 60 performs the test in the same process as the air - conduction hearing tester 50 , a detailed description of the test process of the bone - conduction hearing tester 60 will be omitted . the masking tester 70 will now be described . the masking tester 70 performs the hearing test by generating a noise toward a headphone mounted to one ear and a pure tone to the other ear to be measured . when there is a great difference between the hearings of both ears , this hearing test is intended to prevent the sound from being delivered to the good ear via the skull instead of via an external auditory meatus . in general , the masking tester 70 is activated when there is a difference of 35 db or more between both ears in the air - conduction hearing test or when there is a difference of 15 db or more between the air - conduction hearing threshold of the bad ear and the bone - conduction hearing threshold of the good ear in the bone - conduction hearing test . when masking bone - conduction hearing , the masking tester 70 determines an ear on which the headphone will be mounted and an ear to which the bone - conduction vibrator will be attached , and outputs a control signal to display the determination result on the display unit 10 . the masking tester 70 generates a control signal to increase sound pressure of the noise when the user hears the pure tone and to increase the pure tone when the user does not hear the pure tone . the controller 80 will now be described . the controller 80 is connected to and controls the display unit 10 , the sound generating circuit 20 , the input unit 40 , the air - conduction hearing tester 50 , the bone - conduction hearing tester 60 , and the masking tester 70 . the controller 80 receives a control signal for the frequency and the sound pressure for testing from the air - conduction hearing tester 50 , the bone - conduction hearing tester 60 , and the masking tester 70 , converts the control signal to be suitable for reception by the sound generating circuit 20 , and sends the control signal to the sound generating circuit 20 . here , since the control signal depends on a type of commercially available sound card as the sound generating circuit 20 the controller 80 converts the control signal as mentioned above . the controller 80 controls the display unit 10 to display a guide for any procedure required to perform the hearing test . for example , in the masking test , the controller 80 controls the monitor to display on the screen an ear on which the headphone will be mounted and an ear to which the bone - conduction vibrator will be attached , such that the user correctly mounts the headphone and the bone - conduction vibrator . the controller 80 also receives a signal from the input unit 40 and sends the signal to the air - conduction hearing tester 50 , the bone - conduction hearing tester 60 , and the masking tester 70 . here , the controller 80 further includes a storage unit 82 for storing the test result so that a type and degree of hearing loss is displayed and the test result can be checked by the user at anytime . the controller 80 stores information on the sound generating circuit 20 and the headphone and the bone - conduction vibrator of the output unit 30 . this is because the sound generating circuit 20 , the headphone , and the bone - conduction vibrator have different features depending on make or model , and therefore , the controller 80 cannot generate an accurate sound by using the same control signal . accordingly , it is necessary to recognize the features of the sound generating circuit 20 , the headphone , and the bone - conduction vibrator by performing a test in advance . specifically , the controller 80 measures an electrical signal , sound or vibration output while increasing or decreasing sound pressure for each frequency , determines a value to be corrected for each frequency with respect to each device , and stores the value in a database 84 . the controller 80 reads a correction value for the type of corresponding device and performs correction by applying the correction value . for example , when the connected headphone generates a signal at 1000 hz to output 35 db , a non - corrected signal may be output at 30 db . in this case , the controller 80 controls the sound generating circuit to generate a 35 db signal , such that an output signal of the headphone is 35 db . operation and effects of the pure tone audiometer according to an exemplary embodiment of the present invention will now be described in detail with reference to fig1 . using the keyboard , a user inputs the type of sound generating circuit 20 mounted on the pure tone audiometer of the present invention by viewing the screen of the display unit 10 . the user also inputs make and model names of the headphone and the bone - conduction vibrator connected to the sound generating circuit 20 so that the controller 80 performs the correction . when there is a request from the user for a pure tone hearing test , the controller 80 sends a control signal to control the air - conduction hearing tester 50 to perform a testing procedure . the air - conduction hearing tester 50 displays a guide to instruct the user to wear the headphone on the display unit 10 via the controller 80 . when the user wears the headphone according to the guide and presses an enter key of the keyboard , an input signal from the keyboard is sent to the air - conduction hearing tester 50 via the controller 80 , such that the hearing test is initiated . the air - conduction hearing tester 50 instructs the user to select an ear with good hearing , and begins to first test the selected ear . the air - conduction hearing tester 50 generates a pure tone at 1000 hz to output 40 db , and outputs it to the selected ear . when the user hears the sound and presses a predetermined button , the air - conduction hearing tester 50 decreases the pure tone by an interval of 5 db . when the user does not hear the sound ( i . e ., the user does not press the button for a predetermined time ), the air - conduction hearing tester 50 increases the pure tone by an interval of 5 db . the air - conduction hearing tester 50 performs this process repeatedly three times in order to obtain the threshold . when the two or more responses from the user are the same , the air - conduction hearing tester 50 determines the smallest value to be the threshold . the test is first performed at 1000 hz . the test is then performed at 2000 hz , 3000 hz , 4000 hz , and 8000 hz . a threshold at 1000 hz is obtained again . when a difference between the threshold at 1000 hz and an initial threshold is 10 db or more , the test is performed again at the higher frequencies . when the difference is less than 5 db , the test is performed at lower frequencies in the order of 500 hz , 250 hz , and 125 hz . this process is then performed on the other ear to obtain the air - conduction hearing threshold of both ears . when a difference between both hearing thresholds is 35 db or more , the controller 80 calls the masking tester 70 . the masking tester 70 sends a noise to the good ear and a pure tone to the bad ear , and increases or decreases the sound pressure of the noise or pure tone depending on a response from the user in order to test the hearing . the pure tone audiometer then performs the bone - conduction hearing test on a user who is likely to suffer from hearing loss or is suffering from middle ear inflammation . the bone - conduction hearing test includes sending vibration via the bone - conduction vibrator attached to the rear of the ear , not via the headphone , and detecting the vibration propagated via the skull . the bone - conduction hearing test includes measuring only frequencies from 250 hz to 4000 hz . since this testing process is the same as the process of obtaining the air - conduction hearing threshold , a detailed description thereof will be omitted . when a difference between the air - conduction hearing threshold of the bad ear and the bone - conduction hearing threshold of the good ear , which are sequentially measured , is 15 db or more , the controller 80 calls the masking tester 70 . the masking tester 70 instructs the user to attach the bone - conduction vibrator to the ear to be tested and wear the headphone on the other ear , and then sends a noise to the headphone and a pure tone to the bone - conduction vibrator for hearing testing . the test result may be displayed on the screen of the display unit 10 . the test result may be output by a printer , if necessary . such a test can provide accurate air - conduction and bone - conduction hearing thresholds , such that hearing loss can be prevented and early detection is possible without assistance from a doctor or an audiologist . while the invention has been shown and described with reference to certain exemplary embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims .

US-44135307-A

an automatic verification system for automatically verifying a winner of an on - line game is disclosed . the verification system contains information about subscriber players and contains accounts that are used for betting on outcomes of skill games . the subscribers access the system via the internet to set up an on - line game with other subscribers . the players then compete against each other normally via the game via an e - mail , or by accessing published results of the game , or by accessing the players &# 39 ; published career summaries . based on that automatically generated data , the verification system automatically determines the winner and awards the winner money or points .

the present invention , referred to as a verification system ( although it performs various other functions ), will now be described more fully hereinafter with reference to the accompanying drawings , in which some , but not all embodiments of the invention are shown . this invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided to illustrate the general invention concepts . in one embodiment , the invention is carried out by a programmed verification server having a high speed internet connection . accordingly , the hardware may be conventional . one skilled in the art can program a server to perform the processes described herein without undue experimentation . fig1 illustrates an example of a network in which players may set up games using the verification system , play the games on - line , and have the game results automatically verified . the verification system includes servers to set up the game and verify the game . in fig1 , player 1 represents a player at an x - box or playstation console or other type of video game console . player 2 represents another player at an x - box or playstation console or other type of video game console . the players are connected to the internet with a high speed connection such as cable or dsl . one of the players uses the console ( connected to a video display ) to access the worldgaming matchmaking website server 12 and is led through instructions to set up a competitive game with another player by issuing a challenge . ( the servers 12 and 14 identified in fig1 include all memory for storing data and the operating program used to carry out the processes described herein .) at least the game type , players , and start time are designated by the player . the other player is notified of the challenge by the worldgaming matchmaking server 12 e - mailing a message to the player , and the player accepts the challenge by effectively checking a response box and transmitting the acceptance to the matchmaking server 12 . both players must be registered with worldgaming ( the operator of the verification system ) and have player ids . once the match has been set up , any wagers , points , or other type of reward are verified as being available , and the match is confirmed to the players by an automatic e - mail generator . other aspects of fig1 will be identified during the below description of the game and verification process . the invention primarily relies in the verification - related aspects of the process . the present invention includes a system and process to automatically determine a game winner using one of several methods , depending on the game . this process and method is hereinafter referred to as automated game verification , or agv . at the early days of console video gaming players played against the computer . as the console and games evolved , players were able to play against one - another on a single console . as internet access became more universal , and bandwidth increased , the games transitioned to allow players to play against one - another online , no longer requiring them to be physically collocated . the most current trend in online console video gaming is to supply players with either per - game statistics and / or a career summary . for instance , some games , say a football video game , may show the user details about every game , such as points scored per quarter , possession time , etcetera . others may provide career details such as total touchdowns , total running yards , total wins , total losses , etcetera . the agv is a continuously running process , performed by the verification system ( identified in fig1 as the worldgaming agv server 14 ), that monitors scheduled games and attempts to verify their results using a game - specific verification algorithm . the scheduled games list ( sgl ) is provided via a website , set up by the worldgaming matchmaking website server 12 , that allows players to schedule head - to - head games , join multi - tier scheduled tournaments , participate in leagues , play as a team , and play in multi - player games . multi - tier tournaments and leagues support both head - to - head , teams and multi - player competitions . the scheduled games list ( sgl ) is ordered by earliest scheduled start time first and includes the following key data ( as well as additional data not required for the agv process ): game identifier ( gid )— identifies the game being played ( e . g ., nhl 09 , halo3 , madden 09 ). the player may select the type of game from a menu of games supported by the verification system , and the system automatically associates the game with the proper gid . competition identifier ( cid )— identifies the specific competition , which relates to entry fees to join the competition and payout to the winner . the cid may also be tied to specific game options . the verification system automatically assigns this cid . scheduled start time — identifies when the game is supposed to start . if this is a tournament , the start time is determined by the verification system . if this is a game set up by the players , the players enter a time of day and date for the start of the game . gaming window — identifies how long the verification system should look for results . this may be an automatic window based on typically game durations . the verification system may begin looking for result , for example , 30 minutes after the start time and stop looking 4 hours after the start time . competitor list — identifies who is participating in this game . the players are subscribers of the verification system and are given id codes . the game may be a head - to - head game , team game , or multi - player game . head - to - head game : player 1 vs . player 2 team game : ( player 1 - team 1 , player 2 - team 1 , . . . , playerx - team 1 ), ( player 1 - team 2 , player 2 - team 2 , . . . , playery - team 2 ), . . . ,( player 1 - teamn , player 2 - teamn , . . . , playerz - teamn ) multi - player : player 1 , player 2 , . . . , playern the gid provides game - specific information , such as , but not limited to : game name game logo game type — sports , first - person - shooter , racing , etcetera . game validation process ( gvp ) ( which may be customized for the particular game provider ) minimum playing time — the shortest amount of time a game may take . the cid provides competition - specific information , such as , but not limited to : gid competition type ( single game , multi - tier tournament , league ) competitor type ( head - to - head , team , multiplayer ) game options ( ranked or unranked , number of rounds / periods , duration of each ) competitor list ( same as sgl competitor list ) entry fee management fee winner rewards loser rewards if multi - tier tournament , then next game where the winner should be promoted . once the game is set up , the competing players then log onto the game console network 16 ( fig1 ), which would be a microsoft game network for x - box and a sony game network for playstation . this is conventional . the console network then configures the player consoles to communicate directly with the game server 18 run by the game operator , such as bungie , inc . for halo . the game is then initiated , with the game server 18 receiving game control signals ( e . g ., shooting commands ) from the various players and controlling the players &# 39 ; consoles to react in a coordinated manner to all the players &# 39 ; control signals . such game play is conventional . when the game is completed , the players log off , and the game validation process ( gvp ) is performed to determine the winner and award the winner a wagered amount , points , or other reward . the gvp is automatically performed by the worldgaming agv server 14 in fig1 . one function of a gvp is to provide duplicate - processing protection . consider a scenario where a set of players are playing multiple back - to - back games . depending on the spacing of the games and the gaming window , it is possible that a sgl will include multiple games with the same game options and competitors . the challenge to the verification system is to ensure that the correct games are validated and specifically that a single game - played may not cause multiple games to validate . the agv process iterates through the sgl and , for each cid , triggers the gvp for the specific gid . the agv process may also be responsible for the following tasks , although these are not required to fulfill its core function : cancel competitions that were not accepted by all parties notify players when their games were not validated by the expiration of their competition &# 39 ; s gaming window . notify players of upcoming competitions for which they are enrolled . there are currently three families of gvp , depending on how the game creators are supplying results . the verification system may , for example , use the gvp - det - online verification process for halo3 and the gvp - email process for a game that does not publish results . the three families are : 1 . ( gvp - email ) end - of - game emails being automatically sent from the players &# 39 ; gaming consoles , game console provider , or game server ( e . g ., for halo3 ). the console , game console network , or game server is preprogrammed to send the e - mail to the verification system &# 39 ; s e - mail address , and the contents and format of the e - mail are precisely dictated by a software program . 2 . ( gvp - det - online ) detailed results of each game are published online by the game server or game console provider and accessed by the verification system . 3 . ( gvp - sum - online ) player career summaries are published online by the game server or game console provider and accessed by the verification system . in one embodiment , the gvp - email process requires that players configure their games to e - mail the end - of - game results to a specific e - mail address . a menu walks the players through a form - filling process on their consoles . this may only need to be done one time for all future games of a certain type . ideally , the e - mail address is unique to each player , such as playerid @ website . com , where the player includes his id number in the address , but need not be so for this algorithm . this process requires that strict anti - spam measures be exercised to ensure forged results will not be accepted by the system . anti - spam measures are widely available and beyond the scope of this disclosure . in another embodiment , which is preferred since there is no player set - up , the game server sends an e - mail to the verification system ( e . g ., @ worldgaming . com ) after every game . some game servers are already configured to send an e - mail to the players at the end of the game , and the e - mail address is changed to the worldgaming . com address instead of , or in addition to , the player &# 39 ; s address . in another embodiment , the platform provider ( e . g ., x - box live ) may send the e - mail . a simplified example of an e - mail to the verification system may be : statistics ( detailed game statistics follow in the e - mail along with any other information pertinent to the game or connection ) the agv algorithm programmed in the agv server 14 performs the following steps to determine which game the e - mail relates and the outcome of the game : iterate through the verification system &# 39 ; s e - mail inbox scan each e - mail to determine whether it matches the associated gid this is performed by locating identifying patterns in the e - mail , such as the game name . determine game time ( if not present in the e - mail , then use the ‘ sent - time ’ in the e - mail headers ) determine whether the game time is within the range of the cid scheduled start time and gaming window extract game participants determine whether the participants match the cid competitor list check game status : was the game fully played ? was there a disconnect ? some heuristics for this are game - specific . for example , some games provide the total possession time for each competitor . since the cid includes game options , the algorithm can determine the expected total possession time , then add the possession time for each user to determine if the game was fully played . heuristics can also be established to say that even if a game was disconnected , but still x % complete based on duration , possession time , or any other metric , that the system should count the results as valid . if all the above conditions are met , then a potential match between the e - mail and the game has been found . the only remaining steps are to extract from the e - mail the score ( and therefore winner ), and determine whether this e - mail is a duplicate of an e - mail for the same game but from a different user . this is not an issue if the game server sent the e - mail . score extraction is a game - specific text pattern - matching exercise . the e - mail format is predefined and the score for a certain game will typically always occur at a specific relative position in the e - mail . fig2 a and 2b are a flowchart describing a verification routine using an e - mail sent by the game server to the verification system to determine the game winner . in step 20 , the gvp - email routine starts . the routine will be repeated if the game on the sgl is not detected . in step 22 , the agv server &# 39 ; s e - mail inbox is checked . if it is empty ( step 24 ) the process keeps looping to check the inbox . if there is an e - mail , the game id ( gid ) in the e - mail is detected in step 26 ( e . g ., words in the e - mail matched with corresponding game names in a look - up table ). if the detected game time ( step 28 ) of the competition ( identified in the agv server 14 as a competition identifier ( cid )) occurred within a certain window after the scheduled start time in the sgl ( step 30 ), it is determined that the e - mail still may be directed to the game in the sgl . in step 32 , any game options in the e - mail are cross - referenced to the cid game options . if there is a match , the competitors listed in the e - mail are extracted ( step 34 ), to determine whether they match the competitors in the cid ( step 36 ). if there is a provision for a team - based game to allow short - handed teams , a partial match of the players to the cid will not prevent the verification process from proceeding ( step 38 ). in step 40 , it is determined from the e - mail whether the game was disconnected before completion . if not , the verification process continues . if so , certain rules ( heuristics ) are applied ( step 42 ) to determine whether the game should count anyway , such as if the game was almost complete or if one player intentionally stopped the game when losing . if the game should not count , the game is classified as an invalid game and is ignored ( step 43 ). the above process provides assurance that the e - mail is directed to a particular game on the sgl . the scores are then extracted from the e - mail ( step 44 ). if the game is determined to be not tied ( step 46 ), it is determined whether the e - mail is a duplicate ( step 48 ) by looking up in a cache ( step 50 ) whether the same scores , competitors , and game options were presented in a recent earlier e - mail . if the e - mail has been determined to not be a duplicate , the scores are validated ( step 52 ) and acted upon by the agv server 14 , such as by awarding the winning player money or points , publishing the results on a webpage , and ranking the players . if the e - mail is determined to be a duplicate , the e - mail is ignored ( step 54 ). if the game is a tie game ( step 46 ) and the game time is still within a gaming window time ( step 56 ), the players are presented with an option of replaying the game within the game window time ( step 58 ). if the game window has expired , the players are notified about options such as rescheduling the game , cancelling the game , or contacting customer service for more options ( step 60 ). the above - described gvp - email process contained steps to ensure that a duplicate e - mail will not be processed . consider a scenario where player 1 and player 2 are scheduled for two competitions of the same game and options . the first competition is scheduled for 4 : 00 pm and the second at 4 : 30 pm . now assume that there are e - mail delays , and results e - mails ( automatically sent by each of the game consoles ) are received by the verification system at 4 : 20 pm , 4 : 45 pm , 4 : 52 pm , and 5 : 31 pm . the challenge is to ensure that the correct e - mails validate the correct competition . assume that the four e - mails validated competitions 1 , 1 , 2 , 2 , respectively , or 1 , 2 , 2 , 1 , respectively — there must be an algorithm to avoid mistaken validation of game 1 or 2 . to achieve this protection , the verification system &# 39 ; s gvp - email process contains a cache of the validated competitors list , cid , scores , and extracted game options and game - specific unique information ( such as home / away teams , etcetera ) from past e - mails and other sources . at the end of its validation process described earlier , and right before validating a cid ( i . e ., verifying game results ), it determines whether the same data points were ‘ recently ’ seen . the ‘ recently ’ parameter is adjustable and , through testing , it was determined that 2 hours was a reasonably successful timer . therefore , repeat e - mails will essentially be ignored as applying to a game already processed by the verification system . the gvp - det - online process does not use e - mails for verification of scores and does not require players to configure anything on their side . instead , the verification system polls an online location where detailed game results are published by the game authors ( a trusted source ). this location may be the halo server having a website at bungie . net , for example . the publication of the game results by the game server on a website is conventional . the player &# 39 ; s registered id for the game server is automatically entered by the verification system after accessing the game server website after a game in order to access the player &# 39 ; s personal game statistics . a simplified example may be as follows , which shows the general format of the game results . the agv server 14 ( fig1 ) may be programmed to know the formats used by each game website to more easily extract the pertinent information to validate the game results . select a player from the competitors list ( this step is also used in duplicate - processing protection , discussed below ). pull recent games for this player from the online source ( e . g ., halo server , mlb09 server , etc .). determine game time determine whether the game time is within the range of the cid scheduled start time and gaming window extract game participants determine whether the participants match the cid competitor list check game status : was the game fully played ? was there a disconnect ? some heuristics for this are game - specific . for example , some games provide the total possession time for each competitor . since the cid includes game options , the algorithm can determine the expected total possession time , then add the possession time for each user to determine if the game was fully played . heuristics can also be established to say that even if a game was disconnected , but still x % complete based on duration , possession time , or any other metric , that the system should count the results as valid . if all the above conditions are met , then a likely match has been found . the only remaining steps are to extract the score ( and therefore winner ), and determine whether this result was already processed to validate a different game . score extraction is a game - specific text pattern - matching exercise . since the game server website typically contains information in a certain format , it is easy to associate the data with its significance . fig3 a and 3b are a flowchart showing the gvp - det - online process used to determine the game winner . in step 62 , the routine starts . the routine will be rerun if the game results for a game listed on the sgl are not found . since the game server webpage for the particular game played will list all players , only one of the players needs to be identified to pull up the pertinent webpage . in step 64 , the competitor with the smallest ( numerically lowest ) player id number is used . the particular competitor is arbitrary , but only one is selected . in step 66 , the last fetch time for games played by that player is obtained from the cache . in step 68 , all games involving that player published by the game server prior to the last fetch time are ignored . in step 70 , any games played by that player within a time window after the cid listed on the sgl are considered for being the target game on the sgl . if no games appear , then the game server website has not published the results ( step 72 ), and the last fetch time is updated ( step 74 ). if a game is detected in step 70 , it is determined from the webpage whether the game options match the cid game options in the sgl ( step 72 ). if so , the competitors are extracted from the web page ( step 74 ) and matched to the competitors on the cid ( step 76 ). if there is a match , the game is assumed to be the target game on the sgl , and the scores are extracted from the webpage ( step 44 ). steps not specifically discussed in fig3 a and 3b are identical to the same - numbered steps in fig2 a and 2b and need not be repeated . in step 78 , the “ last fetch time ” is updated in the cache to the start time of step 62 for the particular competitor identified in step 64 . in another embodiment , the platform provider ( e . g ., x - box live ) may publish the game results , and the verification server accesses that webpage . the above - described gvp - det - online process contained steps to ensure that a duplicate e - mail will not be processed . consider a scenario where player 1 and player 2 are scheduled for two competitions of the same game and options . the first competition is scheduled for 4 : 00 pm and the second at 4 : 30 pm . now assume that the results are published at different times for the two users , for example at 4 : 20 pm and 4 : 45 pm for player 1 and 4 : 52 pm and 5 : 31 pm for player 2 . the challenge for the verification system is to ensure that the correct results validate the correct competition . to achieve this protection , the gvp - det - online process contains a map of each player and the last time the system fetched its list of recent matches . when the gvp selects “ a player from the competitors list ,” it uses an algorithm that , given the same set of players multiple times , will deterministically return the same player every time . there are multiple ways of achieving this , such as selecting the smallest playerid ( i . e ., the lowest player id number amongst the competitors ), largest playerid , first playername in alphabetical order , last playername in alphabetical order , etcetera . the exact method is not important , but the fact that the selected player is consistent is a requirement . this selection ensures that , when a competition with a set of players is validated , a particular player will be used to fetch the recent games , which avoids all potential duplicate - processing issues because identical results from that player will not be used to validate two games . the gvp - sum - online process , like the gvp - det - online process , does not require players to configure anything on their side . instead , the system ( the agv server 14 ) polls an online location where a player &# 39 ; s career summary statistics are published by the game authors ( a trusted source ). the publication of the career summary statistics by the game server on a website is conventional . the player &# 39 ; s registered id for the game server is automatically entered by the verification system after accessing the game server website after a game in order to pull down the player &# 39 ; s personal career summary statistics . a simplified example may be as follows , which shows the general format of the game results . the agv server 14 ( fig1 ) may be programmed to know the formats used by each game website to more easily extract the pertinent information to validate the game results . the gvp - sum - online algorithm performs the following steps at the beginning of each sgl scheduled start time . it is only performed one time per cid : the above information provides the initial state for each competitor . since only summary information is available , the algorithm must continuously fetch career summaries until all players &# 39 ; “ games played ” increases by one , and then use the “ career winnings ” and “ career losses ” fields to determine who recently won a head - to - head , multi - player or team - based game . this algorithm can also ensure that all team members participated , since it requires all the competitors to have an additional “ games played ”. the algorithm must also adapt to scenarios such as one player running late and finishing a prior game right after the scheduled start time , causing his games - played to increase by one , but none of the other players &# 39 ; games to increase . the algorithm maintains all the players &# 39 ; states so that , if it sees that in order to validate the game it requires one player to increase games - played by more than others , it will only utilize the most recent changes to determine winners / losers . fig4 is a flowchart showing the gvp - sum - online process used to determine the game winner . in step 82 , the routine starts . the routine will be rerun if the game results for a game listed on the sgl are not found . in steps 84 , 85 , 86 , and 87 , an initial state ( career summary ) for all competitors of a particular game on the sgl is first set prior to game play . this will require accessing the players &# 39 ; career summaries from the game server website using the players &# 39 ; id codes for that game server website . once the initial states are set , and after it is assumed the game has been completed and the career summaries updated by the game server website , the website for one of the competitors ( step 90 ) is selected to determine if there has been a change in his career summary ( step 92 ). if there has been no change , no result is obtained ( step 94 ) and the routine loops until a change has been detected . if a change has been detected , the current states ( i . e ., the states updated after the game ) for all the competitors are fetched from the website ( step 96 ). in step 98 , it is determined whether all the competitors &# 39 ; career summaries have been updated from the initial state ( either wins or losses will be + 1 ). if not , the initial state is replaced with the current state ( step 100 ) and the routine loops until all the competitors &# 39 ; career summaries have been updated by the game server after the game . once it is determined that all the competitors &# 39 ; career summaries have changed , the agv server 14 determines the winner ( s ) and loser ( s ) of the game by comparing the current wins and losses for each competitor to the initial states ( step 102 ). the players &# 39 ; results are then validated ( step 104 ) and winners are awarded appropriately by the agv server 14 by , for example , crediting their account with any waged amounts by the players . in another embodiment , the platform provider ( e . g ., x - box live ) may publish the career summaries , and the verification server accesses that webpage . fig5 a and 5b are a flowchart showing an overall process for registering , setting up games , and automatically verifying results . in steps 110 and 112 , a player accesses the worldgaming website to register . part of the registration process is the player identifying his player id ( s ) for accessing his personal game statistics from game server websites so the verification system can automatically access game information to determine who won games . for the embodiment where the player &# 39 ; s console , game console provider , or game server sends an e - mail to the agv server 14 after a game , this e - mail set - up may also need to be performed by the player . upon registration , all users will have their own dedicated home page that displays all their gaming details . other users can view these pages and scope out their competition and leave comments on the comment board or add other users as friends etc . all profile pages also have challenge buttons on them . if a user clicks challenge , a challenge card opens that first asks that user to select a game that both users have in common . from here they are able to set all the details of the match and then issue it to the other user . the other user is then notified through e - mail via the worldgaming . com notification system . the other user can open the proposed challenged and chat live in real time with the other user and confirm all the match details and then accept the match . in step 114 , it is determined whether the player wants to play for cash or points . if the player wants to play for cash , the player deposits money into an account ( steps 116 , 118 ). the player is now registered and can set up challenges with other subscribers . in step 120 , the player enters the worldgaming website and looks through “ lobbies ” for supported games and tournaments . the player then schedules a match time with another player or enters a tournament ( steps 122 , 123 , 124 , 125 ). competitors may be automatically matched by worldgaming based on the players &# 39 ; rankings the player may meet the opponent on - line ( step 126 ) in a chat room . there are three ways for users to issue / receive a challenge online : 1 . through the game lobby , all players online challenge process 2 . through the game lobby , fast play 3 . through active avatars and player profile pages every game offered on the site has its own dedicated lobby that displays all users who are currently online on the website and have that specific game in their games list . the lobby displays the following user information : worldgaming . com username , site reputation , amount they like to play for , and a taunt . by clicking the challenge button , a challenge card is activated that allows the user to set the preferences for the selected game and use the challenge to the other user . the challenge card then acts as a live chat where the users are able to chat in real time and talk about the details of their game . the users then agree to the setting of the game and agree to the site &# 39 ; s terms or service . the users are then issued a game confirmation number and are ready to go play the game . there is a fast play button located in every lobby . clicking “ fast play ” pulls up a challenge card that allows the user to set the details of the game they want to play . instead of issuing the challenge to another user , fast play creates an open match that resides under the open match tab in the game lobby . all users can browse the open matches and then view the user they will be playing against and all the details of the match . upon another user joining the open match both users are then set to play the game and issued confirmation details . in step 128 , the game is played at around the scheduled time . this is performed by the players independently of the verification system , and the players use conventional game networks set up by microsoft , sony , and other game console providers to play the on - line game . the agv server 14 ( fig1 ) then verifies the result of the game , using the processes described above and in fig2 a and 2b , 3a and 3b , and 4 . such steps are identified by steps 131 - 137 in fig5 a and 5b . after the results are validated , the avg server 14 then determines if the game was a money game ( step 140 ) and , if so , allocates the funds and game management fees ( e . g ., 10 %) ( step 142 ). if the game was not a money game , the server 14 allocates points , bonuses , or other rewards to the player ( s ) ( step 144 ). if the game is a multi - tier tournament game ( step 146 ), the winner of the round is notified ( step 148 ). in step 150 , the competitors are notified of the results of the game . the process then ends ( step 152 ) until another game is played . having described the invention in detail , those skilled in the art will appreciate that , given the present disclosure , modifications may be made to the invention without departing from the spirit and inventive concepts described herein . therefore , it is not intended that the scope of the invention be limited to the specific embodiments illustrated and described .

US-201414499863-A

an optical scanning device is provided . the optical scanning device an excitation light source that is operable to illuminate the object to be scanned . an image detector is operable to detect excited emission rays through illumination of the object to be scanned by the excitation light source and imaging optics that dictate a focal distance . the image detector detects a scan image of the emission radiation of the object to be scanned with the highest level of image sharpness if the focal distance is maintained . a control device includes a distance sensor through which a distance between an optical scanning device and the object to be scanned can be measured , wherein maintenance of the focal distance as the function of the measured distance can be checked by the control device .

fig1 shows one application of an optical scanning device embodied as a fluorescence scanner 1 . a patient 4 to be examined is covered by an operating ( op ) drape 7 and lies on an op table 5 . a surgeon 3 works on a region of the body of the patient 4 through an opening of the op drape 7 . the surgeon 3 holds in his hand a mobile battery - operated fluorescence scanner 1 . the scanner 1 allows the surgeon 3 to examine regions of the body to be treated . the middle part of fig1 illustrates the scan region 8 of the patient 4 to be examined in an enlarged view . in one embodiment , the patient 4 is covered by the op drape 7 except for an opening in the op drape 7 over the scan region 8 . the surgeon 3 directs the fluorescence scanner 1 centrally onto the scan region 8 , which is visible and accessible through the opening . in one embodiment , data recorded by the fluorescence scanner 1 is transmitted wirelessly to a pc workstation 9 . the wireless transmission is illustrated in fig1 . in one embodiment , the pc workstation 9 displays the received data of the scan region 8 on the screen . the surgeon 3 may view the fluorescence scan results on the screen of the pc workstation 9 . the scan results are immediately available for inspection . if necessary , the surgeon 3 can orient his operation strategy or planning in accordance with the fluorescence scan results . to allow orientation in the image in one embodiment , the optical presentation of the fluorescence scan is superimposed by a display of the same visible area or the same scan region 8 as a normal image in the visible wavelength range . for example , using the image in the visible wavelength range , the surgeon 3 may recognize details of the scan region 8 on the screen and , using the superimposed fluorescence scan , the surgeon 3 can assign the result of the scan to the actual visible points of the scan region 8 . the superimposition of an image recorded in the visible wavelength range may be useful if the fluorescence lies in a non - visible wavelength range , for example , ir . in one embodiment , the fluorescence scanner 1 includes a display 18 on which the image data of the scan region 8 is reproduced . the display may be embodied as an lcd display . the reproduction corresponds to that shown on the pc workstation 9 . by looking at the display 18 , the surgeon 3 can accurately orient the fluorescence scanner 1 to the scan region 8 . the surgeon 3 may only be able to detect details of the fluorescence scan on the pc workstation 9 because of the respective size of the display . in one embodiment , the fluorescence scanner 1 includes a control device ( not shown in any greater detail ) which has a distance checking indicator 19 integrated into the display 18 . the distance checking indicator 19 indicates a predetermined distance between the fluorescence scanner 1 and the scan region 8 . the predefined distance is produced based on the focal distance of the imaging optics of the fluorescence scanner 1 and represents that distance at which , within the limits of the optical quality of the imaging optics , the greatest possible image sharpness for images of the scan region 8 is able to be achieved . in one embodiment , the distance checking indicator 19 may include a display element , which is integrated on the display 18 , into the presentation of the fluorescence scan or of the area of scan region 8 . for example , a presentation element highlighted in color , for example , a circle , a cross - hair , or a bar , may be included on the presentation of the fluorescence scan . the presentation element turns a particular color , for example , green , if the predetermined distance is maintained . in one embodiment , the distance checking indicator 19 includes an additional indicator , such as an led , which is arranged to shine through , behind , or near the display 18 in the distance checking indicator 19 . in this embodiment , by illuminating in a specific color or by changing its color , the additional indicator indicates the maintenance or non - maintenance of the predefined distance . fig2 is a perspective view of one embodiment of a fluorescence scanner 1 . the top cover of the housing is omitted from fig2 . in one embodiment , as shown in fig2 , the fluorescence scanner 1 includes a handle 16 which can be held by the surgeon 3 . a switch 17 is disposed on the handle 16 . the switch 17 allows the surgeon 3 to manually actuate a fluorescence scan . in one embodiment , the fluorescence scanner 1 includes excitation light sources 11 , 11 ″, 11 ″, 11 ′″ that are arranged in the front area , which is opposite the distance checking indicator 19 , so that they can illuminate an area approximately 6 to 10 cm away from the unit . the excitation light sources 11 , 11 ′, 11 ″, 11 ′″ are arranged at an angle of around 45 ° with respect to the front panel . this embodiment may produce an optimum working distance , for example , no contact is to be made with the scan region 8 and the distance from the scanner 1 to the scan region 8 does not demand too high of excitation light intensity . in one embodiment , the excitation light sources 11 , 11 ′, 11 ″, 11 ′″ are based on halogen lighting media . in another embodiment , the excitation light sources 11 , 11 ′, 11 ″, 11 ′″ are based on leds ( light emitting diodes ) because halogen lighting media is not generally able to be operated with short switching times . since an individual led has a comparatively low luminous intensity , each of the excitation light sources 11 , 11 ′, 11 ″, 11 ′″ includes an led array that has around 60 leds . each of the total of four led arrays has an overall light output of around 0 . 25 to 1 watt . in one embodiment , the fluorescence scanner 1 includes a lens 12 that is aligned toward the front . fluorescent light and also normal light and ambient light reach the fluorescence scanner 1 through the lens 12 . the lens 12 implements a specific focal distance of the imaging optics , for example , a distance at which the greatest image sharpness is obtained . in one embodiment , the focal distance is of an order of magnitude of between 1 and 40 cm . in one embodiment , the depth of field , that is the focal distance range within which images with high image sharpness are able to be detected , is predetermined by the lens 12 in combination with the shutter to be set by the construction , or if necessary by an adjustable shutter . in one embodiment , an adjustable shutter includes an iris or leaf shutter . if an adjustable shutter is not provided , the shutter opening is provided by the radial restriction of the beam entry of the imaging optics , especially through the mounting of the lens 12 as well as by the front - side opening of the fluorescence scanner 1 , through which the beam path passes . because of the normally low luminous intensity of the fluorescence to be detected , a large aperture is usually provided which causes an increase in the light intensity , but brings with it a reduction in the depth of field . in one embodiment , the control device includes a distance sensor 20 arranged on the front of the fluorescence scanner 1 . in this embodiment , the adherence to the focal distance predetermined by the imaging optics is able to be checked . the distance sensor 20 may be embodied as an ir sensor . in an alternative embodiment , the distance sensor 20 may be embodied as a laser , ultrasound or radar sensor . the distance between target scan region 8 and fluorescence scanner 1 is measured using the distance sensor 20 . the distance sensor 20 measures distances of the order of magnitude of the focal distance of the imaging optics . depending on the measured distance and the focal distance of the imaging optics , the distance checking indicator 19 is activated . in one embodiment , the incident light passes through a filter 13 after the lens 12 . in this embodiment , the fluorescent light is not outshone by the ambient light . in one embodiment , the filter 13 only allows light in the wavelength range of the fluorescence to pass through it , for example , during a fluorescence scan . in one embodiment , a filter changer ( not shown in any greater detail in the figures ) removes the filter from the path of the beam so that light in the visible wavelength can pass through . in this embodiment , an image in the visible wavelength area may be recorded . depending on the optical characteristics of the overall construction , the filter can be omitted for recording on the basis of visible light or , alternatively , another filter can be placed ( swapped ), for example , by the filter changer , into the path of the beam . in one embodiment , the filter changer may include a hinged flap or rotation mechanism . in one embodiment , light that passes through the filter 13 reaches the image detector . the image detector is based on a digital technology and may be embodied as a ccd camera . the ccd camera 15 is able to record images both in the wavelength range of visible light and also in the wavelength range of fluorescence . the image data recorded by the ccd camera 15 is received by a data recording unit . the data recording unit wirelessly transmits the image data to external equipment . the data recording unit 14 may include a memory that stores scanned images . the scanned images can be either used by default or only used if a data connection to outside equipment is not available . in one mode of operation , the fluorescence scanner 1 is initially operated such that normal images are recorded in the visible wavelength range ; for example , either no filter 13 or a filter 13 which lets the visible light pass through it is arranged in the path of the beam . the surgeon 3 initiates a fluorescence scan by pressing the switch 17 after he has aimed the device at the region of the body 8 in question , which he can do with the aid of the recorded optical image . the current image in the visible wavelength range is stored . a filter 13 , which only allows light in the fluorescent wavelength range to pass through it , is then arranged ( swapped ) in the path of the beam . the excitation light sources 11 , 11 ′, 11 ″, 11 ′″ are activated and a fluorescence scan is stored . this sequence , if it is undertaken sufficiently quickly , allows the storage of an optical and a fluorescence recording to be achieved essentially with a matching angle of view , which can then be superimposed over each other . the superimposition ( fusion ) can also be supported by an algorithm which can compensate automatically for slight deviations in the image position . in one embodiment , the control device , which includes the distance sensor 20 and the distance checking indicator 19 , is integrated into the data recording unit 14 . the control device can , for example , be embodied as a software control or can be hard - wired as a hardware module , for example , as an asic ( application specific integrated circuit ), as a cmos circuit or another suitable electronic circuit . the control device uses the distance sensor 20 to record the distance to the scan region 8 , in order to support maintenance of a distance which matches the focal distance of the imaging optics . in one exemplary embodiment , the surgeon 3 can check the distance by checking the distance checking indicator 19 and only actuating a fluorescence scan if the correct distance is maintained . in another exemplary embodiment , the distance is checked automatically by the control device with the initiation of a fluorescence scan by the surgeon 3 only being enabled if the correct distance is maintained . in this exemplary embodiment , despite the switch 17 being pressed , no scan is initiated . in another exemplary embodiment , a fluorescence scan is initiated by the control device as soon as the surgeon 3 has pressed the switch 17 and the correct distance has been set . in this embodiment the actual initiation of the scan can thus also actually be undertaken after a delay once the switch 17 has been pressed , namely at the point at which the correct distance is set after the switch 17 is pressed . in another exemplary embodiment , the scanner 1 operates in a pulsed operation , in which not just a single image is recorded , but an automatically pulsed series of a plurality of images are recorded . in this embodiment , an individual pulse , which records an individual image , is only triggered by the control device when the correct distance is maintained . the pulse sequence can be initiated , however , by pressing the switch 17 , for example , once or continuously . in one embodiment , the recording of an image is initiated independently of maintaining the correct distance whenever the switch 17 is pressed in pulsed operation at each pulse . however , the individually recorded images are marked by the control device depending on the respective distance , so that it is possible to recognize afterwards which images have been recorded at the correct distance . it is then , for example , possible to discard images recorded at an unsuitable distance , not to display them or not to store them . this embodiment makes it possible to evaluate images in accordance with the degree of adherence to the correct distance . in this embodiment , a better evaluated image can be used in each case , but a slightly less well evaluated image can be rejected . fig3 is a side view of the fluorescence scanner 1 . in one embodiment , as shown in fig3 , the fluorescence scanner 1 includes a handle 16 , a switch 17 , and excitation light sources 11 , 11 ″, 11 ′″ arranged on the front of the housing . as shown in fig3 , the excitation light sources 11 , 11 ″ are set at an angle of around 45 ° in relation to the housing . the distance sensor 20 can be seen on the front of the fluorescence scanner 1 . a dashed arrow indicates that the distance sensor 20 measures a distance on the front of the fluorescence scanner 1 . in one embodiment , the distance sensor 20 is disposed so that the distance between the fluorescence scanner 1 and the scan region ( not shown here ) can be measured . in one embodiment , as shown in fig3 , the display 18 is arranged on the back of the fluorescence scanner 1 . however , the fluorescence scanner 1 can , depending on the area in which it is to be used and to reduce the costs , also be embodied without the display 18 . in one embodiment , as shown in fig3 , the distance checking indicator 19 is arranged on the back of the fluorescence scanner 1 . the distance checking indicator 19 may be integrated into the display 18 or independent of it . the distance checking indicator allows a surgeon 8 to keep an eye on the distance checking indicator 19 when creating a fluorescence scan . in one embodiment , the distance checking indicator 19 is disposed on the back of the unit . the back of the unit is a suitable location for the checking indicator 19 because the fluorescence scanner 1 is generally held close to the scan region 8 . in one embodiment , the distance checking indicator 19 is disposed on a side or on the top of the fluorescence scanner 1 . in alternative embodiments , instead of a distance checking light 19 , a mechanical ( vibration ) or acoustic ( buzzer ) indicator can be provided . in one embodiment , the distance indication can be dispensed with entirely if the checking of the scan triggering is undertaken automatically as a function of maintaining the relevant distance . one embodiment of the invention can be summarized as follows . an optical scanning device includes an excitation light source with an image detector , and with imaging optics that dictate a focal distance , which , when maintained can detect a scan image with the greatest image sharpness . in one embodiment , the scanning device features a control device that includes a distance sensor through which the distance between the optical scanning device and the object to be scanned can be measured . a maintenance of the focal distance as a function of the measured distance is able to be checked by a control device . the checking of the maintenance of the focal distance by the control device can assist the user in a recording scan images with high image sharpness . in a further embodiment , the control device can suppress a triggering of the detection of a scan image or a storage of a scan image . in a further embodiment , the control device includes a distance checking indicator by which the maintenance of the correct focal distance can be displayed . in a further embodiment , the scanning device is embodied as a fluorescence scanner .

US-69972207-A

a system and method is provided to accurately treat sites on an eye &# 39 ; s retina employing computer based image generation , processing and central control means in conjunction with diode laser sources and optical fibers . the system and method accurately determine geometry of a treatment zone of a specific eye &# 39 ; s fundus and adjust a treatment beam to irradiate the treatment zone with minimal coverage of adjacent well tissue . the treatment zone or zone is accurately determined with digital processing of angiographic data and slit lamp image data . this information is integrated with information on the treatment beam characteristics to better match treatment beam coverage with minimal overlap with healthy areas of the fundus . additionally preferred embodiments also have the ability to automatically track eye movement and switch the beam source depending on eye movement , adjusting the beam spot area in real time .

the accuracy of the treatment of the fundus of an eye can be drastically enhanced by the combination of diagnostic means with a therapeutic setup . the therapeutic setup consists of a light source , preferably a fiber coupled diode laser and a suitable optical systems which allows one to vary the spot size generated on the retina . the diagnostic device is preferably a slit lamp with an additional optical setup to allow direct fundus viewing through an eyepiece and simultaneously the generation of a digital image of the fundus . the digital image of the fundus is grabbed by a computer based image processor and an image generation device , preferably a ccd camera . from this image the size of the treatment zone can be determined and electronically processed . the treatment beam spot area is variable and a digital image of the fundus is generated with the a simulation of the treatment beam at a fixed position of the treatment beam spot area varying optical system . from these two images it is possible to adjust the treatment beam spot area to the actual treatment zone size . further , if the treatment zone is not sufficiently clearly definable in the generated diagnostic image , it is a subject of the invention to include a digital image generated by means of fluorescence angiography , align this image which is characterized by an extremely high quality to the image obtained by the diagnostic means in the claimed treatment device and determine the necessary treatment beam spot size from the treatment zone area that is visible in the image obtained by fluorescence angiography . all points mentioned can be either implemented in an automatic way or require manual settings by the operator , or be realized in a combination . several methods to generate a variable beam spot area on the retina are also subjects of the invention . fig1 illustrates the setup of the whole device with all elements that are necessary to perform treatments of age related macula degeneration by optical means . for reasons of simplicity only the basic elements of the patients eye one are included in the figure , which are retina 2 and lens 3 . on retina 2 an image is formed which is originated by optical radiation entering the eye being imaged basically by lens 3 . for successful laser treatment contact lens 4 is placed at the cornea of the patients eye which minimizes possible eye movements and enables the laser radiation to enter the eye with out damaging the cornea and with enhanced imaging properties . also for reasons of simplicity the complex optical system present in contact lens 4 is not shown . in any case contact lens 4 has a certain refractive power as is well known in state of the art laser treatment of the retina . several different kinds of radiation are imaged on retina 2 . one is treatment laser radiation 5 . this radiation is originated by laser system 14 , preferably a diode laser and coupled into optical fiber 13 which has a well defined core diameter and numerical aperture . optical fiber 13 is a preferred element , because it simplifies the device and helps to shape treatment radiation 5 to the desired “ top - hat ” form with very sharp rising and falling intensity profiles at the edges and a plateau like near constant intensity elsewhere . radiation 5 emitting from the fiber end is collimated by an optical system and optionally imaged to obtain a desired beam profile . none of these optics is a necessity , in fact quite a number of possible systems with an arbitrary number of lenses or even without any lenses can be used according to the targeted problem . beam source 14 uses another feature : it contains an optical system which allows for coupling the radiation of a secondary light source into optical fiber 13 . this secondary light source preferably has a different wavelength and typically provides a much lower optical power than the treatment source . this additional light source bears the advantage that the visibility and thus the viewing possibilities are enhanced drastically because , due to the retina &# 39 ; s optical characteristics , the treatment beam is sometimes hard to observe . using viewing sources at a different wavelength resolves this problem , because the wavelength can be chosen in order to obtain the maximum viewing quality . optional viewing radiation 16 is preferably imaged via optical system 10 as is treatment beam radiation 5 itself . for reasons of better visibility the secondary radiation is illustrated on a different optical path parallel to the primary radiation , though it can in general also take the same path depending on the optics . both types of radiation pass through beam adjustment device 12 . the secondary radiation creates image 11 on the retina , which does not necessarily coincide with image 15 created by the treatment radiation itself . never the less , since the radiation properties are known , it is possible to determine the treatment image from the secondary image . the design of optical system 12 is a subject of the invention and is now described in detail . common to all these embodiments is that adjustments by optical system 12 are not static ones but are variable to create variable images on retina 2 that have varying beam spot areas . it is common in laser based eye treatment methods to allow simultaneous viewing { inspection ) of retina 2 . therefore , means of a slit - lamp are included in the device . in its simplest form , a slit lamp consists of light source 8 with a collimating optical system generating illumination radiation 7 with suitable optical characteristics . mirror 9 is located at 45 degree with respect to the optical axis . the purpose of mirror 9 is to image the illumination into the eye . the illuminated area can be viewed along mirror 9 with back propagating image radiation 17 passing the slit of mirror 9 and entering optical system 18 fulfilling imaging purposes . radiation 7 is chosen such , that it can pass through dichroic mirror 6 which is chosen highly reflective for treatment radiation 5 and optional secondary radiation 16 , but not totally reflective , hence small parts of both , the treatment radiation 5 and secondary radiation 16 returning from retina 2 can pass through the mirror and contribute to the viewing means . additional filters 19 can be optionally included in the path of viewing radiation 17 in order to enhance the quality or observing selectively only the result of one kind of radiation . beam splitting means 20 is placed in the general optical system behind primary optics 18 . a part of the radiation is mirrored into first secondary optical system 23 which creates an image on the detector area of digital image generation means 24 , preferably a ccd camera . another set of filters 19 can be applied in the path . the other part contributes via secondary optics 21 to a direct viewing by the operator , preferably a physician , via ocular 22 . as described earlier , the state of the art suffers from several deficiencies which basically originate from the fact that the area of the treatment zone cannot be determined accurately and thus all treatment beam spot size variation methods are rudimentary and produce an error up to 600 %. one significant innovation being subject of the invention has already been mentioned above : beam area generation means 10 are of a more sophisticated nature than in the prior art . fig2 shows more elements that are part of the device to allow highly accurate treatment of the fundus of an eye . a central processing unit , preferably a pc in a desktop or an embedded form is used to control the incoming data from viewing devices 24 and to control the beam area generating variable optical system 12 accordingly . one or more display units 27 are connected to processing unit 25 to display the viewing data , external data and to perform operations in order to optimize the treatment procedure . to minimize the error in the treatment mentioned above , the device is such , that in several steps the treatment area is first determined in a relative way concerning the optical system being responsible for imaging the treatment beam to the retina and then the beam spot area is adjusted in the same relative way . this avoids a large source of error in the prior art , because the operator takes the treatment area from an image generated with fluorescence generated under different conditions , than present in the laser treatment device and in particular not very well known . to overcome this , a digital image using slit - lamp device 9 and digital image generation means 24 is taken . further , another digital image is taken with the retina irradiated preferably by secondary light 16 with the optical system being responsible for setting up the treatment beam area on the retina in a pre - determined basic position . alternatively , the treatment beam light can itself can be used , but at significantly lower radiation power . however , due to reasons of visibility explained above , the use of a secondary light source is preferred . from this image the spot size of treatment beam 5 can be precisely calculated in relative coordinates to the slit lamp generated image . further , a digital image without treatment radiation 5 or secondary radiation is taken at near equal time , meaning that the image is taken within a time interval short enough to assure , that the eye did not move . alternatively a true equal time image can be taken using either digital image filtering means or using real filters and more than one digital image recording device . from this image the treatment zone may be determined with sufficient accuracy . if so , the operator marks the treatment zone with a simple software tool and the computer calculates the accurate size and coordinates . applying a simple method , the operator can then use this data to manually adjust the beam area spot size with suitable optical system 12 , which may be guided by electronic aids such as acoustical or optical signals . an even more accurate method is to have central processing unit 25 control optical system 10 . the treatment beam parameters are also provided by central processing unit 25 . the operator can now use manual positioning means 28 to locate the beam spot area center to a predetermined position within the treatment zone , preferably the center or one of the edges . as in the prior art , he can stop and start the treatment beam with a second external control , preferably a foot - piece , and simultaneously inspect the fundus in order to decide , if the treatment area and the treatment beam are aligned or if this alignment has been disturbed by eye - movement . a significant difference and advantage over the state of the art is , that the viewing can also be done via the digital image generated in real - time and illustrated on display unit 27 . digital image processing can enhance the image quality , and electronic image detection means 24 is more specifically sensitive to the applied wavelengths . another subject of the invention is to align the image generated by the slit - lamp means to a diagnostic image generated by means of fluorescence angiography . slit lamp generated images are generally of medium quality and , depending on the status of the disease and the specific eyeball , the treatment zone can hardly be seen or may not be determined with sufficiently high accuracy . therefore a digital angiography image is loaded onto central processing means 25 and displayed on display device 27 . as before , simultaneously or quasi simultaneously a slit lamp image is taken with and without the treatment beam spot and also displayed for the operator . from a minimum of two characteristic points like blood vessel crossings which may be marked by the operator himself , the central processing unit aligns the two images , since they are in general of different form , because the optics or the eye position may vary . the operator further marks the treatment zone in the angiography image , which can be done with high accuracy . these coordinates are then calculated back to coordinates of the slit lamp picture and the system is able to calculate how optical system 12 responsible for the treatment beam spot generation must be adjusted in order to achieve high overlap accuracy . as described above , the adjustment can be performed manually with possibly electronic aids or fully automatically . in a preferred embodiment the complete adjustment , including the positioning of the beam spot to the treatment area , the treatment process and the treatment control is performed automatically by the central processing unit on the basis of a real - time viewing of the retina with the digital image processing means . fig3 illustrates a preferred embodiment for optical device 12 which is responsible for the generation of the treatment beam area . the treatment beam is produced by primary beam source 14 and preferably coupled into optical fiber or light guide 13 to be shaped to the desired top hat intensity profile and to be transported with simple means from primary beam source 14 to the treatment device allowing the beam source to be spatially separated , which is of particular importance for laser sources due to safety requirements . from there primary radiation 5 illuminates aperture 31 . the radiation can illuminate aperture 31 either in a direct way or be imaged via suitable optical elements , preferably forming a telescope , to produce a fixed spot on aperture 31 . in particular , radiation 5 can be collimated optimally in order to minimize the divergence angle . aperture 31 cuts a defined section from said beam . this cut has , apart from diffraction limits , a sharp intensity edges , what is of great advantage to the treatment process , because it assures that all parts of the treatment zone are irradiated with the same energy . aperture 31 is adjustable whether via mechanical means like micrometer screws to be moved via the operator directly or via electromechanical means 34 like step motors or piezo actuators . means 34 can be controlled via the operator directly with suitable control devices or via central processing unit 25 they are connected with via interface lines 35 . more than one aperture may be included within the setup , one of which 32 is illustrated in fig3 . this apertures can be controlled in the same manner as the primary aperture and serve for various purposes . one is the generation of a two dimensional irradiation surface on the retina which is of higher complexity than the simple circle , that would be the best choice for single aperture 31 . for example the combination of a circular aperture with a slit aperture allows near - oval irradiation spots or two slit apertures allow rectangular forms . in a preferred embodiment the whole aperture unit is exchangeable , hence the operator can choose a certain combination in order to adjust the image to the treatment beam area which is visible from the diagnostic fluorescence angiography . common to the optical system is as already mentioned the basic position . for the case of the aperture based solution to the adjustment of beam spot size to treatment zone size basic position of electro - mechanical dislocation means 34 is directly related to a certain basic aperture size of apertures 31 and 32 or eventually more . this size is first illuminated with secondary beam 16 and the radiation passing the aperture propagates to the eyepiece for , or is optionally imaged via optical system 33 . the image of the aperture on the retina is then recorded and digitized . this digital image is one of the basic images mentioned above to perform the calibration . therefore , secondary beam 16 must be coupled into the propagation path of primary radiation 5 . this is done in a unique and well known way in order to have a well defined system of coordinates to compute from secondary beam retina image 11 to primary beam shape 15 and its spot size , in a preferred embodiment secondary beam 16 is already coupled to optical fiber 13 together with the treatment beam . the operator can then use primary beam 5 to chose the exact position of the treatment zone and start the process . this is performed as described above utilizing the means illustrated in fig2 . fig4 illustrates a more advanced system for the generation of the treatment beam area on the retina . state of the art methods suffer from the deficiency that they produce round spots since optical fibers , laser profiles or lamp emitted radiation generally produce round spots . these spots are then shaped and imaged to the retina . the new method illustrated in fig3 and described above already is a significant innovation over the state of the art , since it allows other than round profiles . additionally , the treatment beam is kept at small sizes and thus there is no longer a requirement for a rectangular top hat intensity profile . however , the treatment zone usually has a much more complicated form . in the prior art , the treatment zone could not be determined with sufficient accuracy , hence there was no need for the generation of an accurate treatment beam area . by the methods of this invention the treatment zone becomes well known , hence the mechanisms to illuminate said treatment zone can be enhanced in the same degree . fig4 basically consists of the components described above , but adjusting optical system 12 is embodied as a scanning device . in its most basic form a scanner contains two movable mirrors 36 and 37 positioned in an orthogonal way . the angle relative to the optical axis of each mirror is adjustable in one dimension , hence according to their orthogonal position by independent angle variation the beam can be positioned to an arbitrary position on a two dimensional surface . this surface can further be imaged and such an imaging is performed via contact lens 4 and the eyelens onto the retina . source 14 can be collimated , optionally be expanded to the desired diameter with suitable optical system 10 and then be directly imaged by the scanning means . the eye lens and the original beam diameter hitting the eye lens are responsible for the size of the beam spot on the retina , on which the beam delivered by the treatment beam spot is dependent on the beam diameter and divergence angle when it hits the contact lens and on the contact lens itself . by varying the contact lens and the beam properties by means of adjustable optical system 10 the beam spot on the retina can be varied accordingly . for use with a scanner the beam is of relatively low power and small size . if the scan velocity is chosen sufficiently large , each spot on the treatment zone is impinged by a sufficiently large number of photons for an optimal treatment process . to generate a true image of the treatment zone determined by use of the methods described above , two ways can be followed . the first consists in the generation of a rectangular image and switching the primary beam source on and off sufficiently fast , hence simply no intensity is emitted if the scanner positions a point out of the treatment zone and the laser is on if the scanner positions a point on the treatment zone . hence even non connected treatment zones can be mapped accurately . the second method is to operate the scanner in an asynchronous mode with interruption . mirrors 36 and 37 do not just map a rectangle , they rather map the concrete form of the treatment zone . this enhances the scanning efficiency and lowers the requirements to the switching velocity of primary beam source 14 . however , the requirements to the scanner deflection properties rise . scanner deflection can be implemented by various methods , two commons are to include galvanometric driven mirrors and piezo actuator driven mirrors . principally , instead of two orthogonal one dimensional deflecting mirrors a single two dimensional deflecting mirror can be used . a scanner system can be even of higher complexity . today , micro - mirror devices are commercially available , for example by texas instruments , inc . of houston , tex . which consist of a two dimensional array of micro mirrors . these devices are able to produce pixel based 2 - dimensional image structure which can be used for display technologies , in micro machining and for applications in medicine . a device of this type is included as the basic element of adjusting optical system 12 , optionally combined with suitable optical elements to create optical images which fulfill all the requirements given by the micro - mirror device and the treatment zone . the micro - mirror device is directly controlled by central processing unit 25 . the image created directly propagates via the optics and contact lens 4 to the retina . an equivalent effect to the micro mirror method can be achieved using liquid crystal devices and polarizers , similar to the use of liquid crystal devices in printing , display and lithography applications . adjusting optical system 12 then contains an optical setup which is a liquid crystal modulation device which allows to generate an image formed by a sufficiently large number pixels of that matches the treatment zone . it is obvious , that any image generation means can be included in a treatment setup to generate the treatment zone illumination beam area . the optics further can be positioned externally by the operator for example using positioning means 28 . in particular , said positioning to treatment zone is enhanced by using the secondary beam source as aiming beam and using the digital image recording and processing means described above . the switching the laser on and off is performed in an the use of a scanner system as described only makes sense if it is operated with a sufficiently fast driving electronics and controlled by a computer based system . the inclusion of a system of this type and the connection of all variable elements to the central processing unit is also a subject of the invention . fig4 shows another innovative method for the generation of variable image on the retina . from the point of the operator and the patient , this method provides an equivalent interface for the treatment itself and the result will also be comparable to the results obtained by using scanner methods . in fact the scanning facility is maintained , but in this case secondary light source 16 itself , if directly included in the treatment setup , or the emitting end of fiber 13 if the beam source is external and it &# 39 ; s produced radiation is transported to the treatment device by fiber 13 , is moved along a special path . this movement can , as with the scanning method before , follow a complicated path directly or follow a rasterized rectangle . primary light source 14 is switched according to the treatment size image requirements . to generate the movement of , for example , the fiber end , a two dimensional scanning unit can be constructed either mechanically , electro - mechanically by the application of piezo actuators or by a combination of these . in fig5 fiber 13 is connected to mount 36 . mount 36 is fixed on two dimensional displacement unit 40 . actuators 41 , preferably piezo actuators , cause the appropriate movements and are connected with central processing unit 25 by connection lines 35 . since aiming beam 16 produced by the fiber is preferably transported by said fiber it follows the same contour as treatment beam 5 and can thus be still used for all purposes mentioned above . the optical system images the plane , in which the fiber end moves to the retina . optionally , the optical system can be varied automatically by central control unit 25 or be exchangeable in order to achieve different imaging relations . fig6 illustrates another element which can be implemented in the optical path to achieve the desired beam displacement . incoming treatment beam 5 passes parallel plate 42 optionally coated dielectrically in order to minimize losses . this plate is mounted movably with one reference point on cylinder 47 . relative to this reference point the plate can now be rotated for a certain angle by actuator 49 , which can be a simple stepper or , preferably , a piezo actuator , which is in suitable contact with parallel plate 42 . in particular it must allow a certain linear movement of the actuating point . because of this angle , incoming beam 5 is displaced by a certain distance hence outgoing beams 45 and 46 are parallel the incoming beam , but displaced by different distances according to the angle at which the plate is positioned within the beam . if the plate is in the position marked by feature 43 it creates a smaller displacement in particular beam 45 , than if it is in the position marked by feature 44 , where displaced beam 46 is uniquely given by a mathematical relation between the displacement and the angle and can hence be controlled accurately . the two dimensional displacement can be obtained either by the use of two orthogonal devices each producing a displacement in one direction or a single plate , which has one fixed reference point and two orthogonal variable points . for this displacement unit all optical and electronic features described above can be used . fig7 illustrates another embodiment of treatment optics . primary light source 14 creates treatment radiation 5 , which is preferably coupled into optical fiber 13 and transported to the treatment device , together with secondary radiation 17 which serves as aiming beam and preferably has a different wavelength . the output 5 and 16 from fiber 13 is preferably collimated by optical system 10 and then coupled into optical system 52 , which plays the role of adjusting optical system 12 in prior embodiments . system 52 consists of the optical module of a commercial video camcorder , which is available as a component , as for example the sony eli series . in their original application these modules are intended to generate images on a camera chip for different object distances , which is basically equivalent to the purpose required for the treatment of the fundus of an eye . the optical states of module 52 can be varied electronically through interface 35 and central processing unit ( not shown ), which is preferably a pc . the reference image used for the calibration of the angiography to the native fundus image is recorded at a fixed position of the video module and with the data obtained from the image calibration . the correct state is chosen in order to generate a well defined treatment spot on the treatment zone . the principal treatment features are equivalent to the other embodiments described above . this method can in particular be combined with the aperture method which enhances the performance because it allows other than round profiles , the aperture creates top hat intensity structures if desired and operated far from the diffraction limit and the process can be implemented electronically and thus be controlled completely by a central processing means simply . having described preferred embodiments of the invention with reference to accompanying drawings it is to be understood that the invention is not limited to those precise embodiments , and that various changes and modifications may be effected therein by one skilled in the art without departing from the scope or the spirit of the invention as defined in the appended claims .

US-56943800-A

a method for treating a cancer includes administering to a subject in need thereof a pharmaceutical composition containing a therapeutically effective amount of an antibiotic drug or a pharmaceutical acceptable salt thereof . the antibiotic drug is selected from the group consisting of an aminoglycoside antibiotic drug , an anti - fungal antibiotic drug , a cephalosporin antibiotic drug , a β - propionamide antibiotic drug , a chloramphenicol antibiotic drug , an erythromycin antibiotic drug , a penicillin antibiotic drug , and a tetracycline antibiotic drug . the cancer is selected from the group consisting of lung cancer , gastrointestinal tract cancer , colorectal cancer , prostate cancer , bladder cancer , cervical cancer , breast cancer , and blood cancer .

subculture the different types of cancer cells . the cancer cells includes lung cancer , gastric cancer , hepatic cancer , colon cancer , skin cancer , cervical cancer , prostate cancer , bladder cancer , breast cancer , leukemia , pancreatic cancer , ovarian cancer , tongue cancer , osteosarcoma , and renal cancer . the normal cells used in the control group included renal cell ( hek293 ), hfw human fibroblast cell line , human bronchial epithelial cell line beas - 2b . ( as shown in table 1 ). cancer cell lines were cultured in different culture medium according to different characteristics ( as shown in table 1 ). the cell numbers were counted and reseed as 2 × 10 6 in cell culture plate / flask . then , the culture medium for culturing the cell lines was added to a volume of 10 ml , and the cells were cultured for 2 - 3 days . then , the cells were suspended for loading into 96 - well plates . the cell number was 3000 cells and the volume of the culture medium was 100 ul each well . removing the original culture medium from 96 - well plate . then add 100 μl of commercially drug at a concentration of 10 μm per well . after 72 hours , add the diluted wst - 1 reagent to the well with 100 μ / well , and the diluted wst - 1 reagent was acquired from the dilution of 9 : 1 medium and wst - 1 stock reagent . finally , the total volume of each well are 200 μl / well . culture the 96 - well plate at 37 ° c . for 30 to 90 minutes . detecting and calculating the survival rate of each cancer cell lines with an elisa reader at od450 nm . the lower viability of cancer cells represents better inhibition effect via the drugs . otherwise , the higher viability of cancer cells represents worse inhibition effect via the drugs . growth inhibitory effects on cancer cell lines by various antibiotic drugs in the present invention the antibiotic drugs are classified 9 categories . so , the antibiotic drugs including aminoglycosides antibiotic drug , anti - fungal antibiotic drug , cephalosporin antibiotic drug , β - propionamide antibiotic drug , chloramphenicol antibiotic drug , erythromycin antibiotic drug , penicillin antibiotic drug , tetracycline antibiotic drug and other antibiotic drugs were tested and analyze the inhibit effect on cancer cell lines growth by cell viability analysis . the test results showed obviously that growth inhibitory effects on cancer cell lines by various antibiotic drugs ( as shown in table 2 ). besides , the inhibitory effect of all kinds antibiotic drugs on cancer cells are not the same ( shown as fig1 ). according to the experiment of the present invention , the ritonavir , entecavir hydrate , posaconazole , artemisinin , megestrol acetate , fluconazole , gatifloxacin , ketoconazole , lansoprazole , acitretin , biapenem , cefoselis sulfate , daptomycin , doripenem hydrate , lopinavir ( abt - 378 ), meropenem , ondansetron hydrochloride ( zofran ), resveratrol , stavudine , teicoplanin , tenofovir disoproxil fumarate , tenofovir ( viread ), tigecycline , linezolid ( zyvox ), voriconazole , marbofloxacin , moxifloxacin hydrochloride , cefaclor ( ceclor ), cephalexin ( cefalexin ), aztreonam ( azactam , cayston ), norfloxacin ( norxacin ), cidofovir ( vistide ), natamycin ( pimaricin ), telaprevir ( vx - 950 ), saxagliptin ( bms - 477118 , onglyza ), cefdinir ( omnicef ), clotrimazole ( canesten ), cefoperazone ( cefobid ), sulfapyridine ( dagenan ), sulfameter ( bayrena ), darunavir ethanolate ( prezista ), erythromycin ( e - mycin ), amphotericin b ( abelcet ), docosanol ( abreva ), amprenavir ( agenerase ), nitrofurazone ( nitrofural ), telbivudine ( sebivo , tyzeka ), flucytosine ( ancobon ), amorolfine hydrochloride , chloramphenicol ( chloromycetin ), sulfanilamide , hydrocortisone ( cortisol ), didanosine ( videx ), emtricitabine ( emtriva ), lamivudine ( epivir ), adefovir dipivoxil ( preveon , hepsera ), zalcitabine , terbinafine ( lamisil , terbinex ), prednisolone ( hydroretrocortine ), rifabutin ( mycobutin ), nevirapine ( viramune ), enoxacin ( penetrex ), rifapentine ( priftin ), pyrazinamide ( pyrazinoic acid amide ), rifampin ( rifadin , rimactane ), cefditoren pivoxil , sulfadiazine , oxytetracycline ( terramycin ), ethionamide , trifluridine ( viroptic ), vidarabine ( vira - a ), rifaximin ( xifaxan ), acyclovir ( aciclovir ), butoconazole nitrate , albendazole oxide ( ricobendazole ), chloroxine , chenodeoxycholic acid , bifonazole , pefloxacin mesylate , valaciclovir hcl , ganciclovir , protionamide ( prothionamide ), idoxuridine , sparfloxacin , metronidazole ( flagyl ), tioconazole , sulfamethoxazole , sulfisoxazole , crystal violet , nystatin ( mycostatin ), isoniazid ( tubizid ), levofloxacin ( levaquin ), miconazole nitrate , sulfamethizole ( proklar ), sulbactam , sulphadimethoxine , rimantadine ( flumadine ), sarafloxacin hcl , liranaftate , d - cycloserine , taurine , diclazuril , rebamipide , clindamycin phosphate , oxytetracycline dihydrate , orphenadrine citrate ( norflex ), terazos in hcl ( hytrin ), lafutidine , dextrose ( d - glucose ), bibr - 1048 ( dabigatran ), rosuvastatin calcium ( crestor ), nalidixic acid ( neggram ), ammonium glycyrrhizinate ( amgz ), amfebutamone ( bupropion ), clonidine hydrochloride ( catapres ), fenbendazole ( panacur ), fluocinolone acetonide ( flucort - n ), loperamide hydrochloride , mycophenolic ( mycophenolate ), olanzapine ( zyprexa ), racecadotril ( acetorphan ), rosiglitazone maleate , salbutamol sulfate ( albuterol ), sulfadoxine ( sulphadoxine ), tenoxicam ( mobiflex ), vardenafil ( vivanza ), dopamine hydrochloride ( inotropin ), ritodrine hydrochloride ( yutopar ), isoconazole nitrate ( travogen ), secnidazole ( flagentyl ), lomefloxacin hydrochloride ( maxaquin ), riboflavin ( vitamin b2 ), clomipramine hydrochloride ( anafranil ), ceftiofur hydrochloride , tiotropium bromide hydrate , sulbactam sodium ( unasyn ), terbinafine hydrochloride ( lamisil ), amoxicillin sodium ( amox ), isoprenaline hydrochloride , medroxyprogesterone acetate , streptomycin sulfate , tetracycline hcl , xylometazoline hcl , phenacetin , trazodone hydrochloride ( desyrel ), brompheniramine , clindamycin palmitate hcl , acemetacin ( emflex ), dabrafenib ( gsk2118436 ), clindamycin , paroxetine hcl , zanamivir ( relenza ), niflumic acid , ciclopirox ethanolamine , enrofloxacin , medetomidine hcl , diclofenac potassium , amikacin sulfate , caspofungin acetate , ulipristal , indacaterol maleate , sulfathiazole , amikacin hydrate , trimethoprim , biotin ( vitamin b7 ), sulfamerazine , sodium salicylate , methylthiouracil , darifenacin hbr , naftifine hcl , sertaconazole nitrate , benztropine mesylate , abacavir sulfate , ampicillin sodium , antipyrine , carbenicillin disodium , amitriptyline hcl , azatadine dimaleate , triflusal , clinafloxacin ( pd127391 ), pentamidine , pemirolast ( bmy 26517 ) potassium , homatropine bromide , colistin sulfate , toltrazuril , carbimazole , netilmicin sulfate , spironolactone , ropivacaine hcl , erythromycin ethylsuccinate , escitalopram oxalate , tinidazole , pyrithione zinc , mequinol , spiramycin , bismuth subcitrate potassium , clofazimine , dicloxacillin sodium , sulconazole nitrate , tilmicosin , bacitracin , azithromycin dihydrate , ampicillin trihydrate , orbifloxacin , chlortetracycline hcl , benzylpenicillin sodium , chlorpropamide , cetylpyridinium chloride , sulfaguanidine , climbazole , mezlocillin sodium , nifuroxazide , paromomycin sulfate , penciclovir , domiphen bromide , salicylanilide , betamipron , chlorquinaldol , ethacridine lactate monohydrate , aminothiazole , florfenicol , furaltadone hcl , dirithromycin , valnemulin hcl , piperacillin sodium , minocycline hcl , fidaxomicin , primaquine diphosphate , cetrimonium bromide , carbadox , ceftazidime pentahydrate , clinafoxacin hcl , colistimethate sodium , meclocycline sulfosalicylate , moxalactam disodium , piromidic acid , rolitetracycline , thiostrepton , thonzonium bromide , cinoxacin , bekanamycin , difloxacin hcl , cephapirin sodium , clofoctol , pasiniazid showed significant inhibition effect on different cancer cell lines ( shown as table 3 ). although the present invention has been described in terms of specific exemplary embodiments and examples , it will be appreciated that the embodiments disclosed herein are for illustrative purposes only and various modifications and alterations might be made by those skilled in the art without departing from the spirit and scope of the invention as set forth in the following claims . according to the listing antibiotic drug inhibit cancer cell growth results of table 3 , the inventors take the repeat experiment for checking effectively the inhibitory effect of cancer cell growth by the antibiotic drug . the results show as table . 4 .

US-201515521517-A

an integral , one - piece silanated particle impregnated gutta percha core / cone technique employs a thin layer of a luting agent , such as glass ionomer cement with a machined gutta percha core / cone , precisely matches the preparation , thereby reducing leakage and achieving a hermetic seal . the hermetic seal is further enhanced by a mono - block bond that occurs between the silanated particles in the gutta percha and the appropriate chemical sealant . optional cryogenic treatment of the gutta percha material changes its molecular weight , making it stiffer and conducive to forming an integral , one piece core / cone , without the need for a separate carrier core to install the tapered gutta percha core / cone within the root canal . additionally , the tapered body of the core / cone may be reticulated in a slightly three dimensional texturized framework to increase surface area and therefore increase retention . optional line demarcation indicia are also placed on the core / cone . additionally , the head of the core / cone can be gripped by a delivery vehicle clasp .

as shown in the drawing fig1 – 9 , the integral , one piece gutta percha core / cone 10 has three distinct structural components all produced from the same material , such as gutta percha . the top ( proximal end ) of the core / cone 10 comprises the handle section 12 . the handle 12 is machined to precisely fit the core / cone transporter ™ delivery vehicle 4 as shown in fig5 . this precise fit prevents the handle 12 , and therefore the core / cone 10 , from rotating or shifting when taken to and inserted into the root canal 2 of the prepared tooth 1 . core / cone 10 is inserted within root canal 2 so as to seal the entire portion below its upper orifice 2 a , above which includes upper chamber 2 b of tooth 1 , which is filled with tooth colored resin and related crown post work ( not shown ). the handle 12 allows the transporter ™ delivery vehicle 4 to perform its functions , among which is to facilitate the placement of the one piece integral gutta percha core / cone 10 into a root canal 2 of a tooth 1 without danger of mis - insertion . the optional but preferable length determination section 14 ( with depth markings 14 a ) is another component of the gutta percha core / cone 10 and this segment of depth markings 14 a has preferably measuring indicia , such as , for example , thick lines which denote odd lengths and thin lines which denote even numbered lengths , or vice versa . the lengths range from 16 mm at the first thick line 14 and extend to 27 mm at the last thick line 14 a abutting the handle portion 12 of the core / cone 10 . an additional 2 mm &# 39 ; s may be gained by visually extending the indicia markings 14 a proximally up until the beveled shoulder portion 16 of the cylindrical handle 12 at the proximal end of the conically shaped cone portion 18 of the core / cone 10 of the present invention . a third segment of the gutta percha core / cone is the reticulated framework 20 extending from the most distal portion ( distal apical tip 22 of core / cone 10 ), to the 16 mm line demarcation point 24 . this reticulated framework 20 of varying optional texturizations 20 a , is the portion of the core / cone 10 that is generally in the root canal 2 itself and its surface has been reticulated to increase the surface area , thereby increasing the retention of a luting agent sealer 8 , such as preferably glass ionomer cement , to the core / cone 10 . in connection therewith , as shown in the simulated scanning electron microscope ( sem ) depiction of fig8 , the luting agent 8 is preferably applied in a microthin layer between the outside of the tapered portion of core / cone 10 , and the dentinal material defining the tooth canal space . for example , the luting agent 8 is typically applied to fill the space , which is typically about from , but not limited to , about 0 . 01 mm to about 1 . 0 mm , with the exception of naturally occurring anatomical irregularities deviating from these dimensions , which are also filled by the luting agent 8 . further adhesion is gained from the cryogenic treatment of the gutta percha core / cone 10 . the transporter ™ delivery vehicle 4 is a holding device that facilitates the precise insertion of the core / cone 10 into the root canal 2 . in addition to contributing increased accuracy to the procedure , the transporter ™ delivery vehicle 4 helps the clinician insert the gutta percha core / cone 10 into the root canal 2 of all teeth without the fear of misdirection and consequential stripping of the luting agent sealer 8 , such as cement , from the core / cone 10 . another optional but preferable unique feature of this system is the cryogenic treatment of the gutta percha used to fabricate the core / cone 10 . by a deep freezing process , the cryogenic treatment adds stiffness to the gutta percha and increases the surface area of the gutta percha core / cone 10 , thereby resulting in a more intimate contact between the luting agent sealer 8 ( such as glass ionomer cement ) and the core / cone 10 itself . the result is increased retention . cryogenics changes the molecular structure of compounds to a martensite state rather than a retained austenite state . therefore , coatings , such as luting agent sealers 8 , have a greater affinity for martensite state rather than the austenite state . this results in a greater bond of the gutta percha core / cone 10 to the luting agent sealer 8 . the clinical application of this technique involves the creation of a machined fully tapered 0 . 03 to 0 . 08 preparation , preferably a 0 . 04 or 0 . 06 preparation in a root canal space 2 . a machine preparation is achieved through the use of a rotary file sequence that prepares the canal in a predictable and consistent manner that produces a fully tapered preparation ( 0 . 03 – 0 . 08 mm ). examples of files that produce a fully tapered preparation are the profile by dentsply tulsa dental and the k - 3 by sybronendo . following full instrumentation and debridement , the appropriate size gutta percha core / cone 10 is selected . as an example , if the final preparation is a machined , fully tapered 0 . 06 preparation , with an apical tip size of “ 20 ” ( iso ), then a “ 20 / 0 . 06 ” gutta percha core / cone is selected . following core / cone selection , an appropriate luting agent sealer 8 , such as cement , is mixed ( glass ionomer ) and inserted into the root canal 2 , creating a thin layer of luting agent sealer ( cement ) 8 . the selected gutta percha core / cone 10 is then partially exposed in its sealed package 6 and is grabbed by the transporter ™ delivery vehicle 4 . it is then fully removed by the transporter ™ delivery vehicle 4 from the sterile package maintaining asepsis . the chosen luting agent ( root canal sealer 8 ), is then also placed on the gutta percha core / cone 10 itself , particularly over the reticulated area 20 of the core / cone 10 ( apical 16 mm ). it is recommended that gutta percha core / cone 10 be coated with the sealer 8 ( cement ) by wiping it gently through the mixed sealer 8 . the gutta percha core / cone 10 is now taken to the tooth and inserted into the prepared root canal 2 as far as the appropriate depth marking . after a few minutes , the lower tapered portion of the cemented gutta percha core / cone 10 is severed from the cylindrical handle 12 and length marking section 14 , at the point of the orifice 2 a of the canal 2 with a heated instrument , and subsequent light vertical condensation pressure is applied to the gutta percha core / cone 10 . fig6 d and 6e show an alternate embodiment for a coronal seal that can be further assured by the placement of a cover 32 of bonded restorative material , such as the applicant &# 39 ; s “ endo - kap ™” or “ endo - seal ™”, which is any dental restorative material , such as glass ionomer or a bonded resin , placed into a prepared segment recess 30 created by the removal of gutta percha core / cone material from the coronal aspect on top of the filled root canal space occupied by the severed gutta percha core / cone 10 . this will prevent leaking and bacterial contamination of the coronal aspect of the root canal filling and further prevent the need for retreatment , due to secondary bacterial invasion . furthermore , in those cases where a post / core is required for a satisfactory restoration of a further tooth 1 shown in fig6 f , this invention includes a post system with post 40 , as shown in fig6 h , that matches the fully tapered endodontic preparation of root canal 2 of tooth 1 , so that synchronicity is maintained ( for example , a 0 . 06 tapered post matches a 0 . 06 tapered endodontic preparation ) between the preparation of root canal 2 and the post 40 . there remains in the root canal 2 , below the post 40 , a variable section 42 of gutta percha , which is located apical to the post 40 , that insures an apical seal and prevents contamination from the apical portion of the tooth 1 . the fully tapered post 40 is cemented with a luting agent such as a glass ionomer or a resin - based sealer and the coronal section of the post 40 in fig6 h is covered with a coronal buildup material 44 . the resulting post / core restoration of post 40 and core buildup 44 , as shown in fig6 j , insures proper retention of the crown and also acts as an alternative coronal seal to microleakage . a further option is to have a planing instrument , in those cases with significant surface irregularities , such as the curvature in the root canal of fig6 f , to refine the preparation , such as a 0 . 06 preparation , for example , in such a manner as to accommodate the tapered inflexible post 40 , such as shown in fig6 g and thereby validate or verify the synchronicity between the preparation of the root canal 4 and the cemented post 40 . as shown in fig9 , endodontic integral one piece gutta percha core / cone 10 , in combination with an appropriate luting agent 8 , properly seals , in a three dimensional manner , a preparation space of root canal 2 of tooth 1 , as well as lateral canals 7 extending therefrom . these lateral canals 7 are more effectively filled with sealers 8 that exhibit little or no shrinkage , rather than thermoplastic obturation techniques that produce shrinkage upon cooling . these sealers b , such as methylacrylates , expand slightly rather than shrink , and fill lateral canals 7 of root canal 2 more successfully than thermoplastic gutta percha . the gutta percha core / cone technique is an advance in endodontics that facilitates the obturation of the root canal space for all clinicians . the synchronicity developed between a machined fully tapered 0 . 03 to 0 . 08 preparation of a root canal 2 , preferably a 0 . 04 or 0 . 06 preparation , and the precise match of the appropriate gutta percha core / cone 10 allows the dentist to achieve a precision fit in endodontics , much like a precision fit in industry . as a result of this technique , clinicians can now not only fill a root canal 2 faster ( thereby saving the patient time ) but also they can fill it better in a true three dimensional sense . because the fit is precise , the cement layer of luting agent sealer 8 between the gutta percha core / cone 10 and the tooth structure 1 ( inside walls of the root canal 2 ) is very thin . a thin cement layer of luting agent sealer 8 is far less prone to shrinkage as compared to heated gutta percha , which shrinks significantly upon cooling . additionally , when the interior of the root canal is properly conditioned with a chelating agent , such as etda , the dentinal tubules and lateral canals are opened sufficiently to allow the sealer ( luting agent ) to fill the spaces . the result is a better bond ( retention ) between the gutta percha and the dentinal wall , as well as more effective obturation of the lateral canals . also , the modification of the gutta percha with silanated particles that bond to similar particles in the luting agent will result in less shrinkage . consequently , the goal of a true hermetic seal is closer to being achieved with the gutta percha core / cone technique than any other prior art methods . the unique design features of the gutta percha core / cone 10 , along with the characteristics achieved by optionally having the core / cone 10 undergo cryogenic treatment , render multiple advantages to this technique . the handle design of the core / cone 10 is unique and its design allows for ease of placement of the integral one piece gutta percha core / cone 10 into the prepared root canal 2 of a tooth 1 . the handle 12 is also made of the same gutta percha material ( which is identical to the rest of the core / cone 10 ) and therefore no separate solid core with a wrap of possibly precariously adhesable gutta percha is needed . this is important due to the viscosity of the sealer . the texturized reticulated surface area 20 , ( such as , for example , a lattice framework or other dimpled texturization and the like ) increases surface area and provides greater retention of the luting agent sealer 8 , such as cement , to the core / cone 10 . this unique feature enhances bonding between the luting agent sealer 8 ( such as cement ) and the core / cone 10 along with forming mechanical locks . the preferably optional cryogenic treatment of the core / cone material ( gutta percha ) creates advantages previously unseen with gutta percha . by making the gutta percha stiffer , the cryogenic treatment allows the gutta percha core / cone 10 to work better with the viscosity of sealers ( cements ) associated with this technique . stiffer gutta percha can be pre - curved into a one - piece integral gutta percha core / cone 10 without the need for a separate stiffer carrier core , and this feature will facilitate the “ obturation ” of more challenging root canal anatomy . stiffer gutta percha is also easier for the clinician to handle , as well as to insert into the root canal space , thereby maintaining the integrity of the gutta percha core / cone 10 . optional length markings 14 on the gutta percha core / cone 10 itself will facilitate accurate placement of the core / cone 10 into a canal 2 , and will help ensure the success of the procedure . the packaging of each core / cone 10 in its own separate wrapper or package 6 will help reduce bacterial contamination during the process of obturation of a root canal space 2 . as a result of this aseptic technique , the obturation process has a better prognosis . it is further known that other embodiments may be made to the present invention , within the scope of the invention , as noted in the claims .

US-74464003-A

a thin , skin - toned pocketed card having two layers of material . the foreground layer of this card is made of a thin transparent material that is printed with images of facial features . to print these images , color is applied to the material starting at the boundary of the image and extending out onto the surrounding material . the transparent portion , not the colored portion of the material , hence defines these images . the background layer of material is uniformly colored to match the foreground layer . when the foreground layer is positioned over the background layer the images of facial features become indistinguishable from the background . the layers are then joined to each other so that open pockets are formed between their adjacent surfaces , and so that one set of facial features is allocated to each pocket . uniformly sized strips of colored media representing cosmetic colors are inserted into the open pockets . when the foreground is viewed a colored area of the color strip is visible through the transparent facial image of the pocket in which it is located . this transparent area represents a facial feature , hence the facial feature appears to be colored with cosmetic color .

[ 0052 ] fig1 a , 1b , 1 c , 1 d , 1 e , 1 f and 1 g — preferred embodiment a preferred embodiment of the skin - toned card of the present invention is illustrated in fig1 a ( exploded perspective view ). the skin - toned card has a base layer of paper card 10 of uniform cross section . in the preferred embodiment the base layer comprises paper card however the base layer can consist of any material to which a polyester film can be laminated , such as polyester , nylon , rubber , various laminated or impregnated fibrous materials , various plasticized materials , cardboard , paper , etc . a layer of film 12 consisting of polyester is laminated to one side of paper card 10 . in the preferred embodiment , the film 12 is a polyester film , however the polyester film 12 can consist of any material which can be laminated to the paper card 10 such as mylar , nylon , various other synthetic materials , etc . after the polyester film 12 is laminated to the paper card 10 the assembled lamination is diecut as illustrated by the diecut shape 14 . on the surface of the polyester film 12 is printed a color design 16 in skin - toned ink . in the preferred embodiment the ink is formulated to adhere to polyester , however the ink may consist of any ink that will provide uniform coverage on a synthetic film . in the preferred embodiment the color design 16 is deposited on the polyester film 12 by a flexographic printing process . however , the color design 16 may be formed by any print , electrostatic , paint or other method of depositing or printing color . a further component of the present invention is an overlay of transparent material 20 consisting of polyester . in the preferred embodiment , the transparent material 20 is a polyester film , however the overlay of transparent material 20 can consist of any material which can be heat - sealed to the polyester film 12 such as mylar , nylon , various other synthetic materials , etc . the underside of the transparent material 20 is printed with a color design 22 in skin - toned ink . portions of this color design 22 are omitted and such omitted potions remain transparent and represent facial features and characteristics . in the preferred embodiment the ink is formulated to adhere to polyester , however the ink may consist of any ink that will provide uniform coverage on a synthetic film . in the preferred embodiment depositing ink on the predetermined areas of the transparent material 20 using a flexographic printing process forms the color design 22 . however , such predetermined areas of the transparent material 20 may be colored by any print , electrostatic , paint or other method of depositing or printing color . [ 0056 ] fig1 b ( perspective view ) shows the final location of the transparent material 20 on the paper card 10 . the transparent material 20 is joined to the polyester film lamination 12 by forming a heat - seal edge join 24 at three straight edges and four corners of the transparent material 20 . an additional heat - seal join 18 consisting of five parallel lines joined at one end by a perpendicular line is applied to the surface of the transparent material 20 . the effect of the heat - seal join 18 is to form cavities 26 each open at one end between the transparent material 20 and the polyester film lamination 12 laminated to the surface of the paper card 10 . since the color design 16 of the polyester film lamination 12 is of the same color as the color design 22 of the transparent material 20 , no visual contrast exists between the color design 16 and color design 22 . without such visual contrast , the omitted portions of the color design 22 , when laid over the color design 16 as shown in fig1 b , become imperceptible to the eye . fig1 c shows a perspective view of a skin - toned card with a color design 22 representing images of facial features and characteristics . the position of each set of facial features and characteristics of the color design 22 is shown relative to the location of the heat - seal join 18 . [ 0057 ] fig1 d shows a perspective view of a skin - toned card with a color strip 28 fully or partially inserted into each of the cavities 26 . in the preferred embodiment each color strip 28 consists of a thin paper card base of uniform cross section . however the color strip 28 can consist of any material which can be printed or colored , such as polyester , nylon , rubber , various laminated or impregnated fibrous materials , various plasticized materials , cardboard , paper , etc . if fully or partially inserted into any one of the cavities 26 any portion of the color strip shade and color design 30 is visible through the transparent portions of the transparent material 20 . fig1 e shows a perspective view of a skin - toned card with a color strip 28 fully inserted into each of the cavities 26 . a portion of the color strip shade and color design 30 is visible through the transparent areas of the transparent material 20 that have been omitted from the color design 22 . [ 0058 ] fig1 f shows a plan view of the color design 22 formed by depositing skin - toned ink to the underside of the transparent material . the areas of the transparent material 20 showing the facial features and characteristics 32 , 34 , 38 , 38 remain free of ink . ink is deposited around these areas to allow transparent areas of material 20 showing facial features and characteristics . fig1 g shows a perspective view of a skin - toned card with images of facial features and characteristics located between parallel sealing joins of heat - seal join 18 . in the preferred embodiment the cavities 26 created by the heat - seal join 18 are each of uniform internal width and length . in the preferred embodiment each color strip 28 is of uniform size allowing insertion of its length into each of the cavities 26 . the internal length of the cavities 26 extends from the cavity opening to the perpendicular line of the heat - seal join 18 . the internal width of the cavities is equal to the distance between the closest edges of adjacent parallel lines of the heat - seal join 18 . this permits any color strip 28 to be inserted into each and any of the cavities 26 . additional embodiments are shown in fig2 , and 4 . in each case the arrangement of facial features and characteristics is shown . in fig2 a pocketed card similar to the present invention with 4 lips 38 is shown . in fig3 a pocketed card similar to the present invention with 4 pairs of eyelids 32 is shown . in fig4 sheet of pocketed cards similar to the present invention with perforations 40 to allow easy separation is shown . the sheet of pocketed cards shown in fig4 also has holes 42 to allow for binder storage . fig5 shows a sheet of color strips 44 similar to the color strip 28 of the present invention , with perforations 40 to allow manual separation and holes 42 to allow for binder storage . from the description above , a number of advantages of my pocketed card and color strips become evident : ( a ) the flat pocketed cards and color strips can be produced individually or in perforated sheet form . this will allow easy packaging , mass distribution , and easy storage of single or multiple units . ( b ) the nature of the printed and laminated construction ensures a low unit cost for each pocketed card and color strip . the materials and processes used are common to the printing industry . ( c ) the simple use nature of the pocketed card and color strips requires little , if any , instruction . the underside of the card substrate provides an additional surface for printed information . any individual user will intuitively understand the pocketed card &# 39 ; s operation and use . ( d ) the color strips can be inserted into any combination of pockets to reveal color applied to the selected facial features . in this way color applied to eyes only may be viewed ; or color applied to both lips and eyes may be viewed . if a pocket does not have a color strip inserted into it the facial features located on that pocket remain invisible . in this way , if the user wishes only to view a lip color , no distracting images of colorless facial features will be noticed . ( e ) the user is not required to select a facial shape or profile in order to view color applied to the facial features . excluding the facial shape removes a complicating step and emphasizes the selection of color cosmetic combinations . ( f ) the inks used to color the film portions of the card will be skin - toned . it is possible to use inks corresponding from very dark through to very fair skin tones . in a commercial application the range of ink colors used might correspond to a cosmetic company &# 39 ; s range of foundation colors . in this way a user would select a card whose color matches the foundation product she uses . ( g ) the color strips are sized to fit easily into pockets of uniform size . there is no possibility of incorrect insertion or misalignment of the color strip . inserting a color strip will always produce a color effect . the strip can always be removed easily because the pocket is shorter than the strip . ( h ) a color viewed through several layers of transparent film can be dulled and distorted . the color surface of the color strip is viewed through a single layer of transparent film . the skin color of the color design is also viewed through a single layer of transparent film . subsequently , neither the color being viewed , nor the skin tone , will be dulled or distorted by successive layering of transparent films . ( i ) all facial features on the card are presented at the same distance from the user &# 39 ; s eye . the user is not required to shift focus from one feature to the other in order to view color applied to these features . such focus adjustment would be required if the features were presented at varying focal distances from the user &# 39 ; s eye . ( j ) in the case of the preferred embodiment of the card it is not possible to adjust the alignment of the facial features . the location of facial features relative to one another is fixed . this is an advantage because the facial features cannot be overlapped or mislocated by the user . ( k ) the card shows facial features which are expected . thus the preferred embodiment of the card requires no user customization . furthermore , there is only one user variable involved in selecting a card . the user is simply required to select from a range a card corresponding to her skin tone . ( l ) in a commercial application color strips would be printed with colors closely matching a cosmetic company &# 39 ; s color products . many printing techniques , such as using metallic inks , can ensure the color strips also closely match mass - market cosmetic textures and finishes . ( m ) the images of facial features are created by depositing ink , not formed by cut - out shapes mimicking facial features . hence these images can be generated by using photographic images . this means the appearance of natural texture , such as lines and hairs , can be incorporated into these images . the result is a very natural appearance of the facial features portrayed . ( n ) the card does not require the user to hold still or exert significant concentration to see the result of applying color . the card can be held in the hand , placed on a surface , or viewed at any angle . more than one card can be viewed at a time to compare the effect of several colors . ( o ) in the preferred embodiment the full eyelid is shown . this is advantageous because it is impossible to close one &# 39 ; s eyes and see the effect of color applied to them . in this way the card becomes a useful tool to compare the effects of different eyeshades . such effects may not otherwise be easily seen by the user . ( p ) the color strips and the pockets into which they are inserted are of equal size . this uniformity allows color strips to be readily interchanged between facial features . under this format color strips and cards provided by assorted vendors and companies would be interchangeable . ( q ) the viewing surface is flat , and uninterrupted even when color is selectively applied . thus devoid of any cut - outs or edges it provides a superior surface for viewing color combinations . ( r ) color cosmetics will show more or less edge definition when applied depending on their consistency . images of facial features could thus be printed with their edges defined to a greater or lesser extent . this allows the card to show the appearance and finish of cosmetics as well as their color . the manner of using the pocketed card to display cosmetic color is described thus : the user selects a pocketed card , such as one from the sheet of such cards shown in fig4 . her choice would be a pocketed card matching her skin tone . the user then selects one or more color strips 28 . the selection of color strips 28 is entirely subjective , perhaps based on fashion , mood , likes or recommendations . the user selects a color strip 28 to be applied to a selected facial feature of her choice . she inserts the selected color strip 28 all the way in the cavity 26 corresponding to the chosen facial feature 32 , 34 , 36 , 38 . she observes the facial feature 32 , 34 , 36 , 38 now colored by the color strip 28 . if the facial feature color is judged to complement her skin tone it may remain in the pocketed card . to remove a color strip 28 from the pocketed card she grasps the exposed end and pulls . additional color strips 28 may be inserted into vacant cavities 26 until all cavities are filled . the user judges whether the color of the facial features 32 , 34 , 36 , 38 is complementary , or creates the desired color effect . if so , color cosmetic product corresponding to the color strips 28 may be self - selected or otherwise selected for use . color strips 28 may be inserted multiple times into the cavities 26 . the pocketed card and color strips 28 may be carried as a reference or discarded after cosmetic colors have been selected . their primary purpose is to promote self - expression and confidence when choosing cosmetic color . accordingly the reader will see that the pocketed card of this invention can be used to easily demonstrate cosmetic color combinations , using the user &# 39 ; s own skin tone as a color reference . the pocketed card can be used to view the effect of cosmetic color and finish applied to one or any combination of facial features , without distorting color . the pocketed card , used in this manner , does not require user customization . in addition , operation of the pocketed card is intuitively simple and does not require instruction . furthermore the pocketed card has the additional advantages in that its low cost means it can be used as a promotional tool in assorted locations and in print media packaged with cosmetic samplers it is potentially a low cost promotion to increase consumer awareness of new season colors it can be used in direct sales and mail catalogs to enhance the experience of selecting color cosmetics . although the description above contains many specificities , these should not be construed as limiting the scope of the invention , but merely providing illustrations of some of the presently preferred embodiments of this invention . for example , the pocketed card can have other shapes , such as circular , oval , triangular , etc . ; the facial features can have more or less texture , the eyelids can be shown open , eyebrows can be added , etc . thus the scope of the invention should be determined by the appended claims and their legal equivalents , rather than by the examples given .

US-14040002-A

a self - contained , gas - generating electrochemical cell has been invented . the cell contains an anode which is exposed to water or water containing material , a water permeable , ion - conducting separator between the anode from the cathode and a cathode composed of an electrochemically decomposable chemical compound which produces water in the presence of protons and electrons . an exemplary cell contains silver oxide as a principal component of the cathode , water as the principal anode component and a proton conducting membrane . the silver oxide reacts with protons electrically driven through said membrane and electrons from a power - source to form elemental silver and water . deposition of elemental silver in the cathode compartment is advantageous inasmuch as it improves the electronic conductivity of the material in the cathode compartment . water , in the anode , decomposes to protons and molecular oxygen while releasing electrons . it is this oxygen which acts as a pressurizing gas to perform some useful work , such as being the motive force to dispense fluids from a fluid - containing bladder to deliver said dispensed fluids to a particular site . the dispensed fluids may have some beneficial property such as medicinal , insecticidal , fragrant or other attributes .

in an exemplary cell , the cathode chamber may contain water ( a small amount ) and silver oxide ( ag 2 o ). a gelling or suspension agent , for example , carboxymethyl cellulose and the like may be desirable to improve manufacturability but is not otherwise required . also , dispersed solid polymer electrolyte may be added to the cathode material . for example , 5 % nation solution may be added to the oxide then dried , leaving a mixture which is easily pelletized and which conducts protons . the anode chamber contains water . 1 ) ag 2 o + 2h + + 2e - → 2ag + h 2 o the reaction at the anode is : the hydrogen ions produced in the anode compartment are electrically transported through the membrane to react with ag 2 o in the cathode chamber to produce elemental silver and water . the water permeates ( migrates ) through the membrane from the cathode compartment to be available in the anode compartment to undergo dissociation . in the instant situation , ag 2 o reacts with a proton to form water , which is an effective proton conductor under appropriate conditions . metallic silver , which is an excellent electronic conductor , will tend to plate out upon the cathode chamber wall in contact with the negative pole of the power source ( battery ) thereby improving the electronic conductivity of the cathode compartment material . the device schematically illustrated in fig1 is particularly advantageous inasmuch as the gas - generating cell can be readily sealed and completely isolated from the external environment . the cathode 10 and anode 11 chambers and the membrane separator 12 can be an integral unit which may be readily fabricated . the battery 13 , power source , in contrast to many previous devices , can be external to the cell so long as it is in the electrical circuit between the anode and cathode . thus , by sealing the perimeters or boundaries of the cathode and anode compartments to each other or to the electrolyte ( membrane ) a compact , sealed cell is readily produced . of course , if the compartment shells are sealed to one another an electrical insulator must be used as part of the seal so that the cathode and anode materials are electrically isolated from one another except through the membrane and external circuit . the cell employs a separator which has no electronic conductivity but is permeable to both protons and water . several materials can serve this purpose . many examples are well known in the battery industry . hydrophilic microporous membranes made of polystyrene , polyolefin or glass fibers can absorb enough water or acid so that they are permeable to both water and protons yet are substantially electronic insulators . the cell may also employ a cation exchange membrane which is permeable to protons and water . an example of such a membrane is nafion ™, a sulfonated perfluoroethylene polymer produced by dupont , other sulfonated polymers are well known in the art . a gas permeable anode is adhered to the separator or membrane . the oxygen evolving anode must communicate with a flexible gas chamber into which the oxygen flows . a cathode chamber contains a catholyte of water , a metal oxide such as ag 2 o , cuo , cu 2 o , pbo 2 , pbo , zno , bi 2 o 3 and the like , and possibly , a gel forming material such as carboxymethyl cellulose and the like to improve manufacturability . a battery is in direct contact with its negative pole in contact with the cathode . the positive pole of the battery is connected to a switch in a conductor circuit , which upon activation completes a circuit with the anode . although water is not necessary to initiate the cathode reaction , some small amount of water is generally desirable to assist in the ionic conductivity of the separator or membrane and catholyte . as protons migrate through the electrolyte , the cathode reaction produces water , which permeates through the membrane to replace water at the anode which decomposes to produce gaseous oxygen . oxygen generated at the anode may be directed to a dispensing chamber wherein the oxygen gas compresses a bladder to force out fluid contained in the bladder to be delivered to a desired site . fig1 is a schematic of the gas - generating , self - contained electrochemical cell employing a decomposable , proton - consuming , water - producing , chemical compound as a cathode material . the membrane material 12 is either a cation exchange membrane or is a microporous membrane which is permeable to both water and cations , in particular protons . the anode 11 is composed of electronic conductors , e . g ., graphite and the like , and electrocatalyst material suitable for oxidation of water to oxygen and protons in an acidic media . examples of suitable electrocatalyst would be ru , ruo 2 , ir , iro 2 , and combinations thereof . several electrodes are available which may be utilized to evolve oxygen at the anode . they are disclosed in the article &# 34 ; bifunctional electrodes for an integrated water - electrolysis and hydrogen - oxygen fuel cell with a solid polymer electrolyte ,&# 34 ; j . ahn & amp ; r . holze , j . applied electrochemistry 22 ( 1992 ) 1167 - 1174 ; and in u . s . pat . no . 4 , 039 , 409 , laconti et al . the information in these references is incorporated herein by reference . the anode 11 must also be permeable to water molecules and protons and to oxygen . gaseous oxygen is produced at the anode / membrane interface . the current collector 13 may serve as the anode provided that the anode surface facing the membrane has channels through which the generated oxygen can escape and provided that a means exists for water and protons to reach the anode . a film of water between the membrane and anode would serve this purpose . an electronically conductive screen coated with an appropriate electrocatalyst could also serve as an anode . the cell shell 14 and cathode current collector 15 are impervious to gases and water so that the only transport of material into or out of the cell is through the anode current collector which is either porous or has at least one perforation through which evolved oxygen can escape . the shell can be integrated with other components such as the anode current collector , but the cathode current collector and anode current collector must be electronically isolated except through the circuit as shown with includes , at a minimum , a switch 18 and usually will also include a dc power source such as a battery 16 and a resistor 17 which is selected to attain a desired gas generation rate . in some cases such as when ago is the active cathode material , a battery may be unnecessary . fig2 is a cross - sectional view of a gas - generating , self - contained electrochemical cell of the type schematically shown in fig1 which has been integrated with a battery power source 16 . the shell 14 has been integrated with the anode current collector 13 to form a &# 34 ; can &# 34 ; which has at least one hole , i . e . oxygen port 19 , perforated through one end and is open at the other end to accept other components during manufacturing . an insulative grommet 20 has been introduced to isolate the can from the cathode current collector . a battery retainer 21 holds the battery and includes terminals 21 and 22 which , respectively , contact the positive contact of the battery and the side of the anode current collector &# 34 ; can &# 34 ;, i . e . shell 14 . a resistor 17 is positioned between the two contact terminals . the device is activated when the battery retainer is slid over the &# 34 ; can &# 34 ; such that the negative contact of the battery communicates with the cathode current collector , and the anode terminal 22 communicates with , i . e . contacts , the anode &# 34 ; can &# 34 ; 14 . the anode terminal may be fixed to the battery retainer or it can slide within a groove ( not shown ) in the sidewall of the retainer so that the retainer can be slid over the can without necessarily completing the electrical circuit until the anode terminal is slid downward to contact the can ( anode current collector 13 ) to complete the electrical circuit . fig3 is an illustration of a fluid dispensing apparatus employing a gas - generating cell 23 of the type illustrated in fig2 . the cell 23 is fixed to a gas shell 24 , which is preferably rigid and made of metal , plastic or similar material . the exhaust or gas ports 19 of the gas - generating cell communicate with a gas chamber 25 , which is filled with gas , over time , from the gas - generating device 23 . a flexible diaphragm 26 forms a gas - tight seal about the rim 27 of the gas shell to form one portion of the gas chamber 25 . a fluid shell 28 is also attached to rim 27 to form a fluid reservoir 29 . an outlet vent 30 provides a discharge opening for fluid contained within the fluid reservoir , which is forced out of the reservoir by gas pressure within the gas chamber 25 which presses the flexible diaphragm into the fluid reservoir until the diaphragm is completely flexed or distended , as illustrated at position 31 . the use of a diaphragm to discharge a fluid reservoir for somewhat similar purposes and in a somewhat similar manner is illustrated in richter , supra . the disclosure of said patent relating to fluid dispensing is incorporated heroin by reference . a particular feature of the instant invention is that it is completely self - contained , i . e . no exposure to the outside environment by the electrochemical cell is required . for example , oxygen from the atmosphere is required at the cathode of maget type devices ( see u . s . pat . no . 4 , 552 , 698 ) to react with the cathode to form water . without this oxygen , water would not be formed at the cathode and would not be present to permeate the membrane and supply h 2 o at the anode . an aspect of maget - type and similar devices employing nation membranes is that they are affected by humidity , thus while the cathode compartment must be open to the atmosphere to permit oxygen to be available , moisture in the atmosphere will also be present at the cathode . alteration of the moisture content , i . e . concentration in the membrane alters the conductivity of the membrane and thus changes the rate of oxygen generated , which also alters the rate at which dispensed fluid would be delivered . fluid delivery devices , such as micro delivery devices to deliver medicines , etc . require accurate flow rates over extended periods of times . thus , a variation in flow rate with humidity is not a desirable feature of such a device . the self - contained device of the instant invention is independent of atmospheric conditions and thus delivers a constant flow rate of o 2 and , consequently , delivers a constant rate of dispensed fluid whether the device is used in humid or arid climates or environments . for example , buildings cooled by evaporative air conditioners are humid while buildings cooled by refrigerated air conditioning have cool , drier air . sealing of the device can be very simple inasmuch as the power supply ( battery ) may be external to the gas - generating cell . the cell can be completely contained within a canister , similar to a button cell battery . although the invention has been illustrated hereinabove with a decomposable metal oxide , namely ag 2 o , as the principal cathode material , other chemical compounds containing oxygen which will electrochemically react at a cathode to produce water molecules when in tile presence of protons may be used . the chemical compounds should preferably form water while consuming protons and not produce hydrogen at the cathode . depending on the conditions the membrane will be either a cation conductor which is permeable to water , and in some cases the membrane may be microporous having permeability to ions and water . a microporous membrane may be used if the back - reaction between the chemical compound in tile cathode and oxygen is very slow . preferably , however , the membrane is a undirectional transporter of ions only when under the influence of a voltage differential . usually the electrochemical reactions must be driven by a voltage source such as a battery , although in some cases the reactions are self driving and require only an electrical circuit to be completed for the flow of electrons between the cathode and anode , other than through the separator ; michael hull and herbert james in &# 34 ; why alkaline cells leak ,&# 34 ; j . electrochem . soc ., march 1977 , describe the problem encountered with electrochemical cells which utilize alkaline electrolytes . leakage of the caustic electrolyte is very difficult to prevent at the cathode . &# 34 ; one driving force for this phenomenon is the production of oh - ions arising from the electrochemical reduction of oxygen and / or the evolution of hydrogen occurring in a thin reaction zone above the observed electrolyte meniscus .&# 34 ; hydroxyl ions are produced through reactions 3 or 4 below : in both cases , the reactants may come from the vapor phase . as the hydroxyl ions are formed above the meniscus , electrolyte cations electromigrate toward them to maintain electroneutrality . then since the alkaline salt is hygroscopic , moisture is absorbed . the net result is creepage of electrolyte along the negatively polarized electrode . unlike the case of alkaline electrolytes , in the cathode reaction described in reaction 1 above , where acidic or neutral electrolyte is utilized , all reactants come from the liquid or solid phase rather than the vapor phase . thus the tendency to form products above the liquid / electrode meniscus does not exist . therefore , the cells in the present invention are less difficult to seal compared to cells with alkaline electrolytes . cathode reactants are mixed with a proton conducting material or liquid such as weak sulfuric acid : these reactions together require an applied voltage to proceed . water is produced at the cathode , permeates through the membrane under a concentration gradient and is consumed at the anode at the same rate at which is it produced . likewise , protons are produced at the anode , migrate through the membrane under a voltage gradient , and are consumed at the same rate at which they are produced . the weak acid assists in proton conduction . the undesirable competing cathode reaction in which hydrogen gas is evolved thermodynamically does not proceed in preference to the desired cathode reaction ; however , at high cell voltages , the competing reaction will occur . desirable oxygen release rates can be achieved without high cell voltages if the cell design is one which limits the current density by adjusting the separator / electrode areas . preferable voltages and preferable current densities will be dependent on the actual membranes and electrodes utilized . the production of hydrogen was not a problem with the cells described in the examples below . cells maintained in such a range have negligible hydrogen production in the cathode chamber . __________________________________________________________________________cathode anode overall e . sup . 0 ( v ) __________________________________________________________________________ag . sub . 2 o + 2h . sup .+ + 2e . sup .- → 2ag + h . sub . 2 o h . sub . 2 o → 1 / 2o . sub . 2 + 2h . sup .+ + 2e . sup .- ag . sub . 2 o → ag - 0 . 06o . sub . 2ago + 2h . sup .+ + 2e . sup .- → ag + h . sub . 2 o h . sub . 2 o → 1 / 2o . sub . 2 + 2h . sup .+ + 2e . sup .- ago → ag + 1 / 2o . sub . 2 + 0 . 071 / 2pbo . sub . 2 + 2h . sup .+ + 2e . sup .- → 1 / 2pb + h . sub . 2 o h . sub . 2 o → 1 / 2o . sub . 2 + 2h . sup .+ + 2e . sup .- 1 / 2pbo . sub . 2 → 1 / 2pb + 1 / 2o . sub . 2 - 0 . 56cu . sub . 2 o + 2h . sup .+ + 2e . sup .- → 2cu + h . sub . 2 o h . sub . 2 o → 1 / 2o . sub . 2 + 2h . sup .+ + 2e . sup .- cu . sub . 2 o → 2cu - 0 . 76o . sub . 2cuo + 2h . sup .+ + 2e . sup .- → cu + h . sub . 2 o h . sub . 2 o → 1 / 2o . sub . 2 + 2h . sup .+ + 2e . sup .- cuo → cu + 1 / 2o . sub . 2 - 0 . 67__________________________________________________________________________ in addition to the most preferred materials , other cathode materials may be utilized which are less desirable in that the device must be packaged with water to be consumed . in this category , current is maintained and oxygen is released at a steady rate , but only as long as there is an excess of water available to perpetuate the process . although these cells consume water , the amount of water to be consumed can easily be predetermined and packaged as part of the cathode , or in the oxygen chamber from which the water may be imbibed at the anode . both types of cells , those which are net consumers of water and those which are not , can be completely sealed from the environment so that water will not be lost to the environment in dry conditions . since the conductivity of many ion conducting membranes are functions of water content , being sealed eliminates ambient humidity as a variable . also the device could be exposed to precipitation without a significant effect . a gel forming material such as carboxymethyl cellulose may be desirable to hold the cathode material in place while manufacturing , but it is not essential . an anode of about 0 . 2 square centimeters was adhered to a perfluorinated sulfonic membrane , the membrane was nation 115 from dupont . the electrode consisted approximately of 11 % ruo 2 powder , 60 % graphite powder , and 29 % 1100 equivalent weight nation . a cathode paste was prepared which consisted of 81 % cuo powder and 19 % weak ( 1 %) sulfuric acid solution . the paste was placed into a cathode cavity shown schematically in fig1 . the membrane / anode composite was placed in contact with the cathode paste such that the cathode and anode were on opposite sides . total membrane area was about 1 square centimeter . the cell assembly was attached to a reservoir assembly where the fluid sack was filled with water . the cell was driven with a silver oxide battery through a 16000ω resistor . the amount of fluid dispensed was determined gravimetrically . a plot of the fluid dispensed over time is shown in fig4 . the plot shows that the fluid was dispensed at a nearly constant rate . an anode of about 0 . 2 square centimeters was adhered to a perfluorinated sulfonic membrane , the membrane was nation 115 from dupont . the electrode consisted approximately of 11 % ruo 2 powder , 60 % graphite powder , and 29 % 1100 equivalent weight nation . a cathode paste was prepared which consisted of 69 % ag 2 o powder and 31 % weak ( 1 %) sulfuric acid solution . the paste was placed into a cathode cavity shown schematically in fig1 . the membrane / anode composite was placed in contact with the cathode paste such that the cathode and anode were on opposite sides . total membrane area was about 1 square centimeter . the cell assembly was attached to a reservoir assembly where the fluid sack was filled with water . the cell was driven with a silver oxide battery through a 16000ω resistor . the amount of fluid dispensed was determined gravimetrically . a plot of the fluid dispensed over time is shown in fig5 . the plot shows that the fluid was dispensed at a nearly constant rate . an anode of about 0 . 2 square centimeters was adhered to a perfluorinated sulfonic membrane , the membrane was nation 115 from dupont . the electrode consisted approximately of 11 % ruo 2 powder , 60 % graphite powder , and 29 % 1100 equivalent weight nation . a cathode paste was prepared which consisted of 33 % ag 3 o powder , 33 % carbon powder and 33 % weak ( 1 %) sulfuric acid solution . the paste was placed into a cathode cavity shown schematically in fig6 . the membrane / anode composite was placed in contact with the cathode paste such that the cathode and anode were on opposite sides . total membrane area was about 1 square centimeter . the cell assembly was attached to a reservoir assembly where the fluid sack was filled with water . the cell was driven with a silver oxide battery through a 16000ω resistor . the amount of fluid dispensed was determined gravimetrically . a plot of the fluid dispensed over time is shown in fig1 . the plot shows that the fluid was dispensed at a nearly constant rate . an anode of about 0 . 2 square centimeters was adhered to a glass fiber separator called ultipor by pall rai . the electrode consisted approximately of 11 % ruo 2 powder , 60 % graphite powder , and 29 % 1100 equivalent weight nation . a cathode paste was prepared which consisted of 81 % cuo powder and 19 % weak ( 1 %) sulfuric acid solution . the paste was placed into a cathode cavity shown schematically in fig1 . the membrane / anode composite was placed in contact with the cathode paste such that the cathode and anode were on opposite sides . total membrane area was about 1 square centimeter . the cell assembly was attached to a reservoir assembly where the fluid sack was filled with water . the cell was driven with a silver oxide battery through a 1600ω resistor . the amount of fluid dispensed was determined gravimetrically . a plot of the fluid dispensed over time is shown in fig7 . the plot shows that the fluid was dispensed at a nearly constant rate ,

US-30094794-A

the invention relates to an epilation head for an epilation device , in particular for plucking hair from human skin having a rotating cylinder rotating around a rotational axis having a number of plucking units for grasping and plucking out hair , wherein each plucking unit comprises a movable clamping unit , a stationary clamping unit , wherein the movable clamping unit and the stationary clamping unit form a closable plucking gap , characterized in that the movable clamping unit has a hair guiding device which is associated with the movable clamping unit .

fig1 shows a side view of an exemplary embodiment of an epilation device 1 typical of the generic type but not designed in detail according to the invention . the epilation device 1 has a housing 2 . this housing will typically have a motor and a power adapter . additionally it can also have gear units . placed upon the housing 2 is the epilation head 3 . a further main component of the device is the switch 4 . which is placed centrally on the front of the housing . with this switch the rotation cylinder 5 can then be set in motion in order to perform an epilation process . the rotation cylinder 5 can have , for example on its outer side walls , gear wheels that can be connected via appropriate drive elements ( possibly also via a gear unit ) to the motor . the depicted rotation cylinder has a multiplicity of plucking units , each of which , however , only has one closeable plucking gap and only two clamping elements and which , therefore , are not designed according to the invention . the depicted rotation cylinder 5 , however , could easily be replaced with a rotation cylinder according to the invention , since this rotation cylinder is compatible with a large number of conventional epilation devices and epilation heads . fig2 shows a sectional view through a rotation cylinder 5 according to the invention . this rotation cylinder first of all has a peripheral surface 10 . the first clamping element 11 , the adjacent second clamping element 12 and the adjacent third clamping element 13 and specifically their outer surfaces are essentially flush with this peripheral surface 10 . a first plucking gap 14 is provided between the first clamping element 11 and the second clamping element 12 . a second plucking gap 16 is provided between the second clamping element 12 and the third clamping element 13 . the three clamping elements together with the enclosed two plucking gaps form a plucking unit for capturing and plucking hairs . the rotation cylinder 5 has a multiplicity of such plucking units arranged thereon . all of them are essentially flush with the peripheral surface 10 . they preferably can be and are arranged axially and / or radially offset . the rotation cylinder 5 is bordered laterally by two lateral side faces 18 . the rotation cylinder 5 surrounds a central axis 20 . push rods 22 laterally protrude through the side faces into the rotation cylinder 5 . the push rods 22 have pusher heads 24 , with which they can be actuated , i . e . pushed deeper into the rotation cylinder 5 . on pushing in the actuation elements in the form of the push rods 22 , the clamping elements are moved toward one another , such that the plucking gap closes . springs carry out the opening of the plucking gaps and also the return movement of the push rods 22 . the first plucking gap 14 can be reopened by means of a first spring element 26 . the second plucking gap 16 can be reopened by means of a second spring element 28 . the spring elements can be designed , for example , in the form of a first and a second helical spring . in an advantageous embodiment the rotation cylinder 5 is composed of a plurality of discs being placed one upon the other . the rotation cylinder depicted in fig2 can be assembled using an outer jaw 30 . the outer jaw 30 functions like a stop disk . it provides an end stop for the movable clamping elements . in the context of the present invention , such an end stop can ( optionally ) be designed to further act as a third clamping element 13 . supports in the form of guiding disks 34 are provided between the outer jaws and the stop disks . the geometry of the guiding disks permits the guiding and anchoring of clamping elements . as also visible in fig2 all clamping elemente 11 , 12 and 13 comprise hair guiding devices 60 . the respective hair guiding devices 60 each comprise a recess 62 which is surrounded by a raised structures . the recess 62 hence is essentially provided in the form of a groove . the design of a rotation cylinder 5 according to the invention can be seen particularly well also in the exploded view of fig3 . visible on the left is an outer jaw 30 that carries a multiplicity of push rods 22 . adjoining the outer jaw 30 is a first layer of clamping elements , a clamping element 40 of which is emphasized by way of example . the clamping elements also have pusher feed - throughs 38 . the push rods 22 are led through these feed - throughs 38 and can exert force onto further inwardly situated clamping elements , without the clamping element that offers only one feed - through 38 being actuated by the push rods 22 as an actuation element . the ring of clamping elements 40 additionally is arranged in such a way that there is a rotation axis feed - through 36 . such a rotation axis feed - through is provided for all of the layers of the rotation cylinder . adjoining the layer of clamping elements 40 is a guiding disk 34 . provided in this guiding disk 34 , also in the center , is a rotation axis feed - through 36 ( in the description of this exploded view , components that are identical or similar to one another are denoted with the same reference symbols ). in contrast to the layer of clamping elements 40 , the disk is a unitary piece . adjacent to the disc are damping elements . these clamping elements again form a layer , but are not connected . further adjacent elements are : an additional stop disk 32 , an additional layer of clamping elements 40 , an additional guiding disk 34 , etc ., to the right outer jaw 30 , which likewise has posh rods 22 . fig4 provides a perspective illustration of the same rotation cylinder 5 according to the invention . the view is of an essential portion of the peripheral surface of the rotation cylinder 5 . due to the advantageous construction of the rotation cylinder 5 , this peripheral surface 10 is capable of accommodating a particularly large number of plucking units . the first clamping element 11 , the second clamping element 12 and the third clamping element 13 of different clamping units are shown in each case by way of example . components that are identical or similar to one another are denoted with the corresponding reference symbols in each case . fig5 provides enlarged sectional view of clamping elements . as can be nicely seen again , a first plucking gap 14 is provided between the first clamping element 11 and the second clamping element 12 . a second plucking gap 16 is provided between the second clamping element 12 and the third clamping element 13 . the three clamping elements together with the enclosed two plucking gaps form a plucking unit for capturing and plucking hairs . clamping elements 12 and 13 are combined with a hair guiding devices 60 . provided , that the clamping element has a sufficient area on its top , it is possible to have the hair guiding device 60 attached to the top of the moveable clamping elements . as shown for movable clamping element 12 , a raised structure 64 a is provided the left of the recess 62 and a raised structure 64 b is provided to the right of the recess 62 . the bottom portions of the recess define a base level 70 , which for example spans from the bottom portion 70 a of recess 62 in clamping element 12 to the bottom portion 70 b in clamping element 13 . elements above these base level from an elevation level . generally , the average height of the elevations above the base level 70 defines an elevation level 72 . in the situation depicted in fig5 all elevations have essentially the same height over the base level , such that elevation level corresponds to the level of the outer surfaces of the raised structures of the clamping elements , and hence connects portions 72 a , 72 b , and 72 c . fig6 shows a prior art epilation cylinder . the cylinder comprises a base surface defining a base level denoted as 70 . above this base level a multitude of elements is arranged , which all represent relatively high elevations above the base level . the elevation level is roughly indicated as 72 . the epilation cylinder according to the present invention makes better use of the area of the epilation cylinder and provides an overall smoother and hence less aggressive appearance of the epilation cylinder . the elements of the prior art epilation cylinder , which roughly correspond to elements of the epilation cylinder of the present invention are denoted by corresponding reference signs ( but using primes ). the epilation cylinder 5 ′ rotates about an axis 20 ′. it comprises moveable plucking elements 12 ′ and fixed plucking elements 13 ′. the fixed plucking elements 13 ′ are associated with hair guiding elements 60 ′. most of the outer surface of the epilation cylinder 5 ′ is provided by a flat surface free of element , denoted as 70 ′. the elevation level defined by these elements is marked as elevation level 72 ′. fig7 and 8 schematically illustrate the mode of operation of the rotation cylinder 5 . portions of the rotation cylinder 5 are depicted in a simplified manner as a guide 52 . such a guide can be provided , for example , by means of the stop disks 32 in combination with adjacent guiding disks 34 . however , other types of guides are also possible . the guide advantageously permits a displacement of the clamping elements 40 at least at the outer end thereof , that is , in the region of the clamping jaws 46 having the clamping surfaces 48 . this movement can be in part a rotational movement ( as shown ) or also a lateral displacement . during the epilation process hairs can be fed into the first plucking gap 14 and into the second plucking gap 16 . the movable first clamping element and the movable second clamping element 12 can be moved toward the stationary third clamping element by means of a force acting from one side . in the process , the first plucking gap 14 and the second plucking gap 16 close . in this manner , clamping forces are built up , by means of which hairs can then be plucked . to the extent that clamping forces are actuated by a predetermined motion amplitude of actuation elements , the force acting on the second plucking gap 16 increases with the number of hairs that are already located in the first plucking gap 14 . this leads to an amplifying effect that makes the epilation particularly efficient . fig7 and 8 also show that the movement of the moveable clamping units leads to a movement of the hair guiding devices . this movement will generally move hairs towards the plucking gaps . hence , the provision of hair guiding devices associated with the moveable clamping unit does not only give the benefit of using the surface area of the epilation cylinder very efficiently , but it also ensures that the hair guiding devices work more efficiently . the movement required for the operation of the plucking gaps is also beneficially used to impart a guiding movement to hair to be plucked . the dimensions and values disclosed herein are not to be understood as being strictly limited to the exact numerical values recited . instead , unless otherwise specified , each such dimension is intended to mean both the recited value and a functionally equivalent range surrounding that value . for example , a dimension disclosed as “ 40 mm ” is intended to mean “ about 40 mm .” every document cited herein , including any cross referenced or related patent or application , is hereby incorporated herein by reference in its entirety unless expressly excluded or otherwise limited . the citation of any document is not an admission that it is prior art with respect to any invention disclosed or claimed herein or that it alone , or in any combination with any other reference or references , teaches , suggests or discloses any such invention . further , to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference , the meaning or definition assigned to that term in this document shall govern . while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .

US-201113315694-A

an antiinfective - free formulation for prophylactic treatment of mastitis in dry cows comprises a seal formulation , having approximately 65 % by weight of bismuth sub - nitrate in a gel based on aluminum stearate . the seal formulation is prepared by adding the bismuth sub - nitrate to the gel base in at least two separate stages .

the invention will be more clearly understood from the following description thereof given by way of example only . alugel 30 df ( sterile ) 69 . 2 kg bismuth sub - nitrate 936 . 0 kg b . p . c . ( sterile ) to prepare a batch of seal formulation the liquid paraffin is first delivered into a skerman 800 l kettle . the mixer is run at 20 rpm . the alugel 30 df ( aluminum stearate ) is then added through the transfer port . the mixer is turned off between additions of the alugel powder . the steam line is opened and the temperature is allowed to rise to 160 to 165 ° c . this temperature is held for approximately 2 hours to sterilise the mixture . at the end of the sterilising cycle , the condensate valve is opened and blown down . cooling water is then allowed into the jacket to cool the contents to less than 40 ° c . the base thus formed is then checked for quality . if necessary , the batch base may be homogenised for 10 minutes using a silverson homogeniser . the charge port is then opened and 296 kg of the bismuth sub - nitrate is added in 10 kg lots . the contents are mixed for one minute at 20 rpm between additions of each 10 kg of bismuth sub - nitrate . mixing is continued for approximately 1 hour at 45 rpm . the remaining 640 kg of bismuth sub - nitrate is then added in 10 kg lots as above and mixing is continued for 1 hour following the final additions . we have found that the addition of the bismuth sub - nitrate in two separate portions is important in producing a seal which can be processed and used effectively . if necessary , the mixer is homogenised for 15 minutes using a silverson homogeniser . the product is then transferred to a colibri filling machine for filling into injector tubes . cows were infused in all four quarters at drying off with the seal formulation prepared as described in example 1 . these cows had previously been determined as uninfected in all four quarters . commencing at the first milking after calving , these cows were milked and the composite milk sample collected for analysis . this process was repeated for the first 10 milkings after calving . milk samples were also collected in the same manner from 5 untreated cows . to simulate the milk handling process within the milking system , these milk samples were passed through a fibre filter material used in milking machine filters . the milk samples were then analysed by mass spectrometry for bismuth concentration . the average bismuth level in milk drawn at first milking was 3 . 3 ppm declining to 0 . 39 ppm at milking no . 10 . the maximum level recorded for any individual cow was 8 ppm at first milking . for untreated cows the levels fluctuated in the range 0 . 001 to 0 . 03 ppm . the seal formulation described in example 1 was administered at drying off and has been shown to reduce the incidence of new infection in the dry cow period and in the period around calving . the reduction appears to be comparable with that achieved by prophylactic antibiotic treatment . thus , the seal of the invention very surprisingly offers a non - antibiotic approach to dry cow period prophylaxis . 4 mastitis - free cows selected at drying off . 2 teats in each cow infused at drying - off with seal and remaining teats untreated ( day 0 ). 8 teats sealed and 8 teats untreated ( controls ). 3 days later ( day 3 ) all teats were inoculated into the teat canal ( depth of 4 mm ; using 22 cfu of streptococcus dysgalactiae code m and an inoculum volume of 0 . 1 ml ). new infections resulting from use of the inoculum occurred in five ( 5 ) of the untreated quarters in the period day 3 to day 13 . new infections resulting from use of the inoculum occurred in two ( 2 ) of the treated quarters in the period day 3 to day 13 . resulting new infections were monitored daily for 10 consecutive days after inoculation ( today 13 ). samples of secretion were collected in an aseptic manner from quarters showing signs of clinical mastitis prior to treatment with antibiotics . all quarters in all 4 cows were sampled in an aseptic manner on day 13 ( the last day of the trial )— these samples were used to : ( 1 ) check the amount of seal remaining in teats ( 2 ) monitor the level of str . dysgalactiae surviving in the teats after 10 days 17 mastitis - free cows * selected at drying off : 2 teats in each cow infused at drying - off with seal and remaining teats untreated ( day 0 ). 32 teats sealed and 32 teats untreated ( controls ). 3 days later ( day 3 ) all teats were inoculated into the teat canal ( depth of 17 inn ; using 1 , 190 cfu of streptococcus dysgalactiae code m and an inoculum volume of 0 . 1 ml ). new infections resulting from use of the inoculum occurred in twenty ( 20 ) of the untreated quarters in the period day 3 to day 13 . new infections resulting from use of the inoculum occurred in eight ( 8 ) of the treated quarters in the period day 3 to day 13 . resulting new infections were monitored daily for 10 consecutive days after inoculation ( to day 13 ). samples of secretion were collected in an aseptic manner from quarters showing signs of clinical mastitis prior to treatment with antibiotics . all quarters in all 17 cows were sampled in an aseptic manner on day 13 ( the last day of the trial )— these samples were used to : ( 1 ) check the amount of seal remaining in teats ( 2 ) monitor the level of str . dysgalactiae surviving in the teats after 10 days * a total of 4 quarters were infected in three cows and these quarters were excluded from the study . therefore 32 quarters were assigned to each treatment . a total of 528 cows in three commercial herds were used . each herd had a general history of dry period mastitis . the breed of the herds was predominately fresian or fresian crosses . cows with at least three uninfected quarters , immediately prior to drying off , were identified within the three herds . all individual quarters were assumed to be independent units . the treatments used were as follows . 1 . negative control - untreated , no infusions at drying off , but teat ends were sanitised with alcohol soaked cotton wool swabs . 2 . positive control - treated with 250 mg cephalonium in a long - acting base , infused at drying off . this product is known as cepravin drycow . cepravin is a trademark of mallinckrodt veterinary . 3 . antibiotic with seal - cloxacillin benzathine 600 mg in a 4 g unit dose infused at drying off and followed immediately by an infusion of 4 g of a blend of bismuth sub - nitrate ( 66 %) in liquid paraffin with 8 . 5 % alugel 30 df . 4 . seal — bismuth sub - nitrate 66 % w / w in liquid paraffin with 8 . 5 alugel 30 df in a unit dose of 4 g infused at drying of these treatments were randomised among the 528 cows determined to have three of four uninfected quarters at drying off . the treatments were randomised between quarters to achieve as far as possible the same number of quarters per treatment , left and right , front and back . bacteriological results for individual quarters at drying off and at calving were compared to calculate the incidence of new intramammary infections ( imi ). chi - square testing was used to compare the incidence of the new infection between quarters , treatments and controls . this experiment has demonstrated that the antinfective - free seal formulation of the invention administered at drying off is very surprisingly equivalent in terms of prophylactic efficacy , to a long acting dry cow antibiotic . all three treatments reduced new imi during the dry period by approximately 85 %. surprisingly , there was no significant difference between the antibiotic based treatments and the antibiotic - free treatment of the invention . thus , this study has shown that by physically sealing the teat canal with a seal which has no bacteriostatic or bacterial action , the dry period imi may , surprisingly , be controlled . the invention has the potential therefore of achieving dry period prophylaxis on a wide scale , at a lower unit cost , and with no risk of antibiotic residues after calving . the invention is not limited to the embodiments hereinbefore described which may be varied in detail .

US-201414184100-A

an ostomy device is provided including an ostomy pouch having an entrance opening , a body attachment wafer having a through - going opening and a coupling layer , which couples the pouch to the body attachment wafer and has a central opening therein . the body attachment wafer includes a plastic film , which is coated with a layer of skin friendly adhesive on the side thereof distal to the ostomy pouch . the coupling layer is affixed to the body attachment wafer along an attachment line extending around the central opening in the coupling layer , the attachment line being distanced from the central opening in the coupling layer . the region around the entrance opening of the pouch is affixed to the coupling layer in a landing zone located between the attachment line and the opening in the body attachment wafer .

the ostomy device 1 in the embodiment schematically shown in fig1 comprises an ostomy pouch 2 having an entrance opening 3 , a body attachment wafer 4 and a coupling layer 5 for coupling the ostomy pouch 2 to the body attachment wafer 4 . the coupling layer 5 has an opening having a size corresponding to the opening 3 of the ostomy pouch and is affixed to the ostomy pouch in a region surrounding said openings . the coupling layer 5 is furthermore affixed to the body attachment wafer 4 along an attachment line 9 at its outer periphery . the ostomy device 1 is in fig1 schematically shown attached to the skin of a wearer around the stoma s . the body attachment wafer 4 consists of a plastic film 6 which is coated with a layer 7 of soft and tacky silicone gel . such an adhesive is skin friendly and has an excellent sealing effect . examples of silicone gel adhesives suitable to be used as coating on the plastic film 6 are given in wo2006 / 075950 , which is referred to in this respect . such silicone gel adhesives should have a softness measured as a penetration value of 20 - 10 mm and a weight per unit area of at least 50 g / m 2 , whereby the weight per unit area increases with decreasing softness . the softness is measured by a method based on astm d 937 and described in wo2006 / 075950 , which is referred to in this respect . the plastic film 6 of the body attachment wafer should be thin in order to ensure that the stiffness of the film will not prevent the silicone gel adhesive from penetrating into all irregularities in the skin . the plastic film 6 should therefore have a thickness that does not exceed 50 micrometers . if affixing the ostomy pouch 2 directly to the body attachment wafer , the combined materials in this region , i . e . the material around the opening 3 of the ostomy pouch and the plastic film 6 and the silicone gel adhesive layer 7 of the body attachment wafer 4 , would give rise to higher stiffness than in the rest of body attachment wafer . such an increased stiffness would make it more difficult for the body attachment wafer to follow the irregularities of the skin in this fastening region and would thus increase the risk for local and involuntary detachment of the body attachment wafer in this fastening region during use . such a local detachment of the body attachment wafer can eventually lead to local leakage or total detachment of the body attachment wafer . furthermore , since the material in ostomy pouch 2 is not permeable , the skin can not be ventilated in this fastening region which could cause moisture to gather on the skin in this fastening region , which in turn can lead to local detachment of the body attachment wafer and eventually to total detachment thereof . the fastening region would also be located relatively close to a stoma which means that local detachment can cause local leakage of liquid from the ostomy pouch to leak onto the skin . by providing a coupling layer 5 between the body attachment wafer 4 and the ostomy pouch 2 it can be ensured that in the fastening region , in which the coupling layer 5 is affixed to the body attachment wafer 4 , the vapour permeability would not be negatively affected while still providing less stiffness . the coupling layer is preferably welded to the plastic film 6 of the body attachment wafer 4 along its outer periphery . the grammage , i . e . weight per unit area , of the coupling layer 5 is 15 - 60 g / m 2 , preferably 20 - 40 g / m 2 . by the use of such a thin coupling layer 5 the combined stiffness of the two layers 5 , 6 welded together in the fastening region is considerably lower than the stiffness of the ostomy pouch 2 in the region thereof surrounding the entrance opening 3 and the decrease in vapour permeability in the fastening region due to the presence of the coupling layer 5 is not significant . by having the ostomy pouch 2 affixed to the coupling layer in a landing zone 8 around the opening 3 , the distribution of forces acting on the body attachment wafer 4 due to the weight of the ostomy pouch 2 and its content and to external forces acting on the ostomy pouch 2 is favourably influenced . the attachment line 9 affixing the coupling layer to body attachment wafer is distanced from both the outer and inner periphery of the body attachment wafer 4 so the forces from the ostomy pouch 2 is transferred via the coupling layer 5 to the body attachment wafer 4 at a distance from both the outer and inner edge thereof . thereby the forces from the ostomy pouch 2 will be transferred to the body attachment wafer mainly as shear forces and the risk for peel forces to act on the inner and outer edge of the body attachment wafer is minimized . the ostomy pouch 2 is affixed to the coupling layer 5 in a landing zone 8 which in the embodiment according to fig1 is a region surrounding the opening of the coupling layer 5 . the ostomy pouch 2 is reinforced by an annular layer of plastic material in a region surrounding its opening 3 and this layer is adhesively attached to the landing zone of the coupling layer 5 . the ostomy pouch 2 comprises an inner layer of plastic material and preferably an outer layer of soft nonwoven . the plastic film 6 in the body attachment wafer 4 consists preferably of polyurethane ( pu ) but other plastic material such as polyethylene ( pe ) and ethylene - vinyl acetate ( eva ) can also be used . the coupling layer 5 consists preferably of a film of polyurethane ( pu ) but other plastic materials can also be used . a thin non - permeable foam or a laminate of plastic film and nonwoven is also possible to use . the plastic material in the ostomy pouch 2 should be liquid impermeable as well as vapour impermeable . in fig2 , a second embodiment of an ostomy device 1 ′ in accordance with the present invention is schematically shown in a cross sectional view . the ostomy device 1 ′ differs from the ostomy device 1 shown in fig1 mainly in that the coupling layer 5 ′ is affixed to the body attachment wafer 4 ′ along both the outer an inner peripheries of the coupling layer 5 ′ and that the landing zone 8 ′ for the ostomy pouch 2 ′ is located at a distance from both the outer and inner edges of the coupling layer 5 ′ instead of along the inner edge as is the case in the first embodiment according to fig1 . components in the second embodiment described with reference to fig2 are given the same reference number as similar components in the embodiment of fig1 with the addition of a prime sign . in order not to impair the ventilation ability of the body attachment wafer 4 ′ in the space between the coupling layer 5 ′ and the body attachment wafer 4 ′, this space is ventilated for example by having the outer peripheral region of the coupling layer affixed to the body attachment wafer by a discontinuous weld seam . in a variant holes are made in the coupling layer 5 ′ in the area between the landing zone 8 ′, in which the ostomy pouch 2 ′ is affixed to the coupling layer 5 ′, and the outer periphery of the of the coupling layer 5 ′. it is of course possible to both have holes in said area and a discontinuous weld seam along the outer periphery of the coupling layer . the inner peripheral region of the coupling layer 5 ′ is affixed to the body attachment wafer 4 ′ by a continuous weld seam to prevent leakage . the ostomy pouch is so disposed on a body of a patient that liquid waste from stoma s will flow downwardly after leaving the stoma . by having the inner edge of the coupling layer 5 ′ affixed to the body attachment wafer 4 ′, it is ensured that the first liquid waste leaving the stoma will flow to the lower part of the ostomy pouch 2 ′, i . e . downwards in fig2 , and not gather near the stoma as might happen in the case of the first embodiment according to fig1 , in which there is a risk that liquid waste can leak into the lower part of the space between the coupling layer 5 and the body attachment wafer 4 . in this respect it is pointed out that this space is greatly exaggerated in the figures . when manufacturing the ostomy devices according to fig1 and 2 , coupling layers 5 , 5 ′ are planar annular layers laid onto the body attachment wafers 4 , 4 ′ coplanar therewith . the spaces between the coupling layers 5 , 5 ′ and the body attachment wafers 4 , 4 ′ schematically shown in fig1 and 2 develop due to stretching of the thin coupling layers 5 , 5 ′ by the weight of the ostomy pouches 2 , 2 ′ and their content and external forces acting on the ostomy pouches . usually the ostomy pouches are pressed against the body by the clothing of the patient and / or by other external means . the forces from the weight of the ostomy pouch 2 , 2 ′ and its content will be transferred to the body attachment wafer 4 , 4 ′ mainly along the upper half of the attachment line 9 , 9 ′, i . e . the weld seam connecting the outer periphery of the coupling layer 5 , 5 ′ to the plastic film 6 , 6 ′ of the body attachment wafer 4 , 4 ′. the forces from the weight of the ostomy pouch 2 , 2 ′ and its content will thus be distributed mainly as shear forces to the upper portion of the part of the body attachment wafer lying radially outside the attachment line . the part of the body attachment wafer 4 , 4 ′ lying inside the attachment line 9 , 9 ′, i . e . the central part thereof , will not be influenced by said transferred forces and the risk for peel forces to appear near the inner edge of the body attachment wafer 4 , 4 ′ is minimized . thereby also the risk for liquid waste from the stoma s to leak in under the inner edge of the body attachment wafer 4 , 4 ′ is minimized . in order to ensure that the outer edge of the body attachment wafer 4 , 4 will only be influenced by shear forces by the weight of the ostomy pouch 2 , 2 ′ and its content the attachment line 9 , 9 ′ of the coupling layer 5 , 5 ′ should be distanced from said outer edge by at least 5 mm . by having a coupling layer 5 , 5 ′, the ostomy pouch 2 , 2 ′ can be moved , for example due to movements of the wearer , without directly affecting the body attachment wafer , some movements can be taken up of the coupling layer without affecting the body attachment wafer and other movements will be transferred as shear forces in the coupling layer . by affixing the outer periphery of the coupling layer 5 , 5 ′ to the body attachment wafer 4 , 4 ′, the forces emanating from the ostomy pouch and acting on the body attachment wafer via the coupling layer will be distributed over a larger area of the body attachment wafer than if the ostomy pouch would be directly affixed to the body attachment wafer . the force distribution in ostomy devices according to the present invention is thus so good that the size of the body attachment wafer can be made smaller in comparison with known ostomy devices without increasing the risk for leakage or involuntary detachment of the body attachment wafer . as is evident from fig2 , the inner periphery of the coupling layer 5 ′ is affixed to the body attachment wafer 4 ′ at a distance from the opening therein surrounding the stoma s . the opening in the body attachment wafer 4 ′ for the stoma can , by cutting , thereby be adapted in size and shape to an individual stoma . in the embodiment according to fig1 , it is of course also possible to by cutting adapt the opening in the body attachment wafer 4 to the size and shape of an individual stoma the shapes of the body attachment wafers 4 , 4 ′, the coupling layers 5 , 5 ′ and the openings in said components are preferably circular but other shapes are possible . the shapes of the components and the openings therein can be varied , the coupling layer can for example be oval and the opening therein circular . in the figures the ostomy pouches 2 , 2 ′ are shown in a vertical position but in use the ostomy pouches can be applied in other positions . however , liquid waste will always initially flow downwards in a vertical direction so the forces of the weight of the ostomy pouches and their content will influence the body attachment wafers 4 , 4 ′ in the way described above independent of the positions of the ostomy pouches 2 , 2 ′. since the body attachment wafer in the described embodiments is very flexible it can be difficult to handle . for this reason a releasable stiffening layer in the form of a frame is releasably attached to a peripheral portion of the body attachment wafer lying outside the outer periphery of the coupling layer . this stiffening layer is removed after application of the ostomy device and is accordingly not disclosed in the figures which show the ostomy device in an applied state . the frame consists preferably of paper , thin foam or plastic film . furthermore , a release layer covers the adhesive layer before use of the ostomy device , which layer is removed before application of the ostomy device . the release layer consists preferably of polyethylene or a laminate of polyethylene and paper if the adhesive coating consists of silicone gel but if other skin friendly and soft adhesives are used it can consist of silicone coated paper or any other commonly used material for release layers . the described embodiments can of course be modified without leaving the scope of invention . the attachment line extends in the described embodiments around the outer periphery of the coupling layer but can be located distanced from the outer periphery of the coupling layer , for example if the coupling layer has the same extension as the body attachment wafer , which for manufacturing reasons can be favourable , but the attachment line between the coupling layer and the body attachment wafer is distanced from the outer periphery of the body attachment wafer as is preferred . other soft skin friendly adhesives than silicone gels can for example be used , such as soft hot melt adhesives . furthermore , any kind of known types of ostomy pouches can be used in combination with the described coupling layer and body attachment wafer . it is also possible to use other ways than welding for the affixing of the coupling layer to the body attachment wafer , for example can adhesive be used , either a permeable adhesive or a pattern of adhesive . the scope of invention should therefore only be limited by the wording of the enclosed patent claims .

US-201113581705-A

an apparatus for maintaining at least two seats in a vertical position and a predetermined distance between rows of the at least two seats . the apparatus includes at least two substantially flat base portions ; and at least two support blocks mounted a predetermined distance from each other on an upper surface of each of the base portions , wherein the at least two support blocks define a hollow region for receiving a lower end portion of a leg of a seat to maintain the seat in a vertical position . the predetermined distance between the support blocks corresponds to a predetermined distance between rows of seats .

the following description is presented to enable one of ordinary skill in the art to make and use the invention and is provided in the context of a patent application and its requirements . various modifications to the preferred embodiments will be readily apparent to those skilled in the art and the generic principles herein may be applied to other embodiments . thus , the present invention is not intended to be limited to the embodiment shown but is to be accorded the widest scope consistent with the principles and features described herein . this invention describes a number of related components for use in creating an indoor / outdoor seating system , which can be assembled , disassembled and reconfigured efficiently while providing an attractive , safe and comfortable seating area , keeping code compliant in each configuration for a wide variety of spectator events indoors and out . the structural members and seat modules are optimally designed to be handled efficiently by a small crew who can hand carry the sections , if necessary , to areas where motorized access is not available . fig1 is an isometric view illustrating a single leg triple flip seat module 10 and two floor tracks 100 in accordance with an embodiment of the present invention . the three seat module 10 includes a structure which is a welded one - piece frame 12 . modules with two or more seats are practical . the three seat module 10 is easily handled by one worker . flip - up seats typically use either gravity or a coil spring pivot on shafts 14 to lie flush with seat backs 16 . while conventional construction requires a 36 ″ wide row between seating rows with conventional folding chairs , the automatic flip - up design of the seating modules insures the requisite 12 ″ walk - through clearance with only 30 ″ wide rows . the use of factory - attached seats in modules and floor tracks reduces the labor and time involved in setting up the floor seating and prevents unauthorized movement and guarantees code compliance of the seating . although the embodiments that are illustrated show the use of a three seat module , it is contemplated that the floor tracks in accordance with the present invention may be utilized with any number of seats from one to a plurality . the floor tracks 100 have a flat rectangular shaped base 102 and a pair of support blocks 104 attached to proximal and distal end sections of base 102 . the blocks 104 extend upwardly from base 102 and are configured to engage a leg 18 of the seat assembly 10 . on a horizontal floor application , the support blocks extend substantially perpendicular from the base 102 . it is contemplated that the support blocks 104 may be configured to extend from base 102 at any given angle to maintain the chairs in a vertical position while accommodating a non - horizontal floor application . fig2 is an isometric view illustrating a single leg triple flip seat assembly having a leg 18 in a support block 104 of a floor track assembly 100 in accordance with an embodiment of the present invention . fig3 is an exploded view of detail a of fig2 illustrating a single leg triple flip seat assembly 10 having a leg 18 in a support block 104 of a floor track assembly 100 in accordance with an embodiment of the present invention . each floor track support block 104 is preferably formed having two regions for receiving legs 18 so that a plurality of seat modules may be strung adjacent to each other thereby providing strength and rigidity to the overall setup . a locking pin 20 is illustrated for locking leg 18 to prevent the leg from slipping out of block 104 while in use . the locking pin 20 pin preferably consists of a key ring , a return spring and turned pin . fig4 is an isometric view illustrating a floor track assembly 100 in accordance with an embodiment of the present invention . the base section 102 is preferably formed of aluminum flat stock having approximate dimensions of ¼ inch by 4 inches by 34¼ inches long . the length of the base section will vary in accordance with the number of support blocks that are mounted thereon , which is a function of the number of rows of chairs each floor track will engage . that is , although the embodiments illustrated contain two support blocks mounted on the base section , it is contemplated that the base sections may vary in length to accommodate a plurality of equidistant spaced support blocks . other materials of construction known to one having ordinary skill in the art may also be utilized to form base 102 or any other component . support blocks 104 are also preferably milled from aluminum stock material and welded to base 102 . the support blocks 104 may also be connected to base 102 by other means known to one having ordinary skill in the art . fig5 is an exploded view of detail a of fig4 illustrating a partial floor track assembly 100 in accordance with an embodiment of the present invention . each support block 104 preferably includes two adjacent regions 106 for receiving legs of seat modules . however , it is also contemplated that the support block 104 may be formed having only a single region 106 or a plurality of regions . typically , in the embodiment of support block 104 shown , legs of two adjacent seat modules will be inserted into the regions 106 . it is also contemplated that at the end of a row , when another seat module will not occupy the second region 106 , the second region may be utilized for other applications such as , for example , insertion of a leg of a safety railing , or insertion of a post that can be used as a row sign . the upper end of the support block adjacent to the opening of regions 106 is sloped down towards the region 106 to facilitate easy insertion of a seat leg into the open region 106 during the installation process . longitudinal slots 108 are formed in support blocks 104 to receive a locking pin ( shown in fig3 ) extending from the seat leg as it is inserted into the support block 104 . as the seat leg is inserted into the open region 106 . the sloped portion depresses the locking pin until the leg is fully in the support block 104 and the spring loaded locking pin engages a hole to lock the leg within the support block . fig6 is an isometric view illustrating a support block 104 of a floor track assembly 100 in accordance with an embodiment of the present invention . the view of the support block 104 in fig6 is of the opposite side of the support block 104 illustrated in fig5 . the two elongate holes 110 are formed to receive a locking pin to prevent a seat leg from pulling out of the support block 104 . holes 112 are formed in support block 104 and have a threaded inner surface configured to receive a set screw therein . the purpose of the set screw is to further lock leg 18 within the support block 104 , thereby minimizing the unauthorized removal of leg 18 from the support block 104 during use . fig7 is side view in partial cross - section illustrating a support block 104 of a floor track assembly 100 in accordance with an embodiment of the present invention . as the set screw is screwed into hole 112 , the set screw will enter region 106 and engage a leg of a chair module and secure the leg within region 106 . fig8 is top view in partial cross - section illustrating a support block 104 of a floor track assembly 100 in accordance with an embodiment of the present invention . the cross - section illustrates the position of the set screws within holes 112 . the top view in fig8 also illustrates the slot 108 and the shape , in cross - section , of region 106 . it is contemplated that the shape and depth of region 106 may be altered to accommodate all types of chair configurations . advantageously , when more than one group of chairs 10 are positioned within the support blocks 104 on floor track assemblies 100 , the chairs are restrained from moving side to side or front to back with respect to each other . accordingly , the present invention provides an apparatus for supporting chairs in a manner which will maintain the chairs in their predisposed positions and spacing in accordance with safety and fire code regulations . fabric seat cushions are easily installed to enhance style and comfort that can be used to designate a general admission or vip section . seats can also be upgraded to a theatrical style upholstered chair with a choice of fabric with optional armrest and cup holders to maximize spectator comfort . the present invention can also be easily installed in arenas which are not very accessible to trucks , or in rough outdoors terrain locations , where there is no drive - in access . with this system of the present invention , the installer &# 39 ; s workers can hand carry the components effectively and therefore not be deterred by the fact that one can &# 39 ; t drive a truck into the space or where one has to cross a distance of rough terrain land . although the present invention has been described in accordance with the embodiments shown , one of ordinary skill in the art will readily recognize that there could be variations to the embodiment and these variations would be within the spirit and scope of the present invention . accordingly , many modifications may be made by one of ordinary skill in the art without departing from the spirit and scope of the invention .

US-201113134400-A

a substantially fortified transformable blanket and jacket assembly composed of a secured union between mating and separating connection points , incorporated bundling assemblies and transport assembly for application to a pliable sheet .

referring now to the drawings , fig1 shows an embodiment of a transformable blanket jacket in its extended blanket position generally at reference numeral 1 . the transformable blanket jacket 1 forms a generally rectangular , planar surface in its extended position , with an upper or top side 4 , a lower or bottom side 6 , a left side 8 and a right side 10 . a front surface 12 is visible in fig1 . it is to be understood that this configuration contemplates the transformable blanket jacket extended upon a flat surface , since the materials used in the construction of the transformable blanket jacket are pliable . the transformable blanket jacket of the present invention may be viewed as having two halves formed by an imaginary line generally equidistant from the left side 8 and the right side 10 , and bisecting the upper side 4 and lower side 6 as a midline . such an imaginary line forms a left half 15 and a right half 16 . located on the front surface 12 , near the left side 8 is a first , cooperating fastener 18 . located on the front surface 12 , toward but spaced from the upper side 4 and on the left half 15 is a second , cooperating fastener 19 , generally transverse to the first , cooperating fastener 18 . also located on the front surface 12 , near the right side 10 is a third , cooperating fastener 20 . similarly , toward but spaced from the upper side 4 is a fourth , cooperating fastener 21 on the right half 16 , and generally transverse to the third , cooperating fastener 20 . in the preferred embodiment of the present invention , first , cooperating fastener 18 , second , cooperating fastener 19 , third cooperating fastener 20 and fourth , cooperating fastener 21 are mating zippers , although it will be understood by those skilled in the art that other fasteners could be employed , such as : hooks and loops , sold under the trademark velcro ; buttons and button holes , and the like . located on front surface 12 , spaced a predetermined distance from upper side 4 , amid left side 8 and right side 10 is a durable , pliable neck reinforcement component 32 having a surface 35 , an upper or top side 34 , a lower or bottom side 36 , a left side 37 and a right side 38 . neck reinforcement part 32 is preferably constructed from a durable , pliable material such as canvas . in the preferred embodiment of the present invention , upper side 34 of neck reinforcement part 32 is generally coextensive with second , cooperating fastener 19 and fourth cooperating fastener 21 , coexistence component 41 . located on the front surface 12 , near the left side 8 and upper side 4 is a fifth , cooperating fastener 22 . also located on the front surface 12 , near top side 4 , toward but spaced a predetermined distance from the left side 8 , is a sixth , cooperating fastener 23 . similarly , located on the front surface 12 , near the right side 10 and upper side 4 is a seventh , cooperating fastener 24 . also located on the front surface 12 , right half 16 near top side 4 , toward but spaced a predetermined distance from the right side 10 , is an eighth , cooperating fastener 25 . in the preferred embodiment of the present invention , fifth , cooperating fastener 22 , sixth cooperating fastener 23 , seventh cooperating fastener 24 and eighth , cooperating fastener 25 are mating snaps , although it will be understood by those skilled in the art that other fasteners could be employed , such as : hooks and loops , sold under the trademark velcro ; buttons and button holes , and the like . in use as a jacket , first cooperating fastener 18 is brought into operable engagement with second , cooperating fastener 19 , forming a first , right sleeve opening 28 and a right lapel 45 as illustrated in fig2 . in like manner , third , cooperating fastener 20 is brought into operable engagement with fourth , cooperating fastener 21 to form a second , left sleeve opening 30 and a left lapel 44 as illustrated in fig3 . with coexistence component 41 used as a reference point , upper side 4 is folded to form a collar 42 as illustrated in fig4 . next , fifth cooperating fastener 22 is brought into engagement with sixth , cooperating fastener 23 , forming a first , right sleeve cuff 49 . in like manner , seventh , cooperating fastener 24 is brought into operable engagement with eighth , cooperating fastener 25 to form a second , left sleeve cuff 48 . fig4 shows an embodiment of a transformable blanket jacket back surface in its folded , fastened jacket arrangement generally at reference numeral 14 . referring now to fig5 - 7 , the blanket jacket may be disassembled and bundled in transport carrying formation , where the right side 38 of neck reinforcement component 32 , constructed with a predetermined overall length functions as a reference point gauge when folding the right half 16 as illustrated in fig5 , and 7 . in like manner , left side 37 , of neck reinforcement component 32 functions as a reference point gauge when folding left half 15 for bundling the transformable blanket jacket 1 into transport carrying formation . referring to fig7 secured to bottom side 36 toward but spaced from left edge 37 of neck reinforcement part 32 is a first left bundling loop 39 . similarly , secured to bottom side 36 toward but spaced from right edge 38 of neck reinforcement part 32 is a second right bundling loop 40 . referring to fig8 attached to the pliable neck reinforcement component 32 is a carry strap 60 . what has been described is a one - piece transformable blanket jacket constructed from a substantially durable , pliable material , reinforced securement sections , bundling assembly , and transport assembly incorporated into one unitary garment constructed from a pliable material . in view of the foregoing , it will be seen that the several objects of the invention are achieved and other advantageous results are obtained . as various changes could be made in the above constructions without departing from the scope of the invention , it is intended that all matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense .

US-97242101-A

new gene therapy constructions and compositions are the subject of present invention . the gene therapy compositions consist in adeno - associated vectors which jointly express insulin and glucokinase genes . the new gene therapy constructions are useful for treatment of diabetes either in dogs or human beings .

the significance and potential impact of the gene therapy invention approach , consisting of co - expression of low levels of insulin together with the enzyme glucokinase in skeletal muscle , are potentially enormous . normalization of glycemia with a one - time intervention would result in a great improvement of patients &# 39 ; quality of life and prevention of severe and costly secondary complications of diabetes . the data disclosed in the present invention show that this is feasible and safe . it should be noted that , compared to other experimental therapeutic approach to diabetes , the strategy displayed in the invention is based on engineering skeletal muscle , a readily accessible tissue that do not require any invasive procedures to be manipulated . this is a considerable advantage over other approaches , such as engineering the liver or transplanting insulin - producing β - cells . it should also be pointed out that the gene therapy composition and the method disclosed herein have the advantage of not requiring immunosuppression , as diabetic subjects are naturally immunologically tolerant to insulin and glucokinase ; additionally , even basal ( low ) levels of expression of insulin and glucokinase may result in a dramatic improvement of the disease profile in terms of quality of life ( better glycemic control ) and reduction of insulin requirements . thus , the use of two genes acting synergistically on glycemic control potentially represents a major advance in the management of t1d and t2d diabetes worldwide . therefore , the present invention relates gene therapy compositions which comprise at least a first vector carrying and allowing the expression of insulin gene ( ins ) and at least a second vector carrying and allowing the expression of glucokinase gene ( gck ). as alternative , the gene therapy compositions of present invention comprise a single vectors carrying and allowing the expression of both genes ( ins and gck ) operatively linked . moreover , ins and / or gck genes can be , any of them independently , autologous or heterologous genes with regard to the species wherein are being expressed . in a particular embodiment of the gene therapy compositions of the invention are characterized by the vectors are adeno associated virus based vector . in another particular embodiment of the gene therapy composition disclosed in the present invention , the first vector contains the cds of seq id no . 1 or the cds of seq id no . 3 . in another particular embodiment of the gene therapy composition disclosed in the present invention , the second vector contains the cds of seq id no . 2 or the cds of seq id no . 4 . in another particular embodiment of the gene therapy composition , the first and the second carrying gene vectors are the same . in another particular embodiment of the gene therapy composition , comprises a first vector containing the cds of seq id no . 1 and a second vector containing the cds of seq id no . 2 . in another particular embodiment of the gene therapy composition disclosed herein , the first vector is aav - ins and the second vector is aav - gck . in another particular embodiment , the gene therapy composition of the invention comprises a first vector containing the cds of seq id no . 3 and a second vector containing the cds of seq id no . 4 . in another particular embodiment of the gene therapy composition disclosed in the present invention , the first vector is aav - mhins and the second vector is aav - mhgck . in another particular embodiment , the gene therapy composition of the invention comprises a first vector containing the cds of seq id no . 1 or the cds of seq id no : 3 and a second vector containing the cds of seq id no . 2 or the cds of seq id no : 4 . in another particular embodiment , the gene therapy composition of the invention is characterized by the first vector is selected from aav - ins or aav - mhins and the second vector is selected from aav - gck or aav - mhgck . present invention also relates gene therapy compositions for use in the treatment of diabetes in mammals . in a particular embodiment of the gene therapy compositions disclosed herein , the mammal is a rodent , preferably mice , rats , gerbils and guinea pigs and more preferably mice and rats . in another preferred embodiment of the gene therapy compositions disclosed herein , the mammal is a dog . in another preferred embodiment of the gene therapy compositions disclosed herein , the mammal is a human being . present invention also disclosed a mutated human insulin ( mhins ) gene characterized by comprising the cds having seq id no : 3 and a mutated human glucokinase ( mhgck ) gene characterized by comprising the cds having seq id no : 4 . another object disclosed in the present invention is the mutated human insulin ( mhins ) gene , as disclosed previously , for use in the treatment of diabetes . present invention also disclosed the use of the mutated human insulin ( mhins ) gene disclosed herein for the manufacture of a medicament and / or a gene therapy composition for use in the treatment of diabetes . another object disclosed in the present invention is the mutated human glucokinase ( mhgck ) gene , as disclosed previously , for use in the treatment of diabetes . present invention also disclosed the use of the mutated human glucokinase ( mhgck ) gene disclosed herein for the manufacture of a medicament and / or a gene therapy composition for use in the treatment of diabetes . present invention also disclosed a method of treatment of diabetes which comprises the administration to a subject in need of it , of a therapeutically effective dose of a gene therapy composition according to the present invention . in a preferred embodiment of the invention , the method comprises the administration of the gene therapy composition disclosed herein , in a single dose for all the treatment . in another preferred embodiment of the invention , the method disclosed that the single dose is administered to muscle tissue by means of an unique multi - needle injection . present invention also disclosed a method of treatment of diabetes which comprises the administration to a subject in need of it , of a therapeutically effective dose of a gene therapy composition which comprises at least a vector carrying and allowing the expression of glucokinase gene ( gck ). in a preferred embodiment of the method of the present invention , the vector is an adeno - associated virus based vector . in another preferred embodiment of the method disclosed herein , the vector comprises the cds having either seq id no : 2 or seq id no : 4 . in another preferred embodiment of the method disclosed herein , the vector is selected from aav - mhgck or aav - gck . in another preferred embodiment of the method disclosed herein , the gene therapy composition is administered in a single dose for all the treatment . in another preferred embodiment of the method disclosed herein , the single dose is administered to muscle tissue by means of an unique multi - needle injection . in another preferred embodiment of the invention the method further comprises exogenous insulin injections . the invention will now be described in more detail by way of examples . the following examples are for illustrative purposes only and are not intended , nor should they be interpreted , to limit the scope of the invention . studies in diabetic beagle dogs used a unique 5 - point needle ( fig1 a ) to obtain widespread expression of a gfp reporter in skeletal muscle ( fig1 b ). subsequently , 2 . 5 × 10 12 vg / kg of aav1 - human ins was injected into dog 1 three days after diabetes induction with streptozotocin + alloxan ( 50 ). low levels of circulating human c - peptide were observed 4 days later , peaking after 2 weeks in association with hypoglycemia . dog 1 was sacrificed 21 days after treatment and strong insulin expression was detected in biopsies of the treated area ( fig1 c ). these results indicated that aav vectors injected in multiple sites can efficiently deliver the insulin gene to widespread areas and that aav - mediated gene transfer of insulin to a large animal model of diabetes was feasible , resulting in large amounts of insulin produced and secreted from the dog skeletal muscle . next goal of present invention was to determine the optimum dose able to achieve therapeutic efficacy without causing hypoglycemia . to this end , dog 2 was injected with 1 . 0 × 10 12 vg / kg of aav1 - human ins after diabetes induction . after gene transfer , fasting glycemia decreased to reach normoglycemia without becoming hypoglycemic ( fig2 a ). after ˜ 300 days , the fasting glycemia values became slightly hyperglycemic and have since remained stable . however , even when normoglycemic , we did not see a significant improvement in the ability of this dog to dispose glucose ( fig2 a ). this was despite detecting human c - peptide ˜ 70 days after treatment , with stable levels achieved after 130 days those have lasted for more than 800 days , suggesting the long - term potential of this treatment . muscle biopsies taken 14 and 270 days after treatment showed detectable insulin rna at both time points , whereas a pancreas biopsy at day 270 showed less than 10 % residual β - cell mass and no sign of regeneration . dog 2 demonstrated no adverse events , no signs of toxicity and had a normal weight gain profile suggesting that even modest levels of circulating insulin can have beneficial effects . dog 3 and dog 4 were made diabetic and treated with the same dose of aav1 - human ins as dog 2 and an equal dose ( 1 . 0 × 10 12 vg / kg ) of aav1 - rat gck . both dog 3 and 4 showed a more accelerated return to fasting normoglycemia ( fig2 b ). these dogs remained normoglycemic for a long period (& gt ; 2 years ). circulating human insulin and c - peptide levels in these dogs were detectable after treatment and , importantly , both dogs 3 and 4 showed an improved gtt profile compared with dog 2 ( fig3 b , c ). muscle biopsies 15 and 113 days after viral injection revealed strong expression of both insulin and gck , whereas a pancreas biopsy at 113 days confirmed & lt ; 5 % residual β - cell mass . no muscle damage was seen and , like dog 2 , we observed normal weight gain and no toxicity . together , these data suggests that the combined treatment with human ins and rat gck leads to more beneficial effects in terms of improvement of glycemic control ; these effects were not observed in dog 2 despite the expression of insulin . then experimental diabetes in dog 5 was induced and followed long - term progression of diabetes . despite the complete absence of exogenous insulin treatment , this dog showed a gradual return to fasted normoglycemia , also coinciding with summer times . about six months after diabetes induction , we observed a severe rise in glycemia ( fig4 a ) parallel with a strong decrease in body weight (& gt ; 30 %) and marked increase in liver transaminases ( fig4 b , c ). at that moment , dog 5 was treated with the same doses of aav1 - ins and aav1 - gck as dog 3 and 4 , which resulted in dramatic improvements of its metabolic profile . fasting glycemia dropped sharply within 30 days of treatment ( fig4 a ), coinciding with a rise in circulating human c - peptide and a persistent weight gain ( fig4 b ). biochemical signs of liver damage also normalized ( fig4 c ) and , most importantly , we observed an improved glucose disposal by gtt reminiscent of dog 3 and 4 ( fig3 d ). these results clearly demonstrate the beneficial effects of combined ins + gck therapy in long - term diabetic dogs . therefore , joint expression of insulin and gck in skeletal muscle is a safe approach that allows long - term survival in large diabetic animals (& gt ; 2 years ), body weight maintenance , normal physical performance and normalization of serum parameters . construction of mutated vectors for efficient expression of human insulin and human glucokinase the coding sequence of either human insulin gene ( hins ), containing specific sites for furin processing ( 36 ), or human glucokinase gene ( hgck ) was modified to obtain codon mutated sequences ( mhins or mhgck , respectively ) following geneart procedures ( 48 ). geneart process involves avoiding cis - acting sequence motifs as : internal tata - boxes , chi - sites and ribosomal entry sites ar - rich or gc - rich sequence stretches rna instability motifs repeat sequences and rna secondary structures ( crytic ) splice donor and acceptor sites in higher eukaryotes the codon usage was adapted in geneart process to codon bias of mus musculus genes . in addition , regions of very high (& gt ; 80 %) or very low (& lt ; 30 %) gc content were avoided when possible . the mutated gene constructs obtained showed cai ( codon adaptation index ) of 0 . 96 what means high and stable expression rates in mus musculus . gc - content adjustment made by the process of genart , prolongs mrna half - life of the mutated construct achieved . the mutated human insulin and gck genes described herein are then called mutated human genes . the mutated insulin and gck cdna was cloned in the multicloning site of the paav - mcs plasmid ( stratagene ; fig5 ) resulting in the plasmids paav - mhins and paav - mhgck respectively . this plasmid contains the cmv promoter and polya signal from growth hormone flanked by the two inverted terminal repeats ( itr ) of aav2 . itr sequences are required for packaging of the aav genome into the aav capsid , and are required for replication of the aav genome during aav production . adeno - associated vectors were generated by triple transfection of human embryonic kidney 293 cells ( hek293 ) cells according to standard methods . hek293 are cells from human origin that are stable transfected with the adenovirus e1 gene . the adenovirus e1 gene is required for adenovirus replication and also acts as a helper gene for aav replication . the invention uses hek293 cells for several purposes : 1 .— aav production using triple transfection method . for aav production , it is required to have the cassette of expression flanked by itr ( plasmid 1 ), a plasmid coding for rep and cap genes from the aav ( plasmid 2 ; provides replication functions for aav genome and the capsid proteins depending on the desired serotype ), a third plasmid coding for the essential genes of adenovirus required to provide helper function and support replication of aav ( plasmid 3 , also named as adenovirus helper plasmid with code for e2 , e4 and va genes ). in addition to e2 , e4 and va , e1 gene is necessary for replication of aav , in this case e1 gene is provided by the hek293cells instead of being in the adenovirus helper plasmid . 2 .— for dna transfection . the inventors have used hek293 to study expression , processing and secretion of insulin and expression of gk because they are very efficiently transfected with plasmid using calcium phosphate method . 3 .— hek293 cells were also used to study expression , processing and secretion of insulin and expression of gk from aav1 vectors , because this cell line ( and not others ) are permissive for aav1 - transduction . cells were cultured in roller bottles ( rb ) ( corning , lowell , mass .) in dmem 10 % fbs to 80 % confluence and co - transfected with a plasmid carrying the expression cassette flanked by the viral itrs ( described above ), a helper plasmid carrying the aav rep2 and cap1 genes , and a plasmid carrying the adenovirus helper functions ( both plasmids kindly provided by k . a . high , children &# 39 ; s hospital of philadelphia ). vectors were purified with an optimized method based on two consecutives cesium chloride gradients ( 49 ), dialyzed against pbs , filtered , titred by qpcr and stored at − 80 ° c . until use . hek293 cells were transfected with paavmhins and paavmhgck using calcium phosphate standard method . for experiments using aav vectors , hek293 cells were infected with aav1mhins and aav1mhgck at different moi ( i . e . 10e4 , 10e5 , 10e6 vg / cell ). two days after transfection , cells were lysated with 1 ml of tripure ( roche ) and total rna was extracted with rnaeasy mini kit ( qiagen ). a northern blot was performed with 10 ug of rna and hibridized with the mhins ( cds of seq id no : 3 ) or the mhgck ( cds of seq id no : 4 ) cdna , respectively ( fig6 ). since these plasmids showed a high expression level of the gene of interest , adenoassociated type 1 viral vectors carrying these constructs were produced . subsequently , aav vectors were tested for their mrna expression in hek293 cells 96 h after transduction . high levels of transgene expression were detected by northern blot both with aav1 - mhins and aav1 - mhgck ( fig7 ). in addition to increased rna expression , the present invention has also detected a substantial increase in mhgck protein production by the mutated construct ( fig8 ). codon mutated human gck construct produce 600 % more protein than the rat gck construct and 300 % more protein than the human gck transgene (= non codon mutated ). this data , together with data disclose in example 3 ( fig6 and 7 ) of the present invention demonstrate that mhgck construct result in higher rna and protein production compare with construct carrying rgck or the wild type human gck gene . to demonstrate functionality of these novel constructs , aav1 vectors coding for rat gck ( rgck , nm — 012565 ), wild type human gck ( hgck , nm — 033507 ) or codon mutated human gck ( mhgck , cds of seq id no : 4 ) were produced as disclosed in the previous example 3 and 4 . hek293 cells were transduced with the 3 different vectors and gck activity was measured . as shown in fig9 , the gck activity of codon mutated ( mhgck ) construct was higher than wild type human ( hgck ) construct and rat gck ( rgck ) construct . to provide in vivo evidences of gck function , the inventors injected aav1 vectors coding for rgck , hgck and mhgck into 3 different muscles in the hindlimbs of healthy mice . one month after the injection these muscles were harvested and analyzed for gck activity . as shown in fig1 , muscles treated with mhgck vectors disclosed higher gck activity compare with hgck and rgck . these results clearly demonstrated superior effect of aav1 - mhgck vectors vs aav1 - rgck or aav1 - hgck and suggested that lower doses of codon mutated insulin vectors will be required to achieve same therapeutic effect than non - mutated vectors . mutated construct showed an in vitro and in vivo increased insulin and c - peptide production compare to standard vectors we aimed to compare the ability of the mutated insulin gene versus the non mutated insulin gene to produce human c - peptide and human insulin production . to this end , we transduced hek293 cells with two different adenoassociated vectors ( aav1mhins ) at 3 different mois ( 10e4 , 10e5 and 10e6 vg / cell ). four wells per moi and vector were used . two days after the infection , standard culture media ( dmem + 10 % fbs ) was changed to a serum - free media to avoid the ria detection of the media containing insulin . next day ( three days after the infection ) medium was collected and was analyzed by ria for the human c - peptide and insulin quantification . then it was observed a significant increase in human c - peptide levels ( fig1 ) and human insulin levels ( fig1 ) in aav1 - mhins treated cells compared with standard insulin construct ( aav1 - hins ). these data demonstrate that mutated insulin construct is more efficient in protein production and secretion that standard insulin gene . to provide in vivo evidences of increased insulin and c - peptide production between aav1 - mhins vs aav1 - hins vectors , healthy mice were injected in hindlimb muscles with a total dose of 1 , 4e11vg / mouse . glycemia and insulinemia was measured two weeks after viral injection . as shown in fig1 , a significant reduction in fed glycemia was observed in animals injected with aav1 - mhins compare with aav1 - hins . in agreement with this , insulinemia ( fig1 a ) and c - peptide ( fig1 b ) was higher in aav1 - mhins treated mice . the data disclosed in the present invention , clearly demonstrated a superior effect of aav1 - mhins vectors vs aav1 - hins and suggested that lower doses of codon mutated insulin vectors will be required to achieve same therapeutic effect than non - mutated vectors ( hins ). the use of lower doses of vectors may have several advantages for gene therapy : a ) potential immunological responses might be reduced since it has been suggested that immunological responses to aav are dose dependent , b ) lower number of injection sites to distribute the insulin vector will be required . c ) vector manufacture demand will be lower . the present invention tested the efficacy of a combined gene therapy approach with aav1 vectors carrying codon mutated human constructs in diabetic mice . to this end , we injected aav1 - mhgck vectors , aav1 - mhins or both ( 10e12vg per vector / kg ) into the hindlimbs of c57b16 diabetic mice . experimental t1d was induced by streptozotocin ( stz ) administration as in ( 36 ) and viral vectors were injected 15 days after stz . a control group of stz - treated mice was injected with aav1 - null vectors ( same vector capsid but without expression of any transgene ). animals treated with a combination of aav1 - mhins + aav1 - mhgck showed significant reduction in blood glucose levels both in fasted and fed conditions ( fig1 and 16 , respectively ) compared with aav1 - null vector - treated mice or single treatment with aav1 - mhins or aav1 - mhgck . combined therapy : gene therapy with aav1 - mhgck + exogenous insulin in t1d and t2d the present invention have also evaluated whether aav1 - mhgck gene therapy per se may have therapeutic benefit for treating diabetes . to this end , we injected aav1 - mhgck vectors ( 10e12vg / kg ) into the hindlimbs of c57b16 diabetic mice . experimental t1d was induced by stz administration and viral vectors ( aav1 - mhgck ) were injected 15 days after stz . a control group of stz - treated mice was injected with aav1 - null vectors ( same vector capsid but without expression of any transgene ). two - months after aav injection an insulin tolerance test was performed using low doses of insulin ( 0 , 375 u / kg ). fig1 shows that aav1 - mhgck treatment dramatically increase glucose uptake and reduce glycemia in the presence of exogenous insulin . these results indicate that gene therapy with aav1 - mhgck could be combined with regular exogenous insulin injections to improve the conventional treatment of t1d diabetes . the inventors performed experiments in high fat fed animals as a model of t2d . in these animals , aav1 - rgck vectors ( 2e12vg / kg ) were injected in hindlimb muscles before the induction of diabetes by the high fat diet ( hfd ). three months after hfd an intraperitoneal insulin tolerance test ( 0 . 75 u / kg ) was performed . insulin sensitivity of aav1 - gck - treated mice was similar to control healthy mice while hfd fed mice were insulin resistant ( fig1 ). these data demonstrate that aav1 - gck gene therapy per se could be considered as a treatment for diabetic patients in which insulin production is still present , such as early phases of t2d patients . 1 . 1997 . report of the expert committee on the diagnosis and classification of diabetes mellitus . diabetes care 20 : 1183 - 1197 . 2 . eizirik , d . l ., and mandrup - poulsen , t . 2001 . a choice of death — the signal - transduction of immune - mediated beta - cell apoptosis . diabetologia 44 : 2115 - 2133 . 3 . mathis , d ., vence , l ., and benoist , c . 2001 . beta - cell death during progression to diabetes . nature 414 : 792 - 798 . 4 . kahn , s . e ., hull , r . l ., and utzschneider , k . m . 2006 . mechanisms linking obesity to insulin resistance and type 2 diabetes . nature 444 : 840 - 846 . 5 . roglic , g ., and unwin , n . 2009 . mortality attributable to diabetes : estimates for the year 2010 . diabetes res clin pract 87 : 15 - 19 . 7 . beran , d ., and yudkin , j . s . 2006 . diabetes care in sub - saharan africa . lancet 368 : 1689 - 1695 . 9 . greenwood , h . l ., singer , p . a ., downey , g . p ., martin , d . k ., thorsteinsdottir , h ., and daar , a . s . 2006 . regenerative medicine and the developing world . plos med 3 : e381 . 10 . heine , r . j ., bilo , h . j ., sikkenk , a . c ., and van der veen , e . a . 1985 . mixing short and intermediate acting insulins in the syringe : effect on postprandial blood glucose concentrations in type i diabetics . br med j ( clin res ed ) 290 : 204 - 205 . 11 . binder , c ., lauritzen , t ., faber , o ., and pramming , s . 1984 . insulin pharmacokinetics . diabetes care 7 : 188 - 199 . 12 . the diabetes control and complications trial research group . the effect of intensive treatment of diabetes on the development and progression of long - term complications in insulin - dependent diabetes mellitus . 1993 . n engl j med 329 : 977 - 986 . 13 . cryer , p . e . 2001 . hypoglycemia risk reduction in type 1 diabetes . exp clin endocrinol diabetes 109 suppl 2 : s412 - 423 . 14 . cryer , p . e . 2002 . hypoglycaemia : the limiting factor in the glycaemic management of type i and type ii diabetes . diabetologia 45 : 937 - 948 . 15 . correa - giannella , m . l ., and raposo do amaral , a . s . 2009 . pancreatic islet transplantation . diabetol metab syndr 1 : 9 . 16 . shapiro , a . m ., lakey , j . r ., ryan , e . a ., korbutt , g . s ., toth , e ., warnock , g . l ., kneteman , n . m ., and rajotte , r . v . 2000 . islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid - free immunosuppressive regimen . n engl j med 343 : 230 - 238 . 17 . ryan , e . a ., paty , b . w ., senior , p . a ., bigam , d ., alfadhli , e ., kneteman , n . m ., lakey , j . r ., and shapiro , a . m . 2005 . five - year follow - up after clinical islet transplantation . diabetes 54 : 2060 - 2069 . 18 . elliott , r . b ., escobar , l ., tan , p . l ., muzina , m ., zwain , s ., and buchanan , c . 2007 . live encapsulated porcine islets from a type 1 diabetic patient 9 . 5 yr after xenotransplantation . xenotransplantation 14 : 157 - 161 . 19 . hering , b . j ., and walawalkar , n . 2009 . pig - to - nonhuman primate islet xenotransplantation . transpl immunol 21 : 81 - 86 . 20 . trucco , m . 2005 . regeneration of the pancreatic beta cell . j clin invest 115 : 5 - 12 . 21 . dong , h ., and woo , s . l . 2001 . hepatic insulin production for type 1 diabetes . trends endocrinol metab 12 : 441 - 446 . 22 . lee , h . c ., kim , s . j ., kim , k . s ., shin , h . c ., and yoon , j . w . 2000 . remission in models of type 1 diabetes by gene therapy using a single - chain insulin analogue . nature 408 : 483 - 488 . 23 . cheung , a . t ., dayanandan , b ., lewis , j . t ., korbutt , g . s ., rajotte , r . v ., bryer - ash , m ., boylan , m . o ., wolfe , m . m ., and kieffer , t . j . 2000 . glucose - dependent insulin release from genetically engineered k cells . science 290 : 1959 - 1962 . 24 . ferber , s ., halkin , a ., cohen , h ., ber , i ., einav , y ., goldberg , i ., barshack , i ., seijffers , r ., kopolovic , j ., kaiser , n ., et al . 2000 . pancreatic and duodenal homeobox gene 1 induces expression of insulin genes in liver and ameliorates streptozotocin - induced hyperglycemia . nat med 6 : 568 - 572 . 25 . kojima , h ., fujimiya , m ., matsumura , k ., younan , p ., imaeda , h ., maeda , m ., and chan , l . 2003 . neurod - betacellulin gene therapy induces islet neogenesis in the liver and reverses diabetes in mice . nat med 9 : 596 - 603 . epub 2003 apr 2021 . 26 . kahn , b . b . 1996 . lilly lecture 1995 . glucose transport : pivotal step in insulin action . diabetes 45 : 1644 - 1654 . 27 . printz , r . l ., magnuson , m . a ., and granner , d . k . 1993 . mammalian glucokinase . annu rev nutr 13 : 463 - 496 . 28 . postic , c ., leturque , a ., printz , r . l ., maulard , p ., loizeau , m ., granner , d . k ., and girard , j . 1994 . development and regulation of glucose transporter and hexokinase expression in rat . am j physiol 266 : e548 - 559 . 29 . printz , r . l ., koch , s ., potter , l . r ., o &# 39 ; doherty , r . m ., tiesinga , j . j ., moritz , s ., and granner , d . k . 1993 . hexokinase ii mrna and gene structure , regulation by insulin , and evolution . j biol chem 268 : 5209 - 5219 . 30 . riu , e ., mas , a ., ferre , t ., pujol , a ., gros , l ., otaegui , p ., montoliu , l ., and bosch , f . 2002 . counteraction of type 1 diabetic alterations by engineering skeletal muscle to produce insulin : insights from transgenic mice . diabetes 51 : 704 - 711 . 31 . white , m . f ., and kahn , c . r . 1994 . the insulin signaling system . j biol chem 269 : 1 - 4 . 32 . otaegui , p . j ., ferre , t ., pujol , a ., riu , e ., jimenez , r ., and bosch , f . 2000 . expression of glucokinase in skeletal muscle : a new approach to counteract diabetic hyperglycemia . hum gene ther 11 : 1543 - 1552 . 33 . matschinsky , f . m . 1996 . banting lecture 1995 . a lesson in metabolic regulation inspired by the glucokinase glucose sensor paradigm . diabetes 45 : 223 - 241 . 34 . jimenez - chillaron , j . c ., newgard , c . b ., and gomez - foix , a . m . 1999 . increased glucose disposal induced by adenovirus - mediated transfer of glucokinase to skeletal muscle in vivo . faseb j 13 : 2153 - 2160 . 35 . otaegui , p . j ., ontiveros , m ., ferre , t ., riu , e ., jimenez , r ., and bosch , f . 2002 . glucose - regulated glucose uptake by transplanted muscle cells expressing glucokinase counteracts diabetic hyperglycemia . hum gene ther 13 : 2125 - 2133 . 36 . mas , a ., montane , j ., anguela , x . m ., munoz , s ., douar , a . m ., riu , e ., otaegui , p ., and bosch , f . 2006 . reversal of type 1 diabetes by engineering a glucose sensor in skeletal muscle . diabetes 55 : 1546 - 1553 . 37 . daya s & amp ; berns k i . 2008 . gene therapy using adeno - associated virus vectors . clin microbiol rev 21 ( 4 ): 583 - 593 . 38 . brantly m l , chulay j d , wang l , mueller c , humphries m , spencer l t , rouhani f , conlon t j , calcedo r , betts m r , spencer c , byrne b j , wilson j m , flotte t r . 2009 . sustained transgene expression despite t lymphocyte responses in a clinical trial of raav1 - aat gene therapy proc natl acad sci usa 106 ( 38 ): 16363 - 16368 . 39 . kaplitt m g , feigin a , tang c , fitzsimons h l , mattis p , lawlor p a , bland r j , young d , strybing k , eidelberg d , during m j . 2007 . safety and tolerability of gene therapy with an adeno - associated virus ( aav ) borne gad gene for parkinson &# 39 ; s disease : an open label , phase i trial . lancet 369 ( 9579 ): 2097 - 2105 . 40 . maguire a m , high k a , auricchio a , wright j f , pierce e a , testa f , mingozzi f , bennicelli j l , ying g s , rossi s , fulton a , marshall k a , banfi s , chung d c , morgan j i , hauck b , zelenaia o , zhu x , raffini l , coppieters f , de baere e , shindler k s , volpe n j , surace e m , acerra c , lyubarsky a , redmond t m , stone e , sun j , mcdonnell j w , leroy b p , simonelli f , bennett j . 2009 . age - dependent effects of rpe65 gene therapy for leber &# 39 ; s congenital amaurosis : a phase 1 dose - escalation trial . lancet 374 ( 9701 ): 1597 - 1605 . 41 . maguire a m , simonelli f , pierce e a , pugh e n jr , mingozzi f , bennicelli j , banfi s , marshall k a , testa f , surace e m , rossi s , lyubarsky a , arruda v r , konkle b , stone e , sun j , jacobs j , dell &# 39 ; osso l , hertle r , ma j x , redmond tm , zhu x , hauck b , zelenaia o , shindler k s , maguire m g , wright j f , volpe n j , mcdonnell j w , auricchio a , high k a , bennett j . 2008 . safety and efficacy of gene transfer for leber &# 39 ; s congenital amaurosis . n engl j med 358 ( 21 ): 2240 - 2248 . 42 . manno c s , pierce g f , arruda v r , glader b , ragni m , rasko j j , ozelo m c , hoots k , blatt p , konkle b , dake m , kaye r , razavi m , zajko a , zehnder j , rustagi p k , nakai h , chew a , leonard d , wright j f , lessard r r , sommer j m , tigges m , sabatino d , luk a , jiang h , mingozzi f , couto l , ertl h c , high k a , kay m a . 2006 . successful transduction of liver in hemophilia by aav - factor ix and limitations imposed by the host immune response . nat med 12 ( 3 ): 342 - 347 . 43 . mendell j r , rodino - klapac l r , rosales - quintero x , kota 5 , coley b d , galloway g , craenen j m , lewis s , malik v , shilling c , byrne b j , conlon t , campbell k j , bremer w g , viollet l , walker c m , sahenk z , clark k r . 2009 . limb - girdle muscular dystrophy type 2d gene therapy restores alpha - sarcoglycan and associated proteins . ann neurol 66 ( 3 ): 290 - 297 . 44 . stroes e s , nierman m c , meulenberg j j , franssen r , twisk j , henny c p , maas m m , zwinderman a h , ross c , aronica e , high k a , levi m m , hayden m r , kastelein j j , kuivenhoven j a . 2008 . intramuscular administration of aav1 - lipoprotein lipase s447x lowers triglycerides in lipoprotein lipase - deficient patients . arterioscler thromb vasc biol 28 ( 12 ): 2303 - 2304 . 45 . jiang h , pierce g f , ozelo m c , de paula e v , vargas j a , smith p , sommer j , luk a , manno c s , high k a , arruda v r . 2006 . evidence of multiyear factor ix expression by aav - mediated gene transfer to skeletal muscle in an individual with severe hemophilia b . mol ther 14 ( 3 ): 452 - 455 . 46 . niemeyer g p , herzog r w , mount j , arruda v r , tillson d m , hathcock j , van ginkel f w , high k a , lothrop c d jr . 2009 . long - term correction of inhibitor - prone hemophilia b dogs treated with liver - directed aav2 - mediated factor ix gene therapy . blood 113 ( 4 ): 797 - 806 . 47 . simonelli f , maguire a m , testa f , pierce e a , mingozzi f , bennicelli j l , rossi s , marshall k , banfi s , surace e m , sun j , redmond t m , zhu x , shindler k s , ying g s , ziviello c , acerra c , wright s f , mcdonnell s w , high ka , bennett j , auricchio a . 2010 . gene therapy for leber &# 39 ; s congenital amaurosis is safe and effective through 1 . 5 years after vector administration . mol ther 18 ( 3 ): 643 - 650 . 48 . sharp , p . m . and li , w . h . 1987 . the codon adaptation index — a measure of directional synonymous codon usage bias , and its potential applications . nucleic acids res . 15 ( 3 ). 49 . ayuso e , mingozzi f , montane j , leon x , anguela x m , haurigot v , edmonson s a , africa l , zhou s , high k a , bosch f , wright j f . 2010 . high aav vector purity results in serotype - and tissue - independent enhancement of transduction efficiency . gene ther . 17 ( 4 ): 503 - 10 . 50 . anderson h r , stitt a w , gardiner t a , lloyd s j , archer d b . 1993 induction of alloxan / streptozotocin diabetes in dogs : a revised experimental technique . lab anim . july ; 27 ( 3 ): 281 - 5 .

US-201514951810-A

a catalytic thermal tip double catheter provides an alternative energy source for thermal angioplasty without the expense and technical support required for laser or electrical thermal angioplastic devices . the catalytic thermal tip catheter utilizes heat generated by the reactive of a stoichiometric ratio of oxygen and hydrogen gases catalyzed by a small piece of palladium sponge situated in a chamber adjacent to and enclosed by the metallic tip of the catheter , the vapors formed in the chamber generated being evacuated by a vacuum applied to an inner tube . gas flow regulates catalytic thermal tip temperature which is monitored by a thermocouple positioned within the chamber . vacuum and gas flow are controlled by an automatic or manual controller which is in direct communication with the temperature monitor .

a preferred embodiment 10 of the present invention is schematically illustrated in the sole figure , and includes a catheter body 14 provided with a catalytic tip 12 at its working end . the body 14 of the catheter 10 includes an outer tubing 18 having a distal end 16 which is slid over the proximal open end 22 of a thin - walled metallic tip 20 which defines the thermal tip 12 with a chamber 28 therewithin . an inner tubing 24 is coaxially mounted within the outer tubing 18 , the inner tubing having an open distal end 26 positioned at a fixed distance from the metallic tip 20 . within the chamber 28 between the metallic tip 20 and the end 26 of the tubing 24 is located a suitable catalyst , such as a palladium sponge 30 . the metallic tip 20 is desirably formed of surgical grade stainless steel , although other inert metals or even non - metallic materials of good heat resistance and heat conductivity could be used . tubing 18 and 24 of the catheter 10 is preferably formed of teflon , i . e . polytetrafluroethylene but other inert and heat resistant materials can be used as long as the tubing is of a diameter to permit invasive passage of the catheter through blood vessels and arteries , and if the material under those conditions is sufficiently rigid so as to maintain a circular cross - section while being sufficiently flexible to properly function as a blood vessel catheter . for example , polyimides and certain heat resistant silicone resins can be used instead of teflon . inner tubing 24 , near its distal open end 26 , is supported by any suitable means such as an annular through - hole collar or the like for securing the tubing distal end 26 at a fixed distance from the interior surface of the metallic tip 20 . in the illustrated embodiment , spacing is provided simply by the welding of two axially extending pins , rods or wires 32 to the inner surface of the metallic tip 20 near its proximal end 22 , the wires 32 being spaced roughly 180 ° from one another . regardless of the spacer used , axial through - openings must be provided to permit passage of reactive gases from the proximal end of the catheter 10 to the reaction cavity 28 at the distal end 12 downstream of the spacer . it is also desirable to mount a temperature monitoring thermocouple 40 or the like having a sensor 42 at its end , the thermocouple 40 passing through such a through - opening and the sensor 42 being positioned within the reaction cavity 28 . the inner tubing 24 provides a conduct for applying a vacuum from the proximal end to the reaction cavity 28 , particularly employed to dispose of gases and vapors generated during catalytic reactions carried out in the catalytic chamber 28 . the metallic tip 20 is connected to the open distal end of the outer tubing 18 as shown and described above , and is annularly sealed via a metal ring constrictor 44 which provides a tight fluid seal during operation at high temperatures . due to the high coefficient of heat of expansion of teflon , the seal 44 becomes tighter as the tip 20 is heated and expansion occurs . the metallic tip 20 is extremely small having a diameter of approximately 0 . 9 mm , and it will be consequently understood that all the parts are small and the drawing is on an enlarged scale . the device of the present invention utilizes the combustion of oxygen and hydrogen reactive gases as the energy source to heat the metallic tip 20 . oxygen and hydrogen gases are suitably generated near the proximal end of the device using typical electrolytic processes ; alternatively , the gases may be made elsewhere and stored , although this option is less safe . regardless , a stoichiometric ratio of oxyhydrogen is passed down the annular space of the catheter 10 between the outer tubing 18 and the inner tubing 24 . the amount of gases delivered to the annular space may be controlled by a manual or automatic controller 46 which is in direct communication with a temperature monitoring system 48 , the monitoring system being connected to the thermocouple assembly 40 . in operation , the oxyhydrogen gas reaches the catalytic chamber 28 , encased by the metallic tip 20 , where a piece of palladium sponge 30 resides , and chemical combustion is started by the catalytic action of the palladium sponge on the mixture of oxygen and hydrogen . for every two milli - moles of hydrogen gas ( h 2 ) and one milli - mole of oxygen gas ( o 2 ) consumed , 136 calories or 568 joules of energy in form of heat are delivered to the metallic tip 20 and by conduction through the metallic tip 20 to the locus of surgery . it will of course be understood that the reaction takes place on the surface of the catalyst and therefore where the catalyst contacts the interior of the metallic tip 20 the heat will be conducted directly therefrom to and through the metallic tip 20 . the water vapor or steam formed within the chamber 28 by the reaction of h 2 and o 2 is evacuated through the inner tubing 25 by means of a vacuum applied to its distal end 26 from its proximal end . this vacuum may also be regulated by the controller 46 . without evacuating the formed steam rapidly , the water vapor condenses to form liquid water which may wet and inhibit the catalytic activity of the palladium sponge 30 , thus making it difficult to later reinitiate the chemical combustion of the hydrogen . the double catheter system gives the added advantage to the well - known countercurrent heat exchange system . the oxyhydrogen passing down the annular space between the outer tubing 18 and the inner tubing 24 is progressively heated by the high temperature steam that is evacuated through the inner tubing 24 . increased efficiency of combustion of the hydrogen is thus achieved , and the heat of the water vapor is dissipated to the incoming gases and not to the surrounding tissue along the length of the catheter body 14 . the amount of heating of the metallic tip 20 is regulated easily by the amount of oxyhydrogen delivered through the catheter , via controller 46 . the thermocoupled sensor 42 placed or positioned within the catalytic chamber 28 provides a feedback signal to control the amount of gas delivered . the controller 46 regulates the amount of heating and minimizes any unwanted tissue injury . it should be understood that due to moisture absorbed by the palladium sponge which temporarily destroys its catalytic activity , the device needs to be heat activated initially to dry the palladium sponge prior to operation . heat activation is performed simply by heating the metallic tip with either a heating gun ( e . g ., a hair dryer ), hot plate , or gas flame to approximately 80 ° c . once activated , the device can operate without reactivation even if the oxyhydrogen gas has been turned off for 10 - 15 minutes . in addition , reactivation is never a problem if the metallic tip temperature is maintained above 35 °- 40 ° c . it should be understood that other catalytic materials for the sponge may be employed . for example , a platinum sponge may be used , as opposed to a palladium sponge , to react with the oxyhydrogen gas . furthermore , reactive gases other than oxygen and hydrogen may be employed to react with a catalyst situated in the catalytic chamber . by way of example , a catheter 10 as described above was studied in air and saline , alone and with human atherosclerotic aortic segments . heating was faster in air (& gt ; 350 ° c . in & lt ; 1 sec .) than saline ( temp . ( max ) of 170 ° c . in 5 sec ., t1 / 2 = 0 . 6 sec . ), but thermal relaxation was faster in saline ( t1 / 2 = 1 . 5 sec .) than air ( t1 / 2 = 8 sec .) due to rapid heat convection in saline . in both air and saline , catalytic thermal tip - tissue contact effects were directly related to temperature at the tip ; histologic thermal injury began at temp .& gt ; 180 ° c . but ablation with crater formation , charring , and polymorphous vacuoles did ont occur until temp . & gt ; 325 ° c . effective tissue ablation in saline required initial vaporization of the saline at the catalytic thermal tip - tissue interface . it was conducted that the catalytic thermal tip catheter is safe , inexpensive , and results in efficacious tissue ablation which can be easily and effectively regulated by temperature feedback monitoring , and therefore the present invention is an apparent and excellent alternative to laser and electrical thermal angioplasty . it will be obvious to those skilled in the art that various other changes and modifications may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown in the drawing and described in the specifications .

US-2654087-A